indonesian society of animal agriculture (isaa) jointly published by faculty of animal and agricultural sciences-diponegoro university vol. 45 no. 1 march 2020 j. indonesian trop. anim. agric. pissn 2087-8273 eissn 2460-6278journal of the indonesian tropical animal agriculture and accredited by dgsrd no. : 60/e/kpt/2016 [2016-2021] editorial team editor-in-chief : edy kurnianto [diponegoro university, semarang-indonesia] associate editors : agung purnomoadi [diponegoro university, semarang-indonesia] joelal achmadi [diponegoro university, semarang-indonesia] karno [diponegoro university, semarang-indonesia] sugiharto [diponegoro university, semarang-indonesia] international editorial boards : abdulmojeed yakubu [nasarawa state university, nigeria] anang muhammad legowo [diponegoro university, semarang-indonesia] arda yildirim [gaziosmanpasa university, turkey] atien priyanti [center for animal research and development, bogor-indonesia] budi hartono [brawijaya university, malang-indonesia] budi indarsih [mataram university, mataram-indonesia] cece sumantri [bogor agricultural university, bogor-indonesia] chalong wachirapakorn [khon kaen university, thailand] dian wahyu harjanti [diponegoro university, semarang-indonesia] juni sumarmono [jenderal soedirman university, purwokerto-indonesia] khalil [andalas university, padang-indonesia] muhammad cahyadi [sebelas maret university, surakarta-indonesia] mukh arifin [diponegoro university, semarang-indonesia] ni wayan kurnia karja [bogor agricultural university, bogor-indonesia] nyoman suthama [diponegoro university, semarang-indonesia] retno adiwinarti [diponegoro university, semarang-indonesia] sumeet sharma [edmonton north animal hospital, alberta, canada] sumiati [bogor agricultural university, bogor-indonesia] takuro oikawa [university of the ryukyus, japan] tety hartatik [gadjah mada university, yogyakarta-indonesia] titik ekowati [diponegoro university, semarang-indonesia] umar paputungan [sam ratulangi university, manado-indonesia] vincenzo tufarelli [university of bari ‘aldo moro’, italy] wan zahari muhamed [universiti malaysia kelantan, malaysia] layout editor : rahmat wibowo [diponegoro university, semarang-indonesia] editorial address: journal of the indonesian tropical animal agriculture faculty of animal and agricultural sciences, diponegoro university campus drh. soejono koesoemowardojo tembalang semarang 50275 indonesia phone/fax : 024 – 7474750 jitaa e-mail: jppt.fpundip@gmail.com isaa e-mail: isaa_ina@yahoo.com jitaa website: ejournal.undip.ac.id/index.php/jitaa the front cover illustrates the sketch of leaves and seeds of legume and grass forming a buffalo’s horn (designed by agung purnomoadi) journal of the indonesian tropical animal agriculture history media was the first academic bulletin at faculty of animal science and fisheries, diponegoro university in 1975. along with the development of livestock and fisheries field in the faculty, the faculty was splitted into the faculty of animal science and faculty of fisheries. consequently, there was a change of the journal name from media to jurnal pengembangan peternakan tropis (jppt) in 1998. jppt awarded accreditation at the first time in 1999 by directorate general of higher education, republic of indonesia. the accrediation was obtained every three years until 2011. jppt is published on march, june, september and december. jppt was awarded the internationalization grant from 2009 to 2011. consequently, jppt no longer publish’s articles in indonesian, but all articles have been published in english since september 2009. the name of jppt, therefore, was changed officially to journal of the indonesian tropical animal agriculture (jitaa) in 2009. jitaa was accredited for a period of five years from 2011 to 2016. jitaa was accredited again by directorate general of strengthening for research and development-ministry of research, technology and higher education-republic of indonesia in 2016 for a period of five years started from november 18, 2016 with no 60/e/kpt/2016. jitaa as the open access journal has been indexed by scopus, scimago journal & country rank (sjr), emerging sources citation index (esci)-clarivate analytics, asean citation index (aci), directory of open access journal (doaj), google scholar, cab international, ebsco, sherpa/romeo, garuda (garba rujukan digital), sinta-science and technology index, feedipedia and crossref. aims and scopes journal of the indonesian tropical agriculture (jitaa) is a double blind peer-reviewed publication devoted to disseminate all information contributing to the understanding and development of animal agriculture in the tropics by publication of original research papers. the topics of research are not only on indonesian tropical animal agriculture, but also on other tropical regions of the world. the journal covers all aspect relating to animal agriculture, including animal breeding and genetics, animal feeding and nutrition, animal reproduction, animal biotechnology, animal physiology, animal production and technology, animal products technology, animal management and economics, animal products processing and animal by-products, animal microbiology, livestock farming systems, and other topics in relation to animal sciences. publication ethics and malpractice statement section i: publication 1. all submitted manuscript are reviewed by at least two reviewers who expertise in their subject. 2. the originality, soundness, novelty and language are factors that are taken into account in review by reviewers. 3. the results of review are categorized into eligible to publish in journal of the indonesian tropical animal agriculture (jitaa) without revision, eligible to publish in jitaa with minor revision, eligible to publish in jitaa with major revision, and rejection. 4. if authors are encouraged to revise and resubmit a manuscript, then there is no guarantee that the revised submission will be accepted. 5. rejected manuscript not be re-reviewed. section ii: editor 1. editors have full responsibility and authority to reject/accept an manuscript. history – aims and scopes – publication ethics and malpractice statement i 2. editors should guarantee the quality of the papers published in jitaa. 3. editors should provide all information needed by aouthors to improve the publication. 4. editors should preserve the identity or anonymity of reviewers. 5. editors should publish errata page when needed. 6. editors should not allow any conflicts of interest among authors, reviewers and board members. section iii: authors 1. authors have to certify that the manuscript has not previously been published or is not being considered for publication elsewhere. 2. authors have to certify that manuscript submitted is free from plagiarism. 3. authors state that experiment conducted is according to national, international or applicable regulations for conducting scientific research. 4. authors have to follow the rule of guideline of jitaa. 5. authors state that all data analyzed are real. section iv: reviewers 1. reviewers should evaluate a manuscript solely on academic merits, in which if a conflict of interest is detected it should be immediately notified to the editor. 2. reviewers have to keep all information relating to the manuscript reviewed. 3. reviewers should review a manuscript objectively. 4. reviewers should notify clearly on unclear statement written by authors. 5. reviewers should not review manuscripts in which they have conflicts of interest resulting from competitive or relationships with any of the authors. 6. if plagiarism is detected, reviewers should notify the editors immediately. authors could refer to international standards for editors and authors (https://publicationethics.org/search?t=international-standards) by cope (committee on publication ethics) ii j. indonesian trop. anim. agric. (http://ejournal.undip.ac.id/index.php/jitaa) https://publicationethics.org/search?t=international-standards contents association of snp g.643g>a of myf5 gene polymorphism with body weight and body measurements in bali cattle e. a. saputra, m. f. ulum and j. jakaria 1 6 detection of f94l mutation of the mstn gene in four indonesian local cattle breeds s. anwar, s.d. volkandari, a.s. wulandari, w.p.b. putra, e. sophian and s. said 7 14 selection of bali cattle based on birth weight and calving interval records at west nusa tenggara province of indonesia s. said, w.p.b. putra, m. muzawar and s.a. kantong 15 27 the ammoniation of total mixed fiber with mineral organic supplementation in ration to increase beef cattle production a. imsya, y. windusari and r. riswandi 28 36 body weight, haematological indices and intestinal morphometric of broilers provided with diets containing formic acid, butyric acid or their blends i. isroli, r. murwani, t. yudiarti, e. widiastuti, h. i. wahyuni, t. a. sartono and s. sugiharto 37 46 properties and cost analysis of bio-urine liquid fertilizer (blf) from balinese cattle on the use of bio-activators and different fermentation times m. i. said, e. abustam, st. rohani and r. n. adiatma 47 57 indonesian smallholder beef producers’ perception of sustainability and their treactions to the results of an assessment using the sustainability assessment of food and agriculture system (safa) – a case study based on focus group discussion s. gayatri and m. vaarst 58 68 author index 69 acknowledgment 69 j.indonesian trop.anim.agric. 45[1] march 2020 iii journal of the indonesian tropical animal agriculture [jitaa-pissn 2087-8273 and eissn 2460-6278, formerly jurnal pengembangan peternakan tropis-jppt] is accredited by directorate general of strengthening for research and development ministry of research, technology and higher education, republic of indonesia no. 60/e/kpt/2016 for a period of five years started from november 18, 2016. jitaa is jointly published by faculty of animal and agricultural sciences diponegoro university and indonesian society of animal agriculture in march, june, september and december. all rights reserved. jitaa is indexed by scopus, emerging sources citation index (esci), asean citation index (aci), doaj, google scholar, cab international, ebsco, sherpa/romeo, indonesian publication index (ipi), shinta-science and technology index, feedipedia and crossref. the journal receives original papers in animal agriculture which should not have been previously published or is not being considered for publication elsewhere. the annual subscription for printed journal is idr 300.00 for domestic and us$ 50.00 for overseas per year included mailing cost. #0. jitaa-cover luar-march 2020 #1. cover depan bag dalam_editorial boards 2020 #2. jitaa-home_history and scope 00. content -march 2020 non-linear growth analysis in broiler chicken (a. setiaji et al.) 143 j i t a a journal of the indonesian tropical animal agriculture accredited by ditjen riset, teknologi dan pengabdian kepada masyarakat no. 164/e/kpt/2021 j. indonesian trop. anim. agric. pissn 2087-8273 eissn 2460-6278 http://ejournal.undip.ac.id/index.php/jitaa 48(2):143-149, june 2023 doi: 10.14710/jitaa.48.2. 143-149 gomperzt non-linear model for predicting growth performance of commercial broiler chickens a. setiaji*, d. a. lestari, b. ma’rifah, l. krismiyanto, i. agusetyaningsih, and s. sugiharto department of animal science, faculty of animal and agricultural sciences, universitas diponegoro, tembalang campus, semarang, 50275 central java, indonesia. corresponding author: asepsetiaji93@gmail.com received april 13, 2023; accepted may 19, 2023 abstract an experiment was conducted to estimate growth parameters for commercial broiler chickens in indonesia. the data was collected from july 2021 to june 2022. a total of 1,570 samples consisting of four strains of broiler chickens were collected from 74 houses. the samples were daily weighed from 0 to 7 days of age, and they were weekly weighed from 1 to 5 weeks of age. a nonlinear gompertz growth model was fitted to the observed body weights (bw). the results for five growth parameters were as follows: the asymptotic value (a) of the mature live weight ranged from 3.733 to 5.044 kg; the turning point of growth (b) ranged from 4.499 to 4.561; the value growth rate constant (k) ranged from 0.049 to 0.059 kg/week; inflection points in ranged from 25.292 – 30.970 days, and 1.373 – 1.855 kg for inflection age (ia) and inflection weight (iw), respectively. the model was an excellent fit for the growth data in the commercial broiler with a low akaike information criterion (aic), and high coefficient determination (r 2 ). keywords: asymptotic value, growth rate constant, inflection point, slaughter age, strains introduction modern broiler production is a large and rapidly developing sector that provides the market with a relatively inexpensive, and highquality protein source. the contemporary selection programs have achieved significant improvements in weight gain, feed conversion, slaughter performance, and carcass traits over the past decades (chambers et al., 1981; le bihanduval et al., 1999; zhang and aggrey, 2003; aggrey et al., 2010; siegel, 2014). advances in broiler selection have resulted in significant shorter fattening times, less than 35 days at slaughter weights of 2 kg (hristakieva et al., 2014). regarding the genetic improvement and expansion of the broiler industry in indonesia, there were several stains of broiler chicken produced by the breeders. strains with large populations were cp 707, lohmann, cobb, and ross. each strain has a specific performance of growth, feed efficiency, and carcass quality (abdullah et al., 2010). the growth of body weight is an easimailto:asepsetiaji93@gmail.com 144 j. indonesian trop. anim. agric. 48(2):143-149, june 2023 er indicator for farmers to make an evaluation of their chicks. growth is an economic trait for animals, defined as a change in body size, such as weight or height per unit of time. knowledge of animal growth is critical for improving management and feeding methods to maximize the profits of broiler farms (narinç et al., 2017). the appropriate method is required to make a proper decision about when should farmers harvest or slaughter the chickens. mathematical models have been successful in characterizing growth patterns and visualizing the shape of growth over time. among these models, the most commonly used are non-linear models that allow for the interpretation and understanding of the underlying growth patterns during the growing season (schnute, 1981). gompertz model is one of the non-linear models that are generaly used to describe growth patterns. the gompertz distribution is based on exact central moments and is defined with a more accurate approximation (lenart, 2011). the objective of this study was to estimate growth curve parameters for specific strains of commercial broiler chicken in indonesia. materials and methods data collection the data was collected from commercial broiler farms in the central java province of indonesia. chickens were raised intensively in closed houses with ad libitum access to feed and water. the period of collecting data was from july 2021 to june 2022. a total of 1,570 samples of four strains of broiler chickens were collected from 74 houses. the detailed data used in the study was presented in table 1. the samples were individually daily weighed until 7 days of age and then weekly weighed until 35 days of age. statistical model general linear model with duncan multiple range test was performed as preliminary analysis to differentiate the data of body weights on four strains. the gompertz model was fitted on the observed bw of broiler chickens by using nlin procedure of statistical analysis system (sas ondemand, 2021). the model was as follows: where w (t) is observed bw of chickens t days of age in kg, t is the age of weighed in days. the growth parameters consist of a as the predicted mature life weight of asymptotic value; b as turning point of growth and k as growth rate constant to achieve an adult weight. exp is the value-based of the natural logarithm (2.718). the model was performed for individual data. the inflection of age and weight (ia and iw), respectively were calculated according to the pattern of lupi et al. (2016) as follows: and results and discussion least squares mean (lsm) and standard deviations (sd) of body weights for four strains are presented in table 2. the lsm of observed data showed the highest bw of day-old chicks (doc) was 0.047 kg for cp 707 and cobb, and the lowest was ross (0.044 kg). therefore, that for lohmann was 0.041. mehmood et al. (2013) categorized the bw of doc boiler chick into four groups 1) small ranging from 0.031 to 0.034 kg; 2) medium ranging from 0.035 to 0.038 kg; 3) a-grade ranging from 0.039 to 0.042 kg; 4) a+ grade ranging from 0.043 to 0.046 kg. recently, hidayat et al. (2021) reported bw of doc in indonesia was 0.048 kg. there was no significant difference among strains for bw of doc to 7 days old chicks. the bw of 7 days of chicks observed in this study was higher than 0.125 kg for lohmann reported by mueller et al. (2018); 138.9 kg for cobb reported by masoudi and azarfar (2017) and 146.88 kg for ross reported by al-samarai (2015). the differences in bw among strains were observed at 14 and 21 days old of broiler. cobb non-linear growth analysis in broiler chicken (a. setiaji et al.) 145 showed slightly lower bw than the other strains. the bw of twenty-eight and thirty-five days old were not significant differences among the four strains. the bw of 28 and 35 days of cobb and ross observed in the study were in range with the bw reported by demuner et al. (2017) for the same strain in brazil. they observed the bw for cobb ranged from 1.352 1.556 kg, and 1.876 – 2.219 kg for 28 and 35 days, respectively. meanwhile, that for ross ranged from 1.454 – 1.651 for 28 days and ranged from 2.043 – 2.309 kg for 35 days. a significant difference has been reported for weekly bw of different strains of broiler chicken raised in tropical conditions (udeh et al., 2015). the results indicated that genetic factor has an impact on the growth performance of broiler chicks (smith and pesti, 1998). the results of five growth parameters and predicted body weights for commercial broilers chicks are presented in table 3 and table 4, respectively. the asymptotic value of the mature live weight of commercial broiler chicks ranged from 3.733 to 5.044 kg. the value of b estimated in this study ranged from 4.499 to 4.561. the strain of broiler chicks sequentially from the smallest values of a and b were ross, lohmann, copp, and cp 707. the previous study of growth parameters for broiler chicks using the gomperzt growth model conducted in turkey estimated higher values ranging from 5.454 6.282 kg, and 4.916 – 5.313, respectively for a and b (topal and bolukbasi, 2008). the observed value of k ranged from 0.049 to 0.059 kg/week. mata-estrada et al. (2020) reported a value of 0.021 kg/week for k param table 1. number of sample used in the study sources number of houses cumulative means populations 74 1,132,716 15,306.97 samples 74 1,570 21.22 cp 707 21 595 28.33 lohmann 19 440 23.16 cobb 24 405 16.87 ross 10 130 13.00 table 2. least squares mean and standard deviation for body weight at different ages of commercials broiler chickens a,b p<0.05 age (d) body weight (kg) cp 707 lohmann cobb ross 0 0.047 ± 0.012 0.041 ± 0.011 0.047 ± 0.011 0.044 ± 0.021 1 0.063 ± 0.023 0.059 ± 0.024 0.065 ± 0.029 0.061 ± 0.033 2 0.081 ± 0.031 0.076 ± 0.033 0.080 ± 0.036 0.074 ± 0.041 3 0.099 ± 0.040 0.095 ± 0.042 0.100 ± 0.045 0.093 ± 0.050 4 0.121 ± 0.046 0.116 ± 0.048 0.120 ± 0.055 0.108 ± 0.060 5 0.146 ± 0.059 0.137 ± 0.062 0.142 ± 0.065 0.133 ± 0.084 6 0.172 ± 0.042 0.169 ± 0.038 0.165 ± 0.046 0.167 ± 0.068 7 0.197 ± 0.080 0.192 ± 0.084 0.191 ± 0.082 0.185 ± 0.102 14 0.527 ± 0.204 a 0.514 ± 0.214 a 0.466 ± 0.202 b 0.514 ± 0.261 a 21 1.010 ± 0.401 a 1.008 ± 0.421 a 0.914 ± 0.398 b 1.007 ± 0.489 a 28 1.622 ± 0.716 1.608 ± 0.727 1.506 ± 0.718 1.608 ± 0.764 35 2.267 ± 0.966 2.198 ± 0.929 2.048 ± 1.057 2.207 ± 1.111 146 j. indonesian trop. anim. agric. 48(2):143-149, june 2023 eters in creole chickens of mexico applying the gompertz model. the low value (0.15 g/week) obtained by nguyen hoang et al. (2020) in vietnamese indigenous mia chicken. strains with the highest and smallest values of k were ross and cp 707, respectively. the result demonstrated that ross attain mature weight earlier than other strain. it was state by lupi et al. (2016) that animal with high value of k matured earlier than animals with low value for this parameter. the value of k is important for choosing the chicken for the breeding and marketing goals. early and lower weight of maturity may be preferred if the breeding program is aimed to produce animals with lower energy needs, but a later maturity should be taken into account if the goal of the breeding program is to produce animals with higher mature weights to meet market demand (fitzhugh and taylor, 1971). commercial broilers have been raised for the purpose of efficient production as part of the meat industry. chicken with higher mature weights and delayed maturation were therefore favored. obtained value of inflection points in the present study ranged from 25.292 – 30.970 days, and 1.373 – 1.855 kg for ia and iw, respectively. masoudi and azarfar (2017) reported values of 1.334 for iw in ross, which is similar to obtained iw of the present study, but they reported later ai of 29.28. the value of ai was expected beginning sexual maturity, but pittroff et al. (2008) stated that ai of growth curve was not associated with the onset of puberty. the ai and iw might be appropriate to assign slaughter time. generally, broiler farm holders in indonesia slaughter their chickens less than 5 weeks of age with approximately a body weight of 1.70 kg (hafid, 2022). the specific values of iw and ai table 3. estimated growth parameters of gompertz model for commercials broiler chickens estimated parameter cp 707 lohmann cobb ross a 5.044 4.372 4.437 3.733 b 4.561 4.537 4.483 4.499 k 0.049 0.054 0.050 0.059 ia 30.970 28.005 30.005 25.292 iw 1.855 1.608 1.632 1.373 aic -224.096 -247.935 -193.167 -199.838 𝑅2 0.999 0.999 0.999 0.999 a, predicted mature life weight of asymptotic value; b, turning point of growth; k, growth rate constant to achieve an adult weight; ia, inflection of age; iw, inflection of weight; aic, akaike information criterion; r2, coefficient determination. table 4. predicted body weight at different ages of commercials broiler chickens age cp 707 lohmann cobb ross ------------------------------------------ kg -------------------------------------------- 0 0.052 0.047 0.050 0.041 1 0.065 0.059 0.062 0.054 2 0.081 0.074 0.077 0.068 3 0.099 0.092 0.094 0.086 4 0.120 0.113 0.113 0.107 5 0.144 0.137 0.136 0.131 6 0.171 0.164 0.161 0.159 7 0.201 0.195 0.189 0.191 14 0.519 0.518 0.482 0.524 21 1.013 1.013 0.930 1.019 28 1.624 1.608 1.478 1.584 non-linear growth analysis in broiler chicken (a. setiaji et al.) 147 estimated in this study are applicable for estimation of optimal slaughter age and weight in the broiler industry. the illustration of observed and predicted growth curves for each strain are shown in figure 1. the values of aic ranged from -247.935 to -193.167, and r2 (0.999) for all strains. based on that values, the gompertz model provided an excellent fit for growth of commercial broiler chickens. according to köhn et al. (2007) and khan et al. (2013), the model with low value of akaike information criterion (aic), and high value of coefficient determination (r 2 ) was reliable on estimation. figure 1. growth curve of four strains broiler chickens predicted by gomperzt growth models in comparison with the observed data conclusion the ai and iw of gompertz growth curve model expected could be used to assign the optimum slaughter time of broiler chickens. the model could help define feeding programs and marketing strategies that meet nutritional needs from hatching to maximal growth of commercial broiler chickens. acknowledgment the authors thank the owners and staff of broiler farms who have helped during the data 148 j. indonesian trop. anim. agric. 48(2):143-149, june 2023 collection conflict of interest the authors declare that they have no conflict of interest. references abdullah, a.y., n.a. al-beitawi, m.m. rjoup, r.i. qudsieh and m.a. ishmais. 2010. growth performance, carcass and meat quality characteristics of different commercial crosses of broiler strains of chicken. j. poult. sci. 47(1):13-21. al-samarai, f.r. 2015. growth curve of commercial broiler as predicted by different nonlinear functions. am. j. appl. sci. res. 1(2):6-9. aggrey, s.e., a.b. karnuah, b. sebastian and n.b. anthony. 2010. genetic properties of feed efficiency parameters in meat-type chickens. genet. sel. 42(1):1-5. chambers, j.r., j.s. gavora and a. fortin. 1981. genetic changes in meat-type chickens in the last twenty years. can. j. anim. sci. 61 (3):555-563. demuner, l.f., d. suckeveris, j.a. muñoz, v.c. caetano, c.g.d. lima, d.e. de faria filho and d.e. de faria. 2017. adjustment of growth models in broiler chickens. pesqui agropecu bras. 52:1241-1252. fitzhugh, h.a. and s. taylor. 1971. genetic analysis of degree of maturity. j. anim. sci. 33:717–725. hafid, h. 2022. growth and development of chicken carcass in different sex and age. indonesian j. agric. res. 5(2):121-131. hidayat, c., s. sumiati, a. jayanegara and e. wina 2021. supplementation of dietary nano zn-phytogenic on performance, antioxidant activity, and population of intestinal pathogenic bacteria in broiler chickens. trop. anim. sci. j. 44(1):90-99. hristakieva, p., n. mincheva, m. oblakova, m. lalev and i. ivanova. 2014. effect of genotype on production traits in broiler chickens. slovak j. anim. sci. 47(1):19-24. khan, m.s., s. ahmad, z. a. swati, s. akhtar and a. rahman. 2013. gestational age estimation in kari sheep using nonconventional ultrasonographic parameter. sarhad j. agric. 29(1):105-112. köhn, f., a.r. sharifi and h. simianer, h. 2007. modeling the growth of the goettingen minipig1. j. anim. sci., 85(1):84-92. le bihan-duval, e., n. millet and h. rémignon. 1999. broiler meat quality: effect of selection for increased carcass quality and estimates of genetic parameters. poult. sci. 78 (6):822-826. lenart, a. 2011. the gompertz distribution and maximum likelihood estimation of its parameters. max-planck-institut für demogra fische forschung max planck institute for demographic research konrad-zuse-strasse 1 · d-18057 rostock · germany. 1-19. lupi, t.m., j.m. leon, s. nogales, c. barba and j.v. delgado. 2016. genetic parameters of traits associated with the growth curve in segurena sheep. animal 10:729–735. masoudi, a. and a. azarfar. 2017. comparison of nonlinear models describing growth curves of broiler chickens fed on different levels of corn bran. int. j. avian wildlife biol. 2:34-39. mata-estrada, a., f. gonzález-cerón, a. promartínez, g. torres-hernández, j. bautistaortega, c.m. becerril-pérez, a.j. vargasgalicia and e. sosa-montes. 2020. comparison of four nonlinear growth models in creole chickens of mexico. poult. sci. 99 (4):1995-2000. mehmood, s., a.w. sahota, m. akram, k. javed, j. hussain, h. sharif, s. haroon and a.s. jatoi. 2013. influence of feed restriction regimes on growth performance of broilers with different initial weight categories. j. anim. plant. sci. 23:1522-1526. mueller, s., m. kreuzer, m. siegrist, k. mannale, r.e. messikommer and i.d.m. gangnat. 2018. carcass and meat quality of dualpurpose chickens (lohmann dual, belgian non-linear growth analysis in broiler chicken (a. setiaji et al.) 149 malines, schweizerhuhn) in comparison to broiler and layer chicken types. poult. sci. 97(9):3325-3336. narinç, d., n.ö. narinç and a. aygün. 2017. growth curve analyses in poultry science. worlds poult. sci. j. 73:395–408. nguyen hoang, t., h.t. do, d.h. bui, d.k. pham, t.a. hoang and d.n. do. 2021. evaluation of non-linear growth curve models in the vietnamese indigenous mia chicken. anim. sci. j. 92(1):e13483. pittroff, w., f. dahm, f. blanc, d. keisler and t.c. cartwright. 2008. onset of puberty and the inflection point of the growth curve in sheep–brody’s law revisited. j. agric. sci. 146:239–250. sas, sas/stat., 2021. sas ondemand for academics. https://www.sas.com/id_id/ software/on-demand-for-academics.html siegel, p.b. 2014. evolution of the modern broiler and feed efficiency. annu. rev. anim. biosci., 2(1):375-385. smith, e.r. and g.m. pesti. 1998. influence of broiler strain cross and dietary protein on the performance of broilers. poult. sci. 77 (2):276-281. topal, m. and ş.c. bolukbasi. 2008. comparison of nonlinear growth curve models in broiler chickens. j. appl. anim. res. 34(2):149152. udeh, i., p.n. ezebor and p.o. akporahuarho. 2015. growth performance and carcass yield of three commercial strains of broiler chickens raised in a tropical environment. growth, 5(2):62-67. zhang, w. and s.e. aggrey. 2003. genetic variation in feed utilization efficiency of meattype chickens. worlds poult. sci. j. 59 (3):328-339. author index [vol. 43 no. 4 december 2018] a. a. sakti 361 372 l. krismiyanto 421 428 a. atabany 373 – 382; 412420 l. t. wulandari 396 404 a.a. sadeghi 383 395 l. agustina 445 452 a. kustantinah 343 351 m. amin-afshar 383 395 a. r. seidavi 383 395 m. anwar 361 372 a. s. anggraeni 361 372 m. chamani 383 395 a. suryawijaya 438 444 m. f. karimy 361 372 b. indarsih 333 342 m. h. tamzil 333 342 b.d.p. soewandi 315 322 m. luthfi 352 360 b. p. purwanto 373 382; 412 420 m. n. hidayat 445 452 b. sukamto 396 404 m. sudarwanto 373 382 c. sumantri 323 332 n. nahrowi 412420 d. rahmat 309 314 n. hilmia 309 314 d. dudi 309 314 n. kusnadi 429 437 d. maharani 343 351 n. s. asminaya 412420 e. damayanti 361 372 n. suthama 396 – 404; 421 428 d. rachmina 429 437 r. malaka 445 452 d. samsudewa 438 444 r. priyanto 323 332 h. hartati 315 322 s. anwar 315 322 h.i. wahyuni 421 428 s. b. udrayana 405411 h. jahanpour 383 395 s. sutikno 323 332 h. p. fitrayady 352 360 s. sutiyono 438 444 h. susanty 373 382 s. nurfadillah 429 437 i. mangisah 421 428 t. hartatik 343 351 j. jakaria 323 332 w. a. ridwan 412420 l. affandhy 352 360 w. pakiding 445 452 l. latifah 343 351 y. widyaningrum 352 360 l. lestari 333 342 y. s. ondho 405411 l. istiqomah 361 372 author index, j.indonesian trop.anim.agric. 43(4) december 2018 453 acknowledgment jitaa appreciates to reviewers who have commented manuscripts for the current issue: agung purnomoadi : faculty of animal and agricultural sciences, diponegoro university, semarang anang m. legowo : faculty of animal and agricultural sciences, diponegoro university, semarang anis muktiani : faculty of animal and agricultural sciences, diponegoro university, semarang arda yildirim : faculty of agriculture, gaziosmanpasa university, turkey atien priyanti : indonesian center for animal research and development, bogor cece sumantri : faculty of animal science, bogor agricultural university, bogor dian w. harjanti : faculty of animal and agricultural sciences, diponegoro university, semarang edy kurnianto : faculty of animal and agricultural sciences, diponegoro university, semarang hanny indrat wahyuni : faculty of animal and agricultural sciences, diponegoro university, semarang jakaria : faculty of animal science, bogor agricultural university, bogor joelal achmadi : faculty of animal and agricultural sciences, diponegoro university, semarang karno : faculty of animal and agricultural sciences, diponegoro university, semarang khalil : faculty of animal husbandry, andalas university, padang muhammad cahyadi : faculty of agriculture, sebelas maret university, surakarta panjono : faculty of animal science, universitas gadjah mada, yogyakarta retno adiwinarti : faculty of animal and agricultural sciences, diponegoro university, semarang siti susanti : faculty of animal and agricultural sciences, diponegoro university, semarang sugiharto : faculty of animal and agricultural sciences, diponegoro university, semarang sutaryo : faculty of animal and agricultural sciences, diponegoro university, semarang sutopo : faculty of animal and agricultural sciences, diponegoro university, semarang tety hartatik : faculty of animal science, universitas gadjah mada, yogyakarta titik ekowati : faculty of animal and agricultural sciences, diponegoro university, semarang vincenzo tufarelli : section of veterinary science and animal production, university of bari "aldo moro", italy wan zahari muhamed : faculty of veterinary medicine, universiti malaysia kelantan 454 acknowledgment, j.indonesian trop.anim.agric. 43(4) december 2018 c ut h er e subscription form for volume ….. (20…...) 4 issues a year (march, june, september, december) name : . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . phone/ fax. : . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . e-mail : . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . mailing address : . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . date: . . . . . . . . . . . . . . . . . . . . . . . . authorized signature: . . . . . . . . . . . . . . . . . . . . the annual membership fee is idr 300,000.00 (not included mailing cost for outside of java island and overseas). please return a copy of this form with your remittance to: titik ekowati – bank negara indonesia (bni) 46 cabang undip semarang, bank account 0177702361. subscription form for volume ….. (20…...) 4 issues a year (march, june, september, december) name : . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . phone/ fax. : . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . e-mail : . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . mailing address : . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . date: . . . . . . . . . . . . . . . . . . . . . . . . authorized signature: . . . . . . . . . . . . . . . . . . . . the annual membership fee is idr 300,000.00 (not included mailing cost for outside of java island and overseas). please return a copy of this form with your remittance to: titik ekowati – bank negara indonesia (bni) 46 cabang undip semarang, bank account 0177702361. journal of the indonesian tropical animal agriculture [j. indonesian trop. anim. agric.] faculty of animal and agricultural sciences, diponegoro university, tembalang campus, semarang 50275, central java indonesia phone/fax. : 62-24-7474750 ; e-mail :jppt.fpundip@gmail.com web site: ejournal.undip.ac.id/index.php/jitaa journal of the indonesian tropical animal agriculture [j. indonesian trop. anim. agric.] faculty of animal and agricultural sciences, diponegoro university, tembalang campus, semarang 50275, central java indonesia phone/fax. : 62-24-7474750 ; e-mail :jppt.fpundip@gmail.com web site: ejournal.undip.ac.id/index.php/jitaa journal of the indonesian tropical animal agriculture guide for authors (2018) (2010-rev) a. type of contribution journal of the indonesian tropical animal agriculture (j. indonesian trop. anim. agric.) is called as jitaa promotes sound development of animal agriculture on indonesian and other tropical regions of the world by publication of original research papers. the papers should not have been previously published or is not being considered for publication elsewhere. upon acceptance of an article, the authors will be asked to transfer the copyright of the article. b. preparation and submission of a manuscript b.1. general rules a. manuscripts should be written in english. authors whose native language is not english are strongly advised to have their manuscripts checked by an english specialist colleague prior to submission. manuscript submitted will be checked by the journal at a nominal cost invoiced to the author(s). b. manuscripts should be written by two or more authors. manuscripts written by single author will not be processed. c. manuscripts should be typed on one side of the paper and in 1-column format with double spacing throughout. d. the lines at all pages should be numbered in the left margin, beginning with number 1 (one) on the top of the first page. paper size is a4 and a 3.0 cm margin of the page is desirable. use the font “times new roman” 12 pt. e. manuscripts should not occupy more than 8 pages in length of journal sheet (14-18 pages of manuscript). f. all tables and figures should be typed on separate pages and be numbered according to their sequence in the text. g. standard international (si) units should be used. weights and measures should be expressed in the metric system and temperatures in the celsius scale. h. files should be saved in the format of the word processing software “word for windows” or “open text document” i. manuscripts should be submitted to web site (http://ejournal.undip.ac.id/index.php/jitaa). j. manuscripts that do not fulfill the requirements will not be processed any further. b.2. manuscripts structure manuscripts in general should be organized in the following order: title, abstract, introduction, materials and methods, results and discussion, conclusion, acknowledgements (optional) and references. these major headings should be typed in bold-capital letters and set in the center of the page. title title of paper consists of no more than 20 words. abbreviations are not permitted in the title. title is followed by the name of the authors and complete institution address. when a paper has several authors from the different institution, contact author should be given. a running head (an abbreviated title consisting of no more than 55 characters) should also be appeared above the title. abstract abstract is written in indonesian and in english. the abstract consists of no more than 200 words. it starts with a clear statement of the objectives of the experiment that followed by i http://ejournal.undip.ac.id/index.php/jitaa materials and methods, results and important conclusion. references are never cited in the abstract. abbreviations that appear in the abstract should be defined when they are first used. at the end of the abstract, list up to 5 (five) keywords in alphabetical order that best describe the nature of the research. introduction the introduction should provide the readers with information necessary for understanding research presented in the paper. previous work on the topic should be summarized and objective of the current research should be clearly stated. materials and methods the section of materials and methods should include a discussion of the methods of statistical analysis, and specify equipment source. all modifications of the methods should be explained. results and discussion results and discussion sections may be combined, or they may appear in separate section. in case of being separated, the results section should contain only the results of the current author’s study. there should be no literature comparisons. those comparisons should appear in the discussion section. the discussion should interpret the results clearly. conclusion conclusion should be written a maximum of 100 words. recommendation can be added. references all publications cited in the text should be presented in a list of references in chronological order. use the following system for arranging the references: a. for periodical journals lee, j.w., s.b. choi, y.h. jung, j.f. keown and l.d. van vleck. 2000. parameter estimates for direct and maternal genetic effects on yearling, eighteen-month, and slaughter weights of korean native cattle. j. anim. sci. 78:1414-1421 b. for proceedings of seminar, conference, symposia, etc. guenter, w and j.s. sim. 1998. production of special and modified eggs. proceedings, symposium series 2. the 8th world conference on animal production, seoul national university, seoul, korea, june 28-july4, 1998. p. 361-370 c. for thesis or dissertation rao, s. 1997. genetic analysis of sheep discrete reproductive traits using simulation and field data. phd thesis. virginia polytechnic institute and state university, blacksburg, virginia. d. for standard books steel, r.g.d. and j.h. torrie. 1980. principles and procedures of statistics. mcgraw-hill book co. inc. new york. e. for multi-author book weekes, e.e.c. 1991. hormonal control in glucose metabolism. in: physiological aspects of digestion and metabolism in ruminants. (t. tsuda, y. sasaki, and r. kawashima, eds). academic press. san diego. p.183-200 tables on tables, no vertical line is used and each term should begin with a capital letter. any important explanation to the understanding of the tables should be given as a footnote at the ii bottom of the table. all tables should be explained in the text. an example of constructing table: table 2. body weight, feeding level and their interactions on water intake, cp intake, energy intake and live weight gain of indigenous rams parameters light body weight heavy body weight significance 1xm 1.5xm 1xm 1.5xm bw fl int lwg (g/d) -0.01 0.00 -0.03 0.05 ns ** ** cp intake (g/d) 26.86 49.91 57.36 100.53 ** ** ** energy intake (mj/d) 3.12 5.79 6.66 11.67 ** ** ** tdn (g/d) 171.91 319.39 367.07 643.37 ** ** ** water intake (ml/d) 1299.00 1412.00 1797.00 2647.00 ** * ns lwg = live weight gain; m = maintenance; bw = body weight; fl = feeding levels; int = interaction between body weight and level of feeding; **= highly significant (p<0.01); * = significant (p<0.05); ns = non significant (p>0.05) figures figures should be drawn on white papers and lines should be less than 1 mm wide. the left vertical and bottom horizontal lines is used. all the figures should be numbered in consecutive order. legends should be made outside of figure. an example of constructing figure: 0 20 40 60 80 100 0 1 2 3 4 storage time (weeks) r el at iv e ac ti vi ty ( % ) figure 1. the storage stability of immobilized whey stored in 10 mm pb (ph 7.0) at 4˚c for 4 weeks. the immobilized whey was achieved by circulating 100 ml of whey to 1.0 g of sp-ff and followed by washing to remove unbound lpo. the 100% of relative activity means the initial activity of immobilized whey right after immobilization process. the symbols represent immobilized whey () and free enzyme (). data points are mean values based on triplicate determination. error bars represent standard deviation of the mean. text citation rule in the body of the paper, refer to author as follows: smith and jones (2005). if the sentence structure requires the author’s name be include in parentheses, then the proper format (smith and jones, 2005; mcdonald, 2007) is used. use “et al.” following the first author when there are more than two authors but give all authors in the references. more than one article listed in the same sentence of the text should be in chronological order first and alphabetical order iii for two publications in the same year. citation from internet is acceptable for references having digital object identifier (d.o.i). proof authors are advised to pay attention to check the proof sheet. proof must be sent back to the editorial office within 1 week of receipt. if this period is exceeded, proofs will be recheck by the editorial office without the author’s correction. copyright agreement authors are required to transfer copyright to editorial office. a form of copyright is sent to the corresponding author when article is accepted and article is not published until the complete form has been received by the editorial office via fax or email. c. miscelenaous c.1. the author will be charged in the following expenses: (1) revising english when the editorial board regard it necessary. (2) typesetting and printing of the portion of the text exceeding the length prescribed in the item b.1.e. (3) colour printing. c.2. the current charge is idr 1,500,000.00 or us$ 100.00 for an article decided to publish. c.3. the corresponding author will receive 1 (one) copy of printed journal and 5 (five) copies of reprint. c.4. ordering of each printed journal is idr 75,000.00 for domestic included mailing cost. papers for consideration should be submitted to jitaa’s website: ejournal.undip.ac.id/index.php/jitaa editorial address: journal of the indonesian tropical animal agriculture faculty of animal and agricultural sciences, diponegoro university, campus drh. soejono koesoemowardojo, tembalang semarang 50275, central java, indonesia phone/fax : +62-24-7474750; e-mail: jppt.fpundip@gmail.com list of abbreviation of journals acta agric. scand. j. agric. food chem. acta endocrinol. j. agric. sci. adv. appl. microbiol. j. am. oil chem. soc. adv. carbohydr. chem. j. anim. breed. genet. adv. biochem. j. anim. physiol. adv. food res. j. anim. nutr. adv. genet. j. anim. sci. adv. lipid res. j. clin. invest. adv. protein chem. j. dairy sci. agric. eng. j. food compos. anal. agron. j. j. gen. physiol. am. j. anat. j. hered. am. j. clin. nutr. j. indonesian trop. anim. agric. am. j. clin. pathol. j. nutr. am. j. hum. genet. j. nutr. biochem. am. j. obstet. gynecol. j. physiol. (lond.) am. j. pathol. j. physiol. (paris) am. j. physiol. j. range manage. am. j. vet. res. j. rech. porcine fr. iv mailto:jppt.fpundip@gmail.com anal. biochem. j. reprod. fertil. anal. chem. j. sci. food agric. anim. chem. jpn. poult. sci. anim. behav. korean j. poult. sci. anim. breed. abstr. korean j. anim. sci. anim. feed sci. technol. korean j. animal reprod anim. genet. korean j. dairy sci. anim. prod. korean j. nutr. anim. sci. lab. anim. anim. sci. technol. (jpn.) lipids ann. hum. genet. livest. prod. sci. annu. rev. biochem. meat sci. annu. rev. nutr. metabolism annu. rev. pharmacol. methods enzymol. annu. toxicol. microbiol. annu. rev. physiol. mol. cell. endocrinol. appl. environ. n. z. j. agric. res. appl. microbiol. nature (lond.) arch. biochem. biophys. nature (paris) asian-aust. j. anim. sci. neth. j. agric. res. aust. j. agric. res. neuroendocrinology aust. j. exp. agric. nutr. abstr. rev. biochem. j. nutr. metab. biochemistry nutr. rep. int. biochem. biophys. acta nutr. res. biol. reprod. nutr. rev. biometrics obstet. gynecol. biometrika pharmacol. br. j. nutr. pharmacol. rev. br. poult. sci. physiol. rev. can. j. anim. sci. pig news info. cell poult. sci. clin. toxicol. proc. n. z. grassl. assoc. comp. biochem. physiol. proc. nutr. soc. domest. anim. proc. soc. exp. biol. med. endocrinol. prof. anim. sci. endocrinology q. j. exp. physiol. eur. assoc. anim. rec. prog. horm. res. eur. prod. publ. reprod. fertil. dev. exp. anim. residue rev. fed. proc. s. afr. j. anim. sci. feedstuffs sci. agric. fertil. steril. science food res. steroids food technol. theor. appl. genet. gastroenterology theriogenology genetics toxicol. appl. grass forage sci. vet. rec. growth vet. res. horm. behav. vitam. horm. immunology world anim. rev. infec. immun. world's poult. sci. j. ir. j. agric. res. zuechtungsbiol. note: journals out the list above should be referred to the official abbreviation v indexed by google scholar cab international ebsco eissn 2460-6278 emerging sources citation index indonesian publication index 17. author index and acknowledgment_december 2018 18. invoice langganan 19. guide for authors-jitaa-2018 #0. jitaa-cover belakang-december 2018 factors affecting acceptance of beef farming standards (p. chaisombut et al.) 177 j i t a a journal of the indonesian tropical animal agriculture accredited by ditjen riset, teknologi dan pengabdian kepada masyarakat no. 164/e/kpt/2021 j. indonesian trop. anim. agric. pissn 2087-8273 eissn 2460-6278 http://ejournal.undip.ac.id/index.php/jitaa 47(3):177-183, september 2022 doi: 10.14710/jitaa.47.3.177-183 factors affecting economic profits of phon yang kham beef cattle farming in sakon nakhon province p. chaisombut1, h. umpapol2, r. hanmontree1, p. hanmontree, c. srilapat1, p. sawnongbua2, c. chaisitipatana4, l. lertjunthuk1 and n. rapankum1,* 1 department of agribusiness administration, faculty of agricultural technology, sakon nakhon rajabhat university. sakon nakhon, 47000 thailand 2 department of animal science, faculty of agricultural technology, sakon nakhon rajabhat university. sakon nakhon, 47000 thailand 3 department of food science and technology, faculty of agricultural technology, sakon nakhon rajabhat university. sakon nakhon, 47000 thailand 4 kalasin rice seed center phon thong, meaung kalasin, kalasin 46000, thailand *corresponding e-mail: narawut@snru.ac.th received may 06, 2021; accepted november 24, 2021 abstract the study aimed to determine factors affecting economic profits of beef cattle business in sakon nakhon province. a sample of 400 members of kor ror por klang phon yang kham livestock cooperative limited was determined by using taro yamane method, and binary logistic regression analysis was used to analyze the data. the findings showed that the variables with the statistical significance of 0.01 included concentrate feeds, roughage, and the raised period of less than or equal to 12 months. they were statistically significant at 0.001 0.000, and 0.000 respectively, and the odd ratios were 1.387, 0.921, and 5.697 respectively. additionally, the variables with the statistical significance of 0.05 included charolais cattle (62.50%) and farm location. the two variables were statistically significant at 0.023 and 0.039 respectively with the odd ratios of 5.083 and 0.595 respectively. if the cows are fed on 1 more kg/day of more concentrated feed, it is likely for the farmers to increase economic profit by 0.921 times and 1.387 times respectively. the probability of economic profit is by 5.697 times if the cattle are raised no more than 12 months. the cross-bred cattle with 62.50% charolais breed showed the probability for the farmers to gain economic profit by 5.083 times. finally, those who had farms located next to the farm family’s home were more likely to gain less economic profit by 0.595 times. keywords: factors affecting, economic profits, phon yang kham beef cattle, logit model. mailto:narawut@snru.ac.th 178 j. indonesian trop. anim. agric. 47(3):177-183, september 2022 introduction in the past, thai farmers raised cattle for agricultural use as labour, but now the cattle farming has been for beef production to meet increasing domestic and international demand. to develop and expand beef cattle farming as sustainable profitability for farmers, the government has promoted it through incentives and policy support (division of livestock extension and development, 2012). kho khun refers to a type of beef cattle through the rearing for rapid growth with the maximum quantity and quality of roughage and concentrate feeds so that the cattle (not more than 3 years of age) deposit fat within muscles which is considered premium beef with higher selling price than those fed on only roughage (suwanlee, 2012). the rearing of beef cattle in sakon nakhon has been extensively active in order to sell to cooperatives and also to meet local beef consumption demand. kor ror por klang phon yang kham livestock cooperative limited, registered on june 3, 1980 and located in ba phon yang kham, moo 10, non hom sub-district, mueang district, sakon nakhon province, has its members who are beef cattle farmers. its objectives are to provide farmers with production inputs and to be a buying source of their cattle. in 2018 there were 6,401 members (kor ror por klang phon yang kham livestock cooperative limited, 2019). at the beginning, the cooperative gave support to members in the forms of personnel, location, small-scale slaughterhouse and refrigerated trucks by the french government, equipment in cold storage rooms for carcasses by the german government. although beef consumption demand has increased substantially, the processing system remains conventional, and it results in quality of beef products. it is crucial that kor ror por klang phon yang kham livestock cooperative limited improves the production system in terms of both quantity and quality (kor ror por klang phon yang kham livestock cooperative limited, 2001). phon yang kham beef of sakon nakhon has been well known for its high quality domestically and internationally. after butchering, beef aging is required to enhance tenderness and flavour. it has been recommended by sakon nakhon provincial livestock office and governor’s office of sakon nakhon as one of the provincial top products, and accepted countrywide. moreover, on june 28, 2016 phon yang kham beef was approved by department of intellectual property to be gi registered product. this contributes to community income distribution and the promotion of sustainable beef farming. the success of beef farming generally is determined by profits and losses. therefore making profits is the main objective in livestock farming after deducting production cost from the revenue of sales. it has been discussed that cattle feed is considered the biggest cost in beef farming (kalangia, 2016). even though farmers can maximize the use of agricultural or agroindustrial post-production materials during harvest seasons, they have to be responsible for cattle feed during dry seasons, artificial insemination cost, medicine, and supplements, cattle housing and equipment, and household labour cost. in order to succeed in beef farming, the farmers need to be aware of economic profit affecting factors. the achievements contribute to the cooperation stability and the country economy. the researchers are aware of the significance of cost, return, and net economic profit of beef farming, and aim to determine factors affecting economic profit of beef cattle business. then the factors can be applied in the commercial improvement of beef cattle farming based on the economic profit the farmers gain. this helps farmers to compete in changing international markets, ensure consumers, and eventually make a good living in beef cattle farming sustainably. materials and methods population and sample this survey research used interviews to collect data. the population of the study included 4,327 beef cattle farmers, and they were members of kor ror por klang phon yang kham livestock cooperative limited in 2018. the sample size (366.15) was calculated by using yamane (1973) formula with a static error of 5%. 400 was determined to be the sample size in order to prevent probable errors from the data collection process. the samples were selected based on quota sampling which is a non-probability sampling method by considering the proportion of the pop factors affecting acceptance of beef farming standards (p. chaisombut et al.) 179 ulation of beef cattle farmers in each district of sakon nakhon, and then accidental sampling was used to interview those who were qualified and willing to participate until the total number was reached. data analysis and interpretation binary logistic regression analysis was used with the cases of multiple independent variables by including factors into the model to determine those that affect economic profits of phon yang kham beef cattle farming business as follows (greene, 2003): pi = f(y) = f(α + βi xi) = 1/(1+e-y) when pi = the probability of economic profit farmers gain from phon yang kham beef cattle farming and based on factor xi e = 2.718 (based on logarithm) y = the possibility of economic profit farmers gain from phon yang kham beef cattle farming: y = 0 referring to the economic profit from phon yang kham beef cattle farming  0; and y = 1 referring to the economic profit from phon yang kham beef cattle farming > 0 the equation above can be converted with logarithmic as follows: log [pi/(1-pi)] = y = α + β1 oc + β2 fa + β3 tr + β4 cb1 + β5 cb2 + β6 cb3 + β7 con + β8 ro + β9 cer + β10 ex + β11 lo + β12 rp1 + β13 rp2 the independent variables used in the study to determine factors affecting economic profit of phon yang kham beef cattle farming business are shown in table 1. results and discussion regarding economics cost and return of phon yang kham beef cattle farming of average 14.53 months from a sample of 400, the total cost was 73,369.00 thb/head while the average variable cost was 71,289.97 thb/head or 97.17% of the total cost. the highest variable costs included breeding cost of 29,114.16 thb/head (39.68%), roughage cost of 15,075.16 thb/head (20.55%), concentrate cost of 12,591.73 thb/head (17.16%), labour cost of 10,703.73 thb/head (14.59), motable 1. description of variables independent variables description and measurement symbol main occupation 1 = beef castle 0 = other oc family labour 1 = yes 0 = no fa training on knowledge of cattle 1 = yes 0 = no tr level of charolais breeding cb4 = 75.00%* cb3 = 62.50% cb2 = 50.00% cb1 = not certain cb concentrate feed quantity concentrate feed for beef cattle (kg./head/day) con roughage quantity roughage for beef cattle (kg./head/day) ro standard certification 1 = yes 0 = no cer experience experience in raising beef cattle (year) ex farm location 1 = next to home 0 = away from home lo beef cattle rearing period rp3 = greater than or equal to 15 month* rp2 = 12 15 month rp1 = less than or equal to 12 month rp * reference groups 180 j. indonesian trop. anim. agric. 47(3):177-183, september 2022 lasses of 1,932.90 thb/head (2.63%), utilities of 524.97 thb/head (0.72%), vaccines and medicine of 473.41 thb/head (0.65%), opportunity cost of variable investment of 297.82 thb/head (0.41%), mineral supplements of 267.74 thb/head (0.36%), transportation cost of 258.35 thb/head (0.35%), and cattle fattening cost of 50.00 thb/ head (0.07%). the total average fixed cost was 2,079.03 thb/head or 2.83% of the total cost where the highest fixed costs included interest cost of 995.39 thb/head (1.36%), depreciation of 985.24 thb/head (1.34%), land rental cost of 92.26 thb/head (0.13%), and opportunity cost of fixed investment of 6.15 thb/head (0.01%). in terms of return on investment in phon yang kham beef cattle farming in sakon nakhon, the average total return was 78,887.54 thb/head. the number was broken down into the income from selling cattle to the cooperative of 74,755.02 thb/head, financial support for new born calf of 1,499.52 thb/head, and income from selling manure of 2,633.00 thb/head. consequently, the net return after deducting the costs from total income was 5,518.54 thb/head (table 2). results of the logistic model analysis the variables that affect economic profitability of phon yang kham beef cattle farming were determined by using pearson product moment correlation coefficient, and it was found that family labour and concentrates were correlated at the most significant level at -0.236 which was lower than 0.75. multicollinearity, therefore, did not occur in this case. according to hosmerlemeshow goodness of fit test (rossi, 2009), the fitting of the model was at 8.230 which was lower than 15.507 (x2(0.05. 8)), 8and the p-value was 0.411. it was concluded that the model showed the goodness of fit at the significance level of 0.05 with the accuracy of prediction of 73.80% on average. the results of binary logistic regression analysis revealed the variables with statistical significance of 0.01 including concentrates (con), roughage (ro), and the rearing period of no more than 12 months (rp1) with p-values of 0.001, 0.000, and 0.000.the variables with statistical significance of 0.05 included the percentage of charolais breed of 62.50% (cb3) and the farm location (lo) with p-values of 0.023 and 0.039. the variables were indicated to affect the economic profit of phon yang kham beef cattle table 2. average economic costs and returns of beef cattle of farmers in sakon nakhon province. component cash (baht/head) non cash (baht/head) total (baht/head) percentage 1. total cost 49,557.90 23,811.10 73,369.00 100.00 1.1 variable cost 48,562.51 22,727.45 71,289.97 97.17 breed cost 20,416.13 8,698.03 29,114.16 39.68 roughage 11,630.97 3,444.19 15,075.16 20.55 concentrate feed 12,591.73 0.00 12,591.73 17.16 molasses 1,932.90 0.00 1,932.90 2.63 mineral supplement 267.74 0.00 267.74 0.36 vaccination and medication 473.41 0.00 473.41 0.65 labor 416.32 10,287.41 10,703.73 14.59 registration fee 50.00 0.00 50.00 0.07 transportation 258.35 0.00 258.35 0.35 electricity, water and gasoline 524.97 0.00 524.97 0.72 opportunity cost of capital 0.00 297.82 297.82 0.41 1.2 fixed cost 995.39 1,083.65 2,079.03 2.83 depreciation 0.00 985.24 985.24 1.34 land rental 0.00 92.26 92.26 0.13 interest 995.39 0.00 995.39 1.36 opportunity cost of capital 0.00 6.15 6.15 0.01 2. total income 77,864.29 1,023.25 78,887.54 3. net profit 28,306.39 5,518.54 factors affecting acceptance of beef farming standards (p. chaisombut et al.) 181 farming in sakon nakhon (table 3). discussions 1. cattle breeds: it has been found that the percentage of charolais breed of 62.50% (cb3) with the p-value of 0.023 and the odd ratio of 5.083 positively affect economic profit at the reliability level of 95.00%. the farmers therefore have more possibility to gain economic profit than those with the charolais breed to gain economic profit than those with the charolais breed of 75.00% by 5.083 times. breeds of beef cattle play a significant role in beef cattle farming. the crossbreeding of charolais and brahman or charolais and native cattle has been growing in number as a result of high economic return farmers earn. this result is consistent with marshall et al. (2020) found that increasing the management level of any of the breed or cross-breed types under consideration, including the indigenous zebu animals, resulted in an increased net benefit of 2.2to 2.9-fold. boonprong et al. (2008) have also discovered that tak breed was developed from 37.5% american brahman and 62.5% charolais breeds. the kabinburi breed was developed from 50% german simmental crossed with 50% brahman for enhanced heat tolerance, fertility and growth. 2. concentrates and roughage 2.1 concentrates: the variables with the pvalue of 0.001 and odd ratio of 1.387 indicate positive effects on economic profit at the reliability level of 99.00%. in other words, if the cattle are fed on 1 more kg of concentrate feed (con) per day, the probability of economic profit gained is by 1.387 times. 2.2 roughage: the variables with the pvalue of 0.000 and odd ratio of 0.921 when b is 0.082 confirms the inverse effects on economic profit at the reliability level of 99.00%. this implies that if the cattle are fed on 1 more kg of roughage (ro) per day, the probability of economic profit decreases by 0.921 times. concentrates and roughage are significantly related to beef cattle rearing (ekowati et al., 2018) as they play a major role for cattle growth and development. it is evident that the majority of production cost is cattle feed which is 70-80% of the total cost. considering the growth performance and cost per kg gain of brahman crossbred growing calves, it concluded that the diet consisting of roughage and concentrates ratio are 55:45 may be used for economic beef production (rashid et al., 2015). according to the results of the study, an increase of concentrates is likely for table 3. the results of binary logistic regression analysis for variables that affect economic profitability of phon yang kham beef cattle farming. variables b std.error wald df sig. exp (b) 95% c.i.for exp(b) lower upper constant 0.540 0.862 0.392 1 0.531 0.583 oc 0.461 0.536 0.740 1 0.390 1.586 0.554 4.539 fa -0.122 0.255 0.230 1 0.631 0.885 0.537 1.458 tr -0.467 0.264 3.112 1 0.078 0.627 0.373 1.053 cb1 0.882 0.716 1.520 1 0.218 2.417 0.594 9.827 cb2 1.167 0.670 3.035 1 0.081 3.213 0.864 11.944 cb3 1.626 0.715 5.166 1 0.023* 5.083 1.251 20.654 cb4 7.114 3 0.068 con 0.327 0.099 10.922 1 0.001** 1.387 1.142 1.683 ro -0.082 0.020 16.638 1 0.000** 0.921 0.886 0.958 cer 0.556 0.301 3.418 1 0.064 1.743 0.967 3.143 ex 0.002 0.017 0.013 1 0.910 1.002 0.970 1.035 lo -0.519 0.252 4.252 1 0.039* 0.595 0.363 0.975 rp1 1.740 0.430 16.350 1 0.000** 5.697 2.451 13.241 rp2 0.534 0.285 3.506 1 0.061 1.706 0.975 2.986 rp3 16.350 2 0.000 chi 2 ( 13) = 77.636; prob > chi2 = ** ; pseudo r 2 = 0.246; * significant at level 5%, ** significant at level 1% 182 j. indonesian trop. anim. agric. 47(3):177-183, september 2022 the farmers to earn economic profit; on the other hand, economic profit is likely to decrease if the cattle are fed on more roughage. as a result, the farmers should feed cattle with the maximum amount of concentrates and limit roughage to the appropriate amount. mcgee et al. (2016) confirms that carcass growth response to concentrate supplementation at pasture is higher where grass supply is low and where grass quality if poorer and, usually declines as concentrate supplementation level increases. haloho et al. (2013) also found that when increasing the cost for concentrates, they gained 4.7% more profit. the cost of concentrates has a significant influence on beef farming profitability (p<0.05). 3. beef cattle farm location: the variables with the p-value of 0.039 and odd ratio of 0.595 when b is -0.519 indicate the inverse effects on economic profit at the reliability level of 95.00%. in other words, with the beef cattle farms location (lo) that are close to residences, the farmers tend to earn less economic profit by 0.595 times compared to those located away from neighbouring residences because of better air circulation, better cattle growth rate, low epidemic diseases rate, and convenient access to sources of roughage. muroga et al. (2013) claims that the farms with physical limitations of livestock transportation can prevent animal epidemic. on the other hand, the convenient movements of animal, people, and vehicles can possibly risk the outbreak. kaneene et al. (2002) also states that in order for the farms to lower the risk of the epidemic, they are required to be naturally open, and the decrease of entries among different cattle houses. the feeding stations and pasture boundaries may need to be determined by electric fence. additionally, persson (2015) has found that good physical location is positively associated with the farm’s advantage in competition because of the decrease of feeding cost. 4. rearing period: the variables were divided into 3 groups: less than or equal to 12 months, 12 15 months, and greater than or equal to 15 months. the third group was assigned to be a reference group, and it was found that the rearing period of less than or equal to 12 months had the p-value of 0.000 and the odd ratio of 5.697. this means that rearing period affects economic profits in a positive way at the reliability level at 99.00%. in other words, the rearing period is less than or equal to 12 months (rp1), the probability of economic profit is by 5.697 times compared to the rearing period of greater than or equal 15 months. the beef cattle are about 3 years old as they started to be fattened at 2 years old in accordance with kalangia (2016) that has found that selling 1-year old beef cattle gave lower profits than selling older ones (1-2 years old. however, some farmers chose to sell sterile female cattle or heifers with lower price because of their lower weight and strength. conclusion according to the study of factors affecting economic profits of beef cattle business in sakon nakhon by using logistic regression analysis, it has found that there are 5 affecting factors: the variables with statistical significance of 0.01 including concentrates (con) that should be increased in feeding proportion, roughage (ro) that should be reduced, and the effective rearing period of less than or equal to 12 months (rp1); and the variables with statistical significance of 0.05 including the 62.50% charolais breed (cb3) that is suitable for the climate of thailand and farm location (lo) that should be distant from residences. references boonprong, s., choothesa, a., sribhen, c., parvizi, n., and vajrabukka, c. 2008. productivity of thai brahman and simmentalbrahman crossbred (kabinburi) cattle in central thailand. intl. j. biometeor. 52(5): 409– 415. division of livestock extension and developmentt 2012. beef cattle strategy 2012-2016. department of livestock development, ministry of agriculture and cooperatives. bangkok. ekowati, t., prasetyo, e. and handayani, m. 2 0 1 8 . the factors influencing production and economic efficiency of beef cattle farm in grobogan region, central java. j. indonesian trop. anim. agric. 43(1): 76-84. greene, w. h. 2003. econometric analysis. 5th ed. factors affecting acceptance of beef farming standards (p. chaisombut et al.) 183 prentice hall. new jersey. haloho, r.d., santoso, s.i., marzuki, s., roessali, w. and setiadi, a. 2013. profit function analysis of dairy cattle farming in getasan and west ungaran districts, semarang regency. j. indonesian trop. anim. agric. 3 8 (2 ): 1 1 6 122. kalangia, l.s., syaukat, y., kuntjoro, s.u. and priyanti, a. 2 0 1 6 . factors affecting profit analysis of beef cattle farming in east java, indonesia. livest. res. rural dev. 28(12): 19. kaneene, j.b., bruning-fann, c.s., miller, r., porter-spalding, b.a. and granger, l.m. 2002 . environmental and farm management factors associated with tuberculosis on cattle farms in northeastern michigan. j. american vet. med. assoc.. 221(6): 837-842. kor ror por klang phon yang kham livestock cooperative limited 2001. handbook of phon yang kham cooperative. phon yang kham livestock cooperative limited. sakon nakhon. kor ror por klang phon yang kham livestock cooperative limited. 2 0 1 9 . annual report 2019. kor ror por klang phon yang kham livestock cooperative limited. sakon nakhon. marshall, k., salmon, g.r., tebug, s., juga, j., macleod, m., poole, j., baltenweck, i. and missohou, a. 2 0 2 0 . net benefits of smallholder dairy cattle farms in senegal can be significantly increased through the use of better dairy cattle breeds and improved management practices. j. dairy sci.. 103(9): 81978217. mcgee, m., riordan, e.o. and moloney, a. 2016. concentrate feeding for growing and finishing cattle. agriculture and food development authority. july: 56-59 muroga, n., kobayashi, s., nishida, t., hayama, y., kawano, t., yamamoto, t. and tsutsui, t. 2013. risk factors for the transmission of foot-and-mouth disease during the 2010 outbreak in japan: a case-control study. bmc vet. res. 9: 150. persson, k. 2015. adding value to gain competitive advantagesagricultural and horticultural firms’ corporate strategies to create wealth. bd project. swedish university of agricultural sciences, uppsala, sweden. rashid, m.m., huque, k.s., hoque, m.a., sarker n.r. and bhuiyan, a. 2015. effect of concentrate to roughage ratio on cost effective growth performance of brahman crossbred calves. j. agric. sci. technol.. 5(4): 286-295. rossi, r.j. 2 0 0 9 . applied biostatistics for the health sciences. john wiley & sons. new jersey. suwanlee, s. 2 0 1 2 . cattle fattening and meat quality. department of animal science, faculty of agriculture, ubon ratchathani university. ubon ratchathani. yamane, t. 1973. statistics: an introductory analysis. 3 rd ed. harper and row publication. new york. journal of the indonesian tropical animal agriculture (j. indonesian trop. anim. agric.) pissn 2087-8273 eissn 2460-6278 41(2):53-60, june 2016 doi: 10.14710/jitaa.41.2.53-60 estimation of most probable producing ability value for calf birth's performance in sumba ongole cows s. said1, p. p. agung1, w. p. b. putra1, s. anwar1, a. s. wulandari1 and a. sudiro2 1research center for biotechnology indonesian institute of sciences, jl. raya bogor km. 46, cibinong 16911, west java indonesia 2karya anugerah rumpin (pt. kar), jl. raya cibodas no. 99, rumpin, west java indonesia corresponding e-mail : syahruddinsaid01@gmail.com received february 26, 2016; accepted april 04, 2016 abstrak estimasi nilai most probable producing ability (mppa) sangat penting untuk seleksi induk berdasarkan performan anak-anaknya. data catatan kelahiran dari 48 ekor induk sapi sumba ongole (so) dan data catatan performan lahir dari 52 ekor pedet digunakan untuk estimasi nilai mppa. nilai ripitabilitas (r) yang besar (r>0,30) diperoleh pada sifat panjang badan (pb) lahir. berat lahir (bl), tinggi gumba (tg) dan lingkar dada (ld) memiliki nilai r yang moderat (0,10 < r < 0,30). nilai mppa kumulatif performan lahir pedet pada induk berdasarkan satu catatan kelahiran tertinggi sebesar 4,64 (nomor sapi: 3770) dan terendah sebesar -4,64 (sapi nomor: 2283). pedet nomor b2076 (induk nomor: 3586) memiliki rasio tg (115,70); pb (124,26); ld (118,90) tertinggi, sedangkan rasio bl tertinggi (168,35) dicapai pada pedet nomor b2095 (nomor induk: 3731). sifat bl memiliki nilai r yang moderat sehingga masih akurat sebagai kriteria seleksi. kata kunci: sapi so, mppa, ripitabilitas, performan lahir, rasio performan abstract an estimation of most probable producing ability (mppa) value based on the calves performance is very important for the cow selection. the birth data record of 48 sumba ongole (so) cows and record data from 52 callf birth’s performance were used to estimate the value of mppa. high of r value (r > 0.30) was obtained at the body length (bl). birth weight (bw), withers high (wh) and chest girth (cg) had a moderate value (0.10 < r < 0.30) of repeatability. the mppa value of the cumulative calf birth’s performance of cows based on the highest birth records was 4.64 (cow number 3770) and the lowest was -4.64 (cow number 2283). calf number b2076 (cow number 3586) had the highest ratio of wh (115.70); bl (124.26); cg (118.90), while the highest ratio of bw (168.35) was obtained in calf number b2095 (cow number 3731). it was concluded that the bw of birth had a moderate value of r (0.10) and could be used as a selection criteria accurately. keywords: so cows, mppa, repeatability, calf birth, performance ratio introduction the main cattle breeding programs of production traits is conducted by using body weight at different ages for the selection criteria. these properties are easily measured and correlated positively with other value economic traits and response to the individual selection most probable producing ability value in sumba ongole cows (s. said et al.) 53 (boligon et al., 2010). one of the trait in the breeding of beef cattle is a calf’s birth weight, because this trait is associated with other traits in the development of individual cattle. the birth weight of the calf to be very important in the beef industry (bakir et al., 2004). calf’s birth weight is the one of production trait that affects the performance of the calf and became the first information concerning with the potential development of cattle (oluwumi and saloko 2010). furthermore, the birth weight of calf becomes the main character due to phenomenon of calving ease (vanmiddlesworth et al. 1977), and because this affects the viability, fertility rates and culling of calf (guiturres et al., 2007). value of genetic parameters in a population are described in animal genetic superiority, while the phenotype of livestock is a description of the influence of genetic and environmental factors as well as the interaction between genetic and environmental factors. the most important of this factor is genetic, because this could be passed down to the offspring (warwick et al. 1990). the heritability (h2) value in the animal breeding has an important role, because the heritability provides information about the value of a trait from elders those passed down to their offspring. repeatability (r) value is used for indicating phenotype correlation between the current performance and the future performance of an animal. the range values of repeatability (r) in beef cattle for birth weight are 0.20 to 0.30 (hardjosubroto, 1994). the sumba ongole (so) cattle is one of the genetic resources of indonesian local cattle that need to be conserved and developed for their superiority, thus the program of breeding cattle would produce the superior livestock to their agro-ecosystem. the so cattle is preferred by most raisers because of the quality of meat product (thickness and lean). agung et al. (2015) reported that the hot carcass weight of male so cattle with slaughter weight 401 to 425 kg obtain 218.73±9.15 kg. to maintain and improve the excellence of the so cattle, it is necessary to conduct the selection and breeding program based on their mppa value. the present study estimated the value of mppa based on the performance of birth (birth weight, body height, body length, chest circumference) as a first step to determine the genetic potential of so cattle materials and methods place and samples the materials used in this study were the recording data of livestock throughout the year of 2014. the collected data includes birth records of 48 so cows and measurement data of 52 calves were reared in the pt. karya anugerah rumpin, bogor, west java. standardization data data of birth weight (bw) and calf birth’s body size (withers height, body length, chest girth) were standardized or corrected based on the hardjosubroto (1994) as follows: cfsex = [average of male calves birth performance/ average of female calves birth performance], where cfsex is correction factor of sex for calves performance. correction factor (cf) only used for female calf. these factor was aimed to reduce the variance among population for each trait. commonly, the cf was used for bw, but in this study cf also used for birth measurements. the average of dams age + two years and the cf of dams age is not needed for bw correction. data analysis repeatability. estimation of repeatability values were calculated using interclass correlation method based on two birth records as directed by warwick et al. (1990) as follows :       −      − − = ∑∑ ∑ ∑ n )(x x n )(x x n xx xx r 2 2 2 2 1 1 21 21 where r = repeatability x1 = the first birth performance recording x2 = the second birth performance recording n = number of individu most probable producing ability (mppa) estimation value of mppa cows were calculated based on intruction of hardjosubroto (1994) as follows: )pp( 1)r(n1 nr mppa − −+ = mppacumulative = mppa(bw) + mppa(wh) + mppa(bl) + mppa(cg) 54 j.indonesian trop.anim.agric. 41(2):53-60, june 2016 where mppa = most probable producing ability r = repeatability p = the average individual performance p = the average population performance bw = birth weight wh = withers height bl = body length cc = chest girth performance ratio of calves. the calculation of the performance ratio of the cattle is one alternative way to do the selection when information of cattle heritability value is not available. the calculation of the performance ratio of calves according hardjosubroto (1994): 100% x p p cpr = where cpr = calf’s performance ratio p = the average individual performance p = the average population performance results and discussion birth performance birth weight of so male calf (23.86 kg) was greater than females (19.77 kg) as shown in table 1. the so cattle may have a superior genetic potency than other local indonesian cattle, because the average of birth weight in so cattle was greater than that in other local indonesian cattle. the birth weight of male madura, bali, and aceh cattle were 15.42, 17.73 and 14.08, respectively. the birth weight of female madura, bali and aceh cattle were 13.60, 17.55 and 13.14 kg, respectively (karnaen 2007; gunawan and jakaria, 2011; bakhtiar, 2010). the birth weight as a criterion of selection could be correlated positively with further potential growth of animal (aziz et al., 2005; oluwumi and saloko, 2010). in addition, environmental climate and management may also alter the ability of dam and their calves to express a genetic change directly and maternal factors (speidel et al. 2007). baliarti (1991) reported that the birth weight of indonesian local brahman and most probable producing ability value in sumba ongole cows (s. said et al.) 55 table 1. birth calves performance of sumba ongole (so) cattle performance average sd cv (%) min. max. male (n = 14) birth weight (kg) 23.86a 5.68 23.81 15.00 34.00 body high (cm) 70.71a 5.58 7.89 61.00 80.00 body length (cm) 57.43a 7.16 12.47 45.00 68.00 chest circum. (cm) 65.71a 6.93 10.55 53.00 78.00 female (n = 26) birth weight (kg) 19.77b 3.19 16.14 15.00 25.00 body high (cm) 68.69a 3.79 5.52 60.00 78.00 body length (cm) 55.77a 4.97 8.91 45.00 67.00 chest circum. (cm) 66.15a 6.07 9.18 53.00 77.00 total (n = 40) birth weight (kg) 21.20 4.60 21.70 15.00 34.00 body hight (cm) 69.40 4.53 6.53 60.00 80.00 body length (cm) 56.35 5.80 10.29 45.00 68.00 chest circum. (cm) 66.00 6.30 9.55 53.00 78.00 a,b different superscrips in the same variable indicates significantly different (p<0,05); sd= standart of deviation; cv= coefisien of variation ongole crossbred were 27 and 28 kg, respectively. the so cattle was a type of bos indicus which has bigger body size than madura, bali and aceh cattle. repeatability the estimation of repeatability (r) value in so cattle are presented in table 2. the r value in so cattle was 0.10 for bw, this might be a moderate category. the high r value of calves bw was lower than aceh (0.36) and local ongole crossbred cattle (0.81) (putra et al., 2014; adinata, 2013). simmental cattle had bw r value of 0.25 (suhada et al., 2009). a high value of r indicated that a trait have high repetition value (probability). therefore the cattle selection may be conducted with a minimum of two records (falconer and mackay, 1996). a moderate r value indicates that the correlation between phenotypes in the genetic diversity is high, so that the selection based on the phenotype of bw individuals will be sufficiently effective. thus the selection of the cattle bw may improve the quality for post weaning genetic traits of weaning weight, yearling and average daily gain (adg) because of highly genetic correlations within these traits (guiturres et al., 2007; lasley 1978). this result study showed that the lowest r value reached by the bw. this means that the variation of bw between first and second parities were high. therefore, the selection based on this trait was more effective than the birth measurements. the birth weight trait was is positively correlated with the character in trait of the future selection stage (lasley 1978). in this study, bw might be correlated with weaning weight. however, some studies showed that high genetic correlation value (rg > 0.50) between birth and weaning weights are obtained in brangus (0.78) and red chittagong (0.53) cattle (neser et al., 2012; rabeya et al., 2009). most probable producing ability the mppa cumulative values based on the two birth records are shown in table 3. a cattle numbers 5560 had highest (5.45) and cattle number 1746 was the lowest (-10.56) of mppa. cattle ranking based on the one record (first parity) of birth are shown in table 4. the highest mppa cumulative value (4.64) was obtained in cattle number 3770. the highest mppa value of birth weight in aceh cow by two records was 1.38 (putra et al., 2014). in this study, mppa value ranking was based on first birth merely. thus, the basis of assessment criterion was reflected on the ranking of mppa value. in addition, the mppa estimation method such as anova analysis may be the best for calculating r value. the mppa cumulative value > 0.00 was recommended for the cattle selection, because this may allow an improvement in animal performance (figure 1). 56 j.indonesian trop.anim.agric. 41(2):53-60, june 2016 table 2. estimation of repeatability values (r) of calf’s birth performance in sumba ongole (so) cows properties n r category birth weight 16 0.10 moderate withers height 8 0.26 moderate body length 8 0.59 high chest girth 8 0.28 moderate n: the number of observations table 3. most probable producing ability (mppa) value of calf’s birth performance based on two performance records from two calves in sumba ongole (so) cows no. cattle mppa total (rank) bw wh bl cg 5560 0.200 1.919 0.004 3.332 5.454 (1) 1136 -0.143 -2.456 -4.909 -0.569 -8.076 (3) 1752 0.059 0.689 -2.453 -1.805 -3.509 (2) 1736 -1.142 -0.825 -6.067 -2.522 -10.556 (4) bw= birth weight; wh= withers height; bl= body lenght; cg= chest girth hardjosubroto (1994) stated that the determination of mppa value is a maximum estimate for female production capability, because the estimation involves available performance data of the animal. calf performance ratio table 5 shows top ten of so calves for selection purposes. the ratio of calf performance is used to select cattle based on the individual performance. this is compared then to the average performance of the population (hardjosubroto, 1994). table 4 shows that the calf number b2092, b2076, and b1613 were the best three calves based on birth performance and dam rank. the dams of those calves were 3770, 3586 and 5566, respectively, and those three cows were ranked in 1, 2 and 4, respectively. the dams for calves number b2053 and b2085 had 11st and 15th ranks, respectively (data were not shown in the table). however, the selection of calf based on dam through mppa is preferable, because the genetic potential is described by repeatability, so the calves selection results would be more accurately (hardjosubroto, 1994). figure 2 shows that the selection of calf can be done by selecting the calf with bw ratio values ≥120% and wh, bl and cg, respectively ≥110%. conclusion the repeatability of birth weight was in a moderate category. the ranking of calf that was based on the bw ratio could be used as a criterion of selection for so bull as well as dam. the rangking of dams based on mppa cumulative value may be used as the criterion of selection for most probable producing ability value in sumba ongole cows (s. said et al.) 57 table 4. top ten of sumba ongole (so) cows based on the most probable producing ability (mppa) value for calf birth performance using one record of a calf no. cattle mppa total (rank) birth weight withers height body length chest girth 3770 1.28 2.76 6.28 3.36 4.64 (1) 3586 0.71 2.83 8.07 3.49 4.20 (2) 3731 1.45 -0.11 6.24 1.55 3.00 (3) 5566 0.59 2.83 7.46 2.38 2.97 (4) 0584 0.38 -0.36 1.56 2.52 2.90 (5) 2299 0.96 0.16 3.21 1.55 2.50 (6) 2302 0.96 0.69 2.60 1.27 2.22 (7) 0023 0.96 2.03 -1.05 1.27 2.22 (7) 2297 0.59 1.76 -1.65 1.55 2.13 (8) 2284 0.68 0.42 5.10 1.12 1.80 (9) 3721 0.78 -0.36 2.74 0.84 1.62 (10) figure 1. histogram of mppa cumulative of sumba ongole (so) cows 58 j.indonesian trop.anim.agric. 41(2):53-60, june 2016 table 5. the birth performance ratio of the top five of sumba ongole (so) calves no. calfs (rank) no. cows calf performance ratio (%) rank bw wh bl cg bw wh bl cg b2092 (1) 3770 160.38 115.27 118.90 118.18 2 1 4 2 b2076 (2) 3586 133.52 115.70 124.26 118.90 6 1 1 1 b1613 (3) 5566 127.72 115.70 122.44 112.88 8 1 2 4 b2053 (4) 1931 141.51 110.95 120.67 103.03 4 3 3 10 b2085 (5) 2108 127.72 108.28 109.65 103.85 8 6 9 10 bw= birth weight; wh= withers height; bl= body lenght; cg= chest girth. ranking of calves based on score rank that less from 10 for each traits. despite, rank of dam also used for calves evaluation. figure 2. histogram of calves birth performance ratio of sumba ongole (so) cows the breeding program with male so cattle to produce an optimal birth weight and a calf body size according to the animal standards. acknoledgements this research funding was supported partly by ministry of research, technology, and higher education, the republic of indonesia. a sincere appreciation is expressed to head of research center for biotechnology, indonesian institute of sciences, and director of pt. karya anugerah rumpin, for experimental farm facilities. author gratitude is also expressed to all members of animal research group in research center for biotechnology, indonesian institute of sciences. references adinata, y. 2013. estimasi nilai pemuliaan bobot lahir di unit pengelolaan bibit sumber di loka penelitian sapi potong. seminar nasional teknologi peternakan dan veteriner. medan, 3 – 5 september 2013. p. 66-73. agung, p.p., s. anwar, a.s. wulandari, a. sudiro, s. said and b. tappa. 2015. the potency of sumba ongole (so) cattle: a study of genetic characterization and carcass productivity. j. indonesian trop. anim. agric. 40: 71-78. aziz, m.a., s. nishida, k. suzuki and a. nishida. 2005. estimation of direct and maternal genetic and permanent environmental effects for weights from birth to 356 days of age in a herd of japanese black cattle using random regression. j. anim. sci. 83:519530. bakhtiar. 2010. performans reproduksi dan produksi sapi aceh. tesis. universitas andalas. padang. baliarti, e. 1991. berat badan anak sapi peranakan ongole dan peranakan brahman hasil inseminasi buatan di kabupaten gunung kidul. buletin peternakan. 15: 3037. bakir, g., a. kaygisiz, h. and ulker. 2004. estimates of genetic and phenotypic parameters for birth weight in holstein friesian cattle. pakistan j. biol. sci. 7:12211224. boligon, a.a., j.a.v. silva, r.c. sesana, j.c. sesana, j.b. junqueira and l.g. albuquerque. 2010. estimation of genetic parameters for body weight, scrotal circumference and testicular volume measured at different ages in nellore cattle. j. anim. sci. 88:1215-1219. guiturres, j.p., f. goyache, i. fernández , i. alvarez and l.j. royo. 2007. genetic relationship among calving ease, calving interval, birth weight, and weaning weight in the asturiana de los valles beef cattle breed. j. anim. sci. 85:67-75. gunawan, a. and jakaria. 2011. genetic and non genetic effect on birth, weaning and yearling weight of bali cattle. media peternakan. 34: 93-98. falconer, r. d. and t. f. mackay. 1996. introduction to quantitative genetics. 4th ed. department of genetics. north canada state university. prince george. hardjosubroto, w. 1994. aplikasi pemuliabiakan ternak di lapangan. gramedia widiasarana indonesia, jakarta. karnaen. 2007. model kurva pertumbuhan prasapih dari sapi madura jantan dan betina. jurnal ilmu ternak. 7: 48-51. lasley, j.e. 1978. genetics of livestock improvement. new jersey: prentice hall inc. englewood cliffs. neser, f.w.c., j.b. van wyk, m.d. fair, p. lubout, b.j. crook. 2012. estimation of genetic parameters of growth traits in brangus cattle. s. afr. j. anim. sci. 42: 469-473. oluwumi, s.o. and a.e. saloko. 2010. genetic parameters and factors affecting reproductive performance of white fulani cattle in south western nigeria. global veterinaria. 5: 255-258. putra, w.p.b., sumadi dan t. hartatik. 2014. estimasi nilai pemuliaan dan most probable producing ability sifat produksi sapi aceh di kecamatan indrapuri provinsi aceh. buletin peternakan. 38: 1-7. rabeya, t., a.k.f.h. bhuiyan, m.a. habib and m.s. hossain. 2009. phenotypic and genetic parameters for growth traits in red chittagong cattle of bangladesh. j. bangladesh agril. univ. 7: 265-271. speidel, s.e., r. erns and d.j. garrick. 2007. weaning weight inheritance in environments classified by maternal body weight change. j. anim. sci. 85: 610-617. suhada, h., sumadi, dan n. ngadiyono. 2008. estimasi parameter genetik sifat produksi sapi simmental di balai pembibitan ternak most probable producing ability value in sumba ongole cows (s. said et al.) 59 unggul sapi potong padang mengatas, sumatera barat. buletin peternakan. 33:1-7. vanmiddlesworth, j., c.j. brown and z.b. johnson. 1977. repeatability of calf weight to cow weight in hereford and angus. j anim sci. 45: 1247-1253. warwick, e. j., j. w. astuti, w. hardjosubroto. 1990. pemuliaan ternak. gadjah mada university press, yogyakarta. 60 j.indonesian trop.anim.agric. 41(2):53-60, june 2016 molecular markers on the leptin gene in bali cattle (t. kurlyana et al.) 1 j i t a a journal of the indonesian tropical animal agriculture accredited by ditjen riset, teknologi dan pengabdian kepada masyarakat no. 164/e/kpt/2021 j. indonesian trop. anim. agric. pissn 2087-8273 eissn 2460-6278 http://ejournal.undip.ac.id/index.php/jitaa 48(1):1-9, march 2023 doi: 10.14710/jitaa.48.1. 1-9 association between leptin gene polymorphism and growth traits in bali cattle t. kurlyana 1 , t. hartatik 2 * and sumadi 2 1 graduate student at department of animal breeding and reproduction, faculty of animal science, universitas gadjah mada. jl. fauna no. 3, bulaksumur, sleman 55281, yogyakarta, indonesia. 2 department of animal breeding and reproduction, faculty of animal science, universitas gadjah mada. jl. fauna no. 3, bulaksumur, sleman 55281, yogyakarta, indonesia. * corresponding e-mail: tety@ugm.ac.id received may 25, 2022; accepted january 4, 2023 abstract leptin (lep) gene produces hormone leptin which is secreted by adipose tissue, and plays an important role in energy balance, regulating feed intake, regulating endocrine function, and immune functions. this study aims to identify molecular markers of lep gene and its association with growth traits based on snp in bali cattle. the blood samples were collected from 16 male and 30 female bali cattle. the growth data were recorded from 2018 to 2020, consist of body weight and body size. amplification of leptin gene with polymerase chain reaction (pcr) using pair of primers, leptin_3forward: 5’agcttggaaacatggtggtc-3’ and leptin_3reverse: 5’ catgatgctccctggattct-3’ with dna target 898 bp. the snps were identified by the direct sequencing technique. genotypes of the snps were identified using sequencing method. association of lep genotypes with growth traits was performed using oneway anova. three dna polymorphisms of the lep gene were found, namely g.2913c/t, g.3260t/c, and g.3549g/a. snp g.2913c/t was significantly associated (p<0,05) with weaning shoulder height (wsh), weaning body length (wbl), weaning chest circumference (wcc), yearling shoulder height (ysh), yearling body length (ybl), and yearling chest circumference (ycc). meanwhile, snps g.3260t/c and g.3549g/a were not associated with the body weight and body size in bali cattle. in conclusion, the snp g.2913c/t can be used as molecular marker for body size in weaning and yearling of bali cattle. keywords: bali cattle, leptin gene, growth traits, molecular markers, snp introduction bali cattle are germplasm that was domesticated from descendants of the wild ancestor, banteng (bos javanicus) around 5000-10000 years before present (mohamad et al., 2011) and grow rapidly in bali. despite this, bali cattle are spread massively in west and east nusa tenggara, south sulawesi, and sumatra. bali cattle is one of the native indonesian cattle that has been 2 j. indonesian trop. anim. agric. 48(1):1-9, march 2023 registered through the ministry of agriculture, republic of indonesia (325/kpts/ ot.140/1/2010). several advantages of bali cattle are high percentage of carcass, good adaptability in tropical environments, good reproduction (fertility and low calf mortality), and can digest high-fiber feed (purwantara et al., 2011). these make bali cattle the perfect indigenous breed in tropical climate like indonesia. therefore, bali cattle must be conserved to maintain genetic diversity, so it is important to select bali cattle for breeding programs which can be done by quantitative and molecular methods. recently, molecular approaches using gene markers have been widely used, namely by detecting single nucleotide polymorphism (snp) as molecular markers. snps indicate genetic diversity in individuals which refers to variations in the dna sequence. genes in body affect many traits, one of which is growth traits that are influenced by one of the genes, the leptin gene. lep gene produces the hormone leptin which is secreted by adipose tissue (putra and indriastuti, 2017), and plays an important role in energy balance, regulating feed intake, regulating endocrine function, and immune functions (javanmard et al., 2008; de la hoya et al., 2015). lep gene is located on chromosome 4 in cattle, sheep, and goat (gregorio et al., 2014). the weight of the leptin gene is 16 kd, which encodes for 167 amino acids of the obese (ob) gene. this gene has 3 exons and 2 introns, even though only partially exon 2 and exon 3 are translated to protein (haruna et al., 2020). the study association of lep gene with economic traits showed significant results in several cattle. shin and chung (2007) stated that snp c1180t on exon 2 of lep gene impacted backfat thickness and marbling score in korean cattle, snp e2fb and t945m were found significantly associated with weight gain in nellore cattle (da silva et al., 2012), and the snp a59v was significantly associated with body weight in limousin cattle (kulig and kmieć, 2009). in indonesian cattle, the snp 1180c/y and 1218a/g have found in sumba ongole (so) cattle which is in exon 2 of leptin gene (anugratama and hartatik, 2020). in addition, snp 1181g/a and 1218a/g have found in bali cattle (anugratama and hartatik, 2020). fathoni et al. (2019) stated that snp g.1180c/t of lep gene was found in ongole crossbred (po) cattle and affected weaning chest circumference. the study of nugroho et al. (2022) presented g.1180c/t has an association with growth, carcass, milk, and reproduction trait in madura cattle. recently, identification of exon 3 leptin gene polymorphism in sumba ongole (so) cattle has been reported and found snp g.3260t/c (putra and agung, 2020). based on previous research, snp in leptin gene polymorphism is potential gene as a selection marker for economic traits. therefore, this study aimed to identify molecular markers of lep gene and its association with growth traits based on snp in bali cattle. materials and methods samples and data the blood samples were collected from 16 male and 30 female bali cattle at the jugular vein using venoject needle. approximately about 3 ml figure 1. target sequence of leptin gene based on genbank acc. no. u50365.1 molecular markers on the leptin gene in bali cattle (t. kurlyana et al.) 3 of blood was collected from each animal and stored at vacutainer containing k3edta. all animals were reared with the same maintenance procedures at balai pembibitan ternak unggul dan hijauan pakan ternak (bptu hpt) denpasar, bali province and fed with king grass (pennisetum purpupoides) (10% of body weight) and concentrate (2% of body weight). feeding is done twice a day with ad libitum drinking method. the growth traits data were recorded from 2018 to 2020 at bptu hpt denpasar, consist of body weight and body size such as weaning weight (ww), weaning shoulder height (wsh), weaning body length (wbl), weaning chest circumference (wcc), yearling weight (yw), yearling shoulder height (ysh), yearling body length (ybl), and yearling chest circumference (ycc). dna extraction and polymerase chain reaction (pcr) amplification the dna was isolated using a dna extraction kit (geneaid, new taipei city, taiwan) with extraction methods in the laboratory of genetics and animal breeding, faculty of animal science, universitas gadjah mada. the protocol procedure includes sample preparation, cell lysis, dna binding, wash, and dna elution. the quality of dna extraction was performed by 0,8% agarose gel electrophoresis and observed in a uv transilluminator. there will be a band indicating the dna has been isolated successfully. the primer is designed using primer3 (http://primer3.ut.ee/) by performing alignment using genbank acc. no. u50365.1 (bos taurus), eu313203 (bos indicus), jq711179 (bos taurus), eu642566 (bos frontalis), and mn709609 (bos javanicus) from national center for biotechnology information (ncbi). a specific pair of primers design is leptin_3forward: 5’agcttggaaacatggtggtc-3’ and leptin_3reverse: 5’catgatgctccctggattct-3’ with dna target sequence 898 bp located in intron 2, exon 3, and 3’utr (figure 1). polymerase chain reaction (pcr) was performed in a total reaction of 25 µl per sample containing 9,5 µl aquabidest, 12,5 µl pcr kit (kapa biosystems, usa), 0,5 µl forward primer and 0,5 µl reverse primer, and 2 µl of dna. the pcr protocol is a modification of anugratama et al. (2020), namely predenaturation temperature at 94 o c for 1 min, and 30 cycles of denaturation at 94 o c for 1 min, annealing at 55 o c for 1 min, and extension at 72 o c for 1 min, then the final extension at 72 o c for 5 minutes. the quality of the pcr products was visualized using agarose gel electrophoresis through 1.5% with ethidium bromide as a fluorescent tag and observed using uv transilluminator. snp genotyping and data analysis pcr products were sequenced in laboratorium penelitian dan pengujian terpadu universitas gadjah mada (lppt ugm) and 1 st base laboratory service, malaysia. the snps were found at the early and middle sequences, so the primer used for sequencing were only the reverse primer (figure 2). sequencing results were aligned using bioedit program (version 7.2) and compared with genbank acc. no. u50365.1 to confirm the snp in samples. the “double peak” that appears on electropherogram indicates that a table 1. single nucleotide polymorphism (snp), and amino acid analysis for leptin gene in bali cattle snp region fragment size (bp) amino acid mutation g.2913c/t intron 2 898 g.3260t/c exon 3 valine/valine synonymous g.3549g/a 3’utr bp= base pair 4 j. indonesian trop. anim. agric. 48(1):1-9, march 2023 confirmed snp has been found (figure 4). statistical analysis the data of body weight and body size have been corrected for sex and parent age using formula of hardjosubroto (1994) as follows: where: ww205 = corrected weaning weight at 205 days of age (kg); ww = weaning weight (kg); bwx = birth weight (kg); weaning = time of weaning (days); fkui = correction factor of parent age; fkjk = correction factor of sex; yw365 = corrected yearling weight at 365 days of age (kg); yw = real yearling weight (kg); it = interval time between ww and yw measurement (days). the association between genotypes and growth traits were analyzed using one way anova with ibm spss statistics v.26. the mathematical model as follows (becker, 1992): yik = µ + αi + ei where yik is the observation value (body weight and body size); µ is the average overall growth trait; αi is the genotype effect, and ei is the random error experiment. the significant association was determined by p-value (p<0,05). results and discussion polymorphism, genotype and allele frequency of leptin gene this study found three snps in target sequence, namely g.2913c/t located in intron 2, g.3260t/c located at exon 3 and g.3549g/a located at 3’utr based on genbank acc. no. u50365.1 (table 1). the target fragment of leptin gene successfully amplified with the specific primer and the protocol of pcr, the visualization of amplification shown in agarose gel 1,5% in (figure 3) and the electropherogram sequencing of the leptin gene in bali cattle are presented in (figure 4). the obtained snps formed seven haplotypes and have been submitted to genbank with accession number op748255 (type i), op748256 (type ii), op748257 (type iii), op748258 (type iv), op748259 (type v), op748260 (type vi), and op748261 (type vii). in this study, allele and genotype frequencies of bali cattle were presented in (table 2). the genotype frequencies of snp g.2913c/t are cc, ct and tt, which are cc genotype frequency (0.68) had a higher frequency than ct (0.17) and tt (0.15) genotypes. meanwhile, snp g.3549g/a had a genotype frequency gg (0.80) was higher than ag (0.02). the snp g.3260t/c had a higher frequency of cc genotype (0.96) than ct genotype (0.04). in sumba ongole (so) cattle, snp g.3260t/c showed that tt (0.41) and ct (0.41) genotypes had a higher frequency than cc (0.18) genotype (putra and agung, 2020). these differences of genotype distribution are probably due to differences of cattle breeds and the number of samples. however, these snp needs to ww205 = x fkui x fkjk yw365 = ww205 figure 2. the position of snp on target sequence of leptin gene molecular markers on the leptin gene in bali cattle (t. kurlyana et al.) 5 confirm through other study with large number of samples in bali cattle. association of leptin gene with growth traits in bali cattle snp g.3260t/c and g.3549g/a in bali cattle were not associated with ww, wsh, wbl, wcc, yw, ysh, ybl and ycc (table 3). meanwhile, snp g.2913c/t was significantly associated with body size (wsh, wbl, wcc, ysh, ybl and ycc). snp g.3260t/c located in exon 3 which codes for amino acid in a protein sequence, but the mutation of snp g.3260t/ c did not change the encoded amino acid, so it did not change its effect on growth traits. it is called a synonymous mutation. a mutation in snp g.3260t/c encoding the amino acid valine to valine with gtt and gtc codon. in addition, snp g.3549g/a located in 3’ untranslated regions (3’utr) was not associated with ww, wsh, wbl, wcc, yw, ysh, ybl and ycc in bali cattle. however, snp g.15525 g>a in 3’utr region of capn1 gene was associated with a backfat thickness in bali cattle (dairoh et al., 2022), this proves that 3’utr region also affects economic traits in cattle but does not occur in snp g.3549g/a of the leptin gene in bali cattle. 3’ untranslated region plays an important role in regulate mrna-based processes such as influencing mrna localization, mrna stability, table 2. allele and genotype frequency in lep gene in bali cattle snp genotype n genotype frequency allele frequency g.2913c/t cc 31 0.68 c=0.76 ct 8 0.17 t=0.24 tt 7 0.15 g.3260t/c cc 44 0.96 c=0.98 ct 2 0.04 t=0.02 tt 0 0 g.3549g/a gg 37 0.80 g=0.90 ag 9 0.20 a=0.10 aa 0 0 n= number of animals figure 3. the pcr products performed in 1,5% gel agarose through electrophoresis. m = marker; t1-t5 = samples. 6 j. indonesian trop. anim. agric. 48(1):1-9, march 2023 and efficiency of mrna translation (mayr, 2019). the snp g.2913c/t is located on intron 2 and was significantly associated with body size (wsh, wbl, wcc, ysh, ybl and ycc), although mutation in intron region does not change to amino acid but it can change structural and functional properties (komar, 2007). mutation in intron 2 of lep gene in bali cattle may help change to amino acid, if it occurs at the initial site of mrna splicing after transcription (maskur and arman, 2014). the function of intron is encoded functional rna through processing after splicing to produce non-coding rna molecules before the rna molecules are translated into proteins. introns help to produce variations in mrna molecule to form proteins (chorev and carmel, 2012). moussavi et al. (2006) stated that the intron (g.820c/t) in the leptin gene could influence the phenotype in iranian holstein cattle. futhermore, snp lep/ sau3ai in intron 2 change position 2059 of protein chain (cytosine, c to thymine, t) and significantly affected protein and fat yield, and age of first calving in slovak spotted and pinzgau cows (trakovicka et al., 2013). conclusion leptin gene in intron 2, exon 3 and 3’ untranslated region (3’utr) in bali cattle showed polymorphic snps. there are snp g.2913c/t, g.3260t/c and g.3549g/a. the snp g.2913c/t was significantly associated with body size snp g.2913c/t snp g.3260t/c snp g.3549g/a figure 4. the results of snps identification in the leptin gene based on the electrophoregram using the bioedit program. molecular markers on the leptin gene in bali cattle (t. kurlyana et al.) 7 (wsh, wbl, wcc, ysh, ybl and ycc). although, snp g.3260t/c and g.3549g/a were not associated with ww, wsh, wbl, wcc, yw, ysh, ybl and ycc. the snp g.2913c/t could be used as molecular markers in population of bali cattle at bptu-hpt denpasar, however it remains to be seen if this applies to other breeds of cattle. acknowledgments this research was financially supported by the indonesia endowment fund for education (lpdp) in 2019. in this great chance, the researcher would like to offer their gratitude to the government of lpdp, bptu hpt denpasar, mrs. retno setyawati as a laboratory assistant, and all my friends for the help in the laboratory. references anugratama, l.e and t. hartatik. 2020. short communication: identification of leptin gene in crossbred beef cattle. biodiversitas. 21 table 3. the association between snp of lep gene with growth traits in bali cattle snp variable genotype p-value ct (n=8) tt (n=7) cc (n=31) g.2913c/t ww (kg) 90.42±20.71 78.43±8.80 100.97±25.68 0.06 wsh (cm) 91.80±10.21 b 78.79±5.63 a 94.90±13.97 b 0.04 wbl (cm) 85.29±9.67 b 74.40±7.02 a 87.17±13.56 b 0.04 wcc (cm) 108.85±13.43 b 90.70±4.75 a 108.58±19.36 b 0.04 yw (kg) 142.51±20.89 134.87±12.94 155.53±29.24 0.12 ysh (cm) 100.05±6.88 b 91.15±2.64 a 105.23±11.07 b 0.00 ybl (cm) 96.45±6.65 b 85.60±4.41 a 101.38±12.79 b 0.00 ycc (cm) 130.80±16.50 b 113.51±5.84 a 130.41±16.23 b 0.03 ct (n=2) cc (n=44) g.3260t/c ww (kg) 84.31±2.81 96.22±24.66 0.50 wsh (cm) 78.23±6.85 92.53±13.48 0.14 wbl (cm) 75.51±9.51 85.32±12.87 0.29 wcc (cm) 91.36±9.23 106.57±18.06 0.24 yw (kg) 156.66±13.97 149.82±27.46 0.73 ysh (cm) 92.01±4.69 102.65±10.77 0.17 ybl (cm) 89.67±4.63 98.50±12.40 0.32 ycc (cm) 120.83±3.28 128.22±16.43 0.53 ag (n=9) gg (n=37) g.3549g/a ww (kg) 89.26±25.20 97.27±24.08 0.38 wsh (cm) 90.89±18.48 92.16±12.37 0.80 wbl (cm) 84.49±16.28 85.00±12.10 0.91 wcc (cm) 104.89±19.91 106.15±17.77 0.85 yw (kg) 151.00±26.67 149.90±27.39 0.91 ysh (cm) 101.28±12.53 102.41±10.49 0.78 ybl (cm) 98.77±17.37 97.96±11.01 0.86 ycc (cm) 129.12±19.14 127.61±15.61 0.80 ww = weaning weight; wsh = weaning shoulder height; wbl = weaning body length; wcc = weaning chest circumference; yw = yearling weight; ysh = yearling shoulder height; ybl = yearling body length; and ycc = yearling chest circumference; a,b means different superscripts within the same column show significantly different values at p<0.05. 8 j. indonesian trop. anim. agric. 48(1):1-9, march 2023 (1):226-230. https://doi.org/10.13057/ biodiv/d210129 becker, w. 1992. manual of quantitative genetics. fifth edition. academic enterprises. pullman. washington. chorev, m and l. carmel. 2012. the function of introns. front genet. 3(55):1-15. https:// doi.org/10.3389/fgene.2012.00055 dairoh, d., j. jakaria, m.f. ulum and c. sumantri. 2022. a new snps at 3’utr region of calpain 1 gene and its association with growth and meat quality traits in beef cattle. j. indonesian trop. anim. agric. 47(1):1728. https://doi.org/10.14710/jitaa.47.1.17-28 da silva, r.c.g., j.b.s. ferraz, f.v. meirelles, j.p. eler, j.c.c. balieiro, d.c. cucco, e.c. mattos, f.m. rezende and s.l. silva. 2012. association of single nucleotide polymorphisms in the bovine leptin and leptin receptor genes with growth and ultrasound carcass traits in nellore cattle. genet mol res. 11(4):3721–3728. https:// doi.org/10.4238/2012.august.17.10 de la hoya, m.p.g., j.a.t. ramirez, p.r. contreras, c.e.p. diaz, f.o.r. saucedo and j.s.q. saucedo. 2015. role of leptin in cattle production: review. j. anim. vet. adv. 14(4):18 – 90. http://dx.doi.org/10.3923/ javaa.2015.81-90 fathoni, a., d. maharani, r.n. aji, r. choiri and s. sumadi. 2019. polymorphism of the snp g.1180 c<t in leptin gene and its association with growth traits and linear body measurement in kebumen ongole grade cattle. j. indonesian trop. anim. agric. 44 (2):125-134. https://doi.org/10.14710/ jitaa.44.2.125-134 gregorio, p.d., a.d. trana, p. celi, c. salvatore and a. rando. 2014. comparison of goat, sheep, cattle, and water buffalo leptin (lep) genes and effects of intron 1 microsatellite polymorphism in goats. animal prod. sci. 54:1258-1262. http:// dx.doi.org/10.1071/an14101 hardjosubroto, w. 1994. aplikasi pemuliabiakan ternak di lapangan. jakarta: gramedia widiasarana indonesia. haruna, i.l., s. a hadebe, o. j oladosu, g. mahmoud, h. zhou and j. g h hickford. 2020. identification of novel nucleotide sequence variations in an extended region of the bovine leptin gen (lep) across a variety of cattle breeds from new zealand and nigeria. arch anim breed. 63(2):241248. https://doi.org/10.5194/aab-63-2412020 javanmard, a., m.r. mohammadabadi, g.e. zarrigabayi, a.a. gharahedaghi, m.r. nassiry, a. javadmansh and n. asadzadeh. 2008. polymorphism within the intron region of the bovine leptin gene in iranian sarabi cattle (iranian bos taurus). russ. j. genet. 44:495-497. https://doi.org/10.1134/ s1022795408040169 komar, a.a. 2007. silent snps: impact on gene function and phenotype. pharmacogenomics. 8(8):1075-1080. https:// doi.org/10.2217/14622416.8.8.1075 kulig, h. and m. kmieć. 2009. association between leptin gene polymorphisms and growth traits in limousin cattle. russ. j. genet. 45:738-741. https://doi.org/10.1134/ s1022795409060131 lee, s., k. simon, z. weng and c.r. cantor. 2008. quantitative analysis of single nucleotide polymorphisms within copy number variation. plos one. 3(12):1-10. https:// doi.org/10.1371/journal.pone.0003906 maskur, r. and c. arman. 2014. association of a novel single nucleotide polymorphism in ghr gene with production traits in bali cattle. ital. j. anim. sci. 13:841-844. https://doi.org/10.4081/ijas.2014.3461 mayr, c. 2019. what are 3’utrs doing?. cold spring harb. perspect. biol. 11(10):1-15. https://doi.org/10.1101/ cshperspect.a034728 mohamad, k., m. olsson, g. andersson, b. purwantara, hta.v. tol, h. rodriguezmartinez, b. colenbrander and ja. lenstra. 2011. the origin of indonesian cattle and conservation genetics of the bali cattle breed. reprod. domest. anim. 47:1-4. https://doi.org/10.1111/j.1439 https://doi.org/10.13057/biodiv/d210129 https://doi.org/10.13057/biodiv/d210129 https://doi.org/10.3389/fgene.2012.00055 https://doi.org/10.3389/fgene.2012.00055 molecular markers on the leptin gene in bali cattle (t. kurlyana et al.) 9 0531.2011.01960.x moussavi, a.h., m. ahouei, m.r. nassiry and a. javadmanesh. 2006. association of leptin polymorphism with production, reproduction, and plasma glucose level in iranian holstein cows. asian-australasian j. anim. sci. 19: 627-631. https://doi.org/10.5713/ ajas.2006.627 nugroho, t., t.s.m. widi and d. maharani. 2022. the potency of leptin gene as a selection marker of economic traits for madura cattle: preliminary study. yogyakarta, indonesia: proceedings of 9 th international seminar on tropical animal production (istap); 2021. purwantara, b., r. noor, g. andersson and h. rodriguez-martinez. 2012. banteng and bali cattle in indonesia: status and forecasts. reprod. domest. anim. 47:2-6. http:// dx.doi.org/10.1111/j.14390531.2011.01956.x putra, w.p.b. and p.p. agung. 2020. novel single nucleotide polymorphisms (snps) in intron 2 and exon 3 region of leptin gene in sumba ongole cattle. iran. j. appl. anim. sci. 10(2):241-247. tambasco, d.d., c.c.p. paz, m. tambascostudart, a.p. pereira, m.m. alencar, a.r. freitas, l.l. coutinho, i.u. packer and l.c.a. regitano. 2003. candidate genes for growth traits in beef cattle crosses bos taurus x bos indicus. j. anim. breed. genet. 120(1):51-56. https://doi.org/10.1046/j.1439 -0388.2003.00371.x trakovická, a., n. moravčíková and r. kasarda. 2013. genetic polymorphisms of leptin and leptin receptor genes in relation with production and reproduction traits in cattle. acta biochim. pol. 60(4):783-787. pmid: 24432332. j i t a a journal of the indonesian tropical animal agriculture accredited by ditjen penguatan risbang no. 60/e/kpt/2016 j. indonesian trop. anim. agric. pissn 2087-8273 eissn 2460-6278 http://ejournal.undip.ac.id/index.php/jitaa 45(3):243-249, september 2020 doi: 10.14710/jitaa.45.3.243-249 utilization of electronic marketing and economic determinants to improve income of dairy cattle farmer in boyolali, central java indonesia a. setiadi*, s. i. santoso, m. mukson, s. nurfadillah and k. prayoga agribusiness department, faculty of animal and agricultural sciences, diponegoro university, tembalang campus, semarang 50275 indonesia *corresponding e-mail: agus_setiadi2006@yahoo.co.id received march 17, 2020; accepted may 26, 2020 abstrak penelitian ini bertujuan untuk menganalisis dampak pemanfaatan pemasaran elektronik dan mengetahui faktor-faktor penentu ekonomi untuk meningkatkan pendapatan peternak sapi perah di boyolali, jawa tengah indonesia. survei dilakukan terhadap 80 peternak sapi perah dari kecamatan cepogo, boyolali yang ditentukan dengan simple random sampling. hasil penelitian menunjukkan ratarata produksi susu adalah 8,3 liter/ekor/hari, penerimaan sebesar rp 4.414.000 per bulan, biaya produksi rp 2.105.000 per bulan, dan pendapatan sebesar rp 2.309.000 per bulan. selanjutnya dengan memanfaatkan elektronik, peternak dapat menjual 40% produknya ke kedai kopi dan menghasilkan penerimaan rp 5.411.500, biaya produksi rp 2.705.000 dan pendapatan rp 2.706.500. pemanfaatan pemasaran elektronik dapat meningkatkan r/c dari 2,1 menjadi 2,43. faktor-faktor ekonomi yang mempengaruhi pendapatan adalah harga pasar, biaya transportasi dan komunikasi, biaya pemasaran dan jarak tempuh. berdasarkan hasil penelitian dapat disimpulkan bahwa pemanfaatan pasar elektronik dapat memperluas pasar, meningkatkan harga susu dan akhirnya akan meningkatkan pendapatan. kata kunci : faktor ekonomi, pendapatan, pemasaran elektronik, sapi perah, susu abstract this study aimed to analyze the impact of electronic marketing utilization and to determine the economic determinants to increase the income of small dairy farmers in boyolali, central java, indonesia. a survey of 80 dairy farmers from the cepogo district, boyolali was determined by simple random sampling. the results showed that the average milk production was 8.3 liters/head/day, the revenue of idr 3,824,000 per month, production costs of idr 2,105,000 per month, and income of idr 1,719,000 per month. furthermore, by using electronics marketing, farmers could sell 40% of their products to coffee shops and generate revenue of idr 5,411,500, production costs of idr 2,705,000 and income of idr 2,706,500. the utilization of the electronic marketing could increase r/c from 2.1 to 2.43. economic factors that influence income are market prices, transportation and communication costs, marketing costs and distance traveled. based on the results of the study it can be concluded that the use of the electronic market can expand the market, increase milk prices and ultimately will increase income keywords: dairy cattle, economic factors, electronic marketing, income, milk utilization of electronic marketing (a. setiadi et al.) 243 introduction milk is one of the important livestock commodities in indonesia. because of the milk demand is greater than its supply, the indonesian government still import milk from other countries such as from new zealand and australia. in indonesia, the purpose of dairy cattle raised to produce fresh milk. setianti et al. (2017) stated dairy cattle in indonesia only produce fresh milk less than 10 liters/heads/day. further, setianti et al. stated milk production was influenced by number lactation cow, quality and quantity of milk, and price decided by cooperative and milk processing industry. while the problems faced by dairy cattle farmers in boyolali are lack of market accessibility and low milk quality. the milk processing industry has a dominant position to decide the milk market price. in boyolali, the dairy cattle business is done by farmers to add their income besides the main business as a crop farmer. dairy cattle farmers sell milk through direct marketing. dairy cattle farmers usually sell fresh milk to the cooperative around their area. dairy cattle farmers have not utilized yet the electronic market. utilization technology could increase marketing effectiveness (bahera et al., 2015). the research focused on dairy cattle income in indonesia was done by some researchers (dolewikou et al., 2016; setianti et al., 2017; haloho et al., 2013). setianti et al. (2017) stated that dairy cattle farms have an advantage for a farmer to give additional income besides the income from a crop farmer. in central java, usually, dairy cattle farmers raise 2-3 heads of dairy cattle. farmer raise dairy cattle use traditional technology, so milk production is low and the milk quality is poor. they sell fresh milk to the cooperative at a low price. the utilization of electronic marketing will able to increase income because farmers can access other markets that have higher price (baumuller, 2018; gillespie et al., 2007; larsen and gilliand, 2009). utlization of industry 4.0 to market milk is needed. some researches were done using industry 4.0 on agricultural sector (depeyrot and duval (2018); larsen and gilliland (2009); koirala et al. (2019); roy et al. (2019) and ordolff (2001)). khana et al. (2019) stated utilization technology could improve food processing. studman (2001) stated the internet can be used in many things, such as marketing. rupnik et al. (2019) stated industry 4.0 could be applied to agricultural activity. kim et al. (2019) stated industry 4.0 was applied in mastitis detection. improving marketing technology can improve the market price. application of industry 4.0 in innovation technology would improve business efficiency (annosi et al. (2019), lezoche et al. (2020) and frank et al. (2019)). industry 4.0 could solve the production, innovation, financial and marketing as well (lezoche et al., 2020) electronic marketing using internet was done by some researchers (mathews et al. (2015), and m’kwiriga and imaita (2018)). further m’kwiriga and imaita (2018). stated utilization electronic marketing would increase market price and improve market efficiency. up to present many coffee shop growths in boyolali regency follow the lifestyle of young generation. the electronic market is still not utilized yet by the farmer. almost all dairy cattle farmers in boyolali still utilized traditional marketing strategy, dairy cattle farmer still not used yet internet, whatsapp, etc to market their fresh market, so the research which investigated the scenario of utilization electronic marketing to increase their income is needed. the objectives of the study were to analyze the impact of electronic marketing utilization and to determine the economic determinants to increase the income of small dairy farmers in boyolali, central java, indonesia. materials and methods the survey method was used in the study. eighty (80) dairy farmers were chosen as the respondent by simple random sampling. the study was conducted in cepogo district, boyolali. the district was chosen because this district has the highest milk production (9,565,219 liters/year) in boyolali regency compared to other districts. the primary data was collected through direct interviews with the farmer and data were observed in the field. revenue, cost of production and income were computed in this study. the feasibility was projected if the electronic marketing is applied. if farmers use electronic marketing, they can sell 40% of their products to coffee shops and 60% of products will be sold to cooperative. the coffee shop would order fresh milk using electronic devices like cellular phone and the farmer would deliver the milk. when the farmer sold fresh milk to the cooperative they got idr 5,000/liter but if they sell the fresh milk to the coffee shop in boyolali district they will get 244 j.indonesian trop.anim.agric. 45(3):243-249, september 2020 idr 8,000/liter. income was calculated based on the formula of septiani et al. (2017): tr = py x y tc = tfc + tvc π = tr – tc where tr is the total of dairy farmer revenue (idr/month), tc is the cost total of dairy farmer (idr/month), π is income (idr/month), tfc is total fixed cost (idr/month), py is the output price (idr/month), y is the total of the output (liter/month) and tvc is the total of variable cost (idr/month) return/cost ratio return cost (r/c ratio) was calculated based on the formula of septiani et al. (2017): r/c on total cost = (total revenue)/(total cost) = tr/(tc) assessment criteria were: a. if the value of r/c ratio> 1 then, dairy cattle business is feasible. b. if the value of r/c ratio <1 then the dairy cattle business is not feasible. c. if the r / c ratio = 1 then the farm is said to break even point (bep) regression analysis was determine to effect of economic factor on dairy cattle farmer income. y = a + b1x1+ b2x2+b3x3+b4x4+e where y = income (idr/month), a = constant, b1, b2, b3, b4 = regression coefficients, x1 = market price (idr/liter), x2= transportation and communication cost (idr/month), x3 = labor cost (idr/month), x4 = market distance (km), and e = error results and discussion characteristic of dairy cattle farmers the age of respondents (40-50 years) was 20%, respondents age 50-60 years were 80 %. the young generation less interested to do dairy cattle business, because of low income was obtained. the lactation cow owned by them is 3 heads on average. the milk production was 8,3 liters/cow/day. up to present all of farmers still sold fresh milk to the cepogo cooperative (table 1). the milk price was idr 5,000 per liters but if the coffee shop bought fresh milk, they paid idr 8,000 per liter. some coffee shop is developed in boyolali urban area, this coffee shop needs milk supply from the dairy cattle farmer. the distance between dairy cattle center and boyolali urban was around 15 km. dairy farmers still market fresh milk traditionally, they brought to the cooperative. cost of production variable cost consists of feed concentrate cost, artificial insemination cost, vitamin cost, grass feed cost, and labor cost feed concentrate cost was the highest number (34.44%) as shown in table 2. labor cost was computed as 28.50 % of the total production cost. the farmers usually fed concentrate feed to cattle every day. the concentrate of feed related with milk production. nutrient availability tends to produce good milk in quantity as well as quality. in agreement with septiani et al. (2017) feed cost was the highest cost in the dairy cattle business. efforts to looking for low-cost feed were needed to decrease the production cost. revenue it can be seen in table 3, revenue comes from selling milk, selling young dairy cattle and the gain of cattle. revenue from selling milk per month was idr 2,490,000, revenue from selling calf was idr 950,000 per head and the gain of cattle was idr 974,000. the revenue of dairy cattle farmers in boyolali is greater than revenue dairy cattle farmers in semarang regency which reported by dolewikou et al. (2016). the revenue of dairy cattle farmers in semarang regency was just only idr 4,414,000 per month. the revenue was greater in boyolali because the milk market price in boyolali was higher than in semarang regency. manure not utilized yet as revenue, usually farmer use this for land fertilizer. utilization of electronic marketing (a. setiadi et al.) 245 table 1. socio economic characteristics respondent characteristic number age (year) 54 educational background (%) junior high school 10 senior high school 90 experiences (year) 15 scale of ownership (heads) 3 milk production (liters/cow/day) 8.3 marketing system traditional income as shown in table 4 dairy cattle income per month was 2,309,000 and the r/c ratio was 2.1. this r/c ratio was feasible because it was greater than 1. the r/c ratio 2.1 indicated that every cost spent idr 1,000 could accept revenue idr 2,100. the increasing number of r/c would indicate the farm more efficient. the income mostly comes from milk sold. the increasing number of milk sold would increase the revenue and finally would increase the income. utilization of electronic marketing industry 4.0 was the best strategy to solve the marketing problem in the dairy business. dairy cattle farmers through farmers group using electronic market, they would spend for additional cost, communication and transportation cost. they used whatsapp and facebook to market the product. farmers sold 60% product to cooperative and 40% of product was sold to coffee shop using electronic market so they spent idr 400,000 for communication and transportation cost and the marketing cost was idr 200,000, so the total number of production cost was idr 2,705,000. the production cost if dairy cattle farmers using electronic marketing would increase (table 5). there are additional transportation and communication cost and marketing cost but the milk market price also increased. transportation and communication cost would occur to buy gasoline and quota cellphone. marketing costs would occur to promote milk prices like produced leaflet, etc. revenue dairy cattle farmers accepted revenue was idr 6,555,400, the revenue comes from milk sold, young dairy cattle sold and value-added 246 j.indonesian trop.anim.agric. 45(3):243-249, september 2020 table 2. average cost of production per month no kind of cost cost (idr) percentage (%) 1 variable cost concentrate feed cost 725,000 34.44 artificial insemination cost 62,000 2.95 vitamin cost 30,000 1.43 grass feed cost 200,000 9.50 labor cost 600,000 28.50 2 fixed cost cattle depreciation 300,000 14.25 barn depreciation 178,000 8.46 facility depreciation 10,000 0.48 cost of production total 2,105,000 100.00 table 4. average of income per month no item number (idr) 1 revenue 4,414,000 2 production cost 2,105,000 3 income 2,309,000 r/c 2.10 table 3. average of revenue per month no kind of revenue number (idr) 1 milk sold 2,490,000 2 calf sold 950,000 3 gain of cattle 974,000 total of revenue 4,414,000 cattle (table 6). the increasing market price when the farmers applied the electronic market. the increasing market price when utilized electronic market. the market price was idr 8,000 when using electronic market scenario. this market price would increase revenue. the price would high than the price in dairy cooperative because the coffee shop was the direct consumer. this result in agreement with annosi et al. (2018) and khana et al. (2019) which stated utilization industry 4.0 on marketing strategy would increase the revenue. utilization of industry 4.0 would trigger the farmer to always maintain the quality of the product. income income dairy cattle farmer was 3,850,400 and r/c was 2.4. irissaria et al. (2019) stated the application of industry 4.0 in beef production increased the income (table 7). the utilization of industry 4.0 tends to improve the milk market sold. the r/c ratio increased when the electronic market applied. the study in agreement with hemme et al. (2014), which stated increasing market price would increase the income. the increasing number of r/c ratio showed the scenario using electronic marketing more utilization of electronic marketing (a. setiadi et al.) 247 table 5. average cost of production per month after utilized electronic market no kind of cost number (idr) percentage (%) 1 variable cost feed concentrate cost 725,000 26.80 artificial insemination cost 62,000 2.29 vitamin cost 30,000 1.11 grass feed cost 200,000 7.39 labor cost 600,000 22.18 communication and transportation cost 400,000 14.79 marketing cost 200,000 2 fix cost cattle depreciation 300,000 11.09 barn depreciation 178,000 6.58 facility depreciation 10,000 0.37 cost of production total 2,705,000 100.00 table 6. average of revenue per month after utilized electronic market no kind of revenue number (idr) 1 milk sold 4,631,400 2 calf sold 950,000 3 value added of cattle 974,000 total of revenue 6,555,400 table 7. average of income per month after utilized electronic market no item number (idr) 1 revenue 5,411,500 2 production cost 2,705,000 3 income 3,850,400 r/c ratio 2.3 effectively. this result in agreement with koirala et al. (2019) utilization of computers on agriculture would increase the farmer income, utilization of industry 4.0 would produce effective cost and finally would increase the income. economic determinants as shown in table 8, using regression analysis to determine economic factors that influenced the income after utilized electronic marketing. market price, transportation and communication cost, labor cost and market distance influenced the income significantly (p<0.05). increasing market price would improve the income when farmer applied electronic marketing. the application of electronic marketing would increase transportation and communication cost and labor cost. increasing market distance would decrease the income, the furthest market distance from the farmer location was 15 km. economic determinant showed to keep the market price still high, dairy cattle farmer should maintain the milk quality. setianti et al. (2017) stated milk quality was an important factor that influenced the market price. this result in agreement with mathews et al. (2016) that stated increasing market price tends to increase the income. increasing market price also triggered producers to supply more number of the product to the market. conclusion utilization industry 4.0 in dairy cattle business would solve the marketing problem of dairy cattle farmer. utilization of electronic market leads to increasing the income from idr 2,309,000 to idr 3,850,400. r/c ratio was increased from 2.1 to 2.4. scenario using the electronic market would increase the production cost. the revenue would increase because using this scenario would increase the milk market price from idr 5,000 to idr 8,000. utilization of electronic market would efficiently increase the income. the factors influencing the income were market price, transportation and communication cost, labor cost and market distance. references annosi, m.c., f. brunetta., a. monti and f. nati. 2018. is the trend your friend? an analysis of technology 4.0 investment decision in agricultural smes. computers in industry. 109(4): 59-71. baumuller, h. 2017. the little we know: an explanatory literature review on the utility of moble phone-enabled services for smallholder farmers. j. int. dev. 30(1): 134-154. depeyrot, j.n. and m. duval. 2018. global dairy trade, an electronic marketing platform from new zealand: what opportunities for global dairy markets? economie rurale. 2(364): 31-54. dolewikou, r.l., w. sumekar and a. setiadi.2016. the profitability analysis of dairy cattle business on the group of dairy farmers in west ungaran district, semarang regency. j. indonesian trop. anim. agric. 41(4): 216-223. frank, a.g., l.s. dalenogare and n.f. ayala. 2019. industry 4.0 technologies: implementation patterns in manufacturing companies. int. j. prod. econ. 210(1):1526. gillespie, g., d.l. hilchey, c.c. hinrichs and g. feenstra. 2007. farmers’ markets as 248 j.indonesian trop.anim.agric. 45(3):243-249, september 2020 table 8. economic determinants of utilization electronic market no items coefficients se p values 1 constant -7880.5 0.45 0.003 2 market price 345 0.98 0.002 3 transportation and communication cost 300 0.23 0.004 4 marketing cost 450 0.46 0.004 5 market distance -500 0.06 0.000 keystones in rebuilding local and regional food systems. remarking the north american food system: strategies for sustainability, university of nebraska press, lincoln pp. 65-83. haloho, r.d., s.i. santoso, s. marzuki, w. roessali and a. setiadi. 2013. profit function analysis of dairy cattle farming in getasan and west ungaran districts, semarang regency. j. indonesian trop. anim. agric. 38(2): 116-122. hemme, t., m.m. uddin and o.a. ndambi. 2014. benchmarking cost of milk production in 46 countries. j. rev. global econ. 3(2): 254-270. irisarria, j.g., j.d. dernerb, j. p. rittenc and d. e. peck. 2019. beef production and net revenue variability from grazing systems on semiarid grasslands of north america. livest. sci. 220(2): 93–99. khana, z.k., a. khalidb and j. iqbal. 2019. towards realizing robotic potential in future intelligent food manufacturing system. innovative food science and emerging technologies 48 (4): 11–24. kim, h., y. min and b. choi. 2019. real-time temperature monitoring for the early detection of mastitis in dairy cattle: methods and case researches. computers elect. agric. 169(4): 122-130. koirala, a., k.b. walsha., z.wanga and c. mccarth. 2019. deep learning–method overview andre view of use for fruit detection and yield estimation. computers elect. agric. 162(8): 219–234. larsen, k and j. gilliland. 2009. a farmers’ market in food desert: evaluating impacts on the price and availability of healthy food. health place. 4(9): 1158-1162. lezoche, m., j.e. hernandez and m.m. e.a. diaz. 2020. agri-food 4.0: a survey of the supply chains and technologies for the future agriculture. computers in industry 117(10): 1-14. mathews, s., c. bianchi., k. j. perks., m. healy and r. wickramasekera. 2016. internet marketing capabilities and international market growth. int. business review. 25(4): 820–830 m’kwiriga, m.g. and i. imaita. 2018. factors influencing adoption of e-marketing on dairy products in meru: a cas of meru dairy cooperative union, kenya. int. academic j. human res. business administration. 3(3): 100-119. ordolff. 2001. introduction of electonics into milking technology. computer and electronics in agriculture 30(3): 125-149. roy, p., a. k. islaya., p. a. plonskia and j. l. v. isler. 2019. visionbased preharvest yield mapping for apple orchards. computers elect. agric. 18(8): 36-43. rupnik, r., m. kukar, p. vračar, d. košir, d. pevec and z. bosnić. 2019. agrodss: a decision support system for agriculture and farming. computers elect. agric. 161(9): 260–271. septiani, w., marimin, y. herdiyeni and l. haditjaroko. 2017. risk based milk pricing model at dairy farmers level. media peternakan 40(3): 218-227. setianti, c., t. ekowati and a. setiadi. 2017. market integration of fresh milk in dairy business area of pamijahan district and cisarua district, bogor regency-indonesia. j. indonesian trop. anim. agric. 42(1):4247. utilization of electronic marketing (a. setiadi et al.) 249 j i t a a journal of the indonesian tropical animal agriculture accredited by ditjen penguatan risbang no. 60/e/kpt/2016 j. indonesian trop. anim. agric. pissn 2087-8273 eissn 2460-6278 http://ejournal.undip.ac.id/index.php/jitaa 44(2):187-194, june 2019 doi:10.14710/jitaa.44.2.187-194 egg quality and isoflavone deposition due to dietary inclusion of isoflavone soy sauce by-product (issbp) in laying hens a. malik1,2, e. suprijatna3, v. d. yunianto3, l. d. mahfudz3,* and n. suthama3 1graduate program in animal science, faculty of animal and agricultural sciences, diponegoro university, tembalang campus, semarang 50275 indonesia. 2permanent address: faculty of agriculture and animal husbandry, university of muhammadiyah malang, karangploso, malang 65152 – indonesia 3faculty of animal and agricultural sciences, diponegoro university, tembalang campus, semarang 50275 indonesia. .*corresponding e-mail: inditik@yahoo.com received march 24, 2018; accepted april 23, 2019 abstrak penelitian bertujuan untuk mengkaji kualitas dan deposisi isoflavon dalam telur akibat penggunaan isoflavon ampas kecap dalam ransum ayam petelur. ternak percobaan adalah 480 ayam petelur isa brown betina umur 20 minggu dengan bobot awal 1.754 ± 42 g. penelitian disusun dalam rancangan acak lengkap (ral) dengan 4 perlakuan dan 6 ulangan, terdapat 24 unit percobaan masing-masing berisi 20 ekor ayam. perlakuan penggunaan level isoflavon ampas kecap (isoflavone soy sauce byproduct / issbp) dalam ransum sebagai berikut: issbp0 = tanpa isoflavon, issbp40 = 40 mg/100 g, issbp80 = 80 mg/100 g, dan issbp120 = 120 mg/100 g. ransum perlakuan diberikan selama 10 minggu mulai umur 20 minggu sampai umur 30 minggu. parameter yang diamati meliputi kolesterol telur, dan isomir isoflavon dalam ransum, darah dan telur. data total kolesterol dan isoflavon telur dianalisis statistik dan isomer isoflavon pada pakan ransum, darah dan telur dievaluasi secara dekriptif. hasil penelitian menunjukkan bahwa penggunaan isoflavon dari ampas kecap dalam ransum nyata (p<0,05) menurunkan kandungan kolesterol telur. kolesterol total telur menurun (p<0,05) sampai 33,8%, tetapi isoflavon dalam kuning telur (28,9 mg/g protein) lebih tinggi (p<0,05) dari pada yang di dalam darah (13,75 mg). kualitas isoflavon dalam kuning telur lebih baik karena mengandung lebih banyak aglikons (87,5%), dibandingkan dengan yang ada dalam ransum (52%) dan darah (68,4%). kesimpulan, penggunaan isoflavon ampas kecap dalam ransum ayam petelur dapat menurunkan kolesterol dan meningkatkan kandungan isoflavon pada kuning telur dengan kualitas yang lebih baik, sehingga telur dapat berfungsi sebagai makanan fungsional. kata kunci: ampas kecap, ayam petelur, isoflavon, kolesterol, telur fungsional abstract the objective of the study was to evaluate the quality and deposition of isoflavones in the egg due to dietary inclusion of isoflavone soy sauce by-product (issbp) in laying hens. experimental animals were 480 birds of 20-week old laying hens of isa brown strain, with initial body weight of 1,754 ± 42 g. the experiment was arranged in a completely randomized design (crd), with four treatments and six replications (20 birds each). the treatments were dietary inclusion levels of isoflavone soy sauce byproduct as follows: issbp0 = without isoflavones, issbp40 = 40 mg/100g, issbp80 = 80 mg/100g, isoflavone soy sauce by-product (issbp) for laying hens (a. malik et al.) 187 and issbp120 = 120 mg/100 g feed. dietary treatments were given for 10 weeks from week 20 until 30week old. parameters observed were egg cholesterol and isoflavone isomers in feed, blood, and eggs. data of total cholesterol and isoflavone in the egg were statistically analysed and isoflavone isomer concentration in feed, blood, and egg were descriptively described. the results showed that feeding issbp significantly (p <0.05) decreased cholesterol and increased isoflavones in egg. total cholesterol content in egg decreased up to 33.8%. however, isoflavones in the yolk were higher (28.9 mg/g) than those in blood (13.75 mg/g), and those deposited into the yolks indicated better quality because containing more aglicons isomers (87.5%), than those in feed (52%) and blood (68.4%). in conclusion, dietary inclusion of issbp to laying hens’s decreased cholesterol content and increased isoflavones deposition into the egg with better quality, so that the eggs can function as functional food. keywords: soy sauce by-product, laying hen, cholesterol, isoflavones, functional egg introduction poultry is known to have excellent bioconvertion properties, such as the ability to convert feed components into a good food, egg or meat, and is beneficial for human growth and health. therefore, egg could be designed to improve the nutritional compounds to become a functional food that is beneficial for humans. isoflavones in addition to functioning as antioxidants (akdemir and sahin, 2009; yang et al., 2011; ni et al., 2012) and phytoestrogens (ni et al., 2012; shi et al., 2013; elkomy and elghalid, 2014), they could also be used to improve the quality of poultry meat (jiang et al., 2014), and egg production (cai et al. 2013; gu et al., 2013). isoflavone could be transferred into the tissues of meat and eggs that is beneficial for human health (markovic et al., 2015). research on feeding isoflavone from soy sauce by-product [issbp] to laying chicken in term of its deposition in egg and its quality has never been previously elucidated. this study is important for clarifying isoflavone soy sauce byproduct that has many advantages over other types of isoflavones as well as higher aglycone content. soybean has glycoside content of 97.33%, while aglycon was only 2.67%, but after fermentation for 48 hours glycoside content decreased to 24.49% while aglycon increased to 75.51% (silva et al., 2011). increased isoplavone and active peptide aglycons have more health benefits (hong et al., 2011). the present study was conducted to evaluate feeding effect of issbp in laying chicken in relation to total cholesterol content and isoflavone deposition in yolk. the results of this study are expected to provide a new information concerning the development of poultry nutrition and feeding to produce the designed-egg rich in isoflavon antioxidant as functional food. materials and methods experimental animal and diet experimental animals were 20-week old of 480 laying hens of isa brown strain with initial body weight of 1,754 ± 42 g, and were placed randomly in battery cages. feed was composed of corn gluten meal, distillery dried grain with soluble, fish meal, meat bone meal, yellow corn, rice bran, vegetable oil, oyster shell, methionine and soy sauce by-product. the composition and nutrients content of experimental feed is presnted in table 1. experimental prosedures the present research was conducted by experimental method, using completely randomized design, with 4 treatments and 6 replications with 20 birds each. inclusion levels of soy sauce by-product were created as dietary treatment as follows: issbp0 : control feed without isoflavon soy sauce by-product (issbp) issbp40 : feed contains issbp 40 mg/100 g; or equal to5.8% soy sauce byproduct issbp80 : feed contains issbp 80 mg/100 g; or equal to 11.6% soy sauce by-product issbpp120 feed contains issbp 120 mg/100 g; or equal to 17.4% soy sauce by-product parameters observed were cholesterol and the distribution of isoflavone isomers in feed, blood and eggs. sampling method and analysis after the chickens were provided dietary treatment for 10 weeks, 2.5 ml blood sample was 188 j.indonesian trop.anim.agric. 44(2):187-194, june 2019 taken on day 70 from one bird in each replication. blood was taken through the veins of the wings, and collected in edta-containing test tube for isoflavones analysis. isoflavones in egg was determined in a mixture sampels of egg white and yolk. quantitative analysis of isoflavones was performed using high performance liquid chromatography (hplc) according to the modified procedure of harborne (1992), and total cholesterol analysis based on the method of kleiner and dotti (1962). one egg was taken from each replication unit. statistical analysis data of total cholesterol, and isoflavone isomer in the egg were statistically analysed by analysis of variance and were continued to least significant different (lsd) test (steel and torrie, 1991). isoflavone isomer concentration in feed, blood, and egg were descriptively analyzed. results and discussion isoflavones profiles in feed, blood and eggs feeding isoflavones soy sauce by-product isoflavone soy sauce by-product (issbp) for laying hens (a. malik et al.) 189 table 1. feed ingredient composition and nutrition content of experimental feed ingredient isoflavone inclusion level (mg/100g) issbp0* issbp40 issbp80 issbp120 feed composition (%) yellow corn 46.00 44.80 45.60 45.60 rice bran 19.80 18.70 15.90 13.70 corn gluten meal 11.00 10.00 9.10 8.50 distellers dried grain with solubles 9.00 7.10 5.00 2.00 meat bone meal 6.10 5.00 4.00 3.00 fish meal 4.00 4.00 4.00 4.00 vegetable oil 0.00 0.80 1.20 1.70 oyster shell 4.00 3.80 4.00 4.00 methionine 0.07 0.06 0.05 0.04 soy sauce by-product 0.00 5.80 11.60 17.40 total 100.00 100.00 100.00 100.00 nutrition content** metabolizable energy (kcal/kg)*** 2.949.72 2.949.61 2.949.66 2.949.71 protein (%) 17.93 17.96 18.01 18.03 ether extract (%) 6.32 6.75 6.76 6.86 crude fiber (%) 3.19 3.15 3.01 2.91 cacium (%) 2.37 2.22 2.22 2.15 phosphorus total (%) 0.75 0.71 0.66 0.60 lysine (%) 0.66 0.66 0.67 0.67 methionine (%) 0.36 0.36 0.36 0.36 isoflavone (mg/100g) 0.00 40.00 80.00 120.00 *issbp0 = feed without isoflavones **based on the laboratory analysis value of respective ingredients used for feed composition *** calculated based on the formula of carpenter and clegg (1965) (issbp) indicated different effect on the isoflavones profiles in feed, blood, and eggs. isoflavones analysis in feed, blood and eggs indicated varied content as presented in table 2. results of the present study suggested that the transportation of isoflavones depending on the feed provided, and some interesting findings were found. first, in blood and egg samples of treatment without issbp inclusion (0 mg) did not find isoflavones at all either in whole form or isomers (table 2, and figure 1). control feed (issbp0) did not composed of ingredients derived from the type of beans in general or soybean meal in particular, as the source of isoflavones. second, in the contrary, isoflavones content in eggs yolk dramatically revealed the increasing values when the birds were given dietary inclusion of issbp (issbp40 until issbp120), even the treatments of feeding issbp at 80 mg/100g (issbp80) resulted significantly highest value both in whole form as well as in its isomers. egg cholesterol total cholesterol in egg was significantly (p<0.05) decreased due to dietary inclusion of issbp. the highest cholesterol content of egg was found in group of laying hens provided control feed (table 2 and figure 2). when compared to control group (issbp0), feeding issbp40, issbp80, and issbp120 decreased egg cholesterol by 22.8, 33.8, and 29.9%, respectively. this condition indicated that issbpp was 190 j.indonesian trop.anim.agric. 44(2):187-194, june 2019 figure 1. isoflavone in feed, blood and yolk. table 2. effect of feeding issbpp on cholesterol and isoflavones of egg yolk variable isoflavon inclusion level (mg/100g) issbp0* issbp40 issbp80 issbp120 cholesterol (mg/g) 12.70 ± 0.4a 9.80 ± 0.3b 8.40 ± 0.2c 8.90 ± 0.2c isoflavone (mg/g) nd 28.80 ± 0.9b 33.40 ± 1.1a 24.50 ± 0.8c glycoside isomers (%) nd 12.37 ± 0.4b 14.35 ± 0.5a 10.18 ± 0.3c aglycone isomers (%) nd 87.03 ± 1.8b 85.65 ± 1.7c 89.82 ± 1.9a a-cmean values with different superscripts within the same row differ significantly (p<0.05) *= diet without isovlanes; nd = not detected effective in reducing egg cholesterol content of laying hens. the effectiveness of issbp in lowering the levels of egg cholesterol is closely related to the function of isoflavones as phytoestrogens. isoflavones derived from soybean in general serve as phytoestrogens source which are known to have weak estrogenic hormone activity due to their structure is similar to βestradiol. they can preferentially bind to estrogen receptor and mimicking the effects of estrogen in some tissues in one side, and blocking the effects of estrogen in other side. due to its mode of action as eye scissors in which estrogenic effects in other tissues could help to maintain bone mineral density and improved egg production and shell quality (markovic et al., 2015). on the other hand, because of their estrogenic blocking effects could improved blood lipid profiles and attributable to an impact on the decreased egg cholesterol found in the present study. biochemical mechanism can be explained from the antagonistic activity of phytoestrogenes to depress endogenous estrogen produced by the developing follicle of the hens. this lead to the suppression of activity of hmg-coa reductase enzyme which brought about the inhibition of cholesterol biosynthesis activity, consequently fewer endogenous cholesterol transported into the ovaries, but more were excreted through feces and urine (könig et al., 2007; vakili and heravi, 2016). isoflavone deposition in eggs providing feed containing issbp significantly (p<0.05) increased yolk isoflavone content with the highest value was in issbp80 treatment, while hens fed control feed produced eggs without isoflavones. this phenomenon suggested that issbp in the feed can be transferred into the yolk depending on the level. this result was consistent with the report of lin et al. (2004) who indicated that isoflavone genestein supplementation in quail feed increased the content of isoflavones in the yolk.the transportation mechanism of isoflavones into egg yolk have been clarified in connection with their changed into a conjugated form (saitoh et al., 2004). isoflavones were predicted to reduce by 30% during metabolism and approximately 70% were deposited into egg yolk in a conjugated form. isoflavones changed to a conjugated form, a soluble isoflavones, causing it much easier to be transfered into egg yolk. previous studies (akdemir and sahin, 2009; lin et al., 2004) reported that isoflavone in egg yolk of quail increased due to dietary supplementation of soy isoflavones because the presence of genistein isomer form can be easier to be transferred into the yolk (saitoh et al., 2004).this mechanism was likely seem to that of phytoestrogenes of issbp stimulated the liver to produce neutral fats and phospholipids to function as carrying substances. therefore, conjugated form is absolutely possible to be constructed and carried by the blood into the ovaries for egg yolks formation. the deposition rate of isoflavones in egg yolk which is mostly in the form of aglycone, was 87.6, 85.7, and 89.8% in issbp40, issbp80 and issbp120 treatments, respectively, and the remainder were isoflavones glycosides (figure 3). isoflavone soy sauce by-product (issbp) for laying hens (a. malik et al.) 191 figure 2. cholesterol and isoflavone in yolk http://lpi.oregonstate.edu/mic/glossary#estrogen javascript:; javascript:; http://lpi.oregonstate.edu/mic/glossary#lipid http://lpi.oregonstate.edu/mic/glossary#bone-mineral-density http://lpi.oregonstate.edu/mic/glossary#bone-mineral-density a very high percentage of aglycone content in yolk when compared to isoflavones glycosides is assumed to be attributable to three factors. first, isoflavones in feed consisted of more aglycone around 54.21%, while glycoside only 12.21%, from total isoflavones content. second, biotransformation process occured in the digestive tract brought about the change in glycoside into aglycone form. third, isoflavones in the form of aglycone have higher absorptive rate than those in the form of glycosides. high aglycone concentration in egg yolk found in the present study is supported by the finding of sanz and luyten (2006) that the average absortive rate of aglycone (daidzein and genistein) was 83.5% while that of glycosides (daizine and genestin) was only 60%. isoflavones underwent a series of biotransformation process indicated by the difference in the number and composition of isoflavone isomers among feed, blood, and yolk (figure 1). the presence of isoflavones in feed were in four forms, namely glycosides, aglycons, malonilglycosides, and acetylglycosides, whereas in the blood and egg yolk only isoflavone glycosides (genistin and daidzin) and aglycons (genetein and daidzain). the form of isoflavones in the blood was 68.36% the type of aglycons 192 j.indonesian trop.anim.agric. 44(2):187-194, june 2019 figure 3. isofalvones of glycoside and aglycone in yolk figure 4. isoflavone isomer in feed, blood and yolk (genistein 31.27% and daidzein 37.09%) and that in egg yolk was equal to 87.45% (genistein 41.19% and daidzein 46.26%), these concentrations were higher than that in feed was 49.52% (genistein 25.08% and daidzein 18.25% (figure 4). while isoflavones in the digestive tract, they still underwent biotransformation process (turner et al., 2004) that could change their form of malonilglycosides and acetylglycosides into glycosides and aglycons. this transformation occurs due to the fermentation process under the influence of βglycosidase enzyme produced by intestinal microorganism. similar phenomenon indicated that the glicitein isomer and its derivatives could be changed into other forms during the transformation process underwent in the chicken's body. glicitin isomer and its derivatives were the most easily transformed group of isomers, during the processing of soybeans into soy sauce, and the change was also occured during transit time in the small intestine due to transformation. conclusion dietary inclusion of isoflavones soy sauce by-product (issbp) in laying hens, produce lower egg cholesterol content and rich in isoflavones dominated by aglycone, so that the eggs can function as functional food. references akdemir, f. and k. sahin. 2009. genistein supplementation to the quail: effects on egg production and egg yolk genistein, daidzein, and lipid peroxidation levels. poultry sci. 88(10):2125-2131. cai, j., h. gu, s. shi and h. tong, 2013. effects of high-dose daidzein on laying performance, egg quality and antioxidation in laying hens. poultry sci. 50: 237-241. carpenter, k.j. and k.m. clegg. 1965. the metabolizable energy of poultry feeding stuffs in relation to their chemical composition. j. sci. food agric.7(1): 45-51. elkomy, a.e. and o.a. elghalid. 2014. physiological performance of broiler chicks fed on medicago sativa seeds as natural source of isoflavones. asian j. poult. sci. 8(4): 97-105. gu, h., s.r. shi, l.l. chang, z.y. wang, h.b.tong and j.m. zou. 2013. safety evaluation of daidzein in laying hens: part ii. effecs on calcium-related metabolism. food chem. toxicol. 55:689-692. harborne, j.b. 1996. the flavonoid : advances in research since 1986. london : chapman & hall, inc. hong, y, g. jin, d. ren, s. luo and t. zhou. 2011. mechanism of isoflavone aglycone’s effect on cognitive performance of senescence-accelerated mice. brain cognit.76:206-2010. jiang, s.q., j.z. jiang, g.l. zhou, y.c.lin and c.t. zheng. 2014. effects of dietary isoflavone supplementation on meat quality and oxidative stability during storage in lingnan yellow broilers. j. integr. agric. 13(2):387-393. kleiner, i.s and i.b. dotti. 1962. laboratory instruction in biochemistry. ed 6th mosby, new york. könig, b., h. kluge, k. haase, c. brandsch, g. i. stangl, and k. eder. 2007. effects of clofibrate treatment in laying hens. poult. sci. 86(6):1187-1195. lin, f.j. wu, m. abdelnabi, m. ottinger, and m.m. giusti. 2004. effects of dose and glycosylation on the transfer of genestin into the eggs of japanese quail (coturnix japonica).j. agric. food chem. 52(8): 2397–2403. markovic, r., m.z. baltic, m. pavlovic, m. glisic, s. radulovic, v. djordjevic, and d. sefer. 2015. isoflavones from biotechnology to functional foods. procedia food sci. 5:176-179. ni, y.d., j. wu, h.y. tong, y.b. huang, l.z. lu, r.gosmann and r.q. zhao. 2012. effect of dietary daidzein supplementation on egg laying rate was associated with the change of hepatic vtg-ii mrna expression and higher antioxidant activities during the postpeak egg laying period of broiler breeders. anim. feed sci. technol. 177(1-2):116123 saitoh, s., t. sato, h. harada and t. matsuda. 2004. biotransformation of soy isoflavone glycosides in laying hens: intestinal absorption and preferential accumulation into egg yolk of equol, a more estrogenic metabolite of daidzein. biochim. biophys. acta. 1674(2):122-130. sanz, t. and h. luyten. 2006. release, partitioning and stability of isoflavones fromenriched custards during mouth, stomach and intestine in vitro simulations. food hydrocol. 206(6):892-900. isoflavone soy sauce by-product (issbp) for laying hens (a. malik et al.) 193 shi., s.r., h. gu, l.l. chang, z.y. wang, h.b. tong and j.m. zou. 2013. safety evaluation of daidzein in laying hens: part i. effecs on laying performance, clinical blood parameters, and organs development. food chem. toxicol. 55: 684-688. silva, l.h., r.m.s. celeghini and y.k. chang. 2011. effect the fermentation of whole soybean flour on the conversion of isoflavones from glycosides to aglycones. food chem. 128:640-644. steel, r.g.d and j.h. torrie. 1991. principles and procedures of statistics. 2nd ed. international book company, tokyo. turner, r., t. baron, s. wolffram, a.m. minihane, a. cassidy, and g. rimbach. 2004. effect of circulating forms of soy isoflavones on the oxidation of low density lipoprotein. free radic. res. 38(2):209216. vakili, a. and m. heravi. 2016. performance and egg quality of laying hens fed diets supplemented with herbal extracts and flaxseed. poult. sci. 4(2):107-116. yang, h., g. jin, d. ren, s. luo and t. zhou. 2011. mechanism of isoflavone aglycones effect on cognitive performance of senescence-accelerate mice. brain cognit. 76(1):206-210. 194 j.indonesian trop.anim.agric. 44(2):187-194, june 2019 j i t a a journal of the indonesian tropical animal agriculture accredited by ditjen penguatan risbang no. 60/e/kpt/2016 j. indonesian trop. anim. agric. pissn 2087-8273 eissn 2460-6278 http://ejournal.undip.ac.id/index.php/jitaa 43(4):405-411, december 2018 doi: 10.14710/jitaa.43.4.405-411 effect of two pre-freezing methods on quality of sexed semen in ettawa grade goat y.s. ondho1,* and s.b. udrayana2 1faculty of animal and agricultural sciences, diponegoro university, tembalang campus, semarang 50275 indonesia 2agriculture extension college, jl. dr. cipto no.144a, sengkkrajan, bedali, lawang, malang, east java 65215 indonesia *corresponding e-mail: yon_supriondho@yahoo.com received september 14, 2018; accepted november 13, 2018 abstrak tujuan penelitian ini adalah untuk mengetahui pengaruh perbedaan prosedur pra-pembekuan terhadap kualitas sperma hasil pemisahan kromosom x dan y (sperma sexing) pada kambing peranakan ettawa. materi penelitian berupa semen yang telah dilakukan sexing yang terdiri dari 2 lapisan (lapis atas dan lapis bawah). semen hasil sexing tersebut diberi dua perlakuan, 1) sesuai dengan standar operating prosedur (sop) pabrik semen beku, yaitu pre-freezing dengan menempatkan straw 4 cm di atas n2 cair selama 9 menit, dan 2) perlakuan modifikasi atau prosedur modifikasi (pm), yaitu prefreezing dengan menempatkan straw 16 cm di atas nitrogen cair selama 9 menit kemudian diturunkan menjadi 4 cm di atas nitrogen cair selama 9 menit. parameter yang diamati adalah motilitas, motilitas progresif (gerakan maju), hiperaktivitas dan linieritas sperma. data yang diperoleh dianalisis dengan menggunakan student's t-test hasil penelitian menunjukkan bahwa kualitas semen sexing pada sop pabrik dibandingkan dengan perlakuan modifikasi terhadap lapisan atas dan bawah masing-masing adalah: motilitas pada lapisan atas (46.06 ± 7.52% vs 55.6 ± 7.78%) dan lapisan bawah (36.82 ± 6.49% vs 41.47 ± 6.57% ; progresif pada lapisan atas (16.34 ± 4.27 vs 32.83 ± 5.9 %) dan lapisan bawah 15.97 ± 2.72 % vs 19.79 ± 3.97%); hiperaktivitas pada lapisan atas (0.81 ± 0.6% vs 4.09 ± 1.98% ) dan lapisan bawah (0.71 ± 0.68% vs 1.50 ± 1.05 %); linieritas pada lapisan atas (12.19 ± 2.94 vs 20.52 ± 3.97 %) dan pada lapisan bawah 12.32 ± 2.63 vs 14.70 ± 2.6; non linier pada lapisan atas (0.14 ± 0.2 vs 0.68 ± 0.85 %) dan lapisan bawah (0.4 ± 0.13 % vs 0.34 ± 0.4%). simpulan penelitian ini adalah kualitas semen beku sexing yang diproses dengan teknik modifikasi lebih baik dibandingkan dengan semen beku yang diproses dengan operating prosedur pabrik semen beku. kata kunci: spermatozoa beku, pre-freezing, peranakan kambing ettawa abstract the aim of this study was to determine the influence of pre-freezing different procedures to the quality of ettawa grade goat frozen semen-sexing. the research material was semen sexing consisted of 2 layers those were top layer and bottom layer. the quality of frozen semen sexing was observed by comparing the pre-freezing technique (factory standard operating procedure: fsop) according to the artificial insemination center operating procedure (pre-freezing by placing the straw of semen for about 4 cm above liquid nitrogen for 9 minutes) with the modification procedure (mp), pre-freezing by placing the straw of semen 16 cm above liquid nitrogen for 9 minutes and then it was lowered to 4 cm above liquid nitrogen for 9 minutes during the pre-freezing phase. the parameters observed were motility, progressive motility, hyperactivation, and sperm linearity. data were analyzed using student's t-test. the pre-freezing methods on quality of semen sexing in goat (y. s. ondho et al.) 405 results of this study indicated that the quality of sexed-semen in the standard operating procedures of frozen semen compared to the treatment of modifications to the top and bottom layers were motility at the top layer (46.06 ± 7.52% vs 55.6 ± 7.78%) and bottom layer (36.82 ± 6.49% vs. 41.47 ± 6.57%); progressive top layer (16.34 ± 4.27 vs. 32.83 ± 5.9%) and bottom layer 15.97 ± 2.72% vs. 19.79 ± 3.97%); hyperactivity in the top layer (0.81 ± 0.6% vs 4.09 ± 1.98%) and the bottom layer (0.71 ± 0.68% vs. 1.50 ± 1.05%); linearity consisted of linear and non-linear, the top layer (12.19 ± 2.94 vs. 20.52 ± 3.97%) and bottom layer (12.32 ± 2.63 vs 14.70 ± 2.6); while non-linear in top layer (0.14 ± 0.2 vs 0.68 ± 0.85%) and bottom layer (0.4 ± 0.13% vs 0.34 ± 0.4%). the conclusions in this study indicated that the quality of the frozen sexed-semen that has processed by pre-freezing modification technique was better than the frozen sexed-semen obtained from the artificial insemination center standard operating procedure. keywords: frozen semen, pre-freezing, ettawa grade goat introduction semen sexing procedure is attractive and prospective, because it can be used to select sex animal livestock as needed. semen sexing sperm contribute a great impact on breeding programs, but it needs high cost and resulted in low pregnancy rate especially for artificial insemination (carvalho et al., 2010; tubman et al., 2004). one of the factors that affected to the semen quality is frozen semen production system (seidel, 2009; moce and vicente, 2002; foote, 1990). the results of various studies on sexing methods and materials have been directed at humans and certain animal species, such as dairy cows and beef cattle. the x and y sperm were sexed based on the characteristics that are possessed by each type of sperm, including the dna content, size, motility, surface charge and chromosome fluorescence. the chromatin content of x sperm is greater, making the head size is greater than y sperm (hafez and hafez, 2000); in addition, x sperm contain 3.8% more dna than y sperm (garner and seidel, 2000). in previous studies, the quality of frozen semen sexing after thawing always decreased mainly on the quality after thawing included forward movement, activation and quality degradation (acker and gann, 2003). this was a problem because the semen sexing inseminated on the female animal will result in lower percentage of conception. cochran et al. (1985) stated that pre-freezing and thawing are factors that can affect to a decrease in the quality of semen in ram. the decrease in the quality of the semen is due to the influence of physical and chemical effects on sperm cells when it was separated to obtain the proportion of sperm x or sperm y. sperm motility is determined by the availability of energy obtained from the adenosine triphosphate (atp), in addition to the plasma concentration of semen (hafez and hafez, 2000). process of pre-freezing semen by the manufacturers generally only one stage after the equilibration process. this is due to obtain efficiency in the time process and cost production. various methods have been developed to obtain optimal results, included the use of different technique, equipment, and the addition of various substances (medium) that can protect or damage the spermatozoa (yamashiro et al. 2006). the sexing and freezing of sperm can cause damage and lead to death. therefore, a study investigated the modification of freezing semen for sexing using bovine serum albumine (bsa) gradient centrifugation particularly during the pre-freezing stage (tartaglione and ritta, 2004). correa et al. (1997) stated that semen mortality and occurrence of sperm cell abnormalities during this freezing resulted from the pre-freezing stage of time being too rapid to deep the semen into liquid n2, so that with longer pre-freezing time stages, sperm cells have a sufficient chance to adapt to their ambient temperature well. susilowati (2017) showed that the best distance of straw from liquid nitrogen surface is 8-10 cm. the method can improve the quality of semen sexing after being frozen, there is no procedure has been reported for sexing frozen semen. on the basis of the reason above, this study was conducted to determine differences of pre-freezing procedure that influence the quality of goat sexed semen. materials and methods semen sexing preparation this research was conducted at the artificial insemination center (aic) of sidomulyoungaran, central java. fresh semen was collected 406 j.indonesian trop.anim.agric. 43(4):405-411, december 2018 from 5 pe goats and microscopically evaluated for quality (table 1). furthermore, the fresh semen was added with 10% phosphatidylcholine and examined its quality (table 2), then the sexing process was carried out. the sexing procedure used a centrifugation technique in which fresh semen has been added with 10% phosphatidylcholine in 10% gradient of bovine serum albumine (bsa) and then centrifuged in andromed media at a speed of 1500 rpm for 5 minutes (hamano, 2007). after the centrifugation (post sexing), two layers of top layer post sexing (tlps) and bottom layer post sexing (blps) 10% gradient of bsa were centrifuged in andromed media at a speed of 1500 rpm for 5 minutes (hamano, 2007). bsa diluter is capable of separating sperm cells based on their size and weight differences, so that when centrifugation occurs two layers appear in the centrifugation tube. the formation of the upper and lower layers due to differences in the concentration of sperm x and y. spermatozoa y is concentrated in the lower layer, because of the occurrence of centrifugal force, the material that has a bigger size and weight (sperm y) will reach the base of the tube faster (bottom layer). the upper and lower layers of semenn were then separated and each was inserted into the erlenmeyer and then equilibrated at a temperature of 50°c. then the sexing semen (top and bottom layers) was inserted into the mini-straw and prefreezing treatments there were 2 treatments: 1) pre-freezing by placing the straw of semen at 4 cm above liquid nitrogen for 9 minutes (factory standard operating procedure or fsop), and 2) pre-freezing by placing the straw of semen at 16 cm above liquid nitrogen for 9 minutes and then placing it into 4 cm above liquid nitrogen for 9 minutes (modification procedure; mp). data analysis the quality of the frozen semen sexing (motility, progressive motility, linearity) and postfreezing semen to measure motility, progressive motility, hyperactivity of the sperm and linearity were measured using computer-assisted sperm analysis (casa). replication were performed 7 times a day for one day. data were analyzed using student's t-test (steel and torrie, 1991). result and discussion quality of fresh semen of ettawa buck added with 10% phosphatidylcholine the fresh semen quality of ettawa grade in this research was shown in table 1. the quality of the semen is eligible for frozen semen-sexing production (toelihere, 1993). before sexing process, fresh semen was added with 10% phosphatidylcholine so that the quality remains good. mean motility, progression and linearity of fresh semen after adding 10% phosphatidylcholine was 80% to 90%, 75% to 80% and 45% to 55%, respectively. the quality improvement after addition of diluent is conducted to improve the metabolite functions of organelles in spermatozoa cells utilizing the nutrients provide from the diluents (hammadeh et al., 2001). in addition, phosphatidylcholine serves pre-freezing methods on quality of semen sexing in goat (y. s. ondho et al.) 407 table 1. microscopic evaluation of motility, progressive and linearity on fresh semen ettawa grade goat buck parameters motility progressive linearity …............................................ % …......................................... 1 80 75 45 2 85 80 50 3 80 75 45 4 80 70 40 5 75 75 45 average 80 75 45 as a buffer increasing the volume of semen and providing energy. phosphatidylcholine increased activity of sperm cell membrane metabolism and caused motility. another benefit of phosphatidylcholine in the diluent can protect sperm cells from mechanical damage such as reducing cellular damage due to freezing or centrifugation effect. pesch and hoffmann (2007), nabiev (2003) and park and graham (1992) stated that addition with 10% phosphatidylcholine in the andromed diluent would improve hyperactiveness and linearity of sperm. phosphatidylcholine protects the sperm membrane and triggers the activity of enzymes located in the spermatozoa acrosome. nehring and rothe (2003) and aires et al. (2003) stated that the increasing number of linearity sperm affect directly to the increase in sperm hyperactivity with the strength of cell membranes and the occurrence of acrosome reactions, and the increasing of hyperactivity of the cell sperm. the more aggressiveness and linear movement can be observed by microscopic observations. correa et al. (1997) reported that progressive movements of the sperm head are supported by movement of the tail of spermatozoa. the progressive movement are the combination between hyperactivity movement and linearity. quality of post-sexing semen centrifugation process during semen sexing resulted on 2 layer (top and bottom layer). semen sexing process affected to the decreasing of semen quality. centrifugation process affected to the physical destruction and resulted in disturbing metabolic activity. in this research, decreasing semen quality did not fell down under standard for frozen semen production. this is because spermatozoa cells have been strengthened by adding 10% phosphatidylcholine before processing of semen sexing. motility, progressive motility and linearity of fresh semen added with 10% phosphatidylcholine (fs + ppc) and post sexing (top layer post sexing (tlps) and bottom layer post sexing (blps) on ettawa grade goat was shown in table 2. pre-freezing semen quality the semen quality of pre-freezing on factory standard operating procedure (fsop) compared with modification procedures (mp) is presented in table 3. based on this result, the technique of prefreezing modification in freezing process of semen sexing can increase motility and linier movement of spermatozoa cell (p<0.05), similarly sperm progressive motility and hyperactive compared with standard procedures (p<0.01). table 3 shows that in the top layer, the modified treatment of almost all variables showed better results compared to the factory standard procedure, only parameter non-linear movement that shown non significant difference (p>0,05). in the bottom layer, although statistical analysis of some variables did not show significant differences, but there was a tendency that prefreezing modification treatments improved semen 408 j.indonesian trop.anim.agric. 43(4):405-411, december 2018 table 2. microscopic evaluation of motility, progressive and linearity on fresh semen (fs) added with 10% phosphatidylcholine (fs+ppc) and post sexing (top layer post sexing/tlps, bottom layer post sexing/blps) on ettawa grade goat buck motility progressive liniarity fs+ppc tlps blps fs+ppc tlps blps fs+ppc tlps blps …...................................................................% …................................................................. 1 90 85 80 80 75 85 55 45 60 2 95 90 85 85 70 80 60 55 50 3 90 85 80 80 70 75 55 50 55 4 90 80 80 75 65 75 50 45 50 5 85 85 75 80 70 85 55 50 50 average 90 85 85 80 70 80 55 50 55 quality, in this case only motility variables was significantly different (p <0.01). according to carvalho et al. (2010) the semen sexing procedure affected sperm characteristics, it did not significantly affect fertilization or embryo development. table 3 shows that the quality of sperm increased significantly with the modified treatment in pre-freezing. it is known that the process of sperm freezing can damage spermatozoa cells, so that modification technique was required to reduce the damage of spermatozoa cells. the treatment of modification pre-freezing was done by placing the straw of semen 16 cm above liquid nitrogen for 9 minutes that was intended to gradually lower the freezing temperature with a distance of 16 cm above the surface of liquid nitrogen after have been equilibrated at 3-4°c for 4 hours, then the semen was lowered to 4 cm from the surface of the liquid n2 for 9 minutes. after that, it was frozen by decreasing the temperature of about 30°c then -130° c, and finally semen (already inside the packing straw) was soaked in liquid n2. this modification technique has a positive effect on the quality of semen that is suitable to be used for insemination as stated by toelihere (1993). table 3 shows significant degradation of the semen quality when semen was aligned followed by freezing process. freezing process used as modified procedure has produced better quality semen than using standard factory procedure. this result was the same as the statement of correa et al. (1997) that modification in freezing process of semen sexing can increase the semen quality. thus, the modification procedure in this study may increase the percentage of motility, included forward movement, hyperactive, linear and nonlinear movements in both top and bottom layers of semen sexing. it is noted that the quality of semen after processing (frozen or sexing) decreased about 15-20% compared to fresh semen, although it can still be used for insemination. based on this study, the modification of procedures can improve the quality of semen on 5 variables as observed and measured by using computer-assisted sperm analysis (casa). furthermore, the production of frozen semen sexing by modification of the prefreezing procedure needs a field-test to be able to obtain pregnancy data resulting from insemination by using the frozen semen sexing. conclusion modification procedure (mp) at the prefreezing stage of semen for sexing could increase the motility, progression, hyperactivity and linearity of the sperm top layers. modification procedure (mp) of pre-freezing increased progressive sperm in the bottom layers. modification of pre-freezing semen for sexing with a two-stage pre-freezing procedure produced better-quality sperm than did the factory standard operating procedure (fsop). references acker, j.p. and l.e. mc gann. 2003. protective effect of intracellular ice during freezing. cryobiology. 46: 197-202. aires, v.a., k.d. hinsch, f.m. schloesser, k. pre-freezing methods on quality of semen sexing in goat (y. s. ondho et al.) 409 table 3. average value of variables different pre-freezing on factory standard operating procedure (fsop) and modification procedures (mp) treatment variables top layer bottom layer fsop mp fsop mp ........................................................ % …...................................................... motility 46.06 ± 7.52a 55.61 ± 7.78b 36.82 ± 6.49a 41.47 ± 6.57a progressive 16.34 ± 4.27a 32.83 ± 5.91b 15.97 ± 2.72a 19.79 ± 3.97b linearity 12.19 ± 2.94a 20.52 ± 3.97b 12.32 ± 2.63 14.70 ± 2.63 hyperactive 0.81 ± 0.60a 4.09 ± 1.98b 0.71 ± 0.68a 1.50 ± 1.05b non linear 0.14 ± 0.2 0.68 ± 0.85 0.40 ± 0.13 1.50 ± 1.05b different superscript in the same row at a trait indicate a significantly different (p <0.05). fsop: factory standard operational procedure; mp: modification procedure bogner, s.m. schloesser and e. hinsch. 2003. in vitro and in vivo comparison of egg yolk based and soybean lechitin based extenders for cryopreservation of bovine semen. theriogenology. 60: 269-279. carvalho, j.o., r.sartori, g.m. machado, g.b. mourao and m.a.n. dode. 2010. quality assessment of bovine cryopreserved sperm after sexing by flow cytometri and their use in in vitro embryo production. theriogenology. 74:1521-1530 correa, j.r. g. heersche, jr. and p.m. zavos. 1997. sperm membrane functional integrity and response of frozen-thawed bovine spermatozoa during hypoosmotic swelling test incubation at varying temperatures. theriogenology. 47:715-721. foote, r.h. 1990. cryopreservation of spermatozoa and artificial insemination: past present and future. j. androl. 3: 85-100. cochran, r.c., j.k. judi, j.f. parker and d.m. hallford. 1993. prefreezing and post-thaw semen characteristics of five ram breeds collected by electroejaculation. theriogenology. 23:431-434. garrner, d.l. and e.s.e hafez. 2000. spermatozoa and seminal plasma. in: reproduction in farm animal. 7thed. edited by b. hafez and e.s.e. hafez. lippincott williams & wilkins. philadelphia. garner, d.l. and g.e. seidel. 2000. sexing bull sperm. in: topics in bull fertility. edited by p.j. chenoweth. international veterinary information service. hafez, e.s.e. and b. hafez. 2000. x and y chromosome bearing spermatozoa. in: reproduction in farm animals. 7th ed. edited by b. hafez and e.s.e. hafez. lippincott williams & wilkins. philadelphia. hamano, k.2007. sex preselection in bovine by separation of x and y chromosome bearing spermatozoa. j. reprod. dev. 53(1):27-38. hammadeh, m.e., t.george, p.rosenbaum and w. schmidt. 2001. assosiation between freezing agent and acrosome damage of human spermatozoa from sub normal and normal sperm. andrologia 32:331-336. hans, b. and j.c. bischof, 2004. direct cell injury associated with eutethic crystalization during freezing. cryobiology. 48:8-21. matsuoka, t., h. imai, h. kohno and y. fukui. 2006. effects of bovine serum albumin and trehalosa in semen diluents for improvement of frozen thawed ram spermatozoa. j. reprod. and dev. 52(5): 675-683. moce, e. and j.s. vicente. 2002. effect of cooling and freezing, the two steps of a freezing protocol on fertilizing ability of rabbit sperm. reprod. nut. dev. 42:189-196. nabiev, d., m. giles, h. scheider, e. mahibir, k. wimmers, a. ponsuksili, h. koll and k. schellander. 2003. comparison of andromed and tris egg yolk extender bovine post thaw sperm function parameters and ivf. theriogenology. 38:209-222. nehring, h. and l. rothe. 2003. insemination of cryopreserved bull semen portions with reduced sperm number after freezing and thawing is related to cellular injury. biol. reprod. 71:973-978. park, j.e., and j.k. graham. 1992.effects of cryopreservation procedures on sperm membranes. theriogenology. 38: 209-222. pesch, s. and b. hoffmann. 2007. cryopreservation of spermatozoa in veterinary medicine. j. reprod. endoc. 4: 101-105. seidel, jr. g.e. 2009. sperm sexing techcnology. the transition to commercial application. an introduction to the symposium “update on sexing mammalian sperm”. theriogenology. 7:1-3 sni. 2017. standard nasional indonesia semen beku 4869-1.2.2017. semen beku bagin 1: sapi. badan standardisasi nasional. jakarta. susilawati, t. 2017. spermatology. cetakan kedua. penerbit universitas brawijaya press. malang-indonesia steel, r.g.d. and j.h. torrie. 1980. principles and procedures of statistics. a biometrical approach. 2nd ed. mcmgraw-hill kogakusha, ltd. tartaglione, c.m. and m.n. ritta. 2004. prognostic value of spermatological parameters as predictors of in vitro fertility of frozen-thawed bull semen. theriogenology. 62:1245-1252. toelihere, m.r.1993. inseminasi buatan pada ternak. penerbit angkasa bandung tubman, l.m., z. brink, t.k. suh and g.e. seidel. 2004. characteristics of calves produced with sperm sexed by flow cytometri/cell sorting. in animal growth, physiology and reproduction. animal reproduction and biotechnology laboratory. colorado state university. fort 410 j.indonesian trop.anim.agric. 43(4):405-411, december 2018 collins. yamashiro, h., h.f. wang, y. yamashita, k. kumamoto and t. terada. 2006. enhanced freezability of goat spermatozoa collected into tubes containing extender supplemented with bovine serum albumin (bsa). j. reprod. dev. 52(3):407-414. pre-freezing methods on quality of semen sexing in goat (y. s. ondho et al.) 411 cochran, r.c., j.k. judi, j.f. parker and d.m. hallford. 1993. prefreezing and post-thaw semen characteristics of five ram breeds collected by electroejaculation. theriogenology. 23:431-434. j i t a a journal of the indonesian tropical animal agriculture accredited by ditjen penguatan risbang no. 60/e/kpt/2016 j. indonesian trop. anim. agric. pissn 2087-8273 eissn 2460-6278 http://ejournal.undip.ac.id/index.php/jitaa 44(4):415-422, december 2019 doi: 10.14710/jitaa.44.4.415-422 implication of feed restriction during growth period on the growth hormone profiles and morphology ovary of quail hen (coturnix coturnix japonica) r.t. hertamawati1, e. soedjarwo2, o. sjofjan2 and s. suyadi2* 1animal husbandry department, politeknik negeri jember, jalan mastrip 164 jember 68121 indonesia 2 faculty of animal science, brawijaya university, jalan veteran malang 65145 indonesia *corresponding e-mail:suyadi@ub.ac.id received july 15, 2019; accepted november 16, 2019 abstrak tujuan penelitian ini adalah untuk mengevaluasi pengaruh pembatasan pakan pada profil hormon pertumbuhan dan morfologi ovarium selama periode pertumbuhan. sebanyak 300 ekor burung puyuh umur empat belas hari dari digunakan pada penelitian ini. program pembatasan pakan yang diberikan adalah pembatasan berdasarkan energi metabolisme pakan (me) r1 = 2900 kkal / kg; r2 = 2800 kkal / kg dan pembatasan pakan kuantitatif p0 = 100% dari ad libitum; p1 = 90% dari ad libitum dan p2 = 80% dari ad libitum (n = 300). setiap kelompok perlakuan (n = 50) terdiri dengan lima ulangan, masingmasing 10 ekor puyuh. kadar hormon pertumbuhan ditentukan pada umur 28, 35, 42, dan 49 hari sementara morfologi ovarium diukur pada saat masak kelamin. hasil penelitian menunjukkan bahwa pembatasan pakan terjadi penurunan hormon pertumbuhan dan insulin-like growth factor-1 secara nyata (p<0.01) akan tetapi terjadi peningkatan setelah pakan diberikan lagi secara ad libitum. tidak ada efek signifikan yang disebabkan oleh perbedaan kandungan energi metabolisme pakan. jumlah folikel kuning telur besar (large yellow follicle, lyf) tidak berbeda antara puyuh yang diberi pakan ad libitum dan dibatasi 90% dari ad libitum, namun pembatasan pakan secara signifikan meningkatkan jumlah folikel kuning telur kecil (small yellow follicle, syf). dapat disimpulkan bahwa pembatasan pakan dapat diberikan hingga 90% ad libitum dengan em 2900 kkal / kg selama periode starter (14 hingga 42 hari) tanpa mempengaruhi morfologi ovarium puyuh kata kunci: pembatasan pakan, growth hormone, insulin-like growth factor-1, puyuh, morfologi ovary, folikel kuning telur abstract the aim of this research was to evaluate the effect of feed restriction on growth hormone profiles and ovarian morphology during the growth period. three hundred 14-day-old quails were used. the quails were maintained on two feeding restriction programs: two dietary regimes based on metabolizable energy (me), r1 = 2900 kcal/kg and r2 = 2800 kcal/kg, and 3 quantitative feed restriction diets, p0 = 100% ad libitum; p1= 90% ad libitum and p2 = 80%ad libitum (n=300). each group (n=50) was processed with five replications, 10 birds in each replicate. the change in growth hormone was determined at 28, 35, 42, and 49 days of age, while ovarian morphology was determined at sexual maturity. the results indicated that feed restriction induced a significant increase in growth hormone and insulin-like growth factor-1 after re-feeding. there was no significant effect caused by the rationing of metabolizable energy. the number of large yellow follicles was not different between quails fed with growth hormones profile of quails after restricted feeding (r.t. hertamawati et al.) 415 100% ad libitum and 90% ad libitum. however, feed restriction significantly increased the number of small yellow follicles. in conclusion, the feed could be restricted to 90% ad libitum with a 2900 kcal/kg ration of me and fed during the starter period (14 to 42 days of age) without influencing ovarian morphology in quails. keywords: feed restriction, growth hormone, insulin-like growth factor-1, quail hen, yellow follicle introduction feed affects the body's metabolism and growth that is regulated or mediated by the endocrine system. koyuncu (2013) explain that the main hormones involved with growth are growth hormone (gh), triiodothyronine (t3) and insulin-like growth factor 1(igf-1). gh and igf are known as the key hormones that affect growth, maturation, and metabolism. the hormones are influenced by nutritional factors and have been widely studied, especially in prosocial bird species (mcnabb, 2006). these metabolic hormones are the most important factor in determining the level of hepatic poultry lipogenesis. the application of a feed restriction program on poultry farms primarily aims to reduce excess energy consumption which generally occurs when feeding is provided without restriction (ad libitum). laying chicken have an ability to consume 10-15% more energy than required (busye et al., 2000) and excess energy is converted into body fat which results in faster growth and faster sex maturation. the excess energy consumed is automatically be converted into fat deposits in the body. the high-fat deposits in the body causes early sexual maturation and increases follicular development (diaz and anthony, 2013), whereas the reproductive conditions are not ready to support optimum egg production. increased body fat deposition can cause a high incidence of metabolic disorders and high mortality rates (saber et al., 2011; sahraei, 2012). there is a negative correlation between body weight and reproductive traits. thus, a rapid increase in body weight affects egg production, fertility and hatchability (wariboko and george, 2015). based on research results of busye et al. (2000), restrictions on feeding are followed by an increase in gh secretion which further increases metabolic effects towards the body tissues. increased gh stimulates the liver to increase igfi secretion, obtained both through circulation and local production. feed restriction programs cause a different response in hormone profiles that affect growth, and do not always cause an increase in gh concentration (el-far, 2014). generally, igf-1 concentrations decrease during feed restriction programs to regulate growth and body weight in chickens. however, after being returned to ad libitum feeding, there is an increase in igf-1. feed restrictions, as a nutritional management approach to reduce feed costs or problems related to egg production in quail research, have been carried out which show the positive impact of qualitative and quantitative dietary restrictions on growth performance (abbas et al., 2015). prevous studies revealed that restricted feeding are critical for quail reproduction performance (hassan et al., 2003; fidan and kaya, 2014; wariboko and george, 2015), carcass quality (azeem and azeem, 2011), and spawning properties (petek, 2006). the relationship between gh concentration and quail ovarian morphology has not been clearly studied. the decrease in feed consumption could change the gh, igf-i and other growth hormone concentrations. however information the effect of restricted feeding and its implication on quails growth hormone profile are scarce. thus, it is assumed that there will be an effect on ovulation and egg production in poultry caused by limiting feed and ad libitum feed. the aim of this study was to evaluate the implications of feed restrictions involving different energy contents of feed on gh profiles and ovarian morphology at the sexual maturation period. materials and methods sampling and feed restriction formulation the livestock used as the sample were 14day-old quail hens, obtained from the jaya mulya livestock farmers group, pare kediri city. as many as 500 quails were reared from the age of one day to 14 days with no feed restriction (ad libitum). the cages used in this study were 40× 30× 30 cm, with a capacity to house 15 quails in each unit; up to 30 units were used. treatment with feed restrictions began in 14day-old quails. two types of feed that differed in energy content (2900 kcal/kg and 2800 kcal/kg) 416 j.indonesian trop.anim.agric. 44(4):415-422, december 2019 were given according to altine (2016); these were provided at 90% and 80% of ad libitum feeding, plus 100% of ad libitum feeding as the control. feed restriction was modified from hertamawati (2006). feed r1 contained 24% crude protein (cp) and 2900 kcal/kg metabolizable energy (me), based on the standard requirements for quail hen’s growth period from nrc (1994). feed r2 contained 24% as cp and 2800 kcal/kg me. experimental design the experiment was based on a nested completely randomized design consisting of two independent variables, feed me factors consisting of two me values (2900 kcal/kg and 2800 kcal/kg) and the second factor was the p factor or feed restrictions which consisted of three levels (100%, 90% and 80% as ad libitum feed) that nested in factor r. the feed restriction treatment was conducted from 14 to 42 days of age. quails were divided into six treatments, as follows : r1p0 = me 2900 kcal/kg, ad libitum feeding, r1p1 = me 2900 kcal/kg, restricted feeding 90% ad libitum, r1p2 = me 2900 kcal/kg restricted feeding 80% ad libitum, r2p0 = me 2800 kcal/kg, ad libitum feeding, r2p1 = em 2800 kcal/kg , restricted feeding 90% ad libitum, r2p2 = em 2800 kcal/kg, restricted feeding 80% ad libitum. the quails were fed ad libitum feed after 42 days of age. data collection observation of ovarian morphology was carried out when quails reached sexual maturation. it involved a surgical procedure and observation of reproductive organs by counting the number of ovarian follicles (arora and samples, 2011), including large yellow follicles (lyf) (> 1 cm), medium yellow follicles (myf) (<0.5–1 cm) and small yellow follicles (syf) (<0.5 cm). blood sampling for hormone profiling analysis was carried out from the brachial vein on the wings before the quails reached egg-laying age (28 and 35 days of age), mature age (42 days of age) and during the period of egg laying (49 days of age). blood was collected into an edta tube and immediately centrifuged for 20 minutes at 2500 rpm to separate the plasma. the gh and igf-1 hormone levels were analyzed using the enzyme-linked immunosorbent assay (elisa) and expressed in units of ng/ml. the measurement procedure was conducted according to guidelines of the elisa poultry gh kit (elabscience catalog no: e-el-ch2116) and igf-1 kit (elabscience catalog no: e-el-ch0116). data analysis data were analyzed using one-way anova with a nested design and continued with duncan’s multiple range test if there were differences (spss 21). results and discussion growth hormone profiles the hormonal profiles associated with growth hormones profile of quails after restricted feeding (r.t. hertamawati et al.) 417 figure 1. the gh hormone profiles in quail blood samples at the age of 28, 35, 42 and 49 days with ad libitum and restricted feeding (r1p0 -♦; r1p1-■-; r1p2 -▲-; r2p0-×-; r2p1-*-; r2p2●-) growth include gh and igf-1and levels of these after feed restrictions can be seen in figure 1 and 2. the results showed that the treatments involving feed restriction and different feed energy contents produced a significant effect (p<0.01) on gh levels on days 28, 35, 42 and 49 (table 1). the gh levels showed a decrease on day 35 with both limited feeding and ad libitum feeding, but increased at 49 days of age because at that time the feed given ad libitum (figure 1). the gh reduction with feed restriction was also reported in the study of busye et al. (2000) which stated that the decrease in gh levels occurred due to a decrease in the number of gh receptors in the liver of poultry that is given limited feed, indicating a decrease in gh secretion. the greatest gh hormone increase was on day 49 with the treatment of 80% ad libitum feed restriction, both with me 2900 kcal/kg and me 2800 kcal/kg (p<0.05). figure 2 present igf-1 hormone profile. the results showed that the feed restriction treatment and different energy contents also affected the igf-1 hormone levels significantly (p<0.01) at the ages of 28, 35, 42 and 49 days. the igf-1 hormone levels were decreased at 35 days and then increased at 42 days. the highest increase occurred when the feed was provided ad libitum again (aged 49 days). the highest increase in igf-1 (p<0.05) occurred in the quails feeding at 80% ad libitum. the gh works indirectly on growth through increased igf-i by stimulating the liver to increase igf-i secretion, through the circulation and local production (hrabia, 2015). in this study, there was a proven mechanism by which gh levels increased on day 49, followed by an increase in igf-1 levels. the decrease in igf-1 in peking ducks on a feed restriction program was also reported by el-far (2103). farhat and chavez (1999) proved that igf-1 concentrations were influenced by poultry strains, feed protein contents, sex, feed restrictions and poultry selection criteria. ovarian morphology ovarian morphology at sexual maturity after feed restriction showed a large number of large yellow follicles (lyf), medium yellow follicles (myf) and small yellow follicles (syf) as showed at table 3. the feed restriction treatment had a significant effect on the number of lyf and syf (p<0.05), but had no effect on the number of myf. feed restriction at 80% ad libitum significantly decreased the amount of lyf (p<0.05) at sexual maturity with feed with a me 418 j.indonesian trop.anim.agric. 44(4):415-422, december 2019 table 1. composition and calculated analysis of experimental diets offered to quails from 1 4 to 42 days of age variables r1 r2 maize (%) 0.40 0.30 rice bran (%) 0.07 0.18 concentrate feed (%)1 0.53 0.52 calculated analysis r1 r2 protein (%) 24.01 23.6* 24.01 23.9* fat (%) 4.95 3.3* 5.66 3.9* crude fiber (%) 5.28 2.8* 5.77 3.1* ca (%) 1.37 1.34 p(%) 0.76 0.90 metabolizable energy (kcal/kg) 2916.56 2930** 2822.40 2830** *proximate analysis **estimation of gross energy 1product of comfeed ltd. content of 2800 kcal/kg. however, feed containing me 2900 kcal/kg did not decrease the amount of lyf. this result was different to findings of diaz and anthony (2013) who reported that feed restriction reduced the number of follicles by 50%. the highest average lyf value was with ad libitum feeding and me feed content of 2900 kcal/kg and 2800 kcal/kg as much as 3.40 ± 0.55 and 3.60 ± 0.55, respectively. the number of lyf was less than the number of follicles reported by kashmiri and samples (2011) who found 4.2 follicles in quails with a body weight of 120–130 g and 5.4 follicles in quails with a body weight of 150–160 g. the optimum number of lyf was related to the length of the spawning period. ad libitum feeding in quails did not result in excessive follicular development (more than 5 lyf) as has occurred in broiler chickens (renema et al., 1997). body weight during the sexual maturity period is also associated with an increase in lyf quantity. it has been suggested that ovaries in quails with a higher body weight are more active compared to those with lower body weight, due to gonadotropin activity and an increase in steroidogenic transcripts (diaz and anthony, 2013). this was supported by hocking (2009) who showed a linear relationship between body weight and follicle number in poultry with high body weight compared to low body weight in the sexual maturity period. this was suggested to be a weakness in feed restriction programs or limited energy consumption which results in weight loss that then affects body composition and reduces the number of follicles in the ovary. feed restriction at 90% ad libitum in feed with me of 2900 kcal/kg (r1) and 2800 kcal/kg (r2) increased the number of syf compared to ad libitum feeding (p <0.05). the lowest syf number was found in quails with ad libitum treatment due to the higher body weight gained at sexual maturity than with feed restriction treatment, so that ovarian development was not optimal. this finding was supported by arora and samples (2011) who stated that a decrease in the number of syf in quails with a higher body weight receiving feed containing me of 2800 kcal/kg showed the number of follicles that were not different from ad libitum treatment, presumably due to the level of restriction and feed energy levels inhibiting follicular development. the changes in igf-1 hormone levels due to nutritional differences have been described in mammals and poultry. the decrease in hormone levels associated with the growth was due to dietary restrictions and energy restrictions (kita et al., 1996; mcmurtry, 1997). in this study, the gh and igf-1 levels were also decreased due to the feed restrictions and increased after the feed provision was returned to ad libitum (table 2). feed restrictions at 90% ad libitum produced the same number of follicles as ad libitum feeding, which is economically more efficient in the use of growth hormones profile of quails after restricted feeding (r.t. hertamawati et al.) 419 figure 2. the igf-1 hormone profiles in quail blood samples at the ages of 28, 35, 42 and 49 days with ad libitum and restricted feeding (r1p0 -♦; r1p1-■-; r1p2 -▲-; r2p0-×-; r2p1-*-; r2p2-●-) 420 j.indonesian trop.anim.agric. 44(4):415-422, december 2019 feed. the feed restrictions on quails improved egg production due to the increase in levels of gh and igf-1 hormones after the feed restriction program, and ovary morphology composition was mainly can be seen from the number of syf at the period of sexual maturity. conclusion the feed restrictions on quail hens reduce the gh and igf-1 levels. there is no difference in the number of large yellow follicles with up to 90% ad libitum restriction feeding. the feed restriction programs can be applied with 90% ad libitum feed restrictions with feed containing me of 2900 kcal/kg during the starter period. acknowledgments this research was financially supported by the doctoral research grant no. 486/pl.171/pl/2018 the directorate general of research and development strengthening, ministry of technology research and higher education of indonesia. references abbas, y, a. w. sahota, m. akram, s. mehmood, j. hussain, m. younus, m. m. awais and a. r. sial. 2015. effect of different feed restriction regimes on growth performance and economic efficiency of japanese quails. the j. anim. plant sci. 25(4):966970 altine,s, m.n. sabo,n. muhammad, a. abubakar and l.a. saulawa. 2016. basic nutrient requirements of the domesticquails under tropical conditions: a review. wsn 49(2) 223-235 arora, k.l. and o.samples. 2011. role of body weight on reproductive and physiological traits in japanese quail layers (coturnix japonica). int. j. poult. sci. 10(8):640-643. azeem, a. and f.a. azeem. 2011. influence of qualitative feed restriction on reproductive performance of japanese quail hens. egypt. poult. sci. 31(4) : 883-897. balnave, d. 1973. a review of restricted feeding during growth of laying-type pullets. world's poult. sci. j. 29(4):354362. buyse, j.e. v.m. decuypere, l.m. darras, e.e. vleurick, e.r. kürn and j.d. vedhuis. 200. food deprivation and feeding of broiler chickens is associated with rapid and interdependent changes in the somatotrophic and thyrotrophic axes. br. poult. sci. 41(1): 107-116. diaz, f.j. and k. anthony. 2013. feed restriction inhibits early follicular development in young broiler-breeder hens. anim. reprod. 10(2) : 79-87. el-far, a.h. 2014. effects of quantitative feed restriction on serum triacylglycerol, growth hormones profile of quails after restricted feeding (r.t. hertamawati et al.) 421 table 3. means for the effect of ad libitum and restricted feeding on ovarian morphology during the sexual maturity period me content (kcal/kg) feed restriction (% ad libitum) body weight at sexual maturity (g) yellow follicle large medium small 2900 100 187.4± 8.85 3.40±0.55 a 2.80±0.84 18.60±7.23 a 90 172.4± 8.62 3.20±0.45 a 2.80±0.45 25.20±3.77 b 80 169.6±14.57 2.80±0.45 b 2.80±0.45 21.20±2.28 b 2800 100 185.4±15.13 3.60±0.55 a 2.40±0.55 20.40±4.72 a 90 177.2±12.32 3.20±0.45 a 2.40±0.55 28.40±7.50 b 80 174.4±10.60 2.60±0.55 b 2.60±0.89 20.40±1.14 a a, b mean values with different superscripts within the same column differ significantly (p<0.05) https://www.ncbi.nlm.nih.gov/pubmed/?term=k%c3%bchn%20er%5bauthor%5d&cauthor=true&cauthor_uid=10821532 cholesterol and growth hormones in white pekin duck. global j. biotechn. biochem. 9(3):94-98. hocking, p. m. 2009. feed restriction. biology of breeding poultry ed. hocking p. cab international, london uk. farhat, a. and e. r. chavez. 1999. effects of line, dietary protein, sex, age, and feed withdrawal on insulin-like growth factor-i in white pekin ducks. poult. sci. 78:1307-1312. fidan, e.d and m. kaya. 2014. effects of early feeding restriction on some performance and reproductive parameters in japanese quail (coturnix-coturnix japonica). int. j. poult. sci. 13(6):323-328. hassan, s.m., m.e.mady, a.l. cartwright, h.m. sabri, and m.s mobarak. 2003. effect of early feed restriction on reproductive performance in japanese quail (coturnix coturnix japonica). poult. sci. 82:11631169. hertamawati, r.t. 2006. produksi telur puyuh (coturnix-coturnix japonica) dengan pemberian pakan secara terbatas pada saat pertumbuhan sampai dewasa kelamin. j. indon. trop. anim. agric. 31(3):167-171. hrabia, a. 2015. growth hormone production and role in the reproductive system female chicken. gen. comp. endocrinol. article in press, elsevier. kashmiri l. a. and o. samples. 2011. role of body weight on reproductive and physiological traits in japanese quail layers (coturnix japonica). int. j. poult. sci. 10(8):640-643 kita, k., k. nagao and j. okumura, 2005. nutritional and tissue specificity of igf-1 and igfbp-2 gene expression in growing chickens: a review. asian-aust. j. anim. sci.18 :747-754. koyuncu, c.e., s.t. yildirmak, m. temizel, t. ozpacaci, p. gunel, m. cakmak and y.g. ozbanazi. 2013. serum resist in and insulin-like growth factor-1 levels in patients with hypothyroidism and hyperthyroidism. journal of thyroid research, article id 306750 mcnabb, f. m. a. 2006. avian thyroid development and adaptive plasticity. gen. comp. endocrinol. 147:93-101. mcmurtry j.p., g.l. francis and z. upton. 1997. insulin-like growth factors in poultry. domestic anim. endocrin. 14(4):199-229. petek, m. 2011. effect of feeding time on laying and reproductive performance of pharaoh quail housed in different cage system. asian-aust. j. anim. sci. 19(1):67-71. renema, r.a., f.e. robinson, j.a. proudman, m. newcomb and r.i. mckay. 1999. effects of body weight and feed allocation during sexual maturation in broiler breeder hens. 2. ovarian morphology and plasma hormone profiles. j. poult. sci. 78:629639. wariboko, n.o. and o.s. george. 2015. effects of feeding intensity on the performance characteristics and onset of sexual maturity in japanese quail (coturnix-coturnix japonica). int. j. livest. res. 5(7):41-49 422 j.indonesian trop.anim.agric. 44(4):415-422, december 2019 318 j. indonesian trop. anim. agric. 47(4):318-327, december 2022 j i t a a journal of the indonesian tropical animal agriculture accredited by ditjen riset, teknologi dan pengabdian kepada masyarakat no. 164/e/kpt/2021 j. indonesian trop. anim. agric. pissn 2087-8273 eissn 2460-6278 http://ejournal.undip.ac.id/index.php/jitaa 47(4):318-327, december 2022 doi: 10.14710/jitaa.47.4.318-327 socio-economic factors affecting the use of non-timber forest products in swine production in the colombian amazon v. j. b. martínez*, y. c. medina, and g. a. c. parra florencia, caquetá, colombia, universidad de la amazonia *corresponding email v.balanta@udla.edu.co recieved september 22, 2021; accepted march 9, 2022 abstract in view of the difficulties present in the swine production system to achieve sustainable productivity based on the comparative advantages and potential of the territory of the department of caquetá, located in the natural region of the colombian, the aim of the study was to analyze the socioeconomic factors that may influence the use of non-timber forest products (ntfps) in livestock feed. for this purpose, the study was carried out with a descriptive-transversal methodology with a non-experimental design and quantitative approach, where the survey was applied to 44 swine production units through a non-probabilistic method. the data were systematized using r software; a principal component analysis was performed and the degrees of relationship of socioeconomic factors with the use of ntfps in animal feed. it was concluded that despite being in a biodiverse territory, social factors related to the level of knowledge about ntfps and economic factors linked to sources of financing are directly proportional to the degree of ntfp use in swine production in the department of caquetá. although ntfps are found in most production systems in the region, they are not used for animal feed. keywords: amazon region, ntfp, socio-economic factors, sustainable productivity, swine production introduction swine activity in colombia for 2019 reported a growth of 8.8% with a production of more than 4 million tons of pork, distributed in 232,000 lands, assembled in 3,000 farms and with 56 establishments approved by the national institute of food and drug surveillance (ortiz et al, 2019).of the total production, 60.9% is produced in technified farms and the remaining 39.1% are backyard animals (trujillo et al, 2019). the producing areas that participate with 63% are assembled in the departments of antioquia (4.2%), cundinamarca (17.3%), valle del cauca (15.1%), eje cafetero (8.7%) and meta (7%) ; the rest of the country contributes 37% of the national production. sustaining this production has required the import of raw materials for the production of animal feed, 580 thousand tons of corn, 350 thousand tons of use of non-timber forest products in swine production (v. j. b. martínez) 319 soybeans (ministry of agriculture and rural development, 2019). this situation puts colombia at a disadvantage with other producing contries, due to the fact that the predominant swine production system in colombia presents different problems: i) it is developed on a small scale, ii) it has deficient production levels, iii) its technological appropriation is insufficient and iv) the high costs of inputs for the manufacture of feed needed for the production phase (muñozm, 2015). pig farming in colombia moves $2.6 trillion a year in terms of production and has a share of 1.4% of agricultural gdp and 4.8% of livestock gdp, according to a report presented by ministry of agriculture and rural development (2020). although the production of pigs grew, it is not enough to supply domestic demand, increasing imports, reaching 114,000 tons of pork (ministry of agriculture and rural development, 2020). in this sense, in the structure of a pig production cost, feed represents between 65% and 70%, where the growth-finishing stage reaches more than 70% of this percentage (lizardo et al., 2002). with the growth of production, the consumption of balanced feed based on feed elaborated with an important ingredient which is corn increases, feed required for pigs because of its contribution as a source of energy and protein (velayudhan, 2015). during 2019, colombia presented an approximate consumption of 580 thousand tons of corn, 350 thousand tons of soybean and 1 million tons of concentrate feed to produce 446,602 tons of pork meat (ministry of agriculture and rural development, 2020).to guarantee good levels of profitability and competitiveness, it is necessary to look for feed alternatives that reduce the high costs represented by the purchase of corn and soybean, which make small-scale swine production unfeasible (silva et al, 2018). in colombia, non-timber forest resources (ntfp) are found in great diversity and with potential to be used as raw materials for animal feed (gonzalez et al, 2017). the work carried out by bessada et al. (2019) indicated that the woody perennial fodder plants have been used by different authors highlighting the nutritional quality due to the great contribution of protein and high levels of digestibility, indicating that a high potential in animal feed. the implementation of sustainable and innovative strategies that contribute to agricultural productivity and planning, which may have a direct relationship with education, training, the organizational structures of the community, and the financial capacity of the same. (forero et al., 2013). where, it is possible to highlight the generation of social capital for access to markets by the hand of agribusiness and the strengthening of governance (freitas, et al., 2021), which, if not addressed, would cause production systems to present difficulties in the supply of food. quality and efficient food due to the availability of the ecosystem resources of the territories ( hanisch et al., 2019). from the same perspective, it is stated that the agricultural production systems derive from the non-use of the forest potentialities and another biodiversity of the territory in the low social conditions, the absence of projects for the use of natural resources, the ignorance of the cosmovisions of the population, as well as the lack of economic capital for productive modernization (hernández et al., 2017). furthermore, there is a high relationship between the use of non-timber forest resources with sex, age, family composition, the importance of the forest, and the productive infrastructure of agricultural systems. (mushi et al., 2020; walle and nayak, 2020) therefore, the objective of this research was to analyze the socioeconomic factors that affect the use of ntfp as a food supplement in swine production systems in the natural region of the colombian amazon. regions of high biodiversity effective in promoting the sustainability of the territory and the orientation of public policies in rural management from small rural producers and bioeconomy models around the forest. (ao, et al., 2021; piplani and smith, 2021). materials and methods 320 j. indonesian trop. anim. agric. 47(4):318-327, december 2022 in order to achieve the proposed objective, a methodological design was implemented according to the guidelines of hernandez et al., (2018), which was descriptive transectional in scope, where information was collected through a structured survey of 44 units swine production distributed in the municipalities of san vicente del caguán (25 units), cartagena del chaira (03 units), albania (5 units), puerto rico (08 units) and el doncello (03 units) belonging to the department of caquetá (figure 1). these units were selected using a non-probabilistic method based on selection criteria established by the descriptors of the respective research variables and the characteristics of the small producers. the selection criteria for the lands were: a) swine production systems, b) the land has at least one (01) ha-1 of forest area, c) 70% of the income comes from agricultural activities, d) 80% of the assets are destined to the development of agricultural activities, and e) minimum 5 years of experience in the development of agricultural activities. the data collected from the surveys were systematized around four (04) fixed factors about thentfps , which are related to 10 social factors and 42 economic factors that were analyzed from a quantitative approach. principal component analysis (pca), using the statistical package "factominer" (husson et al., 2016) and the "factoextra" package (kassambara and mundt, 2017) were used to group the dimensions of the respective factors. in the pca performed for the social and economic factors, only those that presented a significant contribution with a percentage of variance explained greater than 10% of the components were selected (table 1), which gives 22 economic factors and 10 social factors. next, the correlation matrix was constructed to jointly analyze the incidence of the social factors and the economic factors selected in the pca on the fixed factors that affected the use of the ntfp. pearson's correlation test (p-value > 0.05) was used for this purpose using the statistical package "corrplot" (wei and simko, figure 1. the observation unit of the study was the department of caquetá located in the natural region of the colombian amazon, where five municipalities that concentrate the highest livestock production are prioritized. source: own data from arcgis. use of non-timber forest products in swine production (v. j. b. martínez) 321 2021). all analyses were performed using r statistical software version 4.0.5 (team, r. c., 2021), using the programming language rstudio version 1.3.1 (rstudio team, 2021). results and discussion the main problems of the pig units of the prioritized municipalities in the department of caquetá are high production costs, environmental problems, livestock diseases and low productivity. this shows the lack of knowledge transfer on the sustainable use of the ntfp and other potentialities of the amazonregion, causing dependence on commercial inputs and low levels of competitiveness of the sector (figure 2). this is different from rahman and islam (2021) statement that ntfps play a vital role in the livelihoods improvement of production systems around forests. where, the importance of designing sustainable management strategies that link the protection and use of the forest in the supply of ecosystem services, which have a direct relationship with the economy and livelihoods of rural producers, is emphasized. (strand et al., 2018; talukdar et al., 2021). social factors that affect the use of ntfp in swine production units. the principal components analysis (pca) explained that 33.19% of the cumulative variance of the social factors of the swine production units of the prioritized municipalities of the department of caquetá. the figure 3.a and 3.b shows that 68.1% of the units studied have a directly proportional relationship between the main problems of the economic activity (sf7), with the table 1. fixed and socioeconomic factors of the swine production system code economic factor code economic factor fixed factors ef1 total grouped hectares. ef31 transient crop area. know about amazonntfp. ef2 access road to the productive unit. ef34 non-arable land. know about production periods of ntfp. ef7 type of assistance last year. ef37 actions taken against environmental events. identified ntfp. ef8 technical assistance practice. ef40 facilities with ceiling. knowledge of ntfp for animal nutrition. ef9 source of monetary resources ef41 facilities with flooring. ef42 facilities with divisions. ef10 reason for the loan. code social factor ef11 loan amount. sf1 health system affiliation. ef12 received financial support. sf2 land tenure. ef15 irrigation system. sf3 time of agricultural activity. ef16 type of feeding. sf4 family composition. ef18 marketing products. sf5 no. minors. ef20 environmental study. sf6 schooling level of producers. ef22 purpose of production. sf7 principal problems productive unit. ef23 income contribution level. sf8 forest importance in productive unit. ef27 rest area. sf9 attitude towards quality of life. ef30 area of stubble. sf10 forest conservation for water. 322 j. indonesian trop. anim. agric. 47(4):318-327, december 2022 degree of knowledge that the producers have about the nutritional components of the ntfp in animal feed. likewise, it is evident that the level of knowledge of the production periods of ntp has a positive correlation with the time of agricultural activity (sf3) and the perception of the level of importance of the forest in the respective productive units (sf8). in the face of this, strand et al. (2018) stated that it is necessary to develop training strategies for producers for the conservation and sustainable exploitation of the forest. at the same time, 15.9% of the production figure 2. the main problems of the swine units of the prioritized municipalities of the department of caquetá are high production costs, environmental problems, livestock diseases and low productivity. figure 3. principal component analysis (pca) a. biplot with selected social factors in swine production system. b. observations grouping by similarity (clustering analysis). c. observations grouping according to ntfp use. * n: number of observations according to each group. use of non-timber forest products in swine production (v. j. b. martínez) 323 units expressed the social factors that address the level of formal schooling of producers (sf6), the attitude towards quality of life (sf9), land tenure (sf2) and family composition (sf4). despite having a positive correlation between them, they do not have a positive correlation with the knowledge and management of ntfp in animal feed. this highlights that the lack of knowledge or guidance on the nutritional potential of ntfp has generated that 97.7% of swine production units did not use of these forest resources present in the natural region of the colombian amazon (figure 3.c), which is a negative scenario in terms of economic reactivation and sustainable industrialization. in view of the above, maua et al. (2020) stated that the management of ntfp utilization should systematically and comprehensively consider the general, ecological, harvesting, cultural, social and market factors related to rural productive units. likewise, ullah et al. (2021) and alcântara et al. (2022) considered that despite the difficulties of community organization, the use of forest resources is highly related to the socioeconomic and environmental benefits of local agricultural production systems. economic factors that affect the use of ntfp in swine production units. with regard to the economic factors, the pca explains 36.5% of the cumulative variance in the figure 4.a and 4.b; and 75% of the pig production units in relation with the use and knowledge of the ntfp have a directly proportional relationship (1) to the total hectares of the land (ef1), (2) to the availability of external financing sources (ef10, ef11) and (3) to the type of technical assistance (ef7) relevant to the sustainable development of the economic activity. on the other hand, there is an inverse correlation between the use of ntfp and the factors related with the management of areas that was not used for pig production (ef27, ef30, ef31, ef34). the level of income contribution (ef23) and the investments promote mitigation actions in the face of environmental events (ef37). as for the factors that deal with the conditions of the swine facilities (ef40, ef41, ef42), they present a null correlation. from this fact, it can be inferred that pig production units did not take advantage of the ntfp in contexts where the sources of financing (ef10, ef11) and the type of technical assistance (ef7) are limited and insufficient for the implementation of new production practices. in this regard, lopes et al. (2019) and masoodi et al. (2020) stated that agricultural activities carry out exploitation of ntfps in proportion to the dis figure 4. principal component analysis (pca) a. biplot with selected ecomomic factors in swine production system. b. observations grouping by similarity (clustering analysis). c. observations grouping according to ntfp use. * n: number of observations according to each group. 324 j. indonesian trop. anim. agric. 47(4):318-327, december 2022 tance from the forest, undermining the conservation role of environmentally important areas, where poor and marginal communities lack elements for forest utilization and improvement of living conditions. ntfp and relationship with socio-economic factors of the pig units. in this way, it is possible to define the relationships between the socio-economic factors and the fixed factors of the use of the ntfp. in the first instance, the knowledge about the ntfp of the natural region of the colombian amazon has a high correlation with the identification of these resources by the producers, which is a moderate correlation with the time of exercising the economic activity (sf3), and a very low correlation with the practice of technical assistance (ef8) and the amount of financing through credits (ef11). at the same time, the identification of ntfp has a moderate correlation with the type of feed provided to pigs (ef16) and the time of economic activity (sf3). equally, understanding the nutritional components of ntfp in the feeding of livestock shows a moderate correlation with the type of technical assistance received (ef7) and practiced by the producers (ef8). thus, the use of ntfp by pig farmers shows a moderate correlation, but not less important, with the economic factors surrounding credit financing (ef10, ef11) and thenon-arable lands (ef34) of the farmers' respective lands (figure 5). this can be related to the fact that the lack of trust in the institutional framework and the absence of public policies on ntfp management figure 5. pearson correlation matrix with socials (red color) and economics (gray color) factors in swine production system, interactions without color are not significant (p-value >0.05). use of non-timber forest products in swine production (v. j. b. martínez) 325 limit the use of these inputs in pro-social, proeconomic and pro-environmental production systems. (authelet et al., 2021). throughout the study, the socio-economic factors that affect the sustainable use of ntfp in animal feed in the farming units of the prioritized municipalities of the department of caqueta were analyzed. the findings were significant for several reasons. first, the results indicate that the problems are related to the dependence on the supply of inputs for the production of concentrate, which generates high costs in production and wastes the comparative advantages of the territory. simultaneously, it was found that environmental conditions, production levels and the healthiness of the livestock aggravate the productive efficiency of small pig farmers. second, when analyzing the social factors that influence the use of ntfp, it was identified that the level of knowledge that producers have about these resources are directly related to the potential use in livestock feed. this could be considered a significant contribution to pig productivity from a differential and endogenous approach of the territory, even more so when the forest is considered as an important element in the lands and supports the experience of the producers in carrying out this economic activity. third, it was observed that within the framework of the economic factors, the sources of financing through credits and technical assistance for the use of ntfp in swine feeding are determinant. conclusion it is indicated that the problems are related to the dependence on the supply of inputs for the production of concentrate, which generates high production costs and wastes the comparative advantages. simultaneously, environmental conditions, production levels, and livestock health were found to aggravate the productive efficiency of small-scale pig producers. next, it is identified that the level of knowledge about these resources is directly related to their potential use in pig feeding. finally, it is defined that the sources of financing through credits and technical assistance for the use of ntfp in pig feeding are decisive for their use. considering the above, it is possible to recommend that the fixed factors that helped in the analysis of the socio-economic factors related to the use of the ntfp should be worked between the technical-scientific knowledge combined with the expertise of local producers that allow an endogenous and sustainable development in reason of the potential particularities of the territory. acknowledgments the authors would like to thank the small pig producers of the municipalities of albania, cartagena del chaira, el doncello, puerto rico and san vicente del caguán in the department of caqueta, colombia for all the willingness and support for the development of this research. likewise, to the ocad of the science, technology and innovation fund of the general system of royalties of colombia (sgr) that through agreement no. 78 of august 21, 2019 approves the funding of the project identified with the code bpin 2018000100107 called "use of agro-industrial and non-timber forest resources in animal feed -arainmbain the municipalities of cartagena del chairá, albania, san vicente del caguán, el doncello, puerto rico.finally, to the universidad de la amazonia for being the executing and co-financing entity of the project. references alcântara, m., r. de lucena and d. da cruz. 2022. toward sustainable production chain by swot-ahp analysis: a case study of fava d'anta (dimorphandra gardneriana tulasne) production chain. environ. dev. sustain. 24: 2056-2078. ao, g., q. xu, q. liu, l. xiong, f. wang, and w. wu. 2021. the influence of nontimber forest products development on the economic-ecological coordination 326 j. indonesian trop. anim. agric. 47(4):318-327, december 2022 evidence from lin’an district, zhejiang province, china. sustainability. 13(2):904. authelet, m., j. subervie, p. meyfroidt, n. asquith and d. ezzine-de-blas. 2021. economic, pro-social and pro-environmental factors influencing participation in an incentive-based conservation program in bolivia. world dev. 145:105487. bessada, s.m., j.c. barreira, and m.b.p. oliveira. 2019. pulses and food security: dietary protein, digestibility, bioactive and functional properties. trends food sci. technol., 93: 53-68. forero camacho, c.a., g.h. rojas carvajal, and j.h. argüelles-cárdenas. 2013. capital social y capital financiero en la adopción de tecnologías ganaderas en zonas rurales altoandinas de colombia. cienc tecnol. 14 (2): 149-163. freitas, l. c., j.r. barbosa, a. l.c. da costa, f. w.f. bezerra, r.h.h., pinto and r.n. de carvalho junior. 2021. from waste to sustainable industry: how can agroindustrial wastes help in the development of new products?. resources, conservation and recycling, 169: 105466. gonzález, a. j., f.a.p. alcivar, m.p.r. rodríguez, o.f.m. jalca, and c.a.c. verdesoto . 2017. utilización de productos forestales no madereros por pobladores que conviven en el bosque seco tropical. j. cfores, 5(3): 270-286. hanisch, a.l., r.r. negrelle, r.a. bonatto, e.r. nimmo, and a.e.b. lacerda, 2019. evaluating sustainability in traditional silvopastoral systems (caívas): looking beyond the impact of animals on biodiversity. sustainability, 11(11): 3098. hernández-sampieri, r., c. fernández collado, and p. baptista lucio. 2018. metodología de la investigación. méxico: mcgraw-hill interamericana. vol. 4: 310-386. hernández-aguilar, j.a., h.s. cortina-villar, l.e. garcía-barrios, and m. a. castillosantiago. 2017. factors limiting formation of community forestry enterprises in the southern mixteca region of oaxaca, mexico. environmental management, 59(3): 490-504. husson, f., j. josse, s. le, and j.m. maintainer. 2016. package factominer. multivariate exploratory data analysis and data mining, 96: 698. walle, y. and d. nayak. 2021. analyzing households’ dependency on non-timber forest products, poverty alleviation potential, and socioeconomic drivers: evidence from metema and quara districts in the dry forests of amhara region, ethiopia. journal of sustainable forestry, 128. kassambara, a. and f. mundt. 2017. package factoextra extract and visualize the results of multivariate data analyses. r package version, 1(5): 337-354. lopes, e., b. soares, f. souza, r. rajão, f. merry, and s. ribeiro. 2019. mapping the socio-ecology of non timber forest products (ntfp) extraction in the brazilian amazon: the case of açaí (euterpe precatoria mart) in acre. landscape and urban planning, 188, 110-117. masoodi, h. and r. sundriyal. 2020. richness of non-timber forest products in himalayan communities—diversity, distribution, use pattern and conservation status. j. ethnobiology. ethnomedicine, 16(1), 1-15. maua, j.o., h. mugatsiatsingalia, j. cheboiwo, and d. odee. 2020. population structure and regeneration status of woody species in a remnant tropical forest: a case study of south nandi forest, kenya. gl. ecology. conservation, 21, e00820. ortiz-barrios, m., c. miranda-de la hoz, p. lópez-meza, a. petrillo, and f. de felice, 2020. a case of food supply chain management with ahp, dematel, and topsis. j. multi-criteria decision analysis, 27(1-2): 104-128. trujillo-diaz, j., f.n. diaz-piraquive, m.m. herrera, and j.g. acero. 2019. modeling the colombian swine supply chain from a knowledge management perspective. in international conference on knowledge use of non-timber forest products in swine production (v. j. b. martínez) 327 management in organizations. springer, cham. 25-35. silva, g. s., l.g. corbellini, d.l. linhares, k.l. baker, and d.j. holtkamp. 2018. development and validation of a scoring system to assess the relative vulnerability of swine breeding herds to the introduction of prrs virus. preventive veterinary medicine, 160: 116-122. mushi, h., p. yanda, and m. kleyer. 2020. socioeconomic factors determining extraction of non-timber forest products on the slopes of mt. kilimanjaro, tanzania. hum ecol 48: 695–707 lizardo, r., j. van milgen, j. mourot, j. noblet, and m. bonneau. 2002. a nutritional model of fatty acid composition in the growingfinishing pig. livestock production science, 75(2): 167-182. piplani, m. and c. smith. 2021. towards a global framework for analysing the forest -based bioeconomy. forests. 12(12):1673. rahman, m. h., b. roy, and m.s. islam. 2021. contribution of non-timber forest products to the livelihoods of the forest-dependent communities around the khadimnagar national park in northeastern bangladesh. regional sustainability, 2(3): 280-295. rstudio, r. t. 2021. integrated development environment for r. 2020. rstudio, pbc, boston, ma. available online: http://www. rstudio. com. strand, j., b. soares-filho, m.h. costa, u. oliveira, s.c. ribeiro, g.f. pires, and m. toman. 2018. spatially explicit valuation of the brazilian amazon forest’s ecosystem services. nature sustainability, 1(11): 657664. talukdar, n.r., p. choudhury, r.a. barbhuiya, and b. singh. 2021. importance of nontimber forest products (ntfps) in rural livelihood: a study in patharia hills reserve forest, northeast india. trees, forests and people, 3: 100042. team, r.c. 2021. r: a language and environment for statistical computing. http://www.r-project.org/ ullah, s., r.s. noor, a. abid, r.k. mendako, m.m. waqas, a.n. shah, and g. tian. 2021. socio-economic impacts of livelihood from fuelwood and timber consumption on the sustainability of forest environment: evidence from basho valley, baltistan, pakistan. agriculture, 11(7): 596. velayudhan, d. e., i.h. kim, and nyachoti. 2015. characterization of dietary energy in swine feed and feed ingredients: a review of recent research results. asian-australasian journal of animal sciences, 28(1): 1-13. wei, t. and v. simko. 2021. r package'corrplot'—visualization of a correlation matrix (version 0.90): github web site. j i t a a journal of the indonesian tropical animal agriculture accredited by ditjen penguatan risbang no. 60/e/kpt/2016 j. indonesian trop. anim. agric. pissn 2087-8273 eissn 2460-6278 http://ejournal.undip.ac.id/index.php/jitaa 43(4):438-444, december 2018 doi: 10.14710/jitaa.43.4.438-444 estrus and pregnancy rate of simmental-ongole crossbred and ongole grade heifer after being synchronized and inseminated s. sutiyono*, d. samsudewa and a. suryawijaya faculty of animal and agricultural sciences, diponegoro university, tembalang campus, semarang 50275 indonesia *corresponding e-mail: barep.sutiyono@gmail.com received february 19, 2018; accepted november 22, 2018 abstrak penelitian ini bertujuan untuk mengkaji hasil sinkronisasi estrus dan inseminasi buatan pada sapi dara peranakan ongole dan peranakan simental-ongole. materi yang digunakan adalah 19 ekor sapi peranakan ongole (po) dan 18 ekor sapi hasil silangan simental-ongole (sso). materi ditentukan secara purposive sampling dengan spesifikasi gigi seri sudah tanggal (poel) dan belum pernah bunting. materi diidentifikasi kenormalan organ reproduksinya dengan metode palpasi rektal, kemudian disinkronisasi berahi menggunakan 50 mg medroxy progesterone acetat dalam spon vagina, dan sapi dara yang mengalami berahi selanjutnya diinseminasi menggunakan semen beku. parameter penelitian adalah jumlah sapi dara yang mempunyai alat reproduksi normal atau abnormal, mengalami berahi dan bunting. analisis data menggunakan analisis deskriptif. hasil penelitian menunjukkan bahwa sapi po dan sapi sso yang mempunyai organ reproduksi abnormal masing-masing satu ekor (5.56%) dan 7 ekor (36.84%). respon sinkronisasi berahi sapi dara yang mempunyai organ reproduksi nomal dan abnormal pada sapi po masing-masing 94.17% dan 100%, sedangkan pada sapi pso 100% dan 42.86%, sedangkan hasil kebuntingan pada sapi po 70.59 dan 0.00%, sedangkan pada sapi sso 50.00 dan 0.00%. kesimpulan dari penelitian ini adalah jumlah sapi pso yang memiliki ketidaknormalan organ reproduksi lebih banyak dibandingkan sapi po. sinkronisasi berahi menggunakan 50 mg medroxy progesterone acetat dalam spon vagina dapat meningkatkan jumlah berahi dan kebuntingan pada sapi dara yang mempunyai organ reproduksi normal. kata kunci: sapi dara,sapi peranakan, berahi, bunting abstract the aim of the study was to examine the synchronization of estrus and artificial insemination in heifers of ongole grade and simental-ongole grade. the research used 19 ongole grade (og) and 18 simental-ongole crossbred (soc) heifers. this research applied purposive sampling to determine the research population. the criteria to select the population were heifers which have in mature body. the normality of heifer’s reproductive organs were identified by performing rectal palpation, then 50 mg of medroxy progesterone acetate on vaginal sponge was used to synchronized estrus. the estrus heifer was inseminated using frozen semen. the observed parameters were the number of heifers with normal and abnormal reproductive organs, estrus sign and pregnancy. data were analyzed descriptively. this study showed that og and soc with abnormal reproductive organs was 1 heifer (5.56%) and 7 heifers (36.84%), respectively. the responses of estrus synchronization in heifers with normal and abnormal reproductive organs were 94.17% and 100% in og, and 100% and 42.86% in soc. meanwhile, the pregnancy rate was 70.59 and 0% in og, and 50.00 and 0% in soc. in conclusion, the number of soc heifers with abnormal reproductive organs is higher than og. estrus synchronization using 50 mg 438 j.indonesian trop.anim.agric. 43(4):438-444, december 2018 medroxy progesterone acetate increase the amount of estrus and pregnancy in heifers with normal reproductive organs. keywords: grade cows, heifer, estrus, pregnant introduction mating is the process of generating offspring from male and female animals. the bull produces and ejaculates sperm while the cow produces ova, pregnant, partus, and nourishing the offspring. in cattle breeding, the female should have normal reproductive organs and physiology. the activity of reproductive organs affected to the rate of pregnancy (geres et al., 2011). heifers are essential in cattle breeding because they will be cows that reproduce in a long term (diskin and kenny, 2014). therefore, heifer should be carefully selected. reproductive performance of heifers is strongly influenced by genetic, conditions of weaning time, and the growth starting from weaning to puberty (pereira et al., 2017). genetic factors and poor growth can lead to organ abnormalities and physiology disorders of reproduction. the abnormality reproductive organ and physiological disorders are factors causing infertility and sterility in cow buffalo (azawi et al., 2008). abnormalities of reproductive tract and ovaries are factors causing infertility in goats, reaching 91.3% (mushonga et al., 2017). farmers in sukoharjo villages district still apply traditional method in raising their cattle with low knowledge on reproduction aspects. low succesfull rate of cattle production will contributes to food security and household income (nyamushamba et al., 2017). livestock breeding programs that correlate positively to their benefits are conventionally selected based on fertility (gizaw et al., 2010). the selection of cow based on reproductive organs was done by rectal palpation in order to determine normality of ovaries, uterus, cervix and vagina. the abnormalities in the reproductive organs occurred in womb or uterus, cervix, ovary, oviduct and vagina with the percentage of 70.8%, 64.6%, 60.0%, 49.2% and 38.5% respectively (kunbhar et al., 2003). the efforts to improve reproduction quality of the herds based on genetic is necessary. superior genetic identification in livestock populations can be used in the selection process. reproduction organ abnormality identification will continuously contribute quantitavely and qualitatively to improve genetic quality (haskell et al., 2014). synchronization is an attempt to make estrus in a livestock population appearing simultaneously (khumran et al., 2012). estrus synchronization makes estrus detection and artificial insemination (ai) efficient. in ai program, estrus detection and insemination are performed during 3-5 days (khumran et al., 2012) and in average insemination was done on 60 hours after the medication is stopped (echternkamp and thallman, 2011; mallory et al., 2011). the use of progesterone in estrus synchronization can increase the size of follicles which positively correlate to the quality of the ovum (pfeifer et al., 2012). the use of controlled internal drug release (cidr), ovsynch and norgestomet ear implant protocols resulted in 100% estrus with conception rates reach 60%, 50%, and 50%, and the overall of three cycles as 80%, 80%, and 70%. (dhami et al., 2015). intra vaginal progesterone implants that were sanitized in lactating primaparous and multiparous of holstein cows, affected reproductive variables, such as timing and synchronization of follicular wave emergence, and size of the ovulatory follicle (melo et al., 2018). response of estrus synchronization using 50 mg medroxy progesterone acetate in heifers and cows were 91.67% and 65.79% (sutiyono et al., 2014). estrus synchronization using progesterone in cidr followed by artificial insemination in beef cows can increase pregnancy by 7.1% (stevenson et al., 2015). on other hand, some case found that heifer with mature body did not come to the estrus cycle because of the reason of bad management and physiological disorder (sutiyono et al., 2017). therefore, need to do the research effect of estrus synchronization used medroxy progesterone acetate (mpa) to the estrus performance and pregnancy. the aim of this research was to examine the synchronization of estrus and artificial insemination in heifers of ongole grade and simental-ongole crossbred. materials and methods this research was conducted in polokarto, mojolaban and nguter district, sukoharjo regency. the materials used were 18 ongole estrus and pregnancy rate of heifer (s. sutiyono et al.) 439 grade (og) and 19 simmental-ongole crossbred (soc) heifers. the materials were selected using purposive sampling by selecting the heifers which mature body. materials (og and soc) were identified as having normal or abnormal reproductive organs used rectal palpation for observation of the cow. the number of og and soc having normal and abnormal reproductive was 17 and 1; 12 and 7, respectively. the heifers were synchronized with 50 mg medroxy progesterone acetate. medroxy progesterone acetate was applied using vaginal sponge for 17 days. on the day-18, the vaginal sponge was removed. estrus was observed three times a day (8:00 am to 09:00 am; 12:00 noon to 01:00 pm; and 04:00 pm to 05:00 pm). heifers that responded to the synchronization were inseminated using frozen semen of pure simmental bull. parameters observed in this study were the normality of reproductive organ, the rate of estrus and pregnancy. here is the method to determine abnormality in reproduction, estrus and pregnancy in heifers: a. reproductive organ disorders were abnormalities in ovaries, uterus (corpus and cornua), cervix and vagina, which were determined by rectal palpation. b. estrus of the heifers was determined using an indicator of uterine tension (recommended by inseminator), vocalization, redness vulva and mucous discharge. c. pregnant cow was determined based on the rectal palpation diagnosis 4 months after ai. data analysis the data of the number of heifers with normal and abnormal reproductive organs, estrous and pregnancy were analyzed descriptively (abebe et al., 2000). results and discussion reproductive organs female reproductive organs have a very important role in the success of generating offspring. female reproductive organs produce ova and reproductive hormones, copulation, sperm duct, the site of fertilization, fetal growth and birth canal. abnormality in female reproductive organs can cause infertility or sterility. normality and abnormality of reproductive organs through rectal palpation of og and soc heifers are presented in table 1. table 1 shows that the number of og heifers was only one (5.56%) which was abnormal cervix. meanwhile, soc had 7 abnormal reproductive organs (36.84%) which were in ovary, uterus or womb, vagina and cervix 3, 2, 1 and 1 respectively. abnormalities in the ovary were undeveloped follicle and one follicle was small in size. the uterus was asymmetric, and the cornua was twisted. the cervix was small in size and the vagina was narrower. the percentage of abnormal reproductive organs in soc (36.84%), higher than og (5.56%). the high percentage of reproductive organ abnormalities in soc can be affected by genetic and nutritional factors. abnormal reproductive organs can be caused by abnormal growth and by the interaction of genes from both parents (connell et al., 2013). abnormalities in soc reproductive organs were the result of interactions between of bos taurus and bos indicus gene. the differences shown in 440 j.indonesian trop.anim.agric. 43(4):438-444, december 2018 table 1. appearance of reproductive organs ongole grade and simmental-ongole crossbred, different age-based dental series release (gsr) gsl ongole grade simmental-ongole crossbred sample (n) normal abnormal sample (n) normal abnormal …………………………………….. head …………………………………… 1 11 11 0 9 5 4 2 3 2 1 6 3 3 3 0 0 0 0 0 0 4 4 4 0 1 1 0 total 18 17 1 19 12 7 % 100 94.44 5.56 100 63.16 36.84 genetic characteristics between bos taurus and bos indicus as well as some of their physiological and behavioral differences (nogueira, 2004). the quality of feed given by local farmer was generally low (nyamushamba et al., 2017), and low quality feed given during the growth, since weaning period, tends to be the cause of abnormalities in reproductive organ (izquierdo, 2016). abnormalities in reproductive organs of female animals can occur in the ovary, oviduct, uterine, vaginal and cervix. response of estrus synchronization and artificial insemination estrus synchronization is a reproductive technology to make a herd of cows in estrus simultaneously for the efficiency of ai. another benefit of estrus synchronization is to produce heifers with similar body weight, therefore it will be easier to manage. the result of estrus synchronization and ai in og and soc which had normal and abnormal reproductive organs is shown in table 2. the estrus table 2 shows that og and soc having normal reproductive organs responded to estrus syncronized were 16 (94.17%) and 12 (100%), respectively, while they having abnormal reproductive organs were 1 (100%) and 3 (42.86%), respectively. the heifers which had abnormal reproductive organs still responded to synchronization only if they still had an active ovary. basically, estrus syncronization works by using progesterone to inhibit the production of the follicle stimulation hormone (fsh), thus, after the treatment is stopped, the follicle is no longer growing. graafian follicle growth was followed by egg cell maturation process (khumran et al., 2012). the response of estrus sync process using progesterone was influenced by body condition, nutrition and ovaries activity. the reproductive disorders of heifers and cows tended to be caused by body conditions, which are reflected in the body condition score (bcs) which is 1-3 with maximum score 9 (sutiyono et al., 2018). nutritional supplementation given significantly affected the condition of the body and the quality of cell produced so that it can be repaired the reproduction process (marume et al., 2014). nutritional deficiency affected hypothalamus to produce gonodotrophin releasing hormone (gnrh) and pituitary gland for the production of fsh and lh low so that ovary activity lasts longer (pradhan and nakagoshi, 2008 and bindari et al., 2013). teshome et al. (2016) stated that the failure of ovulation was caused by neuroendocrine disorders in the hypothalamus, pituitary and ovary. good quality feed given to weaning calves will lead to a good performance of reproductive organ for breeding (izquierdo, 2016). meanwhile imperfect growth due to genetic interaction and nutritional deficiency will lead to deformity and reproductive organ activity disorders (patel et al., 2012). the pregnancy table 2 shows that pregnant heifers having normal and abnormal reproductive organs in og were 70.59 and 0%, respectively, while in soc were 50 and 0%, respectively. the percentage of pregnant heifers with normal reproductive organs was high. it was because both groups of heifers had no history of reproductive physiological abnormalities. synchronization using progestagen was useful to increase progesterone concentration in blood during luteal phase. this can provide bigger ovulatory follicle which positively correlates to the success of pregnancy estrus and pregnancy rate of heifer (s. sutiyono et al.) 441 table 2. number of heifers estrus and pregnant from heifer having normal and abnormal reproductive organ parameters ongole grade simmental-ongole crossbred normal (n=17) abnormal (n=1) normal (n=12) abnormal (n=7) head % head % head % head % estrus 16 94.17 1 100 12 100 3 42.86 pregnant 12 70.59 0.00 0.00 6 50.00 0.00 0.00 (echternkamp and thallman, 2011; mallory et al., 2011). the provision of balanced nutrition significantly affects body condition and the quality of genital cells produced. thus, this increases pregnancy (marume et al., 2014). estrus synchronization in cattle using controlled internal drug release (cidr) containing 1.38 g progesterone resulted in 44.4% of pregnancy after ai (beuchat et al., 2012). the failure of pregnancy in heifers having normal reproductive organs can be influenced by management of local farmer, hormonal disturbances, reproductive organ infections and low sperm quality. but, in this research the quality of semen is good with 70% motility and 12% abnormality. this quality is fulfill the standarization of semen (samsudewa et al., 2018). repeated breeding caused by raising management, storage of hormone and infections of reproductive organs in cattle were 1.70, 18.03 and 14.75% respectively (singh et al., 2008). nutritional deficiency will decrease the activity of reproductive organs resulting in failure in pregnancy (geres et al., 2011). the high rate of pregnancy failure in soc (50%), may be caused by physiological disorders (failure or fertilization and implantation). in this research the cow with abnormalities reproductive organ was not successfull to be pregnant (0%). according to nogueira (2004), the strains formed from bos taurus and bos indicus can cause physiological or reproductive organ abnormalities. the failure of pregnancy in heifers is likely due to nutritional deficiency. nutritional deficiency in heifer is the cause of delayed puberty. meanwhile in cows, the causes are fertilization failure and embryo death in early pregnancy (izquierdo, 2016) table 2 shows that all soc and og having abnormal reproductive organs were not pregnant. normal reproductive organs highly support the process of pregnancy (geres et al., 2011), and high rate of abnormalities in reproductive organs of female herds indicates that the fertility of the herd was low (patel et al., 2012). abnormalities of female reproductive organs in ovaries, uterus, cervix, oviduct, and vagina occur mostly in growth period due to genetic and environmental factors that adversely affect reproductive process (connell et al., 2013). abnormality in ovary causes the ova produced to have low quality. in fallopian tube, it causes fertility failure. abnormality in uterus causes sperms to fail to reach the site of fertilization. in cervix and vagina, it causes difficulty in mating and performing artificial insemination. ovary abnormalities are the main factors causing the failure of ova production, whereas the failure of implantation and pregnancy was caused by endometrial disorder (connell et al., 2013). conclusion the number of simmental-ongole crosbred having abnormal reproductive organs was higher than ongole grade. estrus synchronization using progesterone improved reproduction performance of heifers which have normal reproductive organs, but not in heifers which have abnormal reproductive organs. in breeding process, heifers should be selected carefully, and the breeder should make sure that the selected heifers have normal reproductive organs in order to reproduce successfully. acknowledgement this research was funded by the research program and application of science and technology, research and development (research and development) in central java for fiscal year 2016. refferences abebe, a., j. daniels and j.w. mckean. 2000. statistics and data analysis. western michigan university, kalamazoo, mi. azawi, o.i., a.j. ali and e.h. lazim. 2008. pathological and anatomical abnormalities affecting buffalo cows reproductive tracts in mosul. iraqi j. vet. sci. 22(2):59-67. beuchat, f., p. berthold, l. gerber, r.m. bruckmaler, a. steiner, j. husler and g. hirsbrunner. 2012. conception rate using the select-synch protocol in combination with a lower dose progesterone-releasing intrvaginal insert (1.38 g) in swiss dairy cows. j. vet. med. 3: 6-10. bindari y.r., s. shrestha, n. shrestha and t.n. gaire. 2013. effects of nutrition on reproductiona review. adv. app. sci. res. 4 (1): 421-429. connell, m.t., c.m. owen and j.h. segars. 2013. genetic syndromes and genes involved in the development of the female reproductive tract: a possible role for gene therapy. j. genet. syndr. gene. ther. 4:127. dhami, a.j., b.b. nakrani, k.k. hadiya, j.a. 442 j.indonesian trop.anim.agric. 43(4):438-444, december 2018 patel and r.g. shah. 2015. comparative efficacy of different estrus synchronization protocols on estrus induction response, fertility and plasma progesterone and biochemical profile in crossbred anestrus cows. vet. world. 8(11):1310-1316. diskin, m.g. and d.a. kenny. 2014. optimising reproductive performance of beef cows and replacement heifers. anim. 8(1):27-39. echternkamp, s.e. and r.m. thallman. 2011. factors affecting pregnancy rate to estrous synchronization and fixed-time artificial insemination in beef cattle. j. anim. sci. 89: 3060-3068. geres, d., b. zevrnja, d. zubcic, r. zobel, b. vulic, n. staklarevicn and k. gracin. 2011. asymmetrical functional activities of ovaries and tubular part of reproductive organs of dairy cows. vet. arhiv. 81(2): 187-198. gizaw. s., h. komen and j.a.m. van arendonk. 2010. participatory definition of breeding objectives and selection indexes for sheep breeding in traditional systems. livest. sci. 128:67-74 haskell, m.j., g. simm and s.p. turner. 2014. genetic selection for temperament trait s in dairy and beef cattle. front genet. 5:368. izquierdo, a.c. 2016. best practices in animal reproduction: impact of nutrition on reproductive performance livestock. j. adv. dairy res. 4(1): 1-4 khumran, a.m, y.rosnina, m.o. ariff, h. wahid, g. dhaliwala, m.p. khanh, k.c. yap, m. fahmi and m.e. asmil. 2012. comparison of estrus and pregnancy rates of beef cows synchronzed whit progesterone and protaglandin bases protocols. j. anim. vet. adv. 11(9): 3561-3567. kunbhar h.k., m.u. samo., a. memon and a.a. salangi. 2003. biometrical studies of reproductive organ of thari cow. pakistan j. of biol. sci. 6(4): 322-224 mallory, d.a., j.m. nash, m.r. ellersieck, m.f. smit, and d.j. patterson. 2011. comparison of long-term progestin-based protocols to synchronize estrus before fixed-time artificial insemination in beef heifers. j. anim. sci. 89:1358-1365. marume, u., n. t. kusina, h. hamudikuwanda, m. ndengu and o. nyoni. 2014. effect of. dry season nutritional suppementation on fertility in bulls in sanyati smallholder farming area, zimbabwe. afr. j. agric. res. 9(1): 34-41. melo, l.f., p.l.jr. monterio, a.b. nascimento, j.n. drum, c. spies, a.b. prata, m.c. wiltbank and r. sartori. 2018. follicular dynamics, circulatingl.f progesterone, and fertility in holstein cows synchronized with reused intravaginal progesterone implants that were sanitized by autoclave or chemical disinfection. j. dairy sci. 101(4):35543567. mushonga, b., s. twiyizeyimna, g. habarugira, e. kandiwa, s. chinyoka, a. samkange, and a. bishi. 2017. study of incidence of gross urogenital lesions and abnormalities on does slaughtered at nyagatare slaughterhouse, eastern province, rwanda. j. vet. medic. article id 7564019: 1-7. nogueira, g.p. 2004. puberty in south american bos indicus (zebu) cattle. j. elsevier anim. reprod. sci. 82-83:361-372. nyamushamba, g.b., c. mapiye, o. tada, t.e. halimani, and v. muchenje. 2017. conservation of indigenous cattle genetic resources in southern africa’s smallholder areas: turning threats into opportunities. asian-australas j. anim. sci 30(5):603-621. patel, d.j., a.j. patel, r.k. patel and p.r. parekh. 2012. chromosomal analysis of breeding bull using lymphocyte culture. bangladesh vet. 29:17-21. pereira, g.r., j. o. j. barcellos, a.g. sessim, j.u. tarouco, f.d. feijo, j.b. neto, ê.r. prates and m. e. a. canozzi. 2017. relationship of post-weaning growth and age at puberty in crossbred beef heifers. r. bras. zootec. 46 (5):413-420 pfeifer, l.f.m., s.c.b.s. leal, a. schneider, e. schmitt, m.n. correa. 2012. effect of the ovulatory follicle diameter and progesterone concentration on the pregnancy rate of fixed-time inseminated lactating beef cows. r. bras. zootec. 41(4):1004-1008. pradhan, r. and n. nakagoshi. (2008) reproductive disorders in cattle doe to nutritional status. j. inter. develp. coop. 14(1):45-66. samsudewa, d., s.s. capitan, c.c. sevilla, r.s.a. vega and p.p. ocampo. 2018. hematologic profile and semen quality of male timor deer (rusa timorensis) in various hierarchies. iop. conf. series: earth environ. sci. 119(1):012027. sing, j., d. dadarwal, m. honparkhe and a. kumar 2008. incidences of various estrus and pregnancy rate of heifer (s. sutiyono et al.) 443 https://www.ncbi.nlm.nih.gov/pubmed/?term=melo%20lf%5bauthor%5d&cauthor=true&cauthor_uid=29428754 etiological factors reponsible for repeat breeding syndrome in cattle and buffaloes. j. vet. med. 6(1):87-91. sutiyono, d. samsudewa and a. suryawijaya (2014) dampak sinkronisasi berahi menggunakan progesteron terhadap berahi dan kebuntingan sapi betina milik rakyai kabupaten sukoharjo. j. litbang provinsi jawa tengah, 12(1):27-32. sutiyono, d. samsudewa dan a. suryawijaya. (2017). identifikasi gangguan reproduksi sapi betina di peternakan rakyat. j. vet.. 18(4):580-588 stevenson, j.s., s.l. hill, g.a. bridges, j.e. larson and g.c.lamb. 2015. progesterone status, parity, body condition, and days postpartum before estrus or ovulation synchronization in suckled beef cattle influence artificial insemination pregnancy outcomes. j. anim. sci. 93: 2111–2123. teshome, e, a. kebede, n. abdela and w.m. ahmed. 2016. ovarian cyst and its economic impact in dairy farms. global vet. 16(5):461-471. 444 j.indonesian trop.anim.agric. 43(4):438-444, december 2018 j i t a a journal of the indonesian tropical animal agriculture accredited by ditjen penguatan risbang no. 60/e/kpt/2016 j. indonesian trop. anim. agric. pissn 2087-8273 eissn 2460-6278 http://ejournal.undip.ac.id/index.php/jitaa 42(4):233-239, december 2017 doi: 10.14710/jitaa.42.4.233-239 predicting the age and weight at puberty of ongole grade cattle using nonlinear mathematical model in kebumen farmer association d. maharani1,*, a. h. k. amrullah1, d. t. widayati1, sumadi1, a. fathoni1 and m. khusnudin2 1faculty of animal science, universitas gadjah mada, jl. fauna no. 3, bulaksumur, yogyakarta 55281 indonesia 2kebumen po cattle breeder association (aspokeb), tanggulangin village, klirong subdistrict, kebumen, jawa tengah indonesia *corresponding e-mail:d.maharani@ugm.ac.id received april 28, 2017; accepted july 28, 2017 abstrak penelitian ini bertujuan untuk mengevaluasi penggunaan model matematika non-linear dalam memprediksi umur dan bobot saat pubertas sapi peranakan ongole (po). data yang digunakan berupa catatan bobot badan (768) ekor sapi po, mulai dari umur baru lahir (<1 bulan) sampai dewasa (60 bulan), dan telah dikumpulkan oleh asosiasi peternak sapi po kebumen (aspokeb) kebumen dari tahun 2013 sampai 2015. ternak sapi dipelihara oleh kelompok ternak yang berada di enam kecamatan yaitu kecamatan mirit, lembu purwo, ambal, puring, petanahan, dan puring yang berada di kabupaten kebumen, jawa tengah. analisis data menggunakan model matematika brody, bertalanfy, logistic, dan gompertz. hasil analisis menunjukkan bahwa tingkat kesesuaian dari keempat model tersebut dapat digolongkan dalam kategori tinggi (r2>0.70). bobot dewasa (a) sapi po paling tepat diprediksi oleh model logistic (349 kg) dan gompertz (358 kg). model logistic paling tepat dalam memprediksi bobot pubertas (174 kg) sapi po, akan tetapi seluruh sapi yang diamati masih pada fase follikuler. kata kunci: bobot dewasa, titik belok, logistic, gompertz, smear vagina abstract this research is aimed to evaluate the nonlinear mathematical model in predicting the age and weight of kebumen ongole grade (po) cattle at puberty. the data used in this research was weight recordings of (768) po cattle, ranging from calf (< 1 month) to adult (60 months), collected by kebumen po cattle breeder association (aspokeb) from 2013 to 2015. these cattle were reared by a group of farmers located in six sub-districts: mirit, lembu purwo, ambal, puring, petanahan, and klirong in kebumen district, jawa tengah province. brody, bertalanfy, logistic and gompertz mathematical models were used to analyze the data. the analysis showed that the r2 of the four models classify high in the category (r2 >0.70). mature weight (a) of po cattle predicted by logistic (349 kg) and gompertz (358 kg) were most appropriate. out of the four models, the logistic model was the most accurate in predicting the weight at puberty (174 kg) of po cattle, but all observed cattle are still in the follicular phase. keywords :inflection point, mature weight, logistic, gompertz, vaginal smear age and weight at puberty of ongole grade cattle (d. maharani et al.) 233 introduction ongole grade (po) cattle is the result of crossbreeding between javanese cattle with ongole cattle from india (starting from 1904). it was then developed from generation to next generations by the people in central java and east java provinces. through decree no. 2841/kpts/lb.430/8/2012, po cattle is recognized as a local breed by the indonesian government. po cattle has grown into an established breed with recognized morphological characteristics. po cattle has the advantages of tropical cattle such as adaptability in tropical climate, resistance to heat and parasites, and good tolerance to cattle feed containing a high crude fiber (astuti, 2004). the cattle are raised with a traditional system in which every farmer has two to three cattle with varying raising environment, enabling it to have a varied biologic potential. since its development, little effort has been made to improve its biological and genetic potential. body weight is believed to be the most important trait in evaluating the cattle production capacity (lee et al., 2014). body weight is affected by the growth rate of each individual animal. budimulyati et al. (2012) states growth was divided into two phases, positive and negative. growth rate accelerates during the positive phase, while on the negative phase the growth rate decreases. the transition point from the two different phases will pinpoint the inflection point of a cattle growth graph. determining the transition point requires an appropriate model, for conventional models only use a regressing linear calculation that are not able to explain the phenomena (brody, 1945). the age of puberty and growth rate can be described in a growth curve. in turn, growth curve can be described using mathematical models. the appropriate mathematical model which is easy to interpret biologically and analytically is the nonlinear model (maharani et al., 2001). the mathematical models that are commonly used are brody, von bertalanfy, gompertz, and logistic (budimulyati et al., 2012). the application of nonlinear mathematical model had been done on some research such as saanen goat growth (rocha et al., 2015), fat tailed goat growth (hamouda and atti, 2011), and male gujarat cattle growth (loaiza-echeverrri et al., 2013). in indonesia, the application of nonlinear mathematical models was growth and age puberty in brahman cross cattle (maharani et al., 2001), holstein frisian cattle growth (budimulyati et al., 2012) and rabbit growth (setiaji et al., 2013). the application of nonlinear mathematical model to predict the puberty age and growth rate of po cattle has never been done. the results of this study supposed to be useful for kebumen po cattle breeder association (aspokeb) to select their cattle based on desire trait which can be predicted using the appropriate model. moreover, selection animals based on the recording data will be more value economically. therefore, the objecive of the study was to evaluate the application of nonlinear mathematical model in predicting age and weight during puberty of female ongole grade cattle which are owned and bred by aspokeb. materials and methods data collection the data used in this study were body weight of 768 female po cattle, from the age of birth (< 1 month) to mature (66 months). these cattle are from six sub-districts mirit, lembu purwo, ambal, klirong, petanahan, and puring. the cattle weight data are collected by po cattle breeder association (aspokeb) from the year 2013 to 2015. the data used consist of body weight and the age of the cattle. cattle age data was obtained from recordings in each breeder group, which were then calculated to determine the age of each cattle. body weight data is obtained from recording cattle weighing from the year 2013 to 2015. the weighing of body weight was done using a cattle scale with a 1000 kg capacity and an error margin of 1 kg. the type of data used are cross sectional data, in which data collection were performed by measuring the weight of individual cattle in a certain age group, followed by the measurement of other individual samples within the same population (fitzhugh, 1976). mathematical model the mathematical models used consisted of brody, von bertalanfy, logistic, and gompertz, as explained by forni et al. (2014) and budimulyati et al. (2012). the equations of mathematical models are presented in table 1. determining onset of puberty determining the age and weight at puberty was performed by discovering the inflection point in the growth curve. inflection point is a 234 j.indonesian trop.anim.agric. 42(4):233-239, december 2017 maximum point of growth in body weight. at that point there is a shift change showing the acceleration of the growth becomes slow down in growth. at that point the animals reach their puberty (brody, 1945). inflection point was performed by using equations of mathematical model as presented in table 1. vaginal smear test was used to determine the best mathematical model in predicting age puberty. vaginal smear test was conducted by rubbing a cotton bud that has been moistened with aquadest on the walls of the vagina, which then smeared onto glass slides. next, the slides were soaked with 70% alcohol for 5 to 7 minutes, then it was soaked with 5% giemsa stain for 45 minutes. glass slides were then rinsed with aquadest and dried. colored glass slides were observed with an electron microscope with a magnification of 20 times to observe the development of cells in the vaginal wall. vaginal smear was done every 3 days, for 21 days. data analysis to determine whether there is a difference in value between a, b, and k from each tested mathematical model, the models were tested using one-way anova. duncan multiple range test (dmrt) was used to determine wheter the a, b, and k coefficients for each models were significantly different (topal et al., 2004). goodness-of-fit coefficient of determination (r2) and mean square error (mse) were used to determine the best fit of model (topal et al., 2004). the r2 and mse have been indicated in non linear regression results calculted using spss ver 17. the smaller of mse value, and the bigger of r2 value (>70%), are more fit the mathematical model used in predicting the studied variable. results and discussions body weight variations in body weight in various age groups are presented in table 2 and it can be generated by different environmental and genetic factors and their interaction. genetic influences at each animal will respond differently to the same environmental conditiions. environmental influences can be caused by differences in feed management applied by each farmer. indonesia has two seasons: rainy season and dry season. there is a significant difference in cattle feed availability between the two seasons (sanz-saez et al., 2012). the research done by zarate martinez et al. (2013) on zebu cattle showed a difference between birth weight and weaning weight on each season and birth year. zaratemartinez et al. (2013) added that management in keeping livestock that affects quantity, quality, and the continuity of feed supply, especially before and after weaning will result in delaying the growth of the livestock. swali et al. (2008) noted that growth rate varies between individuals in ages above 6 months old. the animal undergoes an accelerated growth rate at the age of 3 to 6 months old, it decreases afterwards. figure 1 shows a graph of the curve that connects between body weight and age. the curve discribes the growth pattern of po cattle in kebumen district. the result indicated that the overall growth curve depicted by each mathematical model follows the nonlinear growth curve patterns with precise depictions (r2>0.7). the growth rate age and weight at puberty of ongole grade cattle (d. maharani et al.) 235 table 1. the equation of four mathematical models yt= body weight on t of age, a = mature body weight (asimtot), b = the proportion of mature weight which will reached after birth weight formed by yo and early t (the value of integral constants) , e = basic of logarithm (2,718282), k = the animal growth rate reach on mature body weight, m = parameter which obtained the point of inflection in a curve model yt m weight of inflection inflection time brody a(1-be-kt) 1 ........ ........ bertalanfy a(1-be-kt) 3 3 a(8/27) ln 3b/k logistic a(1+be-kt)-1 -1 a(0,5) ln b/k gompertz ae(-be-kt) m→∞ a(e-1) ln b/k predicted by each mathematical model occurs at the time of birth until the point of inflection. the growth rate begins to decrease from the point inflection until the cattle reaches mature weight (348 to 363 kg) at the age ranging from 42 to 48 months, and then the growth rate begins to decrease until it becomes constant. bertalanfy, logistic, and gompertz models all overestimated their prediction of weight from the age of 1 to 4 months and 12 to 14 months. all three mathematical model also underestimated their prediction of weight from the age 13 to 20 months. bahashwan et al. (2015) said that bertalanfy, gompertz, and logistics models were 236 j.indonesian trop.anim.agric. 42(4):233-239, december 2017 table 2. the average po cattle body weight and standard deviation in several age levels (months) age (month) bw±sd (kg) age (month) bw ±sd (kg) age (month) bw ±sd (kg) 1 45.0±6.00 11 173±37.5 21 259±38.7 2 72.2±13.7 12 203±52.7 22 277±69.9 3 76.2±16.9 13 203±53.4 24 290±59.8 4 116±25.3 14 181±47.7 25 272 5 123±26.5 15 184±33.4 26 280 6 131±27.9 16 224±56.1 30 318±32.4 7 137±33.5 17 220±56.5 36 330±34.8 8 154±47.2 18 214±51.2 42 358± 9 158±37.2 19 216±37.8 48 357±21.2 10 176±47.6 20 254±49.3 54 358± 60 345±24.6 bw = body weight, sd = standard deviation figure 1. graph of ongole grade cattle growth overestimated in describing growth curve of dhofari cattle at age of 24 until 60 months old. weaning age also affects the growth. results from sudrajad’s (2013) research stated that cattle breeders in kebumen usually wean calves at the age of 5 to 7 months, where guggeri et al. (2014) noted cattle that are weaned early will have a more substantial weight compared to those who are weaned traditionally. guggeri et al. (2014) suggested that calves that are weaned early and fed with high energy feed have an adg exceeding 1kg/day. growth parameter the result of parameter analysis based on brody, bertalanfy, logistic, and gompertz mathematical models are shown on table 3. the value of parameter a (mature weight) in bertalanfy model have significantly (p<0.05) difference compared to brody, gompertz, and logistic models. while the value of parameter a in brody, gompertz, and logistic models do not show significantly (p<0.05) difference. the result of topal’s et al. (2004) research showed a value difference in parameter a in brody’s model compared to bertalanfy, gompertz, and logistic. budimulyati et al. (2012) stated that the highest value of parameter a was achieved by bertalanfy’s model, followed by gompertz’s and richard’s. the value of parameter b in logistic model is different compared to bertalanfy, brody, and gompertz models. the value of parameter b in gompertz model is also different compared to bertalanfy’s and brody’s, while there are no difference in the value of parameter b between bertalanfy and brody. the highest parameter k value was achieved by logistic model, in which there are no differences in k parameter value in each models. the k value indicates that growth rate of a cattle is relative to its mature weight. cattle with a high k value will reach mature weight faster than those who have smaller k value with the same starting weight (malhado et al., 2009). this study's research indicated that po cattle reached 349 kg body weight at the age of 4 to 5 years. maharani et al. (2001) stated that cattle at the age 4 to 5 years will reaches mature weight. the most appropriate model for predicting the weight of mature po cattle are logistic and gompertz models. maharani et al. (2001) reported that logistic models is the most accurate in predicting parameter a value in brahman cross cattle. however, budimulyati et al. (2012) obtained a different result, in which gompertz model described the most accurately to predict a. brody’s model has the highest determination coefficient (r2=0.74 ) and the lowest mean square error (mse = 1491.39). the r2 high value indicates that variations which arises in weight (y) can be explained by the brody’s model equation followed by bertalanfy, logistic, and gompertz. although brody’s model has the highest suitability, but this model does not describe the age and weight at puberty, growth rate, and mature growth rate. the r2 value obtained from the four models in this study is smaller than those found in budimulyati’s et al. (2012), topal’s et al. (2004), maharani et al. (2001), hamouda’s and atti’s (2011) and zarate – martinez’s et al. (2013) research, with each r2 numbering (0.98), (0.98), (0.92), (0.99) and (0.97). the difference in result is thought to be because of the high variety of data in each age group, although the sample size is relatively large. body weight data from different breeds reared in different environments would influence the goodness of fit of the mathematical model in explaining the variations in body weight in cattle (hafiz et al., 2015). prediction of age and weight onset puberty research results in table 4 shows that the gompertz model predicts the age of puberty younger than bertalanfy and logistic models. the age of puberty of ongole crossbreed cattle based on gompertz model is achieved at the age of 6.32 months of age with a weight of 132 kg at puberty. bertalanfy’s model predict the age of puberty at the age of 7.26 months with a weight of 108 kg. logistic’s model predict the age of puberty at the age of 10.90 months with a weight of 174 kg. zarate martinez et al. (2013) stated that zebu age and weight at puberty of ongole grade cattle (d. maharani et al.) 237 table 3. prediction of age and weight onset puberty model weight of inflection (kg) inflection iime (month) brody ........ ........ bertalanfy 108 7.26 logistic 174 10.90 gompertz 132 6.32 cattle reaches puberty when its weight reaches 55% mature weight. if calculated based on the average mature weight of po cattle at the age of 4 to 5 years (394 kg), the cattle reaches 192 kg during puberty. the most accurate model in describing weight during puberty is the logistic model. the same result has also been found by maharani et al. (2001) and budimulyanti et al. (2013), which stated that the logistic models is the most accurate in predicting the weight of brahman cross cattle (143 kg) and holstein friesian (146 kg), as opposed to the other models. vaginal smear test vaginal smear test was conducted to check the development of vaginal cellular wall in female po cattle suspected of undergoing puberty. the determination of cattle suspected of undergoing puberty will be based on the puberty age predictions calculated using nonlinear mathematical models. puberty age estimate using logistic, bertalanfy, and gompertz models were 10.9 months (n=7), 7.26 months (n=4), dan 6.32 months (n=4). the vaginal cells of po cattle suspected to undergoing puberty, based on the predictions using logistic, bertalanfy, and gompertz models can be observed in figure 2. overall, the observed po cattle are still in their follicular phase (development of follicles). this indicates that all the observed cattle have not entered their puberty phase. each model underestimated their puberty age prediction. this due to the fact that the cattle have not reached their puberty weight. rudolf (2010) stated that the first estrus will occur when the cattle reaches the minimum weight, rather than reaching a certain age. puberty in cattle are influenced by genetics (nogueira, 2004), feed and weaning age (guggeri et al., 2014), maintenance management and climate (chebel et al., 2007). these factors will indefinitely affect to body weight and cattle growth levels (abeygunawardena and dematewewa 2004). limited feeding will lead to the late of puberty, while the giving of supplements into the cattle feed will increase growth and accelerate the start of puberty (guggeri et al., 2014). conclusion all the evaluated nonlinear mathematical models in this study have a high level (>0.70) of r2. brody’s model was the most appropriate model in predicting growth with high determination coefficient (r2 = 0.74 ) and the low mean square error (mse = 1491.39). mature wight of po cattle predicted by logistic (349 kg) and gompertz (358 kg) models were the most appropriate based on body weight data. logistic model was most appropriate model for predicting weight of po cattle at puberty (174 kg) based on body weight data, but all observed cattle are still in the follicular phase. acknowledgement the authors gratefully acknowledge the po cattle breeder association (aspokeb) in kebumen district, indonesia for their willingness on providing the data on their animals recording. this research was supported by graduate research grant from the faculty of animal science, universitas gadjah mada with contract no. 1997/j01.1.25/pasca/2015 references abeygunawardena, h. and c.m.b. dematawewa. 2004. pre-pubertal and postpartum anestrus in tropical zebu cattle. j. anim. reprod. sci. 82:373-387. astuti, m. 2004. potensi dan keragaman sumber daya genetik sapi peranakan ongole. wartazoa. 14:98-106. bahashwan, s., a.s. alrawas, s. alfadli and e.s. 238 j.indonesian trop.anim.agric. 42(4):233-239, december 2017 figure 2. smear from vaginal epithel po cattle during follicular phase. a. parabasal cells (nucleated clear, regular round shape and small cytoplasm, b. intermediate cells (nucleated, irregular shape, and larger cytoplasm. johnson. 2015. dhofari cattle growth curve prediction by different non-linear model functions. livest. res. rural dev. 27:12. brody, s. 1945. bioenergetics and growth. reinhold publishing corp., new york, ny. budimulyati, l.s., r.r. noor, a. saefuddin and c. talib. 2012. comparison on accuracy of logistic, gompertz, and von bertalanffy models in predicting growth of new born calf until first mating of friesian holstein heifers. j. indonesian trop. anim. agric. 37:151-160. chebel, r.c., f.a. braga and j.c. dalton. 2007. factors affecting reproductive performance of holstein heifers. j. anim. reprod. sci. 101:208-224. fitzhugh, h.a. 1976. analysis of growth curve and strategies for altering their shape. j. anim. sci. 42:10361-1051. forni, s., m. piles, a. blasco, l. varona, s.h.n. oliveira, r.b. lobo and l.g. albuquerque. 2014. comparison of different nonlinear functions to describe nelore cattle growth. j. anim. sci. 87:496-506. guggeri, d., a. meikle, m. carriquiry, f. montossi and i. de barbieri. 2014. effect of different management systems on growth, endocrine parameters and puberty in hereford female calves grazing campos grassland. j. livest. sci. 167:4555-462. hafiz, m.a.w., m.r. hifzan, i.a.j. bahtiar and o.m. ariff. 2015. describing growth pattern of brakmas cows using nonlinear regression models. mal. j. anim. sci. 18:37-45. hamouda, m.b. and n. atti. 2011. comparison of growth curves of lamb fat tail measurement and their relationship with body weight in babarine sheep. small rum. res. 95:120127. lee, j.h., s.-h. oh, y.m. lee, y.s. kim, h.j. son, d.j. jeong, n.c. whitley and j.j. kim. 2014. study on growth curves of longisimus dorsi muscle area, backfat thickness and body conformation for hanwoo (korean native) cows. asian-aust. j. anim. sci. 27:1250-1253. loaiza-echeverri, a.m., j.a.g. bergmann, f.l.b. toral, j.p. osorio, a.s. carmo, l.f. mendonca, v.s. moustacas and m. henry. 2013. use of nonlinear models for describing scrotal circumference growth in guzerat bulls raised under grazing conditions. theriogenology. 79:751-759. maharani, d., m. astuti and sumadi. 2001. evaluasi penerapan model matematik nonlinear dalam memprediksi laju pertumbuhan sapi brahman cross di pt buli. agrosains. 14:339-346. malhado, c.h.m., p.l.s. carneiro, p.r.a.m. affonso, a.a.o. souza and j.l.r. sarmento. 2009. growth curves in dorper sheep crossed with the local brazilian breeds, morada nova, rabo largo, and santa ines. small rum. res. 84:16-21. rocha, n.s., r.a.m. vieira, m.l.c. abreu, r.p. araujo, l.s. gloria, w.p. tamy, c.h.p.c. nova and a.m. fernandez. 2015. traditional and biphasic nonlinear models to describe growth of goat kids of specialized dairy breeds. small rum. res. 123:35-46. rudolf, f.o. 2010. puberty in beef heifers: a review. jurnal ilmu peternakan. 20-27. sanz-saez, a., g. erice, j. aguirreolea, j.j. irigoyen and m. sanchez-diaz. 2012. alfalfa yield under elevated co2 and temperature depends on the sinorhizobiumstrain and growth season. j. exp. bot. 77:267-273. sudrajad,p., subiharta and n. qomariyah. 2013. potensi daun gliricidia sp sebagai pakan alternatif untuk pedet sapi peranakan ongole (po) lepas sapih di kabupaten kebumen. prosiding seminar nasional. makassar 19-21 june. bptp sulawesi selatan. 1:765-772. setiaji, a., sutopo and e. kurnianto. 2013. growth analysis in rabbit using gompertz non-linear model. j. indonesian trop. anim. agric. 38:92-97 swali, a., z. cheng, n. bourne and d.c. wathes. 2008. metabolic traits affecting growth rates of pre-pubertal calves and their relationship with subsequent survival. domestic. anim. endocrinol. 35:300-313. topal, m., m. ozdemir, v. aksakal, n. yildiz and u. dogru. 2004. determination of the best nonlinear function in order to estimate growth in morkaraman and awassi lambs. small rum. res. 55:229-232. zarate-martinez, j.p., v.d. hernandez-hernandez, j.c. vinay-vadillo, j.a. villagomez-cortes and a. rios-utrera. 2013. effect of environmental factors from birth to the onset of reproductive function and management in indo-brazilian heifers. int. j. anim. vet. adv. 5:61-66. age and weight at puberty of ongole grade cattle (d. maharani et al.) 239 j i t a a journal of the indonesian tropical animal agriculture accredited by ditjen penguatan risbang no. 60/e/kpt/2016 j. indonesian trop. anim. agric. pissn 2087-8273 eissn 2460-6278 http://ejournal.undip.ac.id/index.php/jitaa 44(1):77-83, march 2019 doi: 10.14710/jitaa.44.1.77-83 nutritional comparison between dried and ensiled indigofera, papaya and moringa leaves a. jayanegara*, v. ardani and h. a. sukria department of nutrition and feed technology, faculty of animal science, bogor agricultural university, jl. agatis, dramaga campus, bogor 16680 indonesia *corresponding e-mail: anuraga.jayanegara@gmail.com received june 10, 2018; accepted december 08, 2018 abstrak penelitian ini bertujuan untuk mengevaluasi komposisi kimia, fermentasi dan kecernaan in vitro dari hijauan indigofera, pepaya dan kelor yang diberi perlakuan pengeringan dan ensilase. perlakuan pengeringan pada hijauan dilakukan pada oven bersuhu 60oc selama 24 jam sedangkan perlakuan ensilase dilakukan selama 30 hari pada suhu ruang. hijauan yang telah dikeringkan dan diensilase dianalisis komposisi kimianya, karakteristik fermentasi dan kecernaan secara in vitro. perlakuan yang diujikan mengikuti pola faktorial 3 × 2 dengan faktor pertama adalah jenis hijauan (indigofera, pepaya dan kelor) dan faktor kedua adalah metode pengolahan (pengeringan dan silase). analisis komposisi kimia dilakukan secara duplikat sedangkan evaluasi in vitro dilakukan dalam tiga ulangan. hasil menunjukkan bahwa perlakuan ensilase menurunkan kandungan pk indigofera dan kelor namun tidak untuk pepaya. ensilase juga menurunkan kandungan ndf dan ndicp dari semua hijauan dibandingkan dengan perlakuan pengeringan. nilai ph dari semua silase tinggi dan mengandung konsentrasi amonia yang tinggi. silase indigofera cenderung memiliki kcbk dan kcbo yang lebih rendah dibandingkan dengan indigofera yang dikeringkan (p<0.1). dapat disimpulkan bahwa ensilase dari hijauan berprotein tinggi menyebabkan tingkat proteolisis yang juga tinggi. kata kunci: pengeringan, ensilase, fermentasi, proteolisis, rumen abstract the objective of this experiment was to evaluate chemical composition, in vitro fermentation and digestibility of dried and ensiled indigofera, papaya and moringa leaves. the leaves were subjected to artificial drying in an oven at 60oc for 24 h and ensiling treatment for 30 d under room temperature. dried and ensiled samples were determined for chemical composition, silage fermentation characteristics and in vitro rumen fermentation and digestibility. the experimental design was a factorial design 3 × 2 in which the first factor was different leaves (indigofera, papaya and moringa) and the second factor was conservation treatments (drying and ensiling). determination of chemical composition was performed in duplicate whereas in vitro evaluation was conducted in three replicates. results showed that ensiling treatment decreased cp contents of indigofera and moringa but not papaya leaves. ensiling also decreased ndf and ndicp contents of all experimental leaves in comparison to drying treatment. the ph of all silages was high and they were characterized with high ammonia concentrations. ensiled indigofera tended to have lower ivdmd and ivomd as compared to dried indigofera (p<0.1). it can be concluded that ensiling of high protein forages leads to considerable extent of proteolysis. keywords: drying, ensiling, fermentation, proteolysis, rumen drying and ensiling of high-protein forages (a. jayanegara et al.) 77 introduction protein supplementation into animal diet is essential in order to achieve optimal animal production and health. although commercial concentrate may be used as a protein supplement, however, it may not be affordable to purchase especially for small-holder farmers. farmers may therefore use high protein forages as protein supplements for their livestock. indigofera (indigofera zollingeriana), papaya (carica papaya) and moringa (moringa oleifera) leaves have been used as protein supplements in the diets of ruminant livestock due to their high protein contents (jayanegara et al., 2010; retnani et al., 2014; suharlina et al., 2016a; 2016b). several animal feeding trials using indigofera, papaya and moringa leaves confirmed their potencies as protein supplements. for instance, supplementation of 12% indigofera in the form of wafer increased average daily gain and feed efficiency of post-weaning ettawa grade goats by 55 and 35%, respectively (dianingtyas et al., 2017). babiker et al. (2017) reported that feeding of moringa leaves to replace alfalfa resulted in a higher milk yield, better composition and quality of ewe and goat milk, and increased growth performance of kids and lambs. despite such promising nutrient profiles and application of the leaves for animal feeding, the effects of feed conservation on their nutritive values are subjected to further studies. livestock sometimes do not consume fresh forages particularly during seasons when their availability are limited (laconi and jayanegara, 2015), and therefore need to consume conserved forages. in tropical regions, season with such limited fresh forage availability is typically during dry season (zahera et al., 2015) whereas in temperate regions is during winter season (yang et al., 2017). common forage conservation practices are based on drying and ensiling methods. drying may be performed naturally by means of sun drying or artificially by using a high temperature oven, commonly around 50-60oc. ensiling is performed in a silo under anaerobic condition and often with the aid of certain additives in order to result a high quality silage (könig et al., 2017; muck et al., 2018). the objective of the current experiment was therefore to evaluate and to compare chemical composition, in vitro fermentation and digestibility of dried and ensiled indigofera, papaya and moringa leaves. materials and methods drying and ensiling of experimental materials indigofera, papaya and moringa leaves were freshly collected from the experimental station of bogor agricultural university, dramaga, bogor. each leaf species was divided into two portions; the first portion was subjected to artificial drying in an oven at 60oc for 24 h whereas the second portion was subjected to ensiling treatment. for the ensiling treatment, an amount of 1 kg of each leaf species was manually cut into ca 3 mm length. each leaf species was inserted into a labscale silo (in three replicates), i.e. a high-density polyethylene bottle with 1 l capacity, equipped with a rubber cap and slit. the slit enables gas from inside to release but prevents gas from outside to enter the silo. ensiling was performed at room temperature (ca 27oc) for 30 d. no starter or lactic acid bacteria from an external source was added in the present experiment.weight of the bottles were measured before and after ensiling in order to determine weight loss of each leaf species. ensiled samples were divided into two parts. the first part was mixed with distilled water (1:7 w/v) and extracted in a blender. supernatant was taken and subjected to silage quality determination, i.e. ph, ammonia and total volatile fatty acid (vfa). the second part was oven-dried at 60oc for 24 h, ground by a hammer mill (1 mm screen size) and, together with leaf samples received drying treatment, were subjected to chemical composition analysis. chemical composition analysis dried and ensiled samples of indigofera, papaya and moringa leaves were determined for their crude protein (cp), neutral detergent fiber (ndf), acid detergent fiber (adf), neutral detergent insoluble crude protein (ndicp) and acid detergent insoluble crude protein (adicp) contents. analysis of cp was performed according to aoac (2005) whereas ndf and adf contents were analysed by following the procedure of van soest et al. (1991). determination of ndicp and adicp was conducted based on licitra et al. (1996) as described in jayanegara et al. (2016). in vitro evaluation in vitro evaluation of dried and ensiled indigofera, papaya and moringa leaves was performed by gas production technique according to theodorou et al. (1994). approximately 750 78 j.indonesian trop.anim.agric. 44(1):77-83, march 2019 mg of each sample was incubated in a bottle together with 25 ml rumen fluid and 50 ml mcdougall buffer under anaerobic condition. rumen fluid was taken from two fistulated ongole crossbred cattle before morning feeding. all bottles were incubated in a waterbath maintained at 39oc for 48 h. gas production was vented and recorded at regular time point intervals, i.e. 2, 4, 6, 8, 10, 12, 24, 36 and 48 h after the start of incubation by using a plastic syringe equipped with a needle. the purpose of measuring gas production at different time point intervals was to analyze the fermentation rate of various experimental treatments particularly during early incubation hours; higher gas production during early incubation indicates faster in vitro rumen fermentation rate and vice versa.supernatant was taken for ph, ammonia and total vfa determinations by employing a ph meter, conway micro-diffusion technique and steam distillation method, respectively. feed residual from rumen fluid incubation was subjected to another 48 h incubation with 75 ml pepsin-hcl 0.2 n in order to determine in vitro dry matter digestibility (ivdmd) and in vitro organic matter digestibility (ivomd). statistical analysis analysis of variance (anova) was applied to the data obtained by following a factorial randomized complete block design with three replicates. the first factor was forage source, i.e. indigofera, papaya and moringa leaves, whereas the second factor was forage treatment, i.e. drying and ensiling. the block or replicate was different incubation runs that performed in different weeks. for the in vitro gas production data at various time point intervals, anova was performed separately at each time point of gas production measurement a duncan multiple range test was applied to significant anova results (p<0.05) in order to separate among different treatment means. results and discussion chemical composition and silage quality indigofera, papaya and moringa leaves, both in dried and ensiled forms contained high cp, i.e. higher than 20% dm (table 1). such high cp contents of indigofera, papaya and moringa leaves were also reported in other experiments, typically ranged from 24-28% dm (jayanegara et al., 2016; kumalasari et al., 2017; syarifuddin et al., 2017). ensiling treatment decreased cp contents of indigofera and moringa but not papaya leaves. lower cp contents of these leaves after ensiling may be attributed to protein degradation into various amino acids and subsequent deamination of the amino acids to result ammonia and α-keto acid (lynch et al., 2014). such protein degradation is possible due to the action of protease from microbial and plant origins. after ammonia is formed, the substance may be solubilized and therefore could not be recovered as n in the dry matter, resulting the n loss. in the case of papaya silage, apparently papain present in the forage (manosroi et al., 2014) inhibits, to a certain extent, the action of microbial and plant protease and therefore does not reduce its cp content. indigofera contained higher ndf and adf than those of papaya and moringa. the ndf and adf contents of indigofera ranged around 27-31 and 25-28% dm, respectively (kumalasari et al., 2017), and the values obtained in this experiment were closely similar. such higher ndf and adf contents of indigofera as compared to those of moringa were confirmed by jayanegara et al. (2010); the authors reported that moringa leaves contained 21.9 and 11.4% of ndf and adf, respectively. ensiling treatment decreased ndf and ndicp contents of all experimental leaves in comparison to drying treatment, but it was not the case for adf. this indicates that lactic acid bacteria present in the silages may possess hemicellulolytic activity but not cellulolytic activity. similar pattern was observed in the study of jia et al. (2011). the authors reported that ensiling of bamboo shoot shell with lactic acid bacteria reduced its ndf content from 70.8 to 66.3% dm, but the adf content did not decrease. enzymatic activity of lactic acid bacteria may partially hydrolysed soluble cell wall components like hemicellulose (adetunji et al., 2016) but it is less likely for the insoluble cell wall components. weight losses of indigofera, papaya and moringa silages after 30 d were generally low, around 2% or lower (table 2). however, ph of all silages was high, being highest in papaya silage and lowest in moringa silage. the silages were characterized with high ammonia concentrations (no difference among the silages). total vfa concentrations between indigofera, papaya and moringa silages were similar. high ammonia concentrations present in indigofera, papaya and moringa silages are the results of massive protein degradation and deamination as previously drying and ensiling of high-protein forages (a. jayanegara et al.) 79 discussed above. since ammonia is rather alkali, its high concentration causes the high ph condition in the silages. such high ph may induce the growth of undesirable bacteria such as clostridia sp. and in turn decreases silage quality (zheng et al., 2017). future research is therefore needed to decelerate proteolysis in high protein silage by adding a certain additive such as tannin since the plant secondary compound forms complex with protein (jayanegara and palupi, 2010) and potentially protect protein from degradation. in vitro rumen fermentation and digestibility dried indigofera and moringa leaves had higher gas production than that of dried papaya leaves (p<0.05) particularly during early incubation hours (table 3). ensiling decreased gas production of indigofera and moringa leaves (p<0.05) but not for papaya leaves. cumulative gas production increased with increasing incubation period but with decreasing rate. higher gas production of dried moringa as compared to dried papaya was expected due to the lower adf content of moringa despite relatively similar ndf content. gas production is primarily as a result of carbohydrate fermentation in the rumen (getachew et al., 1998), including hemicellulose that can be estimated as the difference between ndf and adf values. however, this was not the case for indigofera in which it contained higher adf than that of papaya but had gas production as well. it might be that other factors influencing gas production were present such as different types of carbohydrate, degradability and fermentability of carbohydrate under ruminal environment (morenz et al., 2012) and antinutritive compounds (laconi and widiyastuti, 2010; kondo et al., 2014), in which these parameters were not measured in the present 80 j.indonesian trop.anim.agric. 44(1):77-83, march 2019 table 2. fermentation characteristics of indigofera, papaya and moringa leaf silages forage weight loss (%) ph nh3 (mm) vfa (mm) indigofera silage 1.74ab 5.23a 83.2 182 papaya silage 1.00a 5.70b 82.7 167 moringa silage 2.04b 4.87a 94.3 144 sem 0.193 0.134 4.73 10.1 p-value 0.045 0.007 0.593 0.378 different superscripts within the same column are significantly different at p<0.05. vfa: volatile fatty acid; sem: standard error of mean table 1. chemical composition of dried and ensiled indigofera, papaya and moringa leaves (% dry matter) forage treatment cp ndf adf ndicp adicp indigofera dried 35.6 33.3 25.8 3.55 2.49 ensiled 26.2 27.6 26.2 2.56 2.23 papaya dried 29.9 27.0 22.5 5.22 1.89 ensiled 29.9 24.8 22.2 1.62 0.35 moringa dried 28.7 26.8 16.6 5.44 1.66 ensiled 24.9 21.9 18.2 1.82 1.45 cp: crude protein; ndf: neutral detergent fiber; adf: acid detergent fiber; ndicp: neutral detergent insoluble crude protein; adicp: acid detergent insoluble crude protein experiment. lower gas production after ensiling treatment apparently related to partial utilization of water soluble carbohydrate by lactic acid bacteria and other microorganims present in silage, thus contributing to a reduced gas production. ruminal ph, total vfa and ammonia concentrations of dried and ensiled indigofera, papaya and moringa leaves were indifferent (table 4). the values of these parameters are within the normal range. ensiled indigofera tended to have lower ivdmd and ivomd as compared to dried indigofera (p<0.1). for papaya and moringa leaves, drying and ensiling treatments had similar ivdmd and ivomd values. the ivdmd and ivomd values for the dried leaves were closely similar to literatures. for instance, abdullah (2010) reported that ivdmd and ivomd of indigofera were 67.585.5 and 60.3-82.7%, respectively. dried papaya leaves had ivdmd and ivomd values of 74.9 and 70.9%, respectively (jayanegara et al., 2016). with regard to moringa, paengkoum et al. (2013) reported that total tract dm digestibility of moringa leaves was 70.4%, in which rumen degradability and intestinal digestibility of the leaves contributed 52.9 and 17.5%, respectively. further, kleden et al. (2017) reported that ivdmd of four moringa varieties from east flores regency ranged between 63.3 and 67.1%. indication of lower in vitro digestibility observed in indigofera silage is apparently as a result of lactic acid bacteria consumption on soluble carbohydrate. conclusion indigofera, papaya and moringa leaves are potential forages for use as protein supplements for ruminants, either in dried or ensiled form. ensiling of these high protein forages however leads to considerable extent of proteolysis as indicated by lower cp contents, high ph and high ammonia concentrations in the silage materials. future research is required in order to prevent or at least to decelerate the proteolysis by using certain silage additives. acknowledgement this research was funded by kementerian riset, teknologi dan pendidikan tinggi (kemenristekdikti) through “penelitian berbasis kompetensi” research grant, contract drying and ensiling of high-protein forages (a. jayanegara et al.) 81 table 3. effects of drying and ensiling on in vitro gas production (ml) of indigofera, papaya and moringa leaves forage treatment incubation period (h) 2 4 6 8 10 12 24 36 48 indigofera dried 21b 33b 46b 49 68a 79a 101 119bc 128bc ensiled 11a 23a 36a 50 62a 73a 92 107a 114a papaya dried 10a 24a 38a 52 68a 80a 93 109ab 117a ensiled 10a 21a 35a 47 66a 80a 100 114abc 124abc moringa dried 20b 35b 51b 65 78b 88b 103 121c 130c ensiled 13a 24a 38a 54 68a 79a 97 110ab 119ab sem 1.34 1.69 1.93 2.44 2.62 2.78 1.70 1.68 1.81 p-value forage 0.017 0.013 0.004 0.054 0.004 0.025 0.516 0.451 0.438 treatment 0.006 0.001 <0.001 0.154 0.004 0.031 0.384 0.033 0.044 forage×treatment 0.099 0.126 0.093 0.338 0.168 0.209 0.119 0.031 0.015 different superscripts within the same column are significantly different at p<0.05; sem: standard error of mean. number 129/sp2h/ptnbh/drpm/2018, year 2018. references abdullah, l. 2010. herbage production and quality of shrub indigofera treated by different concentration of foliar fertilizer. med. pet. 33:169-175. adetunji, a.i., h. du clou, s.n. walford and j.r.n. taylor. 2016. complementary effects of cell wall degrading enzymes together with lactic acid fermentation on cassava tuber cell wall breakdown. ind. crops prod. 90:110-117. babiker, e.e., f.a.l. juhaimi, k. ghafoor and k.a. abdoun. 2017. comparative study on feeding value of moringa leaves as a partial replacement for alfalfa hay in ewes and goats. livest. sci. 195:21-26. dianingtyas, b.d., y. retnani and d. evvyernie. 2017. legume wafer supplementation to increase the performance of post-weaning ettawa grade goats. med. pet. 40:42-46. getachew, g., m. blummel, h.p.s. makkar and k. becker. 1998. in vitro gas measuring techniques for assessment of nutritional quality of feeds: a review. anim. feed sci. technol. 72:261-281. jayanegara, a., and e. palupi. 2010. condensed tannin effects on nitrogen digestion in ruminants: a meta-analysis from in vitro and in vivo studies. med. pet. 33:176-181. jayanegara, a., t. sabhan, a.k. takyi, a.o. salih and e.m. hoffmann. 2010. ruminal fermentation kinetics of moringa and peltiphyllum supplements during early incubation period in the in vitro reading pressure technique. j. indonesian trop. anim. agric. 35:165-171. jayanegara, a., s.p. dewi, n. laylli, e.b. laconi, nahrowi and m. ridla. 2016. determination of cell wall protein from selected feedstuffs and its relationship with ruminal protein digestibility in vitro. med. pet. 39:134-140. jia, y.f., w.y. shi, l.h. wu and h.l. wang. 2011. effects of ensilage on the preservation of bamboo shoot shells and their fibre characteristics. j. trop. forest sci. 23:396403. kleden, m.m., h. soetanto, k. kusmartono and k. kuswanto. 2017. genetic diversity evaluation of moringa oleifera, lam from east flores regency using marker random amplified polymorphic dna (rapd) and its relationship to chemical composition and in vitro gas production. agrivita 39:219-231. 82 j.indonesian trop.anim.agric. 44(1):77-83, march 2019 table 4. effects of drying and ensiling on in vitro rumen fermentation and digestibility of indigofera, papaya and moringa leaves forage treatment ph vfa (mm) nh3 (mm) ivdmd (%) ivomd (%) indigofera dried 6.62 168 16.3 70.1ab 69.5 ensiled 6.60 140 15.3 66.0a 64.8 papaya dried 6.67 151 17.5 73.4b 70.9 ensiled 6.64 174 18.7 73.7b 71.2 moringa dried 6.68 124 11.2 73.1b 71.3 ensiled 6.61 195 19.2 70.7b 68.4 sem 0.034 10.2 1.31 1.59 1.50 p-value forage 0.580 0.876 0.474 0.006 0.055 treatment 0.261 0.151 0.361 0.088 0.061 forage×treatment 0.798 0.054 0.253 0.293 0.240 different superscripts within the same column are significantly different at p<0.05; vfa: volatile fatty acid; ivdmd: in vitro dry matter digestibility; ivomd: in vitro organic matter digestibility; sem: standard error of mean. kondo, m., y. hirano, n. ikai, k. kita, a. jayanegara and h.-o. yokota. 2014. assessment of anti-nutritive activity of tannins in tea by-products based on in vitro rumen fermentation. asian-australas. j. anim. sci. 27:1571-1576. könig, w., m. lamminen, k. weiss, t.t. tuomivirta, s. sanz muñoz, h. fritze, k. elo, l. puhakka, a. vanhatalo and s. jaakkola. 2017. the effect of additives on the quality of white lupin–wheat silage assessed by fermentation pattern and qpcr quantification of clostridia. grass forage sci. 72:757-771. kumalasari, n.r., g.p. wicaksono and l. abdullah. 2017. plant growth pattern, forage yield, and quality of indigofera zollingeriana influenced by row spacing. med. pet. 40:1419. laconi, e.b., and t. widiyastuti. 2010. lamtoro leaf (leucaena leucocephala) xanthophylls content as the result of physical and chemical detoxification of mimosine. med. pet. 33:5054. laconi, e.b., and a. jayanegara. 2015. improving nutritional quality of cocoa pod (theobroma cacao) through chemical and biological treatments for ruminant feeding: in vitro and in vivo evaluation. asian-australas. j. anim. sci. 28:343-350. lynch, j.p., l. jin, e.c. lara, j. baah and k.a. beauchemin. 2014. the effect of exogenous fibrolytic enzymes and a ferulic acid esteraseproducing inoculant on the fibre degradability, chemical composition and conservation characteristics of alfalfa silage. anim. feed sci. technol. 193:21-31. manosroi, a., c. chankhampan, k. pattamapun, w. manosroi and j. manosroi. 2014. antioxidant and gelatinolytic activities of papain from papaya latex and bromelain from pineapple fruits. chiang mai j. sci. 41:635648. morenz, m.j.f., j.f.c. da silva, l.j.m. aroeira, f. deresz, h.m. vásquez, f.c.f. lopes, d.s.c. paciullo and l.o. tedeschi. 2012. evaluation of the cornell net carbohydrate and protein system model on the prediction of dry matter intake and milk production of grazing crossbred cows. rev. bras. zootec. 41:398406. muck, r.e., e.m.g. nadeau, t.a. mcallister, f.e. contreras-govea, m.c. santos and l. kung jr. 2018. silage review: recent advances and future uses of silage additives. j. dairy sci. 101:3980-4000. paengkoum, p., s. traiyakun and s. paengkoum. 2013. intestinal digestibility of enrichedprotein fodders measured by mobile bag incubated with or without pepsin-hcl and three-step techniques. south afr. j. anim. sci. 43:511-518. retnani, y., i.g. permana and l.c. purba. 2014. physical characteristic and palatability of biscuit bio-supplement for dairy goat. pak. j. biol. sci. 17:725-729. syarifuddin, n.a., a.l. toleng, d.p. rahardja, ismartoyo and m. yusuf. 2017. improving libido and sperm quality of bali bulls by supplementation of moringa oleifera leaves. med. pet. 40:88-93. suharlina, d.a. astuti, nahrowi, a. jayanegara and l. abdullah. 2016a. in vitro evaluation of concentrate feed containing indigofera zollingeriana in goat. j. indonesian trop. anim. agric. 41:196-203. suharlina, d.a. astuti, nahrowi, a. jayanegara and l. abdullah. 2016b. nutritional evaluation of dairy goat rations containing indigofera zollingeriana by using in vitro rumen fermentation technique (rusitec). int. j. dairy sci. 11:100-105. theodorou, m.k., b.a. williams, m.s. dhanoa, a.b. mcallan and j. france. 1994. a simple gas production method using a pressure transducer to determine the fermentation kinetics of ruminant feeds. anim. feed sci. technol. 48:185-197. van soest, p.j., j.b. robertson and b.a. lewis. 1991. methods for dietary fiber, neutral detergent fiber, and nonstarch polysaccharides in relation to animal nutrition. j. dairy sci. 74:3583-3597. yang, z., y. wang, x. yuan, l. wang and d. wang. 2017. forage intake and weight gain of ewes is affected by roughage mixes during winter in northeastern china. anim. sci. j. 88:1058-1065. zahera, r., i.g. permana and despal. 2015. utilization of mungbean's green house fodder and silage in the ration for lactating dairy cows. med. pet. 38:123-131. zheng, m.l., d.z. niu, d. jiang, s.s. zuo and c.c. xu. 2017. dynamics of microbial community during ensiling direct-cut alfalfa with and without lab inoculant and sugar. j. appl. microbiol. 122:1456-1470. drying and ensiling of high-protein forages (a. jayanegara et al.) 83 272 j.indonesian trop.anim.agric. 46(4):272-281, december 2021 j i t a a journal of the indonesian tropical animal agriculture accredited by ditjen penguatan risbang no. 60/e/kpt/2016 j. indonesian trop. anim. agric. pissn 2087-8273 eissn 2460-6278 http://ejournal.undip.ac.id/index.php/jitaa 46(4):272-281, december 2021 doi: 10.14710/jitaa.46.4. 272-281 association of ghr|alui gene polymorphism with body weight parameters in grati-po cattle h. hartati 1* , a.a.r. hapsari 2 , b.d.p. soewandi 2 , s. anwar 3 , s. p. rahmadani 4 , a. aryogi 1 and d. pamungkas 1 1 indonesian beef cattle research station, indonesian agency for agricultural research and development, ministry of agriculture of indonesia, jl. pahlawan no. 2 grati, pasuruan, east java 67184 indonesia 2 indonesian research institute for animal production (iriap), ciawi, bogor-indonesia 3 research center for biotechnology, national research and innovation agency (brin), jl. raya bogor km. 46, cibinong 16911, west java indonesia 4 graduate student of animal husbandry, university of jambi *corresponding email: hartatifakhri16@gmail.com received february 13, 2021; accepted august 6, 2021 abstrak gen growth hormone receptor (ghr) merupakan anggota dari famili reseptor sitokin kelas i yang penting dalam regulasi pertumbuhan termasuk pada sapi. penelitian ini bertujuan untuk menganalisa asosiasi antara gen ghr|alui dan parameter bobot badan pada populasi sapi po grati. sebanyak 304 sampel darah sapi po dikoleksi dari kandang percobaan loka penelitian sapi potong yang dilengkapi dengan 304 data fenotipiknya. sampel darah diisolasi menggunakan zymo extraction kit. deteksi keragaman gen ghr menggunakan metode polymerase chain reaction-restriction fragment length polymorphism (pcr-rflp) dengan enzim pemotong alui. indikator polimorfisme meliputi frekuensi genotipe, frekuensi alel, hardy-weinberg equilibrium, heterozigositas pengamatan (ho), heterozigositas harapan (he), polymorphism information content (pic) dan jumlah alel efektif (ne). analisis asosiasi dilakukan menggunakan linier mixed model. performans bobot lahir, bobot sapih, bobot setahun dan bobot umur 18 bulan masing-masing adalah 25,4 ± 0,2kg; 113,8 ± 2,3 kg;159,9 ± 2,7 kg; dan 213,7 ± 3,6kg. hasil analisis asosiasi signifikan (p<0,05) pada bobot sapih, bobot setahun dan bobot umur 18 bulan. gen ghr berpotensi sebagai penanda genetik untuk sifat pertumbuhan dan dapat digunakan sebagai kandidat penanda genetik untuk seleksi sapi po-grati. kata kunci: bobot badan, growth hormone receptor, polimorfisme, sapi po-grati abstract the growth hormone receptor (ghr) gene is member of the class i cytokine receptor family that important in growth regulation including in cattle. this study aimed to analyze the association between ghr|alui gene with body weight, parameters in grati-po cattle population. a total of 304 blood samples were collected from the experimental station at the beef cattle research station, which association ghr|alui gene with body weight in grati-po cattle (hartati et al.) 273 introduction growth traits is one of the most important economic traits in beef cattle production. body weight, body size measurements and weight gains are several types of growth traits. growth traits have relationship between growth traits itself or with carcass and meat component (meyer, 1995; albertí et al., 2008; caetano et al., 2013; coyne et al., 2019), so it is widely used as a selection criterion in beef cattle breeding program. body weight measurement is the most common type of growth traits used in the selection program, which are taken from birth and throughout an animal’s life (buzanskas et al., 2014). the growth trait was controlled by many genes and their expression was the accumulation effects of genetic, environmental and interaction (putra et al., 2014). several genes that were thought to be the main genes in influencing growth traits were growth hormone (gh) and growth receptor (ghr) genes. the mechanism of action of these two genes has interrelated activities in influencing cell growth and metabolism in vertebrates. the gh gene in influencing growth and metabolism will interact with a specific receptor called the growth hormone receptor (ghr) on the surface of the targeted cell (di stasio et al., 2005). growth hormone (gh) has proven to be the major regulator of postnatal growth and metabolism in mammals and thus affects growth rate, body composition, health, milk production, and aging by modulating the expression of many genes (ge et al., 2003). the growth hormone receptor (ghr) is a member of the class i cytokine receptor family with a single transmembrane domain (waters and brooks, 2015; chia, 2014). gh receptor (ghr) are active in the central nervous system (cns) and are crucial in regulating several aspects of metabolism (cady et al., 2017). therefore, the essential biological function of ghr, makes the ghr gene proposed as a potential candidate gene for several economically desirable traits including growth traits. the bovine ghr gene has been assigned located on bovine chromosome 20 (moody et al., 1995). the polymorphism of the bovine ghr gene is relatively high. waters et al., (2011) have conducted bovine ghr gene resequensing and found a total of 39 snp entire gene using five different breeds. one of these snp is g.257a>g (in exon 10) which causes a change in the amino acid serine to glycine (ge et al., 2000). this snp can be identified using pcr-rflp with alui restiction enzyme (ghr|alui). the ghr|alui gene was found to be polymorphic in bovine species (di stasio et al., 2005; olenski et al., 2010; zulkarnaim et al., 2010; deepika and salar, 2013; deng et al., 2015). this polymorphism has been reported to be associated with the final weight and some meat quality traits in some bos taurus cattle (di stasio et al., 2005; reardon et al., 2010). however, has no association with various body weight parameters including calf birth weight (cbw) in aberdeen angus cattle (fedota et al., 2017),as well as with cbw in grati-po cattle (hartati et al., 2019). however, the associwere also equipped with 304 phenotypic data. dna was extracted using a zymo extraction kit. detection of of the polymorphism of ghr gene using pcr-rflp method with alui restriction enzymes. polymorphism indicators include genotype frequency, allele frequency, hardy-weinberg equilibrium, observed heterozygosity (ho), expected heterozygosity (he), polymorphism information content (pic) and number of effective alleles (ne). association analysis was carried out using a linear mixed model. the performance of birth weight, weaning weight, yearling weight and 18 months weight were 25.4 + 0.2 kg; 113.8 + 2.3 kg; 159.9 + 2.7 kg and 213.7 + 3.6 kg, respectively. the result of association analysis was significant (p<0.05) on weaning weight, yearling weight and 18 months weight. it could be concluded that the ghr gene has potential to be a candidate genetic marker for growth traits in gratipo cattle. keywords: body weight, growth hormone receptor, polymorphism, po-grati cattle 274 j.indonesian trop.anim.agric. 46(4):272-281, december 2021 ation has not been reported yet for other body weight parameters in grati-po cattle. therefore, the present study was aimed to analyze the association between ghr|alui gene with body weight parameters in grati-po cattle. materials and methods performans data of grati-po cattle grati-po cattle performance data were collected from 304 animals in the experimental enclosure at the beef cattle research station including birth, weaning, yearling and 18 months weight were accordance with recording data in breeding activities. grati-po cattle blood samples were collected from the jugular vein (35ml) using a vaccutainer tube containing k3 edta. dna was extracted using a quick-dna mini prep kit (zymo research, usa) and then stored at -20 0 c for futher use. pcr-rflp analysis the method used to detect dna variations was pcr-rflp. the primers used for the ghr gene refers to di stasio et al. (2005). the primary sequences of forward and reverse are shown in table 1. pcr reaction was performed in a total volume of 20 µl. a total 3 µl dna containing of approximately (10-100) ng/µl of dna, 0.2 µl of each primer, 10 µl pcr mix of mytaqtm hs red mix (bioline, usa), and 6.2 µl ddh2o to a final volume of 20 µl. the pcr conditions were pre-denaturation at 95°c for 1 min, followed by 35 cycles of denaturation at 95°c for 15 s, annealing for 15 s at 53.8°c, extension at 72°c for 10 s, and a final extension at 72°c for 5 min. pcr products were electrophoresed on 1.5% agarose gels, stained with gelred ® 10,000x in water (biotium, usa) and visualized under a g-box gel documentation system (syngene, uk). the pcr products of ghr were digested with alui restriction enzyme (new england biolabs, usa). the digested fragments were electrophorezed on 2% agarose gels, stained with gelred ® 10,000x in water (biotium, usa) and visualized under a g-box gel documentation system (infiity vx2). the sequencing analysis was performed in this study using two sample of pcr product (20 μl) to confirm the findings.the sequencing analysis was performed through commercial laboratory service (pt genetika science). statistical analysis polymorphism indexes such as genotype frequency and allele frequency were calculated according to nei and kumar (2000). expected heterozygosity (he) and observed heterozygosity (ho) were calculated according to weir (1991). polymorphism information content (pic) was calculated according to botstein et al., (1980) by direct counting. the genotypic frequency distribution for its deviation to hardyweinberg equilibrium (hwe) was analyzed by chi-square test was calculated according to kaps and lamberson (2004). the number of effective allele was calculated according to formula nei and tajima (1981). association between ghr|alui genotype and body weight parameters in grati-po cattle population were analyzed applying a randomized block design model as follows : table 1. genbank accession number, amplicon size (bp), location of polymorphic site and primer sequences ghr |alui gene of grati-po cattle gene genbank accession number amplicon size (bp) location of polymorphic site primer sequences (5’-3’) ghr|alui af140284.1 342 exon 10 f:5'-gct aac ttc atc gtg gac aac-3' r : 5’-cta tgg cat gat ttt gtt cag-3’ di stasio et al. (2005) association ghr|alui gene with body weight in grati-po cattle (hartati et al.) 275 results and discussion body weight performance of grati-po cattle descriptive analysis of the body weight performance of grati-po cattle in the ghr|alui gene validation material was shown in table 2. in this study, the mean of birth weight, weaning weight, yearling weight and 18 months weight of grati-po cattle were 25.4 + 0.2 kg; 113.8 + 2.3 kg; 159.9 + 2.7 kg and 213.7 + 3.6 kg, respectively. the results of statistical analysis show that sex has a significant effect (p<0.05) on birth weight of grati-po cattle. the birth weight male calves was higher than female calves were 26.0 + 0.3 kg and 24.8 + 0.2 kg, respectively. the performance of grati-po cattle birth weight in this study was not different from the birth weight in the previous study that was 25.58 ± 3.31 kg (hartati et al., 2015). the birth weight of gratipo cattle in this study was higher than the birth weight of po cattle in napis village, tambakarejo, bojonegoro district that was 11.07 + 3.92 kg (nonok and darmawan, 2014). however, the birth weight of po cattle in this study was much lower than those of po kebumen which reached 31.88 ± 3.78 kg (maharani et al. 2018) or compared to the same bos indicus cattle in other country, such as brahman cattle in columbia which reach to 33.06 ± 3.60 kg (martínez et al., 2017), and nellore cattle in brazil which reach to 32.30 ± 3.80 kg (chud et al., 2014). in this study showed insignificant results between sex on weaning weight and yearling weight in grati-po cattle although during this period, growth was strongly influenced by the environment because at the age of 7 months the calves have begun to wean and learn to consume finished feed until mature. meanwhile, at 18 months weight there was a very significantly (p<0.05) between sex, where the body weight of the 18 months po male cattle : as higher than the female po cattle (225.2 ± 5.8 kg and 203.2 ±4.2 kg, respectively). this probably because the age of yearling to 18 months was the optimal growth period for beef cattle, male and female cattle growth was influenced by sex steroid hormones. the estrogen hormone can inhibit bone growth, especially at the ends of the bones, so that female growth was stunted after puberty begins, whereas male after puberty will continue to grow for a longer period which was stimulated by androgen hormones (testosterone) especially bone growth and other parts, so that : males were always heavier than females at the same age (djagra et al., 2002) ghr|alui gene polymorphism visualization of ghr restriction with alui enzyme, sequence of ghr gene and chromatogram of ghr gene are presented in figure 1, 2 and 3. in figure 3 was shown the chromatogram sequence of the ghr gene from individual po cattle with genotypes aa and gg genotypes. in the gg genotype, there was a substitution of a to g at exon 10 causing a change in the amino acid serine (agc) to glycine (ggc). morihito et al. (2017) stated that the mutation in dna in organisms was substitutions, deletion or addition of one or more parts of the dna molecule. the genotype frequency, allele and heterozygosity of the ghr|alui gene in grati-po cattle were shown in table 3. the genotype frequency in grati-po cattle were detected to have three genotypes, namely aa, ag and gg (figure 1 and figure 2). the aa and ag genotypes of the ghr|alui gene in grati-po cattle were found at almost the same frequency, that were 42.1% and 44.4%, while the gg genotype was found in the lowest frequency that was 13.5%. the a allele was a common allele found in grati-po cattle with a frequency of 0.643 meanwhile the : the g allele was 0.357. where, 𝑌𝑖𝑗𝑘 = dependent variable (bw, ww, yw or 18 mw) µ = overall mean 𝜎𝑖 = the effect of i th sex (male and female) 𝛽𝑗 = fixed effect of the j th genotype (aa, ag, gg) 𝑒𝑖𝑗𝑘 = random residual effect 276 j.indonesian trop.anim.agric. 46(4):272-281, december 2021 the previous research on several local indonesian beef cattle, the a allele was also a common allele, such as on grati-bali cattle 0.579 (hartati, et al., 2021), kebumen cattle 0.58 (soewandi et al., 2021), bali cattle 0.991 and pesisir cattle 0.615 (zulkharnaim et al., 2010). likewise with other exotic cattle such as simmental cattle, the most common genotype figure 1. visualization of ghr restriction with alui restriction enzyme figure 2. sequence alignment of the aa and gg genotype sequenced samples with genbank af140284.1 of bovine ghr gene. the g.257a>g are targeted snp of bovine ghr gene in present study. the grey highlighted sequences are flanking primers (forward and reverse). the restriction site of alui (5' ag^ct 3’) are shown in the yellow highlighted sequences. the three novel snps found between the po cattle sequences (present study) compared with genbank (af140284.1) are indicated by red letters. association ghr|alui gene with body weight in grati-po cattle (hartati et al.) 277 was the aa genotype (64.19%) and the a allele was the common alel (0.720) (ardicli et al., 2017). in contrast, the g allele was the common allele found in simmental and limousin cattle raised at singosari national artificial insemination center bbib singosari malang were 0.714 and 0.735, respectively (zulkharnaim et al., 2010). the results of statistical analysis showed that the genotype frequency of the ghr|alui gene in grati-po cattle was still in hardyweinberg equilibrium (hwe). this explains that the frequency of alleles and genotype in the grati-po cattle population will remain constant from generation to generation. the po cattle population was large enough to have the chance to mate randomly, which causes the gene frequency to remain the same. the factors that can change the frequency of genes in a population were selection, mutation, migration, genetic drift and evolution (falconer and mackay, 1996). the genetic diversity of a gene can be evaluated by the heterozygosity value (ho, he, ne) and polymorphism information content (pic) value. the statistical analysis result showed that the expected heterozygosity (he) and the observed heterozygosity (ho) values in the ghr|alui gene were 0.459 and 0.460. this table 2. performance of grati-po cattle sex n bw + se ww + se yw + se 18 mw + se male female total 146 158 304 26,0 + 0,3ª 24,8 + 0,2ᵇ 25,4 + 0,2 113,2 + 3,2 114,3 + 3,2 113,8 + 2,3 162,1 + 4,1 157,9 + 3,5 159,9 + 2,7 225,2 + 5,8ª 203,2 + 4,2ᵇ 213,7 + 3,6 n : number of observation; bw : birth weight; ww : weaning weight; yw : yearling weight; 18 mw : 18 month weight; se: standard error; means in the same row with different superscripts differ significantly (p<0.05). table 3. genotype frequency, allele and heterozygosity ghr|alui gene of grati-po cattle. gene sex n genotype frequency allele frequency χ2test he ho pic ne aa ag gg a g ghr male 14 6 0.418 0.459 0.123 0.647 0.353 0.004 0.457 0.458 0.352 1.840 female 15 8 0.424 0.430 0.146 0.639 0.361 0.707 0.461 0.463 0.355 1.856 total 30 4 0.421 0.444 0.135 0.643 0.357 0.323 0.459 0.460 0.354 1.849 n : number of observation; x 2 test : chi-square value; he : heterozigosity expected; ho: heterozigosity observed; pic: polymorphic information content; ne: number of effective allele. (a) (b) figure 3. chromatogram sequences of ghr gene in individual of (a) po with aa genotype (b) po with gg genotype. substitution of a to g at exon 10 causing a change in the amino acid serine (agc) to glycine (ggc). 278 j.indonesian trop.anim.agric. 46(4):272-281, december 2021 result shows that grati-po cattle have a high enough value on genetic diversity. the ne valu in this study was 1.849 which means that there were differences in allele frequencies in the ghr|alui gene for grati-po cattle. determination of the informative level of a marker can be seen from the pic value with with three categories, namely the low category (≤0.25), the moderate category (0.25<pic<0.5), and high category (≥0.5). the pic value was 0.354 and in the moderate category. the pic value of grati-po cattle in this study was included in the moderate category which indicated that the markers on the ghr|alui gene were very informative so that it can be associated with body weight in the gratipo cattle population. association of ghr | alui gene with body weight in grati-po cattle the analysis result of the association of ghr|alui genotypes with body weight of gratipo cattle are presented in table 4. the statistical analysis results showed that there was no interaction between sex and genotype even though the effect of sex was significantly different on birth weight and body weight at 18 months (table 2). the genotype of the ghr|alui gene was significantly (p<0.05) associated to weaning weight, yearling weight and 18 months weight in gratipo cattle but not significant (p>0.05) with birth weight of grati-po cattle. the ghr gene was also reported to be significantly associated with weaning weight and daily weight gain in pasundan cattle (said et al., 2016), weight gain and carcass weight in nellore cattle (bos indicus) and it cross breed (curi et al., 2006) but it has no effect on reproductive performance in holsteinfriesian cattle (hadi et al., 2015). in bos taurus cattle, the ghr|alui was found to be associated with birth weight, final wieght and several characteristics of meat quality (di stasio et al., 2005; reardon et al., 2010). this research found that the ag genotype in grati-po cattle has the highest body weight performance both at weaning weight, yearling weight and 18 months weight. based on the results of this study, genotype-based selection can be carried out on individuals with the ag genotype with the selection criteria for weaning weight or yearling weight. weaning weight and yearling weight were two growth characteristics that has high economic value. the high weaning weight illustrates the mother's good mothering ability in raising calves and having good milk production (falconer and mackay 1996). in addition, the heritability value obtained for the two traits where the highest heritability was obtained at the weaning and yearling weight of 0.47+0.15 table 4. association between ghr|alui gene polymorphism and body weight in grati-po cattle genotype n bw +se n ww + se n wy + se n 18 mw+se male (m) aa 61 25.8±0.4 60 108.0±4.5 60 147.6±5.2 58 202.1±7.1 ag 67 26.1±0.4 67 117.8±5.2 67 174.4±6.5 66 242.6±9.1 gg 18 26.4±1.0 17 113.4±7.5 17 164.9±11.8 17 236.3±17.7 female (f) aa 67 25.3±0.4 67 104.4±3.5 67 146.9±4.9 67 179.8±4.0 ag 68 24.6±0.3 64 122.4±5.7 64 170.3±5.3 64 224.9±7.3 gg 23 23.9±0.7 23 120.6±9.9 23 155.4±9.8 23 211.0±11.6 m and f aa 128 25.5±0.3 127 106.1±2.8 a 127 147.2±3.5 a 125 190.2±4.1 a ag 135 25.3±0.3 131 120.0±3.8 b 131 172.4±4.2 b 130 233.9±5.9 b gg 41 25.0±0.6 40 117.5±6.5 ab 40 159.4±7.5 ab 40 221.8±10.1 b n = number of observation; bw : birth weight; ww : weaning weight; yw : yearling weight; 18 mw : 18 month weight; se: standard error; means in the same row with different superscripts differ significantly (p<0.05). association ghr|alui gene with body weight in grati-po cattle (hartati et al.) 279 and 0.63+0.17, respectively (hartati et al., 2015). thus it could be proposed that the ghr gene is very potential and could be used as a genetic marker on genetic improvement and selection for superior of grati-po cattle . conclusion the ghr|alui gene was found to be moderately polymorphic in grati-po cattle. there was no association between ghr|alui gene genotype and birth weight, but it was significant with weaning weight, yearling weight and 18 month weight. therefore, ghr|alui gene may be a potential genetic marker for those three body weight parameters in grati-po cattle. however, this association needs to be validated to the subsequent offspring so that it can optimistically be used as a genetic marker in improving body weight performance in the breeding program for grati-po cattle. acknowledgements this study was founded by the indonesian agency for agricultural research and development (iaard) through kegiatan kerjasama penelitian, pengkajian dan pengembangan pertanian strategis (kp4s) on contract number 31.14/pl.040/h.1/02/2018.k. the author would like to thank all the indonesia beef cattle research station of grati pasuruan teams who helped carry out this research. references albertí, p., b. panea, c. sañudo, j.l. olleta, g. ripoll, p. ertbjerg, m. christensen, s. gigli, s. failla, s. concetti, j.f. hocquette, r. jailler, s. rudel, g. renand, g.r. nute, r.i. richardson and j.l. williams. 2008. live weight, body size and carcass characteristics of young bulls of fifteen european breeds. livest. sci. 114: 19–30 ardicli, s., d. dincel., h. samli and f. balci. 2017. effects of polymorphisms at lep, cast, capn1, ghr, fabp4 and dgat1 genes on fattening performance and carcass traits in simmental bulls. arch. anim. breed. 60: 61–70. botstein, d., r.l. white, m. skolnick and r.w. davis. 1980. construction of a genetic linkage map in man using restriction fragment length polymorphisms. am. j. hum. genet. 32:314–31 soewandi, b. d. p., hartati and a. a. r. hapsari. 2021. identification of growth hormone gene polymorphism and its association with body weight in po kebumen cattle. 2021. the 7th international conference on sustainable agriculture and environment iop conf. series: earth and environmental science 637 (2021) 012072. buzanskas, m. e., d. a. grossi, r. v. ventura, f. s. schenkel, m. sargolzaei, s. l. c. meirelles, f. b. mokry, r. h. higa, m. a. mudadu, m. v. g. b. da silva, s. c. m. niciura, r. a. a. t. junior, m. m. alencar, l. c. a. regitano and d. p. munari. 2014. genome-wide association for growth traits in canchim beef cattle. plos one 9(4): e94802. doi:10.1371/ journal.pone.0094802 cady, g., t. landeryou, m. garratt , j. j. kopchick, n. qi , d. garcia-galiano, c. f. elias, m. g. myers., r. a. miller , d.a. sandoval and m. sadagurski. 2017. hypothalamic growth hormone receptor (ghr) controls hepaticglucose production in nutrient-sensing leptin receptor (leprb) expressing neurons. mol. metab. 6:393-405 chia, d.j. 2014. minireview: mechanisms of growth hormone mediated gene regulation. mol. endocrinol. 28: 1012–1025 chud, t.c.s., s.l. caetano, m.e. buzanskas, d.a. grossi, d.g.f. guidolin, g.b. nascimento, j.o. rosa, r.b. lobo and d.p. munari. 2014. genetic analysis for gestation length,birth weight, weaning weight, and accumulated productivity in nellore beef cattle. livest. sci.170:16–21 coyne, j.m., ross d. evans and d.p. berry. 280 j.indonesian trop.anim.agric. 46(4):272-281, december 2021 2019. dressing percentage and the differential between live weight and carcass weight in cattle are influenced by both genetic and non-genetic factors. j. anim. sci. 2019.97:1501–1512 curi, r.a., h.n. oliveira, a.c. silveira and c.r. lopes. 2006. effects of polymorphic microsatellites in the regulatory region of igf1 and ghr on growth and carcass traits in beef cattle. anim. genet. 36:5862 deepika, r., and k. salar. 2013. polymorphism studies of growth hormone receptor (ghr) gene in indigenous grey cattle breeds of india. dhr-ijbls. 4:270-277 deng, f., c. xia, x. jia, t. song, j. liu, s. lai and s. chen .2015. comparative study on the genetic diversity of ghr gene in tibetan cattle and holstein cows. anim. biotechnol. 26: 217-221 di stasio, l., g. destefanis, a. brugiapaglia, a. albera and a. rolando. 2005. polymorphism of the ghr gene in cattle and relationships with meat production and quality. anim. genet.36:138–140 djagra, i.b., i.g.n.r. haryana, i.g.m. putra, i.b. mantra, a.a. oka. 2002. standard body size of bali cattle. report of research results. cooperation between bappeda of bali province and the faculty of animal husbandry, udayana university, denpasar. falconer, d.s. and t.f.c. mackay. 1996. introduction to quantitative genetic. 4th ed. prince john. north canada state university press, kanada. fedota, o.m., n.g. lysenkoa, s. yu. rubanb, o.i. kolisnykc and i.v. goraychukd. 2017. the effects of polymorphisms in growth hormone and growth hormone receptor genes on production and reproduction traits in aberdeen-angus cattle (bos taurus l., 1758). cytol. genet. 51: 352– 360 ge,w., m.e. davis, h.c. hines and k.m. irvin. 2000. rapid communication: single nucleotide polymorphisms detected in exon 10 of the bovine growth hormone receptor gene. j. anim. sci.78:2229– 2230 ge, w., m. e. davis, h.c. hines, k.m. irvin and r.c.m. simmen. 2003. association of single nucleotide polymorphisms in the growth hormone and growth hormone receptor genes with blood serum insulin-like growth factor i concentration and growth traits in angus cattle. j. anim. sci. 81:641–648 hadi, z., h. atashi, m. dadpasand, a. derakhshandeh and s.m.m. ghahramani. 2015. the relationship between growth hormone polymorphism and growth hormone receptor genes with milk yield and reproductive performance in holstein dairy cows. ijvr.15: 244-248 hartati, muladno, jakaria, r. priyanto, a. gunawan, aryogi and c. thalib. 2015. heritability estimation and non genetic factors affecting production traits of indonesian ongole cross.indones. jitv. 20:168-174 hartati, h., b.d.p. soewandi, a.a.r. hapsari, s. anwar and d. pamungkas. 2019. identification of gh|mspi and ghr|alui gene polymorphism and its association with calf birth weight of grati-po cattle.indones. jitv. 24 49–55 hartati, m. luthfi, d. ratnawati and b.d.p soewandi. 2021. detection of growth hormone (gh|mspi,ghr|alui, pit1|hinfi) genes polymorphism and its association with body weight of grati-bali cattle (bos sondaicus). iop conf. series: earth and environmental science 788 (2021) 012010. the 3rd international conference of animal science and technology. doi:10.1088/1755-1315/788/1/012010 kaps m. and w. r. lamberson. 2004. biostatistics for animal science. cabi publishing, london. maharani, d., a. fathoni, sumadi, t. hartatik and m.khusnudin. 2018. identification of mc4r gene and its association with body weight and body size in kebumen ongole grade cattle. j. indonesian trop. anim. agric. 43:87–93 martínez, r. d. bejarano, y. gómez, r. dason association ghr|alui gene with body weight in grati-po cattle (hartati et al.) 281 eville, a. jiménez, g. even, j. sölkner, and g. mészáros. 2017. genome-wide association study for birth, weaning and yearling weight in colombian brahman cattle. genet. mol. biol. 40:453–459. meyer k. 1995. estimates of genetic parameters for mature weight of australian beef cows and its relationship to early growth and skeletal measures. livest. prod. sci. 44:125-137 moody d.e., d. pomp, w. barendse and j.e. womack. 1995. assignment of the growth hormone receptor gene to bovine chromosome 20 using linkage analysis and somatic cell mapping. anim. genet. 26:341-343 morihito, rondo v.s.a, stephanie e chungdinata, timboeleng a nazareth, m iqbal pulukadang, roy a.m makalew, and benny pinontoan. 2017. “identifikasi perubahan struktur dna terhadap pembentukan sel kanker menggunakan dekomposisi graf.” jurnal ilmiah sains 17 (2): 153. doi:10.35799/jis.17.2.2017.17368. nei, m., and f. tajima. 1981. genetic drift and estimation of effective population size. genetics. 98:625-640 nei, m. and s. kumar. 2000. molecular evolution and phylogenetics. oxford university press, new york. nonok, s., and h. darmawan. 2014. genetic profile and ongole breed cattle breeders as a basic strategy for the development of the village for animal breeding centers. buana sains. 14: 71-84 oleński, k., t. suchocki and s. kamiński. 2010. inconsistency of associations between growth hormone receptor gene polymorphism and milk performance traits in polish holstein-friesian cows and bulls. anim. sci. pap. reports. 28: 229–234 putra, w. p. b., sumadi and t. hartatik. 2014. the genetic correlation of growth traits in aceh cattle at indrapuri district aceh province. j. agripet. 14:37-41 reardon w, a.m. mullen, t. sweeney and r.m. hamill. 2010. association of polymorphisms in candidate genes with colour, water-holding capacity, and composition traits in bovine m. longissimus and m. semimembranosus. meat sci. 86: 270-275 said, s., p.p. agung, w.p.b. putra, s. anwar and a.s. wulandari. 2016. estimation of most probable producing ability value for calf birth’s performance in sumba ongole cows. j. indonesian trop. anim. agric. 41: 53–60 waters, m.j., and a.j. brooks. 2015. jak2 activation by growth hormone and other cytokines. biochem. j. 466:1-11 waters, s. m. , m. s. mccabe, d. j. howard, l. giblin, d. a. magee , d. e. machugh and d. p. berry. 2011. associations between newly discovered polymorphisms in the bos taurus growth hormone receptor gene and performance traits in holstein –friesian dairy cattle. anim. genet. 42:3949 weir, b.s. 1991. genetic data analysis ii: methods for discrete population genetic data. inc. publishers, sunderland. zulkharnaim, jakaria and r.r. noor. 2010. identification of genetic diversity of growth hormone receptor (ghr|alui) gene in bali cattle. media peternakan, 33:81–87 j i t a a journal of the indonesian tropical animal agriculture accredited by ditjen penguatan risbang no. 60/e/kpt/2016 j. indonesian trop. anim. agric. pissn 2087-8273 eissn 2460-6278 http://ejournal.undip.ac.id/index.php/jitaa 45(3):214-221, september 2020 doi: 10.14710/jitaa.45.3.214-221 antioxidant activity and chemical characteristics in egg albumen fermented by lactid acid bacteria n. nahariah1,*, h. hikmah1 and f.n. yuliati2 1laboratory of meat and eggs, faculty of animal husbandry, hasanuddin university makassar, jl. perintis kemerdekaan km 8, makassar 90245 indonesia 2laboratory of animal microbiology, faculty of animal husbandry, hasanuddin university makassar, jl. perintis kemerdekaan km 8, makassar 90245 indonesia *corresponding e-mail: nahariah11@gmail.com received january 18, 2020; accepted june 30, 2020 abstrak kajian waktu fermentasi menggunakan mikrobia dengan penambahan susu bubuk pada albumen telur masih terbatas. tujuan penelitian ini untuk mengevaluasi aktivitas antioksidan dan karakteristik albumen telur fermentasi yang menggunakan level susu bubuk full cream dan waktu fermentasi mikrobia yang berbeda. penelitian ini menggunakan rancangan acak lengkap pola faktorial 4 x 5 perlakuan dengan 4 ulangan. bahan penelitian antara lain telur, susu bubuk full cream dan tiga jenis bakteri asam laktat (l. bulgaricus, l.achidopillus, dan streptococcus thermopillus). perlakuan penelitian yaitu penambahan level susu bubuk (%) meliputi, 0, 2, 4 dan 6. waktu fermentasi adalah 0, 12, 24, 36, dan 48 jam. hasil penelitian menunjukkan bahwa penambahan level susu bubuk dan waktu fermentasi pada albumen telur tidak berpengaruh nyata terhadap aktivitas antioksidan. penambahan level susu bubuk tidak berpengaruh nyata terhadap kandungan glukosa, dan total protein, namun berpengaruh sangat nyata (p<0,01) terhadap kadar air. waktu fermentasi berpengaruh sangat nyata (p<0,01) terhadap glukosa, total protein namun tidak berpengaruh nyata terhadap kadar air. aktivitas antioksidan tidak mengalami perubahan selama penambahan level susu bubuk dan fermentasi berlangsung. waktu fermentasi 24 jam dapat mengurangi total protein dan kadar glukosa. penambahkan 2% susu bubuk dapat mengurangi kadar air pada albumen telur fermentasi. kata kunci : fermentasi, bakteri asam laktat, aktivitas antioksidan, albumen telur abstract research on fermentation time and the addition of milk powder to egg albumen is still limited. the purpose of this study was to determine the antioxidant activity and chemical characteristics of fermented egg albumen using different levels of full cream milk powder and different microbial fermentation times. this study used a completely randomized factorial pattern design, 4 x 5 treatments with 4 replications. research materials include egg albumen, full cream milk powder and mixed lactic acid bacteria (l. bulgaricus, l.achidopillus, and streptococcus thermopillus). the research treatments were the addition of powdered milk in different level (%) including, 0, 2, 4 and 6. fermentation times were 0, 12, 24, 36, and 48 h, respectively. the results showed that the addition of powdered milk in different level and fermentation time had no significant effect on the antioxidant activity. the addition of different-level powdered milk was not significant on the glucose content and total protein, but it was very significant (p<0.01) on water content. the fermentation time had a very significant effect (p<0.01) on glucose levels and total protein, but it had no significant effect on the water content of albumen 214 j.indonesian trop.anim.agric. 45(3):214-221, september 2020 fermentation. antioxidant activity did not change during the fermentation time and the addition of different-level milk powder. the 24 h fermentation time could reduce the total protein and glucose levels of egg albumen. adding 2% milk powder could reduce the water content of egg albumen fermentation. keywords: fermentation, lactic acid bacteria, antioxidant activity, egg albumen introduction eggs are foods rich in antioxidants, vitamins, calcium, unsaturated fatty acids, and polyunsaturated fatty acids (kuang et al, 2018; miranda et al., 2015). eggs are also food which contains high protein, especially in the albumen part. however, the utilization of egg albumen is still limited so that some efforts need to be made to diversify the food. one of the efforts to increase the utilization of albumen egg is processing the albumen egg into drinks. egg albumen processed as a beverage product are constrained by the thick characteristics of the albumen proteins (kuang et al, 2018; miranda et al., 2015). this is because egg albumen has 2 types of proteins including simple proteins and conjugate proteins. simple protein consists of ovalbumin by 75%, ovoconalbumin by 3%, and ovoglobulin by 2% of the total egg albumen (kuang et al, 2018; abeyrathne et al., 2014 ). another protein, which is conjugate protein, is glycoprotein consisting of ovomucoid by 13% and ovomucin by 7%, (kuang et al, 2018; miranda et al., 2015). complex proteins or conjugations are generally bound to carbohydrates and have a thicker characteristic. in general, the protein content of egg albumen is 12.58% (kuang et al, 2018). several studies have been conducted to break down egg albumen proteins. one of which is the method of fermentation using microbes (adebowale and maliki, 2011). fermentation is carried out with the aim of breaking down complex proteins into simpler proteins. a research of nahariah et al. (2018) shows that fermentation using mixed lab which includes l.bulgaricus, l.achidopillus, and streptococcus thermopillus can increase the dissolved protein of fermented egg albumen by 5.34 mg /ml. egg albumen fermentation is a fermented egg product. egg albumen fermentation is expected to be a fermented beverage. egg albumen fermentation has already been developed, but the results have not been maximized. lactic acid bacteria (lab) can be used in egg albumen are very limited, so that can inhibit their activity and growth. microbes which growth is inhibited will have a low metabolic outcome. microbes need energy to carry out activities and growth. energy can be obtained from the results of its metabolism. eggs, especially the albumen part, are very suitable to function as the additional nutrients from the external environment. some sources of glucose include milk. milk can be in either liquid or powder form. milk contains various nutrients, including lactose which is quite high. lactose content is one of the energy sources for microbial growth, especially lactic acid bacteria. maulana et al. (2016) explained that the addition of liquid milk to fermented egg albumen can reduces the ph and moisture content of the fermented egg albumen product. the addition of liquid milk can also give a whiter color with a thinner consistency. chicken egg albumen are food ingredient that contains antioxidants (wawrzykow and kankofer, 2011; nahariah et al., 2014). however, antioxidant activity in egg albumen is still limited. one of the efforts to increase the antioxidants is using the fermentation method. egg albumen as fermented beverage products are being developed and show changes in the characteristics and the increased antioxidant activity (nahariah et al., 2018). the addition of 2% full cream liquid milk on the egg albumen fermentation process can increase dissolved protein and maintain total microbial and antioxidant activity (nahariah et al., 2018). the addition of full cream milk powder is expected to be a source of energy for microbial growth. moreover, the fermentation time can also play a role in the final metabolism of the fermentation process. this studies aim to examine the effect of fermentation time and the addition of differentlevel milk powder on the chemical characteristics and antioxidant activity of fermented egg albumen materials and methods this studies used main ingredients in the form of egg albumen and full cream milk powder. eggs were obtained form chicken farms in maros regency, south sulawesi. the milk powder was a commercial product obtained from a food store. lactobacillus sp (lab) mixed to consisted antioxidant activity on egg albumen fermentation (n. nahariah et al.) 215 https://www.ncbi.nlm.nih.gov/pubmed/?term=kuang%20h%5bauthor%5d&cauthor=true&cauthor_uid=30210871 https://www.ncbi.nlm.nih.gov/pubmed/?term=kuang%20h%5bauthor%5d&cauthor=true&cauthor_uid=30210871 https://www.ncbi.nlm.nih.gov/pubmed/?term=kuang%20h%5bauthor%5d&cauthor=true&cauthor_uid=30210871 https://www.ncbi.nlm.nih.gov/pubmed/?term=kuang%20h%5bauthor%5d&cauthor=true&cauthor_uid=30210871 https://www.ncbi.nlm.nih.gov/pubmed/?term=kuang%20h%5bauthor%5d&cauthor=true&cauthor_uid=30210871 of l.bulgaricus, l.achidopillus, and streptococcus thermopillus. the types of bacteria was derived from commercial yogurt. yogurt product has been developed at the teaching industry, hasanuddin university. this studies used a completely randomized factorial pattern (factorial crd) 4 x 5 with 4 replications (steel and torrie, 1991). each treatment unit used 100 ml of egg albumen. the research treatments included the addition of different-level milk powder (%) 0; 2; 4; 6 and fermentation times 0, 12, 24, 36, and 48 h, respectively. the research procedures were: (1) culture propagation and (2) sample preparation. in culture propagation, the parent culture dilution was carried out by mixing as much as 20 g of parent culture into a sample bottle containing 300 ml of milk liquid (maulana et al., 2016). the material mixture was then homogenized and fermented at 37○c for 24 h. making starter culture (further called biang) was done by taking 100 ml of starter culture and mixing with 100 ml of egg albumen. it then homogenized then fermented at 37○c for 24 h (nahariah et al., 2015). sample preparation, chicken eggs were sterilized by using non-thermal heating. after that, the egg shell were broken, then the egg albumen and yolk were separated using an egg separator. a total of 100 ml of egg albumen were homogenized using a stirrer without forming foam. furthermore, 10 ml of starter sub culture and full cream milk powder in different level were added based on the research treatment. egg sample mixture was homogenized and fermented at 37○c with fermentation time based on the treatment. the testing process was in accordance with each test parameter. measurement of antioxidant activity using the dpph method (1,1-diphenyl-2-picrylhydrazyl) were slightly modified. a total of 3.9 ml of dpph solution (0.1 mm dpph radical in methanol) was mixed with 0.1 ml of sample ( the sample had also been extracted with methanol). the dpph reagen and sample were mixed and shaken. and then the sample mixture was allowed to stand at a temperature in the dark for 3 h. the absorbance of the sample was measured with a uv-vis spectrophotometer (shimadzu brand) at 515 nm. dpph radical scavenging effect (%) = [(a dpph-a sample)/a dpph] x 100, a dpph is the absorbance of dpph, a sample is the absorbance of the sample (chaves et al., 2020; gasic et al., 2014). measurement of total protein value (horwitz and latimer, 2010), a sample of 2 g was poured into the kjeldahl flask along with 20 g of k2so4, 1g hgo and 25 ml of concentrated h2so4. the kjeldahl flask was allowed to cool and slowly add 200 ml of distilled water until the temperature reaches 250oc. the next step was add the naohthiosulfate solution carefully to prevent sudden mixing. the kjeldahl flask was connected to the distillation apparatus and heated until all ammonia was distilled. the remaining standard acid solution titrated with standard naoh solution: n(g/kg) = (vx1,401)/w, n = nitrogen amount, v= volume, w = sampel weight (1 ml acid 0.1 n = 1.401 mg n), glucose contents and water content (horwitz and latimer, 2010). results antioxidant activity antioxidant activity in fermented egg albumen with different levels of milk powder and fermentation time is presented in table 1. the results of variance analysis showed that there was no significant effect on the addition of powdered milk in different levels with different fermentation times. antioxidant activity in fermented egg albumen tended to decrease in the addition of different-level milk powder. this showed that there was a potential for adding different milk powder to reduce antioxidant activity. this was different with the previous studies that the tendency of antioxidant activity to increase in line with the addition of additional levels of full cream liquid milk (nahariah et al., 2018). total protein value the total protein value in fermented egg albumen with different levels of milk powder and fermentation time are presented in table 2. the fermentation time showed a significant effect (p<0.05) on the protein of the fermented egg albumen products. further test results showed that the total protein was significantly different decreases with increasing fermentation time. the total protein in egg albumen did not changes before and after 12 h fermentation. however, the optimal time to reduce the total protein value of fermented egg albumen was 24 h fermentation. there was no difference on the protein reduction at 24 h, 36 h, and 48 h fermentation time. the results of variance analysis showed that the addition of different milk powder has no significant effect on the total protein value of fermented egg albumen. this suggested that the 216 j.indonesian trop.anim.agric. 45(3):214-221, september 2020 addition of milk powder did not contribute to the total protein changes, although it showed the tendency of protein values to decrease in line with the level of milk powder added. glucose content glucose contents in fermented chicken egg albumen with different levels of milk powder and fermentation time are presented in table 3. the results of variance analysis showed that the fermentation time has a very significant effect (p<0.01) on the glucose contents of fermented egg albumen. duncan test further showed that glucose contents decreased with the increasing fermentation times. although there was no difference between pre and post 12 h fermentation, the 12 h fermentation showed significantly different decrease during 24 h, 36 h, and 48 h fermentation time. the fermentation of egg albumen for 24 h did not show significant differences with the increasing fermentation time of 36 h and 48 h. this showed that the optimal fermentation time was 24 h in which it could reduce glucose contents in fermented egg albumen. the results of variance analysis showed that the addition of different milk powder had no significant effect on glucose contents of fermented egg albumen. this showed that the addition of milk powder did not give a change in the glucose contents of fermented egg albumen. however, it showed the tendency of glucose contents to decrease in line with the level of added milk powder. antioxidant activity on egg albumen fermentation (n. nahariah et al.) 217 table 2. the total protein value (g) of fermented egg albumen with the addition of different levels of milk powder and fermentation time milk powder addition (%) time of fermentation (hour) mean 0 12 24 36 48 0 8.07±1.37 8.18±1.29 6.53±0.29 7.14±0.48 6.98±0.26 7.38±0.94 2 7.95±1.36 7.78±1.59 6.43±0.16 6.48±1.10 6.90±0.82 7.10±1.08 4 7.81±1.23 7.78±1.36 6.23±0.01 7.17±1.55 6.93±1.71 7.18±1.16 6 8.06±1.61 8.07±1.48 6.07±1.17 6.36±1.05 6.36±1.15 6.98±1.35 mean 7.97±1.07a 7.95±1.10a 6.31±0.49b 6.78 ±0.93ab 6.79±0.89ab 7.16±1.11 different superscripts in the same row indicate highly significant differences (p<0.01) table 1. antioxidant activity (%) of fermented egg albumen in addition to different levels of milk powder and fermentation time milk powder addition (%) time of fermentation (hour) mean 0 12 24 36 48 0 5.72±3.51 6.48±4.27 4.11±1.16 2.82±0.62 2.45±1.67 4.31±2.85 2 3.71±2.03 3.73±3.21 3.92±0.56 2.53±1.21 2.11±1.49 3.20±1.86 4 3.55±4.42 3.96±2.96 3.79±0.81 2.45±0.96 2.21±1.29 3.19±2.35 6 2.15±0.73 2.06±0.70 3.05±0.26 2.97±0.27 2.31±0.39 2.51±0.63 mean 3.78±3.00 4.06±3.19 3.72±0.81 2.69±0.76 2.27±1.18 3.30±2.15 water content water content in fermented egg albumen with the addition of different levels of milk powder and fermentation time are presented in table 4. the results of variance analysis showed that the fermentation time did not significantly affect the water content of the fermented egg albumen. this showed that the fermentation time did not change the water content of the fermented egg albumen. however, there was a tendency in decreasing water content, in line with the addition of fermentation time to the fermented egg albumen. the results of variance analysis showed that the addition of different-level milk powder had a very significant effect (p <0.01) on the water content of fermented egg albumen produced. duncan's follow-up test showed that there was a marked difference in the decrease with increasing milk powder although there was no significant difference between with or without addition of 2% and 4%. however, water content to egg albumen showed a significant difference with the addition of 6% milk powder. this was due to the characteristic of powder from milk powder which can bind water to egg albumen. discussion table 1 shows the tendency of antioxidants to work optimally to inhibit the oxidation process, especially protein oxidation which occured in fermented egg albumen. this was characterized by the decreasing antioxidant activity during fermentation. the fermentation process in the egg albumen was likely to produce high antioxidants. research by fastawa et al. (2016) shows an increase in the antioxidant activity, in line with the increasing fermentation times in infertile eggs which are left over from the hatchery industry. fermentation can increase antioxidants and reduce rancidity (ledesma et al., 2005; torino et al.,2013). antioxidants are bioactive compounds which naturally exist in food ingredients, including eggs (nahariah et al., 2014; nys et al., 2011). antioxidants generally exist in food which contains high protein. antioxidants are the functional compounds composed of peptide sequences which are derived from decomposed proteins (fastawa et al., 2016; nahariah et al., 2015; majumder et al., 2010). antioxidant compounds are needed in food ingredients to reduce or inhibit oxidative reactions due to the oxidation process (wawrzykow and kankofer, 2011; chaves et al., 2020). the oxidation process in food ingredients can occur due to the fact that food ingredients experience storage, processing, and post-processing handling (pengseng et al., 2010). antioxidants are bioactive compounds which have the ability to inhibit the oxidation process (nahariah et al., 2018). oxidation of food ingredients is related to the presence of oxygen in the air which interacts with the food ingredients (chaves et al., 2020; domínguez et al., 2020). the oxidation process in the food ingredients will have an impact on the decline of the food quality (domínguez et al., 2020). the fermentation process is thought to be the result of oxidative stress which is probably caused by the oxidation of proteins that occur. although protein oxidation 218 j.indonesian trop.anim.agric. 45(3):214-221, september 2020 table 3. glucose contents of fermented egg albumen (%) in addition to different levels of milk powder and fermentation time milk powder addition (%) time of fermentation (hour) mean 0 12 24 36 48 0 3.53±2.23 3.31±2.28 1.73±0.16 0.68±0.52 0.94±0.88 2.03±1.67 2 3.26±2.31 3.24±2.26 1.17±0.55 0.65±0.24 0.73±0.49 1.81±1.67 4 3.21±2.21 3.05±2.17 1.27±0.50 0.67±0.23 0.81±0.47 1.80±1.57 6 3.42±2.53 3.46±2.67 1.67± 0.17 0.97±0.59 0.87±0.67 2.08±1.75 mean 3.35±1.76a 3.26±1.78a 1.46±0.39b 0.74±0.35b 0.84±0.50b 1.93±1.61 different superscripts in the same row indicate highly significant differences (p<0.01) only involves singlet oxygen which has no unpaired electron, it is not free radicals (domínguez et al., 2020). therefore, the addition of different levels of milk powder and fermentation time did not show a significant difference in the antioxidant activity of the fermented egg albumen (table 1). though the antioxidant potential of product was found to be low. however, this study has provided information about the antioxidant activity of egg albumen fermentation using lactid acid bacteria. future studies are expected to measured the concentration of antioxidants or ic50 in the product. the ic50 value is the concentration of antioxidants needed to provided 50% inhibition of the free radicals tested. a low ic50 value indicates a high antioxidant capacity. in general, the optimal growth curve of microbial, especially lactic acid bacteria (lab), has a growth time of 24 h of fermentation. this was likely related to the ability of microbial to grow and the availability of nutrients during the fermentation process. during the fermentation process, microbial are able to break down proteins and utilize nitrogen as their energy source (xu et al., 2010). this results in decreasing protein content. protein values which decrease in fermented egg albumen may be related to the ability of microbial to break down proteins into dissolved proteins (table 2). nahariah et al. (2018) showed an increase in soluble protein due to fermentation of egg albumen using liquid milk. the fermentation process in egg albumen results in the breakdown of protein to produce dissolved protein and small peptide (xu et al., 2010; nahariah et al. 2015: wikandari et al., 2011). the glucose contants decrease in the fermentation process of egg albumen (table 3). this is likely due to the activity of microbial which break down the glucose as energy sources (mishra et al., 2019). the microbial used in this study are a mixture of lab types consisting of l. bulgaricus, l.achidopillus, and streptococcus thermopillus. in general, lab microbial obtain energy from the glucose content in food ingredients (mishra et al., 2019; nahariah et al., 2015). glucose content in fermented egg albumen before added by milk powder is 3.5% or 0.5% higher than the glucose content in albumen by 3% (kuang et al., 2018). the addition of milk powder is expected to increase carbohydrate content as a source of energy for microbial growth. powder milk is a product which has low water content of about 5% due to the drying process carried out (kalyankar et al., 2016). low water content causes powder product to have hygroscopic properties. hygroscopic properties result in powder products which are easily absorbing water. the absorbed water will bind strongly to the material, so that the material-free water content becomes lower. this causes the addition of milk powder in fermented egg albumen will have an impact on the increasing amount of water absorbed and bonded to the material. milk is a product which is rich in protein, and if it is dried, the protein becomes porous asit binds to water (kalyankar et al., 2016). this condition resulted in water being trapped and strongly bound to the material-protein matrix (kalyankar et al., 2016; landfeld et al., 2008) in antioxidant activity on egg albumen fermentation (n. nahariah et al.) 219 table 4. water content of fermented egg albumen (%) in the addition of different levels of milk powder and fermentation time milk powder addition (%) time of fermentation (hour) mean 0 12 24 36 48 0 80.86±0.73 79.18±5.31 79.22±1.97 80.11±0.94 80.09±1.84 79.89±2.49a 2 78.73±2.33 80.24±0.54 79.67±2.42 78.76±1.11 76.42±5.45 78.76±2.92ab 4 79.09±0.89 77.62±3.09 78.72±0.90 78.72±0.90 78.16±0.38 78.49±1.61ab 6 77.48±2.11 78.00±3.74 75.61±3.56 77.04±1.33 77.79±1.66 77.19± 2.53b mean 79.04±1.95 78.76±3.39 78.34±2.80 78.66±1.49 78.12±3.01 78.58±2.58 different superscripts in the same row indicate highly significant differences (p<0.01) https://www.ncbi.nlm.nih.gov/pubmed/?term=kuang%20h%5bauthor%5d&cauthor=true&cauthor_uid=30210871 addition, one of the uniqueness of proteins is the presence of amino acid which have hydrophilic properties. it is the bonds will bind water to the surface of the material (legowo and hayakawa, 2012; kuang et al., 2018). carboxyl bonds in proteins are a combination of carbonil groups and hydroxyl groups. this will result in water absorption properties (kalyankar et al., 2016). hydroxyl bonds having -oh ions can trigger protein oxidation (chaves et al., 2020; domínguez et al., 2020). singlet oxygen in protein is not free radicals because it does not have free electrons (domínguez et al., 2020). any absorbed water can reduces free water, and bound water is limited in materials, so the total water content of the material decreases. the water content is important in the storage of food product. if the water content is low, the product can be stored longer. eggs have a water content of 80-88%. this research can provide information that the application of fermentation using lactic acid bacteria in egg albumen could reduces water content by 2%. conclusion antioxidant activity does not change during the fermentation time and the addition of different level milk powder. the 24 h fermentation time can reduce the total protein and glucose content of fermented egg albumen. adding 2% milk powder can reduce the water content of fermented egg albumen acknowledgments the authors greatfully to thank the ministry of research and technology and higher education for providing financial support. the research scheme is the basic research of tertiary institutions (pdupt). contract number 1740/un4.21/pl.01.10/2019. references abeyrathne, e. d. n. s., h. y. lee and d. u. ahn. 2014. egg white proteins and their potential use in food processing or as nutraceutical and pharmaceutical agents a review. poult. sci. 92(12): 3292-3299 adebowale, o.j. and k. maliki. 2011. effect of fermentation period on the chemical composition and functional properties of pigeon pea (cajanus cajan) seed flour. intl. food res. j. 18(4):1329-1333. mishra, b. k., j. m. varghese and s. das. 2019. probiotic characterization of indigenous lactic strains using foldscope and development of functional yogurt. intl. j. food tech. 8(1): 15-32 chaves, n., a. santiago and j. c. alías. 2020. quantification of the antioxidant activity of plant extracts: analysis of sensitivity and hierarchization based on the method used. antioxidants. 9(76):1-14 domínguez, r., p. gullón , m. pateiro, p. e. s. munekata, w. zhang and j. m. lorenzo. 2020. tomato as potential source of natural additives for meat industry. a review. antioxidants. 9(1):1-22 fastawa, r., n. nahariah and f. maruddin. 2016. optimization of antioxidant with different fermentation time in the salvage industry infertile egg hatching. jurnal ilmu dan teknologi peternakan. 5(1):58-65 gasic, u., s. keckes and d .dabic. 2014. phenolic profile and antioxidant activity of serbian polyfloral honeys. food chem. 145: 599-607. horwitz, w. and g.w. latimer. 2010. aoac international. official methods of analysis of aoac international. 18th ed. gaithersburg, md: aoac international kalyankar, s.d, m.a. deshmukh, s.s. chopde, c.d. khedkar, v.k.lule and s.s. deosarkar. 2016. milk powder. in: caballero, b, p.finglas and f .toldrá. (eds.) the encyclopedia of food and health. (3): 724 728. oxford: academic press. kuang, h., f. yang, y. zhang, t. wang and g. chen. 2018. the impact of egg nutrient composition and its consumption on cholesterol homeostasis. cholesterol.2018: 6303810. landfeld, a., p. nesvadba, k. kyhos, p. novotna, j. pruchova and m. houska. 2008. sorption and thermal properties of dried egg whites. j. food eng. 87:59 -63. ledesma, b.h., b. miralles, l. amigo, m. ramos and i. recio. 2005. identification of antioksidan and acei-inhibitory peptides in fermented milk. j. sci food agric. 85: 1041-1048. legowo, a.m. and s. hayakawa. 2012. functionalities of animal food protein. semarang, jawa tengah: badan penerbit universitas diponegoro semarang 220 j.indonesian trop.anim.agric. 45(3):214-221, september 2020 https://www.ncbi.nlm.nih.gov/pubmed/?term=chen%20g%5bauthor%5d&cauthor=true&cauthor_uid=30210871 https://www.ncbi.nlm.nih.gov/pubmed/?term=chen%20g%5bauthor%5d&cauthor=true&cauthor_uid=30210871 https://www.ncbi.nlm.nih.gov/pubmed/?term=chen%20g%5bauthor%5d&cauthor=true&cauthor_uid=30210871 https://www.ncbi.nlm.nih.gov/pubmed/?term=chen%20g%5bauthor%5d&cauthor=true&cauthor_uid=30210871 https://www.ncbi.nlm.nih.gov/pubmed/?term=wang%20t%5bauthor%5d&cauthor=true&cauthor_uid=30210871 https://www.ncbi.nlm.nih.gov/pubmed/?term=wang%20t%5bauthor%5d&cauthor=true&cauthor_uid=30210871 https://www.ncbi.nlm.nih.gov/pubmed/?term=wang%20t%5bauthor%5d&cauthor=true&cauthor_uid=30210871 https://www.ncbi.nlm.nih.gov/pubmed/?term=zhang%20y%5bauthor%5d&cauthor=true&cauthor_uid=30210871 https://www.ncbi.nlm.nih.gov/pubmed/?term=zhang%20y%5bauthor%5d&cauthor=true&cauthor_uid=30210871 https://www.ncbi.nlm.nih.gov/pubmed/?term=zhang%20y%5bauthor%5d&cauthor=true&cauthor_uid=30210871 https://www.ncbi.nlm.nih.gov/pubmed/?term=yang%20f%5bauthor%5d&cauthor=true&cauthor_uid=30210871 https://www.ncbi.nlm.nih.gov/pubmed/?term=yang%20f%5bauthor%5d&cauthor=true&cauthor_uid=30210871 https://www.ncbi.nlm.nih.gov/pubmed/?term=yang%20f%5bauthor%5d&cauthor=true&cauthor_uid=30210871 https://www.ncbi.nlm.nih.gov/pubmed/?term=kuang%20h%5bauthor%5d&cauthor=true&cauthor_uid=30210871 https://www.ncbi.nlm.nih.gov/pubmed/?term=kuang%20h%5bauthor%5d&cauthor=true&cauthor_uid=30210871 majumder, k. and j. wu. 2010. a new approach for identification of novel antihypertensive peptide from egg protein by qsar and bioinformatics. food res. int. 43(5):13711378. maulana a, n. nahariah and n.y. farida. 2016. physicochemical quality of fermented egg whites through the addition of different milk levels. in: proceedings of the optimization of local resources of people's farms to support the development of business entities belonging to the people 2016; animal science hasanuddin university, makassar, indonesia: national seminar on animal science hasanuddin university. miranda, j.m., x. anton, c. redondo-valbuena, p. roca-saavedra, j.a. rodriguez, a. lamas, c.m franco and a.cepeda. 2015. egg and egg-derived foods: effects on human health and use as functional foods. nutrients. 7(1):706-29. nahariah, n., h. hikmah, and n.y.farida. 2018. antioxidant activities and egg white fermentation characteristics on different levels of fullcream liquids milk. in: proceedings of the downstreaming of livestock technology in the era of industrial revolution 4.0 2018; animal science and agriculture, diponegoro university semarang, jawa tengah, indonesia: national seminar on animal resurrection iii. nahariah, n., a.m . legowo, e. abustam and a. hintono. 2015. angiotensin i-converting enzyme inhibitor activity on egg albumen fermentation. asian-australas. j. anim. sci. 28(6):855-861. nahariah, n., a.m .legowo, e. abustam, a. hintono, v.p. bintoro and y.b. pramono. 2014. endogenous antioxidant activity in the egg whites of various types of local poultry eggs in south sulawesi, indonesia. int. j. poultry sci.. 13(1):21-25. nys, y., m. brain and f.v. immerseel. 2011. trends in food science and technology: egg chemistry, production and consumption. ed 1th. philadephia, usa: woodhead publishing. pengseng, n., s. siripongvutikorn, w. usawakesmanee and s. wattanachant. 2010 effect of thermal processing and protein nutrients on antioxidant activity of tom-kha. asian j. food agro-ind. 3(4):389-399. steel, r.g.d and j.h. torrie. 1991. principle and procedure of statistics. 2nd ed. international book company. tokyo. torino, m.i, r.i. limon, and c.m. villaluenga. 2013. antioksidan and antihypertensive properties of languid and solid state fermented lentils. food chem. 136 (2): 1030-1037. wawrzykow, j. and m. kankofer. 2011. changes in activity during storage and characteristics of superoxide dismutase from hen eggs (gallus gallus domesticus). eur. food res. technol. 233:479-484. wikandari, p.r. suparmo, y. marsono and e.s. rahayu. 2011. potensi bekasem sebagai sumber angiotensin i-converting enzyme inhibitory. biota. 16(1):145-152. xu, y., w. xia and f. yang. 2010. effect of fermentation temperature on the microbial and physicochemical properties of silver carp sausages inoculated with pediococcus pentosaceus. food chem. 118(3):512-518. antioxidant activity on egg albumen fermentation (n. nahariah et al.) 221 https://www.ncbi.nlm.nih.gov/pubmed/?term=cepeda%20a%5bauthor%5d&cauthor=true&cauthor_uid=25608941 https://www.ncbi.nlm.nih.gov/pubmed/?term=redondo-valbuena%20c%5bauthor%5d&cauthor=true&cauthor_uid=25608941 https://www.ncbi.nlm.nih.gov/pubmed/?term=anton%20x%5bauthor%5d&cauthor=true&cauthor_uid=25608941 https://www.ncbi.nlm.nih.gov/pubmed/?term=miranda%20jm%5bauthor%5d&cauthor=true&cauthor_uid=25608941 https://www.ncbi.nlm.nih.gov/pubmed/?term=miranda%20jm%5bauthor%5d&cauthor=true&cauthor_uid=25608941 https://www.ncbi.nlm.nih.gov/pubmed/?term=miranda%20jm%5bauthor%5d&cauthor=true&cauthor_uid=25608941 feeding selenium-rich fermented palm kernel cake to laying hens (b. sundu et al,) 37 j i t a a journal of the indonesian tropical animal agriculture accredited by ditjen riset, teknologi dan pengabdian kepada masyarakat no. 164/e/kpt/2021 j. indonesian trop. anim. agric. pissn 2087-8273 eissn 2460-6278 http://ejournal.undip.ac.id/index.php/jitaa 48(1):37-46, march 2023 doi: 10.14710/jitaa.48.1. 3746 feeding selenium-rich fermented palm kernel cake to laying hens produces selenium-rich eggs, increases egg production and quality b. sundu*, hafsah, m. pamulu, a. adjis, u. hatta, e. kala’langi, g. sapu, s. arifuddin, damry, and i.g. putra faculty of animal husbandry and fisheries, tadulako university, palu, central sulawesi. *corresponding e-mail: b_sundu@yahoo.com received august 24, 2022; accepted february 06, 2023 abstract a study was conducted to determine the effect of selenium (sodium selenite) added to palm kernel cake (pkc) before fermentation on production, selenium content, and quality of eggs. the pkc was added with 0.1% sodium selenite and 1% baking yeast (fermipan®). the mixture was added with sterile distilled water to increase the water content of the substrate. the substrates were fermented at room temperature for 5 days. the fermented products of selenium-rich fermented palm kernel cake (srfpkc) were dried and fed to the laying hens. the experimental diets used were t-0: without srfpkc, t-1: 0.25% srfpkc, t-2: 0.50% srfpkc, t-3: 0.75% srfpkc and t-4: 1.0 % srfpkc. the diets were given to 180 laying hens aged 22 weeks for 14 weeks. data on egg production, feed intake and feed conversion ratio were recorded. feed digestibilities of dry matter and protein were measured based on the method of total fecal collection. egg qualities and egg weight loss were done using eggs stored for 1 and 30 days. selenium and cholesterol contents of eggs were also measured. this study used a completely randomized design and was analyzed by analysis of variance. the results showed that the addition of srfpkc increased egg production, hen day, egg weight, egg selenium, feed digestibility, improve fcr (p<0.05) and inhibit the process of decreasing the quality and weight of eggs stored for 30 days (p<0.05). in conclusion, the addition of srfpkc increased egg production, feed digestibility, and egg selenium, improve fcr and slow down the deterioration of egg quality stored for 30 days. keywords: egg production, fermentation, palm kernel cake, selenium, yeast introduction covid 19 has attacked more than 200 countries with more than 44 million deaths (who, 2020). the world health organization (who) stated that the sars cov-2 virus will remain for a long time, therefore a healthy lifestyle, both in terms of avoiding contact with viruses and consuming functional foods, should be sought to prevent the disease. one of the functional nutrients that can play a role in the formation of the body's immune system is the mineral selenium (se). this trace mineral has various health functions, including preventing infection and disease caused by viruses (beck et al., 2003), as an antioxidant in the form of glutathione peroxidase mailto:b_sundu@yahoo.com 38 j. indonesian trop. anim. agric. 48(1):37-46, march 2023 (gsh-px) (cai et al., 2019), can prevent cancer (chen et al., 2013), prevent heart disease (flores -mateo et al., 2006), increase immunity (huang et al., 2012), and increase sperm fertility (ahsan et al., 2014). this mineral can also inhibit viral mutations causing viruses to become more virulent (beck et al., 2003). the emergence of several relatively virulent variants of the covid 19 virus indicates that the sars cov-2 virus continues to mutate and the prevention process can be carried out by giving se. zhang et al. (2020) reported that there was a correlation between the healing of covid-19 disease and the se content of hair in the cases in china. the efficacy of se in promoting growth, production, and modulating the immune system of poultry has been well accepted. an increased egg production (liu et al., 2020), maintained egg quality during storage (hatta et al., 2020) and increased sperm fertility (ahsan et al., 2014) are some positive effects of se for laying hens, along with its beneficial property in improving the health status of poultry (surai, 2006). therefore, feeding the selenium-rich feed to the laying hens can not only increase the production, egg quality, and health of chickens but at the same time can also produce selenium-rich eggs that are beneficial to humans, especially in the current covid19 pandemic era. studies on the production of selenium-rich coconut meal for broiler chicken through the bioconversion process of inorganic se into organic have been done by a number of workers (sundu et al., 2019; mozin et al., 2019). however, data on the use of baking yeast saccharomyces cerevisiae to bio-convert toxic sodium selenite into organic se by using palm kernel cake as the solid media and its effect on egg production and the quality of 30 days of storage have not been available. a study was carried out to determine the effect of feeding selenium-rich fermented palm kernel cake on feed intake, fcr, feed digestibility, egg production, egg quality, selenium-rich egg, and egg cholesterol. materials and methods preparation of substrate and fermentation process palm kernel cake (pkc) was used as a substrate and baking yeast saccharomyces cerevisiae (fermipan®) as a starter or equivalent to table 1. basal diet feed ingredients concentration (%) soybean meal 16.2 corn 52.0 fish meal 8.0 rice bran 11.0 palm kernel cake 10.0 calcium carbonate 3.0 dicalcium phosphate 1.0 table salt 0.3 premixes 0.3 methionine 0.1 lysine 0.1 calculated nutrients crude protein (%) 17.9 metabolizable energy (kcal/kg) 2741 calcium (%) 2.00 phosphorus (%) 0.62 selenium (%) 0.21 methionine (%) 0.47 lysine (%) 1.07 feeding selenium-rich fermented palm kernel cake to laying hens (b. sundu et al,) 39 346 cfu/g. palm kernel cake was finely ground. the fermentation method on solid media (sundu et al., 2019) was used in this study. the fine ground substrate was autoclaved for 20 minutes at a pressure of 20 psi and then cooled to room temperature. the substrate was mixed with 0.1% sodium selenite and then incubated with 1% baking yeast (fermipan®) and added with sterile distilled water to produce 80% moisture content. the mixture was placed into a plastic that has been perforated with a needle. substrates were stored for 5 days at room temperature. on day 5, the substrate was harvested and dried in an oven at 60 o c for 24 hours. the fermentation products were analyzed for proximate fractions (aoac, 1990), selenium content (almeida et al., 2015), and cholesterol using the liebermann burchard method (kleiner and dotti, 1962). animals and cages the protocol of the study has been approved by the animal ethics committee of the faculty of animal husbandry and fisheries, tadulako university with the approval number: 35/ aec/5/2021. the study used a total of three hundred 20-weeks-old laying hens. the laying hens were kept in the individual battery pens for 14 weeks. prior to the data collection, vaccination against new castle disease was done a week after the arrival of the hens and was repeated after three months. two weeks of adaptation period was carried out to accustom the hens to the pen and to select the hens based on two weeks of egg production was done. a total of 180 selected hens were used for research. the selection was based on the initial egg production. the feeder was located outside of the front pen. nippleshaped drinker was placed above the pen. the pen and the surroundings of the experimental house were cleaned and disinfected whenever necessary. experimental diets an experimental basal diet (table 1) was formulated using the ufff software (pesti et al., 1986). all the feed ingredients were locally purchased at a poultry shop. diets mixture was done every two weeks to maintain the freshness of the diet. the treatment diets were arranged according to the increasing levels of se in the diets by supplementing se-rich fermented palm kernel cake (srfpkc). all the treatments are presented in table 2. parameters and data analysis the productive performance parameters measured were: egg production (egg weight, total production, and hen day production), feed intake, feed conversion ratio (fcr), digestibilities of dry matter, and protein, excreta dry matter, egg yolk index, haugh unit (hu), percentages of yolk, albumen and shell, the thickness of the shell, yolk color, and egg weight loss after storage of 1 and 30 days. selenium content was analyzed by using the procedure of almeida et al. (2015) and liebermann and burchard method was used to measure the cholesterol content of the meat (kleiner and dotti, 1962). the hu, the egg yolk index and egg weight loss are measured based on the following formula: table 2. experimental diets treatments selenium (ppm) replication hens basal 0.21 6 6 basal + 0.25% srfpkc 0.87 6 6 basal + 0.50% srfpkc 1.53 6 6 basal + 0.75% srfpkc 2.20 6 6 basal + 1.00% srfpkc 2.86 6 6 srfpkc: selenium-rich fermented pkc containing 265 ppm of selenium and untreated pkc contains 0.186 ppm selenium egg weight loss (%) = egg weight on collection day – egg weight on measurement day x 100 egg weight on collection day 40 j. indonesian trop. anim. agric. 48(1):37-46, march 2023 hu= 100*log (h+7.57) – (1.7 * w 0.37) where h: albumen height and w: egg wight egg yolk index = yolk height / yolk diameter this study used a completely randomized design with 5 treatments and 6 replications (steel and torrie, 1980). data were analyzed by the variance analysis. any differences detected by the analysis of variance were further tested by the tukey test. results and discussion the effect of treatment on egg production, feed consumption, fcr, dry matter (dm) of excreta, dm digestibility, protein digestibility, egg selenium, and egg cholesterol can be seen in table 3. effect of treatment on egg shape index, egg weight loss, percentage of yolk, albumen and eggshell, albumen and yolk profiles, and shell thickness of eggs stored for 1 day and 30 days at room temperature are shown in tables 4 and 5. the treatment had a significant effect (p<0.05) on egg production, hen day production, egg weight, fcr, dry matter digestibility, and egg selenium, but the treatment did not have a significant effect (p>0.05) on feed consumption, excreta dry matter and egg cholesterol content (table 3). the effect of treatment on eggs stored for 1 day on all egg quality parameters had no significant effect (p>0.05). storage of eggs for 30 days reduces egg quality, but eggs produced from hens fed a diet containing se-rich fermented pkc (srfpkc) can slow down the process of decreasing egg quality (albumen height, haugh unit, yolk height, and yolk index), and decreased egg weight loss during storage (p<0.05). egg index, percentage of yolk, albumen and eggshell, shell thickness, and yolk color were not affected (p>0.05) by the addition of srfpkc. sodium selenite contains 45.7% selenium, adding 0.1% of this compound to the palm kernel cake (pkc) before fermentation, mathematically, can increase the se concentration of the pkc to 457 ppm. the fermentation process of pkc for 5 days with s. cerevisiae can only produce 265 ppm selenium. this means that 58% of the se added to the pkc before fermentation remained in the pkc or may have turned into yeast se, while 42% of the se was lost during the fermentation process. this loss may indicate that yeast metabolizes inorganic se through the selenite methylation process which can produce hydrogen selenite as a waste product and gaseous product which is released freely into the air. the very strong and toxic odor smelled in this study can be an indicator of the production of hydrogen selenite during the fermentation process and this also indicates that there is a bioconversion process of inorganic se into se protein, either seleno-cysteine or selenomethionine. according to demirci et al. (1999), about 0.3% of se can be converted to selenomethionine by the yeast s. cerevisiae. the higher content of se contained in the fermentation process with the addition of sodium selenite than the findings of demirci et al. (1999) may indicate that some of the se present in fermented pkc were still in inorganic form. studies on the effect of the addition of se in poultry feed on egg production have been reported by many researchers (payne et al., 2005; leeson et al., 2008; suchy et al., 2014; han et al., 2017). the previous findings showed inconsistent results on the effect of se in the diet on egg production. this inconsistency was due to a couple of factors affecting egg production, such as the concentration of se in the diet and the source of se (arpasova et al., 2009). a study from payne et al., (2005) showed that the addition of se in the diet, either in the form of sodium selenite or se yeast did not increase egg production. leeson et al. (2008) found that increasing se concentration from 0.1 ppm to 0.3 ppm in the feed increased egg production from 64.9 to 72.3%. in this present study, the addition of fermented pkc with the addition of se (t1 to t4) increased egg production from 412 eggs (t-0) to between 430 and 438 eggs (t-1 to t-4). henday production, egg weight, and total egg production during the study also increased with the addition of se in the form of srfpkc. feeding selenium-rich fermented palm kernel cake to laying hens (b. sundu et al,) 41 the increase in total egg production follows a logarithmic pattern with y = 570.78ln(x) + 21404 and r² = 0.9446. total egg production increased dramatically when the diet was supplemented with 0.87 ppm se (t-1) and further addition of 2.86 ppm se (t-4) produced only a very small increase in total egg production. the same logarithmic pattern was also shown in other egg production parameters such as hen day and egg weight. the non-significant differences in all egg production parameters between the addition of se with a concentration of 0.87 ppm in t-1 and 2.86 ppm in t-4 (table 2) may indicate that a concentration of 0.87 ppm is sufficient to optimize egg production, adding more than this level could not increase egg production. although the addition of se at concentrations exceeding 0.87 ppm did not increase egg production, the se content of eggs increased with increasing se concentrations in the feed. laying hens fed srfpkc with a concentration of 2.86 ppm (t-4) produced eggs with the highest se concentration. these findings indicate that the bioconversion of inorganic to organic se occurs in this study with an indicator of se stored in eggs. liu et al (2020) found that the addition of se in the feed can increase the se content of eggs. the effect of additional treatment of se concentration in the feed did not affect egg cholesterol in this present study. even though cholesterol deposition in the egg can be affected by nutrition, particularly fatty acid content (shahid et al., 2015), the unchanged lipid content in the present experimental diet might be the reason why the cholesterol content of the eggs was unaffected due to the addition of selenium to the diet. table 3. effect of diets on egg production, feed intake, fcr, dry matter excreta, feed digestibility, egg selenium, and egg cholesterol parameters treatment diets t-0 t-1 t-2 t-3 t-4 pvalue sem egg production (egg) 412 b 430 a 431 a 432 a 438 a >0.001 1,84 henday production (%) 81,8 b 85,3 a 85.6 a 85.7 a 86.9 a >0.001 0,366 total production (g) 20423 b 21558 a 21640 a 21715 a 22008 a >0.001 117 egg weight (g/egg) 49,6 b 50.1 a 50.2 a 50.3 a 50.3 a 0.027 0,085 feed intake (g) 50933 51779 52080 51624 52401 0.055 167 fcr 2.49 a 2.40 ab 2.41 ab 2.38 b 2.38 b 0.008 0,012 dm excreta (%) 20.9 22.1 22.6 22.6 22.7 0.956 0,772 dm digestibility (%) 79.8 b 81.9 a 81.7 a 81.7 a 81.6 a >0.001 0,183 prot. digestibility (%) 81.7 b 83.7 a 83.9 a 83.7 a 83.8 a >0.001 0,191 egg selenium (mcg/100g) 53.4 c 80.7 b 80.6 b 81.8 b 90.7 a >0.001 2,42 egg cholesterol (mg/100g) 773 712 842 698 630 0.076 25,2 fcr: feed conversion ratio; dm: dry matter; prot: protein; sem: standard error of means table 4. egg quality of hens stored for 1 day at room temperature parameters experimental diets t-0 t-1 t-2 t-3 t-4 pvalue sem index of egg shape 0.0135 0.0128 0.0126 0.0125 0.0123 0.077 0.0037 loss of egg weight (%) 1.353 1.284 1.255 1.252 1.229 0.989 0.0733 egg yolk (%) 25.05 24.84 24.50 22.90 24.38 0.347 0.3360 egg albumen (%) 63.30 62.55 63.74 66.01 64.01 0.681 1.0300 eggshell (%) 11.65 12.61 11.76 11.09 11.61 0.064 0.1680 height of albumen (mm) 6.64 6.59 6.68 6.79 6.88 0.796 0.0790 height of yolk (mm) 13.43 13.23 13.50 13.21 13.65 0.742 0.1150 eggshell thickness (mm) 0.38 0.37 0.39 0.34 0.36 0.189 0.0064 yolk colour 8.0 8.8 8.2 8.0 9.3 0.323 0.2430 index of yolk 0.310 0.311 0.316 0.313 0.317 0.954 0.0032 haugh unit 83.60 83.71 83.68 83.79 83.75 1.000 0.4360 42 j. indonesian trop. anim. agric. 48(1):37-46, march 2023 this finding is supported by a study by mohitiasli et al (2010). the increase in total egg production by 5.6 – 7.8% due to the addition of se before the fermentation process in this study, was not caused by the increase in feed intake. the fcr was also affected by the addition of selenium-rich pkc. this study was not in line with previous research from han et al. (2017) who found that the addition of se in the diet did not affect the fcr. an increase in egg production without being accompanied by an increase in feed intake indicates that there might be an increase in income over feed cost which is the main target in the livestock business. the addition of srfpkc increased dry matter digestibility of the diets from 80% to 82% and protein digestibility from 82% to 84%. although there was improved feed digestibility, the increased feed intake to produce more eggs led to the unimproved fcr. this might indicate that more digested nutrients in hens fed the supplemental selenium diets were not fully compensated in egg production. the increase in digestibility may be due to two mechanisms. first, fermentation on a substrate rich in fiber and mannose-based polysaccharides can produce several enzymes, such as cellulase (hatta et al., 2014) and mannanase (bahri et al., 2019). these two enzymes are responsible for the breakdown of cellulose and mannan which are the main components of fibrous substances in pkc (sundu et al., 2012). a study by bahri et al. (2019) on the fermentation process of coconut meal having similar profiles in non-starch polysaccharides also indicated that fermentation of coconut meal produced a product in the form of mannose and the highest product of mannose was produced when the coconut meal was fermented for 5 days. the conversion of mannose-based polysaccharides into simple and easily digestible products in the form of mannose and the presence of enzyme products enabled the diets containing fermented pkc to have a higher digestibility than the control diet in this study. therefore, this condition could increase the digestible dry matter intake and the digestible protein intake. second, the addition of se from srfpkc can improve the health status of the digestive tract. readsnyder et al. (2009) found longer small intestinal villi in the se-fed chickens than the intestinal villi of chickens without the addition of se. improving the health of the digestive tract allows the hens to be able to absorb nutrients in the intestinal villi. although there was an increase in digestibility, the water content of the excreta was not affected by the addition of se in this study. although there was an increase in egg production due to the addition of srfpkc, the percentage of each part of the egg (yolk, albumen, and eggshell) was not affected. this finding was in agreement with the previous findings of gjorgovska et al. (2012). our results also indicated that egg quality measured one day after egg collection was statistically the same. this means that the influence of external factors such as temtable 5. egg quality of hens stored for 30 days at room temperature parameters experimental diets t-0 t-1 t-2 t-3 t-4 pvalue sem index of egg shape 0.787 0.772 0.815 0.778 0.768 0.672 0.0106 loss of egg weight (%) 5.13 b 4.22 a 4.37 a 4.34 a 4.24 a 0.039 0.111 egg yolk (%) 26.6 28.8 25.5 25.0 24.3 0.358 0.732 egg albumen (%) 61.6 58.3 62.3 63.3 63.2 0.208 0.757 eggshell (%) 11.9 12.9 12.2 11.7 12.5 0.359 0.207 height of albumen (mm) 3.09 c 3.55 bc 3.60 bc 3.79 ab 4.18 a >0.001 0.862 height of yolk (mm) 7.48 b 8.39 a 8.67 a 8.89 a 9.12 a >0.001 0.132 eggshell thickness (mm) 0.458 0.368 0.420 0.412 0.403 0.245 0.0124 yolk colour 7.8 7.2 7.5 7.3 7.5 0.559 0.124 index of yolk 0.164 b 0.197 a 0.196 a 0.197 a 0.211 a >0.001 0.0038 haugh unit 51.91 b 60.45 a 60.47 a 60.75 a 62.42 a 0.001 0.942 feeding selenium-rich fermented palm kernel cake to laying hens (b. sundu et al,) 43 perature and storage time in this study was minimal or not even detected on 1 day of storage. it is believed that albumen height and haugh unit are affected by selenium (pappas et al., 2005) storage time, and storage temperature (gravena et al., 2011). storage of eggs for 30 days affected the albumen height and haugh unit of eggs fed srfpkc diet. the haugh unit value of eggs without srfpkc stored for 30 days at room temperature was 51.91 and the addition of srfpkc could maintain the haugh unit value in the range between 60 and 62. albumen height, yolk height, and yolk index also showed the same trend where the addition of srfpkc could maintain the quality of albumen and yolks at 30 days of storage. this study showed that the high selenium content of eggs fed with srfpkc plays a role in protecting the internal quality of eggs (leeson et al., 2008). the increased se concentration in the diets increased linearly the albumen thickness of eggs stored at ambient temperature for 30 days with a linear equation of y = 0.3649x + 3.0822 and r 2 = 0.9346. selenium has been believed to play a role in the production and activity of glutathione peroxidase (gsh-px). the yolk index of poultry was better fed on diets supplemented with se (t-1, t-2, t-3, and t-4) than those of control eggs (t-0). this is probably due to the production and activity of gsh-px as an antioxidant enzyme and this enzyme functions to maintain cell integrity and protect the eggs from yolk lipid oxidation. measurement of thiobarbituric acid reactive substances (tbars) to determine fatty acid peroxidation in egg yolk lipids was carried out by gajcevic et al. (2009) who found that the concentration of tbars in egg yolk lipids as an indicator of lipid peroxidation was lower in chicken eggs fed with se. research on the effect of storage time on egg weight reduction has been carried out by hatta et al. (2020). they found that fermentation slowed down the egg weight loss during 28 days of storage. the results of this study also showed that the effect of fermentation with the addition of sodium selenite could suppress the decrease in egg weight during 30 days of storage. the decrease in egg weight may indicate that water evaporation occurs and maximum water evaporation occurs in eggs produced by chickens fed diets without srfpkc supplementation. since egg weight loss is related to the number and size of the pores of the eggshell, the addition of srfpkc might reduce the number and size of the pores of the eggshell and thus reduce the evaporation of water in the albumen and egg yolk. studies on the effect of se supplementation in laying hens’ diet on yolk color and egg shape index have been carried out by a number of authors (renema and sefton 2004; arpasova et al., 2009; han et al., 2017; liu et al., 2020). they found non-significant differences in yolk color (han et al., 2017; arpasova et al., 2009) due to dietary supplementation with se. it has long been believed that yolk coloration is much related to the carotenoid content of the diet (rezaei et al., 2019). the similar yolk color found, in all eggs might indicate that there was not much change in the carotenoid content of the experimental diets due to the supplementation of srfpkc. since the egg shape index is influenced not by the diets but by genotype (shaker et al., 2017), age of hens, and ambient temperature (nikolova and kocevski, 2006), it is expected that the effect of supplementation of srfpkc in the diet on egg shape index is statistically undetected in this present study. this finding is in accordance with the study of liu et al. (2020). conclusion palm kernel cake fermentation with the addition of sodium selenite as a source of selenium can increase the selenium content of palm kernel cake, increase egg production, feed digestibility, egg selenium content, improve feed conversion, egg quality of both the yolk and albumen and slow down the egg weight loss stored for 30 days at room temperature. acknowledgment we would like to thank the ministry of education, culture, research, technology, and higher education for the research funding assis 44 j. indonesian trop. anim. agric. 48(1):37-46, march 2023 tance so that this research can be carried out. we also thank the rector of tadulako university and the dean of the faculty of animal husbandry and fisheries for the research facilities. we also thank the field laboratory staff and students for all their help. references ahsan, u., z. kamran, i. raza, s. ahmad, w. babar, m. h. riaz and z. iqbal. 2014. role of selenium in male reproduction: a review. anim. reprod. sci. 146: 55-62 almeida, i. m. c., m . t . oliva-teles, j. s a ntos, c . delerue-matos and m . b . p . oliveira. 2015. total selenium content of commercial food supplements: label accuracy evaluation. austin j. nutr. food sci. 3: 4. aoac. 1990. association of official analytical chemist official methods of analyses. third edition. aoac. washington dc. arpasova, h., v. petrovic, m. mellen, m. kacaniova, k. cobanova and l. leng. 2009. the effects of supplementing sodium selenite and selenized yeast to the diet for laying hens on the quality and mineral content of eggs. j. anim. feed sci. 18: 90100 bahri, s., b. sundu and m. r. aprianto. 2019. mannanase activity produced through fermentation of coconut flour at various ph by aspergillus niger. j. physics, conf. series. 1242. 012009. doi: 10.1088/17426596/1242/1/012009. iop. publishing. beck, m. a., d. williams-toone and o. a. levander. 2003. coxsackievirus b3resistant mice become susceptible in se/ vitamin e deficiency. free radic. biol. med. 34: 1263–1270. cai, z., j. zhang and h. li. 2019. selenium, aging and aging-related diseases. aging clin exp res. 31:1035‐1047. chen, y. c., k . s . prabu and a . m . mastro. 2013. is selenium a potential treatment for cancer metastasis? nutrients, 5: 1149-1168. demirci, a., a. l. pometto and d. j. cox. 1999. enhanced organically bound selenium yeast production by feed-batch fermentation. j. agric. food chem. 47: 2496-2500. flores-mateo, g., a. navas-acien, r. pastorbarriuso and e. guallar. 2006. selenium and coronary heart disease: a metaanalysis. am j clin nutr. 84:762-73. gajcevic, z., g. kralik, e. has-schon and v. pavic. 2009. effects of organic selenium supplemented to layer diet on table egg freshness and selenium content, italian j. anim. sci. 8: 189-199. gjorgovska, n., f. kiril, l. vesna and k. tosho. 2012. the effect of different levels of selenium in feed on egg production, egg quality and selenium content in yolk. lucr. stiint. 57:270-274. gravena, r. a., r. h. marques, j. roccon, j. picarelli, f. h. hada, j. d. t. da silva, s. a. de quiroz and v. m. b. de moraes. 2011. egg quality during storage and deposition of minerals in eggs from quails fed diets supplemented with organic selenium, zinc and manganese. rev. bras. zootec. 40: 2767-2775. han, x. j., p. qin, w. x. li, q. g. ma, c. ji, j. y. zhang and l. h. zhao. 2017. effect of sodium selenite and selenium yeast on performance, egg quality, antioxidant capacity, and selenium deposition of laying hens. poult. sci. 96: 3973-3980. hatta, u., o. sjofjan, i. subagiyo and b. sundu. 2014. effects of fermentation on nutritive value of copra meal, cellulase activity and performance of broiler chickens. livest. res. rural dev. 26: 4. hatta, u., s. mozin, a. adjis and b. sundu. 2020. fermentation of selenium-added coconut dregs improve chicken egg production and slow down the deterioration of egg quality during 28 days storage. livest. res. rural dev. 32: 12 huang, z., a. h. rose and p . r . hoffmann. 2012. the role of selenium in inflammation and immunity: from molecular feeding selenium-rich fermented palm kernel cake to laying hens (b. sundu et al,) 45 mechanisms to therapeutic opportunities. antioxid. redox signal. 16: 705-743. kleiner, i. s. and l. b. dotti. 1962. laboratory instruction in biochemistry. 6 th edition. the c. v. mosby company, new york leeson, s., h. namkung, l. caston, s. durosoy and p. schlegel. 2008. comparison of selenium levels and sources and dietary fat quality in diets for broiler breeders and layer hens. poult. sci. 87: 2605-2612. liu, h., q. yu, c. fang, s. chen, x. tang, k. m. ajuwon and r. fang. 2020. effect of selenium source and level on performance, egg quality, egg selenium content and serum biochemical parameters in laying hens. foods, 9: 68. mohiti-asli, m., f. shariatmadari, and h. lotfollahian, 2010. the influence of dietary vitamin e and selenium on egg production parameters, serum and yolk cholesterol and antibody response of laying hen exposed to high environmental temperature. arch. geflügelk. 74: 43-50 mozin, s., u. hatta, s. sarjuni, m. gobel and b. sundu. 2019. growth performance, feed digestibility and meat selenium of broilers fed fungi-fermented rice bran with addition of inorganic selenium. int. j. poult. sci 18: 438-444 nikolova, n. and d. kocevski. 2006. forming egg shape index as influenced by ambient temperatures and age of hens. biotechnol. anim. husb. 22. 119-125. payne, r. l., t. k. lavergne and l. l. southern. 2005. effect of inorganic versus organic selenium on hen production and egg selenium concentration. poult. sci. 84: 232-237. pesti, g. m., b. r. miller and r. chambers. 1986. user-friendly feed formulation program (ufff) version 1.11 – 256 k. department of poultry science and agricultural economics. the university of georgia atlanta. read-snyder, j., f. w. edens, a. h. cantor, a. j. pescatore and j. l. pierce. 2009. effect of dietary selenium on small intestine villus integrity in reovirus-challenged broilers. int. j. poult. sci. 8: 829-835. renema, r. a. and a. e. sefton. 2004. dietary selenium sources can affect egg production, shell quality and fertility traits of broiler breeders. xxii world’s poult. congress, 8-13 june, istanbul turkey. rezaei, m., s. zakizadeh, and n. eila. 2019. effects of pigments extracted from the marigold flower on egg quality and oxidative stability of the egg yolk lipids in laying hens. iran. j. appl. anim. sci. 9: 541– 547. shaker, a. s., s. m. s. kirkuki, s. r. aziz, and b. j. jalal. 2017. influence of genotype and hen age on the egg shape index. int. j. biochem. biophys. mol. biol. 2: 68-70. steel, r. g. d. and j . a . torrie. 1980. principles and procedures of statistics. new york, mcgraw hill. suchy, p., e. strakova and i. herzig. 2014. selenium in poultry nutrition: a review. czech j. anim. sci. 59: 495-503 shahid, s., c. naila, r. u. khan, s. m. suhail, n. a. khan. 2015., "alternations in cholesterol and fatty acids composition in egg yolk of rhode island red x fyoumi hens fed with hemp seeds (cannabis sativa l.)". j. chem. article id 362936. sundu, b., u. hatta and a. s. chaudhry. 2012. potential use of beta mannan from copra meal as a feed additive for broilers. world’s poult. sci. j. 68: 707716. sundu, b., u. hatta, s. mozin and a. adjis. 2019. the effect of fermented coconut dregs with the addition of inorganic selenium on feed digestibility, growth performance and carcass traits of broiler chickens. livestock res. rural dev. 31: 11. surai, p. 2006. selenium in nutrition and health. nottingham university press. nottingham. who, 2020. who coronavirus (covid-19) dashboard. https://covid19.who.int/. accessed on 25 th of october 2020. zhang, j., e. w. taylor, k. bennett, r. saad, and m. p. rayman. 2020. association https://scholar.google.com/citations?view_op=view_citation&hl=id&user=qs_znkaaaaaj&citation_for_view=qs_znkaaaaaj:toudhmtppwuc https://scholar.google.com/citations?view_op=view_citation&hl=id&user=qs_znkaaaaaj&citation_for_view=qs_znkaaaaaj:toudhmtppwuc https://scholar.google.com/citations?view_op=view_citation&hl=id&user=qs_znkaaaaaj&citation_for_view=qs_znkaaaaaj:toudhmtppwuc https://scholar.google.com/citations?view_op=view_citation&hl=id&user=qs_znkaaaaaj&citation_for_view=qs_znkaaaaaj:toudhmtppwuc https://covid19.who.int/ https://covid19.who.int/ javascript:; javascript:; javascript:; javascript:; javascript:; 46 j. indonesian trop. anim. agric. 48(1):37-46, march 2023 between regional selenium status and reported outcome of covid-19 cases in china. the american j. clin. nutr. nqaa095. j i t a a journal of the indonesian tropical animal agriculture accredited by ditjen penguatan risbang no. 60/e/kpt/2016 j. indonesian trop. anim. agric. pissn 2087-8273 eissn 2460-6278 http://ejournal.undip.ac.id/index.php/jitaa 45(1):28-36, march 2020 doi: 10.14710/jitaa.45.1.28-36 the ammoniation of total mixed fiber with mineral organic supplementation in ration to increase beef cattle production a. imsya1,*, y. windusari2 and r. riswandi1 1department of animal science, faculty of agriculture, sriwijaya university, jl. raya palembang prabumulih km 32, kecamatan inderalaya, kabupaten ogan ilir, south sumatera indonesia. 2department of biology, faculty of mathematics and natural sciences, sriwijaya university, jl. raya palembang prabumulih km 32, kecamatan inderalaya, kabupaten ogan ilir, south sumetera indonesia. *corresponding e-mail : aimsya@yahoo.com received april 12, 2019; accepted december 04, 2019 abstrak tujuan dari penelitian ini adalah untuk mengevaluasi tingkat mineral organik dalam ransum amoniasi total mixed fiber (atmf) sebagai pakan basal terhadap performa sapi potong. penelitian ini dilakukan secara in vivo dengan metode eksperimen menggunakan uji-t, membandingkan hasil suplementasi terbaik pada penelitian in vitro dan control. sapi yang digunakan adalah sapi bali dengan berat badan + 120kg sebanyak 12 ekor. perlakuan yang diuji adalah p1: 60% amoniasi tmf tanpa suplementasi mineral organik p2: 60% amoniasi tmf + 1,5 x organik makromineral (ca, p, dan s) nrc (2000). masing2 perlakuan ditambah dengan 40% konsentrat. setiap perlakuan mendapatkan 6 kali ulangan. parameter yang diukur dalam teknik in-vivo adalah kecernaan nutrisi yang terdiri dari bahan kering dan organik, protein kasar, serat kasar, ndf, dan adf. performa ternak: konsumsi ransum, konsumsi bahan kering, pertambahan bobot badan dan efisiensi ransum. hasil penelitian menunjukkan bahwa suplementasi mineral organic ca, p dan s dalam ransum dengan atmf sebagai pakan basal memberikan pengaruh yangb berbeda nyata (p<0,05) terhadap kecernaan nutrisi (bahan kering, bahan organik, serat kasar, ndf, dan adf) dan performa ternak. kesimpulan dari penelitian ini adalah suplementasi macrominerals organik (ca, p, dan s) 1,5 x nrc (2000) dalam ransum dengan 60% ammoniasi tmf sebagai pakan basal dapat meningkatkan performa sapi bali. kata kunci : total mixed fiber, suplementasi, mineral organik , sapi potong, performa, amoniasi abstract the objective of this study was to evaluate the level of organic minerals and total mixed fiber ammoniation (tmfa) as basal feed on the performance of beef cattle. this study used the in vivo technique and the experimental method using t-test. the t-test compares the best supplementation result on in vitro research and control treatment, each treatment got 6 replications. the treatments tested were p1: 60% tmf ammoniation + 15% swamp legume without supplementation of organic minerals p2: 60% tmf ammoniation + 1.5 x organic macrominerals (ca, p, and s) nrc (2000) + 15% swamp legumes. the parameters measured in the in-vivo technique were nutrient digestibility consisting of dry and organic matters, crude protein, crude fiber, ndf, and adf. the animal performance: ration and dry matter consumption, body weight gain and ration efficiency. the results showed that supplementation of minerals in rations with tmfa as basal feed had a significant effect (p<0.05) on nutrient digestibility 28 j.indonesian trop.anim.agric. 45(1):28-36, march 2020 (dry matter, organic matter, crude fiber, ndf, and adf) and animal performance. the conclusion of this study was supplementation of organic macrominerals 1.5 x (ca, p, and s) nrc (2000) in a ration with tmf ammoniation as basal feed can improve the beef cattle performance. keywords: total mixed fiber, supplementation, organic minerals, beef cattle, performance, ammoniation introduction the quality and productivity level of local cattle in indonesia is very low, this is due to one of them due to the lack of available forage, lack of processing technology applications such as amoniation or fermentation and feeding management. the lack of availability of forages can be a solution to the development of forages originating from agricultural and plantation waste (herlambang, t, 2014). mixing several sources of fiber from both forage and agricultural waste is known as total mixed fiber (tmf) (maneerat et al., 2013). the preparation of tmf comes from fiber sources with different fiber content and depends on the availability. based on previous research,the use of tmf from agricultural waste in the form of oil palm frond, rice straw and swamp grass (indonesian: kumpai tembaga) with composition of 20% oil palm fronds , 20% rice straw, and 20% swamp grass give the best results but the level of digestibility. this tmf produces the digestibility of dry matter and organic matter 36.32% and 35.96% respectively, ndf digestibility 17.86%, n-nh3 rumen concentration 10.84mm, and scfa concentrations, i.e., acetic acid, propionic acid, and butyric acid 12.39mm 4.39mm and 4.36mm respectively. also, methane gas produced is 6.91mm, it is lower than the other experiment (imsya et al., 2016). low fiber quality will affect livestock performance. the livestock that get low nutrition will produce lower performance than their genetic ability. body weight gain only reached 10%, rarely exceeding 30% of the actual potential of livestock, so that new cattle reaching 3-5 years of age can be slaugthtered and can produce calves in 4-5 years of age with 2-year intervals (leng, 1993). the method to increase the nutrition of livestock rations based on agricultural waste is feed processing technologies such as ammoniation as well as increasing the optimization of rumen bioprocesses by supplementing proteins and minerals. increasing the utilization of feed with a low nutrient content so that it can be optimally utilized can be done by applying technology to feed ingredients such as ammoniation or feementation, besides that it can also be carried out by supplying minerals and proteins in rations. suplementation minerals and protein used for increasing of rumen microbe activity (ponds et al, 2005). this method is conducted to maximize the level of productivity of livestock and improve the metabolism of ruminant animals. the use of organic minerals can increase the content of minerals to protect organic matter that is bound to minerals from degradation in the rumen. the use of organic minerals can increase the content of minerals to protect organic matter that is bound to minerals from degradation in the rumen. micro and macromineral metabolism interact with each other. this interaction can be both negative and positive in the digestive tract system of livestock, especially in the rumen. the other factors that can affect the role of minerals in the rumen such as phytic acid, crude fiber, and other items.these factors can reduce the minerals in the rumen (muhtarudin, 2003; muhtarudin et al., 2003). minerals in the form of chelates can be more easily absorbed in the digestive process. chelating agents can be carbohydrates, lipids, amino acids, phosphates, and vitamins. in the digestive process, chelates in the ration facilitate penetrating the intestinal cell wall. theoretically, it increases the absorption of minerals. amino acid lysine and polyunsaturated fatty acids (pufa) are the chelating agents used in this study for made organic macromineral. supplementation in rations is required for cattle that intensively maintenance (dwiyanto, 2003). based on previous research, tmf ammoniation in the ration with organic mineral supplementation of ca, p and s in the ration can improve the fermentative condition in rumen and population of cellulolytic bacteria, but not affect the total population of bacteria and protozoa and can decrease methane gas production in vitro. the organic mineral supplementation level of ca, p and s 1.5 times from nrc recommendation with 60% of tmf ammoniation gives the best result to the rumen fermentative condition and rumen microbe by in vitro (imsya, et al., 2018). however, the study of supplementation organic mineral (ca, s and p) with tmfa has not done with beef cattle by in vivo. therefore, this study was conducted to organic mineral supplementations with tmfa in beef cattle ration (a. imsya et al.) 29 investigate the effect of organic mineral supplementation level with tmfa as basal feed to digestibility and performance of beef cattle materials and methods animal and feed this study utilized an experimental method using the t-test whose each treatment was repeated for six times. the treatment consists of: p0: 60 % ammoniation of tmf without supplementation. p1: 60 % ammoniation of tmf + 1.5 x organic macrominerals (ca, p, and s) nrc (2000) (best results of digestibility and characteristics of rumen condition under in vitro). the study was conducted under in vivo using bali cattle with a body weight of ±150 kg 12 bali cattle. the treatment ration was added with a concentrate (meal corn, rice bran, tofu waste, salt, and urea) to obtain 100% of the ration (table 1). a ratio of forage and concentrate = 60: 40 (table 2 and table 3) the parameters measured in the in-vivo technique were performance (feed intake, body weight gain and feed efficiency), and nutrient digestibility consisting of dry matter, organic matter and ndf, adf and crude fiber. preparation of tmfa total mixed fiber ammoniation (tmfa)was composed of swamp grass, agricultural and plantation wastes. tmf formulation consisted of 20% kumpai tembaga grass + 20% palm oil frond + 20% rice straw (imsya et al., 2016). the ammoniation was carried out using 4% urea/kg of dry matter tmf. the tmf material was cut 3−5 cm by using a chopper, each forage was mixed according to tmf composition. urea diluted by water in a ratio of 1: 1 w/l. the urea solution was sprayed in tmf, put into the plastic and incubated for 21 days. making organic macrominerals (ca, p and s) according to muhtarudin and liman (2006). the process of making organic macromineral supplements consists of the steps: naoh 10m 400g diluted in distilled water until 1 litre, added palm 912g (initial solution). furthermore, for organic ca minerals, caco3 5m 680.33g dissolved in distilled water to 1 liter. this solution was mixed with the initial solution and composted until homogeneous. organic p minerals: initial solution added kh2po4 solution 601.84g and then was diluted in distilled water to 1 liter. organic s minerals are carried out by dissolving the initial solution into 601.84 g (nh4)2so4 5m solution dissolved in distilled water to 1 litre. in vivo period in vivo research was begun by the preliminary period, i.e. by weighing the initial weight of the livestock and calculating the number of feed requirements (feed intake) prepared from tmf and concentrates. water was given with ad libitum. during this period, the adaptation for livestock to the given ration is made, by fasting the cattle in the morning and giving the ration treatment for the day. the adaptation period is carried out for one month. 30 j.indonesian trop.anim.agric. 45(1):28-36, march 2020 table 1. nutrient content of feedstuff (%) feed materials ccrude protein crude fiber total digestible nutrient rice bran 11.2 18.85 65 milled corn 10.82 2.61 83 tofu waste 11.6 7.79 70 salt 0 0 0 urea 2.61 0 0 tmfa 6.65 27.91 66.99 laboratory of agricultural products technology of sriwijaya university (2016) tmfa: total mixed fiber ammoniation the treatment period is carried out for three months while the interval or the adaptation period with the next treatment period is three days collecting period collecting is carried out during the last three days per period, feces collected and was weighed every day. feces dried for 24 hours and calculated as dry weight. feces was composited and homogenized to analyzed at laboratory to calculate the level of feed digestibility determination of parameter feed digestibility was determined by the following calculations: dry matter digestitility (%) = [(dry matter intake dry matter feces)/dry matter intake] x 100 the same method is used to calculate organic matter, ndf, adf and crude fiber digestibility animal performance determination ration intake determination feed intake was measured by weighing the difference between the amount of feed given and the remaining feed. weighing was done every evening and morning before the next feed was given determination of body weight gain (bwg) bwg was measured using cattle scales weighed every 15 days. bwg was obtained by calculating the difference between the final body weight and the initial weight during the study. feed efficiency (fe) feed efficiency is calculated by comparing intake and weight gain multiplied by 100% data analysis all data were statistically analysed according to independent t-test of sas (sas, 2000). the organic mineral supplementations with tmfa in beef cattle ration (a. imsya et al.) 31 table 2. ingredient and concentrate component intake* feed materials usage cp cf tdn % rice bran 60.5 6.77 11.19 39.32 milled corn 12 1.29 0.31 9.96 tofu waste 26 3.01 2.02 18.2 salt 0.5 0 0 0 urea 2.61 0 0 total 100 13.68 13.52 67.48 *calculated based on table 1 with the use of feed ingredients in concentrates table 3. nutrient of ration* ration nutritional contents usage cp cf tdn % tmfa 60 3.99 16.75 40.19 concentrate 40 5.47 5.40 26.99 total 100 9.46 22.15 67.18 *calculated bases on table 1 and table 2. tmfa: total mixed fiber ammoniation formula of independent t test was: note: xa= mean of sample a xb= mean of sample b sp= total of standar deviation sa= standar deviation sample a sb= standar deviation sample b na= total of sample a nb= total of sample b results and discussions the level of digestibility of feed in the rumen was one indicator to see the quality and fermentation process in the rumen. the high of feed digestibility indicate a good quality of ration and digestive process. the level of feed digestibility in this study shown in table 4. based on the t-test analysis, it showed that organic mineral supplementation of 1.5 x from nrc recommendation (2000) in ration with tmfa as basal feed affected significantly (p<0.05) on the digestibility of feed nutrient (dry matter, organic matter, crude protein, crude fiber, ndf, and adf) (table 4). there was an increase in digestibility with the supplementation of ca, p and s organic minerals in a basal ration of tmfa. dry matter digestibility increases 25%, digestibility of organic matter 24.45%, crude protein digestibility 36.84%, digestibility of crude fiber 68.76%, ndf digestibility 34.61% and adf digestibility 35.00% the performance of bali cattle received organic mineral ca, p and s supplementation with tmfa as basal feed in the ration is shown in table 5. the performance consists of feed intake, dry matter intake, and crude protein intake, body weight gain and feed efficiency. based on the ttest, supplement did not affect significantly (p> 0.05) feed intake, dry matter intake and crude protein intake, but increased body weight gain and feed efficiency. there was an increase in body weight gain 66.66% and an increase in ration efficiency of 62.89 with supplementation of organic minerals (ca, s and p) and tmfa as basal feed . there was an increase in digestibility with the supplementation of ca, p and s organic minerals in a basal ration of tmfa. dry matter digestibility increases 25%, digestibility of organic matter 24.45%, crude protein digestibility 36.84%, digestibility of crude fiber 68.76%, ndf digestibility 34.61% and adf digestibility 35.00% (table 4) . this significant increase in digestibility reflects the influence of ca, p and s organic mineral supplementation in improving rumen conditions. according to muhtaruddin and liman (2006), supplementation of organic minerals provided a better digestibility rate than those without supplementation due to the activity of rumen microbes requiring several minerals such as ca and mg. it was also following hogan (1996) stated that for optimal growth and breeding, rumen microbes require macro and 32 j.indonesian trop.anim.agric. 45(1):28-36, march 2020 table 4. nutrition digestibility tmfa with and without supplementation digestibility (%) tmfa without supplementation tmf ammoniation + 1.5 x mineral macro organic (ca, p, and s) * dry matter 57.16a 76.22b organic matter 55.03a 68.49b crude protein 40.06a 54.82b crude fiber 32.05a 54.09b ndf 38.83a 52.27b adf 37.71a 50.91b * nrc (2000) ndf : neutrat detergent fiber; adf : acid detergent fiber micro mineral. the increase in crude protein, ndf, and adf digestibility also had an impact on increasing the digestibility of dry matter and organic matter. supplementation of organic minerals ca, p and s in the basal feed of tmfa influenced positively on the improvement of rumen conditions, especially for rumen microbial activity and growth. this activity will also affect the increase in feed digestibility. bravo et al. (2003) stated that the minerals ca, and mg in ration stimulating rumen microbial growth also contribute to the activity of metabolic enzymes related to energy so that the impact provides an increase in digestibility. mineral p is needed by all microbes especially to maintain membrane and cell wall integrity, nucleic acid components and parts of high-energy molecules atp, adp and others. increased digestibility of fiber (crude fiber, ndf, and adf) occurred with the use of organic mineral supplementation (ca, p and s) in rations. the results of this study were in accordance with the results of nurhaita et al. (2010) stating that there was an increase in fiber digestibility in rations sheep with a basal feed of palm leave ammoniated and supplemented with sulfur minerals 0.4% and phosphorus 0.27%. this was due to the role of sulfur minerals in helping the formation of amino acids and the synthesis of microbial proteins to optimize cellulose digestion through specific stimulation of cellulolytic bacteria. based on the results of in vitro studies there was an increase in microbial population with the presence of organic mineral supplementation of 1.16 log cell/mn of rumen liquid of cellulolytic bacteria, 0.13 log cell/mn of total rumen bacteria and 0.44 log cell/mn of rumen fluid and 0.44 log cell/protozoa/mumen of rumen fluid as presented in table 6 (imsya et al, 2018). mineral sulfur is needed by rumen microbes to synthesize methionine and cysteine used to form microbial proteins. by adding sulfur to the ration, microbial protein synthesis was increasing (adelina, 2006). there was no increase in feed intake, dry matter intake, and intake of crude protein, but there was an increase in daily body weight gain and feed efficiency (table 5). there was no difference in the intake level due to the same ration palatability, i.e., the color and smell between rations. the reason for this was because the supplementation of organic minerals does not affect palatability ration. palatability is an essential factor in determining the level of feed intake. the taste, smell and color of the forage feed determine ration palatability (prawirokusumo, 1994; mcdonald et al., 2002). physical and chemical properties of the ration also strongly influence and can change as a result of physiological and psychological differences of the individual livestock (grovum, 1988). dry matter intake which received organic mineral supplementation 1.5 times from nrc (2000) recommendation also revealed no significant effect with no supplementation in the ration. dry matter intake range of 9.58-9.81 kg/head/day or 6.54% of body weight. the dry matter intake obtained in this study is sufficient for the dry matter needs of a cattle with a body weight of 150-250kg. according to tillman et al. (1991), the ability to consume feed per cattle per day is 3% dry matter ration of its body weight. based on measurements of cattle body weight during the study, bwg was obtained at 0.45-0.75 kg/head/day. cattle body weight gained in this study with tmfa as basal feed was sufficient enough. the bwg of this research is relatively high compared to the bwg of bali cattle fed local rations with a range of bwg between 0.3-0.5 kg/head/day (hafid and rugayah, 2010). organic mineral supplementations with tmfa in beef cattle ration (a. imsya et al.) 33 table 5. average of feed intake (kg/head/day), weight gain (kg/head/day) and feed efficiency (%) of bali cattle with tmfa as basal feed and organic minerals of ca, p and s supplementation treatment ration intake dmi cpi bwg fe tmfa without supplementation 10.35 9.58 0.55 0.45a 4.69a tmfa with ca, p and s organic supplementation 10.60 9.81 0.62 0.75a 7.64a different superscripts in the same column indicate significantly different (p<0.05) dmi : dry matter intake, cpi : crude protein intake, bwg : body weigh gain, fe : feed efficiency meanwhile, for the average bwg female po cattle fed agricultural waste and bran is 0.65 kg/head/day (hasbullah, 2003). there was an increase in daily body weight gain of a cattle by 0.3 kg/head/day with the presence of organic mineral supplementation 1.5 times the nrc recommendation (2000) with a basal ration of tmfa compared to rations without supplementation. this shows that supplementation of ca, s and p organic minerals with a level 1.5 times that of nrc recommendations (2000) affects the improvement of digestibility in the rumen. as a result, the amount of dry matter intake is not significantly different between tmfa as basal ration supplemented by organic minerals ca, s, and p and without supplementation. it can increase digestibility and cattle body weight. in this study, an increase in dry matter digestibility is 33.34% and organic digestibility of 24.45%, crude protein digestibility of 36.84%, digestibility of crude fiber 68.76%, ndf digestibility 34.61% and adf digestibility 35.00% of rations without organic mineral supplementation with organic mineral supplementation 1.5 times from nrc recommendations (2000) (table 2). this increase in digestibility will have an impact on increasing the daily weight of livestock. livestock with good/high ration intake with normal digestion of feed substances will also produce high body weight (hafid and rugayah, 2010). according to parakkasi (1995), cattle that obtain less nutrient show less optimal productivity. to increase the body weight of a cattle, some needs must be met such as dry matter, crude protein, and additional energy sources. the efficiency of feed usage is a comparison between daily body weight and intake of dry matter. the use efficiency of feed in this study was obtained for ration with tmfa as a basal feed which did not get supplementation of organic minerals ca, s and p (4.69%). also, the ration with organic mineral supplementation was 1.5 times that of nrc recommendation (2000) (7.64%). there was an increase in ration efficiency with tmfa as basal feed with supplementation of ca, s and p minerals. the higher feed use value efficiency, the fewer rations feed consumed to produce body weight gain. according to siregar (2001), the efficiency of the use of feed for cattle ranges from 7.52% -11.29%. some factors that influence feed efficiency include age feed quality and body weight. the better the quality of feed, the better the efficiency of energy formation and production (pond et al., 2005). based on the results of the study, it could be concluded that supplementation of ca, s and p organic minerals with a dose of 1.5 times of nrc recommendations (2000) in rations with basal feeds of total mixed fiber (tmf) ammoniation could improve the performance of cattle. cattle with basal feed ammoniation tmf and supplementation of ca, s and p organic minerals with a dose of 1.5 times nrc recommendations (2000) resulted in feed intake of 10.60 kg/head/day, intake of dry matter 9.81 kg/head/day, weight gain 0.75 kg/head/day and feed efficiency 7.64% conclusion the level supplementation of ca, s and p organic minerals 1.5 times of nrc recommendations (2000) in rations with tmfa as basal feed could improve the performance of 34 j.indonesian trop.anim.agric. 45(1):28-36, march 2020 table 6. the rumen microbial population of beef cattle received the 60% ammonia tmf basal feed with ca, p and s organic mineral supplementation in ration treatment cellulolityc bacteria total bacteria (log cell/ mn rumen liquid) protozoa non supplementation 7.46a 9.09 5.78 0.75 x organic macro minerals*(ca, p and s) 7.16a 9.25 5.45 1 x organic macrominerals (ca, p and s)* 8.55b 9.40 5.63 1.5 x organic macrominerals (ca, p and s) * 8.62b 9.22 5.34 data obtained from imsya et al. (2018), *nrc (2000) cattle. cattle with basal feed ammoniation tmf and supplementation of ca, s and p organic minerals with level 1.5 times nrc recommendations (2000) resulted in feed intake of 10.60 kg/head/day, intake of dry matter 9.81 kg/head/day, weight gain 0.75 kg/head/day and feed efficiency 7.64% acknowledgments this research was supported by competitive competitive research grands from research and services institution universitas sriwijaya through pnbp funds (no. 0007/un9/sk.lp2m.pt/2018 dated june 6, 2018). references adelina, t. 2006. effect of mineral calsium, phospor, magnesium and sulfur supplementation on the microbial protein synthesis in the rumen of goat. jurnal peternakan. volume. 3 no 2:34-40 bravo d, d. sanvant, c. bogaert and f. meschy. 2003. quantitative aspect of phosporous absorption in ruminant. reproductive nutrition development. 43:271-284. davies, k.l.,j,j. mckinnon and t. mutsvangwa. 2013. effects of dietary ruminally degradable starch and ruminally degradable protein levels on urea recycling, microbial protein production, nitrogen balance, and duodenal nutrient flow in beef heifers fed low crude protein diets. canadian j. anim. sci. 93(1):123-136. diwyanto, k., d. sitompul, i. manti, i. w. mathius and soentoro. 2003. pengkajian pengembangan usaha sistem integrasi kelapa sawit – sapi. proseding lokakarya nasional. bengkulu 9 – 10 september 2003 grovum, w.l. 1988. appetite, palatability and control of feed intake. in: chuch. the ruminant animal digestive physiology and nutrition. a reston book. prentice hall. englewood cliffs. new jersey. pp 202-215. hafid, h. and n. rugayah. 2009. persentase karkas sapi bali pada berbagai berat badan dan lama pemuasaan sebelum pemotongan. jurnal teknologi peternakan dan veteriner. 1(1): 77-85 hasbullah el. 2003. kinerja pertumbuhan dan reproduksi sapi persilangan simmental dengan peranakan ongole dan sapi peranakan ongole di kabupaten bantul daerah istimewa yogyakarta. fakultas peternakan universitas gadjah mada. yogyakarta. thesis. hogan, j. 1996. ruminant nutrition and production in the tropics and subtropic. australian centre for international agricultural research. canberra imsya, a, muhakka and f yossi. 2015. evaluasi konsentrasi vfa parsial dan estimasi produksi gas metan bahan pakan dari limbah pertanian dan rumput rawa secara in vitro. prosiding seminar nasional lahan suboptimal. 8-9 oktober 2015. palembang imsya, a, muhakka and f. yossi. 2015. tingkat kecernaan nutrisi dan konsentrasi n-nh3 bahan pakan dari limbah pertanian dan rumput rawa secara in vitro. jurnal peternakan sriwijaya 4(2):1-6 imsya, a, muhakka and f, yosi. 2016. use of swamp grass and agricultural waste as materials for total mixed fiber (tmf) in rations and its effect on methane gas production and production efficiency of beef cattle. pakistan j. nutr. 15(4):342-346. imsya, a, y. windusari and riswandi. 2018. the effect of organic mineral supplementation in the ration with total mixed fiber ammoniation as basal feed to rumen environment. proceeding of 6th international conference on sustainable agriculture, feed, and energy, october 19-21 2018. manila. philippines leng ra.1993. factors affecting the utilization of poor quality forages by ruminants, particularly under tropical conditions. nutrition research reviews volume 3: 277. maneerat, w, s. prasanpanich, s. kongmun, w. sinsmut and s. tumwasorn. 2013. effect of feeding total m fiber on feed intake and milk production in mid-lactating dairy cows. kasetsart j. (nat. sci.) 47:571-580 muhtarudin. 2003. pembuatan dan penggunaan zn-proteinat dalaam ransum untuk meningkatkan nilai hayati dedak gandum dan optimalisasi bioproses dalam pencernaan ternak kambing. jurnal penelitian pertanian terapan. 3(5):385-393. muhtarudin and liman. 2006. penentuan tingkat penggunaan mineral organik untuk memperbaiki bioproses rumen pada kambing secara in vitro. jurnal ilmu-ilmu pertanian indonesia. 8(2):132-140 national research council. 2000. national research council nutrient requirenment of organic mineral supplementations with tmfa in beef cattle ration (a. imsya et al.) 35 beef cattle. national academy of science. washington d. c. nurhaita, n jamarun., l. warly, and m zain, 2010. kecernaan ransum domba berbasis daun sawit teramoniasi yang disuplementasi sulfur, fosfor, dan daun ubi kayu. media peternakan; 33(3):144-149. parakkasi a. 1995. ilmu nutrisi dan makanan ternak ruminan. universitas indonesia press. jakarta. pond wg, dc church, kr pond and pa schoknecht. 2005. basic animal nutrition and feeding. fifth ed. john wiley and sons, inc. united states. p. 91-109. prawirokusumo s. 1994. ilmu gizi komparatif. bpfe-ugm, yogyakarta. siregar s. 2001. ransum ternak ruminansia. penebar swadaya, jakarta steel rgd and jh torrie. 2002. principles and procedures of statistics: a biometrical approach. second edition mcgraw-hill book company, london. p. 633. tillman ad, h hartadi, s reksohadiprodjo, s prawirokusuma dan s lebdosoekodjo. 1991. ilmu makanan ternak dasar. gadjah mada university press, yogyakarta. herlambang, t. 2014. management increasing competitiveness of local beef for the forest fringe communities. j. business and management. 16(9):40-43. 36 j.indonesian trop.anim.agric. 45(1):28-36, march 2020 j i t a a journal of the indonesian tropical animal agriculture accredited by ditjen penguatan risbang no. 60/e/kpt/2016 j. indonesian trop. anim. agric. pissn 2087-8273 eissn 2460-6278 http://ejournal.undip.ac.id/index.php/jitaa 43(1):35-42, march 2018 doi: 10.14710/jitaa.43.1.35-42 effect of tomato (solanum lycopersicum l.) protein on carcass and meat quality of kampong chicken j. r. leke*, j. s. mandey, f. ratulangi and m. najoan faculty of animal husbandry, sam ratulangi university, jl. kampus selatan, manado 95115 – indonesia *corresponding e-mail: rinileke@yahoo.com received september 05, 2017; accepted december 21, 2017 abstrak penelitian bertujuan untuk mengetahui kualitas karkas dan daging ayam kampung yang mengkonsumsi tepung tomat dalam ransum. penelitian ini dilakukan menggunakan 200 ekor ayam kampung umur 10 hari. rancangan yang digunakan dalam penelitian ini adalah rancangan acak lengkap (ral) yang terdiri dari 5 perlakuan dan 4 ulangan dan tiap perlakuan terdiri dari 10 ekor ayam kampung perlakuan yang diberikan adalah 0, 3, 6, 9 dan 12% tepung tomat yang disubstitusi pada ransum basal. ransum basal terdiri dari 42% jagung, dedak halus 9%, tepung ikan 10%, minyak ikan 5%, bungkil kedelai 9% dan ransum komersial 25%. perlakuan adalah po = 100% ransum basal (rb) + 0% tepung tomat (tt); p1 = 97% rb+ 3% tt; p2 = 94% rb + 6% tt ; p3 = 91% rb + 9 % tt; p4 = 88% rb + 12% tt. komposisi kimia tepung tomat adalah: 20,73% protein kasar, 1,53 % lemak, 30,94% serat kasar, 0,98% ca, 1,20% p dan 2.416 kkal/kg gross energy (ge). hasil penelitian menunjukkan bahwa pemberian ransum yang mengandung tepung tomat sampai 12% meningkatkan berat potong, karkas, dada, sayap, kaki dan paha, dan menurunkan lemak abdominal dan kolesterol darah, tetapi tidak berpengaruh pada liver, hati dan gizzard. kandungan air dan protein kasar daging nyata meningkat, lemak daging dan kolesterol daging nyata menurun. disimpulkan bahwa tepung tomat dapat digunakan dalam pakan ayam kampung sampai 12% karena tidak memberikan pengaruh pada kualitas karkas dan daging ayam kampung. kata kunci: ayam kampung, kualitas daging, kualitas karkas, protein, tomat abstract the purpose of this research was to examine the carcass quality and meat quality of native chicken fed dried tomato meal in diet. the study was conducted by using 200 heads of native chickens 10 days. the birds were divided into five experimental diets and each was divided into four replicate groups of ten birds per replicate. the based diet was formulated to contain 42% corn, rice bran 9%, fish meal 10%, fish oil 5%, soybean meal 9% and commercial diets 25%. tomato meal was included in five experimental diets at levels of 0, 3, 6, 9, 12% to substitute based diets. the treatments were po = 100% based diet (bd) + 0% tomato meal (tm); p1 = 97% bd+ 3% tm; p2 = 94% bd + 6% tm;p3 = 91% bd + 9% tm; p4 = 88% bd + 12% tm. chemical composition of tomato meal was: 20 .73% crude protein, 1.53% fat, 30.94%crude fiber, 0.98% ca, 1.20% p and 2,416 kcal/kg of gross energy (ge). results showedthat feeding tomato meal at an inclusion rate of 12% increased slaughter weight, carcass, breast meat, wings, drumstick and thigh, and decreased abdominal fat and blood cholesterol. moreove r, there were no significant difference in giblet (liver, heart and gizzard) between treatments. meat water and meat crude protein were significantly increased. meat crude fat and meat cholesterol were significantly decreased. in conclusion, tomato meal can be used as an alternative feedstuff in kampong effect of tomato protein on carcass and meat of kampong chicken (j.r. leke et al.) 35 chicken diets at inclusion levels up to 12% without negative effects on carcass quality and meat quality. keywords :carcass quality, meat quality, kampong chicken, protein, tomato introduction kampong chicken have been raised by most of the rural community population of indonesia and they represent an important source of meat and eggs. kampong chickens are still not able to provide consumption on a daily basis because of their low production. kampong chickens contribute a lot to household nutrition and income in rural areas of tropics (norris et al., 2007). however, improving nutrition for increasing egg and meat production in kampong chickens in indonesia is critical. productivity of kampong chicken breeds may be doubled with improved diets and management conditions (chowdhury et al., 2006). but the kampong chickens have not attained their full production potencial due to exposure to risks that influence against the survival and productivity under extensive management conditions (faruque et al., 2013). one on the top issues of kampong chickens is a tasty meat flavor. the people are more prefer to consume this type of chickens than that of commercially broiler chickens. therefore, the demand for kampong chickens is always increasing year to year, while only a small portion of it has been met (bamualim et al., 1994). the nutrional value of tomato can provide the poultry industry as an alternative feedstuff. the tomato seed is rich in protein lysine (approximately 13% more lysine than soya protein) and can supply feed that is deficient in lysine (latlief and knorr., 1983). the chemical analysis of tomato meal showed rich in protein (20.73%) and contains high fibre content (30.94%). the high nutrient content of tomato meal makes it a potential feed resource for livestock animals. the crude protein content of tomato meal was higher than the value of crude protein of tomato waste meal. tomato pomace could be used in broiler chicken diets up to level 20%. using of dried tomato pomace (only separated tomato seeds) in broiler chicken diets caused an extended shelf life for broiler meats, because of alpha-, beta-, gamma and delta tocopherols in tomato pomace cause an antioxidant effect (squires et al., 1992). tomato pulp is a good source of protein, vitamins and minerals but may be limited in energy due to the high fiber content (mansori et al.,2008) substitution of tomato pulp instead of other dietary ingredients shows comparable performance parameters in laying hen (jafari et al., 2006). the mentioned study showed that dried tomato pomace including rich food sources, has caused the poultry health and freshness and better feed digestion, as a result, it can increase the absorption of nutrients (asadollahi et al., 2014). tomato also contains a variety of phytochemical, including carotenoids and polyphenols (thompson et al., 2000; campbell et al., 2014). tomatoes and tomato products are the major dietary source of lycopene, folate, vitamin c, vitamin a, phenolics, and flavonoids as potential bioactive compounds (sahin et al., 2006). recent studies have suggested a protective role for lycopene, an antioxidant carotenoid, in the prevention of environmental stress and lead to better performance for birds (donkoh., 1989; sahin, et al., 2008). the red pigment contained in tomatoes is called lycopene. this compound appears to act as an antioxidant, neutralizing free radicals that can damage cells inthe body (bhowmik et al., 2012). along with carotenoids, other antioxidant compounds present in tomato, including ascorbic acid, tocopherols and phenols play a determinant role in disease prevention (karakaya et al., 2001). the dried tomato pomace is mainly consisted of tomato`s skin, seed and its hard texture. this byproduct, after being dried contains up to 22.1%22.4% protein, 14.5%-15.7% fat and 20.8% 30.5% fiber. it is a good source of a, b1 and b2 vitamins and also essential (and non-essential) amino acids (fallahi., 1996). according to jouzi et al. (2015), dried tomato pulp may be used as ingredient in quails ration up to level of 4-6 % without harming weight gain and feed conversion of birds. tomato waste has used as feedstuff in broiler diet up to 20% level without harming weight gain and feed conversion of poultry (lira et al., 2010). when formulating the diets, the main emphasis is placed on the crude protein, because protein is the critical constituent of poultry diets, and together with the other main nutrients such as carbohydrates, fat, water, vitamins, and minerals, is essential for life (cheeke., 2005). protein serve vital metabolic roles as blood plasma proteins, enzymes, hormones, and antibodies, each of 36 j.indonesian trop.anim.agric. 43(1):35-42, march 2018 which has a specific role in the body (pond et al., 1995). however, protein is also one of the most expensive ingredients in poultry diets. therefore, nutritionally and economically, proper protein usage is essential in all feeding systems. on the other hand, during broiler diet formulation, choosing ingredients to maximize nutrient availability, rather than simply meeting energy or amino acid levels, is necessary (ravindran., 2013). in poultry feed formulation, after the energy -yielding raw materials, protein supplements constitute the biggest component, and attention has been focused on the protein and energy levels of the feed (skinner et al., 1992). vegetable (plant) and animal products are the two most important protein sources in poultry diets. the usefulness of a protein feedstuff for poultry depends up on its ability to supply a sufficient amount of the essential amino acids that the bird requires, as well as the protein digestibility and the level of toxic substances associated with it (scanes et al., 2004). in general, vegetable (plant) protein sources are nutritional balanced and poor in certain essential amino acids and this decreases their biological value as they may not furnish the required limiting amino acids needed by birds for egg and meat production (akhter et al., 2008). formulation of poultry diets greatly depends on plant protein that can supply the necessary amino acids that are not available in adequate quantities in the cereals (atteh., 2000). plant protein is relatively cheaper and readily available than the animal protein source. the objectives of this study were to evaluate effect protein of tomato on carcass and meat quality of kampong chickens. materials and methods preparation of tomato meal the tomatoes were washed, cutted, and sundried to constant weight for 3-5 days. part of tomato then was ground to fine powder using mortar and pestle. after that, mixed with other ingredients to compound the feed. birds, feeding and management two hundred of kampong chickens (10 days of age) were used for the study and maintained for 105 days. the birds were divided into five experimental diets and each was divided into four replicate groups of ten birds per replicate using completely randomized design. the control diet (based diet) was formulated to contain 42% corn, rice bran 9%, fish meal 10%, fish oil 5%, soybean meal 9% and commercial diets 25%. tomato meal was included in four experimental diets at levels of 3, 6, 9 and 12% to substitute based diet. the treatments were: ro = 100% based diet (bd) + 0% tomato meal (tm); r1 = 97% bd+ 3 % tm; r2 = 94% bd + 6% tm, r3 = 91% bd + 9% tm, r4 = 88% bd + 12% tm. chemical composition of tomato meal was: 20.73% crude protein, 1.53 % fat, 30.94 % crude fiber, 0.98% ca, 1.20% p and 2,416 kcal/kg of gross energy (ge), and chemical composition of the diets are presented in table 1. at termination of the experiment, twenty chickens representing weight average of the group were taken carcass characteristics, and chemical composition of breast and thigh muscles were determined. chemical analysis proximate analysis of diet and meat of kampong chickens was determined by the methods of aoac (1996). crude protein was determined by multiplying crude nitrogen by 6.25. cholesterol was determined by libermann and burchad method (kenny, 1952) statistical analysis data were analyzed by one-way analysis of variance. probability values <0.05 were taken to indicate statistical significance. the treatments means were compared using duncan’s multiple range test (steel and torrie, 1980). the ibm spss statistics 22 software was used for the statistical processing of data. results and discussion the effects of dietary dried tomato meal on the carcass quality and meat quality of kampong chicken are presented table 2 and table 3. results showed that feeding tomato meal at an inclusion rate of 12% increased slaughter weight, carcass, breast meat, wings, drumstick and thigh, and decreased abdominal fat and blood cholesterol. moreover, there were no significant difference in giblet (liver, heart and gizzard) between treatments. meat water and meat crude protein were significantly increased, however, meat crude fat and meat cholesterol were significantly decreased (table 3). leke et al. (2015) in previous study reported effect of tomato protein on carcass and meat of kampong chicken (j.r. leke et al.) 37 that the whole egg nutrients have similar quality to based diet when chicken fed tomato diet up to 8%, so that could have beneficial nutritional impact for laying hens. leke et al. (2016) reported effect of dried tomato in diet up to 8% without negative effects on performance and egg quality. these suggest that the use of tomato meal in laying hen diets might have positive effects on whole egg quality. yitbarek (2013) showed that carcass yield values were higher for a group fed on 5% dried tomato pomace compared with other treatment 38 j.indonesian trop.anim.agric. 43(1):35-42, march 2018 table 1. composition of experimental of the diets nutrient composition diets (% of tm) 0* 3** 6** 9** 12** base diet 100 98 96 94 92 tm 0 2 4 6 8 crude protein (%) 15.71 18.87 18.64 19.09 19.77 fat (%) 4.36 2.97 2.59 2.97 3.29 crude fiber (%) 3.56 4.16 4.45 5.58 6.26 ca (%) 0.80 0.80 0.81 0.82 0.82 p(%) 0.86 0.87 0.88 0.85 0.90 ge (kcal/kg) 3057 3037 3018 2999 2980 tm = tomato meal * laboratory of science and technology of feed, bogor agricultural university (2017) **laboratory of nutritional biochemistry and fodder, gadjah mada university (2017) table 2. carcass and meat quality of kampong chickens variable 0% tm 3% tm 6% tm 9% tm 12% tm p value slaughter weight (g) 1230 ±15.72a 1241 ±23.37a 1339 ±17.51b 1330±20.13b 1471 ±22.75c .000 carcass (%) 71.2 ± 0.13a 72.1 ± 0.43b 74.2 ± 0.53c 74.5 ± 0.43d 74.7 ± 0.16d .000 breast meat (%) 28.59± 0.31a 29.49 ± 0.07a 32.11± 1.82b 33.88± 0.66c 34.58± 0.29c .000 wings (%) 12.15± 0.45a 12.49± 0.46a 13.27± 0.54b 13.36± 0.38b 14.22± 0.13c .000 drumstick +thigh (%) 31.63± 0.21a 32.08± 0.01b 32.92± 0.11c 35.41± 0.47d 35.45± 0.41d .000 abdominal fat (%) 1.88± 0.11b 1.44± 0.29b 1.32± 0.17a 1.39± 0.32a 1.25+ 0.17a .000 abdominal fat (g) 20.78± 0.69c 19.52± 0.46b 19.12± 1.08ab 18.44± 0.74a 18.26± 1.51a .000 blood cholest. (mg/dl) 136.62± 0.30d 133.64± 0.31c 122.42± 1.32a 123.90± 0.57b 122.22± 1.33a .000 liver (%) 2.80± 0.14 2.74 ± 0.19 2.42± 0.14 2.50± 0.14 2.38± 0.14 .000 heart (%) 0.63± 0.10 0.68± 0.10 0.64± 0.03 0.62± 0.06 0.60± 0.02 .528 gizzard (%) 3.09± 0.17 3.14± 0.10 2.91± 0.08 3.11± 0.34 2.80± 0.20 .062 tm = tomato meal groups. but statistically there were no significant difference between the groups. moreover, the obtained result was not similar to that reported by king and zeidler (2004) who showed that dried tomato pomace up to 15% in diet does not affect carcass traits of broiler chicks. sayed and abdelazeem (2009) reported that dried tomato pomace can be utilized efficiently and safely in the diets of rabbits up to level of 20% without any adverse effect on the performance and carcass traits. significantly similar carcass yield and dressing percentage was observed at 20 % of dried tomato pomace inclusion on grower chicks (yitbarek., 2013). our results indicated that alterations in feed intake and weight gain in some phases promoted by inclusion of tomato meal. chemical composition of tomato meal were : 16.73 % crude protein, 1.53% fat, 30.94% crude fiber, 0.98% ca, 1.20% p and 2,416 kcal/kg ge ( leke et al., 2016) squires et al. (1992) reported that tomato pomace could be used in broiler chicken diets up to level of 20%. that using of dried tomato pomace (only separated tomato seeds) in broiler chicken diets were caused an extended shelf life for broiler meats, because of alpha-, beta-, gammaand delta tocopherols in tomato pomace cause an antioxidant effect. in the present study, a positive effect of dried tomato meal on cholesterol concentration in the blood of kampong chicken was observed. the obtained results were similar to that reported by rahmatnejad et al. (2009) who showed that feeding dried tomato pomace at an inclusion rate of 16% and 24% to broiler chicks increased the mean values of hdl-cholesterol and decrease in serum cholesterol and ldl-cholesterol, as compared to other dietary treatments. moundras et al. (1997) said that the serum cholesterol decreasing effect of crude fiber could be due to its ability to enchange faecal excretion of cholesterol and bile acids. burr et al. (1985) suggested that there is a negative correlation between dietary fiber content and serum cholesterol level. it is possible that for a significant reduction of serum cholesterol, a higher inclusion level of dried tomato pomace in laying hen diets is required. mahata et al. (2016) reported that the total cholesterol, ldl-cholesteroland hdl-cholesterol of laying-hen’s blood serum and fat content of egg yolk was not affected by different levels of boiled tomato waste powder up to 12% in diets. even though there were no difference among treatments statistically but numerically it appeared that increasing in the level of boiled tomato waste powder in the diet lowered the total cholesterol and ldl tremendously and increased the hdl. in contrast, frederiksen et al. (2007) showed that dietary supplementation with an extract of lycopene rich tomatoes had no effect on cholesterol and triglycerol levels measured in rabbit’s plasma. feeding dried tomato pomace to laying hens had no effect on plasma cholesterol and low-density lipoproteins (nobakht and safamehr, 2007). results of abdominal fat and giblet in this experiment are not in agreement with those reported of lira et al. (2010), in which there was no difference between regime with different levels of tomato waste for absolute weight of heart, liver and gizzard neither for yield of gizzard, with means of 13.35 g; 41.83 g, 34.87 g and 1.94%, respectively. however, for yield of heart and liver, there was linear effect, because for each 1% of tomato waste inclusion, there was an increase of 0.0036 and 0.0133%, respectively. effect of effect of tomato protein on carcass and meat of kampong chicken (j.r. leke et al.) 39 table 3. water, crude protein, crude fat and cholesterol of meat of kampong chickens variable 0% tm 3% tm 6% tm 9% tm 12% tm p value water (%) 72.58±0.55a 73.26±0.56bc 72.78±0.44ab 73.50 ± 0.47c 74.72±0.16d .000 crude protein (%) 20.56±0.42a 22.08±1.30b 22.34±0.82bc 23.26 ± 0.42cd 23.60±0.29d .000 crude fat (%) 2.64±0.20d 2.28±0.08c 2.15±0.05bc 2.07 ±0.06ab 1.96±0.13a .000 meat cholesterol (mg/100 g) 24.47±0.58d 23.18±0.79c 21.62 ±0.29b 20.74 ±0.11a 20.26±0.23a .000 tm = tomato meal dietary supplemental plant extracts on different organ weights was reported by akbarian et al. (2013). relative spleen, pancreas, gizzard, liver, proventriculus, thigh, breast, heart and visceral fat weight were not influenced by the use of plant extract. the statistics analysis results of moisture, protein, fat, and cholesterol of meat in this research in different levels of dried tomato pomace significantly different and using 12% of dried tomato pomace showed the best result. asadollahi et al. (2014) reported that results of protein, fat, moisture and ash of meat in different levels of dried tomato pomace up to 10% were significantly increased (asadollahi et al., 2014). comparing the studied parameters showed that increasing the amount of used dried tomato meal up to 12% leads to increase both water and protein content, but reduces the fat and meat cholesterol content of the kampong chicken texture which consequently increased overall consumer acceptability. in general, according to the obtained results of each of the five parameters, the treatment which contained 12% dried tomato meal was determined as the best one and was recommended to be added to the diet of chickens. proteins and lipids of muscle tissue are important meat quality parameters. normally thigh meat fat content in broiler is 90.44 g/kg to 107.55 g/kg in female and 76.95 g/kg to 96.83 g/kg in male. they contribute substantially to the nutritional characteristics of meat. mahata et al. (2014) reported the inclusion of dragon fruit peel in broiler diet up to 15% lowering fat and cholesterol content in thigh meat. the level of dragon fruit peel 10 and 15% in diet were as same as effect in lowering fat content, while the highest lowering cholesterol in thigh meat occured when the dragon fruit peel was included reach 15 % in diet. it be predicted, lowering fat and cholesterol in thigh meat due to anthocyanin, lycopen, and βcarotene from dragon fruit peel inhibited cell cholesterol synthesis by inhibiting hmg-coa reductase work to synthesize mevalonate as intermediate reaction in cholesterol synthesize in cell. conclusion based on the present data, it can be concluded that tomato meal can be used as an alternative feedstuff in kampong chicken 105 days of age diets at inclusion levels up to 12 % without negative effects on carcass quality and meat quality. references akbarian, a., a. golian, h. kermanshahi, r. farhoosh, a.r. raji,s. de smetand j. michiels. 2013. growth performance and gut health parameters of finishing broilers supplemented with plant extracts and exposed to daily increased temperature. spanish j. agric. res. 11(1):109-119. akhter, s., m. khan, m. anjum, s. ahmed, m. rizwan and m. ijaz. 2008. investigation on the availability of amino acids from different animal protein sources in golden cockerels. j. anim. plant sci.18:53-54. asadollahi, s., n. karimi and a. mansuri. 2014. using of dried tomato pomace in broiler's diet and it's effect on chemical components of obtained meat. international conference on chemical, agricultural, and biological sciences (iccabs) oct. 9-10, 2014, antalya (turkey). p. 28-32. association of official of analytical chemist (aoac). 1996. methods of analysis. 13thwashington d.c., usa. atteh, j.o. 2000. principles and practices of feed manufacturing: publishers: adlek printers, ilorin, kwara state. bamualim, u., kedang, a. and s. ratnawaty. 1994. rearing manajement model on native chicken in indonesia due to small farmer income in dry lands. national annual meeting on implementation and communication research findings. p. 256 260. bhowmik, d., k.p. sampath kumar, s. paswan and s. srivastava. 2012. tomato-a natural medicine and its health benefits. j. pharmacognosy and phytochemistry.1 (1): 33-43. burr, m.l., p.m. sweetnam, m.e. barasi and c.j. bates.1985. correlation between dietary content and serum cholesterol in laying hens. nutr. res. 5:465-465. campbell, j.k., k. canene-adams, b.l.l. indshield, t.w.m.boileau, s.k. clinton and j.w. erdman jr. 2014. tomato phytochemicals and prostate cancer risk. international research conference on food, nutrition and cancer. washington, d.c.july 15-16, 2014. cheeke, p.r. 2005. livestock feeds and feeding. 3rd ed. upper saddle river, new 40 j.indonesian trop.anim.agric. 43(1):35-42, march 2018 jersey:pearson prentice hall. chowdhury, s.d., s. ahmed and m.a. hamid. 2006. improved feeding of desi chicken reared in confinement. the bangladesh veterinarian. 23: 29 – 35. donkoh, a. 1989. ambient temperature: a factor affecting performance and physiological response of broiler chickens. int. j. biometeorol. 33: 259–265. emshaw, y., a. melesse and g. assefa. 2012. the effect of dietary inclusion of mango (magniferaindica l.) fruit waste on feed intake, growth and feed efficiency of cobb500 broiler chickens. ethiop. j. agric. sci. 22:73-83. fallahi, m. 1996. tomato alteration industry (tomato paste). barsava edition, tehran, iran. faruque, s., m.s. islam, m.a. afroz, and m.m. rahman, 2013. evaluation of the performance of native chicken and estimation of heritability for body weight. j. bangladesh acad. sci .37(1):93-101. frederiksen, h., s.e. rasmussen and m. schroder. 2007.dietary supplementation with an extract of lycopene rich tomatoes does not reduce atherosclerosis in watanabe heritable hyperlipidemic rabbits. br. j. nutr. 97: 6–10. iyayi, e.a. 2008. prospects and challenges of unconventional poultry feedstuffs. nigeria poult. sci. j. 5:186-194. jafari m., r.r. pirmohammadi and v. bampidis. 2006. the use of dried tomato pulp in diets of laying hens. int. j. poult. sci. 5:618-622. jouzi, h., n. vali and j. pourreza. 2015. the effects of tomato pulp powder supplementation on performance and some blood parameters in japanese quail (coturnix japonica). arpn j. agric. biol. sci. 10 (3): 103-107. karakaya, s., s.n. el and a.a. tas. 2001. antioxidant activity of some foods containing phenolic compounds. int. j. food sci. nutr. 52, 501–508. king, a. and g. zeidler. 2004. tomato pomace may be a good source of vitamin e in broiler diets. california agric. 58:59-62. kenny, a.p. 1952. the determination of cholesterol by the liebermann-burchard reaction.clinical laboratories. 52(39):611620. latlief, s.j. and d.knorr. 1983. tomato seed protein concentrates; effects of methods of recovery upon yield and compositional characteristics. j. food sci. 48:1583-1586. leke, j.r., j.s.mandey and f.j. nangoy. 2015. nutriets and cholesterol of eggs affected by dried tomato meal in laying hens. int. j. advanced sci. eng. inform. technol. 5(3):27-29. leke, j.r., j.s. mandey, j. laihad. f. ratulangi.2016. effect of dried tomato meal (solanum lycopersicum) in diet on performance and egg quality of native chicken. proceedings, symposium the 17th asian-australian association of animal production societies animal science congress. fukuoaka, japan. 22-25 august 2016. pp 47-49. lira, r.c., c. bôa-viagem rabello, m. do carmo m. marques ludke, p.v. ferreira, g.r. q. lana and s.r.v. lana. 2010. productive performance of broiler chickens fed tomato waste. r. bras. zootec. 39(5). mahata, m.e., y. mahlil, y. fajri,r. aditia and r.yose. 2014. the utilization of red dragon fruit (hylocereus polyrhizus) peel as broiler feed. abstract summary, international congress and general meeting. society for southeast asian agricultural science (issaas) in collaboration with saeda, tokyo university of agriculture and jsta, tokyo, japan. mahata, m.e., y. rizal, a.d. hermansyah and g.a. nurhuda. 2016. effects of boiled tomato waste utilization in the diet on serum lipid profile and egg quality of laying-hens. int. j. poult. sci. 15(12): 493-496. mansoori, b., m. modirsanei and m.m. kiaei. 2008.influence of dried tomato pomace as an alternative to wheat bran in maize or wheat based diets, on the performance of laying hens and traits of produced eggs. iranian j. vet. res. 9(4):341-346. moundras, c., s.r. behr, c. remensy and c. demigne. 1997.fecal losses of sterols and bile acids induced by feeding rats guar gum are due to greater pool size and liver bile acid secretion. j. nutr. 127: 1068-1076. nobakht, a. and a.r. safamehr. 2007. the effect of inclusion different levels of dried tomato pomace in laying hens diets on performance and plasma and egg yolk cholesterol contents. j. anim. vet. adv. 6(9):1101-1106. norris d, ng’ambi j.w, benyi k, makgahlela m.l., shemilis h a and e.a. nesamvuni. 2007. analysis of growth curves of effect of tomato protein on carcass and meat of kampong chicken (j.r. leke et al.) 41 indigenous male venda and naked neck chicken. south african journal of animal science, 37(1):21-26. pond, w.g., d.c. church and k.r. pond. 1995. basic animal nutrition and feeding. canada: johnwiley and sons, inc. rahmatnejad, e., m. bojarpour, k.h. mirzadeh, m. chaji and o. ashayerzadeh. 2009. the effect of different levels of dried tomato pomace on broilers chicken hematological indices. j. anim. vet. adv. 8(10):16805593. ravindran v. 2013. poultry feed availability and nutrition in developing countries: main ingredients used in poultry feed formulations. poultry development review. rome, italy: f. a. o.; 2013. p. 6769. sahin n., k. sahin, m. onderici, m. karatepe, m.o. smithand o. kucuk. 2006. effects of dietary lycopene and vitamin e on egg production, antioxidant status and cholesterol levels in japanese quail. asianaust. j. anim. sci.19:224-230. sahin n., c. orhan, m. tuzco, k. sahin and o. kocuk. 2008. the effects of tomato powder supplementation on performance and lipid per oxidation in quail. poult. sci. 87:276283. sayed, a.n. and a.m. abdel-azeem. 2009. evaluation of dried tomato pomace as feedstuff in the diets of growing rabbits. int. j. agro vet. med. sci. 3:2009:12-18. scanes, c.g, g. brant and m.e. ensminger. poultry science. 4th ed. new jersey: pearson prentice hall; 2004. p. 100-118. skinner, j.t., a.l. izat and p.w. waldroup. 1992. effects of dietary amino acids level and durationof finisher period on performance and carcass content of broiler forty-nine days of age. poult. sci. 71: 1207-1214. squires, m.w., e.c. naber and v.d. toella. 1992. the effect of heat water, acid and alkali treatment of tomato cannary waste on growth, metabolizable energy value and nitrogen utilization of broiler chicks. poult. sci. 71: 522-529. steel, r.g.d. and j.a. torrie. 1980. principles and procedures of statistics. mcgraw-hill, new york. thompson, k.a., m.r. marshall, c.a. sims, c.i. wei, s.a. sargentand j.w. scott, 2000. cultivar, maturity and heat treatment on lycopene content in tomatoes. j. food sci. 65:791-795. yitbarek, m.b. 2013. carcass characteristics of rhode island red (rir) grower chicks feed on different levels of dried tomato pomace (dtp). int. j. adv. res.1(2): 17-22. 42 j.indonesian trop.anim.agric. 43(1):35-42, march 2018 j i t a a journal of the indonesian tropical animal agriculture accredited by ditjen penguatan risbang no. 60/e/kpt/2016 j. indonesian trop. anim. agric. pissn 2087-8273 eissn 2460-6278 http://ejournal.undip.ac.id/index.php/jitaa 43(1):9-18, march 2018 doi: 10.14710/jitaa.43.1.9-18 morphometrics and genetic diversity of tegal, magelang and their crossbred ducks based on cytochrome b gene henrik1,*, d. purwantini2 and ismoyowati2 1college of agriculture of mujahidin tolitoli, jl. dr. samratulangi no. 51 tuweley, tolitoli, central sulawesi 94515 indonesia 2animal science faculty, university of jenderal soedirman, jl. dr. soeparno no. 60 purwokerto-central java 53122 indonesia *corresponding e-mail : hendrikaprawi@gmail.com received june 26, 2017; accepted february 06, 2018 abstrak penelitian ini bertujuan untuk mengetahui keragaman morfometrik dan genetik itik tegal, magelang, dan hasil persilangannya. masing-masing 10 ekor itik betina tegal, magelang, gallang, dan maggal yg berumur 20 minggu digunakan sebagai kelompok materi penelitian. morfometrik yang diukur adalah bobot badan, lingkar dada, panjang badan, panjang shank, panjang leher, dan lebar pubis. data yang diperoleh dianalisis menggunakan analisis variansi klasifikasi satu arah. untuk mengetahui polimofisme gen cytochrome b (cyt b) dna mitokondria digunakan polymerase chain reactionrestriction fragment length polymorphism (pcr-rflp). jarak genetik dianalisis berdasarkan nilai heterozigositas, sedangkan pohon filogeni direkonstruksi menggunakan software mega 6. hasil penelitian menunjukkan terdapat perbedaan yang sangat nyata (p<0.01) pada bobot badan, lingkar dada, panjang badan, dan panjang leher antar kelompok, sedangkan panjang shank dan lebar pubis tidak berbeda nyata. jarak genetik antara itik gallang dengan maggal (0.206) lebih tinggi dibanding itik tegal dengan magelang (0.169). berdasarkan hasil penelitian dapat disimpulkan bahwa persilangan resiprok meningkatkan keragaman morfometrik dan keragaman genetic itik lokal indonesia. kata kunci: keragaman morfometrik, keragaman genetic, persilangan resiprokal, itik lokal, cytochrome b abstract this experiment was conducted to study the morphometric and genetic diversity of tegal, magelang, and their crossbred ducks. each ten female about twenty weeks old ducks from tegal, magelang, gallang, and maggal ducks, respectively, were used as the group materialss. the body weight, chest circumference, body length, shank length, neck length, and pubis width were recorded and tested by analysis of variance of one way classification as the morphometric characteristics. polymorphism of cytochrome b (cyt b) gene on mitochondrial dna (mtdna) was analyzed by polymerase chain reaction-restriction fragment length polymorphism (pcr-rflp). genetic distance was analyzed based on value of heterozygosity, whereas the phylogeny tree was reconstructed using mega6 software. the results showed there were highly significant difference (p<0.01) on body weight, chest circumference, body length, and neck length between population, while shank and pubis width were not significant different. the genetic distance between gallang and maggal ducks (0.206) was higher than tegal and magelang ducks (0.169). it is concluded that the reciprocal crosses increased the morphometric and genetic diversity of indonesian local duck population. keywords: korphometric diversity, genetic diversity, reciprocal crosses, local duck, cytochrome b morphometrics and genetic diversity of indonesia local ducks (henrik et al.) 9 introduction domestic duck play an important role in animal protein supply (sultana et al., 2016), which has a high genetic diversity if compared to other populations spread in this world. south-east asian duck population were closely related to the mallard duck (anas platyrhynchos) that indicated by their mean overall genetic distance. indonesian domestic ducks has a relatively closed genetic relationship with anas platyrhynchos and anas zonorhyncha as shown by the variation of the genetic distance ranged from 0.000 to 0.786 (purwantini et al., 2013a). the indonesia local ducks have the morphological features typically. especially in central java province, there were tegal and magelang ducks having a high genetic diversity due to extensive raising system and the high egg production which spread almost throughout the territory of indonesia (purwantini et al., 2013b; ismoyowati and purwantini, 2013; purwantini and roesdianto, 2001). hetzel and gunawan (1984) stated that tegal duck lays more eggs and more profitable than alabio x tegal crossbred ducks under extensive husbandry. egg production of tegal and magelang dukcs were 70.89% and 70.24% with a body weight 1.400±0.14 and 1.600±0.16 g, respectively (ismoyowati and purwantini, 2013; hetzel and gunawan, 1984). therefore, both of crossbred’s different characteristic or genetic distance may be occurred as the results of reciprocal crosses between tegal and magelang ducks. warwick et al. (1995) stated that the results of crosses between different strains or species produced the offspring that are better than their parent. the crossbreeding of two strains of duck is expected to produce better offspring without damaging their genetic sequence. sudewo (2005) reported that if between breeds that has genetic distance <0.025, then the crossing between the same breeds will damage the genetic sequence in the population by the inclusion of recessive genes. therefore, information about genetic distance between duck population is important for duck breeding system. one method often used to determine the genetic distance and relationship is polymerase chain reaction-restriction fragment length polymorphism (pcr-rflp). the pcr-rflp method in the region of mitochondrial dna (mtdna) is a basic technique that is often used in the identification of genetic distance and genetic diversity (kalita, 2015). the pcr-rflp on the cytochrome b of mitochondrial dna (cyt b mtdna) is an appropriate method for species identification. pcr-rflp is also easier and simpler to apply (kalita, 2015; minarovic et al., 2010; chen et al., 2012; farag et al., 2015). by using cyt b mtdna, there is no recombination of dna occur and all offspring from the female parent would have imilarity in mtdna sequence (linacre and tobe, 2011). in indonesia, pcr-rflp method successfully identified the genetic diversity of indonesian local duck population, those were magelang, tegal, mojosari, bali and alabio ducks based on polymorphism of mtdna d-loop (purwantini et al., 2013b). genetic diversity is important for duck breeding management as well as the morphometric diversity. according to yakubu and ugbo (2011), the morphometric and genetic diversity are crucial to the development of duck breeding program appropriate in each country. genetic diversity is also useful for longterm breeding programs such as genetic mapping and molecular breeding marker-based (kalita, 2015). tegal ducks and magelang ducks had the genetic distance ranged from 0.009 to 0.691 based on the single nucleotide polymorphism (snp) analysis on the d-loop mtdna region (purwantini et al., 2013a). nevertheless, information about the genetic diversity of tegal, magelang, and their crossbred by pcr-rflp based on polymorphism of cyt b mtdna has still limited. therefore, this experiment was conducted to investigate the morphometric and genetic diversity of tegal, magelang, and their crossbred based on polymorphism mtdna cyt b by pcr-rflp analysis. materials and methods resiprocal crosses and morphometric traits measurement this experiment was conducted at the experimental farm of animal husbandry faculty of jenderal soedirman university. forty-four about twenty weeks old duck raised intensively in litter cage, consisting respectively 10 female of tegal ducks, magelang, gallang and maggal ducks, and 2 male ot tegal and magelang ducks, respectively. the crossbred of tegal male duck and magelang female duck called the gallang ducks, while crossbred of magelang male duck and tegal female duck called the maggal duck. the equipments used were litter cage, feed tray, 10 j.indonesian trop.anim.agric. 43(1):9-18, march 2018 drinking water, hatching machine, egg tray, shovels, hoses, buckets, stationery, thermometer, hygrometer, binocular eggs, weigher analytic, sprayer, and tape meter. starter feed (br1) was given by continuously with 21% crude protein (cp) and 3100 kcal/kg metabolic energy (me). the grower duck (four-week-old ducks) was fed 100 g/day of diet increased up to 150 g at eightweeks-old. the grower feed was composed of 30% corn, 20% of laying concentrate, 50% rice bran that containing 15.07% cp, 2806 kcal/kg me, 1.8% calcium (ca), and 1.22% phosphor (p). on the layer phase, the feed given was 160 g/duck/day consisting of 20% corn, 16.7% of laying concentrate, 63.3% rice bran that containing 16.95% cp, 2884 kcal/kg me, 0.56% ca, and 0.97 p, while drinking water was provided by continuously. the observed variables were body weight, chest circumference, body length, shank length, neck length, and pubis width. figure 1. shows method to measure body measurement. morphometric was measured during one week when duck start to production (ismoyowati et al., 2006). body length (bl) was measured between the lengths of the end rostrum maxilla until the tail section. chest circumference (cc) was measured in the area under the wings at the edge of the sternum. neck length (nl) was measured from the occipital condyles and cephalic limits on coracoids. shank length (sl) bone was measured by the length of metatarsus (teguia et al., 2008) while pubis width (pw) was measured by the distance between left and right pubis (ismoyowati et al., 2006). data were analyzed using an analysis of variance of one way classification with mathematical models by gomez and gomez (1984). polymorphism of cytochrome b gene of mitochondrial dna blood sample was taken from ten female each of tegal, magelang, gallang, and maggal ducks, respectively. the materials used in the laboratory were disposyble syrink, micropipette, blue type, yellow type, white type, epppendorf, water bath, microwave, gloves, thermo cycler machine advance primus 25 (peqlab, erlangen, germany), submarine electrophoresis (z372331 model, sigma-usa), uv visualization (z654469 model, sigma-usa), dna isolation kit (geneaid), pcr kit, good view, agarose powder, tbe buffer, ethanol absolute, loading day, restriction enzyme (haeiii), phosphate buffer saline (pbs), dh2o, primer forward (5'tgcaaccccagtcctagtc-3'), and primer reserve (3'-gaaggctaggatttt gcgtgt5'). isolation of dna and amplification the steps of dna isolation was based on the instructions of dna isolation kit. amplification of dna was performed by using a thermo cycler machine on the cyt b mtdna using forward primer (tgcaaccccagtcctagtc 5'-3'), and reserve primer (gaaggctaggatttt gcgtgt-3'-5'). the design of oligonucleotide specific primer of cytochrome b gene was performed on the basis of the database of genebank eu678239.1 (he et al., 2008). the primary pair was selected on the conserve area, analyzed by the design oligoprimer software with the primer3 online program. polymerase chain reaction was performed with the cyt b mtdna target gene in 25 µl total reaction volume that consisting 12,5 µl kapa2g fast ready mix pcr kit (kapa biosystems), 9.5 µl dh2o, 1 µl forward and reverse primer respectively, and 1 µl of dna template. the stage of pre-denaturation was performed for 5 minutes at 94oc. furthermore, denaturation stage was carried out at 94°c for 30 seconds and was followed by annealing at 55oc for 45 seconds. the stage where the elongation of the pcr reaction will be discontinued, thermo cycler conditions maintained at 72oc for 1 minute. the last stage of the pcr reaction is post-elongation. it is the stage of dna elongation reaction to enhance and was performed for 5 minutes at 72 oc. the pcr reaction repeated for 35 cycles. furthermore, the pcr product were separated by electrophoresis in 1.5% low-melting agarose gel using 0,5 tbe buffer in electrophoresis machine power pac 3000 (bio pad). restriction fragment length polymorphism restriction fragment length polymorphism was performed on pcr products using endonuclease restriction enzyme haeiii for 6 hours at 37oc consisting of 1 µl restriction enzyme haeiii, 2 µl of buffer enzyme, 7 µl of dh2o, and 5 µl of pcr product. the reason for using this enzyme was because of easy to obtain and has four site cuts on the primer were used. the results of this digestion then electrophoreses on 2% agarose gel and visualized using ultraviolet light. morphometrics and genetic diversity of indonesia local ducks (henrik et al.) 11 data analysis fragment patterns of mtdna cyt b as the digestion results using the restriction enzyme haeiii was tabulated to determine haplotypes. the different of paterns of dna band was showed on agarose gel, then was used to determine haplotype, gen frequency, heterozygosity, and genetic distance. the genetic frequency was determined by pirchner’s formula (pichner, 1981): where: fan is frequency ath gene at the kth locus. based on frequency of gene, individual heterozigosity was determined by nei’s formula (nei, 1978): where: pi is the frequency of ith allele at locus in the population. individual heterozigosity (h) is the value that describes genetic diversity in the population, whereas average heterozygosity (h) was defined as the mean value of over all loci in the genome. value for single loci was estimated using unbiased estimate by nei’s formula (nei, 1978): where: x1 is frequency of corresponding allele in a sample from the population, value of n individual can be different every loci. the average heterozygosity (h) was estimated by nei’s formula (nei, 1978): where: hi as h value at ith loci. individual heterozigosity (h) is the value that the genetic distance was estimated by nei’s formula (nei, 1978): where: genome. relationship genetic between population was reconstructed using mega 6.06 (build number: 6140226) software with upgma method (tamura et al., 2013). results and discussion morphometric characteristics based on the anova of one way classification, the difference among duck population showed highly significant effect (p<0.01) on body weight, chest circumference, body length, and neck length, whereas the shank 12 j.indonesian trop.anim.agric. 43(1):9-18, march 2018 figure 1. measurement method of morphometric of duck (modified from http: www.anatomywarehouse.com). nl: neck length; bl: body length; cc: chest circumference pw: pubis width; sl: shank length ∑ ∑ ∑ ∑ +++ = ana2a1 an an locus..locuslocus locus f ∑−= 2ip1h 1))/(2nx2n(1h 2 ii −−= ∑ ∑ = = r 1k i r h h ] gg g ln[d yx xy−= length and pubis width were not significantly different. the body weight of gallang and maggal ducks highly significant different (p<0.01) compared to tegal and magelang ducks, while between the gallang and maggal duck was not significant different. the body weight of magelang ducks was higher than tegal ducks (table 1), in which the previous study were 1.660±0,16 g and 1.400±1.550 g, respectively for magelang and tegal duck (hetzel and gunawan, 1984; ismoyowati et al., 2006). the different of body weight in this study was due to genetic factors because environmental effects has been made uniformly. ismoyowati et al. (2006) reported that when the affects of the environment are uniform, phenotypes that appear will showed the genetic capability. according to yakubu and ugbo (2011), comparison of phenotype based on morphological characteristics could be representing of genetic differences. the body weight of magelang ducks was higher (p<0.01) than others ducks in this experiment (table 1). the body weight of gallang and maggal ducks was also higher (p<0.01) than tegal ducks, but there was no significant different between gallang and maggal ducks. these different may be influenced by additive genetic inherited from their parent that was called maternal effect. szwaczkowsk et al. (2010) reported that the affect of the parent is defined as all of the affect of the parent to offspring, including direct and genetic affect. body weight is a complex phenotypic with single loci considered as influential, in which presence of dominant genes will give effect to quantitative characteristics including body weight. as well as the heritability (h2), genetic additive has a very significant influence on the quantitative characteristics of ducks (weight, length of the sternum, and the thickness of the chest muscles). the variation of morphometric characteristics appearance among tegal, magelang, gallang, and maggal ducks was not only on body weight but also in other morphometric. the chest circumference size of magelang ducks was higher (p<0.01) than that of tegal duck, but there was no significant different between gallang and maggal ducks. body length and neck length of gallang and maggal ducks was higher (p<0.01) than that of magelang and tegal ducks, but there was no significant different between body length of gallang and maggal ducks. neck length of maggal ducks was higher (p<0.01) than the others ducks in this experiment. shank length and pubis width were not significant different over all duck population in this study. cytochrome b mtdna play an important role in cell respiration to provide energy for metabolism, involved in trans-membrane electron transfer, as well as a center for catalytic subunit ubiquinol-cytochrome c-reductase (complex iii) which is an enzyme involved in the respiratory chain reaction (esposti et al., 1993; mcdonald et al., 2010; rich and maréchal, 2010; heiske, 2010). the number of mitochondria varies greatly between different organisms and even between tissues within the same organism (esposti et al., 1993; rich and marechal, 2010). morphometrics and genetic diversity of indonesia local ducks (henrik et al.) 13 table 1. average morphometric characteristics of tegal ducks, magelang dcks, and their crossbred characteristic duck magelang tegal gallang maggal body weight (g) 1659±200a 1196±94d 1408±153bc 1469±177b chest circumference (cm) 30.55±1.38a 28.45±0.69bc 29.75±1.31ab 29.29±1.38ab body length (cm) 20.75 ±0.79b 18.80±0.63c 23.38±0.68a 23.67±0.70a shank length (cm) 6.45±0.49 6.10±0.46 6.23±0.33 6.08±0.07 neck length (cm) 17.70±1.54c 16.60±1.24cd 21.50±1.13b 23.30±0.87a pubis width (cm) 5.90±0.63 5.70±0.39 6.23± 0.34 6.16±0.32 * marked fields with a different letter notation in the same row means significantly different based on the 1 % level of hsd test. the interaction among genes may be one factor that can affect the raising a new phenotype on the crossbred duck population. suryo (2005) stated that appearing of a new phenotype on the offspring was the results of a crossbreeding. the appearing of variation on morphometric characteristics of gallang and maggal duck was the result of the reciprocal crosses may be affected by the interaction of genes, as well as by maternal genetic including the mitochondria. body weight and other morphometric characteristic are quantitative traits (szwaczkowski et al., 2010) that involved one more gene or many genes. polymorphisms of cytochrome b and genetic distance the mtdna cyt b was isolated and has a size of 533 base pairs (bp) of pcr product. based on pcr-rflp method, this experiment showed the polymorphism in the mtdna cyt b gene of tegal, magelang, gallang, and maggal ducks. restriction patterns were discovered by haeiii restriction enzyme were 533 bp, 284 bp, 174 bp, and 75 bp respectively (figure 2). there were four haplotypes based on restricting patterns. on tegal and magelang ducks were two haplotypes (a and c), gallang ducks three haplotypes (b, c, and d), as well as maggal ducks has four haplotype, those were a, b, c and d (table 2). these proven the genetic diversity of domestic duck population in indonesia were previous reported (purwantini et al., 2013b). purwantini et al. (2013b) reported that 6 haplotype (a, b, c, d, e, and f) of indonesia local duck population (magelang ducks, tegal ducks, mojosari ducks, bali ducks, and alabio ducks) on the basis of polymorphism of mtdna d-loop gene. the difference on the number of haplotypes was founded may due to several factors including the restriction enzyme type and dna region was used. purwantini et al. (2013b) reported that d-loop of mitochondrial dna region has highly polymorphism degree in the mitochondrial genome. however, mtdna cyt b gene still recommended as a universal primers for the species identification study by pcr-rflp because it has stable sequences (minarovic et al., 2010). on the basis of the value of heterozygosity (h), genetic diversity of duck population in this study was about 0658-0691 (table 3). it means, there was no recombination occur in mtdna cyt b gene. according to linacre and tobe (2011), all the offspring of their mother would have identical sequences of mtdna, except mutations occurred. wu et al. (2008) reported that low levels of genetic diversity of a population showed that 14 j.indonesian trop.anim.agric. 43(1):9-18, march 2018 figure 2. the fragment patterns of cyt b mtdna using haeiii restriction enzyme. mr (marker), p (pcr product), m (magelang ducks), t (tegal ducks), gl (gallang ducks), and mg (maggal ducks) there is no genetic mutations occur or the possibility of genetic mutation is very small. it is also in conformity with the average value of average heterozygosity (h) over all duck population in this study showing very small and closely to 0 (0.0273 ± 0.0013) and this may indicate the very small possibility of a genetic drift. the changes of gene frequencies that occur were also very small, so there was not significant increase of h value. mulliadi and arifin (2010) reported that the changes of gene frequencies that occur in the dna had a role to raising the value of heterozygosity. inbreeding crosses could decrease h value while outbreeding crosses could increase it. therefore, reciprocal crosses in this study indicated no inbreeding occur. it was proved by increasing the h value on the crossbred duck population. instead, the reciprocal crosses could increased the genetic diversity in accordance with the report of su et al. (2006) on duck population in china. kalita (2015) stated that genetic diversity is a combination of genes founded in a population and different patterns of variation across population in the same species. the genetic distance across duck population founded in this study showed genetic diversity. the genetic distance between tegal and magelang duck population closer than genetic distance between gallang and maggal duck (table 4). the genetic distance between tegal and magelang duck in this study according to the previous study was reported by purwantini et al. (2013a) about 0.009-0, 691 based on d-loop mtdna region. gallang and maggal ducks as the offspring of reciprocal crosses has a similarity and relationship tend to be closer to tegal ducks compared with magelang ducks. on the basis of phylogeny tree, tegal and magelang ducks were in the same cluster that described a very close relationship, while gallang and magal duck in a different cluster (figure 3). relationship of maggal ducks is closer to tegal and magelang ducks cluster, while gallang ducks was outside of the cluster. it means gallang ducks has a further genetic relationship with other duck population in this study. although, the length branch of cluster has appeared was very small indicates no genetic mutation occur. blanchette et al. (2012) stated that small branch distance between clusters was due there was no genetic mutation occurs. the genetic distance raised by reciprocal crosses between tegal and magelang ducks can increase the genetic diversity of domestic duck population in indonesia. however, the morphometric and genetic diversity of crossbred of gallang with magelang duck or maggal with tegal duck has not identified. because, this study is limited only to find out the morphometric and morphometrics and genetic diversity of indonesia local ducks (henrik et al.) 15 table 2. the haplotype of tegal ducks, magelang ducks, and their crossbred by pcr-rflp with haeiii restriction enzyme ducks haplotype a (75 and 174 bp) b (174 and 284 bp) c (75, 174, and 284 bp) d (533 bp) tegal 3 7 magelang 2 8 gallang 1 8 1 maggal 1 1 7 1 table 3. value of individual heterozygosity (h) and the average heterozygosity (h) on the tegal ducks, magelang ducks, and their crossbred duck population duck heterozygosity tegal (t) 0.658 ± 0.089 h magelang (m) 0.633 ± 0.086 h gallang (gl) 0.690 ± 0.078 h maggal (mg) 0.691 ± 0.037 h h = 0.0273 ± 0.0013 genetic diversity within tegal and magelang ducks population as well as their crossbred. therefore, more research is needed to identifying the morphometric and genetic diversity of “backcross-offspring” with their parent on indonesian domestic duck population. conclusion morphometric and genetic diversity of tegal ducks, magelang, gallang, and maggal ducks population were obtained by reciprocal crosses in this study. polymorphism of mitochondria cytochrome b gene can be used to identify genetic diversity of local ducks population in indonesia. references blanchette, g.r., o’keefe, and l. benuskova. 2012. inference of a phylogenetic tree: hierarchical clustering versus genetic algorithm. lecture notes in computer science. 7691:300-312. chen, s., y. yao and y. liu. 2012. species identification of ten common farm animals based on mitochondrial 12s rrna gene polymorphism. anim. biotec, 23:213-220. esposti, m.d., s. d. vries, m. criml, a. ghelh, t. patarnello and a. meyer. 1993. mitochondrial cytochrome b: evolution and structure of the protein. biochem. biophys. acta. 1143:243-271. farag, m.r., t.s. imam, and k. dhama. 2015. identification of some domestic animal species (camel, buffalo, and sheep) by pcrrflp analysis of the mitochondrial chytochrome b gene. adv. anim. vet. sci. 2(3):136-142. gomez, k.a. and a.a. gomez. 1984. procedure statistics for agricultural research. 2nd ed. 16 j.indonesian trop.anim.agric. 43(1):9-18, march 2018 table 4. genetic distance of tegal ducks, magelang ducks, and their crossbred population based on pcr-rflp analysis on cyt b mt-dna duck genetic distance between population tegal magelang gallang maggal tegal 0 0.169 0.186 0.186 magelang 0 0.189 0.189 gallang 0 0.206 maggal 0 figure 3. phylogeny tree of tegal ducks, magelang ducks, and their crossbred based on upgma method using mega 6 software john willey and sons, new york. he, d.q., q. zhu, s.y. chen, h.y. wang, y.p. liu and y.g. yao. 2008. a homogenous nature of native chinese duck matrilineal pool. bmc evol. biol. 8:298. heiske, m. 2012. modeling the respiratory chain and the oxidative phosphorylation. dissertation. humboldt-universitat zu berlin. hetzel, d.j.s. and b. gunawan, 1984. egg production of indonesian native ducks under intensive and extensive conditions. trop. anim. health prod. 9: 203-215. ismoyowati and d. purwantini. 2013. produksi dan kualitas telur itik lokal di daerah sentra peternakan itik. j. pembangunan pedesaan. 13(1):11-16. ismoyowati, t. yuwanta, j.p.h. sidadolog and s. keman. 2006. relationship between morphological characteristics and reproductive performance of tegal duck as the basis selection. j. indonesian trop. anim. agric. 31(3):152-156 kalita, d.j. 2015. genetic diversity: its importance and analysis in animals. int. j. res. emerging sci. technol. 2(6):68-72. linacre, a. and s.s. tobe. 2011. an overview to the investigative approach to species testing in wildlife forensic science. biomed central. 2(2):1-9. mcdonald, p., r.a. edwards, j.f.d. greenhalgh, c.a. morgan, l.a. sinclair, and r.g. wilkinston. 2010. animal nutrition. seventh edition. pearson. minarovic, t., a. trakovicka, a. rafayova, and lieskovska. 2010. animal species identification by pcr-rflp of cytochrome b. anim. sci. biotech. 43(1):296-299. mulliadi, d. dan j. arifin. 2010. pendugaan keseimbangan populasi dan heterozigositas menggunakan pola protein albumin darah pada populasi domba ekor tipis (javanese thin tailed) di daerah indramayu. j. ilmu ternak. 10(2):65-72. nei, m. 1978. estimation of average heterozygosity and genetic distance from a small number of individuals. genetics. 89:583-590. pichner, f. 1981. population genetic and animal breeding. w.h. freeman and co. san francisco. purwantini, d. and roesdiyanto. 2001. kinerja entik hasil persilangan (entog dan itik) melalui inseminasi buatan (ib) yang dipelihara secara intensif. jurnal animal production. 3(1): 31-39 purwantini, d., t. yuwanta., t. hartatik and ismoyowati. 2013a. polymorpishm of dloop mitochondrial and phylogenetic in five indonesian native duck population. int. j. poult. sci. 12(1):55-63. purwantini, d., t. yuwanta., t. hartatik, and ismoyowati. 2013b. morphology and genetic diversity of mitochondrial dna dloop region using pcr-rflp analysis in magelang duck and other native duck. j. indonesian trop. anim. agric. 38(1):1-9. rich, p.r. and a. maréchal. 2010. the mitochondrial respiratory chain. essay biochemistry. 47:1-23. su, y., c.w. liu, l. liu, c.h. ye, w.q. cao, y.q. huang, j. zheng, d.y. cail, and o. olowofeso. 2006. studies on genetic variation of different chinese duck populations with random amplified polymorphic dna analysis. asian-aust. j. anim. sci. 19(4):475-481 sudewo, a.t.a. 2005. analisis pola protein globulin darah untuk menduga jarak genetik antar populasi itik tegal, magelang, dan mojosari. animal production. 7(3):177-184. sultana, h., d.w. seo, m.s.a. bhuiyan, n.r. choi, m.r. hoque, k.n. heo, and j.h. lee. 2016. genetic diversity and phylogenetic analysis of south-east asian duck population based on the mtdna d-loop sequences. j. anim. sci. 29(12): 1688-1695. suryo. 2005. genetika. cetakan ke-1. gadjah mada university press. yogyakarta. szwaczkowski t., m. grzech, a. borowska, e. wencek, and a. wolck. 2010. maternal genetic effects on body weight and breast morphological traits in duck population under selection. archiv tierzucht. 53(3): 600-608. tamura, k., g. stecher, d. peterson, a. filipski, and s. kumar. 2013. mega6: molecular evolutionary genetics analysis version 6.0. mol. bio. evol. 30:2725-2729. teguia, a., h.m. ngandjou, h. defang, and j. tchoumboue. 2008. study of the live body weight and body characteristics of the african muscovy duck (cairina moschata). trop. anim. health prod. 40:5-10. warwick, e.j., j.m. astuti and w. hardjosubroto. 1995. pemuliaan ternak. edisi 5. gadjah mada university press. yogyakarta. wu, y., x. liu, s. hou, and w. huang. 2008. morphometrics and genetic diversity of indonesia local ducks (henrik et al.) 17 study on genetic diversity of six duck populations with microsatellite dna. asianaust. j. anim. sci. 21(6):776-783. yakubu and s.b. ugbo. 2011. an assessment of biodiversity in morphological traits of muscovy ducks in nigeria using discriminant analysis. int. conf. biol. envi. chem. ipcbee. 1:389-391. 18 j.indonesian trop.anim.agric. 43(1):9-18, march 2018 materials and methods j i t a a journal of the indonesian tropical animal agriculture accredited by ditjen penguatan risbang no. 60/e/kpt/2016 j. indonesian trop. anim. agric. pissn 2087-8273 eissn 2460-6278 http://ejournal.undip.ac.id/index.php/jitaa 42(3):175-184, september 2017 doi: 10.14710/jitaa.42.3.175-184 genetic polymorphism analysis of 5' untranslated region of thyroglobulin gene in bali cattle (bos javanicus) from three different regions of indonesia s. anwar1, a.c. putra2, a.s. wulandari1, p. p. agung1, w.p.b. putra1 and s. said1 1research center for biotechnology-indonesian institute of sciences (lipi), jl. raya bogor km. 46, cibinong 16911, west java indonesia 2department of biological science, faculty of mathematics and natural science, padjajaran university, jl. raya bandung-sumedang km. 21 jatinangor sumedang 45363, west java indonesia corresponding e-mail:saif005@lipi.go.id received april 06, 2017; accepted june 05, 2017 abstrak variasi nukleotida g.422c>t pada gen thyroglobulin dibagian 5’untranslated region (5’utr) (disebut tg5) telah dilaporkan mempunyai asosiasi dengan tingkat kandungan lemak intramuskuler atau marbling pada sapi potong. penelitian ini ditujukan untuk mengkonfirmasi keragaman genetik gen tg5 pada sapi bali dari tiga wilayah sumber bibit yang berbeda di indonesia. sebanyak 200 ekor sapi bali telah dilakukan genotyping pada gen tg5 menggunakan metode polymerase chain reaction-restriction fragment lenght polymorphism (pcr-rflp) dan analisis sekuen. hasil penelitian menunjukkan bahwa tg5 terkonfirmasi monomorfik pada sapi bali dimanapun wilayah asalnya. selain itu, sebanyak sembilan kandidat snp ditemukan di dalam gen tg bagian 5’utr pada sapi bali dibandingkan dengan sekuens genbank, meskipun tidak ditemukan variasi snp di dalam sampel sapi bali yang diteliti. marker genetik lain dari gen tg perlu dieksplorasi dan diverifikasi keragamannya pada sapi bali. sembilan kandidat snp juga perlu diverifikasi dan divalidasi lebih lanjut dengan sampel yang lebih besar untuk dapat dikatakan sebagai snp baru antara sapi bali dengan referensi sekuen dari genbank. kata kunci : gen thyroglobulin, marbling, polimorfisme genetik, sapi bali, 5’-untranslated region abstract the g.422c>t nucleotide variations in the 5’ untranslated region (5’utr) of tg gene (called as tg5) has been reported to be associated with level in intramuscular fat (imf) content or marbling in beef cattle. the objective of this study was to confirm genetic polymorphism of tg5 gene in bali cattle populations from three different regions as the main resources of bali cattle in indonesia. a total of 200 head of bali cattle have been performed genotyping on tg5 gene using polymerase chain reactionrestriction fragment lenght polymorphism (pcr-rflp) method and sequence analysis. results of the study confirmed that tg5 was monomorphic in bali cattle wherever their origin regions. moreover, nine candidate snps were detected within 5’utr of tg gene in bali cattle compared to genbank reference sequences, although no snp variations among bali cattle sample studied. the new other genetic markers within an entire tg gene suggested to be explored and verified for their polymorphisms in bali cattle. 5’utr of thyroglobulin gene polymorphism in bali cattle (s. anwar et al.) 175 the nine candidate snps were also required further verification and validation in a larger sample to be regarded as new snps between bali cattle and genbank reference sequences. keywords : bali cattle, genetic polymorphism, marbling, thyroglobulin gene, 5’-untranslated region introduction beef palatability has becoming a major concern of consumers satisfaction in consuming beef. intramuscular fat (imf) or also called as marbling has been studied contributed to the beef palatability or eating quality of beef through its attributes such as flavour, juiciness and tenderness (okumura et al., 2007; hudson et al., 2015), even though several studies showed that the association between marbling score and beef palatability attributes was a positively small (wheeler et al., 1994; platter et al., 2003). however, marbling score has been used as one of major determinants for beef palatability in international markets especially in japan, australia and usa (watson et al., 2008; gotoh et al., 2014). molecular markers could be used to identify the quantitative trait loci (qtls) that affect desired quantitavive traits (dekkers, 2004; van eenennaam et al., 2007). several studies have identified qtls associated with fatness traits in cattle located on bovine chromosome 14 (bta14) including thyroglobulin gene (tg) (moore et al., 2003; casas et al., 2005). thyroglobulin gene encodes thyroglobulin, a glycoprotein hormone that is sinthesized by thyroid follicular cells and stored in thyroid gland. the tg acts as precursor for the thyroid hormone, the triiodothyronine (t3) and thyroxine (t4) hormones. thyroid hormones are known to play an important role in influencing the lipid metabolism, adipocyte growth and differentiation (ailhaud et al., 1992; casas et al., 2005; pannier et al., 2010). the nucleotide substitution cytosine (c) to thymine (t) at the position of 422 in the 5’untranslated region (5’utr) of tg gene (tg5) has been reported to be associated with level in imf content or marbling score in beef cattle (barendse, 1999). therefore, this finding has been proposed as candidate gene for improving marbling level and eating quality in beef cattle. recently, tg5 has been used as genetic marker to improve the marbling level and other fatness traits of beef in bos taurus and bos indicus cattle (casas et al., 2005; van eenennaam et al., 2007; gan et al., 2008; bonilla et al,. 2010; anton et al., 2011). in previous study, anwar et al. (2016) have identified that tg5 genetic marker tend to be monomorphic in 100 samples of bali cattle at maiwa breeding center (mbc), enrekang district, south sulawesi province using pcrrflp method. for further confirmation of this result, more sample size from three different purebreeding regions of bali cattle have been examined to investigate the possibility of changes in the distribution of alleles and genotypes in the sample studied by using pcr-rflp method and sequence analysis. therefore, the objective of this study was to confirm genetic variation of tg5 and to explore new candidate snps within 5’utr of tg gene in bali cattle (bos javanicus) compared to genbank reference sequences. materials and methods animals and blood collection a total of 200 head of bali cattle were used in this study. the animals were originated from three different regions as the main resources of bali cattle in indonesia, including : 1) south sulawesi province (ss) represented samples from barru district (76 heads), 2) bali province (bali) represented samples from island of nusa penida (52 heads) and west nusa tenggara (ntb) repesented from banyumulek sub-district (72 heads). all animals were unkown pedigree data. blood sample of each animal was collected into vaccutainer tube containing k2edta as anticoagulant. the blood samples were kept at 45°c for further use. dna isolation and pcr amplification genomic dna isolation was performed using genomic dna mini kit (geneaid biotech ltd., taiwan) according to the the manufacturer’s instructions. dna products were stored at -20°c for further use. a 545 base pairs (bp) of 5’utr of tg gene was amplified using a pairs of primer designed by barendse (1999) based on the genbank reference sequence (accession no: x05380.1). the pcr reaction and program were performed according to anwar et al.(2016). 176 j.indonesian trop.anim.agric. 42(3):175-184, september 2017 pcr-rflp genotyping allele and genotype variations of tg5 gene were detected using pcr-rflp method. the bstyi restriction enzyme (new england biolabs, usa) with the restriction site at 5’ r↓gatcy 3’ were used to detect g.422c>t polymorphic site in 5’utr of tg gene. the digestion mixture and procedure were performed according to anwar et al. (2016). gene sequencing and sequence analysis in this study, dna fragments of all samples have been found only one electrophoretic band pattern (cc genotype), while ct and tt genotype were not observed. however, in sequence analysis, we used seven samples consisting a total of six samples represent of cc genotype (four from ss, one from bali and one from ntb regions). the three of four samples from ss were taken from our previous study (enrekang district) while one of four samples was taken from barru district. the one heterozygous ct animal found in enrekang district was used as control to detect g.422c>t mutation. the two genbank accession numbers (x05380.1 and ay615525) of tg gene of bos taurus species were used to compare the different snp (g.422c>t). the accession number of ay615525 was an updated sequence data from x05380.1 which contained two newly snps found in korean cattle populations (g.257c>t and g.335a>g) and has been submitted to genbank by shin and chung (2007). dna fragments of each sample were sequenced for both directions using pcr primers forward and reverse performed by commercial laboratory service at first base laboratories sdn. bhd. (selangor, malaysia) using abi prism 96-capillary 3730xl dna analyzer (applied biosystems, usa). sequence analysis begins with a contig analysis which combines both the sequencing results (forward and reverse) to obtain a complete single sequence of each sample. the nucleotide sequence obtained were then aligned with the genbank reference sequences (accession number : x05380.1 and ay615525) and analyzed by using bioedit sequence alignment editor (hall, 1999) and clustalw alignment method in molecular evolutionary genetic analysis (mega6) software (tamura et al., 2013). results and discussion pcr product and genotype variants the tg5 is code used for genetic marker found in the 5’utr of tg gene which has nucleotide substitution (c>t) at the position of 422. in this study, a 545 bp targeted dna sequence of 5’utr of tg gene was succesfully amplified using a pairs of primer designed by barendse (1999) as shown by the result of a single clear band (figure 1). detection of genotype variants of tg5 was performed using pcr-rflp method and then confirmed using sequence analysis. the genotype found in this study only cc genotype whereas ct and tt genotypes were not detected in 200 sample studied. therefore, in order to know the position of g.422c>t mutation, one dna sample represent ct genotype in previous study was used 5’utr of thyroglobulin gene polymorphism in bali cattle (s. anwar et al.) 177 figure 1. electrophoretic pcr product visualization of tg5 gene (545 bp) in a 1.2% agarose gel (w/v). lane m: marker with 100 pb dna ladder; lane 1,2,3,4,5: number of sample. to be sequenced (anwar et al., 2016) as a control in sequence analysis. the genotype variants (cc and ct) corresponding to g.422c>t mutation of tg5 were succesfully confirmed through dna sequencing. on the c allele, the base c at the position of 422 were not changed so that the bstyi restriction enzyme recognize the restriction site and cuts the dna into three fragments (72, 295 dan 178 pb). while on the t allele, bstyi could not recognize the restriction site at the position of 422 because the base c was replaced by base t and generates only two fragments (72 dan 473 pb). the position of tg5 gene within genbank reference sequence (accession no : x05380.1), its restriction map and chromatogram visual representation of snp (g.422c>t) are shown in figure 2. genetic polymorphism analysis genetic polymorphism could be measured at various levels, e.g. allelic and genotypic variation at certain locus or loci within a populations. in previous study, anwar et al. (2016), showed that the frequency of c allele and cc genotype of tg5 gene from 100 samples derived from maiwa breeding center (mbc), enrekang district, south sulawesi (ss) were 0.995 and 0.990, respectively, and suggested to be monomorphic. in this study, the different sample locations have been used. a total of 200 head of bali cattle were taken from three different regions that designated by indonesian government as purebreeding locations for bali cattle including south sulawesi (ss), bali and west nusa tenggara (ntb) province to confirms the polymorphism of tg5 gene. the allelic and genotypic frequencies for the tg5 gene studied in bali cattle from three regions are shown in table 1. the c allele and cc genotype were found to be fixed in all three region samples (1.000 and 1.000, respectively), whereas the t allele did not observed. as the consequent of the absence of t allele in total samples, ct and tt genotypes were not observed in this study (0.000 and 0.000, respectively). the results in this study indicate that c allele and cc genotype of tg5 gene were found to be fixed in bali cattle (bos javanicus) wherever their origin region. according to nei (1987), frankham et al. (2004) and allendorf and luikart (2007), when a locus in a population found only one allele or if the most common allele is known to be a high frequency (more than 95% or 99%), the locus was considered as monomorphic. this finding confirms on anwar et al. (2016) study, that the tg5 gene was monomorphic in bali cattle in which the most common allele (c allele) was 0.995 or 99.5%. the tg5 marker was located in the 5’ leader sequence or 5’ utr of the tg gene. barendse et al. (2004) stated that tg5 was chosen for marker 178 j.indonesian trop.anim.agric. 42(3):175-184, september 2017 figure 2. schematic representation of the position of tg5 gene, restriction map and chromatogram visual representation of snp within genbank reference sequence (accession no : x05380.1). the arrows indicate a pairs of primer position (forward and reverse) to initiated a process of amplification. the restriction site of bstyi (5' r↓gatcy 3’) are indicated with an asterisk. in the t allele, nucleotide subtitution (c>t) at the position of 422 causing bstyi restriction enzyme do not recognize the restriction site at this position. genetic test, due to the known low level of polymorphism in the tg coding sequence and more importantly to the features present in that dna sequence. furthermore, tg5 is in the leader sequence of the gene affects for the rna polymerase iii binding site which important to initiate transcription in regulation of gene expression, although its functional effect to circulating level of thyroid hormones (t3 and t4) were not undertaken yet. the t allele in tg5 marker has been proposed by barendse et al. (2004), casas et al. (2005), bonilla et al. (2010) and anton et al. (2011), as the favourable allele because the homozygous tt cattle tend to be higher in imf fat deposition or marbling score than heterozygous ct and homozygous cc cattle. this tg5 marker was then launched as a dna marker test for commercial use and has been performed a validation studies although genetic association analysis with marbling traits still varied results in some cattle breeds (casas et al., 2005; rincker et al., 2006; shin dan chung, 2007; van eenennaam et al., 2007; johnston and graser, 2010 and pannier et al., 2010). the allelic and genotypic frequencies of tg5 gene has been reported in several studies in bos taurus, bos indicus and its crossbreeds cattle as presented in table 2. it showed that c allele of tg5 was the most common allele found in all cattle breeds. however, c allele was more frequent found in bos indicus breeds such as brahman cattle (casas et al., 2005) and nelore cattle (fortes et al., 2009) and tend to be fixed as well as in bos javanicus than in bos taurus breeds. conversely, the t allele was mostly frequent in bos taurus breeds (0.229) compared to bos indicus (0.020) and bos javanicus (0.002), although the frequency of t allele in bos taurus was varied (0.016-0.487). wagyu cattle breeds were regarded as bos taurus type that carrying t allele, and the consequently on its inheritances (casas et al., 2007; van eenennaam et al., 2007). this occurance may caused by strong selection in wagyu breed for marbling traits as well as on alleles of other candidate genes associated with high marbling (watanabe et al., 2011). in this study, the c alel was fixed in bali cattle populations represented from three selected regions (ss, bali and ntb). these regions were established by indonesian government for bali cattle purebreeding since 1976 as well as in east nusa tenggara (ntt) (handiwirawan and subandriyo, 2004). then, in 2013, barru district, south sulawesi province, designated as a new location for bali cattle purebreeding through ministerial decree no. 4437/kpts/sr.120/7/2013 (ministry of agriculture of the republic of indonesia, 2013). this results also indicate that if c allele was fixed in bali cattle, additional samples of bali cattle should not be increasing the frequency of t allele with the exception in case of mutation or when it crossed with other breeds confirmed the t allele carriers. morever, crosbreeding may still be difficult to increase the frequency of t allele because the action of tg5 suggested as recessive mode of inheritance (casas et al., 2007). this is the possible reason for previous study by anwar et al. (2016), that has found only one heterozygous cattle (ct genotype) in enrekang district, which is not included as location of purebreeding of bali cattle. however, it needs to be further in-depth investigation. frankham et al. (2004), stated that the other possible factors that allow allele or genotype to be fixed were inbreeding, genetic drift, small, isolated and sustained reduction population size. in the sequence analysis between six 5’utr of thyroglobulin gene polymorphism in bali cattle (s. anwar et al.) 179 table 1. allelic and genotypic frequencies of tg5 gene in bali cattle ( bos javanicus) from three different regions marker region total(n) genotypic frequencies allelic frequencies cc (n) ct (n) tt (n) c t tg5 ss 76 1.000 (76) 0.000 (0) 0.000 (0) 1.000 0.000 bali 52 1.000 (52) 0.000 (0) 0.000 (0) 1.000 0.000 ntb 72 1.000 (72) 0.000 (0) 0.000 (0) 1.000 0.000 total 200 1.000 (200) 0.000 (0) 0.000 (0) 1.000 0.000 ss = south sulawesi province, bali = bali province, ntb = west nusa tenggara province 180 j.indonesian trop.anim.agric. 42(3):175-184, september 2017 table 2. allelic and genotypic frequencies of tg5 gene in numerous cattle breeds species breeds n genotypic frequencies allelic frequencies references cc (n) ct (n) tt (n) c t bos taurus limousin 123 0.667 (82) 0.317 (39) 0.016 (2) 0.825 0.175 1 charolais 80 0.563 (45) 0.350 (28) 0.088 (7) 0.738 0.263 1 simmental 58 0.397 (23) 0.552 (32) 0.052 (3) 0.672 0.328 1 simmental 438 0.534 (234) 0.390 (171) 0.075 (33) 0.729 0.271 2 angus 819 0.643 (527) 0.32 (265) 0.033 (27) 0.805 0.195 3 angus 39 0.205 (8) 0.615 (24) 0.179 (7) 0.513 0.487 1 angus 173 0.457 (79) 0.410 (71) 0.133 (23) 0.662 0.338 2 hereford 32 0.969 (31) 0.031 (1) 0.000 (0) 0.984 0.016 1 belgian blue 19 0.737 (14) 0.158 (3) 0.105 (2) 0.816 0.184 1 friesian holstein 76 0.737 (56) 0.263 (20) 0.000 (0) 0.868 0.132 1 blonde d'aquitaine 13 0.615 (8) 0.308 (4) 0.077 (1) 0.769 0.231 1 friesian holstein 415 0.745 (309) 0.241 (100) 0.014 (6) 0.865 0.135 2 friesian holstein 1279 0.580 (742) 0.390 (499) 0.030 (38) 0.775 0.225 4 jersey 283 0.601 (170) 0.350 (99) 0.049 (14) 0.776 0.224 2 korean 309 0.411 (127) 0.460 (142) 0.129 (40) 0.641 0.359 5 total 4156 0.59 (2455) 0.360(1498) 0.049(203) 0.771 0.229 bos indicus brahman 467 0.946 (442) 0.039 (18) 0.015 (7) 0.966 0.034 6 brahman 383 0.992 (380) 0.008 (3) 0.000 (0) 0.996 0.004 7 nellore 46 1.000 (46) 0.000 (0) 0.000 (0) 1.000 0.000 8 total 896 0.969 (868) 0.023 (21) 0.008 (7) 0.980 0.020 bos javanicus bali 100 0.990 (99) 0.010 (1) 0.000 (0) 0.995 0.005 9 bali 200 1.000 (200) 0.000 (0) 0.000 (0) 1.000 0.000 * total 300 0.997 (299) 0.003 (1) 0.000 (0) 0.998 0.002 crossbreed british-gpe6 211 0.564 (119) 0.341 (72) 0.095 (20) 0.735 0.265 10 norwegian-gpe6 72 0.653 (47) 0.306 (22) 0.042 (3) 0.806 0.194 10 swedish-gpe6 68 0.574 (39) 0.324 (22) 0.103 (7) 0.735 0.265 10 friesiangpe6 149 0.631 (94) 0.349 (52) 0.020 (3) 0.805 0.195 10 wagyu-gpe6 153 0.484 (74) 0.405 (62) 0.111 (17) 0.686 0.314 10 angus cross 40 0.650 (26) 0.275 (11) 0.075 (3) 0.788 0.213 11 rgxn 26 0.962 (25) 0.038 (1) 0.000 (0) 0.981 0.019 8 canchim 41 0.610 (25) 0.341 (14) 0.049 (2) 0.780 0.220 8 b3x 19 0.684 (13) 0.316 (6) 0.000 (0) 0.842 0.158 8 bv3x 15 0.467 (7) 0.400 (6) 0.133 (2) 0.667 0.333 8 total 794 0.591 (469) 0.338 (268) 0.072 (57) 0.759 0.241 n: number of sample; 1: pannier et al. (2010); 2: anton et al. (2012); 3: barendse et al. (2004); 4: khatib et al. (2007); 5: shin and chung (2007); 6: casas et al. (2005); 7: smith et al. (2009); 8: fortes et al. (2009); 9: anwar et al. (2016); 10: casas et al. (2007); 11: anton et al. (2013); *: this study. gpe6 = crossbred genetic group by maternal grandsire. rgxn = rubia gallega x nelore,canchim =(5/8 bos taurus + 3/8 bos indicus), b3x = (9/16 bos taurus + 7/16 bos indicus), bv3x =(3/4 bos taurus + 1/4 bos indicus). consensus sequence samples in this study compared to genbank reference sequences (x05380.1 and ay615525), obtained only 523 bp of 545 bp targeted sequence which is located on the base pair of 63 to 585 (figure 3). individual sample represent ct genotype that found by anwar et al. (2016) was not regarded as polymorphic, thus it could not be included in the sequence analysis. in alignment analysis, besides g.422c>t mutation, the total of nine new candidate snps were also identified in bali cattle compared to genbank reference sequences (x05380.1 and ay615525). the two snps were known as transversion nucleotide substitutions, while seven snps were known as transitions nucleotide substitutions. this findings supports the statement of nei and kumar (2000), in which transitionals were more frequent than transversions nucleotide substitutions in most dna segments. however, nine new candidate snps found in this study could not regarded as novel snps because the sequence analysis conducted only in small studied samples. the candidate snps, its locations and the type of nucleotide subtitutions are shown in table 3. in this study, the six of nine candidate snps compared to both the x05380.1 and ay615525 were located in the base position of 240, 274, 387, 416, 537 and 552, respectively. the two of nine candidate snps compared only with x05380.1 were in the base position of 257 and 335, while one candidate snp compared only with ay615525 was in the base position of 404 (table 3). however, there are no snp variations in all those nine candidate snps among six samples studied and were not considered as polymorphic site within bali cattle or bos javanicus populations. as the results in this study, the other new genetic markers may be explored as well as fortes et al. (2009) suggestion from their study in nelore cattle. gan et al. (2008) and zang et al. (2015) have reported any snps within tg gene in beef cattle. gan et al. (2008), have found six snps in the 3’-flanking region and one of six snps significantly associated with marbling score in bos taurus breeds. zang et al. (2015), have identified four snps in the 5'-flanking region of the tg gene and two of four snps significanlty associated with some carcass and meat quality traits in chinese steers. for further studies, those snps entire tg gene can be verified for their polymorphisms in bali cattle. furthermore, to ensure the nine nucleotide variations that found in this study to be regarded as snps between bali cattle and genbank reference sequences, those required further verification and validation in a larger sample. 5’utr of thyroglobulin gene polymorphism in bali cattle (s. anwar et al.) 181 figure 3. schematic representation of the position of nine candidate snps within (a) a 523 bp of consensus sequence of 5’utr of tg gene in bali cattle compared to b) ay615525 and c) x05380.1 of genbank reference sequences. the g.422c>t indicated with an asterisk. conclusion it can be concluded that tg5 was confirmed to be monomorphic in bali cattle (bos javanicus). nine candidate snps has been found within 5’utr of tg gene in bali cattle compared to genbank reference sequences, although there were no snp variations within bali cattle studied. the new other genetic markers within tg gene may be explored and verified for their polymorphisms on bali cattle. the nine candidate snps were also required further verification and validation in a larger sample to be regarded as snps between bali cattle and genbank reference sequences. acknowledgments this research was supported by enrekang technopark program, funded by center for plant conservation-botanic gardens, indonesian institute of sciences (lipi). part of the samples were from banyumulek technopark program. the authors are grateful to edy sophian, ilham syarif, citra and lusiana for their blood sampling assistance. the authors appreciate hasanuddin university, livestock and fisheries office of enrekang district, and livestock office of barru district, south sulawesi province, and the farmers for the cooperation and providing the samples of animal. references ailhaud, g., p. grimaldi and r. negrel. 1992. cellular and molecular aspects of adipose tissue development. annu. rev. nutr. 12:207-233 allendorf, f.w. and g.h. luikart. 2007. conservation and the genetics of populations. blackwell publishing, uk. anton, i., k. kovács, g. holló, v. farkas, l. lehel, z. hajda, and a. zsolnai. 2011. effect of leptin, dgat1 and tg gene polymorphisms on the intramuscular fat of angus cattle in hungary. livest. sci. 135:300-303. anton, i., k.kovács, g. holló, v. farkas, f. szabó, i. egerszegi, j. rátky, a. zsolnai and k.p. brüssow. 2012. effect of dgat1, leptin and tg gene polymorphisms on some milk production traits in different dairy cattle breeds in hungary. archiv. tierzucht. 55(4):307-314. anton, i., a. zsolnai, i. holló, i. repa and g. holló. 2013. effect of thyroglobulin gene polymorphism on the intramuscular fat content in cattle examined by x-ray computed tomography and soxhlet methods. archiv. tierzucht. 56 (59):593182 j.indonesian trop.anim.agric. 42(3):175-184, september 2017 table 3. candidate snps, locations and the type of nucleotide subtitutions in 5’utr of tg gene in bali cattle compared to genbank reference sequences samples candidate snps and base locations 240 257 274 335 387 404 416 537 552 x05380.11 g c c a g t g c t ay61551 g t c g g c g c t ss12 t t a g a t a t c ss22 t t a g a t a t c ss32 t t a g a t a t c ss42 t t a g a t a t c bali3 t t a g a t a t c ntb4 t t a g a t a t c type of subtitutions5 tv ts tv ts ts ts ts ts ts 1genbank reference sequences; 2,3,4dna samples from south sulawesi, bali and west nusa tenggara region, respectively; 5type of nucleotide substitutions, tv = transversion, ts = transition. 596. anwar, s., a.c. putra, a.s. wulandari and s. said. 2016. the 5’ untranslated region of thyroglobulin gene (tg5) polymorphism in bali cattle (bos javanicus) [in indonesian with english summary]. seminar nasional masyarakat biodiversitas indonesia, bogor, jawa barat, indonesia, 17 september 2016. 2(2):159-164. barendse, w.j. 1999. assessing lipid metabolism. international patent application wo9923248 us6383751 (pct/au98/00882) barendse, w., r. bunch, m. thomas, s. armitage, s. baud and n. donaldson. 2004. the tg5 thyroglobulin gene test for a marbling quantitative trait loci evaluated in feedlot cattle. aust. j. exp. agric. 44:669674. bonilla, c.a., m.s. rubio, a.m. sifuentes, g.m. parra-bracamonte, v.w. arellano, m.r.d. méndez, j.m. berruecos and r. ortiz. 2010. association of capn1 316, capn1 4751 and tg5 markers with bovine meat quality traits in mexico. genet. mol. res. 9:23952405. casas, e., s.n. white, d.g. riley, t.p.l smith, r.a. brenneman, t.a. olson, d.d. johnson, s.w. coleman, g.l. bennett and c.c. chase, jr. 2005. assessment of single nucleotide polymorphisms in genes residing on chromosomes 14 and 29 for association with carcass composition traits in bos indicus cattle. j. anim. sci. 83:13-19. casas, e., s.n. white, s.d. shackelford, t.l. wheeler, m. koohmaraie, g.l. bennett and t.p.l. smith. 2007. assessing the association of single nucleotide polymorphisms at the thyroglobulin gene with carcass traits in beef cattle. j. anim. sci. 85:2807-2814. dekkers, j.c.m. 2004. commercial application of marker and gene-assisted selection in livestock: strategies and lessons. j. anim. sci. 82:e313-e318. fortes, m.r.s., r.a. curi, l.a.l. chardulo, a.c. silveira, assumpção meod, j.a. visintin and h.n. de oliveira. 2009. bovine gene polymorphisms related to fat deposition and meat tenderness. genet. mol. biol. 32(1):75-82. frankham r., j.d. ballou and d.a. briscoe. 2004. a primer of conservation genetics. cambridge university press, new york gan, q.f., l.p. zhang, j.y. li, g.y. hou, h.d. li, x. gao, h.y. ren, j.b. chen and s.z. xu. 2008. association analysis of thyroglobulin gene variants with carcass and meat quality traits in beef cattle. j. appl. genet. 49(3):251-255. gotoh, t., h. takahashi, t. nishimura, k. kuchida and h. mannen. 2014. meat produced by japanese black cattle and wagyu. anim. frontiers. 4(4): 46-54. hall, t.a. 1999. bioedit: a user-friendly biological sequence alignment editor and analysis program for windows 95/98/nt. nucl. acids. symp. ser. 41:95-98 handiwirawan, e. and subandriyo. 2004. potency and genetic diversity of bali cattle [in indonesian with english summary]. wartazoa. 14(3):107-115 hudson, n.j., a. reverter, p.l. greenwood, b. guo, l.m. cafe and b.p. dalrymple. 2015. longitudinal muscle gene expression patterns associated with differential intramuscular fat in cattle. animal. 9(4):650-659. johnston, d.j. and h.u. graser. 2010. estimated gene frequencies of genestar markers and their size of effects on meat tenderness, marbling, and feed efficiency in temperate and tropical beef cattle breeds across a range of production systems. j. anim. sci. 88:1917-1935. khatib, h., i. zaitoun, y.m. chang, c. maltecca and p. boettche. 2007. evaluation of association between polymorphism within the thyroglobulin gene and milk production traits in dairy cattle. j. anim. breed. genet. 124:26-28. ministry of agriculture of the republic of indonesia. 2013. ministerial decree no. 4437/kpts/sr.120/7/2013 about establishment of barru district as bali cattle resources region [in indonesian] moore, s.s., c. li, j. basarab, w.m. snelling, j. kneeland, b. murdoch, c. hansen and b. benkel. 2003. fine mapping of quantitative trait loci and assessment of positional candidate genes. j. anim. sci. 81:19191925. nei, m. 1987. molecular evolutionary genetics. columbia university press, new york. nei, m. and s. kumar. 2000. molecular evolution and phylogenetics. oxford university press, new york. okumura, t., k. saito, t. nade, s. misumi, y. 5’utr of thyroglobulin gene polymorphism in bali cattle (s. anwar et al.) 183 masuda, h. sakuma, s. nakayama, k. fujita and t. kawamura. 2007. effects of intramuscular fat on the sensory characteristics of m. longissimus dorsi in japanese black steers as judged by a trained analytical panel. asian-aust. j. anim. sci. 20(4):577-581. pannier, l., a.m. mullen, r.m. hamill, p.c. stapleton, t. sweeney. 2010. association analysis of single nucleotide polymorphisms in dgat1, tg and fabp4 genes and intramuscular fat in crossbred bos taurus cattle. meat sci. 85:515-518. platter, w.j., j.d. tatum, k.e. belk, p.l. chapman, j.a. scanga and g.c. smith. 2003. relationships of consumer sensory ratings, marbling score, and shear force value to consumer acceptance of beef strip loin steaks. j. anim. sci. 81:2741-2750 rincker, c.b., n.a. pyatt, l.l. berger and d.b. faulkner. 2006. relationship among genestar marbling marker, intramuscular fat deposition, and expected progeny differences in early weaned simmental steers. j. anim. sci. 84:686-693. shin, s.c. and e.r. chung. 2007. association of snp marker in the thyroglobulin gene with carcass and meat quality traits in korean cattle. asian-aust. j. anim. sci. 20(2):172177 smith, t., m.g. thomas, t.d. bidner, j.c. pascha and d.e. franke. 2009. single nucleotide polymorphisms in brahman steers and their association with carcass and tenderness traits. genet. mol. res. 8(1):39-46. tamura, k., g. stecher, d. peterson, a. filipski and s. kumar. 2013. mega6: molecular evolutionary genetics analysis version 6.0. mol. biol. evol. 30:2725-2729. van eenennaam, a.l., j. li, r.m. thallman, r.l. quaas, m.e. dikeman, c.a. gill, d.e. franke and m.g. thomas. 2007. validation of commercial dna tests for quantitative beef quality traits. j. anim. sci. 85:891-900 watanabe, n., y. satoh, t. fujita, t. ohta, h. kose, y. muramatsu, t. yamamoto, and t. yamada. 2011. distribution of allele frequencies at ttn g.231054c > t, rpl27a g.3109537c > t and akirin2 c.*188g > a between japanese black and four other cattle breeds with differing historical selection for marbling. bmc res. notes. 4:10. watson, r., r. polkinghorne and j.m. thompson. 2008. development of the meat standards australia (msa) prediction model for beef palatability. aust. j. exp. agric. 48:13681379. wheeler, t.l., l.v. cundiff and r.m. koch. 1994. effect of marbling degree on beef palatability in bos taurus and bos indicus cattle. j. anim. sci. 72:3145-3151. 184 j.indonesian trop.anim.agric. 42(3):175-184, september 2017 dietary supplementation of s. platensis and s. cerevisiae in laying hens (h.i. wahyuni et al.) 47 j i t a a journal of the indonesian tropical animal agriculture accredited by ditjen riset, teknologi dan pengabdian kepada masyarakat no. 164/e/kpt/2021 j. indonesian trop. anim. agric. pissn 2087-8273 eissn 2460-6278 http://ejournal.undip.ac.id/index.php/jitaa 48(1):47-57, march 2023 doi: 10.14710/jitaa.48.1. 47-57 dietary supplementation of spirulina platensis and saccharomyces cerevisiae on egg quality, physiological condition and ammonia emission of hens at the late laying period h. i. wahyuni*, t. yudiarti, e. widiastuti, t. a. sartono, i. agusetyaningsih, s. sugiharto department of animal science, faculty of animal and agricultural sciences, universitas diponegoro, semarang, 50275, indonesia *corresponding e-mail: hihannyiw123@gmail.com received november 11, 2022; accepted february 27, 2023 abstract the study was aimed to evaluate the effect of spirulina platensis and saccharomyces cerevisiae or its combination on egg quality, physiological condition and ammonia excretion of hens at the late laying period. at 81 weeks old, 144 lohmann brown layer chickens were divided into four treatment groups included con (hens fed basal feed), sp (basal feed + 0.3% s. platensis), sc (basal feed + 0.2% s. cerevisiae), and spsc (basal feed + 0.3% s. platensis + 0.2% s. cerevisiae). at the end of the study, eggs, intestinal mucosa, digesta, excreta and blood sample were collected. results showed that albumin index was higher (p<0.05) in spsc group than in con, sp and sc. the yolk index and yolk colour were greater (p<0.05) in sp and spsc groups than in con and sc. the erythrocyte values were higher (p<0.05) in sp group compared to con, sc and spsc groups. the ileum ph was higher (p<0.05) in sp than in con, sc and spsc. lactic acid bacteria counts were lower (p<0.05) in the caecum of sc and spsc than in con and sp groups. the lower (p<0.05) counts of lactose-negative enterobacteriaceae were shown in sc and spsc than in con. the excreta ph was lower (p<0.05) in sc group compared to con, sp and spsc groups. there were better (p<0.05) protein digestibility coefficient and nitrogen retention in spsc group than others. faecal ammonia decreased (p<0.05) in sp, sc and spsc groups. in conclusion, s. platensis improved egg yolk index and colour, increased erythrocyte counts and played an important role in maintaining the balance of bacteria in the intestine resulting in reduced ammonia excretion. dietary inclusion of s. cerevisiae reduced ammonia excretion of laying hens during the late laying period. keywords: laying hens, microalgae, probiotic, yeast introduction laying hens are one of the livestock commodities that primarily produce eggs. the rearing period of laying hens is typically divided into several phases, included starter, grower, laying and finisher phase. laying hens start producing eggs in the pullet phase and decrease after reaching the peak of production. molnar (2017) stated, laying hens are kept in production until they are 48 j. indonesian trop. anim. agric. 48(1):47-57, march 2023 75-80 weeks old. yet, farmers generally extend the egg production period till the age of 100 weeks, which is not only contributed to higher profitability but also more sustainable food production (pottgüter, 2016). there were, however, a number of challenges, such as decreasing egg production and quality as well as the physiology of the hens in the later stages of commercial laying hens. it takes a diverse strategy to solve these problems. antibiotic growth promoters (agp) were commonly used to maintain the productivity and health of laying hens during the late stage of egg production, but their use is now prohibited in the vast majority of countries worldwide included indonesia (wongsuvan et al., 2018; afandi et al., 2020). spirulina platensis has attracted the attention of poultry nutritionists because of its high protein content and other active ingredients (mullenix et al., 2021). the microalgae s. platensis contains 53.31 g/100 g crude protein, 9.25 g/100 g lipids, 23.38 g/100 g carbohydrate, 7.44 mg/g chlorophyll a, 6.41 mg/g chlorophyll b, and 1.69 mg/g carotenoid (rahim et al., 2021). s. platensis also contains antioxidant, immunomodulatory, anti-inflammatory, antiviral, and antimicrobial properties (langers et al., 2012; abdel-daim et al., 2013; shokri et al., 2014). in laying hens, dietary supplementation of s. platensis resulted in a significant improvement in egg physical characteristics (omri et al., 2018; zahroojian et al., 2013; selim et al., 2018). moreover, mariey et al. (2012) showed that dietary inclusion of s. platensis (at 0.1, 0.15, and 0.2% of diets) increased egg weight, egg mass, and laying rate. in other commodities, the inclusion of 1% s. platensis into pig and broiler feeds was capable of improving the blood parameters, nutrient digestibility and performance, antioxidant activity, while reducing ammonia emission (sugiharto et al, 2018; park et al., 2018; evans et al., 2015; furbeyre et al., 2017). saccharomyces cerevisiae has been widely used as an additive and an alternative to agp for poultry (ogbuewu et al., 2018; morales-lopez and brufau, 2013). s. cerevisiae contains vitamins, amino acids, and enzymes like mannases, glucanases, amylases, lipases, and proteases (sugiharto, 2022; ahiwe et al., 2021). the cell wall of s. cerevisiae is primarily composed of αmannan (31% dry mass), mannoprotein, which accounts for approximately 40% dry mass, βglucan (approximately 60% dry mass), and chitin (approximately 2% dry mass) (ahiwe et al., 2021). study in laying hens by pinar (2013) and swain et al. (2011) found that dietary supplementation of 1% or 1.5 g/kg s. cerevisiae, respectively, increased the percentage of hen day production, improved feed conversion ratio (fcr), increased albumen and shell thickness, increased egg weight, and improved feed efficiencies. another study by yalcin et al. (2014) found that adding yeast cell wall at 1 or 2 g/kg diets improved egg nutritional quality by lowering egg yolk cholesterol levels in 26-weeks brown laying hens. it has been very common to combine several active ingredients to achieve synergistic and complementary effects on poultry. in this study, s. platensis and s. cerevisiae were used together for laying hens. indeed, s. platensis contains a hepatotoxin called microcystin, which is toxic to the liver in high concentrations (sugiharto et al., 2018). study by valerio et al. (2014) revealed that s. cerevisiae can ameliorate the toxic effect of microcystin in s. platensis. in this regard, the use of s. platensis and s. cerevisiae together was expected to get a synergistic effect from the two additives without causing toxic effects from s. platensis. so far, the use of combination of s. platensis and s. cerevisiae for commercial laying hens has not been studied. this study therefore aimed to evaluate the effect of s. platensis and s. cerevisiae or its combination on egg quality, physiological condition and ammonia excretion of hens at the late laying period materials and methods animals and experimental diets one hundred forty four of 81 weeks old isa brown laying hens with an average body weight dietary supplementation of s. platensis and s. cerevisiae in laying hens (h.i. wahyuni et al.) 49 of 1,915±131.92 g from the commercial farm were used in this study. this study used an battery cage (20 × 40 cm 2 ). the temperature and humidity of the cage was between 22 to 30°c and 70 to 90%, respectively, while the light was provided intermittently every 2 hr from 7 pm until 5 am. four treatment groups with 6 replications for each group were arranged, so there were 24 experimental units. each unit containing 6 laying hens that were divided into 3 cages, each with 2 hens. the treatment groups included con (hens fed basal feed), sp (basal feed + 0.3% s. platensis), sc (basal feed + 0.2% s. cerevisiae), and spsc (basal feed + 0.3% s. platensis + 0.2% s. cerevisiae). s. platensis was purchased from pt. algaepark indonesia mandiri (tangerang, banten, indonesia). based on manufacturer’s label, s. platensis contained 6064 g/100 g protein, 5.6-7.2 g/100 g water, 20-24 g/100 g carbohydrates, <0.05 omega-6, 110-145 mg/100 g magnesium, 4.2-5.0 mg/100 4.2-5.0 mg/100 g vitamin b3, 1.5-2.5 mcg/100 mg vitamin b12, 6.0-7.2 mg/100 g vitamin e, 250-295 mg/1000 g carotene, 720-840 mg/100 g chlorophyll, 9150-10450 mg/100 g phycocyanobilin. s. cerevisiae contained 9.82 × 10 11 cfu/g. the yeast was purchased from angel yeast co. ltd., hubei, china. the hens were provided with manual feeders and drinking water facilities. the nutrition content of basal feed was 13% water, 16% protein, 3% fat, 7% crude fibre, 12% ash, 3% calcium, and 0.6% phosphor, with 2800 kcal/kg metabolizable energy. from the beginning to the end of the rearing period, drinking water was provided ad libitum, while the feed was offered twice a day (morning and afternoon). the treatment lasted 35 days. egg was taken from each experimental unit in the last 3 days of the study (33-35 days) to determine the egg quality. following that, blood and excreta samples were collected at the last day of the experiment. data collection and laboratory analysis table 1. nutritional compositions of basal feeds items content (%) corn 55.0 rice bran 18.0 soybean meal 11.0 corn gluten meal 5.00 meat bone meal 3.00 bone meal 2.00 limestone 4.00 mcp 1.00 premix** 1.00 analysed nutritional composition* metabolizable energy (kcal/kg) 2800 crude protein 15.41 crude fibre 7.00 crude fat 3.00 ash 12.00 water content 13.00 calcium 3.00 phosphor 0.60 *crude protein level was according to proximate analysis, while the other content corresponds to the feed label. **premix containing (per 10 kg of diet): vitamin a 12,000,000 iu; vitamin d3 2,000,000 iu; vitamin e 8,000 iu; vitamin k3 2,000 mg; vitamin b1 2,000 mg; vitamin b2 5,000 mg; vitamin b6 500 mg; vitamin b12 12,000 µg; vitamin c 25,000 mg; calcium d-pantothenate 6,000 mg; niacin 40,000 mg; choline chloride 10,000 mg; methionin 30,000 mg; lysine 30,000 mg; manganese 120,000 mg; iron 20,000 mg; iodine 200 mg; zinc 100,000 mg; cobalt 200 mg; copper 4,000 mg; santoquine (antioxidant) 10,000 mg. 50 j. indonesian trop. anim. agric. 48(1):47-57, march 2023 egg quality observation on egg quality were carried out at the end of the study. one egg was collected for each experimental unit to be examined for albumin index, yolk index, yolk colour, haugh unit, shell thickness and egg weight. the height of albumen and yolk was measured using a standard micrometre, while yolk diameter was determined using calliper. shells were washed using water and dried, then shell thickness was measured by micrometre. haugh units was calculated by formula as described by khaleel et al. (2019) as follows = 100*log(h+7.57)-(1.7*we 0.37 ). yolk index was determined by dividing the yolk height by yolk diameter. complete blood counts blood sample was collected from the wing vein of each hen for complete blood count determination. the collected blood was placed in ethylenediaminetetraacetic acid (edta)-containing vacutainers prior to analysis. routine haematology measurements were carried out with a fully automatic haematology analyser from pt. prima alkesindo nusantara (prima, power 100400v~50/60hz 150 va). intestinal ph twenty-four laying hens were used to assess the intestinal ph from intestine. the digestive tract was immediately prepared after euthanasia. a ph meter (ohaus st300) was used to measure the ph of the duodenum, jejunum, ileum, and caecum. ileum and caecum bacterial population the determination of intestinal bacterial population of the ileum and caecum was conducted according to sugiharto et al. (2022). after euthanasia, the digesta of ileum and caecum were transferred into 15 ml containers and immediately analysed for the number of lactic acid bacteria (lab), coliform and lactose-negative bacteria (lne). viable counts of lab in the digesta sample were conducted by plating onto de man rogosa and sharpe (mrs) agar and on macconkey agar plates for coliform and lne. the incubation of the mrs agar medium was carried out anaerobically for 48 h at 37°c and 24 hours at 37°c under aerobic condition for macconkey agar. after incubation, the bacterial colonies were counted and presented in log cfu/g. water content, acidity, temperature of excreta and protein digestibility sample of excreta were collected at the end of study. total nitrogen (n) was determined by standard kjehdahl method. the kjehdahl procedure was adopted for the crude protein measurement (jabbar et al., 2020). measurement of ammonia level was carried out using ammonia detector (smart sensor ar8500, intell instrumens plus) with accuracy of 1 ppm according to the manufacturer instruction. excreta temperature was determined by inserting a thermometer (thermoone, onemed) into hen excreta. moisture content was measured by weighing the wet weight and dry weight of excreta. nitrogen retention was calculated according to tillman (1998). nitrogen retention was measured by calculating the amount of nitrogen consumed minus the nitrogen excretion corrected for endogenous nitrogen. the formula for calculating the nitrogen retention is as follow = n consumption – (n excreta – n endogenous) statistical analysis spss program version 16.0 (ibm spss statistics for windows) was used to analyse data. the data obtained were statistically analysed using one-way anova with a 5% significance level. duncan’s multiple range test was used to evaluate the variations among treatment groups. results egg quality table 2 shows data on egg quality. the treatment of sp, sc, and spsc had substantial effects (p<0.05) on albumin index, yolk index, and yolk colour. the albumin index was higher in the spsc group than in the con, sp, and sc dietary supplementation of s. platensis and s. cerevisiae in laying hens (h.i. wahyuni et al.) 51 groups. there was no significant difference in albumin index between con, sp, and sc groups. in contrast to the previous parameters, the sp and spsc groups had differences (p<0.05) in yolk index and yolk colour when compared to the con group, but the sc group was not significantly different when compared to the con or sp and spsc groups. the treatment had no effect (p>0.05) on haugh unit, shell thickness, or egg weight. complete blood counts data on complete blood counts of laying hens are listed in table 3. the values of erythrocytes were greater (p<0.05) in sp group than in con, sc and spsc. there was no influence (p>0.05) of treatments on the serum concentrations of haemoglobin, haematocrits, mcv, mch, mchc, leukocytes, heterophils, lymphocytes and thrombocytes in laying hens. small intestine ph data on the small intestine ph of laying hens are listed in table 4. the ph level of ileum was higher (p<0.05) in sp than in con, sc and spsc groups. there was no significant change in ph in all groups. intestinal ecology of laying hens the bacterial populations in the intestine are presented in table 4. there was no difference (p>0.05) in the numbers of lab, coliform and lne enumerated in ileum. however, the sp and spsc groups showed a decrease (p<0.05) in lab populations when compared to con and sc groups. likewise, the lne population in the table 2. egg quality of laying hens items con sp sc spsc sem p value albumin index 0.083 b 0.095 ab 0.093 ab 0.108 a 0.032 0.046 yolk index 0.308 b 0.331 a 0.330 ab 0.332 a 0.003 0.012 yolk colour 11.77 b 12.27 a 11.77 ab 12.05 a 0.147 0.019 haugh unit 78.73 82.61 84.18 86.83 0.006 0.113 shell thickness (mm) 0.52 0.49 0.48 0.48 0.007 0.195 egg weight 65.00 64.14 64.18 64.43 0.234 0.563 a,b means marked with superscript letters in the same row are significantly different (p<0.05) con (hens fed by basal feed), sp (basal feed + s. platensis 0.3%), sc (basal feed + s. cerevisiae 0.2%), and spsc (basal feed + s. platensis 0.3% + s. cerevisiae 0.2%), sem: standard error of the mean table 3. complete blood counts of layer chickens items con sp sc spsc sem p value haemoglobin (g/dl) 10.67 12.33 10.25 10.83 0.12 0.349 erythrocytes (10 6 /µl) 3.00 b 3.66 a 2.77 b 3.01 b 0.43 0.038 haematocrit (%) 38.67 44.67 36.08 38.67 1.52 0.238 mcv (fl) 128.81 122.18 130.45 128.36 1.63 0.312 mch (pg) 35.52 35.25 37.00 35.88 1.52 0.238 mchc (g/dl) 27.62 27.58 28.42 28.02 0.25 0.624 leukocytes (10 3 /µl) 77.50 80.25 73.16 77.00 2.81 0.865 heterophils (10 3 /µl) 3.00 2.08 2.75 1.83 0.20 0.112 lymphocytes (10 3 /µl) 74.50 78.16 70.41 75.16 2.78 0.825 thrombocytes (10 3 /µl) 9.16 11.50 10.66 9.00 0.58 0.375 a,b means marked with superscript letters in the same row are significantly different (p<0.05) con (hens fed by basal feed), sp (basal feed + s. platensis 0.3%), sc (basal feed + s. cerevisiae 0.2%), and spsc (basal feed + s. platensis 0.3% + s. cerevisiae 0.2%), sem: standard error of the mean, mcv: mean corpuscular volume, mch: mean corpuscular haemoglobin, mchc: mean corpuscular haemoglobin concentration 52 j. indonesian trop. anim. agric. 48(1):47-57, march 2023 sc and spsc groups decreased (p<0.05) compared to con. laying hens treated with sp did not show a significant difference from the con, sc and spsc groups. water content, acidity and excreta temperature data of water content, acidity and excreta temperature of laying hens are listed in table 6. at the end of study, the treatments applied had no significant effect (p>0.05) on water content (%) and excreta temperature. in the contrary, ph of excreta was significantly affected by the treatment. the hens in sc group have a greater excreta ph than others (con, sp and spsc). protein digestibility research data on protein digestibility are shown in table 7. it was shown that the treatment had an effect on the protein digestibility coefficient, nitrogen retention and excreta ammonia. the sc group had a lower protein digestibility coefficient (p<0.05) compared to spsc group. higher n retention (p<0.05) found in spsc group than in sc. treatment with sp, sc and spsc lowered (p<0.05) the ammonia content in laying hen excreta. however, the treatment had no significant effect on n excreta. discussion s. platensis and s. cerevisiae have received attention as a potential alternative to agp that can maintain production performance, and also acts as health promoting agent in poultry. although having no positive influence on the egg production, feed consumption, fcr and mortality (unpublished data), data in the present study showed that the albumin index increased in the spsc group. furthermore, the yolk index and yolk colour in the sp and spsc groups increased significantly when compared with the con and sc groups. indeed, these present findings were consistent with those of dogan et al. (2016), who revealed that feeding 2% s. platensis increased quail yolk index. different from our study, selim table 4. small intestine ph of laying hens items con sp sc spsc sem p value duodenum 6.27 6.38 6.58 6.04 0.07 0.081 jejunum 6.30 6.55 6.37 6.07 0.09 0.305 ileum 6.58 b 7.34 a 6.90 b 6.60 b 0.08 0.001 cecum 7.00 7.37 7.29 7.05 0.08 0.284 a,b means marked with superscript letters in the same row are significantly different (p<0.05) con (hens fed by basal feed), sp (basal feed + s. platensis 0.3%), sc (basal feed + s. cerevisiae 0.2%), and spsc (basal feed + s. platensis 0.3% + s. cerevisiae 0.2%), sem: standard error of the mean table 5. bacterial populations in ileum and caecum of laying hens items con sp sc spsc sem p value ileum (log cfu/g) lab 11.51 11.51 11.44 11.36 0.074 0.900 coliform 6.03 5.70 5.75 5.55 0.208 0.891 lactose negative-enterobacteria 7.48 7.82 6.85 5.55 0.367 0.127 caecum (log cfu/g) lab 11.70 a 11.64 a 11.19 b 11.17 b 0.082 0.021 coliform 6.96 7.33 6.34 6.48 0.287 0.629 lactose negative-enterobacteria (lne) 9.08 a 7.74 ab 6.90 b 6.80 b 0.333 0.045 a,b means marked with superscript letters in the same row are significantly different (p<0.05) con (hens fed by basal feed), sp (basal feed + s. platensis 0.3%), sc (basal feed + s. cerevisiae 0.2%), and spsc (basal feed + s. platensis 0.3% + s. cerevisiae 0.2%), sem: standard error of the mean dietary supplementation of s. platensis and s. cerevisiae in laying hens (h.i. wahyuni et al.) 53 et al. (2018) found no significant effect of s. platensis on albumin index and yolk index of hens. the higher flavonoid content of s. platensis added to feed can explain the improvement in yolk colour in the sp and spsc groups (tufarelli et al., 2021). the latter authors further revealed that higher flavonoid levels in feed corresponded to higher pigment deposition in yolk, which determined colour intensity. moreover, the effect of s. platensis on yolk colour may also be due to the biomass’s β-carotene content due to s. platensis treatment (khan et al., 2021). it was apparent in this present study that, treatment with s. platensis increased erythrocyte counts in laying hens. similar to this study, sarker et al. (2022) reported the increased concentration of erythrocytes in laying hen blood after supplementation with s. platensis. in this case, erythrocytes improved due to phycocyanine, a bioactive compound in s. platensis that can stimulate erythropoietin hormone production (sarker et al., 2022). this hormone stimulates stem cells in the bone marrow to produce more red blood cells. similar to sarker et al. (2022), pankaj and varma (2013) discovered that oral administration of s. platensis to rats increased red blood cell count. in the current study, feeding s. cerevisiae and combining it with s. platensis reduced the population of lab and lne in the caecum digesta of laying hens. with regard particularly to s. cerevisiae, such probiotic yeast has reportedly been shown to possess antimicrobial characteristics, hence lowering the number of dangerous bacteria, such as lne, in the intestine of poultry (sugiharto et al., 2022). different from erya et al. (2020) showing no effect of s. cerevisiae on the caecal lab population, results in this present study showed reduced caecal lab counts due to s. cerevisiae treatment. so far, the exact reason for such condition remains unknown. in term of s. platensis, flavonoid compound of s. platensis was actually expected to function as a bacterial clearing agent (akbarbaglu et al., 2022). in accordance with this, s. platensis administration resulted in reduced caecal lne content in this study, although the values did not reach the significant levels. in line with our findings, nuhu (2013) revealed that s. platensis was effective at inhibiting the growth of harmful bacteria in the intestine as a result of antibacterial activity. the water content of laying hen excreta ranged from 79.9 to 84.7% in this study. the treatment had no discernible effect on the excreta water content in any of the treatment groups table 6. water content, acidity and temperature of laying hens excreta items con sp sc spsc sem p value water content (%) 84.7 79.9 81.7 84.6 0.004 0.274 ph 6.7 b 6.5 b 6.8 a 6.7 b 0.029 <0.001 temperature (°c) 33.8 34.2 34.5 34.3 0.133 0.271 a,b means marked with superscript letters in the same row are significantly different (p<0.05) con (hens fed by basal feed), sp (basal feed + s. platensis 0.3%), sc (basal feed + s. cerevisiae 0.2%), and spsc (basal feed + s. platensis 0.3% + s. cerevisiae 0.2%), sem: standard error of the mean table 7. protein digestibility of laying hens items con sp sc spsc sem p value protein digestibility coefficient (%) 57.76 ab 60.96 ab 48.60 b 70.40 a 2.73 0.031 nitrogen retention 3.80 bc 4.07 ab 3.01 c 4.90 a 0.21 0.009 nitrogen excreta 5.29 5.26 5.65 4.59 0.16 0.124 faecal ammonia 14.2 a 7.0 b 6.8 b 6.7 b 0.818 <0.001 a,b,c means marked with superscript letters in the same row are significantly different (p<0.05) con (hens fed by basal feed), sp (basal feed + s. platensis 0.3%), sc (basal feed + s. cerevisiae 0.2%), and spsc (basal feed + s. platensis 0.3% + s. cerevisiae 0.2%), sem: standard error of the mean 54 j. indonesian trop. anim. agric. 48(1):47-57, march 2023 because the basal feed distributed to each group had the same nutritional composition. indeed, high protein encourages high water content in excreta because of higher glomerulus uric acid concentration, which causes laying hens to drink more water. due to the little percentage inclusion in this investigation, it seemed as s. platensis inclusion did not significantly increase the crude protein content of the basal diets. the excreta temperatures in the sp, sc, and spsc groups did not differ significantly from one another. this suggests that the amount of metabolizable energy in each group was equal to the amount required to maintain a normal body temperature, indicating that there were no appreciable differences in homeostasis between the treatment groups. in this study, s. platensis, s. cerevisiae, and both combinations were found to reduce ammonia levels in excreta. the dietary supplementation of s. platensis and s. cerevisiae was thought to have resulted in optimal intestinal microbe function. the probiotic microbes could inhibit the activity of the urease enzyme (rezaee et al., 2019), which can reduce the amount of uric acid in the digestive tract of laying hens. acid producing bacteria combined with oligosaccharidecontaining ingredients were more effective at reducing ammonia. the level of ammonia in excreta is typically determined by the amount of n in the excreta (jeong and kim, 2014). however, there was no significant effect of n excreta treatment in this study. the higher protein digestibility coefficient in the spsc group compared to the sc group suggests that both supplements had a synergistic effect. protein digestibility appears to be related to the balance of essential and nonessential amino acids in s. platensis, which can aid in the digestion of crude protein in poultry (park et al., 2018; bleakley and hayes, 2017; evans et al., 2015). maximum protein digestibility can increase n retention, as demonstrated by the findings of this study. nitrogen retention is the amount of nitrogen that hens absorb and use. the results showed that higher n retention in spsc groups corresponded to lower excreta ammonia in the spsc group. this means that n from amino acids was used more for production and maintaining health than nitrogen from the consumed ration (park et al., 2018). overall, several parameters showed better results with single administration of s. platensis or s. cerevisiae, when compared to the combined administration of s. platensis and s. cerevisiae. this may be because the combination of s. platensis and s. cerevisiae does not always have a synergistic effect on poultry conditions (sugiharto et al., 2022). the results of this study indicate that single administration of s. platensis or s. cerevisiae will be more efficient in improving egg quality and health of laying hens in the period after peak production. in conclusion, s. platensis improved yolk index and colour, increased erythrocyte counts and played an important role in maintaining the balance of microbes in the digestive tracts resulting in reduced ammonia excretion. dietary inclusion of s. cerevisiae reduced ammonia excretion of laying hens during the late laying period. conflict of interest we certify that there is no conflict of interest with any financial, personal, or other relationships with other people or organization related to the material discussed in the manuscript. acknowledgements author wishing to acknowledge the research students, laboratory technicians and financial support from universitas diponegoro. references abdel-daim, m.m., s.m. abuzead and s.m. halawa. 2013. protective role of spirulina platensis against acute deltamethrin-induced toxicity in rats. plos one. 8(9):e72991. afandi, r., b. hartono and i. djunaidi. 2020. the analysis of production costs of laying dietary supplementation of s. platensis and s. cerevisiae in laying hens (h.i. wahyuni et al.) 55 hen farms using semi self-mixing and total self-mixing feeds in blitar regency, east java. trop. anim. sci. j. 3(1):70-76. ahiwe, e.u., t.t. tedeschi dos santos, h. graham and p.a. iji. 2021. can probiotic or prebiotic yeast (saccharomyces cerevisiae) serve as alternatives to in-feed antibiotics for healthy or disease-challenged broiler chickens?: a review. j. appl. poult. res. 30 (3):100164. akbarbaglu, z., a. ayaseh, b. ghanbarzadeh and k. sarabandi. 2022. techno-functional, biological and structural properties of spirulina platensis peptides from different proteases. algal res. 66: 102755. bleakley, s. and m. hayes. 2017. algal proteins: extraction, application, and challenges concerning production. foods. 6(5):33. dogan, s.c., e. hussein and r. abou akbar. 2016. effect of spirulina platensis as feed additive on laying performance, egg quality and hepatoprotective activity of laying hens. eur. poult. sci. 82:1-14. erya, s.n., h.i. wahyuni, t. yudiarti, e. widiastuti, and s. sugiharto. 2020. intestinal morphology and growth performance of the indonesian indigenous crossbred chickens supplemented with formic acid and saccharomyces cerevisiae. j. indonesian trop. anim. agric. 45(4):348-355. evans, a.m., d.l. smith and j.s. moritz. 2015. effects of algae incorporation into broiler starter diet formulations on nutrient digestibility and 3 to 21 d bird performance. j. appl. poult. res. 24(2):206-214 furbeyre, h., j. van milgen, t. mener, m. gloaguen and e. labussiere. 2017. effects of dietary supplementation with fresh water microalgae on growth performance, nutrient digestibility, and gut health in weaned piglets. animal. 11(2):183-192 jabbar, a., m. tahir, r.u. khan, and n. ahmad. 2020. interactive effect of exogenous protease enzyme and dietary crude protein levels on growth and digestibility indices in broiler chickens during the starter phase. trop. anim. health prod. 53(1):23. jeong, j.s. and i.h. kim. 2014. effect of bacillus subtilis c-3102 spores as a probiotic feed supplement on growth performance, noxious gas emission, and intestinal microflora in broilers. poult. sci. 93(12):30973103. khaleel, r.m.t. 2019. prediction of haugh unit through albumen height and egg weight. mesopotamia j. agric. 47:37-43. khan, f., a.a.s. shuvo and k.m.s. islam. 2021. effect of dietary inclusion of spirulina platensis on egg yolk pigmentation. livest. res. rural dev. 33(8):101. langers, i., v.m. renoux, m. thiry, p. delvenne and n. jacobs. 2012. natural killer cells: role in local tumor growth and metastasis. biologics. 6:73-82. mariey, y.a., h.r. samak and m.a. ibrahem. 2012. effect of using spirulina platensis algae as a feed additive for poultry diets. 1. productive and reproductive performance of local laying hens. egypt. poult. sci. 32 (1):201-215. molnar, a. 2017. extended production cycle in laying hens-the role of nutrition and management. ph.d. thesis ku leuven, belgium. doi: 10.13140/rg.2.2.20930.27841 morales-lopez, r. and j. brufau. 2013. immunemodulatory effects of dietary saccharomyces cerevisiae cell wall in broiler chickens inoculated with escherichia coli lipopolysaccharide. br. poult. sci. 54 (2):247-251. mullenix, g.j., c.j. maynard, c.m. owens, s.j. rochell, w.g. bottje, r.d. brister and m.t. kidd. 2021. spirulina platensis meal inclusion effects on broilers fed a reduced protein diet. j. appl. poult. res. 31(1):100199. nuhu, a.a. 2013. spirulina (arthrospira): an important source of nutritional and medical compounds. j. mar. biol. doi: http:// dx.doi.org/10.1155/2013/325636 ogbuewu, i.p., v.m. okoro, e.f. mbajiorgu and c.a. mbajiorgu. 2019. yeast 56 j. indonesian trop. anim. agric. 48(1):47-57, march 2023 (saccharomyces cerevisiae) and its effect on production indices of livestock and poultry a review. comp. clin. pathol. 28: 669-677. omri, b., m. amraoui, a. tarek, m. lucarini, a. durazzo, n. cicero, a. santini and m. kamoun. 2019. arthrospira platensis (spirulina) supplementation on laying hens’ performance: egg physical, chemical and sensorial qualities. foods. 8(9):386. pankaj, p.p. and m.c. varma. 2013. potential role of spirulina platensis in maintaining blood parameters in alloxan induced diabetic mice. int. j. pharm. pharm. sci. 5(4): 450 -456. park, j.h., s.i. lee and i.h. kim. 2018. effect of dietary spirulina (arthrospira) platensis on the growth performance, antioxidant enzyme activity, nutrient digestibility, cecal microflora, excreta noxious gas emission, and breast meat quality of broiler chickens. poult. sci. 97(7):2451-2459. pinar, s., e. ahmed, h.k. bekir, o. bulent and c. zafer. 2011. effect of inactivated brewer’s yeast (saccharomyces cerevisiae) on egg production, serum antibody titres and cholesterol levels in laying hens. vet. ir zootech. 61(83):53-60. pottgüter, r. 2016. feeding laying hens to 100 weeks of age. lohmann information. 50(1):18-21. rahim, a., c. cakir, m. ozturk, b. sahin, a. soulaimani, m. sibaoueih, b. nasser, r. eddoha and a. assamadi. 2021. chemimcal characterization and nutritional value of spirulina platensis cultivated in natural conditions of chichaoua region (morocco). s. afr. j. bot. 141:235-242. rezaee, p., r.k. kermanshahi and t. falsafi. 2019. antibacterial activity of lactobacilli probiotics on clinical strains of helicobacter pylori. iran j. basic med sci. 22 (10):1118-1124. sarker, m.s., k. rafiq, m.m. rahman, k.k.i. khalil, s. islam and m.s. islam. 2022. effect of spirulina (spirulina platensis) on production, hematological parameters and lipid profile in layers. res. agric. livest. fish. 9(1):49-55. selim, s., e. hussein and r. abou-elkhair. 2018. effect of spirulina platensis as a feed additive on laying performance, egg quality and hepatoprotective activity of laying hens. europ. poult. sci. 82:1-13. shokri, h., a. khosravi and m. taghavi. 2014. efficacy of spirulina platensis on immune functions in cancer mice with systemic candidiasis. j. mycol. res. 1(1):7-13 sugiharto, s., b.m. atmaja, e. widiastuti and h. hadiyanto. 2022. combined use of spirulina platensis and saccharomyces cerevisiae: implication on growth, blood profile, and intestinal morphology and bacteria of the indonesian crossbred chickens. biodiversitas. 23(1):160-165. sugiharto, s., t. yudiarti, i. isroli and e. widiastuti. 2018. effect of feeding duration of spirulina platensis on growth performance, haematological parameters, intestinal microbial population and carcass traits of broiler chicks. s. afr. j. anim. sci. 48(1):98-107. swain, b.k., p.k. naik, e.b. chakurkar and n.p. singh. 2011. effect of probiotics and yeast supplementation on performance, egg quality characteristics and economics of production in vanaraja layers. indian poult. sci. 46:313-315. tillman, a.d. 1998. basic animal feed sciences. yogyakarta. gadjah mada university press. tufarelli, v., p. baghban-kanani, s. azimiyouvalari, b. hosseintabar-ghasemabad, m. slozhenkina, i. gorlov, a. seidavi, t. ayasan, and v. laudadio. 2021. effect of horsetail (equisetum arvense) and spirulina (spirulina platensis) dietary supplementation on laying hens productivity and oxidative status. animals, 11(2):335. valerio, e., a. vilares, a. campos, p. pereira and v. vasconcelos. 2014. effects of microcystin-lr on saccharomyces cerevisiae growth, oxidative stress and apoptosis. toxicon. 90:191-198. dietary supplementation of s. platensis and s. cerevisiae in laying hens (h.i. wahyuni et al.) 57 wongsuvan, g., v. wuthiekanun, s. hinjoy, n.p. day and d. limmathurotsakul. 2018. antibiotic use in poultry: a survey of eight farms in thailand. bull. world health organ. 96(2):94-100. yalcin, s., i. onbasilar, e.h. handan and a. sahin. 2014. effect of dietary yeast cell wall on performance, egg quality and humoral immune response in laying hens. ankara univ. vet. fak. derg. 61(4):289-294. zahroojian, n., h. moravej and m. shivazad. 2013. effects of dietary marine algae (spirulina platensis) on egg quality and production performance of laying hens. j. agr. sci. tech, 15(7):1353-1360. 192 j. indonesian trop. anim. agric. 47(3):192-203, september 2022 j i t a a journal of the indonesian tropical animal agriculture accredited by ditjen riset, teknologi dan pengabdian kepada masyarakat no. 164/e/kpt/2021 j. indonesian trop. anim. agric. pissn 2087-8273 eissn 2460-6278 http://ejournal.undip.ac.id/index.php/jitaa 47(3):192-203, september 2022 doi: 10.14710/jitaa.47.3.192-203 comparative analysis of technical efficiency of piglet farming in three production center provinces in indonesia h. harianto 1 and e. n. keraru 2* 1 department of agribusiness, faculty of economics and management, ipb university 2 department of socioeconomics of agriculture, faculty of agriculture and animal science, universitas katolik indonesia st. paulus ruteng *corresponding e-mail: keraruesternurani@yahoo.com received march 5, 2022, accepted july 13, 2022 abstract pork production occupies the third position in indonesia, after chicken and beef. even pigs occupy the top rank in contributing to indonesia's live animal exports. the purpose of this study was to compare the level of technical efficiency of smallholder piglet production farming in three centers of pig production areas, namely north sumatra, bali, and east nusa tenggara (ntt). the research data was sourced from secondary data at the farm level, collected by the central statistics agency of indonesia, through the livestock business household survey. this research utilized the stochastic production frontier model to assess the production efficiency and the one-step maximum likelihood estimation (mle) method to measure the level of technical efficiency and the significance of the factors. the results show that the average level of technical efficiency of piglet production farms in indonesia is relatively low. piglet production farms in bali have the highest efficiency level and ntt is the lowest of the three provinces being compared. the number of pigs, feed expenditure, capital, and vaccinations are important factors in influencing production and the level of technical efficiency. public policies that can increase farmers' access to production factors and better pig farm vaccine management become a necessity. keywords: bali, household survey, stochastic production frontier, vaccination introduction the majority of indonesia's population are adherents of islam. for muslims, pork and its various derivative products are forbidden for consumption. however, based on data from livestock and health animal statistics of indonesia (lhasi) in 2020, it could be seen that pig farming is an important livestock business. pork production occupies the third position after chicken and beef. the share of pork production was 5.2% of the total meat production in 2020 which is 4.6 million tons. meanwhile, the share of chicken and beef at the same year were 79.3% and 11.0% respectively. national pork production is supported by the pig population which is piglet farming in indonesia (h. harianto and e. n. keraru) 193 increasing every year with a national average growth in 2014 to 2020 of 2.58%. the growth of indonesia's pig population is higher than other countries such as china 1.70%, vietnam -0.89%, or the philippines -0.17% (nga et al., 2014). pig farming is also the mainstay of indonesia's livestock exports. live animal exports were dominated by pigs, with a share of 99.1% of total live cattle exports in 2019. on the other hand, live animal imports were dominated by cattle, which amounted to 94.3% of total live animal imports. basically, the pig farming industry in indonesia is centered in three regions, namely north sumatra, bali, and east nusa tenggara (ntt). based on livestock in figures 2020 published by the central agency of statistics of indonesia (bps), the three regions accounted for 66.2% of the total domestic pig production. the share of swine production in north sumatra, bali, and ntt were 16.7%, 30.0%, and 19.5%, respectively, of the total pig production in indonesia, with the rest spread over 21 other regions (provinces). although pigs produce is the mainstay of livestock exports in indonesia, the structure of pig agribusiness is still considered to be relatively unequal. the development of pig farming is not supported by developments in the downstream industry, especially livestock that specifically produces and provides piglets. based on a household survey of livestock business in 2014 conducted by bps, there are only 0.8% of pig farms that specialize in producing piglets. more than 52.8% of small-scale pig farmers use pig seeds that come from the piglets they raise, and not from purchases. in general, domestic pig farming businesses still have subsistence characteristics in the production factors they use (keraru et al., 2021). in the future it is necessary to have better quality pig breeds so that pig agribusiness in indonesia will be more competitive. therefore, it is necessary to study the efficiency level of the piglet industry on a smallholder farm scale. if the efficiency level is still low, then the performance can be improved by increasing the efficiency to get closer to the frontier. on the other hand, if the piglet industry is already efficient, it is necessary to has a technological breakthrough to improve the performance of the piglet industry at small holder farm scale. various studies on pig farms generally discuss the characteristics and performance of grower-finisher pig farming (dedecker et al., 2005; galanopoulos et al., 2006; aminu and akhigbe-ahonkhai, 2017). likewise, research that utilizes the stochastic production frontier model in assessing the performance of piglet production farms, has not been widely carried out (sharma et al., 1997; lansink and reinhard, 2004; umeh et al., 2015; zhou et al., 2015; wang et al., 2021). the objective of this study is to analyze and compare the level of technical efficiency of piglet production farms in three production centers in indonesia, namely north sumatra, bali and ntt. as far as the best authors knowledge, no one has specifically discussed the level of technical efficiency of piglet production farms, namely farms that only raises breeding pigs to produce piglets, at the household level. moreover, there has never been a comparison of the technical efficiency of pig farming in bali, ntt, and north sumatra. one of the main obstacles to assessing the technical efficiency of piglet production farms is the difficulty of obtaining sufficient research samples, especially cross section data that is suitable for analysis using the regression method. less than 1 percent of the total smallholder pig farms in indonesia that produce piglet are entirely dedicated to selling to the market. in the field, the characteristics of farms that produce piglet entirely sold to the market are also difficult to distinguish from those that produce piglets for their own use in the process of fattening pigs. the livestock census, which is the source of the data for this research, is an invaluable source of information to obtain an adequate number of observations for farms with a relatively small population in indonesia. this research is based on the idea that piglet breeding is an important factor that determines the development of a pig farming business in an area. thus, the knowledge of the technical efficiency of piglet breeding business is needed to be able to formulate appropriate public policies. 194 j. indonesian trop. anim. agric. 47(3):192-203, september 2022 materials and methods source of data the data used in this study is part of the latest livestock farms household survey (st2013stu). this study covers pig farms throughout indonesia using samples from 20 provinces. the number of samples in the livestock business household survey is 6,738 pig farms on a household scale, and from the total number of samples there are only 57 farms who are categorized as piglet production nursery. the sample used in this study was dominated by piglet production farming from north sumatra 28.01%; east nusa tenggara 27.86%; and bali 21.42%. these three provinces have contributed more than 77% of the total sample. the household of piglet production farming selected as a sample must use a cage, because it allows a more accurate calculation of the relationship between input and output of pig farming. empirical model and method of estimation research on the technical efficiency of farming using the stochastic production frontier (spf) model has been widely carried out in various countries. the spf model used is based on the thoughts of (aigner et al., 1977). the spf estimation adopted is based on the ideas presented by (jondrow et al., 1982), namely through the variance decomposition model. in this study, inefficiency effect was formulated using the model suggested by (battese and coelli, 1995). there are two production function models that are commonly used in stochastic production frontier research, namely the cobb-douglas model and the translog model. based on the results of a survey of several major spf studies using spf, the cobb-douglas production function model is the most widely used (meeusen and van den broeck, 1977; ahmad and bravo-ureta, 1996; coelli and battese, 1996; tabe-ojong and molua, 2017; mwangi et al., 2020). in this study the cobb-douglas production function was deliberately chosen. there are two main reasons for using the cobb-douglas model in this study. first, the cobb-douglas production function requires a relatively small number of samples to obtain a degree of freedom equivalent to the translog model. with the limited number of samples of piglet-producing farms obtained in the livestock national survey, which was only 57 samples, the cobb-douglas model became a more appropriate model. second, the translog model has a greater chance to violate the regression assumption, namely the existence of a high multicollinearity phenomenon among its independent variables, which is indicated by a high vif value (hair et al., 2010). the specification of cobb-douglas stochastic production frontier function employed in this study are as follow: description: where, vi is a random component which is assumed to be independently identically distributed (iid). ui is a random variable that represents the effect of technical inefficiency in production. i is i th household of piglet production farm. the efficiency effect (ui) model used in this study employed the form function specification as suggested by battese and coelli (1995), which is ln 𝑌𝑖 = ln 𝛽0 + 𝛽1 ln 𝑋1𝑖 + 𝛽2 ln 𝑋2𝑖 + 𝛽3 ln 𝑋3𝑖 + 𝛽4 ln 𝑋4𝑖 +𝛽5𝑋5𝑖 + 𝑣𝑖 − 𝑢𝑖 yi = the production value, namely the accumulation of livestock added value (idr000) x1= quantity of pig cultivated (head) x2= quantity of labor (man days) x3= quantity of feed (kg) x4= capital, namely fuel, electricity, water; maintenance of livestock health; other expenses (idr000) x5= dummy pig origin (=1 if own production, =0 if otherwise) β0 to β5 > 0 = coefficient of regression vi ui = error term piglet farming in indonesia (h. harianto and e. n. keraru) 195 empirically expressed in the following equation: description: pig farmers produce piglets that were not standardized, and the production benefits received from the production process in on-farm were determined not only in units of tails or kilograms but also by looking at non-measurable quality of the piglets they produce. therefore, the production function model used in this study did not use tails or kilograms but uses a value-added measure. if the units used are physical (tails or kilograms), then the model cannot capture the dimensions of quality in the product, so the results of production function became biased. the value-added measure as a representation of output can capture the dimensions of quantity and quality of a product. value added is also more suitable to represent output in farming where the harvest is not done at one time, such as harvesting corn or rice farming. harvesting in piglets is not done at the same time but is harvested when the farmer needs cash or when it is deemed that the piglets are on time for sale. the stochastic production frontier function that did not use physical measurements for the relationship between output and input in pig farming had also been carried out by etim et al. (2022) and jabbar and akter (2008). the stochastic frontier production function model does not have to be in the form of physical input-output relationship. it is possible that the input-output relationship represented by measurement of output and input in money value terms (tenaye, 2020). the estimation of the spf model using the cobb-douglas production function above was carried out using the maximum likelihood estimation (mle) approach without rejecting the assumption of heteroscedasticity, and the analysis was done with the help of the stata 13 program (wang and schmidt, 2002; belotti et al., 2013; tian et al., 2015). this study applied a single-stage mle approach which it allows simultaneous estimation of the frontier production function and technical inefficiency model parameters and is free from high bias (coelli et al., 2005). the spf model has been widely used in research related to pig farming as in adetunji and adeyemo (2012); tian et al.(2015); and aminu and akhigbeahonkhai (2017). the spf model specification test is carried ln 𝑌𝑖 = ln 𝛽0 + 𝛽1 ln 𝑋1𝑖 + 𝛽2 ln 𝑋2𝑖 + 𝛽3 ln 𝑋3𝑖 + 𝛽4 ln 𝑋4𝑖 +𝛽5𝑋5𝑖 + 𝑣𝑖 − 𝑢𝑖 𝑢𝑖 = 𝛿0 + 𝛿1𝑍1𝑖 + 𝛿2𝑍2𝑖 + 𝛿3𝑍3𝑖 + 𝛿4𝑍4𝑖 + 𝛿5𝑍5𝑖 + 𝛿6𝑍6𝑖 + 𝛿7𝑍7𝑖 + 𝛿8𝑍8𝑖 + 𝛿9𝑍9𝑖 + 𝛿10 𝑍10𝑖 + 𝛿11 𝑍11𝑖 + 𝛿12 𝑍12𝑖 + 𝛿13 𝑍13𝑖 ui= the effect of technical inefficiency of i th piglet production farm z1= age of head of household (year) z2= number of household members (person) z3= formal education of household head (year) z4= dummy gender of household head (1=man, 0=otherwise) z5= dummy farming experience (1= more than 10 years, 0= otherwise) z6= dummy feed area (1= available, 0= otherwise) z7= dummy vaccination (1=yes, 0=no) z8= dummy feed combination (1=forage+factory feed+industrial waste; 0=otherwise) z9= dummy access to finance (1=yes, 0=no) z10= dummy access to extension (1=yes, 0=no) z11= dummy member of cooperative (1=yes, 0=no) z12= dummy market orientation (1=yes, 0=no) z13= dummy province (1=north sumatra, bali; ntt, 0=otherwise) 196 j. indonesian trop. anim. agric. 47(3):192-203, september 2022 out by testing two hypotheses using the likelihood ratio (lr) test, as follows: the first hypothesis examines the existence of an inefficiency component of the total error term of the stochastic production function. in the first hypothesis test, l(h0) is the log likelihood value of the generalized linear model (glm) and l(h1) is the log likelihood value of the stochastic frontier (sf). the second hypothesis tests that each explanatory variable in the inefficiency effect model has an influence on the level of inefficiency in the production process. in the second hypothesis test, l(h0) is the log likelihood value of the sf model without explanatory variables for the inefficiency effect model and l(h1) is the complete sf model with all explanatory variables for the inefficiency effect model. the calculated test statistic should be compared with the critical value of the mixed chi-square distribution proposed by kodde and palm (1986). the null hypothesis is rejected if the lr test value is greater than the mixed chi-square distribution at the 1% probability level. results and discussion performance of the piglet production farming based on research samples, it can be said that piglet production is a small-scale farming business. the average number of pigs cultivated in one period is 15 pigs, consisting of 6 males and 9 females. smallholder pig farming with the number of pigs below 50 heads is a business that is commonly found in many developing countries (adetunji and adeyemo, 2012; thanapongtharm et al., 2016). the average feed consumption per head per period is 343 kg. the composition of feed comes from various sources, namely factory waste (39%), forage (17%), factory feed (14%), agricultural waste (12%), household waste (6%), and others (12%). based on the composition of the feed sources, the piglet production farm relies on various types of waste as its feed source, which is 57%. in contrast, the content of feed from feed mills is only 12%. this can be an indication that the nature of subsistence in piglet farming is still relatively high, especially from the aspect of providing production inputs. research phengsavanh et al. (2010) in northern lao, mekuriaw and asmare (2014) in northwestern ethiopia, leslie et al. (2015) in indonesia, nantima et al. (2015) along the uganda-kenya border, and lekule and kyvsgaard (2003) in resource-poor tropical areas of africa, also found important sources of pig food originating from the surrounding environment and from agricultural and industrial waste or by-products. the amount of feed per head per period in indonesia is relatively less than pig farm in other country, which daily feed intake ranging from 1.8 kg – 2.5 kg (pierozan et al., 2016). the optimum amount and 𝐿𝑅 = −2[ln 𝐿 𝐻0 / ln {𝐿 𝐻1 }] = −2[ln 𝐿 𝐻0 − 𝑙𝑛{𝐿 𝐻1 }] table 1. cost structure and profitability in piglet production farming of the three provinces in indonesia per pig head managed per period description north sumatra bali ntt idr % idr % idr % a. variable cost 1,426.74 1,057.79 474.36 labor 560.57 38.55 250.72 21.95 179.49 33.81 feed 796.49 54.77 760.44 66.58 232.73 43.84 capital 69.68 4.79 46.63 4.08 62.15 11.71 b. fixed cost* 27.55 1.89 84.40 7.39 56.53 10.65 c. total cost (a+b) 1,454.29 100 1,142.19 100 530.89 100 d. revenue (value added) 2,717.39 1,588.82 1,510.00 e. profit (d-c) 1,263.10 446.63 979.11 idr in ‘000’. *with the following detail: fuel, electricity, water; maintenance of livestock health; other expenses. **with the following details: capital goods improvements; land lease; rent on stables, buildings, machinery, and tools; tax and levies; interest on loans. piglet farming in indonesia (h. harianto and e. n. keraru) 197 composition of feed depends on the age, body weight, and breed of the pig, and the management of the pig's feed (njoku et al., 2013; patience et al., 2015; colpoys et al., 2016). based on research data, feed and labor were the dominant production factors in the cost structure of piglet farming (table 1). piglet farming in north sumatra employed more feed and labor than farms in bali and east nusa tenggara. the share of the use of inputs other than feed and labor, namely capital, was largest in piglet farming in east nusa tenggara. however, piglet farming in north sumatra provided the highest added value and profit compared to piglet farming in the other two provinces. technical efficiency of piglet production farming based on the results of the likelihood ratio test on the spf model used, it can be seen that there is an inefficiency effect in the model. this inefficiency effect is influenced by various factors, and this is also evident from the results of the likelihood ratio test obtained. table 2 presents the results of the specification test on the cobb-douglas spf model along with the factors that affect the inefficiency. the estimation results of the spf in table 3 show that only labor inputs show no significant effect on production. by using primary data from a household-scale pig farming survey in nigeria, the research of umeh et al. (2015) found a positive effect of labor and feed on the level of production. however, the results of their research did not find a real effect of capital input on the level of production. on the other hand, this study found that capital has a significant positive effect on the level of piglet production farming. in the spf function to control the influence of seed sources, a dummy variable equal to 1 was included if the pigs that were cultivated come from own farming products and were equal to zero if others. the estimation results show that the origin of the pigs raised from the farm itself has a positive influence on the level of production. it seems that pigs that come from own livetable 2. hypothesis test for spf specification in piglet production farming description results no inefficiency effect; h0: 𝛾 = 0 lr test 33.843 mixed chi-square 5.412 decision reject h0 coefficient of inefficiency factors; h0: 𝛿0 = 𝛿1 = 𝛿2 = ⋯ 𝛿𝑛 = 0 lr test 29.266 mixed chi-square 28.485 decision reject h0 table 3. the estimation result of spf in piglet production farming variable coefficient standard error constant 6.269*** 0.017 total pig 0.360*** 0.097 labor 0.546 ns 0.353 feed 0.198*** 0.022 capital 0.137*** 0.020 pig’s origin 0.797*** 0.247 sigma_u_sqr 0.489*** 0.098 sigma_v_sqr 0.000 0.000 log likelihood -43.9379 wald chi2(5) 3.30e+09 prob>chi2 0.0000 *** p<0.01; ** p<0.05; * p<0.1; ns p>0.1 198 j. indonesian trop. anim. agric. 47(3):192-203, september 2022 stock have better quality than pigs that come from other sources. probably, breeders select the pigs it produces which were considered to have the best quality for the piglet production farm they are working on. based on the estimation results of the spf model, the te level of each observation can be measured. of the 57 samples used in the spf estimation, the average te level of piglet production farms in indonesia is 41.9% (table 4), and can be categorized as a low level of te, because it is below 70% (coelli et al., 2005). the efficiency level of piglet production farms is relatively lower when compared to pig farming in other countries (tian et al., 2015; nguyen et al., 2016). the estimation results from this study indicate that there is still great potential to increase the productivity of piglet production farms in indonesia. the currently available pig farming technology does not appear to be optimally applied by breeders. it is still possible to improve the allocation of resource use in order to obtain a higher level of piglet production farm productivity. increasing production through a new technology is certainly more difficult to do, because many factors can hinder the decision to adopt technology by piglet farmers (zanu et al., 2012). if piglet production farms were grouped based on the area where the farm is located, it can be seen that piglet production farms in bali have the highest average te value and ntt is the lowest. based on the research results presented in table 5, the average te values of piglet production farms in bali and ntt are 50.1% and 35.9%, respectively. bali also has the lowest diversity of te values compared to the other two regions, with a coefficient of variation of 45.7%. the te value of piglet production farms in bali relatively higher to the other two provinces was supported by budaarsa's (2017) explanation that pig breeders in bali have widely applied artificial insemination (ai). the positive effect of insemination methods and breeding practices for increasing pig farming productivity was also found by galanopoulos et al. (2006) research in greece. sources of technical inefficiency the average value of technical efficiency in the three provinces which was classified as low, with available technology, indicates that there is a great opportunity to increase the productivity of piglet production farms. table 6 presents the table 4. distribution of te level in piglet production farming technical efficiency number of observation percentage (%) <0.5 37 64.91 0.5-0.6 7 12.28 0.6-0.7 4 7.02 0.7-0.8 2 3.51 0.8-0.9 2 3.51 0.9-1 5 8.77 total sample 57 100 mean 0.419 std. dev 0.266 min 0.052 max 0.999 table 5. the comparison of the mean and coefficient variation of te of piglet production farming in three provinces province mean of te cv of te north sumatera 0.437 0.645 bali 0.501 0.457 ntt 0.359 0.618 piglet farming in indonesia (h. harianto and e. n. keraru) 199 results of the estimation of factors that affect production inefficiency in piglet production farms. table 6 should be presented as an integral part of table 3, because it is generated by estimation using a one-step procedure with the maximum likelihood method, as suggested by coelli et al. (2005). however, for the purposes of a clearer explanation followed, the results of processing the models of factors that affect technical inefficiency are separated into table 6. piglet production farms located in north sumatra, bali, and ntt are more efficient than in other provinces. this is indicated by the significant negative effect of the variable dummy of province on technical inefficiency. based on the estimation results, the age of the breeder has a negative effect on increasing technical efficiency. the older age of the head of the household has a negative and significant effect on the efficiency level of the piglet production farm. it seems that the younger generation is less and less interested in running a small-scale pig farming business, and prefers to work in the non-agricultural sector or work in urban areas. the experience of raising pigs is a factor that can significantly affect the efficiency of a piglet production farm. small-scale pig farms tend to use technology that has been traditionally passed down from generation to generation, so experience is a determining factor for success (zanu et al., 2012). this was reinforced by the estimation results which show the level of education and extension variables that do not have a significant effect. likewise, the effect of the variable presence of feed land which significantly increases inefficiency can be an indication that piglet production farms that rely on feed sourced from nearby forages are lower in efficiency compare to farms that rely on feed from other feed sources. the estimation results also show that vaccination, although with a low statistical significance level, does increase inefficiency. this is certainly contrary to expectations, where vaccination should be expected to improve the technical efficiency of piglet production farms. however, the estimation results that were contrary to this expectation could be an indication of the need to improve a more credible vaccination program in pig farms. vaccinations that do not show the expected results may be caused by vaccination management or inadequate biosecurity practices at the internal pig farming level (delsart et al., 2020; mutua and dione, 2021). with the complexity of the problems surrounding pig farming, especially with the increasing asf pandemic in pig farms, the role of research institutions and universities is urgently needed (gunnarsson et al., 2020) to improve the effectiveness of vaccination. the model proposed in this study is able to capture the influence of institutions, namely cotable 6. the sources of technical inefficiency in piglet production farming in indonesia variable coefficient standard error constant -0.241 0.755 head of household age 0.038*** 0.012 number of household members -0.032 0.079 education of household head 0.010 0.023 gender of household head 0.255 0.332 farming experience -0.936** 0.370 feed area 0.816** 0.340 vaccination 0.594* 0.338 feed combination -0.767 0.619 access to financing 0.553 0.478 access to extension 0.398 0.392 member of cooperative -0.662* 0.399 market orientation -0.323 0.333 province -0.754** 0.368 *** p<0.01; ** p<0.05; * p<0.1; ns p>0.1 200 j. indonesian trop. anim. agric. 47(3):192-203, september 2022 operatives, in increasing the technical efficiency of piglet production farms. farmer households who join cooperatives have a greater opportunity to gain access to the required input market and the output market for the piglets they produce. members of agricultural cooperatives generally also have a higher level of technical efficiency when joining a cooperative (ma et al., 2018; qu et al., 2020; olagunju et al., 2021). conclusion the results show that the efficiency level of piglet production farms in indonesia is relatively low. the production factors of the number of livestock, feed expenditure, and capital has a positive and significant influence on the level of production. bali has the highest level of technical efficiency and also the lowest level of variation in technical efficiency. the experience of raising pigs and the implementation of vaccination have contributed to the reduction of technical inefficiency in this farm. public policy that can increase farmers' access to sows, feed and capital is expected to increase piglet production. acknowledgments authors would like to thank the department of agribusiness ipb university for access to the st2013-stu data which became the basis of this research. however, if there are omissions and errors in this paper, it is entirely the responsibility of the authors. references adetunji, m. o. and k. e. adeyemo. 2012. economic efficiency of pig production in oyo state, nigeria: a stochastic production frontier approach. am. j. exp. agric. 2:382 –394. ahmad, m. and b. e. bravo-ureta. 1996. technical efficiency measures for dairy farms using panel data: a comparison of alternative model specifications. j. product. anal. 7:399–415. aigner, d., c. a. k. lovell, and p. schmidt. 1977. formulation and estimation of stochastic frontier production function models. j. econom. 6:21–37. doi:10.1016/03044076(77)90052-5. available from: https:// linkinghub.elsevier.com/retrieve/ pii/0304407677900525 aminu, f. o. and c. e. akhigbe-ahonkhai. 2017. profitability and technical efficiency of pig production in nigeria: the case of ekiti state. agric. trop. subtrop. 50:27–35. doi:10.1515/ats-2017-0004. battese, g. e. and t. j. coelli. 1995. a model for technical inefficiency effects in a stochastic frontier production function for panel data. empir. econ. 20:325–332. belotti, f., s. daidone, g. ilardi, and v. atella. 2013. stochastic frontier analysis using stata. stata j. 13:719–758. doi:10.1177/1536867x1301300404. bps (statistics indonesia). 2020. statistik produksi daging babi menurut provinsi. bps-statistics indonesia, jakarta. budaarsa, k. 2017. east indonesia as the center of pig production. int. j. agric. innov. res. 6:2319–1473. coelli, t. and g. battese. 1996. identification of factors which influence the technical inefficiency of indian farmers. aust. j. agric. resour. econ. 40:103–128. coelli, t. j., d. s. p. rao, c. j. o’donnel, and g. e. batesse. 2005. an introduction to efficiency and productivity analysis. 2nd ed. springer science + business media, new york. colpoys, j. d., a. k. johnson, and n. k. gabler. 2016. daily feeding regimen impacts pig growth and behavior. physiol. behav. doi:10.1016/j.physbeh.2016.03.003. available from: http://dx.doi.org/10.1016/ j.physbeh.2016.03.003 dedecker, j. m., m. ellis, b. f. wolter, b. p. corrigan, s. e. curtis, and g. r. hollis. 2005. effect of stocking rate on pig performance in a wean-to-finish production system. can. j. anim. sci. 85:1–6. delsart, m., f. pol, b. dufour, n. rose, and c. piglet farming in indonesia (h. harianto and e. n. keraru) 201 fablet. 2020. pig farming in alternative systems: strengths and challenges in terms of animal welfare, biosecurity, animal health and pork safety. agric. 10:1–34. doi:10.3390/agriculture10070261. etim, n.-a. a., e. s. ebukiba, e. j. udoh, and e. u. essang. 2022. technical efficiency in swine production under different waste management techniques. world j. soc. sci. 9:38–49. doi:10.5430/wjss.v9n1p38. galanopoulos, k., s. aggelopoulos, i. kamenidou, and k. mattas. 2006. assessing the effects of managerial and production practices on the efficiency of commercial pig farming. agric. syst. 88:125–141. doi:10.1016/j.agsy.2005.03.002. gunnarsson, s., k. a. segerkvist, t. wallgren, h. hansson, and u. sonesson. 2020. a systematic mapping of research on sustainability dimensions at farm-level in pig production. sus. 12:1–15. hair, j. f., w. c. black, b. j. babin, and r. e. anderson. 2010. multivariate data analysis. vectors. 816. doi:10.1016/ j.ijpharm.2011.02.019. jabbar, m. a. and s. akter. 2008. market and other factors affecting farm specific production efficiency in pig production in vietnam. j. int. food agribus. mark. 20:29– 53. doi:10.1080/08974430802157606. jondrow, j., c. a. knox lovell, i. s. materov, and p. schmidt. 1982. on the estimation of technical inefficiency in the stochastic frontier production function model. j. econom. 19:233–238. doi:10.1016/0304-4076(82) 90004-5. available from: https:// linkinghub.elsevier.com/retrieve/ pii/0304407682900045 kementrian pertanian direktorat jenderal peternakan dan kesehatan hewan (ministry of agriculture, directorate general of animal husbandry and health). 2020. livestock and animal health statistics 2020. kementrian pertanian, jakarta. keraru, e. n., h. harianto, and y. yusalina. 2021. profitability of the three types of smallholder pig farming in indonesia: an adaptation of enterprise budgeting method. bull. anim. sci. 45:262–269. doi:10.21059/ buletinpeternak.v45i4.68763. kodde, d. a. and f. c. palm. 1986. wald criteria for jointly testing equality and inequality restrictions. econometrica. 54:1243. doi:10.2307/1912331. lansink, a. o. and s. reinhard. 2004. investigating technical efficiency and potential technological change in dutch pig farming. agric. syst. 79:353–367. doi:10.1016/ s0308-521x(03)00091-x. lekule, f. p. and n. c. kyvsgaard. 2003. improving pig husbandry in tropical resourcepoor communities and its potential to reduce risk of porcine cysticercosis. acta trop. 87:111–117. doi:10.1016/s0001706x(03)00026-3. leslie, e. e. c.,m. geong,m. abdurrahman,m. p. ward,and j. a. l. m. l. toribio. 2015. a description of smallholder pig production systems in eastern indonesia. prev. vet. med. 118:319–327. doi:10.1016/ j.prevetmed.2014.12.006. http:// dx.doi.org/10.1016/ j.prevetmed.2014.12.006 ma, w., a. renwick, p. yuan, and n. ratna. 2018. agricultural cooperative membership and technical efficiency of apple farmers in china: an analysis accounting for selectivity bias. food policy. 81:122–132. doi:10.1016/j.foodpol.2018.10.009. meeusen, w. and j. van den broeck. 1977. efficiency estimation from cobb-douglas production functions with composed error. int. econ. rev. (philadelphia). 18:435–444. doi:10.2307/2525757. mekuriaw, y. and b. asmare. 2014. assessment of pig production and constraints in mecha district, amhara region, northwestern ethiopia. adv. agric. 2014:1–5. doi:10.1155/2014/329254. mutua, f. and m. dione. 2021. the context of application of biosecurity for control of african swine fever in smallholder pig systems: current gaps and recommendations. front. vet. sci. 8:1–11. doi:10.3389/ 202 j. indonesian trop. anim. agric. 47(3):192-203, september 2022 fvets.2021.689811. mwangi, t. m., s. n. ndirangu, and h. n. isaboke. 2020. technical efficiency in tomato production among smallholder farmers in kirinyaga county, kenya. african j. agric. res. 16:667–677. doi:10.5897/ ajar2020.14727. nantima, n., m. ocaido, j. davies, m. dione, e. okoth, a. mugisha, and r. bishop. 2015. characterization of smallholder pig production systems in four districts along the uganda-kenya border. livest. res. rural dev. 27. nga, n. t. d., h. n. ninh, p. van hung, and m. l. lapar. 2014. smallholder pig value chain development in vietnam : situation analysis and trends. nairobi, kenya. available from: https://cgspace.cgiar.org/bitstream/ handle/10568/53935/ pr_situation_analysis_vietnam_web.pdf? sequence=7&isallowed=y nguyen, t.-l., t. nanseki, and y. chomei. 2016. technical efficiency and its determinants in household pig production in vietnam : a dea approach. japanese j. rural econ. 18:56–61. doi:10.18480/jjre.18.56. njoku, c. p., a. b. j. aina, o. m. sogunle, o. a. adeyemi, and o. o. oduguwa. 2013. evaluation of feed quantity offered, feeding frequency and duration of feeding on the performance of growing pigs. thai j. agric. sci. 46:181–190. olagunju, k. o., a. i. ogunniyi, z. oyetundeusman, a. o. omotayo, and b. a. awotide. 2021. does agricultural cooperative membership impact technical efficiency of maize production in nigeria: an analysis correcting for biases from observed and unobserved attributes. plos one. 16:16–18. doi:10.1371/journal.pone.0245426. patience, j. f., m. c. rossoni-serão, and n. a. gutiérrez. 2015. a review of feed efficiency in swine: biology and application. j. anim. sci. biotechnol. 6:1–9. doi:10.1186/s40104015-0031-2. phengsavanh, p., b. ogle, w. stür, b. e. frankow-lindberg, and j. e. lindberg. 2010. feeding and performance of pigs in smallholder production systems in northern lao pdr. trop. anim. health prod. 42:1627–1633. doi:10.1007/s11250-0109612-4. pierozan, c. r., p. s. agostini, j. gasa, a. k. novais, c. p. dias, r. s. k. santos, m. pereira jr, j. g. nagi, j. b. alves, and c. a. silva. 2016. factors affecting the daily feed intake and feed conversion ratio of pigs in growfinishing units: the case of a company. porc. heal. manag. 2:1–8. doi:10.1186/s40813-016-0023-4. qu, r., y. wu, j. chen, g. d. jones, w. li, s. jin, q. chang, y. cao, g. yang, z. li, and l. j. frewer. 2020. effects of agricultural cooperative society on farmers’ technical efficiency: evidence from stochastic frontier analysis. sustain. 12:1–13. doi:10.3390/su12198194. sani, a. s., j. g. sogen, and s. m. makandolu. 2020. efisiensi penggunaan faktor produksi pada usaha ternak babi skala rumah tangga di kecamatan ende timur kabupaten ende. j. nukl. peternak. 7:41– 50. sharma, k. r., p. leung, and h. m. zaleski. 1997. productive efficiency of the swine industry in hawaii : stochastic frontier vs . data envelopment analysis. j. product. anal. 8:447–459. tabe-ojong, m. p. j. and e. l. molua. 2017. technical efficiency of smallholder tomato production in semi-urban farms in cameroon: a stochastic frontier production approach. j. manag. sustain. 7:27. doi:10.5539/jms.v7n4p27. available from: http://www.ccsenet.org/journal/index.php/ jms/article/view/71395 tenaye, a. 2020. technical efficiency of smallholder agriculture in developing countries: the case of ethiopia. economies. 8. doi:10.3390/economies8020034. thanapongtharm, w., c. linard, p. chinson, s. kasemsuwan, m. visser, a. e. gaughan, m. epprech, t. p. robinson, and m. gilbert. 2016. spatial analysis and character piglet farming in indonesia (h. harianto and e. n. keraru) 203 istics of pig farming in thailand. bmc vet. res. 12:1–15. doi:10.1186/s12917016-0849-7. tian, x., f. sun, and y. zhou. 2015. technical efficiency and its determinants in china’s hog production. j. integr. agric. 14:1057– 1068. doi:10.1016/s2095-3119(14)609898. umeh, j. c., c. ogbanje, and m. a. adejo. 2015. technical efficiency analysis of pig production: a sustainable animal protein augmentation for nigerians. j. adv. agric. technol. 2:19–24. doi:10.12720/ joaat.2.1.19-24. wang, g., c. zhao, y. shen, and n. yin. 2021. estimation of cost efficiency of fattening pigs, sows, and piglets using sfa approach analysis: evidence from china. c. a. zúniga-gonzález, editor. plos one. 16:e0261240. doi:10.1371/ journal.pone.0261240. wang, h. j. and p. schmidt. 2002. one-step and two-step estimation of the effects of exogenous variables on technical efficiency levels. j. product. anal. 18:129–144. doi:10.1023/a:1016565719882. zanu, h. k., a. antwiwaa, and c. t. agyemang. 2012. factors influencing technology adoption among pig farmers in ashanti region of ghana. j. agric. technol. 8:81– 92. zhou, y., x.-h. zhang, x. tian, x. h. geng, p. zhang, and b. j. yan. 2015. technical and environmental efficiency of hog production in china a stochastic frontier production function analysis. j. integr. agric. 14:1069–1080. doi:10.1016/s2095-3119 (14)60990-4. longevity and productive lifetime traits of cow under subtropical condition (o. almasri et al.) 89 j i t a a journal of the indonesian tropical animal agriculture accredited by ditjen riset, teknologi dan pengabdian kepada masyarakat no. 164/e/kpt/2021 j. indonesian trop. anim. agric. pissn 2087-8273 eissn 2460-6278 http://ejournal.undip.ac.id/index.php/jitaa 48(2):89-100, june 2023 doi: 10.14710/jitaa.48.2. 89-100 a comparative study between shami and holstein cows for longevity and productive lifetime traits under subtropical conditions o. almasri * 1 , s. abou-bakr 2 , m. a. m. ibrahim 2 , and m. a. a. awad 2 1 general commission for scientific agricultural research, damascus, syria. 2 department of animal production, faculty of agriculture, cairo university, giza 12613, egypt. corresponding e-mail : obaidaalimasri@gmail.com; obaidaalimasri@post.agr.cu.edu.eg recieved february 19, 2023; accepted may 07, 2023 abstract this study aimed to compare the longevity and productive lifetime traits between shami and holstein cows under subtropical conditions, in addition to assess the effect of age at first calving (afc), first lactation milk yield (flmy), year and season of first calving on the studied traits in both breeds. the available data included 495 records for shami and 1129 records for holstein from birth to disposal date during the period from 1982 to 2014.the studied traits were lifespan (ls), productive life (pl), cow efficiency index (cei), number of calvings (nc), lifetime milk production (lmp), total lactation periods (tlp), lifetime daily milk production (ldmp), and total dry periods (tdp). the least squares means of ls, pl, cei and nc were 96.3±1.80 months, 73.2±2.80 months, 64.9±0.008 % and 4.3±0.12 calving for shami cows in respective order. the corresponding figures for holstein cows were 66.1±1.81 months, 43.5±2.81 months, 56.4±0.012 % and 3.5±0.19 calving, respectively. the means of lmp, tlp, ldmp and tdp were 7713±563.38 kg, 787±33.43 days, 2.7±0.13 kg and 890±25.55 days for shami cows and 14406±875.77 kg, 1049±51.96 days, 5.9±0.20 kg and 275±39.72 days for holstein, respectively.the effect of breed was highly significant (p<0.01) on all studied traits. cows for both breeds with afc less than 24 months had more pl and nc. also, cows with the highest average flmy had the highest lmp, ldmp and tlp. it could be concluded that under the subtropical conditions, shami cows exhibit superiority for longevity traits compared to holstein ones. keywords: dairy cows, longevity, productive lifetime traits, syria introduction indigenous cows are characterized by low productive performance compared to holstein ones (belay et al., 2012). however, indigenous cows play a pivotal role in the conservation of genetic biodiversity of ecosystems and increase the profit for small farmers due to their longer longevity traits, in addition to their adaptation to harsh environmental conditions especially during higher ambient temperatures and heat waves (jonkus et al., 2020). in context, mekonnen et al. mailto:obaidaalimasri@gmail.com 90 j. indonesian trop. anim. agric. 48(2):89-100, june 2023 (2020) indicated that holstein cows reared in tropical and subtropical environments produced less milk yield by 40-60% than those reared in mild and comfortable conditions. the number of cows in syria reached one million heads, the majority of them are holstein cows, whereas, the total number of shami cows was close to one thousand head representing about 0.1 % of the total cattle population in syria (annual agricultural statistical group, 2018). the shami cows are characterized by high productive and reproductive performances, as well as high resistance to many diseases such as brucella and foot and mouth diseases (awad et al., 2022). longevity and productive lifetime traits are considered the most crucial traits that influence the economic costs of dairy farms. the longevity traits of cattle are defined as the time from its birth date to the culling date (dallago et al., 2021). the natural lifespan of cattle may reach 20 years, but they were culled as much earlier than their expected life, due to their low milk production (najafabadi et al., 2016). whereas, the actual productive life of dairy cattle ranges between 3 to 4.5 years (el sabry and almasri, 2022), moreover, the highest milk yield and related outcomes happen at the fifth and sixth parity (horn et al., 2012). the intensive selection for milk yield in the holstein breed reduces its longevity traits, increases the replacement costs, and increases its sensitivity to climate change and harsh environment compared to local breeds that characterized by their high adaptation to extreme conditions (dallago et al., 2021). previous studies had been showed that longevity and productive lifetime traits are complex traits that affected by several factors such as age at first calving (nilforooshan and edriss, 2004), health (shabalina et al., 2020), conformation score (miglior et al., 2017), nutrition and management practices (fuerstwaltl et al., 2018), and replacement heifers costs (kamaldinov et al., 2021). the aims of this study were to compare the longevity and productive lifetime traits of shami and holstein cows under subtropical conditions; and to study the effect of breed, age at first calving (afc), first lactation milk yield (flmy), year and season of first calving on studied traits of shami and holstein cows. materials and methods ethical statement ethical approval was not necessary for this study because the study did not involve direct animal handling and the data were obtained from an existing database in the governmental farms. data collection data used in this study were collected from two syrian stations during the period from 1982 to 2014. the first set of data was 495 records of shami cows. the second set of data contained 1129 records of holstein cows. both stations are belonging to the ministry of agriculture and land reclamation, syria. each record included data of age at first calving, first lactation milk yield, lifespan, productive life, lifetime milk production, lifetime daily milk production, lactation periods, total drying periods and the number of calvings for each cow under study. herd management cows in the two stations were kept under almost the same conditions. cows were reared under a free housing system in semi-closed sheds. cows were fed commercial concentrates (16 % protein), hay, and fresh green fodders whenever available. roughages were provided to the cows twice a day. water was available all the time. for shami heifers, natural services were done for the first time at age 18 months with more than 250 kg of body weight. regarding holstein cows, heifers were artificially inseminated at an average age of 13-15 months with a more than 350 kg of body weight. rectal palpation was used to detect pregnancy in all cows after two months of insemination date. the machine milking was used in both stations twice daily. milk yield was recorded twice monthly to calculate the monthly and the total milk produc longevity and productive lifetime traits of cow under subtropical condition (o. almasri et al.) 91 tion for each cow. the drying period for holstein cows was about 60 days before calving, whereas shami cows were dried spontaneously. studied traits the studied traits were calculated according to sawa et al., (2019) and almasri et al., (2020) as follows: 1the longevity traits: 1.1. lifespan (ls, months) = disposal date – birth date. 2.1. productive life (pl, months) = disposal date – first calving date. 3.1. cow efficiency index (cei, %) =productive life/lifespan *100. 4.1. number of calvings (nl, calving) = total number of calvings during the productive life of a cow. 2the productive lifetime traits: 1.2. lifetime milk production (lmp, kg) = the cumulated total milk yield produced through the productive life of a cow. 2.2. total lactation periods (tlp, days) = the sum of all full lactation periods during the cow’s productive life. 3.2. life daily milk production (ldmp, kg) = lifetime milk production per number of days during the total lactation periods. 4.2. total dry periods (tdp, days) = the sum of all full dry periods during the cow’s productive life. statistical analysis in order to determine the effect of breed, afc, flmy, and year and season of first calving on the longevity and productive lifetime traits, heifers were classified into five groups according to their average of afc and flmy depending on the standard deviation distribution of them. analysis of variance was conducted using the general linear model (glm) of xlstat 2020.3.1.27 software. the statistical model was as follows: yijklmn= µ + bi + aj+ tk + rl + sm + eijklmn where: yijklmn: observation on the n th animal for the studied traits, µ : the overall mean, bi: the fixed effect of the i th breed, (i=1, 2), where, 1=shami cows and 2= holstein cows, aj: the fixed effect of the j th age at first calving (j=1, 2, 3, 4 and 5), where, 1<24, 2= 24– 27.9, 3= 28–31.9, 4= 32–35.9 and 5≥ 36 months, tk: the fixed effect of the k th first lactation milk yield (k=1, 2, 3, and 4), where, 1≤1200 kg, 2= 1200-1999, 3= 2000-2799 and 4≥2800 kg, rl: the fixed effect of the k th year of first calving (l= 1, 2 and 3); where 1<1200, 2= 12001999, and 3= 2000-2799, and 4 ≥ 2800 kg. sm: the fixed effect of the m th season of first calving (m= 1, 2, 3 and 4), where, 1= winter (december to february), 2= spring (march to may), 3= summer (june to august), and 4= autumn (september to november), and eijklmn: random error assumed n i d (0, σ 2 e ). results the longevity traits the results in table (1) indicated that shami cows had higher lifespan (ls), productive life (pl), cow efficiency index (cei) and number of calvings (nc) than holstein ones, and the differences were highly significant (p< 0.01). the pl and cei were significantly affected by afc. they were higher for cows of afc <24 months. the lsm of pl and cei were 60±4.53 months and 69.1±0.016 %, and then decreased gradually till reached 48.7±2.71 months and 52.6±0.014 % for cows had afc ≥36 months. the effect of flmy on ls, pl and cei was not significant. however, the flmy affected significantly (p<0.01) nc. it was the highest (4.3 calving) for cows produced milk less than 1200 kg in their first lactation compared to those produced milk more than 1200 kg. the ls, pl, cei and nc were highly significantly affected (p< 0.01) by the year of the first calving (table 1). it could observe that the means decreased gradually with progressing groups of the first calving. the analysis did not show any significant effect for the season of first 92 j. indonesian trop. anim. agric. 48(2):89-100, june 2023 calving on ls, pl, cei and nc (table 1). the productive lifetime traits the results in table (2) indicated that holstein cows had higher lifetime milk production (lmp), total lactation periods (tlp), lifetime daily milk production (ldmp) and shorter total dry periods (tdp) compared to shami ones.the tlp, ldmp and tdp were significantly affected by afc. however, the lmp was not affected by afc (table 2). cows calved for thefirst time at<32 months had higher ldmp, tlp, and shorter tdp compared to those calved for the first time at ≥ 32 months. the effect of flmy on all productive lifetime traits was highly significant (p<0.01). cows had high flmy produced the highest lmp, tlp and ldmp, and the shortest tdp compared to other cows (table 2) all productive lifetime traits (lmp, tlp, ldmp and tdp) were highly significant (p<0.01) affected by the year of first calving. however, the effect of the season of first calving on these traits was not significant except ldmp. the ldmp was lower (4.1 and 4.2 kg) in the summer and spring seasons compared to 4.4 kg in both winter and autumn seasons (table 2). discussion the longevity traits the significant results of shami cows for lifespan, productive life, cow efficiency index and number of calvings compared to holstein ones is due to that shami cows had more ability to tolerate and adapt to syrian subtropical environmental conditions. this result agrees with those of gandini et al. (2007) who reported that the indigenous reggiana cows had ls (71 months) and pl (48 months) longer than those of holstein ones in italy (65 and 38 months, respectively). the authors attributed that to the fertility traits which were better in indigenous reggiana cows compared to those of holstein, therefore, the holstein cows were culled early. also, cielava et al. (2017) found that the ls of latvian indigenous brown cows was 111 months longer than that of crossbred holstein black and white cows (94 months). moreover, zhang et al. (2021) stated that the holstein cows in china had shorter pl (27 months). this is due mainly to the intense genetic improvement in milk production of holstein cows which adversely affected the longevity traits. garciapeniche et al. (2006) reported that the cei was significantly affected by breed. the cei for jersey cows (48.2 %) was higher than that of holstein ones (45.9 %) in us. the significant effect of afc on both pl and cei is due to that cows calved for the first time early started their pl early compared to those calved lately, in addition, cows calved lately had poor reproductive and productive performance, so they were culled early. these results agree with those of morales et al. (2017) on retinta cows in spain, török et al. (2021) on hungarian holstein and medina et al. (2022) on honduras holstein cows. conversely, adamczyk et al. (2017) found that holstein cows calved for the first time at < 24 months had a shorter pl (64.8 months) compared to those calved lately at > 31 months (70.8 months). also, valchev et al. (2020) indicated that bulgarian holstein cows calved for the first time at ≤ 24 or ≥ 37 months had the shortest pl (48.4 and 46.8 months, respectively), whereas, the pl was the highest (58 months) when the afc for those cows ranged from 28 to 30 months. the authors attributed that heifers at this age have appropriate mature and fit body condition score for life. on the other hand, vukasinovic et al. (2001) and niforooshan and edriss (2004) indicated that the pl was not significantly affected by afc for switzerland cows and holstein cows in iran, respectively. however, the insignificant effect of afc on ls and nc is in accordance with those of mészáros et al. (2008) on slovak pinzgau cows and morales et al. (2017) on retinta cows in spain, who did not find any significant effect of afc on ls. conversely, cooke et al. (2013) and török et al. (2021) indicated that holstein cows in the uk and hungary had significantly the longest ls when they calved for the first time longevity and productive lifetime traits of cow under subtropical condition (o. almasri et al.) 93 early (< 26 months), compared to those calved lately (more than 28 months). while, kalińska et al. (2019) and valchev et al. (2020) reported that the holstein cows in poland and bulgaria that calved for the first time at < 24 months had the shortest ls (56 and 73 months, respectively) compared to 67.2 and 88 months, respectively for those calved for the first time at >30 months. moreover, froidmont et al. (2013) and medina et al. (2022) reported that the holstein cows in belgium and honduras that calved for the first time lately at > 38 months had significantly the longest ls (81.5 and 120 months, respectively) compared to 72.3 and 73 months for those calved earlier (<30 months). the significant effect of flmy on nc may be due to the negative correlation between milk production and fertility. this result agrees with that of sawa and bogucki (2017) who indicated that the holstein cows produced milk yield between 7001 and 9000 kg in their first parity had the highest nc (3.09) compared to other ones that produced more than 9000 kg. conversely, sawa and krezel-czopek (2009) did not find any significant effect for flmy on nc in polish holstein cows. table 1.least squares means and their standard errors (lsm±se) of longevity traits 1 within each classification, means not followed by the same letter differ significantly at the 5 % level; total number of records = 1624; ** (p< 0.01); ns = not significant classification 1 number of records lifespan (ls, months) productive life (pl, months) cow efficiency index (cei, %) number of calvings (nc, calving) breed ** ** ** ** shami 495 96.3 b ±1.80 66.1 b ±1.81 64.9 b ±0.008 4.3 b ±0.12 holstein 1129 73.2 a ±2.80 43.5 a ±2.81 56.4 a ±0.012 3.5 a ±0.19 age at first calving (afc, months) ns ** ** ns <24 32 82.5±4.51 60.0 b ±4.53 69.1 e ±0.016 4.1±0.30 24-27.9 769 85.0±1.86 58.6 b ±1.87 64.1 d ±0.012 4.1±0.13 28-31.9 544 84.8±1.60 55.5 b ±1.61 61.0 c ±0.011 3.9±0.11 32-35.9 177 84.7±2.28 51.2 a ±2.29 56.4 b ±0.014 3.7±0.15 ≥36 102 86.9±2.70 48.7 a; ±2.71 52.6 a ±0.014 3.6±0.18 first lactation milk yield (flmy, kg) ns ns ns ** <1200 260 90.1±3.85 60.3±3.86 62.2±0.016 4.3 b ±0.26 1200-1999 168 82.4±2.85 52.4±2.86 59.6±0.012 3.9 ab ±0.19 2000-2799 131 82.2±2.33 52.2±2.33 59. 8±0.010 3.7 a ±0.16 ≥2800 1065 84.2±2.41 54.3±2.41 61. 0±0.010 3.6 a ±0.16 year of first calving (groups) ** ** ** ** 1982-1992 397 90.1 c ±1.91 60.3 c ±1.92 62.4 b ±0.008 4.2 b ±0.13 1993-2002 623 86.4 b ±1.77 56.4 b ±1.78 61.5 b ±0.008 4.0 b ±0.12 2003-2014 604 77.9 a ±1.99 47.8 a ±2.00 58.0 a ±0.008 3.4 a ±0.13 season of first calving ns ns ns ns winter 428 84.7±1.96 54.8±1.96 60.7±0.008 3.9±0.132 spring 361 84.7±2.00 54.7±2.00 60.6±0.008 3.8±0.135 summer 418 84.8±1.95 54.8±1.96 60.6±0.008 3.8±0.131 autumn 417 84.9±1.99 54.9±2.00 60.6±0.008 3.9±0.134 94 j. indonesian trop. anim. agric. 48(2):89-100, june 2023 the non-significant effect of flmy on ls, pl and cei agrees with those of brzozowski et al. (2003) for polish cows and petrović et al. (2019) on simmental breed in serbia. on the other hand, haworth et al. (2008) reported that dairy cows produced less than 30 liters of milk/ day in the first lactation had longer ls. also, jankowska et al. (2014) indicated that polish holstein cows produced <5000 to 10000 kg of milk in their first lactation and had longer ls (63 months) than those produced< 5000 or > 10000 kg of milk in the first lactation, where their ls was 59.4 and 53.2 months, respectively. they attributed to cows that produced high milk yield in the first lactation had poor reproductive performance, thus they were culled early and their ls was shorter. whereas, marinov et al. (2020) reported that the bulgarian holstein cows had table 2. least squares means and their standard errors (lsm±se) of productive lifetime traits classification 1 lifetime milk production (lmp, kg) total lactation periods (tlp, days) lifetime daily milk production (ldmp, kg) total dry periods (tdp, days) breed ** ** ** ** shami 7713 a ±563.38 787 a ±33.43 2.7 a ±0.13 890 b ±25.55 holstein 14406 b ±875.77 1049 b ±51.96 5.9 b ±0.20 275 a ±39.72 age at first calving (afc, months) ns ** ** ** <24 10969±1412.62 956 ab ±83.82 4.6 b ±0.32 729 c ±64.07 24-27.9 11833±583.36 977 b ±34.61 4.6 b ±0.13 604 bc ±26.46 28-31.9 11256±501.64 942 ab ±29.76 4.3 ab ±0.11 567 ab ±22.75 32-35.9 10470±715.46 875 a ±42.45 3.9 a ±0.16 514 a ±32.45 ≥36 10771±844.79 842 a ±50.13 3.9 a ±0.19 497 a ±38.31 first lactation milk yield (flmy, kg) ** ** ** ** <1200 10980 a ±1204.46 913 ab ±71.47 3.6 a ±0.27 714 c ±129.53 1200-1999 9219 a ±892.54 833 a ±52.96 3.8 a ±0.20 589 bc ±60.24 2000-2799 10149 a ±728.57 885 a ±43.23 4.1 a ±0.17 552 ab ±43.66 ≥2800 13891 b ±753.33 1042 b ±44.70 5.6 b ±0.17 473 a ±43.66 year of first calving (groups) ** ** ** ** 1982-1992 11410 b ±597.95 977 b ±35.48 4.1 a ±0.136 678 c ±27.12 1993-2002 11494 b ±554.20 993 b ±32.88 4.3 a ±0.126 574 b ±25.13 2003-2014 10275 a ±622.82 785 a ±36.96 4.5 b ±0.142 495 a ±28.25 season of first calving ns ns ** ns winter 11585±612.66 932±36.35 4.4 b ±0.140 582±27.79 spring 10859±625.32 915±37.10 4.2 a ±0.143 586±28.36 summer 10603±610.11 908±36.20 4.1 a ±0.139 579±27.67 autumn 11192±623.60 918±37.0 4.4 b ±0.142 581±28.28 1 within each classification in the same column means followed by different letters differ significantly; ** (p< 0.01); ns = not significant longevity and productive lifetime traits of cow under subtropical condition (o. almasri et al.) 95 flmy up to 4000 kg and more than 10000 kg had the shortest pl (32.4 and 33.6 months, respectively) compared to 36 months for those had flmy around 4000-8000 kg milk. the authors observed that cows with low flmy were culled early. the reported tendency for shorter pl of cows with very high flmy of more than 10000 kg is an indicator of exhaustion of young cows with high first lactation productivity. also, the significant effect of periods of the year of first calving on ls, pl, cei and nc may be due to the differences in management practices from one period to another. these results are in the same line with sawa and bogucki, (2010) on holstein cows in poland, froidmont et al. (2013) on holstein cows in belgium, and singh et al. (2018) on crossbred cows (friesian × sahiwal) in india. the uneffect season of the first calving on all longevity traits could be due to the resemblance of feedstuffs in their quality and quantity as well as may be due to the uniform management practices among different seasons. this result is in accordance with those of salem and hammoud (2019) on friesian cows in egypt, froidmont et al. (2013) on holstein cows in belgium, and kučević et al. (2020) on serbian holstein cows. on the other hand, petrović et al. (2019) observed that season significantly affected cei. it was the highest (59.49 %) in summer season and the lowest (57.31 %) in autumn one. the productive lifetime traits the superiority of holstein cows over shami ones for lmp, ldmp, and tlp with shorter tdp is due to that holstein cows were exposed to an intensive genetic selection, which increased their productive performance compared to shami cows, which were not subjected to any genetic improvement program. these results were confirmed by cielava et al. (2017) who found that the black and white friesian cows had lmp (37916 kg) and ldmp (13.2 kg) more than those of native brown cows in latvia (35188kg and 10.4 kg, respectively). the significant effect (p<0.01) of afc on tlp, ldmp and tdp agrees with that of m'hamdi et al. (2010) who observed that holstein cows in tunisia that calved early had the longest tlp compared to those calved lately. also, sung et al. (2016) found that holstein cows of afc between 24 and 28 months had longer tlp (1143 days) than those calved either at < 24 months (1046 days) or > 28 months (1111 days) in korea. regarding the ldmp, sawa et al. (2019) found that the holstein cows that calved early at ages between 24.1 and 26 months had significantly higher ldmp (21.9 kg) than those calved at ages more than 32 months (19.5 kg) in poland. also, eastham et al. (2018) found that cows had afc around 22 months produced higher ldmp (15.2 kg) than those of 36 months afc (12.8 kg) in the uk. kalińska et al. (2019) indicated that the polish holstein cows that calved for the first time between 24 to 27.9 months had the highest ldmp (9.1 kg) compared to 7.8 kg for those calved for the first time at > 29.9 months.on the other hand, salem and hammoud (2019) indicated that the ldmp was not significantly affected by afc in friesian cows in egypt. there is no significant differences for lmp among cows that calved in different afc; however, the cows that calved at afc between 2431.9 months had the greater lmp. this result agrees with that of kučević et al. (2020) for holstein cows in serbia. conversely, froidmont et al. (2013) reported that holstein cows in belgium that calved for the first time at 22-26 months produced significantly the highest lmp (29340 kg) compared to the other ones that calved lately. also, teke and murat (2013) found that the highest lmp was observed when the afc was 23 months and the lowest lmp was recorded when the afc was less than 21 months, or more than 43 months of holstein cows in turkey and the differences were significant. in korea, sung et al. (2016) found that holstein cows of afc ranged between 24-28 months produced 34000 kg lmp higher than those calved either < 24 months (32000 kg) or > 28 months (33000 kg) and the difference was significant. also, hutchison et al. (2017) reported that the cows had afc < 24 months had significantly higher 96 j. indonesian trop. anim. agric. 48(2):89-100, june 2023 lmp (25184 kg) than those of 20783 kg for the cows had afc > 30 months. sawa et al. (2019) reported that holstein cows with afc between 22.1-26 months produced lmp> 25 000 kg which was significantly higher than that of 19095 kg for the cows with afc > 32 months. medina et al. (2022) found that the holstein and brown swiss cows in honduras that calved early at < 30 months scored the highest lmp (14290 kg and 15979 kg, respectively) compared with those calved lately (> 42 months),whereas the values were 10840 kg and 10411 kg, respectively, and the differences were significant. kalińska et al. (2019) indicated that polish holstein cows that calved for the first time at the age < 24 and > 28 months had significantly the lowest lmp; however, the cows that calved between 24 and 28 months produced the highest lmp. the effect of flmy on lmp, ldmp, tlp and tdp was highly significant. this is due to that the cows started their productive life with high flmy, achieved better productive performance through their subsequent lactations till culled from the herd. these results agree with those of tekerli and koçak (2009) on holstein cows under subtropical conditions, sawa and krezel-czopek (2009) on holstein friesian cows in poland, and musingi et al. (2022) on sahiwal cows in kenya. the significant effect of year of the first calving on productive lifetime traits in this study may be due to variations in management policies and environmental conditions through different years. these results agree with those of berihulay and mekasha (2016) on holstein friesian cows in ethiopia, froidmont et al. (2013) on holstein cows in belgium, petrović et al. (2019) on simmental cows in serbia, and manzi et al. (2020) on the ankole cow and ankole crossbred cows of rwanda. additionally, the effect of the season of first calving on all productive lifetime traits was not significant except on ldmp. this is due to there were no differences in feedstuff and climate conditions among different season. whereas, the significant effect of the season of first calving on ldmp may be attributed to the cows calved in winter and autumn having high lmp and nc. this result agrees with that of berihulay and mekasha (2016) on holstein cows in ethiopia. conversely, froidmont et al. (2013) reported that holstein cows in belgium that calved for the first time during the spring season produced significantly the lowest lmp (26243 kg); however, the highest lmp (27705 kg) was recorded during the summer season. also, kučević et al. (2020) indicated that the effect of the season of first calving on ldmp was not significant on serbian holstein cows. however, in india, singh and singh (2016) reported that sahiwal cows that calved in summer had lower tlp (1471 days) than those cows that calved in winter (1602 days). conclusion it could be concluded that under the subtropical environmental conditions, holstein cows are more sensitive to high ambient temperatures and harsh environments compared to shami cows. therefore, holstein cows may have lower values for lifespan, productive life, cow efficiency index, and number of calvings compared to shami cows. consequently, shami cows are considered promising local genetic resources that could guarantee more economic efficiency and suitability in the long term than holstein cows, especially for smallholder farmers. thence, shami cows should be subjected to sustainable genetic improvement for their productive and reproductive performance along with the suitable management practices. acknowledgement the authors are grateful to the islamic development bank (isdb) for their financial support to the first author and for providing necessary facilities for conducting this work. conflict of interest there are no conflicts regarding the publication of this manuscript. longevity and productive lifetime traits of cow under subtropical condition (o. almasri et al.) 97 references adamczyk, k., j. makulska, w. jagusiak and a. weglarz. 2017. associations between strain, herd size, age at first calving, culling reason and lifetime performance characteristics in holstein-friesian cows. animal. 11 (2): 327–334. doi: 10.1017/ s1751731116001348 almasri, o., s. abou-bakr and m.a.m. ibrahim. 2020. effect of age at first calving and first lactation milk yield on productive life traits of syrian shami cows. egyptian j. anim. prod. 57(2):81-87. doi: 10.21608/ ejap.2020.104022 annual agricultural statistical group. 2018. statistics office. ministry of agriculture and land reclamation syria. awad, m.a.a., o.a. almasri, m.a.m. ibrahim, r.r. sadek and s. abou-bakr. 2022. characterization of the lactation curve in shami cows. advances in animal and veterinary science. 10(4):786-794. doi https:// dx.doi.org/10.17582/ journal.aavs/2022/10.4.786.794 belay, d., k. yisehak and g.p. janssens. 2012. productive and reproductive performance of zebu x holstein-friesian crossbred dairy cows in jimma town, oromia, ethiopia. global veterinarian. 8 (1): 67-72. berihulay, h. and y. mekasha. 2016. breeding efficiency and lifetime production performance of holstein-friesian dairy cows at alage dairy farm, south western ethiopia. livestock research for rural development. volume 28, article #157. retrieved september 14, 2022, from http://www.lrrd.org/lrrd28/9/beri28157.html brzozowski, p., w. empel, k. zdziarski and h. grodzki. 2003. influence of cows’ health and their milk yield during first lactation on their productive life and life-time milk yield. polish vet med. 59: 626-2. cielava, l., d. jonkus and l. paura. 2017. the effect of cow reproductive traits on lifetime productivity and longevity. international journal of animal and veterinary sciences. 11(3): 220-223. cooke, j. s., z. cheng, n.e. bourne and d.c. wathes. 2013. association between growth rates, age at first calving and subsequent fertility, milk production and survival in holstein-friesian heifers. open j. anim. sci. 3: 1–12. doi: 10.4236/ojas.2013.31001 dallago, g. m., k.m. wade, r.i. cue, j.t. mcclure, r. lacroix, d. pellerin and e. vasseur. 2021. review. keeping dairy cows for longer: a critical literature review on dairy cow longevity in high milk -producing countries. animals. 11(808):126. eastham, n. t., a. coates, p. cripps, h. richardson, r. smith and g. oikonomou. 2018. associations between age at first calving and subsequent lactation performance in uk holstein and holstein-friesian dairy cows. plosone. 13 (6): e0197764. doi: 10.1371/ journal.pone.0197764 el sabry, m.i. and o. almasri. 2022.space allowance: a tool for improving behavior, milk and meat production, and reproduction performance of buffalo in different housing systems—a review. tropical animal health and production 54 (5), 266. https:// doi.org/10.1007/s11250-022-03247-y froidmont, e., p. mayeres, p. picron, a. turlot, v. planchon and d. stilmant. 2013. association between age at first calving, year and season of first calving and milk production in holstein cows.animal. 7(4): 665–672. doi:10.1017/s1751731112001577 fuerst-waltl, b., t. aichhorn and c. fuerst. 2018. mountain pasturing of rearing stock reduces the culling risk as dairy cows. int. j. anim. bio sci. 13: 209–212. doi: 10.1017/ s1751731118001465 gandini, g., c. maltecca, f. pizzi, a. bagnato and r. rizzi. 2007. comparing local and commercial breeds on functional traits and profitability: the case of reggiana dairy cattle. journal of dairy science. 90(4):20042011. doi: https://doi.org/10.3168/jds.2006 -204 garcia-peniche, t. b., b. g. cassell and i. https://doi.org/10.1017/s1751731116001348 https://doi.org/10.1017/s1751731116001348 https://dx.doi.org/10.21608/ejap.2020.104022 https://dx.doi.org/10.21608/ejap.2020.104022 http://dx.doi.org/10.4236/ojas.2013.31001 https://doi.org/10.1371/journal.pone.0197764 https://doi.org/10.1371/journal.pone.0197764 https://scholar.google.com.eg/citations?view_op=view_citation&hl=en&user=e1fnc0oaaaaj&sortby=pubdate&citation_for_view=e1fnc0oaaaaj:4fkuyhm3qg0c https://scholar.google.com.eg/citations?view_op=view_citation&hl=en&user=e1fnc0oaaaaj&sortby=pubdate&citation_for_view=e1fnc0oaaaaj:4fkuyhm3qg0c https://scholar.google.com.eg/citations?view_op=view_citation&hl=en&user=e1fnc0oaaaaj&sortby=pubdate&citation_for_view=e1fnc0oaaaaj:4fkuyhm3qg0c https://scholar.google.com.eg/citations?view_op=view_citation&hl=en&user=e1fnc0oaaaaj&sortby=pubdate&citation_for_view=e1fnc0oaaaaj:4fkuyhm3qg0c https://scholar.google.com.eg/citations?view_op=view_citation&hl=en&user=e1fnc0oaaaaj&sortby=pubdate&citation_for_view=e1fnc0oaaaaj:4fkuyhm3qg0c https://doi.org/10.3168/jds.2006-204 https://doi.org/10.3168/jds.2006-204 98 j. indonesian trop. anim. agric. 48(2):89-100, june 2023 miszta. 2006. effects of breed and region on longevity traits through five years of age in brown swiss, holstein, and jersey cows in the united states. j. dairy sci. 89:3672– 3680. haworth, g. m., w. p. tranter, j. n. chuck, z. cheng and d. c. wathes. 2008. relationships between age at first calving and first lactation milk yield, and lifetime productivity and longevity in dairy cows. veterinary record.17:162(20):643-7. doi: 10.1136/ vr.162.20.643 horn, m., w. knaus, l. kirner and a. steinwidder. 2012. economic evaluation of longevity in organic dairy cows. organic agriculture. 2: 127–143. https://doi.org/10.1007/ s13165-012-0027-6 hutchison, j. l., d. j. van raden, j.b. cole and d.m. bickhartt. 2017. genomic evaluation of age at first calving. j. dairy sci. 100: 1– 9. doi: 10.3168/jds.2016-12060 jankowska, m., a. sawa and j. kujawska. 2014. effect of certain factors on the longevity and culling of cows. acta sci. pol., zootech. 13: 19–30. jonkus, d., l. paura and l. cielava. 2020. longevity and milk production efficiency of latvian local breeds during last decades. agronomy research. 18(s2):1316–1322. kalińska, a., j. slósarz, m. gołębiewski, a. wójcik, t. przysucha and b. kruzińska. 2019. the impact of age at the first calving on lifetime milk yield, life span and herd life of dairy cows. animal science. 58 (3): 215–221. doi 10.22630/aas.2019.58.3.21 kamaldinov, e. v., o.d. panferova, o.v. efremova, v.g. marenkova, a.f. petrov and i.n. ryumkina. 2021. assessment of the variability of reproductive abilities of a black and white cattle using genealogical data and paratypical factors. data in brief 35 (2021) 106842. http:// creativecommons.org/licenses/by-nc-nd/4.0/ kučević, d., s. trivunović, z. šoronja, d. janković, d. stanojević, r. đedović and t. papović. 2020. association between age at first calving and milk production in first lactation on longevity traits in holstein cows. biotechnology in animal husbandry. 36 (1):27-35. https://doi.org/10.2298/ bah2001027k manzi, m., l. rydhmer, m. ntawubizi, c. d’andrehirwa, c. karege and e. strandberg. 2020. milk production and lactation length in ankole cattle and ankole crossbreds in rwanda. tropical animal health and production. 52:2937–2943. doi: https:// doi.org/10.1007/s11250-020-02311-9 marinov, iv., v. valchev, d. dimov and t. penev. 2020. relation between first lactation milk yield and functional traits in dairy cows. agronomy research 18(3): 21272137. https://doi.org/10.15159/ar.20.229 medina, k.a.c., m.v. rodas, j.j.b. rodríguez, j.g.m.m. monforte and j.c.s. correa. 2022. effect of early age at first calving on longevity, number of days in production and lifetime milk yield of holstein and brown swiss dairy cows in honduras. revista mexicana de ciencias pecuarias.13(1):163174. https://doi.org/10.22319/ rmcp.v13i1.5444 m mekonnen, t., y. tadesse and s. meseret. 2020. genetic improvement strategy of indigenous cattle breeds: effect of cattle crossbreeding program in production performances. journal of applied life sciences international. 23(1): 23-40. doi:10.9734/ jalsi/2020/v23i130140 mészáros, g., j. wolf and o. kadlečík. 2008. factors affecting the functional length of productive life in slovak pinzgau cows. czech journal of animal science. 53: 9197. doi:10.17221/2712-cjas m'hamdi, n., r. aloulou, m. bouallegue, k.b. satinder and m. ben hamouda. 2010. study of functional longevity of tunisian holstein dairy cattle using a weibull proportional hazard model. livestock science. 132: 173-176. doi10.1016/ j.livsci.2010.05.011 miglior, f., a. fleming, f. malchiodi, l.f. brito, p. martin and c. f. baes, 2017. a 100-year review: identification and genetic selection https://pubmed.ncbi.nlm.nih.gov/?term=haworth+gm&cauthor_id=18487583 https://pubmed.ncbi.nlm.nih.gov/?term=tranter+wp&cauthor_id=18487583 https://pubmed.ncbi.nlm.nih.gov/?term=chuck+jn&cauthor_id=18487583 https://pubmed.ncbi.nlm.nih.gov/?term=cheng+z&cauthor_id=18487583 https://pubmed.ncbi.nlm.nih.gov/?term=cheng+z&cauthor_id=18487583 https://pubmed.ncbi.nlm.nih.gov/?term=wathes+dc&cauthor_id=18487583 https://doi.org/10.1136/vr.162.20.643 https://doi.org/10.1136/vr.162.20.643 https://link.springer.com/article/10.1007/s13165-012-0027-6#auth-a_-steinwidder https://link.springer.com/article/10.1007/s13165-012-0027-6#auth-a_-steinwidder http://creativecommons.org/licenses/by-nc-nd/4.0/ http://creativecommons.org/licenses/by-nc-nd/4.0/ https://doi.org/10.15159/ar.20.229 http://dx.doi.org/10.9734/jalsi/2020/v23i130140 http://dx.doi.org/10.9734/jalsi/2020/v23i130140 http://dx.doi.org/10.17221/2712-cjas http://dx.doi.org/10.1016%2fj.livsci.2010.05.011 http://dx.doi.org/10.1016%2fj.livsci.2010.05.011 longevity and productive lifetime traits of cow under subtropical condition (o. almasri et al.) 99 of economically important traits in dairy cattle. j. dairy sci. 100:10251. doi: 10.3168/jds.2017-12968 moralesa, r., f. phocasb, m. soléc, s. demydapeyrásd, a. menéndez-buxaderaa and a. molina. 2017. breeding beef cattle for an extended productive life: evaluation of selection criteria in the retinta breed. livestock science. 204: 115–121. http:// dx.doi.org/10.1016/j.livsci.2017.08.014 musingi, b. m., l. m. mahianyu and d. m. musingi. 2022. evaluation of the genetic relationship between longevity and growth, milk yield and fertility traits in the sahiwal breed in kenya. open journal of animal sciences. 12:16-35.doi:10.4236/ ojas.2022.121002 najafabadi, h.a., s.a. mahayari, m.a. edriss and e. strapakova. 2016. genetic analysis of productive life length in holstein dairy cows using weibull proportional risk model. arch. anim. breed. 59: 387–393. doi: 10.5194/aab-59-387-2016 nilforooshan, m. a. and m.a. edriss. 2004. effect of age at first calving on some productive and longevity traits in iranian holsteins of the isfahan province. j. dairy sci. 87: 2130-2135. https://doi.org/10.3168/ jds.s0022-0302(04)70032-6 petrović, m., s. rakonjac, v. bogdanović, s. bogosavljević-bošković, r. đoković, r. đedović and m. petrović. 2019. effect of non-genetic factors on longevity traits in simmental cows. biotechnology in animal husbandry. 35 (3): 229-241. https:// doi.org/10.2298/bah1903229p salem, m. m.i and m.h. hammoud. 2019. genetic evaluation of some productive lifetime traits of locally born friesian cows in egypt. egyptian j. anim. prod. 56(2):39-45. https://www.researchgate.net/ publication/334824710 sawa, a. and m. bogucki. 2010. effect of some factors on cow longevity. arch. tierzucht. 53: 403-414.doi:10.5194/aab-53-403-2010 sawa, a. and m. bogucki. 2017. longevity of cows depending on their first lactation yield and herd production level. ann. anim. sci. 17(4): 1171–1183. doi:10.1515/aoas-20160096 sawa, a. and s. krezel-czopek. 2009. effect of first lactation milk yield on efficiency of cows in herds with different production levels. archivtierzucht. 52 (1): 7-14. doi:10.5194/aab-52-7-2009 sawa, a., k. siatka and s. krężel-czopek. 2019. effect of age at first calving on first lactation milk yield, lifetime milk production and longevity of cows, annals of animal science. 19: 189-200. doi: 10.2478/ aoas-2018-0044 shabalina, t., t. yin and s. knig. 2020. influence of common health disorders on the length of productive life and stay ability in german holstein cows. j. dairy sci. 103, 583–596. doi: 10.3168/jds.2019-16985 singh, j. and c.v. singh. 2016. genetic and phenotypic parameters of first lactation and life time traits in sahiwal cows. journal of veterinary science &veterinary science & technology. 7:4. doi: 10.4172/21577579.1000345. singh, s., d. chakraborty, a.k. das, r.k. taggar, n. kumar and d. kumar. 2018. factors affecting lifetime performance traits in frieswal cows. international journal of fauna and biological studies. 5(3): 203-205. sung, m. k., s. c. lee, j. k. jeong, i. s. choi, s.h. moon, g.k. hyun and h. k. ill. 2016. effect of age at first calving on productive and reproductive performance in dairy cattle. j. vet. clin. 33(2) : 93-96. http:// dx.doi.org/10.17555/jvc.2016.04.33.2.93 teke, b. and h. murat. 2013. effect of age at first calving on first lactation milk yield, lifetime milk yield and lifetime in turkish holsteins of the mediterranean region in turkey bulgarian journal of agricultural science. 19 (no 5): 1126-1129. tekerli, m. and s. koçak. 2009. relationships between production and fertility traits in first lactation and life time performances of holstein cows under subtropical condition. arch. tierz. 52 (4): 364–370. doi:10.5194/ http://dx.doi.org/10.1016/j.livsci.2017.08.014 http://dx.doi.org/10.1016/j.livsci.2017.08.014 http://dx.doi.org/10.4236/ojas.2022.121002 http://dx.doi.org/10.4236/ojas.2022.121002 https://doi.org/10.3168/jds.s0022-0302(04)70032-6 https://doi.org/10.3168/jds.s0022-0302(04)70032-6 http://dx.doi.org/10.5194/aab-53-403-2010 https://doi.org/10.1515/aoas-2016-0096 https://doi.org/10.1515/aoas-2016-0096 http://dx.doi.org/10.5194/aab-52-7-2009 http://dx.doi.org/10.17555/jvc.2016.04.33.2.93 http://dx.doi.org/10.17555/jvc.2016.04.33.2.93 http://dx.doi.org/10.5194/aab-52-364-2009 100 j. indonesian trop. anim. agric. 48(2):89-100, june 2023 aab-52-364-2009 törö, e., i. komlósi, v. sz˝onyi, b. béri, g. mészáros and j. posta. 2021. combinations of linear type traits affecting the longevity in hungarian holstein-friesian cows. animals. 11: 3065. https:// doi.org/10.3390/ ani11113065 valchev, v., i. marinov and t. angelova. 2020. relationship between age at first calving and longevity and productive life in holstein cows. actauniversitatisagriculturaeet silviculturaemendelianaebrunensis. 68(5): 867–874. doi: 10.11118/ actaun202068050867 vukasinovic, n., j. moll and l. casanova. 2001. implementation of a routine genetic evaluation for longevity based on survival analysis techniques in dairy cattle in switzerland. journal of dairy science. 84 (9): 2073– 2080. https://doi.org/10.3168/jds.s00220302(01)74652-8 zhang, h., a. liu, y. wang, h. luo, x. yan, x. guo, x. li, l. liu and g. su. 2021. genetic parameters and genome-wide association studies of eight longevity traits representing either full or partial lifespan in chinese holsteins. front. genet. 12:634986. doi: 10.3389/fgene.2021.634986 http://dx.doi.org/10.5194/aab-52-364-2009 https://doi.org/10.3168/jds.s0022-0302(01)74652-8 https://doi.org/10.3168/jds.s0022-0302(01)74652-8 the different type of bedding in suckling holstein calves (s.m.j. hosseini et al.) 236 j i t a a journal of the indonesian tropical animal agriculture accredited by ditjen penguatan risbang no. 60/e/kpt/2016 j. indonesian trop. anim. agric. pissn 2087-8273 eissn 2460-6278 http://ejournal.undip.ac.id/index.php/jitaa 46(3):236-247, september 2021 doi: 10.14710/jitaa.46.3.236-247 the effects of different types of bedding on the performance, skeletal and behavioral characteristics, hygienic and immunity conditions of suckling holstein calves s. m. j. hosseini, t. tanha* and h. maghsoodi department of animal science, faculty of agriculture, payame noor university, tehran, iran *corresponding e-mail: t.tanha@pnu.ac.ir received february 22, 2021; accepted july 10, 2021 abstrak kajian menginvestigasi pengaruh jenis alas kandang pada kinerja, karakteristik kerangka dan perilaku, kondisi kesehatan dan kekebalan pedet sapi holstein yang menyusui, percobaan dilakukan dalam desain acak lengkap menggunakan 80 pedet sapi holstein. pedet sapi dibagi menjadi 5 perlakuan dan 4 ulangan (setiap ulangan terdiri dari 2 ekor jantan dan 2 ekor betina). lima perlakuan percobaan adalah sekam, jerami, ampas tebu, pasir, atau “mat”. hasil penelitian menunjukkan bahwa konsumsi pakan tertinggi terdapat pada pasir dan alas sekam dan pertambahan bobot tertinggi terdapat pada sekam, jerami dan sandbedding (p<0,05). tinggi layu tertinggi dan terendah masing-masing untuk perlakuan jerami dan tikar (p<0,05). waktu berdiri dan istirahat terpanjang dalam perilaku pedet sapi ditemukan untuk perlakuan pasir dan jerami, masing-masing (p<0,05). pada skor kebersihan, hidung, mata, dan sendi, jumlah kontaminasi tertinggi terkait dengan perlakuan “mat” dan pasir (p<0,05). untuk parameter imunitas, perlakuan ampas tebu menunjukkan kadar eosinofil paling tinggi dibandingkan perlakuan lainnya (p<0,05). hasil penelitian menyimpulkan bahwa alas kandang jerami memiliki karakteristik pertumbuhan, perilaku, dan kesehatan pedet yang lebih baik dibandingkan dengan jenis alas kandang lainnya. kata kunci: pedet holstein, alas kandang, imunitas, perilaku, performa. abstract to investigate the effects of bedding types on the performance, skeletal and behavioral characteristics, health and immunity conditions of suckling holstein calves, an experiment was conducted in a completely randomized design using 80 holstein calves. the calves were distributed over 5 treatments and 4 replicates (each replicate included 2 male and 2 female calves). the 5 experimental treatments werechaff, straw, bagasse, sand, or mat. the results showed that the highest feed intake was related to the sand and chaff beddings and the highest weight gain (p<0.05) was found for the chaff, straw and mailto:teymurtanha@yahoo.com 237 j.indonesian trop.anim.agric. 46(3):236-247, september 2021 sandbeddings . withers height was highest and lowest for straw and mat treatments, respectively (p<0.05). the longest standing and resting times in calf behavior (p<0.05) were found for the sand and straw treatments, respectively. in cleanness, nose, eye, and joint scorings, the highest amount of contamination was related (p<0.05) to the mat and sand treatments . for immunity parameters, bagasse treatment showed the highest level of eosinophils (p<0.05) compared to the other treatments. according to the results, it can be concluded that the straw bedding has better characteristics for growth, behavior, and health of calves compared to the other beddings. keywords: holstein, bedding, immunity, behavior, performance. introduction farm animal welfare has always been one of the most important issues in the field of animal sciences. paying attention to animal welfare is very effective in reducing diseases and their consequences and thus affecting the economic outcome (ahmadi et al., 2019; poorghasemi et al., 2017). in this regard, studies have proposed several indicators for animal well-being. design, size and type of bedding, floor type of stand and corridors, stand cleanness, livestock behavior and social interactions, management, livestock density in the stand, weather conditions and heat stress, ventilation, amount of walkway area, manger, and drinking place are among the indicators (slozhenkina et al., 2020; ahmadi et al., 2018; poorghasemi et al., 2013). suckling calves are no exception. each farm has a section for keeping calves, which should have some characteristics to provide livestock comfort (boujenane, 2019; leach et al., 2015). to create livestock comfort, different factors such as the type of bedding, the dimensions of the stand, proper ventilation, proper feed, etc. must be considered. each of these factors has direct effects on the life quality of calves (pirzadehnaeiny et al., 2019). bedding is one of the most important factors affecting calf growth. in general, beddings are divided into organic and inorganic groups. straw, sawdust, wood chips, bagasse, and dry manure are among the organic beddings (meng et al., 2015).the main disadvantage of this type of beddings is the rapid growth of bacteria due to increased moisture. the presence of moisture, which is one of the conditions for the growth of microbes, causes a rapid increase in bacteria in this type of bedding in 24 hours (meng et al., 2015). in these types of beddings, the particle size of the bedding constituents is also important because the smaller the particles, the more the bedding material comes into contact with the animal's body and causes more bacteria to be transferred to the animal (eklind and kirchmann, 2000). inorganic beddings include sand, rubber mattresses and beddings, which can be the best bedding for livestock from a microbiological point of view. the advantages of this types of beddingare the absence of carbon and nitrogen, which help the growth of microbes, low capacity to retain moisture and their soft tissue,which provides comfort for livestock (eklind and kirchmann, 2000). regarding the advantages and disadvantages of inorganic beddings, various cases have been mentioned, the most important of which is poor management regarding buying the proper inorganic bedding and also lack of knowledge on how to manage its use in livestock resting areas (eklind and kirchmann, 2000). different factors such as the type of bedding, the dimensions of the place, proper ventilation and proper feed should be considered to create livestock comfort. each of these factors has a direct impact on the quality of life of the calf. the bedding is one of the most effective factors that affect the growth of calves. in addition to the importance of bedding type for cleaning, drying, and keeping calves comfortable and healthy, how the different type of bedding in suckling holstein calves (s.m.j. hosseini et al.) 238 bedding types affect calf growth performance and health can also be important in terms of innovation in calf breeding. therefore, this study aimed to evaluate the effect of five types of bedding on calf performance, health, and behavior. materials and methods eighty calves were used for this experiment. the initial condition of the calf was examined after birth in the maternity ward. according to the standard, single-born calves over 37 kg for males and 35 kg for females with no calving difficulty and physical problems were selected for the experiment. after feeding colostrum in the first six hours of life, calves were randomly divided into 5 treatments and 4 replicates (each replicate included 2 male calves and 2 female calves). experimental treatments included 1chaff, 2straw, 3bagasse, 4sand, and 5rubber? mat. to prepare the treatments, first, the beddings were properly washed and the beds with almost equal height were filled on the ceiled area. for this purpose, 15 kg chaff bedding, 10 kg straw bedding, 15 kg bagasse bedding, 130 kg sand bedding, and one layer of mat bedding were placed in each box. during the growing period (1 to 70 days) the calves, in addition to consuming milk twice a day (4 liters per day) had free access to a completely mixed diet. these diets were adjusted using the nrc (2011). the nutrients used in the diet and its chemical composition are presented in table 1. performance the feeds were weighed daily from the first day with a digital scale and given to each calf up tothe amount of their appetite. subtracting the remaining amount of feed from the initial amount in the next morning, the amount of feed intake for each calf was recorded and finally, the feed intake for the whole period was calculated. the weighing was performed every 14 days before feeding in the morning. to obtain the average weight gain of the entire period, the differ table 1. nutritional values and chemical compounds of starter diet percentage in diet chemical compounds percentage in diet dietary compounds 89.1 dm 10 barley 83.51 tdn 5 wheat barn 17.6 cp 45 corn grain 6.01 cf 25.6 soybean meal 8.712 ee 10 full-fat soybean 11 ndf 0.5 di-calcium phosphate 5.7 adf 1 sodium bicarbonate 1.2 ca 1.2 calcium carbonate 0.55 p 0.5 salt 0.2 toxinbinders 0.5 vitamin supplement 1 0.5 mineral supplement 2 100 total dm: dry matter; tdn: total digestible nutrients; cp: crude protein; cf: crude fiber; ee: ether extracts; ndf: neutral detergent fiber and adf: acid detergent fiber 1 vitamin premix (mg/kg diet): vitamin a: 4500000 iu; vitamin d3: 40000 iu; vitamin e: 350 iu and monensin: 50 mg. 2 mineral premix: ca: 1 % dm; p: 0.46 % dm; mg: 0.26 % dm; cu: 25 ppm; co: 0.5 ppm; i: 0.6 ppm; fe: 80 ppm; mn: 41 ppm; zn: 51 ppm and se: 0.3 ppm. 239 j.indonesian trop.anim.agric. 46(3):236-247, september 2021 ence in the amount of weight at the end of the breeding period of each calf from the birth weight was divided by the number of days spent in the period. finally, the feed conversion ratio for each calf was obtained by dividing the feed intake of the entire period by the amount of body weight gain in the entire period. measurement of skeletal characteristics the criteria including body length, chest circumference, abdominal circumference, withers height, and pelvic width were used to measure skeletal characteristics. body length was measured from the front part of the humero radial joint of the elbow to the pin bone (the prominent pelvis part of the tuber coxae). measurement of chest circumference was performed exactly from the olecranon joint of the elbow so that the meter rotated in a complete oval around the front ribs and then the number was recorded. abdominal circumference was measured as an oval from the end of the ribs. the height of the calf was measured from the withers area with the calf standing straight with its head up. two pelvic bulges of the wing of ilium bones were used to measure pelvic width, regardless of the bulge in the area where the tail grows (sharifi et al., 2017). behavior calf behavior was recorded to assess the activity and well-being of the calves. behaviors were examined in nutritional and non-nutritional contexts. nutritional behaviors included duration of feed intake, duration of water drinking, milk drinking, and non-nutritional behaviors including sitting, standing, resting, and bucket licking. behavioral studies of calf behaviors for each treatment were recorded on days 15, 16, 30, 31, 60, and 61. the measurements were taken every 5 minutes for 8 hours per day from 9 am to 5pm to include one milk feeding in the schedule (seifzadeh et al., 2019). hygiene status of calves at this stage, scoring on cleanness, eye health, ear health, nose health, cough condition, and scratch condition in the hock joint area was performed on days 1, 15, 30, and 60. scores were were on a scale from0 to 3. the cleanness score of 0was assigned toa clean back, thighs, and hooves free of feces; the cleanness score of 1 was assigned to a partial or no smeared back, low smeared thighs and hooves; the cleanness score of 2 was assigned to a 2/3 smeared thighs and hooves as well as the pelvis; the cleanness score of 3 was assigned to a complete smeared hooves and thighs so that the cover of the body was not visible and the back of the calf was completely smeared with feces. for eye scoring, the score of 0 was assigned to two healthy and transparent eyes free of any infection; the score of 1 was assigned to colorless tear discharges that cause wetting around the calf's eye; the score of 2 was assigned to tear secretions with a unilateral eye infection and loss of eye transparency; the score of 3 was assigned to the bilateral ocular discharges. for ear scoring, the score of 0 was assigned to two healthy ears and a normal state, free of any hanging or problematic postures; the score of 1 was assigned to shaking the ear or shaking the head; the score of 2 was assigned to one hanging ear; the score of 3 was assigned to shaking the head vigorously and two hanging ears of the calf. for nasal scores, the score of 0 was assigned to clean and normal nostrils, with colorless and natural moisture; the score of 1 was assigned to low one-side creamy discharge; the score of 2 was assigned to severe bilateral mucus shedding and low two-side creamy discharge; the score of 3 was assigned to severe bilateral purulent discharges from the nose. for cough scoring, the score of 0 was assigned to normal mode; the score of 1 was assigned to single cough; the score of 2 was assigned to consecutive coughs in a short period; the score of 3 was assigned to continuous coughs that interfere with breathing. finally, for the scratch scoring in the hock joint area, the score of 0 was assigned to the normal condition of the hock joint area, the score of 1 was assigned to untidy hair in the hock joint area, the score of 2 was assigned to untidy hair and the different type of bedding in suckling holstein calves (s.m.j. hosseini et al.) 240 table 2. the effect of experimental treatments on calf performance sem p-value mat sand bagasse straw chaff performance traits 0.04 0.031 0.523 b 0.655 a 0.566 ab 0.604 ab 0.622 a feed consumption (kg dm/cow per day) 0.03 0.028 0.800 ab 0.853 a 0.746 b 0.854 a 0.849 a body weight gain (kg/cow per day) 0.04 0.029 0.65 b 0.76 a 0.76 a 0.70 ab 0.73 ab feed conversion ratio dm: dry matter. the means within the same row with at least one common letter, do not have a significant difference (p<0.05). sem: standard error of the means. hair loss in some areas of the hock joint andthe surrounding area; the score of 3 was assigned to intense hair loss so that the skin is directly visible (rowbotham and ruegg, 2016). blood immunity parameters to measure blood cells, blood samples were taken from the jugular vein of the calves at 70 days of age under hygienic conditions. blood samples were transferred to the test tubes containing the anticoagulant edta and used for differential counting of white blood cells (heterophils, lymphocytes, monocytes, eosinophils). giemsa staining technique and light microscope (e =×100) were used for this purpose (leso et al. 2020). statistical analysis of data the collected data were statistically analyzed in a completely randomized design using the general linear model (glm) and statistical software sas (2004). the comparison of the means were performed using duncan’s test at 5% probability level. the statistical model of the design was yij = μ + ai + eij. in this model, yij was the value of each observation for the studied trait, µ was the average of the observations, ai was the effect of experimental treatments and eij was the effect of experimental error. results the results of the effects of the experimental treatments on calf performance are presented in table 2. the highest feed intake was related to the sand and chaff beddings and the lowest consumption was related to the mat bedding (p<0.05). also, highest weight gain was related to the sand, chaff and straw, whereas the lowest weight gain was related to the bagasse (p<0.05). the feed conversion ratio of calves on mat bedding was significantly reduced, i.e. improved, compared to the bagasse and sand treatments (p<0.05). the results on the effects of the experimental treatments on the skeletal characteristics of the calves are presented in table 3. almost no significant effects were found for any period or trait, with the exception of body length at 1 month of age and wither height in the finisher period. after one month, the calves with mat bedding had the lowest body length, which was significantly reduced compared to the other treatments (p<0.05). at the beginning of the period, the average height from the withers in all groups was 80 to 81 cm, which indicated the uniformity of the cattle (p>0.05). at one month of age, no significant difference was observed in the height growth of the calves and the calves had a height growth of about 10 to 15 cm (p>0.05). at the end of the period, calves under the straw treatment and the mat treatment had the highest and lowest height, with 99.2 cm and 95.9 cm, respectively, which was a significant difference between the two treatments (p<0.05). the results related to the effect of experimental treatments on the behavior of calves are presented in table 4. the highest feeding time 241 j.indonesian trop.anim.agric. 46(3):236-247, september 2021 table 3. the effect of experimental treatments on the skeletal characteristics of calves sem p-value treatments parameters mat sand bagasse straw chaff body length 2.46 0.74 66.4 63.3 61.8 65.3 65.1 starter period 1.50 0.006 71.2 b 79.5 a 76.4 a 78 a 77.5 a one month of age 2.20 0.28 95.3 101 98.7 96.8 100.8 finisher period chest circumference 1.03 0.46 81.9 81.5 83 81.3 80.2 starter period 1.02 0.35 93.4 93.5 94.9 92.3 92.3 one month of age 1.19 0.47 109 112 109.5 110.3 110.2 finisher period abdominal circumference 1.71 0.40 83.3 83.8 79.5 82.9 81 starter period 1.27 0.38 96 96.9 96.3 96 93.5 one month of age 1.74 0.67 120.1 121.4 120.4 124.6 121 finisher period height from the withers 0.693 0.97 80.1 80.1 80.1 80.3 80.6 starter period 0.680 0.21 84.4 86 85.4 84.2 85.8 one month of age 1.02 0.05 95.9 b 97.9 ab 96.7 ab 99.2 a 97.3 ab finisher period pelvic width 0.382 0.20 21.4 21.6 20.9 20.8 21 starter period 0.287 0.56 24.8 25.3 25 24.9 25.4 one month of age 0.719 0.55 28.9 29.2 29.1 30 29.3 finisher period the means within the same row with at least one common letter, do not have a significant difference (p<0.05). sem: standard error of the means. was related to the sand treatment, which was significantly different from the chaff, straw, and mat treatments (p<0.05). the duration of drinking water in the bagasse treatment increased significantly compared to the chaff, straw, and mat treatments (p<0.05). also, the longest and shortest sitting time of the calves after milk feeding belonged to the chaff and straw treatments, which were significantly different from the other treatments (p<0.05). the resting duration was significantly (p<0.05)longer in the straw (21.7 min)than in the sand treatment (9.1 min). the shortest sitting time belonged to the sand and the longest sitting time belonged to the mat treatment (p<0.05). the highest licking time among the treatments was related to the straw treatment, which had a significant increase compared to the other treatments (p<0.05). the results on the effects of the experimental treatments on the health status of the calves are presented in table 5. the results showed a significant difference in all four stages of cleanness and also in the mean cleanness score for all the experimental treatments, which was the highest numerically, i.e. worst, for the mat treatment (p<0.05) followed by the sand treatment. for the nose and eye scores in the first two weeks, mat and sand treatments had the highest values compared with the other treatments (p<0.05). in the second scoring (after one month), the highest nasal score belonged to chaff and mat, which was significantly different from bagasse treatment (p<0.05). this situation was slightly different in ocular discharges, so that mat treatment had the highest value compared with chaff, straw, and bagasse (p<0.05). in the third nasal scoring, the chaff and straw treatments had significant higher values compared to the different type of bedding in suckling holstein calves (s.m.j. hosseini et al.) 242 table 4. the effect of experimental treatments on the behavior characteristics of calves sem p-value treatments parameters mat sand bagas se straw chaff nutritional 4.04 0.04 25 bc 39.2 a 30 ab 27.5 bc 21.7 cb feed consumption (h) 1.87 0.01 1.66 b 2.50 ab 6.66 a 0.833 b 1.66 b drinking water (h) 3.52 0.002 5.33 c 5.00 c 15.16 b 3.33 c 21.8 a sitting after milkfeeding (h) non-nutritional 13.93 0.35 255 a 208 b 237 ab 215 ab 228 ab sitting resting (h) 37.3 0.01 148.3 b 168.3 a 129.2 b 148.3 b 161.7 b standing (h) 4.89 0.01 9.1 ab 6.7 b 11.7 ab 21.7 a 15.8 ab resting sitting (h) 3.30 0.01 30.0 b 38.3 b 40.8 b 32.5 a 35.8 b licking (h) the means within the same row with at least one common letter, do not have a significant difference (p<0.05). sem: standard error of the means. the mat treatment and in the fourth nasal scoring, the chaff treatment had a significant increase compared to the other treatments, except the sand treatment (p<0.05). in the third ocular scoring, the bagasse treatment was significantly increased compared to the other treatments (p<0.05). in the fourth ocular score, the mat and sand treatments had the highest significant differences compared to the other treatments (p<0.05). the highest mean nasal score was related to the chaff treatment which was significantly different from bagasse treatment (p<0.05). the highest mean eye scoring was related to mat treatment which was significantly different from the chaff, straw, and bagasse treatments (p<0.05). no significant differences were observed between the treatments regarding the ear and cough scores (p>0.05). also, for the joint score, the mat treatment had the highest significant difference compared to the other treatments (p<0.05). the results on the effects of the experimental treatments on the blood immunity parameters of the calves are presented in table 6. among blood cells, there was a significant difference in the treatments only for eosinophils so that bagasse treatment showed the highest difference compared to the other treatments (p<0.05). discussion according to the results of the present experiment, the growth rate in the chaff, straw, and sand treatments was higher than in the bagasse treatment. it seems that in the mat treatment, feed intake was lower than the other groups, possibly due to the lower animal comfort, and as a result, consumption was reduced and eventually the animal lost weight (gascon et al., 2012). bagasse, due to its good taste, also caused the animal to refuse to eat feed, which is why bagasse treatment had a significantly lower weight gain than the other treatments (gascon et al., 2012). the conversion ratio in mat treatment was 0.65, which was lower (better) than all the other treatments. the conversion ratio of sand and bagasse was 0.76, which was numerically higher than the other treatments. studies have shown that conversion ratio alone can be misleading and the final weight gain of calves is more important (hizli et al., 2018). hänninen (2005) stated that the rate of weight gain can be affected by the softness and comfort of the bedding so that more comfortable bedding allows the calf to consume more feed and grow more. in this experiment, calves in the mat treatment also tenden to weigh less than 243 j.indonesian trop.anim.agric. 46(3):236-247, september 2021 table 5. the effect of experimental treatments on the hygienic condition of calves sem p-value treatments parameters mat sand bagasse straw chaff cleanness score 1.22 <0.001 2.50 a 1.90 b 0.083 de 0.333 d 0.666 c the first score 1.05 <0.001 2.58 a 1.81 b 0 d 0.333 c 0.50 c the second score 1.01 <0.001 3.50 a 2.0 b 0.333 e 0.666 d 1 c the third score 1.07 <0.001 3.50 a 2.45 b 0.333 e 0.666 d 1 c the fourth score 1.02 <0.001 3.02 a 2.06 b 0.187 d 0.50 c 0.791 c average score eye score 1.02 0.002 0.416 a 0.454 a 0 b 0 b 0 b the first score 0.79 <0.001 0.50 a 0.363 ab 0 c 0.166 bc 1.6 bc6 the second score 0.97 0.05 0.166 bc 0.181 bc 0.50 a 0.166 bc 0 c the third score 1.01 0.02 1.160 a 1.09 a 0.583 b 0.583 b 0.416 b the fourth score 0.87 0.05 0.562 a 0.522 ab 0.270 bc 0.229 c 0.145 c average score ear score 0.44 0.61 0.83 0.181 0 0.83 0.166 the first score 0.44 0.61 0.83 0.181 0 0.83 0.166 the second score 0.27 0.54 0 0 0.83 0 0.166 the third score 0.27 0.54 0 0 0.83 0 0.166 the fourth score 0.92 0.68 0.041 0.090 0.041 0.041 0.166 average score nose score 0.34 0.01 0.416 a 0.272 a 0 b 0 b 0 b the first score 0.53 0.04 0.416 a 0.181 ab 0 b 0.166 ab 0.416 a the second score 0.37 0.05 0 b 0.272 ab 0.25 ab 0.333 a 0.333 a the third score 0.41 0.03 0.583 b 0.818 ab 0.166 c 0.583 b 1.00 a the fourth score 0.42 0.05 0.354 ab 0.386 ab 0.104 b 0.270 ab 0.437 a average score cough score 0 0 0 0 0 0 the first score 0.01 0.37 0 0 0 0.181 0 the second score 0.07 0.12 0 0 0 0.25 0 the third score 0.29 0.36 0.166 0.181 0 0.25 0 the fourth score 0.18 0.43 0.041 0.045 0 0.166 0 average score joint score 0.16 0.002 0.50 a 0.181 b 0 b 0 b 0 b the first score 0.38 0.004 1.66 a 0.181 b 0.166 b 0.333 b 0.333 b the second score 0.91 0.001 3.50 a 0.818 b 0 c 0 c 0.166 c the third score 0.91 <0.001 3.50 a 0.818 b 0 c 0 c 0.166 c the fourth score 0.89 <0.001 2.29 a 0.50 b 0.041 c 0.083 cb 0.166 c average score zero values: means an average score of zero. the means within the same row with at least one common letter, do not have a significant difference (p<0.05). sem: standard error of the means. those in the chaff, straw, and sand treatments. in this study, skeletal growth at the end of the period including body length, chest circumference, abdomen circumference, and pelvic width was not affected by the bedding and no significant difference was seen in them, which is consistent with the results of sutherland et al. (2017). sutherland et al. (2017) showed that cement, gravel, chaff, and debris beddings cannot make a significant difference in calf growth performance. in this experiment, only the height from withers showed a significant difference. the straw treatment with an average of 99.2 cm had the highest growth and the mat treatment the different type of bedding in suckling holstein calves (s.m.j. hosseini et al.) 244 table 6. the effect of experimental treatments on the blood immune parameters of calves sem p-value treatments parameters sand mat sand bagasse straw chaff 2.98 0.81 77.7 76 75.4 72.8 74 lymphocytes 2.80 0.51 21 22.3 24.4 27.1 26 neutrophils 0.158 0.001 0.164 b 0.162 b 0.50 a 0.166 b 0.164 b eosinophils 0.468 0.41 0.25 0.500 1.08 0.750 0.500 monocytes 0.179 0.58 0.333 0.333 0.250 0.083 0.333 basophils the means within the same row with at least one common letter, do not have a significant difference (p<0.05). sem: standard error of the means. with 95.9 cm had the lowest growth. some researchers have stated about the skeletal growth of calves that the more comfortable the calf is on the bedding, the more playful and refreshed the calf will be, and the better the resting, the better the weight gain and growth (boissy et al., 2007; sutherland et al., 2017). behaviorally, the calves in sand treatment with an average of 208 minutes had the shortest resting time and with 168.3 minutes had the longest standing time, which tallies with the results of hänninen (2005). hänninen (2005) stated that this behavior originates from two characteristics of the aeolian sand bedding: the first is that the bedding is cold in winter and the second is the bedding moisture. also, the aeolian sand treatment showed more hours for feed harvesting, which is probably due to the increase in body temperature in cold conditions. in the straw, bagasse, and chaff treatments, the time that the calves lay on their side on the bedding was longer than the other groups, which indicates the comfort of the animals on the bedding (camiloti et al., 2012). another important point in this area is the duration that the calf tends to sit after consuming milk, because the sooner the calf feels comfortable and sits down, the more it gains weight (duve and jensen, 2012). according to the analyzes performed in the chaff and bagasse treatments, the calves sat with a mean of 22 and 15 minutes after milk consumption, respectively, which indicates the comfort of the calf on the bedding of straw and bagasse (duve and jensen, 2012). there was also a significant increase in drinking water in the bagasse group, probably due to the taste of the bagasse bedding (singh et al., 2020). the results of this study showed that the rate of cough and ear problems in the calves were not affected by the type of bedding. according to research by sutherland et al. (2014), cleanness scores were not affected by the beddings such as sawdust and rice stalks. contrary to the mentioned research, in this experiment, there was no significant difference observed on the cleanness score among the beddings. the calves in the mat, sand, chaff, straw, and bagasse treatments had the highest stool contamination scores, respectively. according to panivivat et al. (2004), the beddings that transmit contamination and retain less moisture will be the best bedding for calves. this issue is very important from both health and economic points of view, because the contaminated bedding will cause many infectious problems for livestock, and as a result, the cost of treatment and growth retardation will be the consequences. economically, in addition to the cost of treatment, there is also the issue of removing the contaminated bed and replacing it (haley et al., 2001). the score of nasal discharge in the chaff treatment was significantly higher than the other treatments, which may be due to the presence of fine wood particles in this bedding (thomsen et al. 2012). however, both sand and mat treatments led to rather high scores. for eye discharges, in general, the best scores belonged to the chaff and straw treatments, while sand and mat 245 j.indonesian trop.anim.agric. 46(3):236-247, september 2021 beddings caused ocular problems in calves, possibly owing to the nasty odor caused by urinary ammonia (fregonesi et al., 2007). considering that these two beddings both had the highest percentage in terms of stool contamination (cleanness score), it can be concluded that higher microbial load and more exposure of the calf to infectious agents have a significant effect on the discharges of the nose and eyes (mattachini et al., 2019). regarding joint problems, the mat bedding created the most severe degree of problems for livestock, which is consistent with the results of wolfe et al. (2018). they stated that the farms that used more material for the bedding and had deeper beddings for the livestock showed fewer joint injuries. according to roland et al. (2014), bedding has no direct effect on the number of white blood cells in calves. however, in the present experiment, it was found that eosinophils in the two groups of straw and bagasse treatments were significantly different from the other treatments. the researchers stated that the main function of eosinophils in the immune system is to fight parasitic infections and allergies (majorek et al., 2012; poorghasemi et al., 2015). because in the results of the present experiment the reported number for the straw treatment is very small, it is not possible to get an accurate and reliable result. but in the case of bagasse, gascon et al. (2017) reported that there were allergies as well as ocular and nasal discharges observed in the calves with bagasse bedding. in this study, considering that significant ocular discharges were recorded in the third ocular scoring, this bedding was probably able to cause mild allergies in calves, which caused an increase in eosinophil levels. conclusion the results of the present experiment showed that the mat bedding is not suitable for calf raising in any aspect, because it has negative effects on the calf in terms of comfort, health, and growth performance compared to the other beddings. straw, bagasse, and sand beddings had the best growth performance, however, bagasse treatment had the lowest growth performance, probably because calves consumed less feed as a consequence of their consuming the bedding, making it not an ideal choice as weight gain is very important. the sand bedding was also excellent in terms of growth,+ but did not provide a good hygienic condition for the calves. finally, straw bedding seems to be ideal bedding for calves, although more research on this subject is necessary. references ahmadi m., a. ahmadian, m. poorghasemi, p. makovicky and a. seidavi. 2018. nanoselenium affects on duodenum, jejunum, ileum and coloncharacteristics in chicks: an animal model. int. j. nano dimen. 10 (2): 225-229. ahmadi m., m. poorghasemi, a. seidavi, e. hatzigiannakis and c. milis. 2019. an optimum level of nano-selenium supplementation of a broiler diet according to the performance, economical parameters, plasma constituents and immunity. j. elementol. 25(3): 1178-1198. boissy a. m., g. manteuffelb, m. bakjensenc, r. o. moed, b. spruijte, l. j. keelingf, c. wincklerg, b. forkmanh, i. dimitrovi, j. langbeinb, m. bakkenj, i. veissiera and a. aubert. 2007. assessment of positive emotions in animals to improve their welfare. physiol. behav. 92, 375-397. boujenane i. 2019. effects of milking frequency on milk production and composition of holstein cows during their first three lactations. iranian j. appl. anim. sci. 9(1), 2529. camiloti t. v., j. a. fregonesi and d. weary. 2012. short communication: effects of bedding quality. am. dairy sci. assoc. 4:3380-3383. duve l. r. and m. b. jensen. 2012. social behavior of young dairy calves housed with limited or full social contact with a peer. j. the different type of bedding in suckling holstein calves (s.m.j. hosseini et al.) 246 dairy sci. 95(10):5936-45. eklind y. and h. kirchmann. 2000. composting and storage of organic household waste with different litter amendments. ii: nitrogen turnover and losses. bioresour. technol. 74:125-133. fregonesi j.a., d. m. veira, von m. a. g. keyserlingk and d. m. weary. 2007. effects of bedding quality on lying behavior of dairy cows. j. dairy sci. 90:5468–5472. gascon m. k., h. kromhout, d. heederik, w. eduard and b. van wendel de joode. 2012. respiratory, allergy and eye problems in bagasse-exposed sugar cane workers in costa rica. occup. environ. med. 69(5), 331-338. haley d. b., a. m. de passillé and j. rushen. 2001. assessing cow comfort: effects of two floor types and two tie stall designs on the behaviour of lactating dairy cows. appl. anim. behav. sci. 71:105–117. hänninen, l.d. 2005. the effect of flooring type and social grouping in the rest and growth of dairy calves. appl. anim. behav. sci. 10:193-204. hizli h., t. ayasan and a. isik. 2018. growth performance and survival rate of southern anatolian red calves. iranian j. appl. anim. sci. 8(4):591-595. leach k. a., s. c. archer, j. e. breen, m. j. green, i. c. ohnstad, s. tuer and a. j. bradley. 2015. recycling manure as cow bedding: potential benefits and risks for uk dairy farms. vet. j. 206(2):123-130. leso l., m. barbari, m. a. lopes, f. a. damasceno, p. galama, j. l. taraba and a. kuipers. 2020. invited review: compostbedded pack barns for dairy cows. j. dairy sci. 103(2):1072-1099. majorek k. a., p. j. porebski, a. dayal, m. d. zimmerman, k. jablonska, a. j. stewart, m. chruszcz and w. minor. 2012. structural and immunologic characterization of bovine, horse, and rabbit serum albumins. mol. immunol. 52(3-4):174-182. mattachini g., j. pompe, a. finzi, e. tullo, e. riva and g. provolo. 2019. effects of feeding frequency on the lying behavior of dairy cows in a loose housing with automatic feeding and milking system. animals. 9(4):121-128. meng j., f. h. shi, q. x. meng, l. p. ren, z. m. zhou, h. wu and l. p. zhao. 2015. effects of bedding material composition in deep litter systems on bedding characteristics and growth performance of limousin calves. asian-australas j. anim. sci. 28 (1): 143–150. panivivat r.e., e. b. kegley, j. a. pennington, d. w. kellogg and s. l. krumpelman. 2004. growth performance and health of dairy. j. dairy sci. 87, 3736-3745. pirzadeh naeiny a., m. danesh mesgaran, a. r. vakili and h. ebrahimi. 2019. milk production and composition, and intake of holstein lactating cows fed diets with partial substitution of soybean meal with flaked field pea. iranian j. appl. anim. sci. 9(1), 45-50. poorghasemi m., m. chamani, s. z. mirhosseini, a. a. sadeghi and a. seidavi. 2017. effect of probiotic and different sources of fat on performance, carcass characteristics, intestinal morphology and ghrelin gene expression on broiler chickens. kaf. univ. vet. fak. derg. 24(2): 169-178. poorghasemi m., a. r. seidavi, a. a. a. qotbi, j. r. chambers, v. laudadio and v. tufarelli. 2015. effect of dietary fat source on humoral immunity response of broiler chickens. european poult. sci. 79: 1-8. poorghasemi m., a. r. seidavi, a. a. a. qotbi, v. laudadio and v. tufarelli. 2013. influence of dietary fat source on growth performance responses and carcass traits of broiler chicks. asian-australasian j. anim. sci. 26(5): 705-710. rowbotham r.f. and p. l. ruegg. 2016. bacterial counts on teat skin and in new sand, recycled sand, and recycled manure solids used as bedding in free stalls. j. dairy sci. 99:6594-6608. 247 j.indonesian trop.anim.agric. 46(3):236-247, september 2021 roland l., drillich m. and iwersen m. 2014. hematology as a diagnostic tool in bovine medicine. j. vet. diagn. invest. 26(5):592 –598. seifzadeh s., m. ramezani, j. seifdavati, h. abdi-benemar and v. razmazar. 2019. effects of weaning age on growth and blood parameters of replacing holstein calves fed on a restricted step up and down milk feeding program. iranian j. appl. anim. sci. 9(2), 197-204. sharifi m., a. a. khadem, b. j. heins, r. pahlavan, j. mosavi and m. safdari. 2017. effect of forage feeding level on body weight, body condition score, milk production, and milk urea nitrogen of holstein cows on an organic diet. iranian j. appl. anim. sci. 9(4), 617-624. singh a.k., t. kumari, m. s. rajput, a. baishya, n. bhatt and s. roy. 2020. a review: effect of bedding material on production, reproduction and health and behavior of dairy animals. int. j. livest. res. 10(7):11-20. slozhenkina m.i., i. f. gorlov, o. p. shakhbazova, r. g. radjabov, n. v. ivanova, d. a. mosolova, o. a. knyazhechenko, m. poorghasemi and a. seidavi. 2020. productivity of steers of different genotypes: forecast based on interior indicators. arq. bras. med. vet. zootec. 72(6): 2279-2287. sutherland m.w., g. m. worth, c. cameron , c. m. ross and d. rapp. 2017. health, physiology, and behavior of dairy calves reared on four different substrates. j. dairy sci. 100, 1-9. thomsen p.t., l. munksgaard and j. t. sørensen. 2012. locomotion scores and lying behaviour are indicators of hoof lesions in dairy cows. vet. j. 193(3):644-647. vasseur e., j. gibbons, j. rushen, d. pellerin, e. pajor, d. lefebvre and a. m. de passillé. 2015. an assessment tool to help producers improve cow comfort on their farms. j. dairy sci. 98:698–708. wolfe t., v. e. vasseur, t. j. devries and r. bergeron. 2018. effects of alternative deep bedding options on dairy cow preference, lying behavior, cleanliness, and teat end contamination. j. dairy sci. 101:530– 536. mtdna d-loop diversity of kalang, krayan, and thale noi buffaloes (suhardi et al.) 93 j i t a a journal of the indonesian tropical animal agriculture accredited by ditjen penguatan risbang no. 60/e/kpt/2016 j. indonesian trop. anim. agric. pissn 2087-8273 eissn 2460-6278 http://ejournal.undip.ac.id/index.php/jitaa 46(2):93-105, june 2021 doi: 10.14710/jitaa.46.2.93-105 mtdna d-loop sequence analysis of kalang, krayan, and thale noi buffaloes (bubalus bubalis) in indonesia and thailand reveal genetic diversity s. suhardi1, 3*, p. summpunn2, and s. wuthisuthimethavee1 1laboratory of agricultural genomics, school of agrucultural technology, walailak university, nakhon si thammarat, 80160, thailand 2food technology and innovation research center of excellence, school of agricultural technology, walailak university, nakhon si thammarat 80160, thailand 3department of animal science, agriculture faculty, mulawarman university, samarinda, east kalimantan, po box 1040, 75123, indonesia *corresponding e-mail: suhardi@faperta.unmul.ac.id co-corresponding e-mail: wsuwit@wu.ac.th received desember 01, 2020; accepted january 29, 2021 abstrak kerbau kalang (kbuf), krayan (krbuf), dan thale noi (tbuf) merupakan sumberdaya genetik kerbau rawa di indonesia dan thailand. area d-loop dna mitokondria merupakan material penting untuk inferensi filogenetik dan analisis keragaman genetik. tujuan dari penelitian ini adalah untuk mengevaluasi keragaman genetik dan untuk merekonstruksi pohon filogenetik dalam bangsa kerbau di kalimantan, indonesia, dan phatthalung, thailand menggunakan sekuens d-loop dna mitokondria. sebanyak 140 ekor kerbau (70 jantan dan 70 betina), dengan masing-masing jumlah sample di provinsi kalimantan utara sebanyak 40 ekor, kalimantan timur 40 ekor, kalimantan selatan 40 ekor dan provinsi phatthalung, thailand sebanyak 20 ekor. sampel dna diisolasi dari rambut ekor kerbau. sekuens dna dirangkai secara manual menggunakan program bioedit dengan mempertimbangkan celah dan sekuens yang ambigu. pohon filogenetik kerbau dihasilkan dengan software phylip. variabel yang diamati meliputi keanekaragaman haplotipe, jarak genetik dan pohon genetik. total 956 bp mtdna d-loop yang diamplifikasi dari 2 fragmen set primer 647 bp dan 595 bp menyajikan 24 haplotipe dengan beberapa mutasi yang mencakup transisi (293), transversi (60), delesi (15), dan insersi (20). pohon neighbor-joining menggunakan model kimura 2 parameter menunjukkan dua kelompok kerbau lokal antara kerbau di kalimantan dan kerbau di thailannd, sedangkan secara internal kerbau di kalimantan (kk dan kkr) menunjukkan empat pola hubungan kekeluargaan. hasil dari penelitian ini menunjukkan bahwa analisis sekuens dna kerbau menunjukkan keanekaragaman yang relatif tinggi dan merupakan dasar yang baik untuk melakukan seleksi dan pengembangan pemuliaan kerbau secara modern. kata kunci: filogenetik, dna mitokondria, area d-loop, keragaman genetik, kerbau abstract kalang (kbuf), krayan (krbuf), and thale noi buffaloes (tbuf) are swamp buffalo genetic resources in indonesia and thailand. the maternally inherited mitochondrial dna (mtdna), http://ejournal.undip.ac.id/index.php/jitaa mailto:suhardi@faperta.unmul.ac.id mailto:wsuwit@wu.ac.th 94 j.indonesian trop.anim.agric. 46(2):93-105, june 2021 particularly d-loop region is an important material for phylogenetic inference and analyzing genetic diversity. therefore, the objectives of the present study were to identify genetic diversity and to reconstruct the phylogenetic tree within buffalo breeds in kalimantan, indonesia, and phatthalung, thailand using mtdna d-loop sequences. a total of 140 buffaloes (70 males and 70 females) were observed including 40 buffaloes from north (nk), 40 from east (ek), and 40 from south kalimantan (sk) provinces indonesia and 20 from phatthalung (pt) province, thailand. dna samples were isolated from buffalo tail hairs. dna sequences were manually assembled using bioedit program with consideration of gaps and ambiguous sequences. the phylogenetic tree of buffalo was generated by phylip software. the observed variables included haplotype diversity, genetic distance, and genetic tree. the 956 bp of amplified mtdna d-loop fragment presented a total of 24 haplotypes with several mutations that included transitions (293), transversions (60), deletions (15), and insertions (20). the neighbor-joining tree using the kimura 2 parameter model demonstrated two local buffalo clusters among buffalo from kalimantan and thailand while internally four buffalo relationship patterns observed from buffaloes in kalimantan island (kbuf and krbuf), indonesia. the results of the present study demonstrated that the buffaloes sequence analysis revealed relatively high diversity and is a good basis to perform selection and modern buffalo breeding development. keywords: buffalo, d-loop region, genetic diversity, mitochondrial dna, phylogenetic introduction kalang buffaloes (kbuf) are important in indonesia’s economy and play a significant role in religion and society (suhardi et al., 2020; komariah et al., 2014). currently, four known buffalo breeds genetically originated from indonesia, namely: swamp, riverine, spotted toraja, and kalang buffaloes (director general of livestock services, 2003). thale noi buffalo (tbuf) is a breed originating from the thale noi wetlands located in phatthalung, southern thailand (fao, 2020). unfortunately, the buffalo population in the southeast asian region has steadily declined in population due to the long calving interval and low calving rate (escarcha et al., 2018). sudden changes in calving rates have been complicated by external and internal factors such as environment and genetics, respectively (el debaky et al., 2019; hassan et al., 2018). with this in mind, the potential for commercial rearing of swamp buffaloes through genetic studies has been made possible and to an extent, has become an alternative solution to support the red meat industry of indonesia (suhardi et al., 2020). furthermore, improvement of the genetic potency of a herd through molecular methods may consequently lead to a better quality of traits leading to better yields in terms of livestock (nguyen et al., 2020). variations in genotypic profiles are influenced by constant environmental changes that allow species to adapt for survival (yusnizar et al., 2015). these variations would also lead to improved hereditary traits in some species (hassan et al., 2018). mitochondrial dna (mtdna) d-loop markers are influenced by the movements/genetic drift of the female buffalo and are considered key in understanding the link between current population density and the extent of genetic variation (ruihua et al., 2018). the highly variable regions in mtdna such as the displacement loop (d-loop) have been the focus of genetic variation studies due to its higher mutation rate (yacoub and fathi, 2013). due to this, the mtdna is considered to be an important material for phylogenetic inference and thus analyzing genetic diversity within the framework of breed conservation, genetic characterization, and genetic resource management (sayres, 2018). therefore, to understand the current genetic status of kalang and krayan buffaloes, it is essential to observe the buffalo genetic diversity through analysis of the mtdna d-loop region in buffalo sequences in the three major provinces in kalimantan, indonesia, by tracing ancestry, and defining biodiversity for genetic development in the future. saputra et al. (2020) reported, base on microsatellite marker that indonesia has two cluster of swamp buffalo, first cluster consisting of aceh, north sumatra, and riau and the second cluster consisting of banten, central java, west nusa tenggara, and south sulawesi. similarly, rusdin et al. (2020) reported two clusters of eight indonesian swamp buffalo breeds based on cytochrome b gene marker, the first cluster consisting of aceh, north toraja, west nusa tenggara, banten, kolaka, and konawe populations, while the second cluster consisting of mtdna d-loop diversity of kalang, krayan, and thale noi buffaloes (suhardi et al.) 95 bombana island, bombana mainland, kolaka, and konawe populations. to date, there are no investigations conducted regarding the genetic diversity of buffalo breeds in kalimantan using molecular methods. studies available are focused on epidemiological data of disease rather than genetic variation (komariah et al., 2014; natalia et al., 2006). the present study aimed to identify for the first time the genetic diversity and reconstruct the phylogenetic tree within breeds of buffaloes in east, south, and north kalimantan, indonesia, coupled with similar analysis conducted on swamp buffaloes from phatthalung, thailand using mtdna d-loop sequences. materials and methods sample collection and processing one hundred and forty buffaloes (70 males and 70 females) were selected from the three major provinces in kalimantan, indonesia, and one province in thailand (figure 1) and studied for genetic diversity using dna collected from tail hairs. buffaloes between three to five years of age were qualified and selected as follows: north kalimantan (nk) (20 males and 20 females krayan buffaloes), east kalimantan (ek) (20 males and 20 females kalang buffaloes), and south kalimantan (sk) (20 males and 20 females kalang buffaloes), provinces indonesia and phatthalung (pt) thailand (10 males and 10 females thale noi buffaloes). the study was conducted for twelve months from november 2018 to october 2019. dna extraction and mtdna d-loop sequence analysis were performed at the laboratory of aquaculture genomics, walailak university, thailand. dna extraction, amplification, and sequencing dna from buffalo tail hair was extracted using previously established methods with slight modification by using guanidine as a buffer (wuthisuthimethavee, 1999). approximately 20 25 hair strands, two inches from the base of the buffalo tail were collected using sterile tweezers and placed in zipper sealed sample bags (fisher scientific, canada). the oligonucleotide primers were designed using “primer3plus” software (primer3plus, 2018). to ensure that all codons in the d-loop region were amplified, two sets of primers were created to avoid missing codons at the beginning and the end of sequence synthesis. figure 1. buffalo sampling sites from the three provinces in kalimantan island, indonesia, and phattalung province, thailand. krayan buffalo (krbuf) from north kalimantan province, kalang buffalo (kbuf) from south and east kalimantan provinces, and thale noi buffalo (tbuf) from phatthalung province (arcgis online basemap, 2019). 96 j.indonesian trop.anim.agric. 46(2):93-105, june 2021 polymerase chain reaction (pcr) was carried out using designed primer sets, forward: (bufd lp.af1) 5`-caacacccaaagctgaagtt-3`; reverse: (bufd-lp.ar1) 5’ taccaaatgcatgacagcac-3’; and a second primer set forward: (bufd-lp.bf2) 5` tcatctaaaatcgcccactc-3`; reverse: (bufd-lp.br2) 5’-cgctcctcttagtctcgttg-3’ (figures 2 and 3). optimized pcr was carried out in a reaction mix containing hot firepolblend united kingdom). the mtdna was purified using genephlowtm gel/pcr kit (geneid, new taipei city, taiwan) following the manufacturer's protocol. purified amplicons were sent to a commercial sequencing company for further analysis (bioneer, daejon, south korea). sequence data analysis sequences obtained were aligned with the mtdna of bubalus bubalis isolate ynb26 (genbank: kx758374.1) and bos taurus figure 2. buffalo sequence amplification through pcr. (a) amplification of buffalo mtdna d-loop (647 bp) with primer bufd-lp.af1-bufd and lp.ar1; (b) amplification of buffalo mtdna d-loop (595 bp) with primer bufd-lp.bf2 and bufd-lp.br2. master mix (hot firepoldna polymerase proofreading enzyme, 2 mm mgcl2, 200 m dntps of each, bsa) (solis biodyne, estonia), 0.3 m each of the forward and reverse buffalo specific primers, 50 ng of purified dna, and autoclaved milli-q water. thermal cycling conditions were similar for each primer sets as follows: 95 °c for 15 minutes initial denaturation, 35 cycles of denaturation at 95 °c for 30 seconds, annealing temperature of 60 °c for 30 seconds, extension at 72 °c for 30 seconds, and a final extension at 72 °c for 5 minutes. amplicons were visualized in 2% agarose gel stained with 6x flourodye (thermo fisher scientific, usa), the amplified products were visualized under uv light using a gel documentation system (syngene, (genbank: nc_006853.1) available in the genbank database. using bioedit, the highest percent pairwise identity of the consensus sequence from each species was compared to the percent specimen similarity scores of the consensus sequence from each species within the bold-ids (bold identification system) (ratnasingham and hebert, 2007) for genetic diversity evaluation through mutation identification. the observed variables including haplotype diversity, genetic distance, and genetic tree. the neighbor-joining phylogenetic tree was constructed using the kimura 2 parameter tree model as suggested by phylip software using 1000 replications (felsenstein, 1989; saitou and nei, 1987). mtdna d-loop diversity of kalang, krayan, and thale noi buffaloes (suhardi et al.) 97 atattaaatacactggtcttgtaaaccagaaaaggagaacaaccaacctccccaagactcagggaagaggctata gccccactaccaacacccaaagctgaagttctatttaaactactccctgaatactattaatatagctccacaaat gcaaagagccttctcagtatcaaattcactaaaacttgcaataacttaacactgactttacactctagcctaaca ttagaaataactgcaatcatcaacacacctgacctcatatgtacaacacacaacatatggccttaccactccgaa tgggggaggcgtacataatattaatgtaacaaggacataatatgtatatagtacattatattatataccccatgc atataagcaagtatataagcatgcatgatagtacatagtacattcgattgttaatcgtacatagcgcattcaagt caaatccgtccttgtcaacatgcatatcccctccattagatcacgagcttgaccaccatgccgcgtgaaaccagc aacccttcagacagggacccctcttctcgctccgggcccataccttgtgggggtagctatttaatgaactttaac agacatctggttctttcttcagggccatctcatctaaaatcgcccactctttccccttaaataagacatctcgat ggactaatgtctaatcagcccatgctcacacataactgtgctgtcatgcatttggtatttttttattttggggga tgcttggactcagctatggccgtcaaaggccccgacccggagcatgaattgtagctggacttaactgcatcttga gcaccagcataatggtaggcatgggacattacagtcaatggttacaggacataaatatattatttattccccccc ctcctatcaaccccccccttaaatacttaccaccatttttaacatgcttctccctagatgcttattcgaatttat cacatttccaatactcaaatcagcactccaaataaagtaactatataagcacccaatccatcacttcacaacaca gttaatgtagcttaaaaccaaagcaaggcactgaaaatgcctagatgagttctcccaactccataaacacatagg tttggtcccagccttcctgttaactcttaataaacttacacatgcaagcatccgcatcccggtgagaatgcccct aggtcaacgagactaagaggagcgggcatcaagcac 1st fragment 647 bp f1 (bufd-lp.af1) = caacacccaaagctgaagtt; r1 (bufd-lp.ar1) = taccaaatgcatgacagcac 2nd fragment 595 bp f2 (bufd-lp.bf2) = tcatctaaaatcgcccactc; r2 (bufd-lp.br2) = cgctcctcttagtctcgttg figure 3. two different single-round pcrs were used for the detection 956 bp of isolate ynb26 (genbank: kx758374.1)mitochondrion d-loop region bubalus bubalis (grey highlight) fragments that contained overlapping regions. the amplification using the bufd-lp.af1-bufd/ lp.ar1 primers (647 bp) and the amplicons using bufd-lp.bf2/bufd-lp.br2 primers (595 bp) were designed to overlap in the middle (103 bp). results results and discussions ek, sk, and pt provinces (figure 4). specifically, 11 indels (2 deletions and 9 insertions) in nk, 5 indels (3 deletions and 2 a total of 140 mtdna d-loop sequences were observed for mutations, including substitutions, deletions, and insertions, and revealed a total of 24 haplotypes. the number of mutations including substitutions (353) was caused by transitions (293), transversions (60), deletions (15), and insertions (20). the analysis of mtdna d-loop from nk, ek, sk, and pt showed that the average nucleotide composition for t, c, a, g, a+t, and c+g were 27.51, 26.65, 30.95, 14.90, 58.45, and 41.55, respectively (table 1). the average nucleotide composition between buffalo breeds in the present study as compared to bubalus bubalis was lower compared to bos taurus. it was observed that buffaloes in all the study sites of the present study have a closer genetic relationship with bubalus bubalis compared to bos taurus. based on 177 polymorphic sites, 15 deletions and 20 insertions were found in nk, insertions) in ek, 9 indels (6 deletions and 3 insertions) in sk, and 9 indels (4 deletions and 6 insertions) in pt. further, 92 substitutions were observed in nk (14 transversions and 78 transitions), 80 substitutions in ek (11 transversions and 69 transitions), 93 substitutions in sk (17 transversions and 76 transitions), and 88 substitutions in pt (18 transversions and 70 transitions) (figure 5). the difference in the composition of nucleotides between bubalus bubalis and buffalo breeds from nk, ek, sk, and pt provinces can be seen in table 2. the nucleotide composition of male and female ek buffaloes had the smallest percentage when compared to bubalus bubalis with a difference of 4.18% and 4.29%, respectively. male ek buffaloes compared to buffaloes from other provinces had different nucleotide base arrangements ranging from 1.25 2.40%, while female ek buffaloes compared to 98 j.indonesian trop.anim.agric. 46(2):93-105, june 2021 table 1. the average nucleotide composition of the buffalo mtdna d-loop region buffalo region n t c a % g a+t c+g male nk 20 27.39 26.88 31.01 14.72 58.40 41.60 female nk 20 27.31 26.93 30.73 15.03 58.04 41.96 male ek 20 27.50 26.55 30.95 15.01 58.45 41.55 female ek 20 27.47 26.56 30.96 15.01 58.43 41.57 male sk 20 27.73 26.55 31.02 14.70 58.75 41.25 female sk 20 27.54 26.60 30.90 14.97 58.43 41.57 male p 5 27.55 26.47 31.16 14.83 58.71 41.29 female p 5 27.46 26.50 30.86 15.18 58.32 41.68 bubalus bubalis 1 28.13 26.22 31.10 14.54 59.24 40.76 bos taurus 1 28.90 24.51 32.75 13.85 61.65 38.35 average 27.51 26.65 30.95 14.90 58.45 41.55 a: adenine; g: guanine; t: thymine; c: cytosine. nk: north kalimantan; ek: east kalimantan; sk: south kalimantan; pt: phatthalung. buffaloes in other provinces ranged from 1.57 2.72%. in contrast, male and female nk buffalo have the largest composition of nucleotides compared to bubalus bubalis, which were 6.28% and 5.65%, respectively. genetic diversity was observed to start at the initial d-loop nucleotide base sequence starting from site 80 bp to 938 bp. the largest genetic distance (kimura 2 parameter distance 0.07) based on the nucleotide sequences of mtdna d-loop region were between bubalus bubalis and male and female nk buffaloes at 4.39% and 4.14%, respectively. the smallest genetic distance of 0% was observed between male ek with female ek buffaloes and male ek with female sk buffaloes. these results demonstrated the close relationship between buffalo breeds from ek and sk. also, genetic distance between bubalus bubalis (genbank: kx758374.1) compared to male and female ek, male and female sk, male and female pt buffaloes were observed at 3.64%, 3.64%, 3.76%, 3.64%, 3.76%, and 3.52%, respectively (table 3). phylogenetic analysis demonstrated two local buffalo clusters among kbuf, krbuf, and note. (bp) : base pair; b.b : bubalus bubalis (genbank: kx758374.1); . : identity; ̶ : deletion figure 4. distribution of insertions and deletions in buffalo mtdna d-loop sequences of male north kalimantan (m-nk), female north kalimantan (f-nk), male south kalimantan (m-sk), female south kalimantan (f-sk), male east kalimantan (m-ek), female east kalimantan (f-ek), male phatthalung (m pt) and female phatthalung (f-pt) provinces. (bp) t c c c c c c g t t t t t t t a c c c c c c c c c a a . g t a . . . . . . g t a a a a a a a a c t t t t t t t t c c a g g g g g g g g g c g t . . g . . g . . . . . . . . . . . . . . . . . . . . c c c c c c c . . . . . . . . . . . . . . . . . . . . . a . g g g t t . . . . . . . . . . . . . . . . . . . . . t t t t t t t t t t t t . . c c . c . c . c t . . . . . . . . . t c . . . . c . t c c c c c c a a g a . . . . . . . . . . . . . . g b.b m-nk f-nk m-sk f-sk m-ek f-ek m-pt f-pt 8 4 1 3 0 1 3 4 1 5 1 1 5 8 1 5 9 1 6 0 1 7 7 1 8 0 1 8 4 1 8 8 1 8 9 1 9 9 2 0 1 2 0 2 2 0 3 2 0 4 6 0 2 7 9 4 7 9 5 7 9 6 7 9 7 7 9 8 8 0 6 8 2 4 8 7 3 8 7 7 9 3 6 mtdna d-loop diversity of kalang, krayan, and thale noi buffaloes (suhardi et al.) 99 figure 5. genetic physical mapping of mtdna d-loop mutations that occurred through substitutions (transitions and transversions), insertions, and deletions in male and female buffaloes from north, east, and south kalimantan, indonesia and phatthalung, thailand. tbuf. in addition, four buffalo patterns of relationship were observed among buffalo breeds from kalimantan island (kbuf and krbuf), indonesia. the two local buffalo clusters were the first cluster, the female buffaloes from pt and the second cluster, the male buffaloes from pt, male and female buffaloes from nk, male and female buffaloes from ek, male and female buffaloes from sk (figure 6). the neighbor-joining tree using the kimura 2 parameter model showed that male buffaloes from pt were closely related to male and female buffaloes from the three provinces of kalimantan indonesia. the male sk buffalo cluster separated from female sk, male and female ek, and male and female nk buffaloes with a bootstrap value of 70. while female sk buffaloes were found in the same group as male and female ek buffaloes with a bootstrap value of 73. however, male and female nk buffaloes were found in a separate group with a bootstrap value of 97. overall, based on dendrogram analysis, there were four buffalo sub clusters in kalimantan island, the first sub-cluster consisted of female sk, male ek, and female ek table 2. differences in the composition of buffalo nucleotides bubalus bubalis male nk female nk male ek female ek male sk female sk male pt female pt bubalus 0 bubalis male nk 6.28 (60) 0 female nk 5.65 (54) 1.46 (14) 0 male ek 4.18 (40) 1.67 (16) 1.25 (12) 0 female ek 4.29 (41) 1.88 (16) 1.57 (15) 1.04 (10) 0 male sk 4.81 (46) 2.40 (23) 1.99 (19) 1.67 (16) 1.99 (19) 0 female sk 4.81 (46) 2.30 (22) 1.99 (19) 1.88 (18) 1.88 (18) 2.61 (25) 0 male pt 5.44 (52) 2.82 (27) 2.40 (23) 2.40 (23) 2.72 (26) 3.14 (30) 3.03 (29) 0 female pt 4.50 (43) 2.61 (25) 2.30 (22) 2.09 (20) 2.40 (23) 3.14 (30) 2.61 (25) 2.51 (24) 0 nk: north kalimantan; ek: east kalimantan; sk: south kalimantan; pt: phatthalung. table 3. buffalo genetic distance based on the kimura 2 parameter model bubalus bubalis male nk female nk male ek female ek male sk female sk male pt female pt bubalus 0.00000 bubalis male nk 0.04397 0.00000 female nk 0.04136 0.00450 0.00000 male ek 0.03642 0.00677 0.00449 0.00000 female ek 0.03642 0.00677 0.00449 0.00000 0.00000 male sk 0.03764 0.00790 0.00562 0.00112 0.00112 0.00000 female sk 0.03642 0.00677 0.00449 0.00000 0.00000 0.00112 0.00000 male pt 0.03764 0.01021 0.00790 0.00562 0.00562 0.00675 0.00562 0.00000 female pt 0.03517 0.01251 0.01019 0.00790 0.00790 0.00604 0.00790 0.01134 0.00000 nk: north kalimantan; ek: east kalimantan; sk: south kalimantan; pt: phatthalung. 1 0 0 j .in d o n e sia n t ro p .a n im .a g ric . 4 6 (2 ):9 3 -1 0 5 , j u n e 2 0 2 1 mtdna d-loop diversity of kalang, krayan, and thale noi buffaloes (suhardi et al.) 101 buffaloes, the second sub-cluster only included male nk buffaloes, the third sub-cluster was female nk buffalo, and the fourth sub-cluster only included male sk buffalo. the buffalo clustering from the nk, ek, sk, and pt provinces as a local buffalo group was separated from the group bubalus bubalis (genbank: kx758374.1) and bos taurus (genbank: nc_006853.1) which were out-groups. discussion variation of nucleotides and haplotypes of the mtdna d-loop region the analysis of 140 mtdna d-loop fragments of kbuf, krbuf, and tbuf revealed 24 haplotypes which were higher compared to the 15 haplotypes observed from swamp buffaloes from aceh, sumatera, riau, banten, central java, west nusa tenggara, south sulawesi, and riverine buffalo from north sumatera (saputra et al., 2013), but lower compared to the 28 different haplotypes resulting from 77 polymorphic sites (hassan et al., 2009). the results of the present study demonstrated two groups of buffaloes originating from different ancestry in three provinces (nk, sk, and pt) while kbuf from ek originated from different ancestry as well. these genetic findings can be supported by phenotypic characteristics recently observed where male and female buffaloes from ek demonstrated many similarities in qualitative variables such as body appearance, skin color, coat color, horns pattern, chevron, and foot color (suhardi et al., 2020). also, this close ancestry can be supported by minimal mutations or genetic differences found in ek buffaloes as having only one transversion (204 bp), one insertion (796 bp), one deletion (806 bp), and one transition (877 bp) (belfield et al., 2018). the average value composition of purines and pyrimidines in the present study was 45.84% and 54.16%, respectively. the composition of the 956 bp results of multiple alignments found that the average nucleotide between a+t (58.45%) was more than g+c (41.55%) and influenced the phenotypic character of buffalo breeds (suhardi et al., 2020). the variations in nucleotide composition in the present study were imparted by mutations in the form of substitutions (transversions and transitions). these results were consistent with reports that the d-loop region accumulates nucleotide substitutions and experiences deletions, insertions, and duplication more quickly than other regions in mtdna and is passed to the next generation (burgstaller et al., 2014). inheritance of mammalian mtdna through the mother undergoes no recombination (nagarajan et al., 2015) but demonstrates a high degree of substitution (carelli et al., 2015). in mammals, the level of sub-coding (d-loop) substitution was estimated to be 2.8-5 times higher than in other places in the mitochondria and in this region, around the second domain (hypervariable region) or even faster (carelli et al., 2015). the nucleotide composition in the buffalo mtdna d-loop region in the present study demonstrated mutations (figure 6). results of the present study demonstrated unique nucleotide arrangements in the mtdna d-loop region of kbuf and krbuf which were imparted by deletions, insertions, and substitutions at different sites. unique nucleotide arrangements were observed at sites 236 to 851 for nk, sites 340 to 796 for ek, and sites 201 to 898 for sk buffaloes while nucleotide sequence variation was observed at sites 188 to 877 from tbuf. these variations in nucleotide sequences in the mtdna d-loop region have also been reported in other buffalo breeds as follows: river buffalo in indian (kumar de et al., 2019; nagarajan et al., 2015), thai wild water buffalo (sarataphan et al., 2017), chinese swamp buffalo (lau et al., 1998), swamp buffaloes from aceh, north sumatra, riau, banten, central java, west nusa tenggara, south sulawesi and riverine buffalo from north sumatera, indonesia (saputra et al., 2013). overall, the results of the present study provided informative polymorphisms for discriminating between different buffalo populations which can be useful for further studies on the evolution and genetics of the kbuf, krbuf, and tbuf breeds as well as for the documentation of the phylogenetic position of not only buffaloes in indonesia and thailand but also among southeast asian territories to ensure genetic integrity. genetic distance the close relationship of local buffalo breeds as demonstrated in the present study was possibly influenced by the gene flow due to the enclosed geographical ecology. male ek buffaloes were observed to have a close genetic distance from female sk buffaloes (0%). this is genetic evidence that supports the historical accounts of field interviews with farmers that originally inhabited sk and later on, migrated to east 102 j.indonesian trop.anim.agric. 46(2):93-105, june 2021 kalimantan along with their livestock decades ago (wardani, 2007). environmental conditions, climate, social community, and topography in ek were similar to sk, where land areas are surrounded by swamps and rivers that were optimal habitats for buffalo livestock. in the present study, male and female krbuf had the largest genetic distance from bubalus bubalis compared to buffalo breeds from other provinces. the krayan sub-district area of nk where the buffalo samples were collected is an isolated area, which at present is only accessible via a small aircraft (cassa, 212) with limited capacity (15 people/flight) and flight schedules of 2-3 times per week. at present, there is no access by land and water to support transportation routes to this province and has influenced the inbreeding of buffalo livestock in the area. the challenges faced in isolated areas are increasingly exacerbated at the genetic level, where an increased effect of genetic drift and the potential for inbreeding causes low genetic variation (gupta et al., 2015). the application of artificial insemination (ai) programs to buffaloes have not been effectively implemented in this province due to the weaknesses in the service system, human resources of artificial insemination officers (inseminator), human resources of farmers, and the difficulty of reaching remote areas. in contrast, farmers in cosmopolitan setting are quicker to adopt technological innovations such as artificial insemination because of the availability of resources and less-challenging logistics (caffaro et al., 2020). the population of the buffalo germplasm is declining rapidly due to the lack of access to proper breeding strategy, making the species very vulnerable to extinction. it is important to evaluate genetic diversity to develop a suitable breeding strategy for the conservation plan of the local buffalo breeds. phylogenetic analysis of mtdna d-loop sequences the present study demonstrated that the buffalo clustering from nk, ek, sk, and pt were separated from the bubalus bubalis (genbank: kx758374.1) and bos taurus (genbank: nc_006853.1) (figure 6). genetic cluster analysis demonstrated a closer relationship between male and female ek buffaloes with female sk buffaloes originating from adjacent geographical regions. these findings were figure 6. neighbor-joining phylogenetic tree of 140 sequences based on 956 nt sequences of buffalo mtdna d-loop. the distance was computed using the kimura 2 parameter model using1000 replicates. m-nk: male north kalimantan; f-nk: female north kalimantan; m-ek: male east kalimantan; f-ek: female east kalimantan; m-sk: male south kalimantan; f-sk: female south kalimantan; m-pt: male phatthalung; f-pt: female phatthalung; bubalus bubalis (genbank: kx758374.1); bos taurus (genbank: nc_006853.1). mtdna d-loop diversity of kalang, krayan, and thale noi buffaloes (suhardi et al.) 103 consistent with reports that swamp buffaloes in aceh, banten, central java, west nusa tenggara, and south sulawesi indonesia are very closely related to swamp buffaloes in china (saputra et al., 2013). blast results of buffalo sequences from the present study demonstrated maternal ancestry from bubalus bubalis. the close relationships between female sk buffaloes with male and female ek buffaloes (genetic distance value 0.00093 and a nucleotide base equation of 98.12%), as being in the same sub-cluster, demonstrated common ancestry and provides further genetic evidence that supports the historical accounts of the buffalo development of the banjar natives from sk who migrated to ek in 1918 (wardani, 2007). based on the analysis of the mtdna d-loop region, kbuf, krbuf, and tbuf kinship to bubalus bubalis provided genetic evidence on the dominant hybridization between females bubalus bubalis and male buffaloes from kalimantan island. this indicates that most buffalo genetic material in kalimantan island contains genetic material from bubalus bubalis. sex differences also presented differ greatly in genetic trees compared to differences in the location or origin of buffalo, for example of buffaloes m-pt and f pt, and m-sk and f-sk (figure 6). it was showed differences in ancestry between male and female buffaloes even though the buffaloes originate from the same province, due to buffalo migration, genetic drift and the implementation of an artificial insemination program (sayres, 2018; kumar et al., 2019). the mtdna is a marker for maternal genealogy (haploids) which in buffaloes can be used to define the history of herds (gupta et al., 2015). the results obtained in the present study demonstrated that kbuf, in particular, the males and females from ek and females from sk have a very close relationship. these findings support the hypothesis that domestication of swamp buffaloes in china spread with rice cultivation through two separate routes (a) through taiwan, to the philippines, and the eastern islands of kalimantan and sulawesi, (b) south through mainland southeast asia (likely interbreeding with wild buffalo) to peninsular malaysia and on to the western island of sumatra and java (lau et al., 1998). the analysis of mtdna d-loop sequences of buffaloes from nk, ek, sk, and pt provided genetic data that are useful for effective conservation programs of domestic buffaloes. the genetic data is important in facilitating and maintaining high-quality breeds and managing the genetic resources of biodiversity for buffalo breeding development through selection, pedigree recording, reproductive efficiency, crossbreeding, and genetic modification. most of the domestic buffalo populations are not unique and might be inter-crossed throughout their geographical distribution. however, the polymorphisms identified here from the hypervariable d-loop region could be linked to the identified haplotypes to discriminate the various buffalo populations. nevertheless, more molecular studies are required to further improve breed quality and manage the genetic resources of buffalo livestock. to clarify a “unique sequence”, it is necessary to analyze more samples from local swamp buffaloes in other provinces in indonesia and thailand. since genetic diversity within kalang, krayan, and thale noi buffaloes was found to be relatively high, this is a good basis to perform selection and breeding development through pedigree recording, reproductive efficiency, crossbreeding, and genetic modification to produce high-quality breeding stock for the buffalo farming industry. the translational application of these findings and perspectives, respective of buffalo breeds, will be beneficial to breeding and effective conservation programs of domestic buffaloes, as well as the maintenance, monitoring, and potential enhancement of the buffalo genetic resource using a sustainable framework for optimal benefits in terms of economy and local biodiversity. conclusion the genetic diversity of kbuf and krbuf in indonesia and tbuf in thailand demonstrated high genetic diversity. the phylogenetic analysis of sequences demonstrated two local buffalo clusters among kbuf, krbuf, and tbuf. there were four patterns of relationship observed among buffalo breeds from kalimantan, indonesia. this genetic diversity among local buffalo breeds can be beneficial for the buffalo farming industry through the enhancement of buffalo genetic resources and local biodiversity. acknowledgments this research was supported by the graduate studies research fund of walailak university, thailand (no. 15/2562) and the directorate general for higher education, republic of 104 j.indonesian trop.anim.agric. 46(2):93-105, june 2021 indonesia (ref. hde/edu/1203). we are grateful to the livestock and animal health services, provincial government of north, east and south kalimantan, indonesia, and phatthalung, thailand for the assistance in literature, data gathering, and conceptualization of real-life scenarios of buffalo farmer concerns. we also thank the anonymous referees for their helpful comments. references belfield, e. j., z. j. ding, f. j. c. jamieson, a. m. visscher, s. j. zheng, a. mithani and n. p. harberd. 2018. dna mismatch repair preferentially protects genes from mutation. genome res. 28(1): 66–74. burgstaller, j. p., i. g. johnston, n. s. jones, j. albrechtova´, t. kolbe, c. vogl, a. futschik, c. mayrhofer, d. klein, s. sabitzer, m. blattner, c. gu¨lly, j. poulton, t. ru¨licke, j. pia´lek, r. steinborn and g. brem. 2014. mtdna segregation in heteroplasmic tissues is common in vivo and modulated by haplotype differences and developmental stage. cell reports. 7(6): 2031–2041. caffaro, f., m. m. cremasco, r. roccato and e. cavallo. 2020. drivers of farmers’ intention to adopt technological innovations in italy: the role of information sources, perceived usefulness, and perceived ease of use. j. rural stud. 76(1): 264-271. carelli, v., a. maresca, l. caporali, s. trifunov, c. zanna and m. rugolo. 2015. mitochondria: biogenesis and mitophagy balance in segregation and clonal expansion of mitochondrial dna mutations. int. j. biochem. cell biol. 63(1): 21-24. director general of livestock services. 2003. national report on animal genetic resources indonesia. a strategic policy document. fao. el debaky, h. a., n. a. kutchy, a. ul-husna, r. indriastuti, s. akhter, b, purwantara and e. memili. 2019. review: potential of water buffalo in world agriculture: challenges and opportunities. appl. anim. sci. 35(2): 255 268. escarcha, j. f., j. a. lassa, e. p. palacpac and k. k. zander. 2018. understanding climate change impacts on water buffalo production through farmers’ perceptions. journal of clim. risk manag. 20(1): 50-63. fao. 2020. agricultural system, thale noi wetland, phatthalung province. ministry of agriculture and cooperatives, thailand. retrieved from http://www.fao.org/country showcase/item-detail/en/c/1276972/ (accessed 15 april 2020). felsenstein, j. 1989. phylip: phylogeny inference package (version 3.2). cladistics. 5: 164-166. gupta, a., a. bhardwaj, supriya, p. sharma, y. pal, mamta and s. kumar. 2015. mitochondrial dnaa tool for phylogenetic and biodiversity search in equines. j. biodivers. endanger. species. s1(6): 1-8. hassan, a. a. m., e. a. balabel, h. a. s. oraby and s.a. darwish. 2018. buffalo species identification and delineation using genetic barcoding markers. j. genet. eng. biotechnol. 16(2): 499-505. komariah., kartiarso and m. lita. 2014. productivity of swamp buffalo in muara muntai subdistric, kutai kartanegara regency, east kalimantan. bul. pet. 38(3): 174-181. kumar de, a., p. ponraji, d. malakar, r. muthiyan, a. kundu and d. bhattacharya. 2019. complete mitogenome sequencing of andaman buffalo: an endangered germplasm of andaman and nicobar islands, india. j. genet. 98(97): 1-8. lau, c.h., r. d. drinkwater, k. yusoff, s. g. tan, d. j. hetzel and j. s. barker. 1998. genetic diversity of asian water buffalo (bubalus bubalis): mitochondrial dna d-loop and cytochrome b sequence variation. anim. genet. 29(4): 253-264. nagarajan, m., k. nimisha and s. kumar. 2015. mitochondrial dna variability of domestic river buffalo (bubalus bubalis) populations: genetic evidence for domestication of river buffalo in indian subcontinent. genome biol. evol. 7(5): 1252-1259. natalia, l., suhardono and a. priadi. 2006. swamp buffalo in south kalimantan: problem, disease and control. wartazoa. 16(4): 206-215. nguyen, a.h.l., s. tiawsirisup and m. kaewthamasorn. 2020. low level of genetic diversity and high occurrence of vector-borne protozoa in water buffaloes in thailand based on 18s ribosomal rna and mitochondrial cytochrome b genes. infect. genet. evol. 82(1):104304. primer3plus. 2018. primer design. retrieved from https://primer3plus.com/cgibin/dev/primer 3plus.cgi. ratnasingham, s and p. d. n. hebert. 2007. http://www.fao.org/country-showcase/item-detail/en/c/1276972/ http://www.fao.org/country-showcase/item-detail/en/c/1276972/ https://primer3plus.com/cgibin/dev/primer3plus.cgi https://primer3plus.com/cgibin/dev/primer3plus.cgi https://primer3plus.com/cgibin/dev/primer3plus.cgi mtdna d-loop diversity of kalang, krayan, and thale noi buffaloes (suhardi et al.) 105 bold: the barcode of life data system. mol. ecol. notes. 7(3): 355-364. ruihua, z., j. ping, s. chuanbo, s. deyong, z. feng and h. chaochao. 2018. the analysis of genetic variation in the mitochondrial genome and its application for the identification of papilio species. mitochondrial dna part b. 3(2): 687-690. rusdin, m., d. d. solihin, a. gunawan, c. talib and c. sumantri. 2020. genetic variation of eight indonesian swamp-buffalo populations based on cytochrome b gene marker. trop. anim. sci. j. 43(1):1-10. saitou, n and m. nei. 1987. the neighbor-joining method: a new method for reconstruction of phylogenetic trees. mol. biol. evol. 4(4): 406-425. saputra, f., jakaria, a. anggraeni and c. sumantri. 2020. genetic diversity of indonesian swamp buffalo based on microsatellite markers. trop. anim. sci. j. 43(3):191-196. saputra, f., jakaria and c. sumantri. 2013. genetic variation of mtdna cytochrome oxidase subunit i (coi) in local swamp buffaloes in indonesia. med. pet. 36(3): 165 170. sarataphan, n., w. narongwanichgarn and s. maneerat. 2013. phylogenetic analysis of a thai wild water buffalo (bubalus arnee) through mitochondrial control region. int. j. conserv. sci. 8(1): 105-112. sayres, m. a. w. 2018. genetic diversity on the sex chromosomes. genome biol. evol. 10(4): 1064-1078. suhardi., p. summpunn, m. duangjinda and s. wuthisuthimethavee. 2020. phenotypic diversity characterization of kalang and thale noi buffalo (bubalus bubalis) in indonesia and thailand: perspectives for the buffalo breeding development. biodiversitas. 21(1): 5128-5137. wardani. 2007. madam ka banua urang: beberapa catatan awal tentang migrasi suku banjar, proses, dan penyebarannya. jurnal kebudayaan. 14(5): 175. wuthisuthimethavee, s. 1999. dna marker technologies for biodiversity study in shrimp. master’s thesis, kasetsart university, bangkok. thailand. yacoub, h.a and m. m. fathi. 2013. phylogenetic analysis using d-loop marker of mtdna of saudi native chicken strains. mitochondrial dna. 24(5): 538-551. yusnizar, y., m. wilbe, a. o. herlino, c. sumantri, r. r. noor, a. boediono, l. andersson and g. andersson. 2015. microphthalmia-associated transcription factor mutations are associated with white spotted coat color in swamp buffalo. anim. genet. 46(6): 676-682. s. suhardi1, 3*, p. summpunn2, and s. wuthisuthimethavee1 abstrak abstract introduction materials and methods sequence data analysis results discussion genetic distance phylogenetic analysis of mtdna d-loop sequences conclusion acknowledgments references 76 j. indonesian trop. anim. agric. 48(2):76-88, june 2023 j i t a a journal of the indonesian tropical animal agriculture accredited by ditjen riset, teknologi dan pengabdian kepada masyarakat no. 164/e/kpt/2021 j. indonesian trop. anim. agric. pissn 2087-8273 eissn 2460-6278 http://ejournal.undip.ac.id/index.php/jitaa 48(2):76-88, june 2023 doi: 10.14710/jitaa.48.2. 76-88 effects of rumen-protected fat on changes of metabolites and reproductive genes in testes of malin rams a. ismail 1 , a. i. muhammad 1,2 , l. t. kee 1 , l. t. chwen 1 , and a. a. samsudin 1* 1 department of animal science, faculty of agriculture, universiti putra malaysia, serdang 43400, malaysia; 2 department of animal science, faculty of agriculture, federal university dutse, dutse 7156, nigeria *corresponding author: anjas@upm.edu.my submitted february 14, 2023, accepted march 28, 2023 abstract the effects of rpf on metabolites and reproductive genes in testes of malin ram was investigated. twenty malin rams (36.6kg ± 5.57 kg of bodyweight), were subjected to four dietary treatments; a: basal diet without rumen-protected fat (rpf), b; basal diet with 2% prilled fat, c; basal diet with 2% calcium salt and d; basal diet with 2% canola oil. at the end of the experiment four out of five animals from each group were slaughtered. the testes were excised for metabolites and gene expression studies. the genes tested were associated to testes development and spermatogenesis (odf1, serpina10, catsper4, adipor2 and dazl). feeding rpf with calcium salt (treatment c) has resulted in the upregulation more than two folds in all reproductive genes. there were metabolites changes occurred between the groups and identified 44 important putative metabolites present in the testes. in conclusion, feeding of rpf to the animals as a source of energy has up-regulated the genes and identified the metabolites involve in the male reproductive tissues and activities. keywords: energy, fat, gene expression, metabolites, sheep. introduction animal feeding is one of the main factors that can alter the performance of male animals. in the reproduction activities, rams that are not allowed to have proper feeding and nutrition will impact the breeding performance such as undeveloped testes, low sperm production, and quality which in turn will lead to reduce the fertility of the animals (lone et al., 2017; singh et al., 2018). to overcome these limitations, the farmers need to provide the rams with proper feeds, especially during breeding seasons. grains that were incorporated in the pellet are a common practice to overcome these issues. however, as the price of the grains is getting higher these days, it would affect the farmers in terms of their finances. alternatively, the use of fats as feed supplements during breeding seasons will help to resolve these issues (schoech et al., 2004). currently, there is a technology to produce insoluble fats from microbial fermentation and mailto:anjas@upm.edu.my rumen protected fat and reproductive genes in malin rams (a. ismail et al.) 77 biohydrogenation which is called rumenprotected fats (rpf) (behan et al., 2019 and de silva et al., 2020;). this helps the rpf to escape the rumen microbial fermentation, absorbed through the small intestine and then converted to a source of energy (owens and basalan, 2016). there have been a few studies on the effects of rpf on metabolites and gene expression in female animals (behan et al., 2019; chavda et al., 2022), however, the current study focused on metabolites changes and reproductive genes in the ram’s testes. the sperm fatty acid composition is characterized by very high proportions of omega3 pufas (n−3), particularly docosahexaenoic acid (dha; 22:6 n − 3) (hosseini et al., 2019; ngcobo et al., 2021). the ratio of omega-6 (n−6) to n−3 pufas may play a significant role in several aspects of animal production and reproduction (khoshniat et al., 2020; ngcobo et al., 2021). furthermore, there is substantial evidence that the lipid composition of the sperm membrane is a major determinant of motility, overall viability, cold sensitivity, fusion capacity of sperm, and lipid metabolism (wysokińska and szablicka, 2021). there have been several studies on the effect of rfp on metabolites in ewes, however, our research focused on metabolites in the ram’s testes. rpf increased malin ram reproduction performance by enhancing sperm quality (ahmad et al., 2018; manriquez et al., 2019). the development of testis and spermatogenesis are frequently regulated by core genes (du et al., 2021; zhang et al., 2019). there are many genes associated with nutrition and reproduction (ma et al., 2019; heng yang et al., 2018), therefore the current study focused on five differential genes (degs) which were; outer density fiber protein 1 (odf1), serpina 10, cat ion channel of sperm4 (catsper 4), adipor2 and dazl. these genes were chosen because of their functions in testis development and spermatogenesis (bai et al., 2017; qu et al., 2019). gene expression is a process that involves transcription, translation, and turnover of messenger ribonucleic acids (mrnas) and proteins (naval-sanchez et al., 2018). it is regarded as one of life’s most fundamental processes, and the genes expressed in an organism define its characteristics or features (buccitelli and selbach, 2020). to improve animal reproductive performance, many farmers now use rumen-protected fat. rpf improved malin ram reproduction performance by improving sperm quality (ahmad et al., 2018), and the current work was a continuation of that research to further understand rpf effects at the molecular level. therefore, this study aimed to investigate how rumen-protected fat altered metabolite changes, and mrna expression of reproductive genes involved in testes development and spermatogenesis in malin ram testes. materials and methods experimental design, animals and diets twenty malin rams (bw of 36.6 kg ± 5.6 kg at 10-14 months of age, with body scores 3.0 3.5) were reared at the national institute animal biodiversity jerantut, pahang and approved by the universiti putra malaysia animal care and table 1: feed ingredients of experimental diet ingredients experimental diets control prilled casa canola brachiaria grass 66.00 76.00 75.00 77.00 commercial sheep concentrate 34.00 22.00 23.00 21.00 prilled fat 00.00 02.00 00.00 00.00 calcium salt of fatty acid 00.00 00.00 02.00 00.00 canola oil 00.00 00.00 00.00 02.00 total (%) 100.00 100.00 100.00 100.00 calculated analysis me (kcal/kg) 2217 2218 2210 2212 crude protein (%) 12.20 11.30 11.30 11.20 78 j. indonesian trop. anim. agric. 48(2):76-88, june 2023 use committee (iacuc) guidelines (reference # r064/2016). the experimental animals were divided randomly into four treatment groups, each of which received a different feeding treatment: a: basal diet without rumen-protected fat (rpf); b: a basal diet with rpf (as 2% prilled fat from palm oil source); c: basal diet with 2% rpf (as calcium soap, casa); and d: basal diet with 2% canola oil (table 1). the 12-week experiment included a two-week adaptation period and ten weeks of feeding trials. each group received isocaloric and isonitrogenous formulated feed according to the maintenance requirement of sheep with water provided ad-libitum. the animals were dewormed with fenbendazole 10%, 1ml/10kg two weeks before the feeding trials. testes collection four malin rams’ testes (four from each treatment group) were taken as described in our earlier work (ahmad et al., 2018) to determine metabolites and gene expression in testes. the testes samples were stored at -80 °c for further gene expression study. sample preparation and lc-ms analysis the testes' tissues were crushed into a fine powder using a pestle and mortar with liquid nitrogen. the testes tissue samples were prepared as described in previous studies (chen et al., 2015; fraser et al., 2021), with slight modifications. briefly, approximately 150 mg of each pulverized sample was homogenized in 450 μl methanol in two steps to make a final volume of 900 μl to precipitate the proteins. the solution was vortexed three times for five minutes each, then centrifuged at 16000 x g for 15 minutes at 4 °c. a centrifugal evaporator was used to concentrate the sample to a final volume of 75 μl. the sample was then centrifuged at 17,500 × g for 5 min at 4 °c and the supernatant was transferred to a new 1.5 ml microcentrifuge tube for lc-ms analysis. each biological sample was replicated four times. fingerprinting sample was performed using agilent 1200 lc system with an auto-sampler and binary pump coupled to 4000 q-trap (ab sciex, usa). chromatographic separation was performed on zorbax eclipse xdb – c18 150 x 4.6 mm x 5 u. mobile phases consisted of solution a; 0.1% formic acid in ultrapure water and solution b; 100% acetonitrile with the following gradient conditions; 0-1 minute 97% of solution a and 3% of solution b. from minutes 1 to 19 minutes, solution b was from 3% to 97% of concentration. then it was maintained until 22 minutes. the column was equilibrated before each analysis. the flow rate was 0.5ml/min and the volume of the sample injected was 15μl. analysis was performed at 45°c. the mass spectrometer was operated in a positive mode in scan type of enhance ms (ems). the scan rate was 1000da/s and the scan range of 50-2800 m/z. total rna extraction and purification total rna was extracted from sample tissues using the rneasy® lipid tissue mini kit (cat. no. 748sw04, qiagen, hilden, germany) according to the manufacturer’s protocol. next, using a spectrophotometer (nanodrop (nd 1000), 1 µl of rna was used to evaluate the purity of rna by measuring the absorbance ratio at 260 nm/280 nm, and only samples with a ratio of ̴ 2.0 were generally accepted as “pure”. furthermore, the purification of rna was determined by the evaluation of cdna using standard curves. quantitative real-time polymerase chain reaction (q-pcr) the synthesis of first-strand cdna was run by reverse transcription of 3 µg isolated total rna (20 µl reaction mixture) as per kit protocol. the reaction was placed in the thermal cycler mj research ptc-100, usa. the master mix was prepared as per the manufacturer’s protocols. the master mix was prepared according to the manufacturer’s protocol. the 2x quantinova sybr green pcr master mix, quantinova yellow template dilution buffer, cdna, primers, and rnase-free water were thawed. the primers sequences of the selected gene which were forward and reverse are presented in table 2. each reaction (20 μl) contained 10 μl 2x sybr pcr rumen protected fat and reproductive genes in malin rams (a. ismail et al.) 79 master mix, 1 μl of each forward and reverse primers, 7 μl of nuclease-free water, and 1 μl of cdna. the qpcr reactions were carried out following standard cycling mode as per kit protocol. a melting curve was also generated to confirm the sequence-specific pcr products. two house-keeping genes of glyceraldehyde 3phosphate dehydrogenase (gapdh) and betaactin (β-actin) were used in triplicates to determine the stable house-keeping gene in tissues. real-time pcr was then performed on a biorad cfx manager™ 3.1 real-time pcr system (bio-rad laboratories, hercules, ca, usa). genes of interest were amplified through the 3 steps cycling program; step 1; denaturation for 15 seconds at 95°c; step 2; annealing for 20 seconds at 60°c; and step 3, extension for 20 seconds at 72°c. a standard curve was constructed to determine if the sample can be either a genespecific plasmid or a cdna preparation in which the gene of interest is present. the r 2 of the standard curve should be > 0.980 (qiagen, germany). for the efficiency, reproducibility, and dynamic range of an sybr green assay, the standard curve was constructed using serial dilutions of 10 -1 , 10 -2 , 10 -3 , 10 -4 and 10 -5 . the efficiency of the assay should be 90-105%. quantification analysis was performed by measuring the average cycle threshold (ct) value ∆∆ (2-∆∆ct method) described by livak and schmittgen, (2001) using the formula below, following the standard curve method after normalization with reference genes. in the above equation, etarget and eref are the amplification efficiencies of the target and references genes, respectively. ∆ct target (calibrator-test) = ct of the target gene in the calibrator minus the ct of the target gene in the test sample and ∆ct, ref (calibrator – test) is the ct of the reference gene in the calibrator minus the ct of the reference gene in the test sample. data processing the success of the lc-ms technique can be determined by its ability to give three dimensional (3d) data. first, the compounds were separated in time by lc (retention time). secondly, the ions generated in the ionization source were then separated according to their mass to charge ratio, and m/z ratios in the mass analyser of ms, and finally, the ms detector measured the abundance of each ion (intensify). for data processing, the ion sources data then went to further screening, verify and quantitate using the analyst 1.5.1 software. during the pre-screening, the outlier ions were removed from the data. the cleaned data were then reformed into an excel matrix for further analysis. data analysis the excel matrix was exported to simca-p software (version 14.1, mks umetrics, sweden) for further multivariate statistical analysis. the data were employed to identify biochemical patterns using principal component analysis (pca), partial least squaresdiscriminate analysis (plsda) and orthogonal partial least squares discriminate analysis (opls-da). some outlier ions also need to be removed along the process to get the most relevant ions. the values of variables' importance in the projection (vip) in the opls-da model were used to determine important metabolites. the characteristic of metabolites (the exact molecular mass and m/z) were identified using the human metabolome database (http://hmdb.ca/spectra/ms/search), and the massbank database (www.massbank.jp/search), metabolites and tandem ms database (http:// metlin.scripps.edu) and the riken integrated database of mammals (http://scinets.org/db/ mammal). statistical analysis data were analyzed using statistical analysis software (sas, version 9.4). general linear model (glm) was used to analyse the data and duncan’s multiple range test (dmrt) was used to compare the mean between the treatments. data were expressed as (mean ± se) and statistical analysis that has a value of p < 0.05 was considered significantly different (one-way http://hmdb.ca/spectra/ms/search) http://hmdb.ca/spectra/ms/search) http://www.massbank.jp/search http://metlin.scripps.edu/ http://metlin.scripps.edu/ http://scinets.org/db/mammal) http://scinets.org/db/mammal) http://scinets.org/db/mammal) 80 j. indonesian trop. anim. agric. 48(2):76-88, june 2023 anova). results and discussion pca, pls-da and opls-da of metabolomics profile pca, an unsupervised pattern recognition method, was used to determine the presence of inherent similarities in spectral profiles. each scatters represented the testes sample in every treatment group. the pca and pls-da result showed that there were not any separation between the groups or overlapping each other. to differentiate the testicular metabolites, we applied the opls-da model to characterize the control and each different dietary group. there was a distinct clustering between the control group and each treatment group. however, the clustering between group c and group d was not well separated (figure 1; opls-da). the completely separated clustering between the treatment groups indicated that control group a could table 2. primer sequence of selected genes (bai et al., 2017) name of target gene primer sequence product size cat ion channel of sperm4 (catsper4) f: tcggctggttaaatggtttc 114 r: cgacggcactgagttcatta serpina10 f: tcttaccctgggctgaccta 117 r: ctgccattgcctctgtacct dazl f: ttatcatgtgcagccacgtc 118 r: agggttcatcatggttggag adipor2 f: gaggagtgtgagtgcgatga 128 r: cgaccttcccagaccttaca outer density fibre protein 1 (odf1) f: cgcgagaacagatacgactg 117 r: gagcccgtaggagtacgtca β-actin f: gctctcttccagccttcctt 114 r: cgtgttggcgtagaggtctt gadph f: catggccttccgtgttccta 460 r: tacttggcaggtttctccagg figure 1. multivariate analysis, opls-da. a control, b prilled fat, c calcium salt, and d canola oil. rumen protected fat and reproductive genes in malin rams (a. ismail et al.) 81 table 3. identified putative metabolites in the testes (human metabolome database; http://hmdb.ca/spectra/ms/search, mass bank database; www.massbank.jp/search, metabolites and tandem ms database http://metlin.scripps.edu) no. vip m/z putative metabolites formula 1 1.89877 102.0377 10-hydroxy-(2e,8e)-decadien-4-ynoic acid c10h12o3 2 1.82653 102.0281 albendazole s-oxide c12h15n3o3s 3 1.57053 102.0238 nicotinuric acid c8h8n2o3 4 1.24246 51.5657_11 methylcyclopentane c6h12 5 1.2031 1528.0176 cl(20:1(11z)/18:2(9z,12z)/18:1(11z)/18:1(11z) c83h152o17p2 6 1.19827 1293.3397 18(r)-hydroxy-20-oxo-20-coa-lte4 c44h69n8o23p3s2 7 1.19754 1680.3548 cl(i-13:0/a-21:0/i-24:0/a-25:0)[rac] c92h180o17p2 8 1.17195 116.0285_3 methylpentanoic acid 1 hexanoic acid c6h12o2 c6h12o2 9 1.16402 1401.0123 dg(20:5(5z,8z,11z,14z,17z)/ 22:6(4z,7z,10z,13z,16z,19z)/0:0) c45h66o5 10 1.13656 989.4541 fluspirilene c29h31f2n3o 11 1.11573 1201.0583 ce(12:0) c39h68o2 12 1.11306 1121.1937 anhydrosafflor yellow b c48h52o26 13 1.05437 132.0922 5,10-pentadecadien-1-ol c15h28o 14 1.01708 85.9785 crotonoic acid c4h10n2 15 1.01065 58.8554_14 1,1-dimethylbiguanide c4h11n5 16 0.974863 1051.2896 cyanidin c47h55o27 17 0.971319 118.0185 succinic acid dl-2-hydroxyvaleric acid c5h12no2 c5h10o3 18 0.97953 104.0473 dl-2,3-diaminopropionic acid choline 3-cyanopyridine c3h8n2o2 c5h14no c6h4n2 19 0.939066 57.7020 2-amino-5-phenyl pyridine c11h10n2 20 0.936192 85.9790 piperazine c4h10n2 21 0.934178 1866.7223 glycerol trinonadecanoate c60h116o6 22 0.921368 976.8095 tg(20:3(5z,8z,11z)/15:0/20:3(5z,8z,11z)) c58h100o6 23 0.9064 71.9484 superoxide o2 24 0.861032 714.6696 cer(d18:1/23:0) c41h81no3 25 0.854799 69.9193 propionic acid c3h2n2 82 j. indonesian trop. anim. agric. 48(2):76-88, june 2023 table 3. identified putative metabolites in the testes (continued) no. vip m/z putative metabolites formula 26 0.854243 1208.6346 m(ip)2c(d18:0/16:0 preprosomatostatin c52h101no24p2 c52h83n17o15 27 0.836234 136.9952 antharilic acid c7h7no2 28 0.834576 89.9993 dl lactic acid lactic acid c3h6o3 c3h6o3 29 0.826173 705.8320 guanosine 3'-diphosphate 5'-triphosphate c10h18n5o20p5 30 0.820011 1057.9136 1-heneicosanoyl-2-docosanoyl-3-sn glycerol c68h122o6 31 0.808577 188.1263 antipyrine gly-leu c11h12n2o c8h16n2o3 32 0.796197 137.0017 anthranilic acid trigonelline c7h7no2 c7h7no2 33 0.786638 846.6861 pc(18:0/22:0) pc(20:0/20:0) pc(16:0/24:0) pe(17:0/26:0)[u] pe(24:0/19:0)[u] pe(22:0/21:0)[u] c48h96no8p c48h96no8p c48h96no8p c48h96no8p c48h96no8p c48h96no8p 34 0.780037 940.5459 dehydrosoyasaponin i c48h76o18 35 0.776376 769.8285 pe 38:3 pc 35:3 phosphatidylcholine 17:1-18:2 phosphatidylethanolamine 18:0-20:3 c43h80no8p c43h80no8p c43h80no8p c43h80no8p 36 0.768842 1041.8005 ps(24:0/24:1(15z)) c54h104no10p 37 0.735888 54.4800 peroxynitrite hno3 38 0.712305 58.8516 n4-acetylaminobutanal c6h11no2 39 0.684643 120.0019 (-)-1-(methylthio)propyl 1-propenyl disulphide c6h12s2 40 0.647569 132.0214 l-ornithine c5h12n2o2 41 0.63501 51.1855 ethylbenzene c8h10 42 0.591421 1116.0686 tg(20:0/24:1(15z)/22:1(13z)) c69h130o6 43 0.562731 59.8535 acetate c2h2o2 44 0.527496 59.8654 acetate c2h2o2 rumen protected fat and reproductive genes in malin rams (a. ismail et al.) 83 be attributed to have different metabolites from groups b, c, and d. the variable importance for the projection (vip) summarizes the importance of the variables to explain and correlate to y. the plot was sorted from high to low, to show the confidence intervals for the vip value. vip values were arger than 0.5 indicated “important” metabolites and lower indicated “unimportant” (figure 2). using vip > 0.5 as the cut-off, the important metabolites were identified in the testes and listed in table 3. the corresponding loading’s scattered (ls) plot showed the distribution of different variables between control and treatment groups. each point in the ls plot represents an ion. ions far away from the origin are significantly important to the differences between groups. ions in figure 3, were illustrated and given the identification according to their groups as shown in table 4. the opls-da plots of the metabolites in the testes differed between the control group (a) and the treatment group fed with rpf. this finding indicates the presence of different metabolites. there were 44 differentiated metabolites identified in testes using the vip analysis (vip>0.5). the important putative metabolites in this study are; 10 – hydroxy (2e,8e) – decadiene – 4 ynoic acid (organic compounds known as mediumchain fatty acids), albendazole soxide, nicotinuric acid, methylcyclopentane (saturated monocyclic hydrocarbons), cl (20: 1 (11z) / 18: 2(9z,12z)/18: 1(11z)/18:1 (11z) glycerophospholipids, 18(r) hydroxy – 20 – oxo – 20 – coa lte4 (metabolite through lipid oxidation of leukotriene e4 (lte4)), cl(i-13:0/a21:0/i-24:0/a25:0)[rac]('double' phospholipids), methylpentanoic acid (saturated fatty acids with an acyl chain that has a methyl branch). in the control group (a), 10 – hydroxy (2e,8e) – decadiene – 4 ynoic acid was mainly identified. we found the metabolite in the group fed with prilled fat (b) was different from the group (a), (c) and (d). the metabolite in group b was, 1 heneicosanoyl – 2– docosanoyl – 3 (7z, 10z, 13z, 16z, 19z, docosapentanoyl) – sn – glyceryl is categorized as glycerolipids [gl], main class: triradylglycerols [gl03] and subclass: triacylglycerols [gl0301] (tags). the metabolites went through further changes however, we could not identify the specific metabolites in group calcium salt and canola oil which exact mass figure 2. viable importance for the projection (vip) plot showed the summarized of the important metabolites (sorted from most important to lower) in the samples. vip 84 j. indonesian trop. anim. agric. 48(2):76-88, june 2023 are adenosine 5' pentaphosphate and pe (24:0/24:1(15z)). adenosine is a product of complete dephosphorylation of adenine nucleotides which are presence in various compartments of the cell. pe (24:0/24:1(15z)) is a phosphatidylethanolamine (pe or gpetn). fatty acids containing 16, 18 and 20 carbons are the most common, however pe (24:0/24:1(15z)), in particular, consists of one chain of lignoceric acid at the c-1 position and one chain of nervonic acid at the c-2 position. while most phospholipids have a saturated fatty acid on c-1 and an unsaturated fatty acid on c-2 of the glycerol backbone, the fatty acid distribution at the c-1 and c-2 positions of glycerol within phospholipids are continually in flux, owing to phospholipid degradation and the continuous phospholipid remodeling that occurs while these molecules are in membranes. pes are neutral zwitterions at physiological ph. they mostly have palmitic or stearic acid on carbon 1 and a long chain of unsaturated fatty acid (e. g. 18:2, 20:4 and 22:6) on carbon 2 (pubchem, u.s. national library of medicine). the synthesis of adenosine and pe could be due to the increment of the metabolism rate in the cells and the various process involved in the spermatogenesis in the testes in the animals’ group fed with calcium salt and its efficiency to produce energy (pavkovych et al., 2015). basch et al. (1992) reported that a ca2+ and mg2+ stimulated adenosine 5’ diphosphatase has been found in lactating bovine mammary glands. the enzyme is associated with membranes of mitochondrial, microsomal, and golgi table 4. identified putative metabolites in treatment groups. groups* m/z putative metabolites a 102.0377 10-hydroxy-(2e,8e)-decadien-4-ynoic acid b 1057.9136 1-heneicosanoyl-2-docosanoyl-3-sn glycerol c and d 705.8320 adenosine 5' pentaphosphate pe (24:0/24:1(15z) *acontrol; b-prilled fat; ccalcium salt; d-canola oil figure 3. loading’s scatter (ls) plot illustrated the metabolites that consist in different treatment groups rumen protected fat and reproductive genes in malin rams (a. ismail et al.) 85 apparatus fractions in the mammary gland which indicates a possible role for this enzyme in the milk secretory process, particularly in atp cycling in vesicles. therefore, kurebayashi et al., (1980) mentioned that adenosine 5’ pentaphosphate represents an extremely useful tool in experiments with fragmented sarcoplasmic reticulum, such as studies of h + movement accompanying ca + movement, atp-adp exchange reaction, and calorimetry of the ca + uptake process in bullfrog skeletal muscle. cusostomo et al., (2020) reported that the increase in testicular content in atp and atp/ adp ratio was correlated with sperm counts. he also identified polar lipid metabolite in testicular of mice which are glycerol, ethonolamine, phosphoethamolamine and myoinositol using the h-nmr. in general, the lipid maps comprehensive classification system for lipids is comprised of eight lipid categories: fatty acyls (fa), glycerolipids (gl), sphingolipids (sp), glycerophospholipids (gp), saccharolipids (sl), prenol lipids (pr), polyketides (pk), and sterol lipids (st). each lipid category has its subclassification hierarchy. glycerolipids (gl) are mono-, di-, and tri-substituted glycerol’s, the most well-known being the tags, fatty acid esters of glycerol, formerly termed as triglycerides. tags represent the most abundant lipid class in oils and fats of animal origin and comprise the bulk of storage fat in mammalian tissue. these molecules exist as enantiomers since a centre of asymmetry is created upon enzymatic biosynthesis at carbon 2 of the glycerol backbone (donato et al., 2015). from this finding, we could understand that the important putative metabolites in the testes were fatty acids and their derivatives. this is consistent with jafaroghli et al. (2014) who mention that lipids are abundant in testicles, playing a crucial role in membrane structure and function, energy storage and cell signaling. reproductive genes the relative expression of the outer dense fiber protein 1 (odf 1), serpina10, catsper4, adipor2 and dazl are presented in figure 4. in the group fed with calcium salt and canola oil, the expression levels of odf 1 were five-fold and seven-fold compared to the control. serpina10 has expressed up-regulation compared to control which is four-fold, eight-fold, and 15-fold in the group fed with prilled fat, calcium salt, and canola oil. catsper4 was expressed up to fourfold in calcium salt meanwhile, in canola oil two-fold compared to control. the adipor2 gene was only expressed in the group fed with calcium salt which is ten-fold compared to the control. dazl gene was expressed five-fold in both groups; the group was fed with calcium salt and canola oil, respectively. ram fertility is important and it is influenced by testis development and spermatogenesis. both testis development and spermatogenesis are often regulated by core genes (bai et al., 2017). feeding rpf with calcium salt resulted in the up-regulation of all genes studied in this study (odf1, serpina10, catsper4, adipor2 and dazl), with more than two fold increment. this is because calcium salts have the highest digestibility among the other unsaturated fatty acid sources, providing the highest digestible energetic value which leads to the up-regulation of these core genes (block et al., 2006). odf1 and catsper4 are the genes related to sperm total number, concentration, and progressive motility (ahmad et al., 2018). serpina10 gene can improve fertilization and sperm development (bai et al., 2017). lipid metabolism with pufas improves gene expression of adipor (mazaherioun et al., 2017), and dazl gene which will bring up the meiosis and spermatogenic process in the testes (ma et al., 2013). the present findings are congruent with the report made by pavkovych et al., (2015), where supplementation of protected fats and polyenoic fatty acids of vegetable origin in a diet of cattle stimulates metabolism in the animals, increases their productivity, and improves the quality of milk and meat. supplements of calcium salts of fatty acids, made of palm oils, soybean, sunflower, rapeseed, and flaxseed are best given in a diet to young animals. present finding suggested that supplemen 86 j. indonesian trop. anim. agric. 48(2):76-88, june 2023 tation of rpf in the form of calcium salt may improve the fertility of malin ram through sperm total number, concentration, and progressive motility. conclusion it could be concluded that feeding lipid as rpf with calcium salt had converted pufas to adenosine, or energy for the spermatogenesis process in the testes. the opls-da model showed that there was a metabolites difference or changes between the control and rpf dietary group. however, no changes were identified between the calcium salt and canola oil. the changes indicated the efficiency of the rpf metabolism to produce pufas, tag, pe, and adenosine during the spermatogenesis in the testes. the present study also revealed 44 important putative metabolites via preliminary screening of lc/ms. however, this study only gives an overview of the metabolites in the testes and the changes when the animals are fed with prilled fat, calcium salt, and canola oil. the nmr or lc-ms/ms and proteomic integration with pathway analysis should be performed to confirm the putative metabolites and pathways in this study. similarly, feeding rpf with calcium salt gave up-regulation effects on reproductive gene expression such as odf1, serpina10, catsper4, adipor2, and dazl in malin ram. this finding gave the impression that supplementation of rpf with calcium salt will improve the reproductive efficiency in male ruminants by improving the motility of the sperm as well as the meiosis and spermatogenic process in testes. acknowledgement a.i. was a recipient of a scholarship from federal training award (hlp), the government of malaysia. references ahmad, m. h., l. t. chwen, and m. s. maidin. 2018. effect of different rumen protected fat from palm oil on testosterone level and tesfigure 4. the fold change of reproductive genes: outer dense fiber protein 1 (odf 1), serpina10 (ser10), catsper4 (cats), adipor2 (adi) and dazl rumen protected fat and reproductive genes in malin rams (a. ismail et al.) 87 ticular traits in malin rams. mal. j. anim. sci. 21: 27–38. bai, m., l. sun, j. zhao, l. xiang, x. cheng, j. li, c. jia, and h. jiang. 2017. histological analysis and identification of spermatogenesis-related genes in 2-, 6-, and 12-month-old sheep testes. naturwissenschaften. 104: 84. basch, j., c. leung, e. wickham, and h. farrel. 1992. distribution of adenosine 5 diphosphatese activity in the lactating bovine mammary gland. j. dairy sci. 75: 732-738. behan, a. a., t. c. loh, s. fakurazi, u. kaka, a. kaka, and a. a. samsudin. 2019. effects of supplementation of rumen protected fats on rumen ecology and digestibility of nutrients in sheep. anim. 9: 400. block, b. e., w. chalupa, d. palmquist, and c. sniffen. 2006. calcium salts are highly digestible. meyler’s side effects of drugs: the international encyclopedia of adverse drug reactions and interactions. 77, 610– 611. buccitelli, c. and m. selbach. 2020. mrnas, proteins and the emerging principles of gene expression control. nat. rev. genet. 21: 630 –644. chavda, m. r., h. h. savsani, m. r. gadariya, k. b. vala, a. j. dhami and v. k. karangiya. 2022. effect of peripartum supplementation of rumen protected choline and rumen protected fat on energy status, insulin, igf-1 and postpartum fertility in gir cows. the indian j. vet. sci. and biotechnol. 18: 34– 38. chen, x., c. hu, j. dai c.u, and l. chen. 2015. metabolomics analysis of seminal plasma in infertile males with kidney-yang deficiency: a preliminary study. evid. based complementary altern. med. 2015:892930. cusostomo, l., r. videira and i. jaral. 2020. diet during early life define testicular lipid content and sperm quality in adulthood. am. j. physiol. endocrinol. metab. 319:e1061e1073 de silva, s. m. h. h., e. d. n. s. abeyrathne, w. m. p. b. weerasinghe, k. k. t. n. ranaweera and m. b. p. k. mahipala. 2020. rumen protected fat preparation using by products generated in coconut processing industry. proceedings of the international research conference of uva wellassa university, 15. donato, p., f. cacciola, m. beccaria, p. dugo and l. mondello. 2015. lipidomics. compr. anal. chem. 68: 395–439. du, l., w. chen, z. cheng, s. wu, j. he, l. han, w. qin and z. he. 2021. novel gene regulation in normal and abnormal spermatogenesis. cells. 10: 1–16. fraser, l., k. wasilewska-sakowska, ł. zasiadczyk, e. piątkowska and k. karpiesiuk. 2021. fractionated seminal plasma of boar ejaculates analyzed by lc–ms/ms: its effects on post-thaw semen quality. genes. 12: 1574. hosseini, b., m. nourmohamadi, s. hajipour, m. taghizadeh, z. asemi, s. a. keshavarz and s. jafarnejad. 2019. the effect of omega -3 fatty acids, epa, and/or dha on male infertility: a systematic review and meta-analysis. j. diet. suppl. 16: 245–256. jafaroghli, m., h. abdi-benemar, m. j. zamiri, b. khalili, a. farshad and a. a. shadparvar. 2014. effects of dietary n-3 fatty acids and vitamin c on semen characteristics, lipid composition of sperm and blood metabolites in fat-tailed moghani rams. anim. reprod. sci. 147: 17–24. khoshniat, m. t., a. towhidi, k. rezayazdi, m. zhandi, f. rostami, n. dadashpour davachi, f. khalooee and j. kastelic. 2020. dietary omega-3 fatty acids from linseed oil improve quality of post-thaw but not fresh sperm in holstein bulls. cryobiology. 93: 102–108. kurebayashi, n., t. kodame and y. ogawa. 1980. adenosine 5 pentaphosphate as an inhibor of adenylate kinase in studies of fragmented sarcoplasmic reticulum from bullfrog skeletal muscle. j. biochem. 88: 871-876. livak, k. j. and t. d. schmittgen. 2001. analysis of relative gene expression data using real-time quantitative pcr and the 2-δδct 88 j. indonesian trop. anim. agric. 48(2):76-88, june 2023 method. methods. 25: 402–408. lone, s. a., n. shah, h. p. yadav, m. a. wagay, a. singh and r. sinha. 2017. sperm dna damage causes, assessment and relationship with fertility: a review. theriogenology insight an intl. j. reprod. anim. 7: 13-20. ma, c., j. li, h. tao, b. lei, y. li, k. tong, x. zhang, k. guan, y. shi and f. li. 2013. discovery of two potential dazl gene markers for sperm quality in boars by population association studies. anim. reprod. sci. 143: 97–101. ma, l., j. b. cole, y. da and p. m. vanraden. 2019. symposium review: genetics, genome-wide association study, and genetic improvement of dairy fertility traits. j. dairy sci. 102: 3735–3743. manriquez, d., l. chen, p. melendez and p. pinedo. 2019. the effect of an organic rumen-protected fat supplement on performance, metabolic status, and health of dairy cows. bmc vet. res. 15: 1–14. mazaherioun, m., a. saedisomeolia, m. h. javanbakht, f. koohdani, m. r. eshraghian and m. djalali. 2017. beneficial effects of n -3 polyunsaturated fatty acids on adiponectin levels and adipor gene expression in patients with type 2 diabetes mellitus: a randomized, placebo-controlled, doubleblind clinical trial. arch. med. sci. 13: 716– 724. naval-sanchez, m., q. nguyen, s. mcwilliam, l. r. porto-neto, r. tellam, t. vuocolo, a. reverter, m. perez-enciso, r. brauning, s. clarke, a. mcculloch, w. zamani, s. naderi, h. r. rezaei, f. pompanon, p. taberlet, k. c. worley, r. a. gibbs, d. m. muzny, … j. kijas. 2018. sheep genome functional annotation reveals proximal regulatory elements contributed to the evolution of modern breeds. nat. comm. 9: 1–13. ngcobo, j. n., f. v. ramukhithi, k. a. nephawe, t. j. mpofu, t. c. chokoe and t. l. nedambale. 2021. flaxseed oil as a source of omega n-3 fatty acids to improve semen quality from livestock animals: a review. anim. 11: 1–12. owens, f. n. and m. basalan. 2016. ruminal fermentation. in rumenology. springer, cham. pavkovych, s., s. vovk and b. kruzhel. 2015. protected lipids and fatty acids in cattle feed rations. acta sci. pol. zootech. 6145: 3–14. pubchem, u.s. national library of medicine website, https://pubchem.ncbi.nlm.nih.gov qu, y. h., l. y. jian, l. ce, y. ma, c. c. xu, y. f. gao, z. machaty and h. l. luo. 2019. identification of candidate genes in regulation of spermatogenesis in sheep testis following dietary vitamin e supplementation. anim. reprod. sci. 205: 52–61. schoech, s. j., r. bowman and s. j. reynolds. 2004. food supplementation and possible mechanisms underlying early breeding in the florida scrub-jay (aphelocoma coerulescens). horm. behav. 46: 565–573. wysokińska, a. and d. szablicka. 2021. integrity of sperm cell membrane in the semen of crossbred and purebred boars during storage at 17◦c: heterosis effects. anim. 11: 3373. yang, h., x. liu, g. hu, y. xie, s. lin, z. zhao and j. chen. 2018. identification and analysis of micrornas-mrnas pairs associated with nutritional status in seasonal sheep. biochem. biophy. res. comm. 499: 321–327. zhang, q., s. y. ji, k. busayavalasa, j. shao and c. yu. 2019. meiosis i progression in spermatogenesis requires a type of testis-specific 20s core proteasome. nat. comm. 10: 1–11. effect some natural additives on productive performance of white leghorn layers (s. tessema et al.) 101 j i t a a journal of the indonesian tropical animal agriculture accredited by ditjen riset, teknologi dan pengabdian kepada masyarakat no. 164/e/kpt/2021 j. indonesian trop. anim. agric. pissn 2087-8273 eissn 2460-6278 http://ejournal.undip.ac.id/index.php/jitaa 48(2):101-112, june 2023 doi: 10.14710/jitaa.48.2. 101-112 evaluation of ruta graveolen, coriander and basil seed extracts as natural additives on productive performance, blood profiles and egg quality of white leghorn layers s. tessema 1 , m. girma 1 , m. yirgalem 3* , n. ameha 1 , and t. zeryehun 2 1 school of animal and range sciences, haramaya university, p o box 138, dire-dawa, ethiopia 2 college of veterinary medicine, haramaya university, po box 138, dire dawa, ethiopia 3 department of animal sciences, wolkite university, p.o.box 07, wolkite, ethiopia *corresponding e-mail: ymetages257@gmail.com received march 14, 2023; accepted may 12, 2023 abstract the study was conducted to investigate the effect of mixtures of ruta graveolen (rg), coriander (c), and basil (b) seed extracts on productive performance, blood profiles, egg quality and egg chemical composition of white leghorn (wl) layers. one hundred eighty wl layers at twentysix weeks of age were randomly distributed to four treatments, each replicated three times with fifteen layers per replications in a completely randomized design and kept on a deep litter system for eight weeks. the treatments (t) were water containing mixtures of ruta graveolen, coriander, and basil seed extract with the proportion of 0 ml (t1), 2 ml (t2), 4ml (t3), and 6 ml (t4) per liter of water. the hen day egg production (hdep) was significantly (p<0.05) higher for layers in t3 (50.75%). serum cholesterol and ldl (low-density lipoprotein) cholesterol levels decreased significantly while, hdl (high-density lipoprotein) cholesterol and globulin increased significantly (p<0.01) when compared with the control. there were no significant differences (p>0.05) among treatments in egg weight, albumen weight, yolk weight, shell weight and thickness. generally; the mixtures of rg, c, and b seed extracts in 4ml/1lt in drinking water could increase hdep and egg quality and reduce serum cholesterol. keywords: basil seed, coriander seed, layer performance, ruta graveolen seed, white leghorn introduction antibiotic growth promoters have undoubtedly improved animal performance and health status however, the inclusion of antibiotics as a principal growth promoter pose a serious health problem for consumer often resulted in the incidence of antibiotic resistance among pathogens and a source of residues in animal body tissues (abd el-hack et al., 2022). hence, the european union banned the use of antibiotics as a growth promoter in animal feeds. as a result, scientists searched for locally available phytogenic feed additives intended to improve gut health and functions by fighting pathogenic bacterial infection (sapsuha et al., 2021; abd el-hack et al., 102 j. indonesian trop. anim. agric. 48(2):101-112, june 2023 2022). various types of phytogenic products– such as, garlic, anise, cinnamon, coriander, oregano, chili, basil, pepper, rosemary, rosehip and thyme – may be used as additives to enhance performance and modulate gut health in poultry (criste et al., 2017). medicinal plant extracts that were used as natural antimicrobials have a positive effect on performance parameters, including egg production, egg quality (khan et al., 2012), the immune system and antioxidant status (abd el-hack and alagawany, 2015). in addition, the extract improved performance by increasing the digestibility and retention of nutrients, increasing the secretion of digestive enzymes and mucous production, and improving gut health status and microbial population to maintain production performance during heat stress (criste et al., 2017). the seed of ruta graveolen is a rich source of secondary metabolites mainly: coumarins, alkaloids, volatile oils, flavonoids, and phenolic acids. it has been used to reduce inflammation abundantly worldwide due to its diverse medicinal properties or presence of essential oil obtained from this plant species have been shown to possess various pharmacological activities, such as antioxidant, anti-inflammatory, spasmolytic, sedative, antibacterial, antifungal, and antidiabetic effects (szewczyk et al., 2023). furthermore, it has anti-rheumatic, anti-diarrheic, anti-febrile, antiulcer, and antimicrobial properties reported in the recent pharmacological trials (jianu et al., 2021). the seeds of coriander (coriandrum sativum) contain 0.5% 1.0% essential oil rich in beneficial phytonutrients including flavonoids, carvone, geraniol, limonene, borneol, camphor, lemon, and linalool. flavonoids compound in coriander includes phenolic acid; it has been used to treat infections with worms due to its presence of anti-parasitic and antifungal (matasyoh et al., 2009). similarly, the seeds of basil (ocimum basilicum) have biologically active compounds including ursolic acid, apigenin, and luteolin that activate the cell-mediated immune response and stimulate appetite responses and counterattack the deterioration of feed due to the presence of antioxidant (shahrajabian et al., 2020). generally, as different researcher explained the use of medicinal plant extracts in poultry feeding have a positive effect on animal health, productivity, appetite stimulation, enhancement of enzyme activity and secretion related to diet digestion and absorption such as trypsin, amylase and jejunal chime (windisch et al., 2008; ghazaghi et al., 2014). in layer chickens, several studies indicated the possible beneficial effects of plant oils on egg production performance, improving egg quality and also supporting health status as a single compound or as mixed preparations (alshaheen et al., 2023). according to hadi and jassim (2013) study, adding 1.5 g/kg of basil leaves powder to the diet of growing quail resulted in better body weights, less serum cholesterol and increase levels of serum total proteins and globulins from 1 st week up to 6th week of age compared to the control group. basil seeds at 0.3% and 0.6% level also led to enhance the blood biochemical parameters and health status of broilers (kadhim, 2016). similarly, supplementation of coriander seeds 1%-3% significantly increased yellowness in yolk color without affecting other quality parameters (habiyah et al., 2016). on the other hand, synergistic effects of phytogenic compounds have been reported in studies with essential oils and a combination of herbal powders might tend to be more effective than a single herb administration (khaligh et al., 2011). however, there is limited information on the utilization of mixtures of ruta graveolen, coriander, and basil seed extracts in layers feeding. therefore, this study was designed to evaluate the effect of mixtures of ruta graveolen, coriander, and basil seed extracts on productive performance, blood profiles, egg quality, egg chemical composition, and economic benefit of wl layers. materials and methods study area the study was conducted at haramaya university poultry farm, which is located 505 km from addis ababa, capital city of ethiopia. the site is situated at an altitude of 1980 meters effect some natural additives on productive performance of white leghorn layers (s. tessema et al.) 103 above sea level, 9 0 26 ' n latitude, and 42 0 3' e longitude. the area has an average annual rainfall of 741.6 millimeters the mean annual minimum and maximum temperatures are 8.25 0 c and 23.4 0 c, respectively (mishra et al., 2004). collection and preparation of seed extracts ruta graveolen (rg), coriander (c), and basil (b) seeds were purchased from harar market and the dried seeds were pulverized at haramaya university's feed processing plant. the powder was preserved in an airtight plastic container until it was directly used for the preparation of water extract. then 20 g rg + 20 g c+ 20g b (a total of 60 g of the three seeds powder were added to 1l of distilled water and was shaken and infused overnight at room temperature, then filtered for all experimental days according to the protocol described by mollah et al. (2012).\ management of experimental chickens a total of 180 white leghorn layers were randomly selected for the study from haramaya university poultry farm. the birds were weighed and randomly distributed into four treatments, each treatment being replicated three times. each replicate was kept in 2x2 m pens wire-mesh partition on deep litter housing covered with a wheat straw. before the announcement of the actual experiment, watering, feeding troughs, and laying nests were thoroughly cleaned and disinfected. the experimental pen was sprayed against ecto-parasites. the birds were acclimated to rations for 7 days and then fed for 60 days for evaluation of egg parameters. during the experiment, feed was offered ad libitum and water was available all the time throughout the experimental period after they had finished ruta graveolen, coriander and basil infusion offered in drinking water daily at 6:30 hours. experimental design and treatments a completely randomized design with three replications was used for each treatment. each treatment was replicated three times with fifteen layers (table 1). using commercial layer ration of the nutrient requirements of 2800-2900 kcal me/kg dm and 16-17% cp (nrc, 1996). measurements and observations chemical analysis. representative samples of 20g of ruta graveolen, 20g of coriander, and 20g of basil seed powder were further analyzed before starting the experiment for chemical composition. according to the proximate analysis method aoac (1996) chemical analysis of experimental feeds were carried out for dry matter (dm), ether extract (ee), crude fiber (cf), ash, and nitrogen (n) content was determined by kjeldahl procedure and crude protein (cp) was calculated as nx6.25. the analysis was conducted in the animal nutrition laboratory of haramaya university. metabolizable energy (me) of the experimental diets was determined by indirect method according to the formula given by wiseman (1987) as follows. me (kcal/kg dm) = 3951 + 54.4 ee 88.7 cf 40.8 ash. feed intake. feed was weighed and offered twice daily at 8:00 and 17:00 hours. the orts were collected the next morning and weighed after removing external contaminants by visual inspection and handpicking. the feed offers and refusal were recorded for each replicate. feed intake was determined as the difference between the feed offered and refused. . body weight. the initial body weight of laying hens was individually measured and the final body weight was recorded at the end of the experimental study using sensitive balance to determine the body weight change and the mean value of the pen was taken. bodyweight change per pen per bird was determined as the difference between the final and initial body weight. average daily gain or loss was calculated as bw change divided by the number of experimental days. egg production. eggs were collected twice a day from each pen at 10:00 and 15:00 hours. the sum of the two collections was recorded as daily egg production. the rate of lay for each 104 j. indonesian trop. anim. agric. 48(2):101-112, june 2023 replicate was expressed as the average percentage of hen-day egg production following the method of (hunton, 1995). egg weight and egg mass. daily collected eggs immediately after collection were individually weighed for each replication and average egg weight was computed by dividing the total sum egg weight by the total number of eggs. after the mean weight has been determined, the following formula was employed to calculate the egg mass per pen on daily basis (north and bell, 1984). feed conversion ratio. the feed conversion ratio was calculated as the ratio of grams of feed to grams of egg mass according to the following formula. egg quality parameters. egg quality was assessed in terms of egg weight, albumen quality (albumen height and albumen weight), yolk quality (yolk height, yolk weight, yolk diameter, yolk color, and yolk index), external quality of shell weight and thickness, and haugh unit score (hus). for internal egg quality measurement, (15 eggs per treatment and 5 eggs per replication) were taken randomly and the average was computed for each quality parameter once every two week. albumen height and (haugh unit). the sample eggs were individually weighed, coded, and broken on a flat tray, the height of the thick albumen of each egg was measured with a tripod micrometer, and the average haugh unit value for each replicate was calculated by using the formula given by (haugh, 1937). haugh unit (hu) =100 x log (h1.7w 0.37 +7.6) where, h= albumen height (mm); w= weight of egg (g) eggshell weight and thickness. the shells of the broken eggs were separated from their shell membrane, air-dried, and weighed. the measurement of shell thickness was carried out with a micrometer gauge having a sensitivity of 0.001 mm, at three points of the eggshell (air cell, equator, and sharp end). yolk quality evaluation. the yolk of each of the sample eggs was separated from the white and yolk height and the diameter was measured using a tripod micrometer and ruler respectively. then, the yolk was thoroughly mixed and a sample droplet from each egg was placed on a piece of white paper. the roche color fan consisting of a series of fifteen colored plastic strips were used as a reference to determine yolk color, with 1 rated as very pale yellow and 15 as deep reddish-orange. the mean for each replicate was calculated by taking the average reading from the three sample eggs. yolk index was also computed using the following formula: yolk index = (yolk height) / (yolk diameter) x 100 hematological and serum biochemical parameters. at the end of the experiment, blood samples (5 ml each) were collected from the wing vein of 12 hens from each treatment. hematological and serum biochemical analysis was conducted at haramaya university veterinary physiology laboratory and higher clinic laboratory, respectively. for, the blood analysis, 2.5 ml of blood was collected using edta (ethylene diamine tetra acetic acid) tube while the remaining 2.5 ml was collected in a plain tube and left to coagulate. blood samples were analyzed for total red blood cells (rbc), hemoglobin (hb), packed cell volume (pcv), white blood cell (wbc), total protein (tp), and serum cholesterol % hen egg production = egg mass (g/hen/day) = effect some natural additives on productive performance of white leghorn layers (s. tessema et al.) 105 concentration. rbc and wbc were determined by using an improved neubauer hemocytometer chamber (dacie and lewis, 1991). hemoglobin concentration was determined by using acid hematin or sahli's methods. the packed cell volume (pcv) by microhematocrit (capillary) tubes method and centrifuged at 3000 rpm for 5 minutes. finally, serum was harvested from blood collected in a plain tube which was transferred to an endorphin tube and stored at -20c o and analyzed for serum chemistry parameters (serum total protein and albumin, total cholesterol count, hdl-c, and ldl-c) with an automated chemistry analyzer (douglas et al., 2010). the globulin value was determined by the difference between serum total protein and albumin (doumas et al., 1981). egg chemical composition. a total of 48, twelve eggs per treatment (four per replication) were taken for proximate analysis. the egg yolk and albumen were separated carefully and then each component was mixed thoroughly and poured into the pan and covered with aluminum foliate. the egg yolk and albumen collected were heated in an oven at 55 o c for about 72 hours for partial drying. the sample was ground, homogenized, packed, and stored for further proximate analysis. the partially dried samples were weighed and dried in an oven at 105 o c for about 12 hours for the determination of the dry matter. the ash, protein, and lipid content of the egg white and yolk were analyzed following the aoac methods (aoac, 2000). egg nitrogen content was determined by the kjeldahl method and crude protein was calculated using the formula; egg nitrogen × 6.25. table 1. experimental layout treatments number of replications layer/replication t1 0 ml infusion of rg, c, and b/l water 3 15 t2 2 ml infusion of rg, c, and b/l water 3 15 t3 4 ml infusion of rg, c, and b/l water 3 15 t4 6 ml infusion of rg, c, and b/l water 3 15 total 12 60 rg=ruta graveolen, c= coriander b= basil and t=treatment and ml=milli liter, l=litter table 2. effect of mixtures of ruta graveleon, coriander, and basil seed extracts on bodyweight gain, egg production performances parameters treatments t1 t2 t3 t4 sem sl feed intake (g/hen/day) 99.77 b 100.53 ab 103.23 a 98.53 b 0.9647 * initial bw (g) 1133.29 1169.98 1186.16 1178.1 15.741 ns final bw (g) 1244.4 b 1292.2 b 1360.6 a 1304.7 ab 20.378 * body wt. change 111.11 b 122.22 b 174.44 a 126.89 b 9.9355 ** bw gain(g/hen/day) 1.85 b 2.04 b 2.91 a 2.11 b 0.1656 ** total egg/bird(no) 27.13 b 29.07 ab 30.44 a 27.82 b 0.6390 * hdep (%) 45.23 c 48.42 ab 50.75 a 46.37 bc 0.9302 * egg weight(g) 50.77 52.54 54.10 51.78 0.9963 ns em (g/hen/day) 22.97 b 25.44 ab 27.48 a 24.01 b 0.8391 * fcr(egg bases) 4.34 a 3.96 ab 3.77 b 4.10 ab 0.1178 * a, b, c, row means with different superscripts are significantly different,**=p<0.01, *= p<0.05, sl = significant level, sem = standard error of mean, g = gram, bw = body weight, hdep = hen day egg production, fcr = feed conversion ratio, em = egg mass 106 j. indonesian trop. anim. agric. 48(2):101-112, june 2023 statistical analysis the experimental design used in this study was a completely randomized design. the data collected during the period of the study were subjected to analysis of variance using (sas 2009 version 9.4) computer software. when the analysis of variance indicates the existence of a significant difference between treatment means, then the least significant difference method was used to locate the treatment means that are significantly different (p < 0.05). results and discussion feed intake, egg production and egg mass feed intake (fi) was significantly differ (p<0.05) among the different levels of mixtures of ruta graveolen, coriander, and basil seed extracts in drinking water. higher feed intake was recorded in t3 followed by t2, t1, and, t4 (table 2). the improvement in feed intake with the addition of polyherbal could be due to essential oils and their main component, which stimulated the appetizing and digestive process in animals. mudalal et al. (2021) reported that medicinal plant extracts have appetite and digestionstimulating properties and antimicrobial and antioxidant effects. the possible reason for lower feed intake in t4 as compared to t2 and t3 might be due to the high concentration of essential oils which is toxic when used at higher doses (lee et al., 2004). feed intake and water intake have positive relationship (leeson and summers, 2005). plant extract that was given in drinking water can affect the feed intake of the animal. as sigolo et al., (2021) indicated, different plant extracts were delivered to broiler in drinking water and they had a significant impact on the feed intake of the animal. body weight gain and egg production in t4 were not significantly different compared to control that could be the feed intake similarity between these treatments (yaman et al., 2020). egg production of white leghorn layers was significantly higher (p<0.05) in t3 than in t2 and t1. t4 was numerically higher than in the t1 (control) but, it did not indicate any statistical difference (p>0.05) (table 2 and figure 1). the result in this study is in line with the study of ooi et al. (2018) who reported dietary local medicinal herbs as feed additives on production performance and fecal parameters in laying hens level of 1% was effective to increase egg production. similarly better egg production was obtained by using supplementation of medicinal polyherbal extracts supplements at a level of 1%2% in the production and egg quality of laying japanese quail hens (zeweil et al., 2006). the exact mechanism through which egg laying performance enhanced is not known. however, according to zhao et al. (2011) the higher egg production performance of the laying hens may be due to antioxidant, antimicrobial and other activities such as increased blood circulation and secretion of digestive enzymes and reduction in the oxidation of feed due to the bioactive components in the plant. in addition the bioactive components play a vital role in the digestion and absorption of nutrients that might have improved the performance parameters of laying hens h e n -d a y e g g p r o d u c ti o n figure 1. weekly average hen-day egg production of white leghorn chick administerd on mixtures of rg, b and c seed extract via drinking water effect some natural additives on productive performance of white leghorn layers (s. tessema et al.) 107 (windisch et al., 2008). the egg mass of layers in t3 was higher (p<0.05) than that of layers in t2, t4, and control group. similarly, guler et al. (2006) reported that significant (p<0.05) increase in the highest egg mass were in 1% and 2% coriander seed extracts on egg production performance and nutrient retention in laying japanese quails. these results are in contrast with the findings of ooi et al. (2018) who reported dietary local medicinal herbs as feed additives on production performance in laying hens level of 1% was effective to increase egg weight but no significant change in egg mass. a possible reason for higher egg mass might be due to positive influence of the extract on the conversion of digested feed into eggs. yolk color a high yolk color score was recorded in t3, followed by t2, t4, and t1. but yolj color score of t3 was statistically similar to t2 (table 3). likewise, kazem (2013) stated that dietary supplementation of 1%-3% medicinal herbs on diets including 2% medicinal herbs increased egg yolk color. in addition, kopsell et al. (2005) explained that, basil was shown to rank highest among spices and herbal crops for carotenoids. similarly, supplementation of coriander seeds into the feed was able to increase the absorption of betacarotene contained in the feed (habiyah et al., 2016). so, the changes in color values, i.e., the increase in yolk color fun (ycf) score from the experimental treatments in the present study are consistent with the changes in the content of carotenoid fractions in the diets (kljak et al., 2021). table 3. effect of mixtures of ruta graveleon, coriander, and basil seed extracts on egg quality measurements of white leghorn layers. treatments parameters t1 t2 t3 t4 sem sl albumen weight (g) 30.40 30.00 26.80 29.90 1.30 ns albumen height (mm) 6.50 6.40 5.70 6.40 1.29 ns haugh unit 90.76 90.09 87.75 89.86 2.15 ns yolk weight (g) 15.49 16.97 15.36 16.81 0.45 ns yolk height (mm) 15.87 16.13 15.71 15.90 0.165 ns yolk diameter (cm) 4.12 4.14 4.02 4.10 0.054 ns yolk index 0.38 0.39 0.39 0.39 0.001 ns yolk color (*rsp) 3.63 c 4.13 ab 4.45 a 4.00 bc 0.137 * shell thickness (μm) 0.334 0.307 0.335 0.328 0.003 ns shell weight (g) 5.471 4.966 4.971 5.056 0.193 ns a, b, c, row means with different superscripts are significantly different, *= p<0.05, t1 = 0ml of rg,c and b seed extracts (control), t2 = 2ml of rg,c and b seed extracts ,t3=4ml of rg,c and b seed extracts,t4=6ml of rg,c and b seed extracts, g = gram, cm = centimeter, rsp =roche scale point sl = significant level, sem = standard error of mean, rg=ruta graveleon,c=coriander, b=basil table 4. effect of mixtures of ruta graveleon, coriander, and basil seed extracts in drinking water on egg chemical composition of white leghorn layers. albumen t1 t2 t3 t4 sem sl moisture (%) 87.71 87.67 86.84 85.45 0.6807 ns protein (%dm) 62.19 b 63.15 b 64.46 b 69.78 a 1.2393 * lipid(%dm) 0.81 0.62 0.58 0.93 0.1793 ns ash(%dm) 3.73 3.65 4.11 3.01 0.6142 ns yolk moisture (%) 93.89 94.82 94.55 93.36 0.7774 ns protein (%dm) 15.75 20.80 15.41 17.99 1.9677 ns lipid(%dm) 49.19 52.52 50.86 55.01 1.2356 ns ash(%dm) 5.92 5.21 4.44 4.82 0.7059 ns a and b, row means with different superscripts are significantly different *= p<0.05, sl = significant level, sem = standard error of the mean. 108 j. indonesian trop. anim. agric. 48(2):101-112, june 2023 as hernandez et al. (2014) reported the carotenoid in such medicinal herbs supported the high yolk color score since it had the same function as xanthophyll. albumen weight, eggshell, yolk weight, yolk height, yolk index and yolk diameter the result of this study revealed that eggshell, albumen, yolk weight, yolk height, yolk index, and yolk diameter did not show significant difference (p>0.05) among the different treatments (table 3). likewise, habiyah et al. (2001), reported no significant (p>0.05) difference in the shell, albumen, and yolk weight by supplementation of the deferent ratio of coriander seed extracts in lohmann brown. the current study disagrees with the study of guler et al. (2006) who reported that significantly (p < 0.05) increase in the highest yolk and albumen weights were in 1% and 2% coriander seed extracts on egg production performance and nutrient retention in laying japanese quails. . egg yolk and albumen chemical composition there were no significant (p>0.05) differences in egg yolk and albumen chemical compositions across all the treatments combination except for albumen protein content (table 4). higher (p<0.05) albumen protein content was recorded in t4 than those in t3, t2, and t1. but, t3, t2, and t1 were statistically similar. the increase in albumen protein might be the synergetic effect of the active compounds in polyherbal seed (furanocoumarins, flavonoids, and furoquinolines) which have strong, antioxidant, antiinflammatory, and anti-helminthic properties maybe reduce protein oxidation (brenes and roura, 2010). besides, rg, c, and b mixtures might have abundant photolytic enzymes, which promote protein digestion, deposition, and improve the transportation of metabolic protein in birds (wasiyati et al., 2018). blood analysis the total serum cholesterol concentration was significantly lower (p < 0.01) in t4 compared with control, t2, and t3. as supplementation of rg, c, and b seed extracts increased, serum hdl-cholesterol significantly (p < 0.01) increased from 47.57 mg/dl in t1 to 55.95 mg/dl in t4. in the present study, the serum ldlcholesterol concentration decreased significantly (p <0.05) from 101.65 mg/dl in t1 and 96.75 mg/dl in t4 (table 5). the finding in the present study was in line with khubeiz and shirif (2020) who observed that coriander as a feed additive to broiler increased hdl-cholesterol level and decreased their ldl-cholesterol level. the decrease in cholesterol levels might be due to the polyherbal oil is an inhibitor of the hepatic 3hydroxy-3-methylglutaryl coenzyme a (hmgtable 5. effect of mixtures of ruta graveleon, coriander, and basil seed extracts in drinking water on hematological and serum biochemistry of white leghorn layers. parameters treatments sem sl t1 t2 t3 t4 total cholesterol (mg/dl) 149.52 a 148.53 a 146.22 a 142.24 b 1.08 ** hdl-c (mg/dl) 47.57 c 49.43 bc 51.96 b 55.95 a 1.11 ** ldl-c (mg/dl) 101.65 a 101.08 ab 97.38 c 96.75 bc 1.22 * tp (g/dl) 3.50 b 3.50 b 3.95 a 3.51 b 0.04 *** albumin(g/dl) 1.93 1.89 2.00 1.98 0.08 ns globulin(g/dl) 1.56 b 1.56 b 1.95 a 1.53 b 0.07 ** rbc(10 6 /μl) 3.46 3.54 3.56 3.34 0.65 ns wbc(10 3 /μl) 7.10 a 6.33 ab 6.12 b 5.42 b 0.30 * hb (g/dl) 10.39 b 10.78 ab 11.33 a 10.65 b 0.18 * pcv (%) 33.82 34.47 35.23 33.95 0.42 ns a, b, c, row means with different superscripts are significantly different,***= p<0.001, **=p<0.01, *= p<0.05, sl = significant level, sem = standard error of mean, rbc=red blood cells, hb= hemoglobin, pcv= packed cells volume, wbc= white blood cells, tp= total protein, hdl-c= high density lipoprotein cholesterol, ldl-c= low density lipoprotein cholesterol, rg=ruta graveleon,c=coriander, b=basil. effect some natural additives on productive performance of white leghorn layers (s. tessema et al.) 109 coa) reductase activity, which is a key regulatory enzyme in cholesterol synthesis by hepatocytes or the fractional reabsorption from the small intestine (lee et al., 2004). statistically significant difference was not seen on pcv and total rbc count of the experimental birds among the different treatments. however, significant differences (p<0.05) were noted on total wbc count, hb concentration, serum total protein and globulin. likewise, zeweil et al. (2006) noted significantly higher serum total protein and globulin with 1% supplementation of medicinal polyherbal extracts to laying japanese quail hens as compared to a control diet. a higher value serum total protein and globulin might indicate there is enzyme hydrolysis of dietary proteins explained that the blood pool serves as a major source of amino acids needed for the synthesis of proteins as indicated by scott (1970). significant difference in blood constituents of hens may be due to associated with the effects of herbs bioactive compounds on improving the antioxidant status of the bird (rababah et al., 2004) conclusion from this study, it was concluded that inclusion of 4ml of ruta graveolen, coriander, and basil seed extracts (mixed medicinal herbs powder) in one liter of drinking water significantly increased hen-day egg production, yolk color, feed intake, egg weight, egg mass and hdl cholesterol level while, it can significantly decrease serum ldlcholesterol level. further research was recommended to assess the identification of active chemical compounds in the seeds of ruta graveolen, coriander, and basil as well as their effect at higher proportions on the performance of layers. acknowledgments authors would like to thank haramaya university research office for the financial funding to the research project. a special gratitude is going to haramaya university animal nutrition and food science laboratory technicians and poultry farm workers for their kind support with critical research inputs and the help in the farm and laboratory. references abd el-hack, m.e., m.t. el-saadony, h.m. salem, a.m. el-tahan, m.m. soliman, g.b. youssef, a.e. taha, s.m. soliman, a.e. ahmed, a.f. el-kott, k.m. al syaad and a.a. swelum. 2022. alternatives to antibiotics for organic poultry production: types, modes of action and impacts on bird's health and production. poult. sci. 101: 1-20. abd el-hack, m.e. and m. alagawany. 2015. performance, egg quality, blood profile, immune function, and antioxidant enzyme activities in laying hens fed diets with thyme powder. j. anim. feed sci. 24: 127133. al-shaheen, s.a., r.j. abbas and t.i. majeed. 2023. effect of different levels of basil and peppermint an essential oils on productive and physiological performance of two quail lines during egg production period. ann. for. res. 66: 2526-2546. aoac (association of official analytical chemists). 1996. official methods of analysis of aoac international (16 th edition). virginia. usa. asghariana, s., m.r. hojjatib, m. ahrari, e. bijad, f. derisc and z. lorigooinia. 2020. ruta graveolens and rutin, as its major compound: investigating their effect on spatial memory and passive avoidance memory in r ats. pharm. biol. 58: 447–453. https:// doi.org/10.1080/13880209.2020.1762669. brenes, b. and e. roura. 2010. essential oils in poultry nutrition: main effects and modes of action. anim. feed sci. technol. 15:81-114. criste, r.d., t.d. panaite, c.tabuc, m. saracila, c. șoica and m. olteanu. 2017. effect of oregano and rosehip supplements on broiler (14-35 days) performance, carcass and internal organs development and gut health. agrolife sci. j. 6: 75-83. https://doi.org/10.1080/13880209.2020.1762669 https://doi.org/10.1080/13880209.2020.1762669 110 j. indonesian trop. anim. agric. 48(2):101-112, june 2023 dacie, j.v. and s.m. lewis. 1991. practical hematology. 7th edition, churchil livingstone, edinburgh, p. 54-79. douglas, j., k. weiss and j. wardrop. 2010. veterinary hematology. 6th edn. blackwell publishing ltd. esteghamat, p. 82 . doumas, b.t., d.d. bayso, r.j. carter, t. peters and r. schaffer. 1981. determination of total serum protein. clin. chem. 27:16421643. https://doi.org/10.1093/ clinchem/27.10.1642 ghazaghi, m., m. mehri and f. bagherzadehkasmani. 2014. effects of dietary mentha spicata on performance, blood metabolites, meat quality and microbial ecosystem of small intestine in growing japanese quail. anim. feed sci. technol. 194: 89-98. guler, t., o.n. ertaş, m. ciftçi and b. dalkiliç. 2006. effect of feeding coriander (coriandrum sativum l.) on egg production performance and nutrient retention in laying japanese quails.j. appl. anim. res. 30: 181 -184. https:// doi.org/10.1080/09712119.2006.9706614 habiyah, u., r. mutia, and s. suharto. 2016. performance and egg quality of laying hens fed ration containing coriander seeds (coriandrum sativum linn). media peternakan. 39: 61-66. https:// doi.org/10.5398/medpet.2016.39.1.61. hadi m.m. and d.b. jassim. 2013. effect of using dried basil leaves powder on some productive and hematological traits of japanese quail. euphrates j. agric. sci. 5: 57-64. (in arabic). hashemi, s.r. and h. davoodi. 2010. phytogenics as a new class of feed additive in the poultry haugh, r. 1937. the haugh unit for measuring egg quality. http://edis.ifas.ufl.edu/pdffiles. hernandez, f., j. madrid, v. garcia, j. orengo and m.d. megias. 2004. influence of two plant extracts on broiler performance, digestibility, and digestive organ size. poult. sci. 83(2): 169-174. https://doi.org/10.1093/ ps/83.2.169 hunton, p. 1995. egg production, processing and marketing. international world poultry science, elsevier, tokyo, p. 457-480. jianu, c., i. goleț, d. stoin, i. cocan, g. bujanca, c. mișca, m. mioc, a. mioc, c. șoica, a.t. lukinich-gruia and l.c. rusu. 2021. chemical profile of ruta graveolens, evaluation of the antioxidant and antibacterial potential of its essential oil, and molecular docking simulations. appl. sci. 11:11753. kadhim, s.k. 2016. effect of different levels of basil seeds on some blood biochemical traits. j. biosci. biotechnol. 5: 477-480. kazem, k. 2013. effect of dietary medicinal herbs on performance, egg quality and immunity response of laying hens. adv. environ. biol. 13 khaligh, f., g. sadeghi, a. karimi and a. vaziry. 2011. evaluation of different medicinal plants blends in diets for broiler chickens. j. med. plant res. 5:1971-1977. khan, r.u., z. nikousefat, v. tufarelli, s. naz, m. javdani and v. laudadio. 2012. garlic (allium sativum) supplementation in poultry diets: effect on production and physiology. world poultry sci. j. 68: 417-424. khubeiz, m.m. and a.m. shirif. 2020. effect of coriander (coriandrum sativum l.) seed powder as feed additives on performance and some blood parameters of broiler chickens. open vet. j. 10:198-205. doi: 10.4314/ovj.v10i2.9 kljak, k., k. carović-stano, i. kos, z. janječić, g. kiš, m. duvnjak, t. safner and d. bedeković. 2021. plant carotenoids as pigment sources in laying hen diets: effect on yolk color, carotenoid content, oxidative stability and sensory properties of eggs. foods. 10: 721. kopsell, d.a., d.e. kopsell and j. currancelentano. 2005. carotenoid and chlorophyll pigments in sweet basil grown in the field and greenhouse. hortscience, 40: 1119 -1119. lee, k.w., h. everts and a.c. beynen. 2004. essential oils in broiler nutrition. int. j. poult. sci. 3: 738-752. https:// doi.org/10.3923/ijps.2004.738.752. https://doi.org/10.1093/clinchem/27.10.1642 https://doi.org/10.1093/clinchem/27.10.1642 https://doi.org/10.1080/09712119.2006.9706614 https://doi.org/10.1080/09712119.2006.9706614 https://doi.org/10.5398/medpet.2016.39.1.61 http://edis.ifas.ufl.edu/pdffiles https://doi.org/10.1093/ps/83.2.169 https://doi.org/10.1093/ps/83.2.169 https://doi.org/10.4314/ovj.v10i2.9 https://doi.org/10.3923/ijps.2004.738.752 effect some natural additives on productive performance of white leghorn layers (s. tessema et al.) 111 leeson, s. and j.d. summers. 2005. commercial poultry nutrition. 3rd ed. nottingham university press, canada. 398p. matasyoh, j.c., z.c. maiyo, r.m. ngure and r. chepkorir. 2009. chemical composition and antimicrobial activity of the essential oil of coriandrum sativum. food chemistry. 113: 526-529. mishra. b.b, k.m. kibret and b. eshetu. 2004. soil and land resources inventory at alemayauniversiry research farm with referen ce to land evaluation for sustainable agricult ural management and production. synthesis of working papers, soil sciences bulletein, 1:123. mollah, m.r., m.m. rahman, f. akter and m. mostofa. 2012. effects of nishyinda, black pepper and cinnamon extract as growth promoter in broilers. bangladesh j. vet. med. 29: 69-77. https://doi.org/10.3329/ bvet.v29i2.14345 mudalal, s., a. zaazaa and j.a. omar. 2021. effects of medicinal plants extract with antibiotic free diets on broilers growth performance and incidence of muscles abnormalities. braz. j. poult. sci. 23: 1-8 north, m. and d. bell. 1984. breeder management. commercial chicken production manual. avian. publishing company. inc.westport, connecticut, p. 240-321. nrc (national research council). 1996. nutrient requirement of poultry, 19th edition. national academic press, washington d.c. usa. p. 167. ooi, p.s., a.r. rohaida, a.d. nur hardy, d. devina, a.h. borhan, s. kartini, j.s. jupikely, m. abdul rahman and a.r. alimon. 2018. effect of local medicinal herbs as feed additives on production performance and faecal parameters in laying hens. malays. j. anim. sci. 21:59-67. rababah, t.m., n.s. hettiarachchy and r. horax. 2004. total phenolics and antioxidant activities of fenugreek, green tea, black tea, grape seed, ginger, rosemary, gotu kola and ginkgo extracts, vitamin e and tertbutylhydroquinone. j. agric. food chem. 52: 5183-5186. rahimi, s., z. teymouri zadeh, m.a. karimi torshizi, r. omidbaigi and h. rokni. 2011. effect of the three herbal extracts on growth performance, immune system, blood factors, and intestinal selected bacterial population in broiler chickens. j. agric. sci. 13:527– 53. sapsuha, y., e. suprijatna, s. kismiati and s. sugiharto. 2021. combination of probiotic and phythobiotic as an alternative for antibiotic growth promoter for broilers chickens a review. livest. res. rural. dev. 33: 49. scott, a. 1970. absorption of carbohydrate and protein metabolism. in duke"s physiology of domestic animals. (18th eds). (swenson, m.j. edited). cornell university press limited, london, uk. shahrajabian, m.h., w. sun and q. cheng. 2020. chemical components and pharmacological benefits of basil (ocimum basilicum): a review. int. j. food prop. 23: 1961–1970. sigolo, s., c. milis, m. dousti, e. jahandideh, a. jalali, n. mirzaei, b. rasouli, a. seidavi, a. gallo, g. ferronato and a. prandini. 2021. effects of different plant extracts at various dietary levels on growth performance, carcass traits, blood serum parameters, immune response and ileal microflora of ross broiler chickens. ital. j. anim. sci. 20:359-371. szewczyk, a., w. pazdziora, and h. ekiert. 2023. the influence of exogenous phenylalanine on the accumulation of secondary metabolites in agitated shoot cultures of ruta graveolens l. molecules. 28: 727. wasiyati, a., f. pratama and t. widowati. 2018. physical and chemical properties of salted egg with addition of coriander seed extract (coriandrum sativum l.). int. j. recent sci. res. 9: 29878-29880. windisch, w., k. schedle, c. plitzner and a. kroismayr. 2008. use of phytogenic products as feed additives for swine and poultry. j. anim. sci. 86: e140–e148. wiseman, j. 1987. feeding of non-ruminant livestock. butter worth and c. ltd. p.370. https://doi.org/10.3329/bvet.v29i2.14345 https://doi.org/10.3329/bvet.v29i2.14345 112 j. indonesian trop. anim. agric. 48(2):101-112, june 2023 yaman, m.a., y. usman, c.a. fitri and h. latif. 2020. increase in egg production, egg quality and immunity of local chicken resulted by cross-breeding. iop conf. ser.: earth environ. sci. 425: 012043. doi:10.1088/1755-1315/425/1/012043. zeweil, h.s., s.g. genedy and m. bassiouni. 2006. effect of probiotic and medicinal plant supplements on the production and egg quality of laying japanese quail hens. in proceeding of the 12th european poultry conference zwan, september, 2006. p. 16. zhao, x., z.b. yang, w.r. yang, y. wang, s.z. jiang and g.g. zhang. 2011. effects of ginger root (zingiber officinale) on laying performance and antioxidant status of laying hens and on dietary oxidation stability. poult. sci. 90:1720-1727. https:// doi.org/10.3382/ps.2010-01280. https://doi.org/10.3382/ps.2010-01280 https://doi.org/10.3382/ps.2010-01280 the water filter application with zeolite filter in laying hens farm (m. fauzi et al.) 113 j i t a a journal of the indonesian tropical animal agriculture accredited by ditjen riset, teknologi dan pengabdian kepada masyarakat no. 164/e/kpt/2021 j. indonesian trop. anim. agric. pissn 2087-8273 eissn 2460-6278 http://ejournal.undip.ac.id/index.php/jitaa 48(2):113-125, june 2023 doi: 10.14710/jitaa.48.2. 113-125 water filter application with zeolit composite material in laying hens farm towards the egg quality m. fauzi 1 , i. isnafia arief 2 , and z. abidin 3* 1 graduate school of animal production and technology, ipb university 2 department of animal production and technology, faculty of animal science, ipb university 3 department of chemistry, faculty of mathematics and natural sciences, ipb university bogor, 16680, indonesia *corresponding e-mail : abidinzed@apps.ipb.ac.id; abidinz.ipb@gmail.com received november 25, 2022; accepted may 05, 2023 abstract this study aimed to analyze the physical, chemical, and microbiological properties of applying an antibacterial water filter made from zeolite composites in laying hens. this study used a completely randomized design with a factorial pattern with 2 factors and 3 replications for egg quality. factor a is the zeolite treatment, and factor b is the day of egg collection after being filtered. if the measures show a significant difference, it is continued with the least significant difference test, and the chemical quality of the eggs and the microbiology of the eggs are tested using the t-test analysis (paired samples). the results showed that there was a significant interaction between the zeolite treatment and the day after the filter was installed after the eggs were collected. this increases the value of egg length, egg width, shell weight, shell thickness, and haugh units. furthermore, the chemical quality of eggs treated with zeolite alone on day 3 had a significant effect (p<0.05) on the dry matter and egg fat content . the microbiological quality of the eggs also showed that the zeolite treatment reduced the tpc value and effectively killed escherichia coli and salmonella sp. it was concluded that the application of zeolite filters to the drinking water of laying hens could improve physical quality, maintain chemical quality, and is effective as an antibacterial against bacterial populations, escherichia coli and salmonella sp bacteria in eggs. keywords: laying hens, microbigical quality, physicochemical quality, zeolite filter introduction laying hens are a potential poultry livestock in various parts of the world. this typerof chickens is cultivated in producing eggs for daily consumption in large commercial production across the globe (duman et al., 2016). purebred chicken eggs are highly nutritious livestock, so oftenly they become a highly comestibles need (tolimir et al., 2017). laying hens obtain water from 3 sources: drinking water, water from food, and water from the oxidation of carbohydrates, fats, and proteins. water consumption in laying hens is generally influenced by age, ambient mailto:abidinzed@apps.ipb.ac.id mailto:abidinz.ipb@gmail.com 114 j. indonesian trop. anim. agric. 48(2):113-125, june 2023 temperature, production, ration consumption, and the chickens' health. the water used to feed chickens must be sufficient and in good quality.water quality is affected by escherichia coli bacteria, water ph, magnesium levels, nitrate and nitrite levels, sodium/chloride levels, and another minerals. (swick et al., 1999). water quality has an essential role in the maintenance of laying hens. the growth of bacteria, fungi, minerals, and water additives interact in water sources and piping and drinking places for laying hens to cause an optimal performance impact on laying hens (oviedo et al., 2006). although 1000 bacteria per millimeter are acceptable for poultry drinking water, up to 1 million bacteria per millimeter have been found in contaminated water (watkins et al., 2002). based on the results of the drinking water test before zeolite treatment on drinking water of laying hens on farms, the total number of bacteria was 8 x 10 4 cfu/ml, escherichia coli 1.4x10 1 cfu/ml and salmonella sp. 1.5x10 1 cfu/ml and water quality standard values for livestock were grouped as classes ii with microbiological requirements of 5000 mpn/100 ml of coliform and 2000 mpn/100 ml of escherichia coli. ideally, bacteria should not be present in drinking water; the presence of coliform bacteria contamination in drinking water is related to fecal contamination and other contaminants produced from the livestock environment, which contaminate water sources and can have an impact on the productivity of laying hens and the quality of the eggs produced (brake and hess 2001). boetius et al. (2015) stated that several factors, such as sufficient nutrients, the appropriate ph, and sufficient temperature around the chicken drinking bowl, caused microorganisms to grow correctly. using chlorine to suppress bacterial populations in drinking water hurts the health of chickens and negatively impacts humans who consume chicken eggs (polder et al., 2016). due to the adverse effects of chlorination on drinking water for chickens, in several developed countries, the use of chlorination for drinking water is prohibited, and chlorination as a disinfection process is no longer used (shi et al., 2017). based on the problems above, it is necessary to carry out proper handling to overcome the problem of bacterial contamination in laying hens' drinking water with modified natural zeolite as an antibacterial. it does not hurt the health of laying hens and humans who consume chicken eggs. therefore an antibacterial water filter is made with the addition of copper (cu) modified zeolite. zeolite is a porous alumina-silica material found in nature or synthesized and is often applied as an adsorbent, ion exchanger, and catalyst (nik malek et al., 2018). zeolite has a structure composed of an alumina tetrahedron which acts as a negative charge, and a silica tetrahedron which acts as a positive charge (drakhshankhah et al., 2020). as an ion exchanger, zeolite can contain metal ions or nanoparticles. metal ions which have the potential as antibacterial and are contained in inorganic materials, can make these composite materials antibacterial (ferreira et al., 2012). natural zeolite + 0.5 m cuso4 can inhibit bacteria because natural zeolite has been activated with the heavy metal cuso4 0.5 m by soaking the zeolite so that the zeolite and cuso4 combine perfectly to form cu 2+ and then burning at 700◦c changes to cuo + cu2o so that the zeolite cuso4 0.5 m has inhibitory power against escherichia coli bacteria. this study aims to analyze the physical, chemical, and microbiological properties of water filter applications made from zeolite composites in laying hens farms on egg quality. materials and methods material the material used was laying hens of the lohman brown strain, with the age between 8083 weeks. the laying hens used have a population of 2000 laying hens. the cages used for the research used a battery cage system made of wood and wire equipped with feeders, drinking water containers, and lights. one battery box contains one laying hen. the battery floor is designed to be inclined, with a slope angle of between 20-25 o . the goal is that the eggs removed from the chickens can easily roll out. the water filter application with zeolite filter in laying hens farm (m. fauzi et al.) 115 chickens are fed once a day at 15.00 wib in the afternoon. the feed given was 120 grams/ head, and the total feed given to one cage was 240 kg. the feed used in this study was selfmixed with the feed ingredients used consisting of yellow corn, rice bran, soybean meal, meat, bone meal, and vegetable oil with a nutritional content consisting of 13.00% moisture, 14.00% ash, and crude protein. 17.00%, crude fat 3.00%, crude fiber 7.00%, calcium (ca) 3.25-4.25%, phosphorus (p) 0.45%, total aflatoxin (max) 50µg/kg and amino acids consisting of lysine 0.80%, methionine 0.40%, methionine + cystine 0.67%, tryptophan 0.18% and threonine 0.55%. drinking water is given adlibitum; before installing the zeolite filter, drinking water from the nipple is filtered using an ordinary water filter, while after installing the drinking water filter from the nipple that has been filtered using a composite zeolite filter. avian influenza (ai) vaccine is given five times in 1 period, newcastle disease (nd) and infectious bronchitis (ib) vaccines are given every 12 weeks by injection, and vitamins are given anti-stress vitamins (vita stress) 2 times a month. environmental conditions on the farm have temperatures of 26 33 ◦ c during the day and 18◦c at night, with rainfall ranging from 1.200 to 2.200 mm/year with an altitude of 300 meters above sea level and environmental conditions of relative humidity (rh) ranging from 70-90%. the lighting conditions in the cage during the day use sunlight, and at night use yellow light. procedure installing a zeolite-based filter installation on a laying chicken farm using a water filter made from zeolite containing copper oxide is put in a filter container suitable for chicken farming (standard water filter container) and then installed in a chicken farm cage containing 2000 laying hens. the water filter is a filter from healthy water filtered directly in the laying hen house. egg sampling was carried out before and after filter installation. before installation, eggs were selected randomly with replicates on different collection days. after installing the filter for 3 days, egg samples were taken on different days. the number of samples is 20 eggs once taken to test egg quality and 20 samples for replication. variables egg samples were taken for analysis of egg quality. the length and width of the eggs were measured using a caliper by measuring the length and width of the eggs. the egg index was converted from the length and width of the eggs using a caliper. egg weight was obtained by weighing each egg using a digital scale and recording the results based on (mota et al., 2017). the white and yolk weights were weighed using figure 1. zeolite water filter installation design 116 j. indonesian trop. anim. agric. 48(2):113-125, june 2023 a digital balance based on egg whites and yolks. white height and yellow height were measured using a caliper. the weight of the eggshell that has been broken is removed from the egg white residue attached to the inside of the shell, and then the shell weight is measured using a digital scale. the thickness of the eggshell, the egg which has been cracked and the inner membrane removed, is measured by measuring the thickness of the shell using a screw micrometer. haugh unit is a parameter of egg interior quality calculated based on albumin height and shell weight (keener et al., 2006). variable chemical quality of dry matter eggs is obtained by reducing the water content of the material based on (relling, 2011). ash, protein, and fat content were calculated according to the formula (aoac, 2005) and carbohydrates (by difference). egg microbiological quality test, total plate count test were analyzed using the method (bam, 2001) and using plate count agar (pca) media with a dilution of 10 -1 to 10 -3 , total escherichia coli was analyzed using the method (bam, 2001) with eosin media methylene blue agar (emba) at a dilution of 10 -1 to 10 -3 and salmonella sp. were analyzed by the method (bam, 2001) with xylose lysine deoxycholate agar (xlda) medium at a dilution of 10 -1 to 10 -3 . data collection egg quality data were analyzed using a factorial completely randomized design (crd) with 2 factors and 3 replications. factor a is the zeotable 1. average value of egg quality in egg length, egg width, egg index, egg weight, white weight, yellow weight before and after zeolite treatment. zeolite treatment days after filter average significance and pvalue 3 days 6 days 9 days tz daf int egg length (mm) before 57.71±0.55 b 58.24±1.57 b 62.28±2.59 a 59.41±1.02 ns 0.90 ns 0.14 * 0.01 after 59.76±0.62 ab 59.70±0.23 ab 58.53±1.75 b 59.33±0.79 average 58.73±0.05 58.97±0.94 60.41±0.59 egg width (mm) before 44.58±0.43 b 44.54±0.50 b 49.18b±3.54 a 46.10±1.78 ns 0.87 * 0.04 * 0.02 after 46.02±0.27 b 46.66±0.53 ab 45.98±0.57 b 46.22±0.16 average 45.30±0.11 b 45.60±0.02 b 47.58±2.10 a egg index (%) before 76.79±0.59 77.79±3.37 78.24±1.21 77.60±0.60 ns 0.71 ns 0.95 ns 0.37 after 78.78±0.80 78.10±1.21 76.97±0.36 77.95±0.74 average 77.78±0.99 77.94±0.15 77.60±0.63 egg weight (g) before 65.31±0.49 c 65.21±0.51 c 69.16±2.70 a 66.56±1.27 b ** 0.00 ** 0.00 ** 0.00 after 70.10±0.90 b 71.86±4.39 b 68.87±3.48 b 70.27±1.81 a average 67.71±0.29 b 68.53±2.74 b 69.01±0.55 a white weight (g) before 40.71±2.66 40.78±1.11 43.13±1.16 41.54±0.88 b ** 0.00 ns 0.74 ns 0.13 after 44.62±2.57 46.23±0.78 43.64±2.77 44.83±1.10 b average 42.67±0.06 43.51±0.23 43.39±1.14 yellow weight (g) before 18.20±0.34 17.77±1.17 18.68±1.33 18.21±0.53 ns 0.24 ns 0.81 ns 0.09 after 18.83±1.06 19.49±0.20 17.91±0.73 18.74±0.43 average 18.52±0.51 18.63±0.68 18.29±0.42 a,b,c value with superscript that is significatly different (p < 0.05); tz = treament zeolite; daf = day after filter ; int = intrection between treatment zeolite and days after filter; ** = highly significant (p <0.01); * = significant (p<0.05); ns = non significant (p>0.05). the water filter application with zeolite filter in laying hens farm (m. fauzi et al.) 117 lite treatment, and factor b is the day of egg collection after filtering. if the treatment showed a significant difference, it was continued with the least significant difference (lsd) test, and the chemical quality of the egg, the microbiology of the egg was tested using the t-test analysis (paired sample). data analysis was carried out using the spss version 22 application. results and discussion egg quality egg quality is an indicator that relates to the quality standard of the egg's exterior (kraus et al., 2021). table 1 shows the physical quality of eggs before and after zeolite treatment. variations in egg length, egg width, and egg index the egg length values in table 1 show an interaction (p<0.05) between the zeolite treatment and the days after the filter in the egg length values. further tests on the interaction of the zeolite treatment and the day after the filter showed that the highest egg length value was found in the treatment before the 9th day zeolite treatment with a value of 62.28 mm, while the lowest egg length value was in the treatment before the 3rd day with a value of 57.71 mm. the variation in egg length produced in this study is thought to be influenced by the application of zeolite treatment in drinking water affecting the absorption of nutrients in laying hen feed, especially calcium, and egg length in this study was categorized into oval, oval, and round shapes. the results in table 1 show a significant interaction (p<0.05) between the zeolite treatment and the day-after filter in increasing the egg width value. further tests on the interaction of the zeolite treatment and the day of egg collection after the filter showed that the highest egg width value was in the treatment before the zeolite treatment on day 9 with a value of 49.18 mm, and the lowest value was in the treatment before the 6th day with a value of 44.54 mm. the longer the day of egg collection, the higher the egg width; this is due to variations in egg width which are affected during the egg formation process. the research results in table 1 show no interaction (p>0.05) between the zeolite treatment and the day of egg collection on the egg index value. in this study, the zeolite treatment and egg collection day it has maintained the egg index value. this is presumably because the zeolite contains minerals that affect the index value of the eggs produced. the index value of the eggs produced in this study ranged from 76.7978.78% the index value of the eggs produced was still in the ideal category. overall, the results of this study suggest that zeolite treatment can affect the value of egg length, egg width, and egg index. this can be assumed because there has yet to be any previous research similar to and related to this research. variations in egg weight, albumen weight, and yolk weight the research results in table 1 show a significant interaction (p<0.05) between the zeolite treatment and the day of egg collection after filtering, increasing the egg weight value. further tests on the interaction of the zeolite treatment and the day of egg collection after the filter showed that the highest egg weight value was found in the treatment after the 6th day zeolite treatment with a value of 71.86 g while the lowest value was in the treatment before the zeolite treatment on the 6th day with a value of 65.21 g. additional days of zeolite treatment affected increasing egg weight, this was due to the increasing age of the chickens, the egg weight increased. this was in accordance with john-jaja et al. (2016) stated that egg weight is affected by age, the older the laying hens, the heavier the eggs produced. based on the sni standard (2008), the egg weight in this study was included in the large group. egg weight values before and after zeolite treatment ranged from 65.21-71.86 g. egg weight is affected by ovarian development. the ovary is where the yolk is formed. egg weight will be low if the formation of the yolk is less than perfect. in addition, according to tugiyanti (2012), low nutrient absorption inhibits 118 j. indonesian trop. anim. agric. 48(2):113-125, june 2023 ovarian development, making egg weight less than optimal. the research results in table 1 show that the zeolite treatment before and after had a significant effect (p<0.05) on the egg white weight value. the resulting white weight test further shows that the average value of zeolite treatment after zeolite treatment is higher than before on egg white weight. the higher the white weight value in the treatment after the zeolite treatment of 44.83 g is influenced by the density of the denser the egg white, the heavier the weight, which is supported by the intake of nutrients needed for egg formation, both protein, minerals, and vitamins. the lowest white weight value was in the pre-treatment zeolite treatment of 41.54 g, which was thought to be low in egg white due to insufficient nutrient intake during egg formation and the influence of the length and width of the eggs produced. the white weight results of this study were higher than that of fendri et al. (2012), who used zeolite on the egg quality of tunisian laying hens around 34.1536.02 g. yields of egg white weight in several countries; according to zhu et al. (2020), egg weight in china is 63.98 g, and guo et al. (2020) egg weight in japan is 71.80 g. the variance results also showed no interac t able 2. average value of egg quality in white height, yellow height, eggshell weight, eggshell thickness, haugh unit before and after zeolite treatment zeolite treatment days after filter installation average significa nce and p value 3 days 6 days 9 days t z daf int white height (mm) before 7.67±0.27 7.67±0.40 8.87±0.44 8.07±0.09 ns 0.21 * 0.03 ns 0.15 after 8.03±0.11 7.25±0.99 7.93±0.57 7.74±0.44 average 7.85±0.11 ab 7.46±0.42 b 8.40 ±0.09 a yellow height (mm) before 17.66±0.17 17.74±0.31 18.8±1.06 18.07±0.48 ns 0.75 ns 0.28 ns 0.07 after 18.47±0.40 17.98±0.67 18±0.170 18.15±0.25 average 18.07±0.16 17.86±0.26 18.4±0.63 e ggshell weight (g) before 7.07±0.2 ab 6.67±0.24 b 7.34±0.4 a 7.03±0.11 ns 0.79 ns 0.56 * 0.04 after 7.1±0.27 ab 7.2±0.44 ab 6.82±0.27 ab 7.06±0.10 average 7.12±0.05 b 6.93±0.14 b 7.08±0.10 a eggshell thickness (mm) before 0.24±0.04 b 0.26±0.01 b 0.38±0.02 a 0.29±0.01 b ** 0.00 ** 0.00 ** 0.00 after 0.36±0.02 a 0.36±0.03 a 0.36±0.02 a 0.36±0.01 a average 0.30±0.01 b 0.31±0.02 b 0.37±0.00 b haugh unit (hu) before 85.97±1.56 b 71.97±3.47 c 91.59±2.14 a 83.17±0.98 ns 0.16 ** 0.00 ** 0.00 after 86.74±0.90 ab 82.47±4.39 b 86.13±2.81 b 85.11±1.75 average 86.35±0.47 a 77.22±0.65 b 88.86±0.47 a a,b,c value with sup erscript that is significantly d ifferen t (p < 0.05); tz = treatment zeolite; daf = day after filter ; int = interaction between treatment zeolite and days after filter; ** = highly significant (p <0 .01); * = significant (p<0.05); n s = non significant (p>0.05). the water filter application with zeolite filter in laying hens farm (m. fauzi et al.) 119 tion (p>0.05) between the zeolite treatment and the day of egg collection after filtering on egg yolk weight. the average value of yolk weight before and after treatment zeolite ranged from 18.21 -18.74 g. the importance of the yolk is influenced by the weight of the eggs produced in the study. the higher the weight of the eggs obtained, the higher the weight percentage of the yolk. tugiyanti and iriyanti (2012) stated that yolk weight is influenced by ovarian development, chicken body weight, age at reaching sexual maturity, quality and quantity of feed, disease, environment, and feed consumption. variation in albumen height, yolk height the study's results in table 2 show no interaction (p>0.05) between the zeolite treatment and the day of egg collection after filtering on white height. the white height test showed that the average result before the zeolite treatment was higher than the white height value after the zeolite treatment. the high value of white height before zeolite treatment of 8.07 mm was influenced by optimal nutrient absorption, so the egg white content increased, and white height correlated with egg weight gain. the lowest value of white height after zeolite treatment was 7.74 mm which was affected by the increasing age of the chickens, so nutrient absorption was not optimal. in table 2 shows that there was no interaction (p> 0.05) between the zeolite treatment and the day of egg collection after filtering, on egg yolk height. the average value of yellow height before and after zeolite treatment ranged from 18.07 – 18.15 mm. this is because the high value of the yolk also correlates with the weight of the yolk; the weight of the yolk in this study did not significantly affect the weight, so the height of the yolk also did not have a significant effect after zeolite treatment in the drinking water of laying hens. variations in shell weight, shell thickness and haugh units the results in table 2 show a significant interaction (p<0.05) between the zeolite treatment and the day of egg collection after filtering on shell weight. further test results on the interaction of the zeolite treatment and the day of egg collection after the filter showed that the highest value in shell weight was in the treatment before the 9th day zeolite treatment with a value of 7.34 g and the lowest value was in the 6th day with a value of 6.67 g while the value after the weight treatment shell shows a value of 6.93 – 7.12 g. the value of shell weight before and after zeolite treatment dramatically influences the absorption of feed nutrients and the age of laying hens; this is in line with john-jaja et al. (2016) that shell weight is related to genetic factors, age factors, and physiological characteristics of laying hens. the age factor gives the progress of the variation of the shell weight coefficient in various ages of laying hens under 25 weeks, namely 8.39%, 10.05% at 25, 10.18% at 51 weeks, and 13.18% at 72 weeks, and yuwanta (2010) states that eggshell quality can be affected by the age of the broodstock. the older the parent, the quality of the chicken shell decreases. the results in table 2 show a significant interaction (p<0.05) between the zeolite treatment and the day of egg collection after filtering on the shell thickness value. the test results on the interaction of the zeolite treatment and the day of egg collection after the filter showed that the highest values were found on days 3, 6, and 9 after 0.36 mm zeolite treatment, and the lowest values were found in the treatment before 0.24 mm treatment. this study showed that the thickness of the shell after the zeolite treatment showed an increase in the thickness of the eggshell, and the presence of antibacterial substances in the zeolite in the chicken drinking water filter could also optimize the absorption of nutrients, especially in calcium. this is in line with ketta and tumova (2016) that the eggshell thickness of the lohman brown strain at 20-24 weeks of age is 0.354 mm, and when it is 56-60 weeks, the thickness of the shell can reach 0.372 mm. the shell thickness in this study was higher than the eggshell thickness based on aguillón-páez et al. (2020) from colombia with a shell thickness of 0.20 mm, saudi arabia 0.04 mm (attia et al., 2014) and zhu et al. (2020) shell thickness in 120 j. indonesian trop. anim. agric. 48(2):113-125, june 2023 china is 0.31 mm. the research results in table 2 shows a significant interaction (p<0.05) between the zeolite treatment and egg retrieval results after filtering on the high value of egg units. further tests on the interaction of the zeolite treatment and the day of egg collection after the filter showed that the highest value was in the treatment before zeolite treatment, 91.59, and the lowest value was in the treatment before zeolite treatment, 71.97. this is because the measurement time for each repetition is carried out at the same hour so that the haugh unit values produced are almost the same. the high value of the research unit is still balanced with the high unit value in l, attia et al. (2014) state that in saudi arabia, the high unit value is 60.37, which is lower than the results of the study. overseas, tw et al. (2019) state that the high unit value in brazil is 87.36. the high haugh value of egg units obtained was because after taking the eggs, the eggs were immediately measured. the haugh unit value decreases with the increasing age of the egg because the egg albumen will melt more due to the evaporation of co2 and the entry of microorganisms into the albumen so that it is damaged. based on this, the eggs produced during the study were included in the quality category aa, namely eggs of the highest quality with a value of haugh unit > 72 or still fresh eggs. egg chemical quality the results of the chemical analysis of eggs which include dry ingredients, ash, protein, and carbohydrates before and after zeolite treatment, show the results presented in table 3. dry ingredients organic matter is a nutrient component comprising carbon, hydrogen, oxygen, and nitrogen (mcdonald et al., 2010). the study results in table 3 show that the dry matter on day 3 before and after the zeolite treatment showed significantly different values (p<0.05) before the zeolite treatment. another in the egg. kocatepe et al. (2011) stated that an increase in dry matter value was correlated with an increase in other nutrient content, such as carbohydrates, fats, and protein. meanwhile, days 6 and 9 did not show different values for dry matter before and after zeolite treatment. the dry matter value of the zeolite treatment is high compared to that after the treatment experienced shrinkage. this is because before and after the zeolite treatment in the treated drinking water did not affect the nutritional value of the eggs, especially the dry matter. the material's ash, protein, and fat content influences the high dry matter content. the high ash, protein, and fat content before and after zeolite treatment is the cause of the high dry matter. the dry matter value in this study was higher than that of kabir et al. (2015), namely local chicken 25.58, exotic chicken 38.52, guinea fowl 32.90, and quail 30.67 dry matter value. ash content the research results in table 3 show that the ash content on days 3, 6, and 9 before and after the zeolite treatment showed no significant difference (p>0.05) in the egg ash content. before treatment on days 3, 6, and 9, the value of high ash content after treatment was experienced. this shrinkage is due to the absence of a treatment effect on the value of ash content both before and after zeolite treatment.the ash content of eggs is related to the levels of minerals contained in eggs, such as ca and phosphorus in eggs. the value of the ash content before and after treatment was more excellent, ranging from 3.323.77%. this proves that zeolite treatment in chicken drinking water can increase the ash content, resulting from burning organic matter in the form of minerals. the organic matter content is inversely proportional to the ash content. the higher the ash content, the lower the organic matter content. \ protein the research results in table 3 show that the protein values on days 3, 6, and 9 before and after zeolite treatment did not appear to be significantly different (p> 0.05). the protein value remained stable both before and after treatment, and this proved that the zeolite treatment did not the water filter application with zeolite filter in laying hens farm (m. fauzi et al.) 121 reduce the protein value in eggs. the value after zeolite treatment showed a constant range in egg protein. chicken egg protein levels are generally influenced by the nutrients consumed by livestock. according to argo et al. (2013) high protein content in feed contributed to high protein in eggs. the protein content in chicken eggs without the effect of zeolite treatment a content in the range of 46.8348.38 %. at the same time, the fat content in chicken eggs with the influence of zeolite treatment found 48.24 – 48.38% results. the results of bakhtra et al. (2016) stated that the protein content of purebred chicken eggs through nitrogen analysis using the kjeldahl method obtained an average egg protein content value of purebred chicken eggs of 6.45%, native chicken eggs 6.91%, duck eggs 6.59% and quail eggs 6.55%. fat based on the results of the study in table 3, shows that the fat value on day 3 after zeolite treatment showed an increase in the fat value significantly different (p> 0.05) in eggs; this was allegedly due to the increase in egg fat content caused by high egg yolk and white egg values. almost no fat content. considering that the highest content in egg yolk was fat, while on days 6 and 9, the fat value was not significantly different (p> 0.05) before and after zeolite treatment. the fat content in chicken eggs without the effect of zeolite treatment content in the range of 30.56% 34.43%. while the fat content in chicken eggs with the effect of adding zeolite found results of 32.26% for observations on the 3rd and 6th days and 34.92% on the 9th day of observation. iman research (2003) stated that the fat in the eggs of merawang chickens, by feeding them with omega-3 supplements, obtained a fat value of 21.69% lower than the study's results. carbohydrate carbohydrate levels in eggs generally have a small amount. the research results in table 3 table 3. chemical value of eggs in dry material, ash level, protein, fat, and carbohydrate before and after zeolite treatment variable daf zeolite treatment p value significance before after dry material (%) 3 97.31 ± 0.11 91.44 ± 0.17 0.00 ** 6 96.10 ± 0.33 89.48 ± 0.17 0.04 * 9 91.62 ± 0.19 89.85 ± 0.35 0.41 ns ash level (%) 3 3.77 ± 0.54 3.58 ± 0.12 0.62 ns 6 3.63 ± 0.08 3.56 ± 0.27 0.06 ns 9 3.32 ± 0.04 3.40 ± 0.16 0.5 ns protein (%) 3 46.83 ± 0.76 48.38 ± 0.63 0.36 ns 6 48.63 ± 0.75 48.09 ±0.42 0.63 ns 9 47.93 ± 0.12 48.24 ± 0.59 0.5 ns fat (%) 3 30.97 ± 0.80 32.26 ± 0.77 0.01 ** 6 32.97 ± 2.75 32.26 ± 0.04 0.16 ns 9 34.43 ± 0.69 34.92 ± 0.00 0.5 ns carbohydrate (%) 3 13.29 ± 1.21 7.24 ± 0.32 0.12 ns 6 11.38 ± 0.68 5.46 ± 0.05 0.76 ns 9 5.92 ± 0.66 5.23 ± 0.32 0.50 ns score of p value p<0.05 showing real difference; daf = day after filter; ** = highly significant (p <0.01); * = significant (p<0.05); ns = non significant (p>0.05). 122 j. indonesian trop. anim. agric. 48(2):113-125, june 2023 show that the carbohydrate values on days 3, 6, and 9 before and after the zeolite treatment were not significantly different (p> 0.05). the hydrolysis process in the zeolite treatment in drinking water decreased the carbohydrate value in eggs. carbohydrate content in chicken eggs before zeolite treatment has content in the range of 5.92% 13.29%. meanwhile, the fat content in chicken eggs after the zeolite treatment resulted in 5.23% 7.24%. microbiological quality table 4 shows the results of evaluating the total number of microorganisms in eggs before and after zeolite treatment. tpc (total plate count) the research results in table 4 show that tpc contamination on days 3 and 6 significantly differed after the zeolite treatment, and there was a decrease in tpc in chicken eggs. this is because the zeolite used as a drinking water filter has antibacterial properties, which can kill bacteria by releasing cu ions which causes bacteria to be killed. in contrast, on day 9, tpc was no different before and after zeolite treatment. the amount of tpc in this study complied with the requirements for microbiological quality (sni 3926:2008 concerning the consumption of chicken eggs), namely that there should be no microbial contamination of more than 1x10 5 or 5 logs. in contrast, in the study, the value of microbial contamination was obtained before zeolite treatment in the range of 1.73 – 1.26 log cfu/ml, whereas after treatment, the results were 1.41-1.28 log cfu/ml. the tpc contamination value from this study after zeolite treatment was lower than that of el-kholy et al. (2014) in egypt at 3.04 log cfu/g and rizaldi et al. (2020) at the tamiang layang market, east barito regency at 1.90 log cfu/g. escherichia coli according to table 4, the 3 and 9 days before and after zeolite treatment had a negative value for escherichia coli bacteria because the zeolite used as a water filter has been modified to have antibacterial properties capable of killing pathogenic bacteria carried by chicken drinking water. however, on the 6th day, there was escherichia coli bacteria before the zeolite treatment, 1.43 log cfu/ml in chicken eggs, this was presumably due to contamination of escherichia coli bacteria before the zeolite treatment, presumably because the chicken's drinking water still contained escherichia coli bacteria, so it was carried into the chicken eggs. contamination detected was still below the maximum standard for microbial egg contamination, namely 5 log cfu/g, 100 mpn/g, and 50 mpn/g for each type of microbitable 4. the score of egg microbiology before and after zeolite treatment egg microbiology test unit daf zeolite treatment before after total plate count (tpc) log cfu /ml 3 1.73 ± 0.96 1.41 ± 0.21 6 1.63 ± 0.09 1.38 ± 0.18 9 1.26 ± 0.17 1.28 ± 0.00 escherichia coli log cfu/ml 3 negative negative 6 1.43 ± 0.34 negative 9 negative negative salmonella sp log cfu /ml 3 negative negative 6 negative negative 9 1.32 ± 0.74 negative daf = day after filter; there is real difference of cfu ml log between before and after zeolite treatment. the data of colony numbers were transformed into the form of log. the water filter application with zeolite filter in laying hens farm (m. fauzi et al.) 123 al contamination, coliform and escherichia coli according to sni 3926:2008 microbiological quality standards for consumption chicken eggs. in the research results by anton et al. (2019) on the consumption of chicken eggs from the east jakarta city area, escherichia coli bacteria were detected at 1.5 mpn/g. salmonella sp. the results showed that salmonella sp. bacteria in eggs on day 4 showed no different results before and after zeolite treatment. this salmonella sp. bacteria were negative and, on day 6, showing the same thing. salmonella sp. bacteria were negatively detected both before and after zeolite treatment. this is because the zeolite treatment used has a high concentration of cu, which has greater anti-bacterial power. the existence of a positive charge on cu ions and a negative charge on the bacterial cell membrane will cause a tug-of-war between the two. according to humphrey (1994), eggs have a chemical defense in the egg white, namely lysozyme. lysozyme is a bactericidal substance that can destroy bacteria. the study's results on the 9th day before the zeolite treatment showed the presence of salmonella sp. bacteria with a value of 1.32 cfu/ml. this was suspected because the growth of salmonella sp. started to occur, which was influenced by the environment, such as temperature and humidity. this was reinforced by the statement of momani et al. 2018 that bacterial contamination of eggs also occurs when microorganisms enter the eggshell through the pores on the surface of the eggshell. chusniati et al. (2008) state that there are two possible ways for salmonella sp. to enter the egg, namely directly vertically, through the egg yolk and egg white from the ovary the hen infected with salmonella sp. salmonella sp. can also enter horizontally through the pore. pores on the eggshell. zeolite treatment reduced the presence of salmonella sp. to a negative value after treatment. this shows that the zeolite treatment of chicken drinking water is in accordance with sni 2897 (2008) and that microbial contamination from salmonella sp. is negative. conclusion the application of zeolite filters to the drinking water of laying hens could improve physical quality, maintain chemical quality, and is effective as an antibacterial againstbacterial populations, escherichia coli and salmonella sp. bacteria in eggs. acknowledgment the researcher acknowledges his heartfelt appreciation for the financial assistance provided by the ministry of education, culture, research, and technology under contract number 001/ e.4.1/ak.04.prn/2021 and continued riim schema under contract 82/h.7/hk/2022. references aguillón-páez, y.j., l.a.romero., and g.j. diaz. 2020. effect of full-fat sunflower or flaxseed seeds dietary inclusion on performance, egg yolk fatty acid profile and egg quality in laying hens. anim nutr. 6(2): 179-184. anton, e. taufik, z. wulandari. 2019. study of antibiotic residue and microbiological quality of commercial eggs sold in administrative city of east jakarta. j. livest. sci. prod. 08 (3):151-159 association of analitycal chemist. 2005. official method of analysis. 18 th ed. aoac international. virginia attia, y.a., m. a al-harthi., and m.m shiboob. 2014. evaluation of quality and nutrient contents of table eggs from different sources in the retail market. italian j. anim. sci. italian j. anim. sci. italian j. anim. sci.13 (2):369-367 bacteriological analytical manual. 2001. aerobis plate count: u.s. food and drug administration (fda). bakhtra, rusdi, a. mardiah. 2016. determination of protein levels in poultry eggs through nitrogen analysis using the kjeldahl method. 124 j. indonesian trop. anim. agric. 48(2):113-125, june 2023 higea pharm. j. 8(2):1-8 boetius, a,. anesio, m. alexandre, deming,w. jody , mikucki, a. jill, rapp, z josephine. 2015. microbial ecology of the cryosphere: sea ice and glacial habitats. nat. rev. microbiol. 13(11):677-690 brake, j. p., and j. b. hess. 2001. evaluating water quality for poultry. publ. arn-1201. 4 pages. alabama cooperative extension system. auburn university chusniati, s., r.n. budiono and r. kurnijanti. 2009. detection of salmonella sp. in freerange chicken eggs sold as a mixture of herbs in sidoarjo district. j. poult. disease. 2(2):20-23 derakhshankhah, h., s. jafari, s. sarvari, e. barzegari, f. moakedi, m. ghorbani,b.s. varnamkhasti, m. jaymand , z. izadi, l. tayebi. 2020. biomedical applications of zeolitic nanoparticles with an emphasis on medical interventions. int. j. nanomedicine. 15:63–386 duman, m., a. şekeroğlu., a.yıldırım., h. eleroğlu and o. camcı. 2016. relation between egg shape index and egg quality characteristics. eur. poult. sci. 80:1 – 9. el-kholy, a.m., s.h. el-shinawy, h.seliem and m.a.m. zeinhom. 2020. potential risk of some pathogens in table eggs. j. vet. med. res. 27(1): 52 – 65. fendri, i., l. khannous, z. mallek, a.i traore, n. gharsallah, r. gdoura. 2012. influence of zeolite on fatty acid composition and egg quality in tunisian laying hens. lipids health dis. 11:71–76 ferreira, l., a.m. fonseca, g. botelho, c.a. aguiar, i.c. neves. 2012. antimicrobial activity of faujasite zeolites doped with silver. microporous mesoporous mater. 160:126–132. guo,y., z.h. zhao., z.y. pan, l.l. an., b. balasubramanian and w.c. liu. 2020. new insights into the role of dietary marinederived polysaccharides on productive performance, egg quality, antioxidant capacity, and jejunal morphology in late-phase laying hens. poult. sci. 99(4) : 2100 – 2107. humphrey, t.j. 1994. contamination of eggs shell and contents with salmonella enteridis. int. j. food microbiol. 21(2): 31-40 iman, r.h.s. 2003. physical characteristic, chemical composition and organoleptic test of merawang chicken egg fed with omega3 supplementation diet. j. food technol. ind. 1017(3): 199 – 205 indonesian national standardization agency. 2008. sni. 2897:2008: methods for testing for microbial contamination in meat, eggs and milk, and their processed products. bsni. jakarta indonesian national standardization agency. 2008. sni. 3926:2008: consumption of chicken eggs.bsni. jakarta john-jaja, s. a., u.h. udoh and s.c. nwokolo. 2016. repeatabilitity estimates of egg weight and egg-shell weight under various production periods for bovan nera black laying chicken. j. basic appl. sci. 5(4):389394. kabir, m., u.k. nkeonye, u.a. adamu, umar, k.a. badmus. 2015. comparison of proximate composition, internal and external qualities of eggs from four species of poultry marketed in samaru zaria, nigeria. proc. 40 th ann. conf. nigerian society for animal product. 33-35. keener, k.m.j.d., p.a. la crosse, k.e.curtis, anderson, b.e. barkas. 2006. the influence of rapid air cooling and carbon dioxide cooling and subsequent storage in air and carbon dioxide on shell egg quality. poult. sci. 79:1067–1071 ketta, m., e. tumova. 2016. eggshell structure, measurements, and quality-affecting factors in laying hens. czech j. anim. sci. 61(7): 299-309. kocatepe, d., h. turan, g. taşkaya, y. kaya, r. erden, f. erdoğdu. 2011. effects of cooking methods on the proximate composition of black sea anchovy(engraulis encrasicolus, linnaeus 1758). gida. 36(2):71-75 kraus, a., l. zita, o. krunt, h. härtlováand, e. chmelíková. 2021. determination of selected biochemical parameters in blood serum the water filter application with zeolite filter in laying hens farm (m. fauzi et al.) 125 and egg quality of czech and slovak native hens depending on the housing system and hen age. poult. sci. 100(2): 1142 1153. mcdonald, p.r.a. edwards, j.f.d. greenhalgh, c.a. morgan,r.a. sinclair, r.g. wilkinson. 2010. animal nutrition 7 th edition. pearso. harlow momani, w.a., s. janakat, and m. khatatbeh. (2018). bacterial contamination of table eggs sold in jordania markets. pakistan j. nutr. 17(1): 1520. mota, a. s.d. b., p. m. d.s. lima, d.s. silva, v.k.g. abreu, e. r. freitas and a.l.f. pereira. 2017. internasional quality of eggs coated with cassava and yam starches. rev. bras. cienc. agrar. 12 (1): 47-50. nik malek, n.a.n., n.a. azid, a. abdul hadi, s.n ishak, m.h. asraf, m.z. amir awaluddin . 2018. antibacterial activity of copper exchanged zeolite y synthesized from rice husk ash. mal.j. fund. appl. sci. 14:450–453. oviedo, e. o., 2006. important factors in water quality to improve broiler performance. north carolina poult. ind. newsletter. 4(1): 7–8. polder, a., m.b. muller,o.b. brynildsrud, j. de boer, t. hammers, e. lie, .r.h. mdegela, h. h.h.w. moberg, x. nonga, m. sandvik, j.u. skaare, j.l. lyche. 2016. dioxins, pcbs, chlorinated pesticides and brominated flame retardants in free-range chicken eggs from peri-urban areas in arusha, tanzania: levels and implications for human health. sci total environ. 551: 656-667. reiling, b. a. 2011. feed dry matter conversions. university of nebraska-lincoln risnajati, d. 2011. the effect of timing of drinking water at different temperatures on the performance of laying hens in the grower period. anim. sci. 9(2):7781 rizaldi, a., e. zelpina. 2020. microbiology quality of eggs based on the total amount of microb and colifroms in tamiang layang market, east barito district. j. livest. anim. health. 3 (2) : 45 -48 shi, p., s. jia, x.x. zhang,t. zhang, s. cheng, a. li. 2013. metagenomic insights into chlorination effects on microbial antibiotic resistance in drinking water. water res. 47 (1): 111-120. swick, r. a. 1999. water quality and management for poultry. american soybean association. singapore. tolimir, n., m. maslovaric, z. skrbic, m. lukic, b. rajkovic and r. radisic. 2017. consumer criteria for purchasing eggs and the quality of eggs in the markets of the city of belgrade. biotechnol. anim.husb. 33(4): 425–437. tugiyanti, e., and n. iriyanti. 2012. external quality of laying hen eggs receiving rations with the addition of fermented fish meal using isolates of anti-histamine procedures. j. food technol. appl. 1(2): 44-47 tw, a.s. al, s ap, m ja, s rt, f nv, f de, ff de. (2019). performance and egg quality of commercial linear programming. brazilian j. poult. sci. 21(3):1-10. watkins, s. 2008. water: identifying and correcting challenges. avian advice. 10(3):10–15. yuwanta, t. 2010. eggs and egg quality. gadjah mada university pr. yogyakarta. indonesia zhu, y.f., j.p. wang., x.m. ding., s.p. bai., s.r.n. qi., q.f. zeng.,y. xuan, z.w. su and k.y zhang. 2020. effect of different tea polyphenol products on egg production performance, egg quality and antioxidative status of laying hens. anim. feed sci. technol. 267: 2-8. 126 j. indonesian trop. anim. agric. 48(2):126-142, june 2023 j i t a a journal of the indonesian tropical animal agriculture accredited by ditjen riset, teknologi dan pengabdian kepada masyarakat no. 164/e/kpt/2021 j. indonesian trop. anim. agric. pissn 2087-8273 eissn 2460-6278 http://ejournal.undip.ac.id/index.php/jitaa 48(2):126-142, june 2023 doi: 10.14710/jitaa.48.2. 126-142 physiological condition, gut morphology and immune responses of broilers supplemented with moringa oleifera leaf extract, whey protein or their combination i. agusetyaningsih*, b. marifah, e. widiastuti, h.i. wahyuni, t. yudiarti, t.a. sartono, and s. sugiharto department of animal science, faculty of animal and agricultural sciences, universitas diponegoro, semarang 50275 indonesia *corresponding author: ikaniaa@ymail.com received april 06, 2023; accepted may 24, 2023 abstract to improve growth performance and health, the broiler industry has recently incorporated plant sources and dairy milk byproducts as feed additives. the aim of this study was to investigate the effect of dietary supplementation of moringa oleifera leaf extract (mole) and whey protein concentrate (wpc) or their combination on production performance, physiological status, gut integrity and immune responses of broilers. a total of 364 day old broiler chicks were used and assigned according to a completely randomized design with four dietary treatments, including cont (basal feed as control), mole (basal feed + 1% mole), wpc (basal feed + 1% wpc), and mole-wpc (basal feed + 0.5% mole + 0.5% wpc). daily weight gain and daily feed intake of broilers were higher in wpc and cont groups (p<0.05) compared to mole group. the low-density lipoprotein (ldl) were lower in cont and wpc (p<0.05) than in mole and mole-wpc groups. the serum glutamic oxaloacetic transaminase (sgot) were lower in mole group (p<0.05) than in mole-wpc. in comparison to the cont and wpc groups, the villi height and ratio of villi to crypt depth in the duodenum were more favorable in the mole and mole-wpc groups. the lactose negative enterobacteria have a lower number (p<0.05) in mole group. histologically, the jejunum, ileum, and spleen were in better condition in the mole and mole-wpc groups (p<0.05) than in the other groups. in conclusion, supplementing mole, wpc or their combination improved the gut integrity and immune organ, but had no appreciable impact on production performance and physiological status in broilers. keywords: blood parameter, broiler, immune response, moringa oleifera, whey protein introduction the use of antibiotic growth promoter (agp) in poultry feed has been prohibited as a result of the widespread concern about the harmful effects of antibiotic residues on consumers. indeed, research demonstrates that removing agp from poultry feed has a detrimental effect on the wellbeing and growth of chickens (sugiharto, 2016). as a result, poultry nutritionists have been putting a lot of effort into coming up with a suggested agp substitute for the poulmailto:ikaniaa@ymail.com feeding moringa oleifera extract and whey protein to broiler (i. agusetyaningsih et al.) 127 try sector. the use of phytobiotics in poultry as an alternative to agp has been recommended (sugiharto, 2016), and one such phytobiotic is the leaf of the moringa oleifera plant. the m. oleifera leaf contains a variety of bioactive chemicals such as vitamins and phenolic compounds that are beneficial for the health and growth performance of poultry (khan et al., 2021). m. oleifera has long been employed as an agp substitute in broiler production. the populations of salmonella, staphylococcus spp., and eschericia coli in ileum was decreased when 1% and 5% m. oleifera leaf extract (mole) was used in feed (abu hafsa et al., 2019). total serum protein was also increased, and the blood profile was improved. additionally, broiler chicks receiving mole had a favorable impact on growth index, according to alabi (alabi et al., 2017). additionally, mole administration to broiler rations was found to reduce feed intake and feed conversion ratio (ochi et al., 2015; sugiharto and toana, 2020). according to other studies, adding m. oleifera to broiler diet can boost antibody titre against newcastle disease and infectious bronchitis virus, lower mda and alt levels, and protect the liver from injury (balami et al., 2018; khan et al., 2021; akram et al., 2020). whey is a by-product of cheese making which still has high nutritional value due to its essential amino acid content. whey contains branched chain amino acids, especially leucine, which plays an important role as a modulator in protein metabolism. whey protein concentrate also contains 65% lactose which helps increase the proliferation of lactic acid bacteria in the digestive tract (rama et al., 2019). therefore, whey protein is suggested to have prebiotic potentials so that it can provide healthful effects for the host (zarei et al., 2020). the study by zadegan et al. (2022) reported that the use of whey in broiler feed increased the activity of antioxidant enzymes and reduced lipid peroxidation. other studies suggest that dietary supplementation using whey protein has emerging health benefits including reducing malondialdehyde (mda) activity (reduced lipid peroxidation), serum triglycerides and cholesterol, increasing catalase (cat), superoxide dismutase (sod) and glutathione peroxidase (gpx) enzyme activity, as well as facilitating microbiota proliferation throughout the small intestine (ashour et al., 2019; greenhalgh et al., 2022). although it did not show a significant effect on performance, pcv, hemoglobin, lymphocytes and polymorphonuclear leukocytes (pmn), the use of whey protein in feed had positive effects on platelets and leukocytes in broiler chickens (szczurek et al., 2013; kanza et al., 2013). combining plant extract with other healthy ingredients to have a synergistic effect on the host is quite frequent (sugiharto, 2021). in broiler chicken production, the combination use of mole and whey protein has, however, never been tried before. it was hypothesized that using mole and whey protein together will produce greater impact than using just one of them. determining the impact of mole, whey protein, or their combination on broiler growth performance, physiological state, gut morphology, and immunological responses was thereof the goal of the current investigation. materials and methods the current experiment was approved by the committee of animal ethic of the faculty of animal and agricultural sciences, universitas diponegoro (58-04d/a-6/kep-fpp). animals and experimental diets a total of 364 day-old cobb broiler chicks, purchased from a local hatchery, were employed in this present study. the initial weight of chicks averaged 45.75 ± 0.96 g. all chicks were raised in broiler open-sided house following the standard broiler rearing management practice. rice husk was used as a litter. continuous lighting was provided to the chicks throughout the study period. for the entire duration of the study, the chicks were given unlimited access to food and 128 j. indonesian trop. anim. agric. 48(2):126-142, june 2023 water. the chicks were divided at random into 4 treatment groups, each of which had 7 replications/pens, and each pen had 12 chicks in it. the chicks were raised on commercial pre-starter feed from the time of arrival to day seven, which contained 23% crude protein, 5% crude fat, 5% crude fiber, and 7% ash (according to the feed label). from day 8 onward, the chicks were given formulated starter and finisher feeds as shown in table 1. from day 0 to 42 days old, the treatments using mole and whey protein concentrate (wpc) as a feed addition were used. the the treatment groups included cont (basal feed as control), mole (basal feed + 1% mole), wpc (basal feed + 1% wpc), and mole-wpc (basal feed + 0.5% mole + 0.5% wpc). the mole was bought from the local pharmaceutical industry (pt. boroburur, semarang, central java). the mole contains total flavonoid of 14.295% and antioxidant capacity 65.615%. the wpc was purchased from davisco (80% crude protein; davisco foods international, le sueur, minnesota, usa). the all chicks were vaccinated against newcastle disease (nd), infectious bronchitis (ib), avian influenza (ai) and infectious bursal disease (ibd) to protect the birds from the field virus infection during the trial. at day 4 th , the chicks were vaccinated with medivac nd-ib by eye drop and medivac nd-ai by 0.15 ml subcutan injection. at day 11 st , medivac gumboro a were applied by drinking water. data collection and laboratory analysis productivity parameters. the daily body weight gain, daily feed intake, and feed efficiency of the chicks were all measured. data on daily weight gain were calculated by weighing the chickens at their final weight (42 days of age), deducting by their initial weight, and then dividing by the treatment period (42 days). daily feed intake was determined by dividing the total feed consumption during treatment by the number of treatment days. feed efficiency was determined table 1. feed formulation on starter and finisher period items compositions (%) items (%) compositions (%) starter period finisher period yellow maize 57.9 yellow maize 61.0 palm oil 2.55 palm oil 2.95 soybean meal 34.8 soybean meal 32.0 dl-methionine 0.19 dl-methionine 0.19 bentonite 1.00 bentonite 0.75 limestone 1.34 limestone 1.00 monocalcium phosphate 1.51 monocalcium phosphate 1.30 premix 2 0.27 premix 2 0.34 chlorine chloride 0.07 chlorine chloride 0.07 salt 0.40 salt 0.40 chemical compositions: chemical compositions: me (kcal/kg) 1 3385 me (kcal/kg) 1 3594 crude protein 15.94 crude protein 15.61 crude fibre 3.44 crude fibre 3.96 crude fat 2.01 crude fat 2.74 ash 6.00 ash 5.07 1 metabolizable energy was calculated according to bolton formula: 40.81 {0.87 [crude protein + 2.25 crude fat + nitrogen‐ free extract] + 2.5} 2 premix contained (per kg of diet) of vitamin a 7750 iu, vitamin d3 1550 iu, vitamin e 1.88 mg, vitamin b1 1.25 mg, vitamin b2 3.13 mg, vitamin b6 1.88 mg, vitamin b12 0.01 mg, vitamin c 25 mg, folic acid 1.50 mg, ca-d-pantothenate 7.5 mg, niacin 1.88 mg, biotin 0.13 mg, co 0.20 mg, cu 4.35 mg, fe 54 mg, i 0.45 mg, mn 130 mg, zn 86.5 mg, se 0.25 mg, l-lysine 80 mg, choline chloride 500 mg, dl-methionine 900 mg, caco3 641.5 mg, dicalcium phosphate 1500 mg feeding moringa oleifera extract and whey protein to broiler (i. agusetyaningsih et al.) 129 by dividing the body weight during treatment by the total feed consumed and then multiplied with 100%. the blood profile. at the end of experiment, 1 chicken from each experimental unit was randomly selected for blood collection through the brachial vein using steril syringe. one mililitre (ml) of blood was put into the edta tube for routine blood testing and 3 ml blood was placed at non-edta tube for serum formation. the routine blood profile testing of chicks was determined automatically with a hematology analyzer (prima fully-auto hematology analyzer, pt. prima alkesindo nusantara, jakarta, indonesia). the anticoagulant-free blood was sentrifuged at 3,000 rpm (10 minutes) for serum separation. serum samples were stored at freezer for later analysis of total cholesterol, triglyceride, high-density lipoprotein (hdl) and low-density lipoprotein (ldl), uric acid, and creatinine. triglyceride levels were determined by the enzymatic colorimetric assay method of werner et al. (1981). low density lipoprotein (ldl) were precipitated by adding magnesium ions and phospotungstic through the sample. for this purpose one part of the sample and three parts of precipitant were used. by using centrifugation, hdl will be left in the supernatant. the cholesterol level was determined based on the procedure described by lopes-virella et al. (1997). the total protein and albumin levels were measured with spectrophotometric assays (sigma-aldrich, st. loius, usa). the data of globulin were calculated from the serum total protein minus serum albumin. specific reagent were used for determination of serum sgot, sgpt, uric acid and creatinine. sgpt and sgot enzyme activity was determined using kinetic enzymatic reaction. the principle of sgpt kinetic examination is lalanine aminotransferase catalyzes the transamination of l-alanine and α-ketoglutarate to form lglutaate and pyruvate. the piruvate then reduced to lactate by lactate dehudrogenase (ldh) enzyme and nicotinamide adenine dinucleotide (nadh) was oxidized to nad. the amount of oxidized nadh resulting from the decreased of absorption were directly proportional to alt activity and measured photometrically with 340 nm wavelength. the sgot determination was according to aminotransferase (ast) catalization from l-aspartate and α-ketoglutarate to lglutamate and oxaloasetate. oxaloacetate was reduced to malate dehydrogenase enzyme (mdh), then nicotinamide adenine dinucleotide (nadh) was oxidized to nad. the amount of oxidized nadh is directly proportional to ast activity and measured photometrically with 340 nm wavelength. the creatinine was determined using enzymatic spectrophotometry method. a 10 µl of serum sample was diluted with 740 µl distilled water then being fortified with 500 µg/ ml creatinine-d3 solution. ethanol was then added to the above of the mixture to precipitate outs the proteins. after vortexing for 1 minute and centrifugation at 12,000 rpm for 10 minutes, the supernatant was collected. the creatinine level was observed and presented in mg/dl. enzymatic determination of uric acid results from the oxidation of uric acid by uricase, which converts its substrate to allantoin. the sample were observed by colorimetric method according to badoeidalfard et al. (2019). the antibody titers against nd and ai were determined using hemagglutination inhibition (hi) assay according to oie (2021a) and oie (2021b). the nd and ai antibody titers test was performed in u-based microtiter plates using 4 ha units of lasota antigen and ai h5n1 antigen. the two folds serial dilution of the test samples were mixed with an equal volume of nd and ai antigen. chicken red blood cells (crbc) were added and subsequently the number of dilutions were examined for the presence of complete inhibition of the hemagglutination. the thiobarbituric acid method (placer et al., 1966) was used to determine the serum mda level. the mda values was measured as a lipid peroxidation index. the serum samples was homogenized in 4.0 ml potassium chloride (kcl) and 0.1 mm butylated hydroxytoluene. then, 200 µl of the homogenized sample were extracted and mixed with 2 ml of thiobarbituric acid solution. the 130 j. indonesian trop. anim. agric. 48(2):126-142, june 2023 mixed samples were placed in a waterbath for 60 minutes at 95 °c until the developing of the palered pigment. the samples were placed at cooler room under running water. then, 3 ml of nbutanol was added, and the sample was vortexed for 60 seconds. the mixture was then centrifuged at 4000 rpm for 15 minutes, and the supernatant was extracted. mda values were determined using colorimeter spectrophotometer against pure n-butanol. digestive tract’s ph and gut microbiota. measurement of intestine ph was carried out on the duodenum, ileum and cecum segment using digital ph-meter (st300 portable ph-meter, ohaus). the pen tip of ph-meter was attached to the duodenum, ileum dan cecum mucosa until the intestinal ph values appeared on the phmeter screen. the lactose negative enterobacteria and total coliform were counted on macconkey agar (merck kgaa, darmstadt, germany) as colorless and red colonies after incubation for 24 hours at 38°c. the lactic acid bacteria colony was enumerated using de man, rogosa and sharpe agar (mrs) from merck kgaa and followed by anaerobic incubation at 38°c for 48 hours. lymphoid organ weight and histology parameters. the lymphoid organ relative weight (bursa of fabricius, spleen and thymus) was determined by calculated lymphoid organ weight divided by the live body weight and multiplied by 100%. the histologic analysis was conducted to the spleen and small intestinal segment (duodenum, jejunum and ileum). histologic organ were prepared by 5 µm transverse cutting and hematoxilin-eosin (he) stained. the measurement of villus height and crypt depth of each intestinal segment were performed using an optical microscope equipped with a digital camera (leica mycrosystems gmbh, wetzlar, germany). the villus-crypt ratio (vh/cd) was determined by calculating the villus height divided by crypt depth. the lesion of spleen and small intestine were graded according to the severity of tissue injury. for injury distribution, scores were according to the injury type, focal or multifocal injury, loss of cilia, epithelial cell hypertrophy/ hyperplasia, inflammatory infiltration and necrosis. a severity score was assigned where 0 (no lesion, 0% cells damage); 1 (mild, 5-25% of cells damage); 2 (moderate, 26-50% cells of damage), 3 (severe, >50% of cells damage) (agusetyaningsih et al., 2022; alabi et al., 2020). the villi height and crypt depth were measured by calculating the average of 3 observations site per small intestine sample. statistical analysis the spss program version 16.0 was used to analyze the data. the analysis was carried out based on a one-way anova with 5% significance level. the duncan multiple range test was used to evaluate the variations among the treatment groups. the histopathological lesion scores on spleen and small intestinal segments were analysed non-parametrically using kruskalwallis analysis method. results performance of broilers data on the growth performance of broilers table 2. performance of broilers (days 0-42) items cont mole wpc mole-wpc sem p value dwg (g) 45.34 a 41.43 b 45.69 a 43.22 ab 0.53 0.008 dfi (g) 76.49 ab 74.74 bc 77.05 a 73.74 c 0.40 0.006 fe (%) 58.09 54.57 57.31 56.46 0.53 0.106 a,b,c means marked with superscript letters in the same row are significantly different (p<0.05). cont: control (basal feed), mole: basal feed + 1.0% m. oleifera, wpc: basal feed + 1% whey protein concentrate, mole-wpc: basal feed + 0.5% m. oleifera + 0.5% whey protein concentrate, sem : standard error mean, dwg: daily weight gain, dfi: daily feed intake, fe: feed efficiency feeding moringa oleifera extract and whey protein to broiler (i. agusetyaningsih et al.) 131 are presented in table 2. the daily weight gain were higher on cont and wpc group (p<0.05) than in mole groups, whereas mole-wpc not significantly different to other groups. the wpc group had a higher daily feed intake (p<0.05) compared to mole and mole-wpc groups, while mole-wpc has a lowest dfi compared to all groups. the treatments had no significant effects on broiler’s feed efficiency. table 3. complete blood counts of broilers items cont mole wpc mole-wpc sem p value haemoglobin (g/dl) 10.78 10.07 10.07 10.00 0.23 0.63 erythrocytes (10 6 /µl) 2.66 2.93 2.77 2.53 0.92 0.49 haematocrit (%) 32.28 35.64 33.35 30.71 1.09 0.46 mcv 122.48 122.18 121.32 122.27 0.46 0.84 mch 43.97 34.41 36.54 39.35 1.76 0.25 mchc 36.08 28.30 30.37 32.42 1.40 0.24 rdw-sd 43.97 34.41 36.54 39.35 1.42 0.75 rdw-cv 36.08 28.30 30.37 32.4 0.29 0.80 mpv 9.77 9.87 9.11 9.84 0.16 0.30 pdw 9.65 13.98 10.78 12.01 0.60 0.06 leukocytes (10 3 /µl) 114.57 98.14 89.25 91.28 4.66 0.21 heterophils (10 3 /µl) 13.07 13.14 13.07 6.92 1.36 0.29 lymphocytes (10 3 /µl) 101.50 85.00 76.21 84.35 3.79 0.11 eosinofil (10 3 /µl) 0.00 0.00 0.00 0.00 0.00 thrombocytes (10 3 /µl) 22.42 24.28 30.71 22.71 1.73 0.30 cont: control (basal feed), mole: basal feed + 1.0% m. oleifera, wpc: basal feed + 1% whey protein concentrate, mole-wpc: basal feed + 0.5% m. oleifera + 0.5% whey protein concentrate, sem : standard error mean, mcv: mean corpuscular volume, mch: mean corpuscular hemoglobin, mchc: mean corpuscular hemoglobin concentration, rdw-sd: red cell distribution width-standard deviation, rdw-cv: red cell distribution-coefficient variation, mpv: mean platelet volume, pdw: platelet distribution width table 4. blood biochemical parameters items cont mole wpc mole-wpc sem p value total cholesterol (mg/dl) 97.71 103.10 100.47 99.51 2.39 0.89 hdl (mg/dl) 31.95 31.07 29.74 24.01 2.12 0.57 ldl (mg/dl) 53.57 b 63.14 a 57.28 ab 65.28 a 1.54 0.01 triglyceride (mg/dl) 60.97 44.52 67.24 51.11 4.82 0.36 total protein (g/dl) 3.17 2.86 3.22 3.01 0.10 0.64 albumin (g/dl) 1.18 1.14 1.17 1.15 0.24 0.93 globulin (g/dl) 1.99 1.99 2.05 1.85 0.09 0.61 uric acid (mg/dl) 6.27 5.68 5.67 5.96 0.25 0.83 creatinine (mg/dl) 0.05 0.05 0.06 0.05 0.01 0.09 sgot (g/dl) 275.59 ab 225.97 b 282.31 ab 345.77 a 15.12 0.03 sgpt (g/dl) 5.19 6.20 4.81 2.72 0.49 0.08 mda (nmol/ml) 2.19 1.99 2.22 2.37 0.07 0.30 acr 21.68 21.84 17.75 21.70 0.67 0.07 a,b means marked with superscript letters in the same row are significantly different (p<0.05). cont: control (basal feed), mole: basal feed + 1.0% m. oleifera, wpc: basal feed + 1% whey protein concentrate, mole-wpc: basal feed + 0.5% m. oleifera + 0.5% whey protein concentrate, sem : standard error mean, hdl: high density lipoprotein, ldl: low density lipoprotein, sgot: serum glutamic oxaloacetic transaminase, sgpt: serum glutamic pyruvic transaminase, mda: malondialdehyde, acr: albumin to creatinine ratio 132 j. indonesian trop. anim. agric. 48(2):126-142, june 2023 complete blood counts and biochemical parameters the treatments had no significant effect on the complete blood counts of broilers as presented in table 3. the data of blood biochemical parameters are listed in table 4. mole and mole-wpc groups had a higher level of ldl (p<0.05) than in cont group, and also wpc had no significant difference to another groups. the highest level of sgot was observed in mole-wpc group (p<0.05), while cont group was the lowest (p<0.05). digestive tract’s ph and small intestine histomorphometry the data of ph of duodenum, ileum and caecum are listed on table 5, and there were no significant effects due to the treatments. however, all treatments had a significant impact on villi height and villi height to crypt depth ratio (vh/ cd ratio) in duodenum (table 6). the mole and mole-wpc groups had a higher duodenum villi height compared to cont and wpc groups. the vh/cd ratio was higher (p<0.05) in mole and mole-wpc groups compared to cont group but have no significant difference with wpc group. the treatments had no significant impact on jejunum and ileum histomorphometry. ileum and caecum microbiota the data of ileum and caecum microbiota are presented in table 7. the counts of ileum lactose negative bacteria (lne) increased in wpc and mole-wpc groups (p<0.05) compared to mole group. while the ileum lne counts in cont group showed no significant difference to wpc and mole-wpc groups. the treatments in this study did not have the significant impact to ileum coliform and lab, and all table 5. ph of digestive tracts items cont mole wpc mole-wpc sem p value duodenum 6.01 5.97 6.01 5.96 0.04 0.96 ileum 5.56 5.16 5.85 5.81 0.11 0.13 caecum 6.47 6.69 6.41 6.52 0.06 0.50 cont: control (basal feed), mole: basal feed + 1.0% m. oleifera, wpc: basal feed + 1% whey protein concentrate, mole-wpc: basal feed + 0.5% m. oleifera + 0.5% whey protein concentrate, sem : standard error mean table 6. small intestine histomorphometri items cont mole wpc mole-wpc sem p value duodenum villi height (vh) 902.11 b 1309.89 a 1049.51 ab 1290.36 a 63.36 0.05 crypt depth (cd) 236.35 201.17 203.72 220.54 9.45 0.54 vh/cd ratio 3.82 b 6.55 a 5.36 ab 6.21 a 0.36 0.03 jejunum vili height (vh) 828.08 1106.43 1211.81 946.87 63.52 0.14 crypt depth (cd) 164.52 176.25 202.86 187.97 9.94 0.58 vh/cd ratio 0.19 0.17 0.17 0.21 0.01 0.40 ileum vili height (vh) 590.11 689.01 648.92 559.43 39.38 0.63 crypt depth (cd) 175.21 163.56 141.81 145.18 10.87 0.68 vh/cd ratio 3.40 4.50 4.69 4.06 0.24 0.26 a,b means marked with superscript letters in the same row are significantly different (p<0.05). cont: control (basal feed), mole: basal feed + 1.0% m. oleifera, wpc: basal feed + 1% whey protein concentrate, mole-wpc: basal feed + 0.5% m. oleifera + 0.5% whey protein concentrate, sem : standard error mean feeding moringa oleifera extract and whey protein to broiler (i. agusetyaningsih et al.) 133 bacterial numbers in caecum. immunology parameters the data listed in table 8 show the treatment using mole and wpc or their combination did not affect the relative immune organ weight (bursa of fabricius, spleen, thymus) and antibody titre against newcastle disease and avian influenza in chicks. histopathologic scoring of the lymphoid tissue and small intestines table 9 shows histopathologic scoring of the small intestines and spleen of broilers. the treatment with mole and wpc or their combination had a significance effect (p<0.05) on jejunum ileum and spleen lesion score. the wpc group had a lower lesion score (p<0.05) compared to con, mole and mole-wpc groups. the wpc and mole-wpc groups had the lower ileum lesion score (p<0.05) compared to cont group, but had no significance different with mole group. the spleen lesion score were greater (p<0.05) in mole-wpc and cont groups compared to mole and wpc groups. according to figure 1-4, the visible changes in the duodenum were only mild damage in mucosal and muscularis layer. in jejunum (figure 58), the figure of cont group showed that there were severe erosion in mucosal layer and in mole group showed the moderate lesion in mucosal layer. while, the wpc group performed the normal mucosa and muscular layer. the figure mole-wpc group described the erosion in mucosal layer and moderate lesion in muscular layer. figure 9-12 shows the broiler ileum lesion table 7. ileum and caecum microbiota items (log cfu/mg) cont mole wpc mole-wpc sem p value ileum coliform 1.10 1.01 3.37 3.37 0.47 0.34 lne 2.02 ab 1.36 b 4.25 a 4.25 a 0.44 0.02 lab 4.37 4.37 4.18 4.18 0.57 3.01 caecum coliform 3.46 3.47 3.42 4.42 0.42 0.82 lne 2.51 3.37 3.91 2.68 0.42 0.64 lab 8.14 7.95 7.95 7.91 0.07 0.61 a,b means marked with superscript letters in the same row are significantly different (p<0.05). cont: control (basal feed), mole: basal feed + 1.0% m. oleifera, wpc: basal feed + 1% whey protein concentrate, mole-wpc: basal feed + 0.5% m. oleifera + 0.5% whey protein concentrate, sem : standard error mean, cfu: colony forming unit, lne: lactosenegative bacteria, lab: lactic acid bacteria table 8. immunology parameters items (% bw) cont mole wpc mole-wpc sem p value relative immune organ weight bursa of fabricius 0.04 0.04 0.03 0.04 0.002 0.26 spleen 0.12 0.12 0.14 0.17 0.01 0.34 thymus 0.29 0.23 0.20 0.25 0.01 0.30 antibody titre nd 10.00 9.28 23.14 13.28 2.60 0.21 ai 1.71 2.57 13.42 12.14 2.60 0.24 cont: control (basal feed), mole: basal feed + 1.0% m. oleifera, wpc: basal feed + 1% whey protein concentrate, mole-wpc: basal feed + 0.5% m. oleifera + 0.5% whey protein concentrate, sem : standard error mean, gmt: geometric mean titre, nd: newcastle disease, ai: avian influenza 134 j. indonesian trop. anim. agric. 48(2):126-142, june 2023 score. the cont group figure was described the moderate lesion in mucosal layer and no lesion in muscularis layer, but in mole, wpc and mole-wpc had showed the mild lesion in mucosal layer. figure 13-16 were an overview of the broiler spleen lesion score. the cont and mole-wpc groups performed a lesion score that were closed to normal with almost no microscopic organ changes, different from the mole and wpc groups which showed moderate-severe spleen lesion. discussion the results of this study demonstrated that dietary administration of mole had a detrimental effect on broiler chicken growth. alabi et al. (2020) have previously shown that administering mole to broiler chicks decreased their feed intake and growth performance of broilers, which is in accordance with our findings. the latter authors pointed out that the antinutritional components in mole were responsible for the decrease in feed intake and growth in chicks given mole. in this regard, these antinutritional substances, such as tannins and saponin, may obstruct the digestive enzyme activities and compromise nutrient absorption (abd el-hack et al., 2022). the corresponding results were also documented by cui et al. (2018), in which dietary inclusion of moringa oleifera leaves meal impaired growth performance of broiler chickens. they found that moringa oleifera leaves had an effect on reducing broiler abdominal fat content. such reduced abdominal fat content may therefore reduced the final body weight gain of broilers (cui et al., 2018). in fact, the latter circumstance was also noted in the current investigation, where feeding mole to broilers reduced the proportion of abdominal fat content (data not shown) and hence broiler final body weight. the use of wpc in feed had no impact on broiler daily weight gain. this finding was in line with pineda-quiroga et al. (2017) that the use of wpc had no effect on the performance of broiler chickens. in contrast, kanza et al. (2013) and greenhalgh et al. (2022) reported that production parameters such as feed consumption, body weight and body weight gain increased with feeding whey protein. several studies have reported that giving whey protein (due to high content of protein) can interfere with kidney function which then affects the growth of broilers (ko et al., 2017; ashour et al., 2019). other studies further suggested that whey protein may modulate lipid metabolism in adipocytes, such as plasma release triacylglycerol and intestinal fat absorption (boscaini et al., 2020). this is thought to exert minimal fat deposition in the body, resulting in decreased absolute body weight gain in chicks. in addition of this study, the protein content of the basal feeds were formulated to meet the nutritional requirement of broilers. in this respect, the addition of wpc in the basal feeds resulted in higher protein intake than the need of broilers (exceeding requirements). such conditions are very likely to interfere with kidney function, and thereby attenuated the growthpromoting effect of wpc. however, this inference must be interpreted with caution because table 9. histopathologic scoring of the small intestines and spleen items cont mole wpc mole-wpc sem p value duodenum 10.86 15.71 17.50 13.93 0.12 0.38 jejunum 18.43 a 16.64 a 6.29 b 16.64 a 0.13 <0.01 ileum 20.57 a 16.86 ab 10.29 b 10.29 b 0.15 0.02 spleen 10.40 b 20.50 a 20.50 a 6.57 b 0.14 <0.01 the data presented are the mean-rank. a,bmean-rank marked with superscript letters in the same row are significantly different (p<0.05). cont: control (basal feed), mole: basal feed + 1.0% m. oleifera, wpc: basal feed + 1% whey protein concentrate, mole-wpc: basal feed + 0.5% m. oleifera + 0.5% whey protein concentrate, sem : standard error mean feeding moringa oleifera extract and whey protein to broiler (i. agusetyaningsih et al.) 135 figure 1-4. duodenum microscopic photograph of 42 days old broiler chickens. cont (mild lesion in mucosal and no lesion in muscular layer), mole (mild lesion in mucosal layer), wpc (mild lesion in mucosal layer), mole-wpc (mild lesion in mucosal layer). h&e staining, 40×. figure 5-8. jejunum microscopic photograph of 42 days old broiler chickens. cont (severe erosion in mucosal layer), mole (moderate lesion in mucosal layer), wpc (normal mucosa and no lesion in muscular layer), mole-wpc (erosion in mucosal and moderate lesion muscular layer). h&e staining, 40×. 136 j. indonesian trop. anim. agric. 48(2):126-142, june 2023 figure 9-12. ileum microscopic photograph of 42 days old broiler chickens. cont (moderate lesion in mucosal and no lesion in muscular layer), mole (mild lesion in mucosal layer), wpc (mild lesion in mucosal layer), mole-wpc (mild lesion in mucosal layer). h&e staining, 40×. figure 13-16. spleen microscopic photograph of 42 days old broiler chickens. cont (mild lesion in reticular cells colony), mole (moderate lesion in red pulp), wpc (moderate lesion in red pulp), mole -wpc (close to normal). h&e staining, 40×. feeding moringa oleifera extract and whey protein to broiler (i. agusetyaningsih et al.) 137 indicators of renal impairment, reflected in uric acid and creatinine levels, did not differ among treatment groups. in this study, feed supplementation with mole and wpc, or their combination had no significant effect on complete blood counts of broilers. this was in line with egbu et al. (2022) and castillo et al. (2017) showing no effect of m. oleifera supplementation on the values of haemoglobin, mch, mchc, mcv, platelets and leukocytes of broiler and quail. supplementing wpc in this treatment also did not altered the blood parameters of broilers. this finding was in contrary to the previous study (kanza et al., 2013) that found the increase of platelets and white blood cells due to whey protein supplementation in broilers. blood profile is the best signal for broiler health status that could helps to identify whether there is acute or chronic immune disorders and infective or non-infective disease occurred. this current results might therefore indicates that the bioactive components in whey were less-able to affects the blood profile of broilers. low-density lipoprotein values were substantially increased by mole or mole-wpc supplementation. this finding was not in line with abousekken (2015) and alnidawi et al. (2016) who reported a decrease in ldl values due to m. oleifera leaf supplementation in broiler feed. detailed explanation of these differences was not known with certainty until now. in this study, mole was extracted from m. oleifera leaves which were added with maltodextrin as a filler. maltodextrin has a long carbohydrate chain along with 2-3% glucose and 5-7% maltose. in general, the body digests maltodextrin as a simple carbohydrate which can then be easily converted into instant energy (parikh et al., 2014). bai et al. (2019), reported that the high content of simple carbohydrates in feed can increase or stimulate ldl transcytosis resulting in higher ldl level. based on the facts above, it was possible that the increased ldl level in the serum of broiler chickens receiving mole or mole-wpc was due to maltodextrin stimulation on ldl transcytosis. sgot is an indicator of liver health, in which high levels of sgot indicate impaired liver function in broiler chickens. when compared to the control group, the sgot levels in the treatment groups were not significantly different in this present study. this showed that the administration of mole and mole-wpc did not have a negative impact on the liver health of broiler chickens. small intestinal morphology is one of the factors that can determine the utilization of nutrients and indicators of physiological status of broiler chickens. in this study, mole and mole-wpc increased the vh and the ratio of vh to cd of the duodenum. nkukwana et al. (2015) and khan et al. (2017) reported an increase in vh in broiler chickens treated with moringa oleifera leaf meal. higher villi in the duodenum indicate an increase in the absorption area thereby improving nutrient absorption by the chickens (muhammadsadeghi et al., 2019). furthermore, mahfuz and piao (2019) and khan et al. (2017) reported that enlargement of the absorption area is usually accompanied by an increase in the number of goblet cells which act as the mucosal immune system in poultry. in terms of the mole treatment, the content of short-chain carbohydrates and polyphenols in mole can be the main cause of increased intestinal vh (nkukwana et al., 2015; das et al., 2020). likewise, kamboh and zhu (2014) suggested that polyphenol compounds can stimulate epithelial cell mitosis which results in higher vh. in general, the vh/cd of duodenum can indicate the digestibility and absorption of the small intestine, in which a higher vh/cd reflects a strong ability to digest and absorb nutrients (tian et al., 2021). in this study, the dietary inclusion of mole reduced the numbers of lactose negative enterobacteria (lne) in the ileum compared to that of wpc and mole-wpc. aside from being a source of antioxidants, mole is known to show antimicrobial activity (gupta et al., 2018). in this case, oluduro (2012) showed that m. oleifera contains methyl n-4-(α-l-rhamnopyranosyloxy) 138 j. indonesian trop. anim. agric. 48(2):126-142, june 2023 benzyl carbamate and 4-(α-d-glucopyranosyl1→4-α-l-rhamnomyranosyloxy) benzyl thiocarboxamide which can act as antimicrobials. according to this study, chickens in the wpc and mole-wpc groups had a higher population of lne in the ileum compared to the mole group. in this case, the protein in wpc has a potential role in promoting the growth of intestinal microflora. whey can also act as a substrate for enterobacterial growth due to the presence of lactose, vitamins and minerals (you et al., 2017; geiger et al., 2016). in the current investigation, the dietary administration of mole, wpc, or both had no discernible effect on the development of immune organs and humoral immunity, as indicated by the bursa fabricius, spleen, thymus weight, and nd-ai antibody titre. eladia and ampode (2021) noted the same findings, in which administering of m. oleifera to broiler chicks had no impact on their immune status of broilers. in this study, data on spleen histopathologic scoring lesion showed that mole-wpc group have a better condition compared to mole and wpc groups. it indicated that bioactive compounds in mole and wpc seemed to act as immune cells protectors in broiler spleen. dietary supplementation of wpc and combination mole and wpc improved the integrity of jejunum and ileum of broilers. in this case, wpc and molewpc chicks had better gut lesion score compared to cont and mole groups. this results may be due to biophenols and cysteine-rich protein contents in wpc which can induce the integrity of gut cell wall (xiao et al., 2020; solak and akin, 2012). conclusion in conclusion, dietary supplementation of mole, wpc or their combination improved the gut integrity and immune organ, but had no appreciable impact on production performance and physiological status in broilers. acknowledgement the authors express the deepest gratitude to faculty of animal and agricultural sciences, universitas diponegoro for the research funding through “dipa 2022” with the contract number 58/un7.5.5.2/pp/2022. conflict of interest all authors declare that there has no conflict of interests. references abd el-hack, m. e. a., a. h. alqhtani, a. a. swelum, m. t. el-saadony, h. m. salem, a.o. babalghith, a. e. taha, o. ahmed, m. abdo and k a. el-tarabily. 2022. pharmacological, nutritional and antimicrobial uses of moringa oleifera lam. leaves in poultry nutrition: an updated knowledge. poult. sci. 101:102031. https://doi.org/10.1016/ j.psj.2022.102031 abousekken, m. s. m. 2015. performance, immune response and carcass quality of broilers fed low proteins diets contained either moringa oleifera leaves meal or its extract. am. j. sci. 11(6):153-164. retrieved december 26, 2022, from http:// www.jofamericanscience.org abu hafsa, s.h., s.a. ibrahim, y. z. eid and a.a. hassan. 2019. effect of ietary moringa oleifera leaves on the performance, ileal microbiota and antioxidative status of broiler chickens. j. anim. physiol. anim. nutr. 00:1-10. https:// doi.org/10.1111/jpn.13281 agusetyaningsih, i., e. widiastuti, h.i. wahyuni, r. murwani and t.a. sartono and s. sugiharto. 2022. effect of encapsulated cosmos caudatus leaf extract on the physiological conditions, immune competency, and antioxidative status of broilers at high stocking density. ann. anim. sci. 22(1):653 -662. https://doi.org/10.2478/aoas-20210043 feeding moringa oleifera extract and whey protein to broiler (i. agusetyaningsih et al.) 139 akram, m., i. saleem, m. farhab and z. luqman. 2020. immunomodulatory effects of moringa oleifera leaf meal (molm) against newcastle disease in broilers. osmaniye korkut ata üniversitesi. j. nat. appl. sci. 3(2):19-25. https:// doi.org/10.47495/okufbed.738447 alabi, o.j., a.d. malik, j.w. ng’ambi, p. obaje and b.k. ojo. 2017. effect of aqueous moringa oleifera (lam) leaf extracts on growth performance and carcass characteristics of hubbard broiler chicken. braz. j. poult. sci. 19:273-280. https:// doi.org/10.1590/1806-9061-2016-0373 alabi, o.j., j.w. ng’ambi and e.f. mbajiorgu, e. f. 2020. aqueous extract of moringa (moringa oleifera) leaf (aemol) on the growth, sensory and histology parameters of broiler chickens. appl. ecol. environ. res. 18(5):6753-6764. http:// dx.doi.org/10.15666/aeer/1805_67536764 alnidawi, n. a. a., f.m.a. hana, s.s. abdelgayed, f.a. ahmed and m. farid. 2016. moringa oleifera leaves in broilers diets: effect on chicken performance and health. j. food. qual. 58:40-48. retrieved december 26, 2022, from http://www.iiste.org ashour, e. a., m. abd el-hack, m. alagawany, a. swelum, a. o. osman, i.m. saadeldin, m. abdel-hamid and e.o.s. hussein. 2019. use of whey protein concentrate in broiler diets. j. appl poult. res. 28:1078-1088. http://dx.doi.org/10.3382/japr/pfz070 bai, x., x. yang, x. jia, y. rong, l. chen, l. zeng, w. li, g. wu, l. wang, j. zhang, l. xiong, y. wang, l. zhu, y. zhao and s. jin, s. 2019. cav1-cavin1-lc3bmediated autophagy regulates high glucosestimulated ldl transcytosis. atg. 16 (6):1111-1129. https:// doi.org/10.1080/15548627.2019.1659613 badoei-dalfard, a., n. sohrabi, z. karami and g. sargazi. 2019. fabrication of an efficient and sensitive colorimetric biosensor based on uricase/th-mof for uric acid sensing in biological samples. biosens. bioelectron. 141:111420. https://doi.org/ j.bios.2019.111420 balami, a.g., j.j. ndahi, j.j. gadzama, s.j. enam, m.a. chiroma, p.a. abdu, a.m. wakawa, t. aluwong and s.b. oladele. 2018. effect of moringa oleifera feed supplementation on the serum biochemical profile of broilers challenged with very virulent infectious bursal disease virus. j. adv. vet. anim. res. 5(2):155-165. https:// doi.org/10.5455/javar.2018.e260 boscaini, s., r.c. rubio, o. nychyk, j.r. speakman, j.f. cryan, p.d. cotter and k.n. nilaweera. age and duration dependent effects of whey protein on high fat diet induced change in body weight, lipid metabolism and gut microbiota in mice. physiol. reports. 8(15):e14523. https:// doi.org/10.14814/phy2.14523 castillo, l. r. i, l.j.j. portillo, f.j. leon, d.r. gutierrez, e. m. a. angulo, m.d. muyrangel and j.b. heredia. 2018. inclusion of moringa leaf powder (moringa oleifera) in fodder for feeding japanese quail (coturnix coturnix japonica). braz. j. poult. sci. 20 (1):15-26. http://dx.doi.org/10.1590/18069061-2017-0410 cui, y. m., j. wang, w. lu, h.j. zang, s.g. wu and g.h. qi. 2018. effect of dietary supplementation with moringa oleifera leaf on performance, meat quality, and oxidative stability of meat in broilers. poult. sci. 97, 2836-2844. https://doi.org/ 10.3382/ps/ pey122 das, q., m. islam, d. lepp, j. tang, x. yin, l. mats, h. liu, k. ross, y. m. kennes and h. yaichi. 2020. gut microbiota, blood metabolites, and spleen immunity in broiler chickens fed berry pomaces and phenolicenriched extractives. front. vet. sci. 7. https://doi.org/10.3389/fvets.2020.00150 egbu, c. f., l. e. motsei, a. o. yusuf and c. m. mnisi. 2022. evaluating the efficacy of moringa oleifera seed extract on nutrient digestibility and physiological parameters of broiler chickens. agr. 12:1102. https:// https://doi.org/10.1590/1806-9061-2016-0373 https://doi.org/10.1080/15548627.2019.1659613 140 j. indonesian trop. anim. agric. 48(2):126-142, june 2023 doi.org/10.3390/agriculture12081102 eladia, r. e and k. m. b. ampode. 2021. moringa (moringa oleifera lam.) pod meal: nutrient analysis and its effect on the growth performance and cell-mediated immunity of broiler chickens. j. anim. health. prod. 9(2):170-177. http:// dx.doi.org/10.17582/ journal.jahp/2021/9.2.170.177 geiger, b., h. m. nguyen, s. wenig, h. a. nguyen, c. lorenz and r. kittl. 2016. from byproduct to valuable components: efficient enzymatic conversion of lactose in whey using β-galactosidase from streptococcus thermophilus. biochem. eng. j. 116:45-53. https://doi.org/10.1016/j.bej.2016.04.003 greenhalgh, s., a. lemme, j. de paula dorigan, p.v. chrystal, s. p. macelline, s. y. liu and p. h. selle. 2022. dietary crude protein concentrations, feed grains, and whey protein interactively influence apparent digestibility coefficients of amino acids, protein, starch, and performance of broiler chickens. poult. sci. 101:102131. https:// doi.org/10.1016/j.psj.2022.102131 gupta, s., r. jain, s. kachhwaha and s. l. kothari. 2018. nutritional and medicinal applications of moringa oleifera lam-review of current status and future possibilities. j. herb. med. 11:1-11. https://doi.org/ 10.1016/j.hermed.2017.07.003 kamboh, a. a w. y. zhu. 2014. individual and combined effects of genistein and hesperidin on immunity and intestinal morphometry in lipopolysaccharide-challenged broiler chickens. poult. sci. 93:1-9. http:// dx.doi.org/10.3382/ps.2014-03971 kanza, m. majeed, a. sameen, m. u. khan, m.a. shariati and v. karapetkovskahristova, v. 2013. impact of cheese whey protein on growth performance of broiler: an approach of cheese whey utilization in poultry feed. j. microbiol. biotechnol. food sci. 6(4):1117-1120. http://doi.org/ 10.15414/jmbfs.2017.6.4.1117-1120 khan, a., m. tahir, i. alhidary, a. abdelrahman, a. a. swelum and r. u. khan. 2021. role of dietary moringa oleifera leaf extract on productive parameters, humoral immunity and lipid peroxidation in broiler chicks. anim. biotechnol. https:// doi.org/10.1080/10495398.2021.1899936 khan, i., h. zaneb, s. masood, m. s. yousaf, h. f. rehman and h. rehman. 2017. effect of moringa oleifera leaf powder supplementation on growth performance and intestinal morphology in broiler chickens. anim. physiol. anim. nutr. 101:114-121. https:// doi.org/10.1111/jpn.12634 ko, g. j., y. obi, a. r. tortoricci and k. k. zadeh. 2017. dietary protein intake and chronic kidney disease. curr. opin. clin. nutr. metab. care. 20:77-85. https://doi.org/ 10.1097/mco.0000000000000342 lopez-virella, m. f., p. stone, s. ellis and a. j. coldwell. 1997. cholesterol determinations in high density lipoproteins separated by three methods. clin. chem. 23:882-884. https://doi.org/10.1093/clinchem/23.5.882 mahfuz, s. and x. s. piao. 2019. application of moringa (moringa oleifera) as natural feed supplement in poultry diets. review. anim. 9(431):1-19. https://doi.org/10.3390/ ani9070431 muhammadsadeghi, f., m. afsharmanesh and h. ebrahimnejad. 2019. the substitution of humic material complex with mineral premix in diet and interaction of that with probiotic on performance, intestinal morphology and microflora of chickens. livest. sci. 228:1-4. https://doi.org/10.1016/ j.livsci.2019.07.010 nkukwana, t. t., v. muchenje, p. j. masika and b. mushonga. 2015. intestinal morphology, digestive organ size and digesta ph of broiler chickens fed diets supplemented with or without moringa oleifera leaf meal. s. african. j. anim. sci. 45(4):362-370. http:// dx.doi.org/10.4314/sajas.v45i4.2 ochi, e.b., m. e. elbushra, m. fatur, o. abubakr and h. a. ismail. 2015. effect of moringa (moringa oleifera lam) seeds on http://dx.doi.org/10.17582/journal.jahp/2021/9.2.170.177 http://dx.doi.org/10.17582/journal.jahp/2021/9.2.170.177 https://doi.org/10.1016/j.hermed.2017.07.003 https://doi.org/10.1093/clinchem/23.5.882 https://doi.org/10.3390/ani9070431 https://doi.org/10.3390/ani9070431 feeding moringa oleifera extract and whey protein to broiler (i. agusetyaningsih et al.) 141 the performance and carcass characteristics of broiler chickens. j. nat. sci. res. 5:66– 73. https://doi.org/10.9734/bpi/ecafs/ v2/5204f oie. 2021a. newcastle disease (infection and newcastle disease virus). chapter 3.3.14. world organisation for animal health. paris. oie. 2021b. avian influenza (infection and avian influenza virus). chapter 3.3.4. world organisation for animal health. paris. oluduro, a. o. 2012. evaluation of antimicrobial properties and nutritional potentials of moringa oleifera lam. leaf in southwestern nigeria. malays. j. microbiol. 8:59 -67. https://doi.org/10.21161/mjm.02912 parikh, a., s. agarwal and k. raut. 2014. a review on applications of maltodextrin in pharmaceutical industry. int. j. pharm. biol. 4(8):67-74. retrieved december 26, 2022, from http://www.ijpbs.com pineda-quiroga, c., a. camarinha-silva, d. borda-molina, r. atxaerando, r. a. ruiz and a. gracia-rodriguez. 2018. feeding broilers with dry whey powder and whey protein concentrate affected productive performance, ileal digestibility of nutrients and cecal microbiota community. anim. 12 (4):692-700. https://doi.org/10.1017/ s1751731117002208 placer, z. a., l. l. kusman and b. c. johnson. 1966. estimation of product of lipid peroxidation (malonyl dialdehyde) in biochemical systems. anal. biochem. 16:359-364. https://doi.org/10.1016/0003-2697(66) 90167-9 rama, g. r., d. kuhn, m. j. maciel and c. f. volken de souza. 2019. potential application of dairy whey for the production of lactic acid bacteria cultures. int. dairy j. 98:25 -37. https://doi.org/10.1016/ j.idairyj.2019.06.012 solak, b. b. and n. akin. 2012. health benefit of whey protein: a review. j. food sci. eng. 2:129-137. https://doi.org/10.17365/21595828/2012.03.001 sugiharto, s. 2016. role of nutraceutical in gut health and growth performance of poultry. j. saudi soc. agric. sci. 15(2):99-111. https://doi.org/10.1016/j.jssas.2014.06.001 sugiharto, s. 2021. herbal supplements for sustainable broiler production during post antibiotic era in indonesia an overview. livest. res. rural. dev. 33(8). retrieved december 26, 2022, from http:// www.lrrd.org/lrrd33/8/33103sgh_u.html sugiharto, s., n. m. toana. 2020. the effect of kelor (moringa oleifera) seed meal on productive performance, carcass traits, and meat cholesterol of broiler chickens. makassar, indonesia: proceedings of the 3 rd international conference of animal science and technology, earth and environtmental science, november 3-4 th ; 2018 szczurek, w., b. szymczyk, a. arczewskawłosek, d. jozefiak and m. n. alloui. 2013. the effects of dietary whey protein concentrate level on performance, selected intestinal tract and blood parameters and thiobarbituric acid reactive substances in the liver and breast meat of broiler chickens. j. anim. feed. sci. 22:342-353. https:// doi.org/10.22358/jafs/65923/2013 tian, h., y. liang, g. liu, y. li, m. deng, d. liu, y. guo and b. sun. 2021. moringa oleifera polysaccharides regulates caecal microbiota and small intestinal metabolic profile in c57bl/6 mice. int. j. biol. macromol. 182:595-611. https:// doi.org/10.1016/j.ijbiomac.2021.03.144 werner, m., d. g. gabrielson and g. eastman. 1981. ultramicrodeterminations of serum triglycerides by bioluminescent assay. clin. chem. 21:268-271. pmid: 7460277 xiao, x., wang, j., meng, c., liang, w., wang, t., zhou, b., wang, y., luo, x., gao, l., & zhang, l. (2020). moringa oleifera lam and its therapeutic effects in immune disorders. frontiers in pharmacology, 11, 1-9. https://doi.org/ 10.3389/fphar.2020.566783 you, s., h. chang, q. yin, m. wang, r. su, r. 2017. utilization of whey powder as subhttps://doi.org/10.9734/bpi/ecafs/v2/5204f https://doi.org/10.9734/bpi/ecafs/v2/5204f https://doi.org/10.1017/s1751731117002208 https://doi.org/10.1017/s1751731117002208 https://doi.org/10.1016/j.idairyj.2019.06.012 https://doi.org/10.1016/j.idairyj.2019.06.012 https://doi.org/10.1016/j.jssas.2014.06.001 https://doi.org/10.3389%2ffphar.2020.566783 142 j. indonesian trop. anim. agric. 48(2):126-142, june 2023 strate for low-cost preparation of βgalactosidase as main product, and ethanol as by-product, by a litre-scale integrated process. bioresource. technol. 245:12711276. https://doi.org/10.1016/ j.biortech.2017.08.092 zadegan, m. a. n., h. kermanshahi and a. javadmanesh. 2022. evaluation of antioxidant enzymes activity, lipid peroxidation and sperm quality in broiler breeder roosters fed whey protein and sodium selenite. poult. sci. j. 10(1):129-138. https:// doi.org/10.22069/psj.2022.20034.1790 zarei, f., l. nateghi, m. z. eshaghi and m. e. t. abadi. 2020. production of gammaaminobutiric acid (gaba) in whey protein drink during fermentation by lactobacillus plantarum. j. microbiol. biotechnol. food sci. 9(6):1087-1092. https:// doi.org/10.15414/jmbfs.2020.9.6.1087-1092 https://doi.org/10.22069/psj.2022.20034.1790 the c. perfringens isolated from broiler chickens (r. d. eraky and w. a. abd el-ghany) 1 introduction enteric diseases are very important in the poultry industry as they lead to production losses, mortalities, and risk of contamination of poultry products (dahiya et al., 2006). infection with clostridium perfringens (c. perfringens) is considered one of the most critical enteric problems in chickens and causes necrotic enteritis (ne) (cooper et al., 2013). the first case of ne in fowl was reported in australia in 1930 and was genetic characterization, antibiogram pattern, and pathogenicity of clostridium perfringens isolated from broiler chickens with necrotic enteritis 1 r. d. eraky and 2* w. a. abd el-ghany 1 department of bacteriology, animal health research institute (damietta branch), damietta, egypt 2 department of poultry diseases, faculty of veterinary medicine, cairo university, giza, egypt * corresponding e-mail: wafaa.soliman1974@gmail.com received june 14, 2021; accepted october 24, 2021 abstract the aims of this investigation were characterization, demonstration of the antibiogram pattern and detection of the pathogenicity of clostridium perfringens (c. perfringens) strains isolated from broiler chickens in damietta governorate, egypt. a total of 357 samples representing 202 intestinal contents and 155 liver samples from freshly dead broiler chickens were collected from 18 broiler farms. isolates of c. perfringens were identified morphologically, microscopically, and biochemically. forty-seven c. perfringens isolates were recovered, which represented 20.3% of the intestinal contents and 3.8% of the liver samples. the toxins and virulence genes of c. perfringens were investigated using polymerase chain reaction. all of the toxigenic c. perfringens strains were type a and carried netb, tpel, cpe, and plc genes. the in vitro antibiogram of c. perfringens strains revealed 100% sensitivity to gentamycin and levofloxacin and 100% resistance to nalidixic acid and ceftriaxone. the isolated c. perfringens strains were highly pathogenic and induced signs and lesions of necrotic enteritis as well as 43.3% mortalities in 20-day-old chicks. in conclusion, c. perfringens is an important pathogen that affects broiler chickens due to the presence of virulence genes and the pathogenicity in the inoculated birds. keywords: antibiotics, c. perfringens, pcr, poultry, toxins fully investigated in england (parish, 1961). later, the disease spread rapidly in almost all poultry-producing countries around the world (finken and wages, 1997). the disease causes severe economic problems represented by low feed conversion rate, mortalities, and increased treatment costs (cooper and songer, 2009). the production losses due to ne outbreaks in the global poultry industry are estimated to be us $6 billion annually (moore, 2016). the main sources of ne infection are litter and contami j i t a a journal of the indonesian tropical animal agriculture accredited by ditjen riset, teknologi dan pengabdian kepada masyarakat no. 164/e/kpt/2021 j. indonesian trop. anim. agric. pissn 2087-8273 eissn 2460-6278 http://ejournal.undip.ac.id/index.php/jitaa 47(1):1-16, march 2022 doi: 10.14710/jitaa.47.1.1-16 mailto:wafaa.soliman1974@gmail.com 2 j. indonesian trop.anim.agric. 47(1):1-16, march 2022 nated environment (craven et al., 2003; profeta et al., 2020), and transmission of infection occurs through ingestion of contaminated food and water. husbandry practices like diet and litter types influence the incidence and severity of ne in poultry (henry et al., 1995). two to six-weekold broiler chickens and 12to 24-week-old layers are highly susceptible to ne (lovland et al., 2004). affected birds with acute ne show severe necrosis and damage of the intestinal mucosa, which lead to high mortalities (wu et al., 2010) and poor performance in subclinical cases (skinner et al., 2010). the causative agent of ne is c. perfringens, which is a gram-positive, anaerobic, and spore-forming bacillus (timbermont et al., 2011). these bacilli are found naturally in the soil, water, sewage, food, and feces as well as in the intestinal tracts of livestock, poultry, and humans (li et al., 2016). c. perfringens is considered a normal inhabitant of the birds’ intestinal tract as well as a potential pathogen causing ne. strains of c. perfringens are divided into seven extracellular toxin types: a, b, c, d, e, f, and g (rood et al., 2018; goossens et al., 2020). however, c. perfringens type a and to a lesser extent type c have been shown to be the major cause of ne in chickens (cooper and songer, 2009). moreover, alpha (α) toxin is primarily responsible for ne in poultry (keyburn et al., 2010). the virulence of c. perfringens is attributed to more than 20 toxins and hydrolytic enzymes (kiu and hall, 2018; gu et al., 2019), while individual strains only produce a subset of these toxins (van immerseel et al., 2008). major extracellular toxins of c. perfringens are alpha (α) (cpa), beta (β) (cpb), epsilon (ε) (etx), and iota (ι) (iap). however, different strains of c. perfringens can also produce other enzymes and toxins, namely, β2, theta (θ) [perfringolysin o (pfo)], kappa (κ), delta (δ), mu (µ), sialidase, hyaluronidase, collagenase, neuraminidase, enterotoxin (cpe), necrotic enteritis toxin b-like (netb), and toxin perfringens large (tpel) (lukinmaa et al., 2002; li et al., 2013; duff et al., 2019; wei et al., 2020). all c. perfringens type a strains possess phospholipase c (plc) or cpa gene that produces α toxin in varying amounts (kumar et al., 2019; helal et al., 2019). this gene is present on the chromosome close to the origin of replication of all c. perfringens strains (canard et al., 1989). it was found that netb and tpel toxins play a role in the virulence of some c. perfringens strains of avian origin (rood et al., 2016; elsharkawy et al., 2020; thi et al., 2021). most c. perfringens strains that produce a pore-forming toxin (netb) belong to toxin type g (rood et al., 2018). in addition, tpel, a recently designated novel family member of large clostridial cytotoxins, was detected in some c. perfringens type a strains isolated from ne cases (coursodon et al., 2012; mwangi et al., 2019). enterotoxin gene (cpe) coding toxin of c. perfringens has been identified by gao and mcclane (2012), and it induces gastroenteritis (lukinmaa et al., 2002). ne has become a hurdle affecting broiler production especially after the great restrictions on the application of antibiotics in ration under modern high stalking density (van immerseel et al., 2008). therefore, there is an urgent need to select the drug of choice to control this critical disease. therefore, this study aimed to characterize, investigate the antibiogram pattern and determine the pathogenicity of c. perfringens strains isolated from broiler chickens in damietta governorate, egypt. materials and methods sample collection a total of 357 samples were taken from 202 intestines and 155 livers of sacrificed diseased and freshly dead chickens (2-8-week-old) representing 18 commercial broiler chicken farms at different locations in damietta governorate, egypt, from december 2019 to june 2020 (table 1). clinically suspected cases with ne showed anorexia, depression, reluctance to move, diarrhea, and death. sacrificed and dead chickens showed dehydration, enteritis, ballooned and friable intestines with hemorrhages, and yellow diphtheritic necrotic membranes on the mucosa the c. perfringens isolated from broiler chickens (r. d. eraky and w. a. abd el-ghany) 3 as well as liver necrosis. the samples were aseptically collected in sterile plastic bags and quickly transported to the laboratory in ice-cooled containers for further microbiological examination. conventional isolation and identification sample processing was done according to a routine protocol as previously described by willis (1977). for enrichment, one gram of each of the intestinal contents or liver tissue samples was inoculated into tubes of freshly prepared robertson cooked meat broth (oxoid, uk) and incubated for 24 h at 37°c in a gas-pak anaerobic jar. aliquots of 0.1 ml were streaked onto a perfringens agar base containing 400 μg/ml of tryptose sulfite cycloserine (tsc) with egg emulsion (oxoid, uk) and incubated anaerobically. for the proliferation and detection of the hemolytic characteristics of clostridium isolates, 5% de-fibrinated sheep blood agar with neomycin sulphate (200 µg/ml) was prepared. after 2448 h incubation at 37°c, typical black colonies were selected and cultured onto de-fibrinated 5% sheep blood agar and egg yolk agar plates and incubated anaerobically for 24 h at 37°c (cruickshank et al., 1975). typical colonies on blood agar or egg yolk agar were further identified according to the morphological characteristics using gram staining and different biochemical tests, such as catalase, nitrate reduction, gelatinase, lecithinase, indole, oxidase, urease storm gas production on litmus milk medium, and fermentation of glucose, lactose, fructose, sucrose, and mannitol. molecular detection of the toxins and virulence genes dna extraction from suspected samples was performed using the qiaamp dna mini kit (qiagen, germany, gmbh) with modifications according to the manufacturer’s recommendations. briefly, 200 µl of the sample suspension was incubated with 10 µl of proteinase k and 200 µl of lysis buffer at 56°c for 10 min. after incubation, 200 µl of 100% ethanol was added to the lysate. the sample was then washed and centrifuged following the manufacturer’s recommendations. nucleic acid was eluted with 100 µl of elution buffer provided in the kit. primers provided by metabion (germany) are listed in table (2). multiplex polymerase chain reaction (pcr) was used for the detection of α, β, ε, and ι toxins. primers were utilized in a 50 µl reaction containing 25 µl of emerald amp max pcr master mix (takara, japan), 1 µl of each primer of 20 pmol concentration, 11 µl of water, and 6 µl of dna template. for uniplex pcr, primers were utilized in a 25 µl reaction containing 12.5 µl of emerald amp max pcr master mix (takara, japan), 1 µl of each primer of 20 pmol concentration, 5.5 µl of water, and 5 µl of dna template. all the reactions were performed in an applied biosystems 2720 thermal cycler. the products of pcr were separated by electrophoresis on 1.5% agarose gel (applichem, germany, gmbh) in 1x tbe buffer at room temperature using gradients of 5v/cm. for gel analytable 1. the number of the examined samples distributed in damietta governorate, egypt locality number of examined farms number of examined samples intestine liver kafer-saad 3 18 18 farskour 3 32 31 om el-reda 4 44 40 kafer el-batekh 2 19 9 cinania 1 11 11 kafer-elghabe 2 35 29 zarka 3 43 17 total 18 202 155 4 j. indonesian trop.anim.agric. 47(1):1-16, march 2022 sis, 40 µl of the multiplex pcr products and 15 µl of the uniplex pcr products were loaded in each gel slot. a gel pilot 100 bp ladder (qiagen, gmbh, germany) and gene ruler 100 bp ladder (fermentas, thermo, germany) were used to determine the fragment sizes. the gel was photographed using a gel documentation system (alpha innotech, biometra), and the data was analyzed through computer software. the antibiogram pattern the antimicrobial susceptibility testing of c. perfringens strains was done using the disc diffusion method developed by the national committee for clinical laboratory standards (nccls, 2007). the used chemotherapeutic agents discs (oxoid) and the inhibition zones (susceptible, intermediate susceptibility, and resistant) are shown in table (3). all c. perfringens strains were cultivated in cooked meat broth for 24 h, and then the culture broth was suspended into 0.85% nacl to obtain an optical density equal to macfarland 0.5 standards. after that, the strains were inoculated in 5% defibrinated sheep blood agar for 10 minutes and the antibiotic discs were dispersed in the agar plates. the plates were incubated anaerobically at 37°c overnight, and the inhibition zones were table 2. primers sequences, target genes, amplicon sizes and cycling conditions for c. perfringens. target toxin and virulen ce genes primers sequences amplifie d segment (bp) primary denaturation amplification (35 cycles) final extension reference secondary denaturation annealing extension α gttgatagcgcag gacatgttaag 402 94˚c 5 min. 94˚c 30 sec. 55˚c 40 sec. 72˚c 45 sec. 72˚c 10 min. yoo et al. (1997) catgtagtcatct gttccagcatc β actatacagacag atcattcaacc 236 ttaggagcagtta gaactacagac ε actgcaactacta ctcatactgtg 541 ctggtgccttaat agaaagactcc ι gcgatgaaaagcc tacaccactac 317 ggtatatcctcca cgcatatagtc netb gctggtgctggaa taaatgc 560 94˚c 5 min. 94˚c 30 sec. 58˚c 40 sec. 72˚c 45 sec. 72˚c 10 min. datta et al. (2014) tcgccattgagta gtttccc tpel atatagagtcaag cagtggag 466 94˚c 5 min. 94˚c 30 sec. 55˚c 40 sec. 72˚c 45 sec. 72˚c 10 min. bailey et al. (2013) ggaataccacttg atatacctg cpe acatctgcagata gcttaggaaat 247 94˚c 5 min. 94˚c 30 sec. 55˚c 30 sec. 72˚c 30 sec. 72˚c 7 min. kaneko et al. (2011) ccagtagctgtaa ttgttaagtgt plc ata gat act cca tat cat cct gct 283 94˚c 5 min. 94˚c 30 sec. 55˚c 30 sec. 72˚c 30 sec. 72˚c 7 min. akhi et al. (2015) the c. perfringens isolated from broiler chickens (r. d. eraky and w. a. abd el-ghany) 5 measured as recommended by the manufacturer. the pathogenicity test in broiler chickens the experiment was done according to the national regulations on animal welfare and institutional animal ethical committee (iaec). a total of 105 day-old cobb chicks were obtained from local hatcheries, and five birds were subjected on arrival to bacteriological examination to confirm the absence of c. perfringens. the chicks were reared on thoroughly cleaned and disinfected semi-closed houses and vaccinated using the standard protocol for vaccination. feed and water were given ad libitum. the ration was supplemented with 12% wheat to enhance the experimental induction of infection. the chicks were divided into two equal groups, each containing 50 birds. group (1) was the negative control non-challenged group and was inoculated with sterile phosphate buffered saline. each bird in group (2) was orally inoculated with a field mixture of eimeria oocysts in a dose of 1x10 3 sporulated oocysts/0.1ml of oocysts mixture at the age of 10 days. however, at the age of 20 days, each chick in group (2) was challenged orally with 1 ml of 24 hr broth culture containing 1.7×10 8 viable cells of the toxigenic strain of c. perfringens type a for four successive days (timbermont et al., 2009). all chicken groups were kept under observation for two weeks postchallenge (pc) to monitor the clinical picture. results and discussion c. perfringens is a widely distributed bacterium in the environment and is mostly found in the intestinal tracts of humans and domestic animals (kiu and hall, 2018). the organism is a major enteric pathogen that can lead to both clinical (long and truscott, 1976) and subclinical diseases (lovland and kaldhusdal, 2001). the pathogen is responsible for causing ne in poultable 3. the interpretation of c. perfringens antibiogram pattern antibiotic disc (code) disc content/ µg interpretation (diameter of the zone/ mm) susceptible ≥ intermediate susceptibility resistant ≤ amoxycillin/clavulanic acid (amc) 20/10 18 14-17 13 neomycin (ne) 10 17 16 doxycycline (do) 30 16 13-15 12 erythromycin (e) 15 21 16-20 15 nalidixic acid (na) 30 19 14-18 13 penicillin (p) 10 22 23 ciprofloxacin (cip) 5 21 16-20 15 gentamycin (cn) 10 15 13-14 12 levofloxacin (lev) 5 17 14-16 13 ceftriaxone (ces) 30 28 24-27 23 table 4. the incidence rate and the type of c. perfringens in damietta governorate, egypt age of chicken/week intestine liver no. of samples no. of positive % positive no. of samples no. of positive % positive no. of examined farms 1-2 62 2 3.2 47 0 0 5 2-3 56 15 26.8 48 3 6.3 10 3-4 45 13 28.9 39 2 5.1 12 4-8 39 11 28.9 21 1 4.8 8 total 202 41 20.3 155 6 3.8 18 6 j. indonesian trop.anim.agric. 47(1):1-16, march 2022 try, especially c. perfringens type a, which is the most frequently isolated clostridial type (opengart, 2008). based on the cultural, morphological, and biochemical characteristics of the isolates, 20.3% and 3.8% c. perfringens isolates were recovered from 202 intestine and 155 liver samples, respectively, from freshly dead broiler chickens in damietta governorate (table 4). morphologically, c. perfringens isolates grew anaerobically and produced double zones of hemolysis (an inner zone of complete hemolysis and an outer zone of discoloration and incomplete hemolysis) on 5% sheep blood agar with neomycin sulfate (figure 1). however, c. perfringens isolates on tsc showed black colonies due to the reduction of sulfite to sulfide, which in turn reacts with iron and forms a black iron sulfide precipitate (figure 2). a zone of opalescence appeared around the c. perfringens colonies on egg yolk agar plates. microscopically, c. perfringens isolates revealed gram-positive, non-motile, and spore-forming large-sized bacilli. biochemically, all c. perfringens isolates were positive for nitrate reduction and lecithinase activity (figure 3), but they were negative for catalase, indole production, and oxidase. the isolates produced typical stormy fermentation reaction in litmus milk medium. manfreda et al. (2006) isolated c. perfringens from broiler farms with a rate over 90% and found c. perfringens in 87 out of 149 samples (58.40%). however, the lowest frequency of isolated c. perfringens was reported by kalender and ertas (2005) who showed that only 5% of the intestinal contents were positive for c. perfringens. in egypt, hussein and mustfa (1999) demonstrated 30 isolates of c. perfringens out of 60 intestinal samples (50%) in 4-6-week-old broiler chickens in assiut governorate, while ebtehal (2000) found that out of 470 broiler chicken samples, 231 (71.9%) strains of c. perfringens could be isolated in assiut and el-minia governorates. this high incidence was not surprising if the spread of the microorganisms in the environment, diet, water, litter, and slaughtering houses was considered. other egyptian studies reported isolation of c. perfringens from the intestines of both apparently healthy and diseased broiler chickens with high rates of 42.0% and 91.3%, respectively (el-refaey et al., 1999); 30% and 75%, respectively (rasha, 2009); and 35.4% and 100%, respectively (osman et al., 2012). moreover, c. perfringens figure 1. colonies of c. perfringens on 5% sheep blood agar with neomycin sulfate showing double zones of β hemolysis (inner zone of complete hemolysis and outer zone partial hemolysis). figure 2. colonies of c. perfringens on tryptose sulfite cycloserin (tsc) showing black colonies. figure 3. lecithinase activity of c. perfringens on egg yolk agar (lecithinase: α toxin phospholipase hydrolyzes phospholipids in egg yolk agar around streaks). the c. perfringens isolated from broiler chickens (r. d. eraky and w. a. abd el-ghany) 7 was isolated from the intestines of chickens with ne with incidence rates of 47.70% (el-rash, 2012) and 60% (eman et al., 2013). out of 120 intestine and liver samples taken from diseased broiler chickens, ei-jakee et al. (2013) isolated 90 (75%) c. perfringens with an incidence rate of 53.8%. multiplex pcr showed that c. perfringens strains belonged to type a as they contained the cpa gene (402 bp) that coded for α toxin and the cpb (236 bp), etx (541 bp), and ia (317 bp) genes that coded for β, ε, and ι. toxins, respectively (figure 4). molecular detection of the virulence genes of c. perfringens type a strains showed the presence of the netb, tpel, cpe, and plc genes in all isolated strains (figures 5 and 6). the pcrbased detection of α toxin is essential for the typical identification of α toxigenic c. perfringens strains (baums et al., 2004). several clostridia enteric diseases occur in poultry, but probably the most common and severe one is ne, caused by c. perfringens type a (moore, 2015). in sweden, engstrom et al. (2003) demonstrated that all c. perfringens strains were classified as type a without enterotoxin genes. furthermore, in finland, heikinheimo and korkeala (2005) showed that 118 poultry isolates of c. perfringens were classified as type a strains using multiplex pcr. in a belgian study, five out of 63 c. perfringens isolates were β2 toxin-positive, and the authors indicated that this type of toxin is not an essential virulence factor in the development of ne in poultry (gholamiandekhordi et al., 2006). it is well known that c. perfringens type a induces intestinal mucosal damage in chickens (moore, 2015). the α toxin producing c. perfringens is phospholipase c sphingomyelinase that hydrolyzes lecithin into phosphorylcholine and diglyceride and as a consequence induces the production of inflammatory mediators causing blood vessel contraction, platelet aggregation, myocardial dysfunction, and finally acute death (matsuda et al., 2019). detection of c. perfringens toxin types and subtypes is critical for a better understanding of the epidemiology of c. perfringens infection and may be helpful in the implementation of effective preventive measures (fancher et al., 2021). in this study, the presence of eight toxin genes (cpa, cpb, etx, ia, netb, tpel, plc, and cpe) of c. perfringens type a isolates has been investigated. figure 4. pcr amplification using clostridium genus -specific primers for toxins (α, β, ε and ι), p= positive control, l= ladder, lines 6-9 = c. perfringens type a strains, n= negative control. figure 5. pcr amplification using c. perfringens genus-specific primers (cpe and plc genes), p= positive control, l= ladder, lines 1-4 = cpe and plc genes of c. perfringens, n= negative control. figure 6. pcr amplification using c. perfringens genus-specific primers (tpel and netb genes), p= positive control, l= ladder, lines 1-4 = tpel and netb genes genes of c. perfringens, n= negative control. 8 j. indonesian trop.anim.agric. 47(1):1-16, march 2022 the results revealed the presence of netb, tpel, plc, and cpe genes. this result confirms high production of toxins that lead to the destruction of the intestinal mucosa and consequently the development of ne (mwangi et al., 2019). similar findings were reported by ebtehal (2000) who indicated the role of toxigenic c. perfringens in the production of toxins that lead to ne in poultry. in addition, c. perfringens strains possess other common virulence genes (netb) producing β toxin (yang et al., 2018). since the discovery of this new virulence factor, the presence of the netb gene in c. perfringens strains has been investigated in different regions of the world. the results indicated the existence of this gene in c. perfringens type a strains. johansson et al. (2010) reported that more than 90% of all isolates from cases of ne carried the netb gene. through the examination of 36 isolates of c. perfringens, 19 (52.8%) isolates showed presence of the netb gene (tolooe et al., 2011). a previous study of miwa et al. (1998) demonstrated that strains of c. perfringens that were netbnegative failed to cause disease in an experimental model, whereas all netb-positive strains produced typical lesions of ne. in addition, it has been found that netb, a pore-forming toxin, plays a role in the pathogenesis of ne in poultry as a strongly necrotizing and lethal toxin (keyburn et al., 2010; wade et al., 2020). native and recombinant netb were cytotoxic for chicken hepatocytes. the netb gene is mostly found in outbreaks of ne but is relatively uncommon in healthy birds (tolooe et al., 2011). however, several studies demonstrated the absence of the netb gene in c. perfringens isolates (datta et al., 2014; li et al., 2018; zhang et al., 2019). furthermore, all c. perfringens type a strains of avian origin possess phospholipase c (plc) or the cpa gene that produces α toxin (abildgaard et al., 2009). this gene has also been discovered in strains of human origin (matsuda et al., 2019). moreover, kimy et al. (2017) classified c. perfringens as a toxin type a based on the presence of the α toxin gene (plc). isolates of c. perfringens that have α toxins as well as enterotoxin (cpe) are regarded as type f. enterotoxin (cpe) is produced by about 1%5% of c. perfringens type a. this toxin is a single polypeptide chain of about 35 kda and, unlike other toxins, is released upon lysis of the mother cell in the sporulation stage (abildgaard et al., 2010). previous studies showed that there is a relationship between c. perfringens type a isolates that carry the cpe gene and foodborne infection (miyamoto et al., 2012) as well as nonfoodborne gastrointestinal diseases (azimirad et a a b figure 7. a: the intestine is filled with blood (hemorrhagic enteritis) and distended with gases. b: the caecum is filled with blood (hemorrhagic typhlitis). the c. perfringens isolated from broiler chickens (r. d. eraky and w. a. abd el-ghany) 9 al., 2019). the findings of this study showed that c. perfringens isolates carry the cpe gene which is similar to the findings of other studies (asaoka et al., 2004). the authors suggested that cpe plays a role in intestinal necrosis with minor intestinal damage, allowing the multiplication of c. perfringens and consequently development of the disease. periodic evaluation of c. perfringens antimicrobial susceptibility testing is important to avoid the losses resulting from this infection (finken and wages, 1997). in 47 c. perfringens strains, the in vitro sensitivity test revealed high susceptibility to levofloxacin and gentamycin (100%) as well as ciprofloxacin (85.1%). low degree of susceptibility to doxycycline and erythromycin (25.5%), in addition to neomycin (23.4%), was reported. resistance to penicillin, nalidixic acid, and ceftriaxone was 100%, while resistance to amoxycillin/clavulanic acid was 72.3% (table 5). nearly similar antibiotic sensitive patterns were observed by mehtaz et al. (2013) who found that c. perfringens isolates were sensitive to some fluoroquinolones, such as ciprofloxacin and ofloxacin. however, these results are inconsistent with those reported by hussein and mostfa (1999) who stated that neomycin was highly effective but enrofloxacin was not effective against c. perfringens. algammal and elfeil (2015) reported 100% resistance of c. perfringens to neomycin, which is commonly used as an antimicrobial drug to treat bacterial enteritis in poultry. in this study, c. perfringens isolates showed resistance to nalidixic acid and amoxicillin, similar to the results reported by another study (camacho et al., 2008). nevertheless, another study demonstrated a high level of sensitivity to penicillin (algammal and elfeil, 2015). clinical signs observed among c. perfringens-challenged chicks in the challenged group were depression, ruffled feathers, decreased appetite, and diarrhea. mortalities were observed at 48 hr pc at a rate of 43.3%. no clinical signs or mortalities were observed in control birds that were inoculated with phosphate buffered saline. the intestines of dead and sacrificed chickens at the end of the observation period were filled with blood (hemorrhagic enteritis) and distended with gases (figure 7 a), and the caecum was filled with blood (hemorrhagic typhlitis) (figure 7 b). enlargement, paleness, and necrosis of the liver were also observed (figure 8). the pathogenesis of c. perfringens infection figure 8. enlarged and pale liver with necrotic foci. 10 j. indonesian trop.anim.agric. 47(1):1-16, march 2022 involves the colonization of the tissue’s host, acquisition of nutrients to allow more multiplication, dodging of the immune system of the host, and finally transmission of toxins with tissue damage (prescott et al., 2016). the presence of some risk factors associated with c. perfringens challenge enhances the development of ne clinical infection. some predisposing factors, such as eimeria species and the use of wheat and barley, are important for the induction of ne (kocher, 2003). moreover, c. perfringens infection was significantly higher in the presence of stress factors, such as worm infestation or coccidiosis (mateos et al., 2002). it has been found that eimeria species colonize the bird’s intestinal tract, causing damage and releasing plasma proteins which is the minimal requirements for growth of c. perfringens include more than 11 amino acids, besides many growth factors and vitamins (hofacre et al., 2003). moreover, lovland et al. (2004) reported that c. perfringens type a causes mucosal damage in the intestines of chickens. regarding the pathogenicity test in broiler chicks using c. perfringens strains, the results revealed general signs with variable degrees of diarrhea, mortalities (43.3%), and intestinal and liver lesions. similar observations were reported in previous studies (freedman et al., 2015; thi et al., 2021). lovland and kaldhusdal (2001) found that ne can present as an acute clinical disease characterized by sudden high mortality rates that can reach 50% in flocks. moreover, ebtehal (2000) found that c. perfringens given orally to chicks caused 80% mortality. similar intestinal lesions were also reported in previous studies (park et al., 2015; to et al., 2017; abdul-aziz and barnes, 2018). they mentioned that infected chickens with ne showed intestinal lesions ranging from thin and friable walls to frank hemorrhagic enteritis along with gas distension. in addition, necrotic lesions present on the liver of chickens after c. perfringens challenge were the same as the lesions reported by lovland and kaldhusdal (2001), sasaki et al. (2003), and thi et al. (2021). conclusion continuous and periodical surveillance studies should be conducted to alleviate the severe economic losses caused by c. perfringens infection in broiler chicken flocks. detection of the sensitivity of the bacterium to different antibiotics is a must before developing successful control and treatment strategies. future studies on the preparation of bacterin to prevent such infection are needed. reference abdul-aziz, t and h.j. barnes. 2018. necrotic enteritis. in gross pathology of avian diseases: text and atlas (pp.50–52). madison, wi: omnipress. abildgaard, l., t.e. sondergaard and r.m. engberg. 2010. in vitro production of necrotic enteritis toxin b, netb, by netb positive and netb-negative clostridium perfringens originating from healthy and diseased broiler chickens. vet. microbiol. 144:231–235. https://doi.org/10.1016/ j.vetmic.2009.12.036 abildgaard, l., r.m. engberg, k. pedersen, a. schramm and o. hojberg. 2009. sequence variation in the alpha-toxin encoding plc gene of clostridium perfringens strains isolated from diseased and healthy chickens. vet. microbiol. 136:293–299. https://doi.org/10.1016/ j.vetmic.2008.11.001 akhi, m.t., s.b. asl, t. pirzadeh, b. naghili, f. yeganeh, y. memar and y. mohammadzadeh. 2015. antibiotic sensitivity of clostridium perfringens isolated from faeces in tabriz, iran. jundishapur j. microbiol. 8 (7):e20863. https://doi.org/10.5812/ jjm.20863v2 algammal, a.m. and w.m. elfeil. 2015. pcr based detection of alpha toxin gene in clostridium perfringens strains isolated from diseased broiler chickens. benha vet. med. j. 229(2):333–338. https:// dx.doi.org/10.21608/bvmj.2015.31744 asaoka, y., t. yanai and h. hirayama. 2004. https://doi.org/10.1016/j.vetmic.2009.12.036 https://doi.org/10.1016/j.vetmic.2009.12.036 https://doi.org/10.1016/j.vetmic.2008.11.001 https://doi.org/10.1016/j.vetmic.2008.11.001 https://doi.org/10.5812/jjm.20863v2 https://doi.org/10.5812/jjm.20863v2 https://dx.doi.org/10.21608/bvmj.2015.31744 https://dx.doi.org/10.21608/bvmj.2015.31744 the c. perfringens isolated from broiler chickens (r. d. eraky and w. a. abd el-ghany) 11 fatal necrotic enteritis associated with clostridium perfringens in wild crows (corvus macrorhynchos). avian pathol. 33(1):19– 24. https:// doi.org/10.1080/03079450310001636228 azimirad, m., f. gholami, a. yadegar, d.r. knight, s. shamloei, h.a. aghdaei and m.r. zali. 2019. prevalence and characterization of clostridium perfringens toxinotypes among patients with antibioticassociated diarrhea in iran. sci. rep. 9: 7792. https://doi.org/10.1038/s41598-01944281-5 bailey, m.a., k.s. macklin and j.t. krehling. 2013. use of a multiplex pcr for the detection of toxin-encoding genes netb and tpel in strains of clostridium perfringens. isrn vet. sci. 11:865702. https:// dx.doi.org/10.1155%2f2013%2f865702 baums c.g., u. schotte, g. amtsberg and r. goethe. 2004. diagnostic multiplex pcr for toxin genotyping of clostridium perfringens isolates. vet. microbiol. 100(12):11–16. https://doi.org/10.1016/s03781135(03)00126-3 camacho, n., c. espinoza, c. rodriguez and e. rodriguez. 2008. isolates of clostridium perfringens recovered from costa rican patients with antibiotic-associated diarrhoea are mostly enterotoxin-negative and susceptible to first-choice antimicrobials. j. med. microbiol. 57(3):343–347. https:// doi.org/10.1099/jmm.0.47505-0 canard, b., t. garnier, b. saint-joanis and s.t. cole. 1989. molecular genetic analysis of the nagh gene encoding a hyaluronidase of clostridium perfringens. mol. gen. genet. 243:215–224. https://doi.org/10.1007/ bf00280319 cooper, k.k. and j.g. songer. 2009. necrotic enteritis in chickens, a paradigm of enteric infection by clostridium perfringens type a. anaerobe, 15(1-2):55–60.https:// doi.org/10.1016/j.anaerobe. 2009.01.006 cooper, k.k., j.g. songer, and f.a. uzal. 2013. diagnosing clostridial enteric disease in poultry. j. vet. diagn. invest. 25(3): 314– 327. https:// doi.org/10.1177/1040638713483468 coursodon, c.f., r.d. glock, k.l. moore, k.k. cooper and j.g. songer. 2012. tpelproducing strains of clostridium perfringens type a are highly virulent for broiler chicks. anaerobe, 18(1):117–121. https://doi.org/10.1016/ j.anaerobe.2011.10.001 craven, s.e., n.a. cox, j.s. bailey and d.e. cosby. 2003. incidence and tracking of clostridium perfringens through an integrated broiler chicken operation. avian dis. 47(3):707–711. https:// doi.org/10.1637/6010 cruickshank, r., j.p. duguid, b.r. marmion and r.h.a. swain. 1975. medical microbiology. (12 th eds). edinburgh: churchill livingstone. p. 812–825. dahiya, j.p., d.c. wilkie, a.g. van kessel and m.d. drew. 2006. potential strategies for controlling necrotic enteritis in broiler chickens in post-antibiotic era. anim. feed sci. technol. 129(1-2): 60–88. https:// doi.org/10.1016/j.anifeedsci.2005.12.003 datta, s., n.k. rakha, g. narang, d. arora and n.k. mahajan. 2014. prevalence of α, ß and netb toxin producing strains of clostridium perfringens in broiler chickens in haryana. haryana vet. 53(1):39–42. duff a.f., c.n. vuong, k.l. searer, w.n. briggs, k.m. wilson, b.m. hargis, l.r. berghman and l.r. bielke. 2019. preliminary studies on development of a novel subunit vaccine targeting clostridium perfringens mucolytic enzymes for the control of necrotic enteritis in broilers. poult. sci. 98:6319–6325. http:// dx.doi.org/10.3382/ps/pez448 ebtehal, m.m. 2000. studies on intestinal clostridial infections in broiler chicken. m.v.sc. thesis. faculty of veterinary medicine, assiut university, egypt. el-rash, amal, n. 2012. studies on clostridium perfringens in laying hens. m.v.sc. thesis. faculty of veterinary medicine, cairo university, egypt. https://doi.org/10.1080/03079450310001636228 https://doi.org/10.1080/03079450310001636228 https://doi.org/10.1038/s41598-019-44281-5 https://doi.org/10.1038/s41598-019-44281-5 https://dx.doi.org/10.1155%2f2013%2f865702 https://dx.doi.org/10.1155%2f2013%2f865702 https://doi.org/10.1016/s0378-1135(03)00126-3 https://doi.org/10.1016/s0378-1135(03)00126-3 https://doi.org/10.1099/jmm.0.47505-0 https://doi.org/10.1099/jmm.0.47505-0 https://doi.org/10.1007/bf00280319 https://doi.org/10.1007/bf00280319 https://doi.org/10.1177/1040638713483468 https://doi.org/10.1177/1040638713483468 https://doi.org/10.1016/j.anaerobe.2011.10.001 https://doi.org/10.1016/j.anaerobe.2011.10.001 https://doi.org/10.1637/6010 https://doi.org/10.1637/6010 https://doi.org/10.1016/j.anifeedsci.2005.12.003 https://doi.org/10.1016/j.anifeedsci.2005.12.003 http://dx.doi.org/10.3382/ps/pez448 http://dx.doi.org/10.3382/ps/pez448 12 j. indonesian trop.anim.agric. 47(1):1-16, march 2022 el-refaey, t.m. 1999. bacteriological studies on clostridium microorganisms in poultry. m.v. sc. thesis. faculty of veterinary medicine, cairo university, egypt. elsharkawy, a.s., d. talat, a.s. elnaggar and m.s. ibrahim. 2020. detection of clostridium perfringens and their virulence toxins in broiler chicken. europ. j. pharmaceut. med. res. 7(1):78–83. ei-jakee, j., s.a. nagwa, a. mona, s.m.a. azza, h.h. riham, n.m. shawky and h.m. shawky 2013. characterization of clostridium perfringens isolated from poultry. global veterinaria 11(1): 88–94. eman a.k., m.d. sohad, m.a. bakry and a.s. hakim. 2013. molecular diversity of alpha toxin produced by clostridium perfringens strains causing avian necrotic enteritis. world appl. sci. j. 21(1):15–20. engstrom, b.e., c. fermer, a. lindberg, e. saarinen, v. baverud and a. gunnarsson. 2003.molecular typing of isolates of clostridium perfringens from healthy and diseased poultry. vet. microbiol. 94(3): 225– 235. https://doi.org/10.1016/s0378-1135 (03)00106-8 fancher c.a., h.t. thames, m.g. colvin, l. zhang, n. nuthalapati, a. kiess, t.t.n. dinh and a.t. sukumaran. 2021. prevalence and molecular characteristics of clostridium perfringens in “no antibiotics ever” broiler farms. poult. sci. 100(11): 101414. https://doi.org/10.1016/ j.psj.2021.101414 finken, m.d. and wages, d. 1997. necrotic enteritis. in: diseases of poultry. (y.m. saif, b.w. calnek, h.j. barnes, c.w. beard, l.r. mcdougald, and y.m. said, 10th ed). iowa state university press. london. pp. 261–264. freedman, j.c., j.r. theoret, j.a. wisniewski, f.a. uzal, j.i. rood and b.a. mcclanea. 2015. clostridium perfringens type a-e toxin plasmids. res. microbiol. 166(4):264 –279. https://dx.doi.org/10.1016% 2fj.resmic.2014.09.004 gao, z. and b.a. mcclane. 2012. use of clostridium perfringens enterotoxin and the enterotoxin receptor-binding domain (ccpe) for cancer treatment: opportunities and challenges. j. toxicol. 2012: 981626. https://doi.org/10.1155/2012/981626 gholamiandekhordi, a.r., r. ducatelle, m. heyndrickx, f. haesebrouck and f. van immerseel.2006. molecular and phenotypical characterization of clostridium perfringens isolates from poultry flocks with different disease status. vet. microbiol. 113(1-2):143–152. https:// doi.org/10.1016/j.vetmic.2005.10.023 goossens, e., e. dierick, r. ducatelle and f. van immerseel. 2020. spotlight on avian pathology: untangling contradictory disease descriptions of necrotic enteritis and necrohaemorrhagic enteritis in broilers. avian pathol. 49(5): 423–427. https:// doi.org/10.1080/03079457.2020.1747593 gu, c., h.s. lillehoj, z. sun, y. lee, h. zhao, z. xianyu, x. yan, y. wang, s. lin, l. liu and c. li. 2019. characterization of virulent netb+/tpel+clostridium perfringens strains from necrotic enteritis– affected broiler chicken farms. avian dis. 63: 461–467. https://doi.org/10.1637/11973 -092018-reg.1 heikinheimo, a. and h. korkeala. 2005. multiplex pcr assay for toxinotyping clostridium perfringens isolates obtained from finnish broiler chickens. lett. appl. microbiol. 40(6): 407–411. https:// doi.org/10.1111/j.1472-765x.2005.01702.x helal, s.s., n.m. khalaf, a.a. el menisy and m.a. lebdah. 2019. clostridium perfringens type a causing necrotic enteritis outbreaks among chickens in egypt. zagazig vet. j. 47(4): 398–407. https:// dx.doi.org/10.21608/zvjz.2019.14139.1055 henry, c.w., b.d. murphy and r.a. norton. 1995. incidence of clostridia [sic] perfringens on commercial broiler farms with a history of necrotic enteritis. poult. sci. 74(1): 51. hofacre, c.l., t. beacorn, s. collett and g. mathis. 2003. using competitive exclusion, https://doi.org/10.1016/s0378-1135(03)00106-8 https://doi.org/10.1016/s0378-1135(03)00106-8 https://doi.org/10.1016/j.psj.2021.101414 https://doi.org/10.1016/j.psj.2021.101414 https://dx.doi.org/10.1016%2fj.resmic.2014.09.004 https://dx.doi.org/10.1016%2fj.resmic.2014.09.004 https://doi.org/10.1155/2012/981626 https://doi.org/10.1016/j.vetmic.2005.10.023 https://doi.org/10.1016/j.vetmic.2005.10.023 https://doi.org/10.1080/03079457.2020.1747593 https://doi.org/10.1080/03079457.2020.1747593 https://doi.org/10.1637/11973-092018-reg.1 https://doi.org/10.1637/11973-092018-reg.1 https://doi.org/10.1111/j.1472-765x.2005.01702.x https://doi.org/10.1111/j.1472-765x.2005.01702.x https://dx.doi.org/10.21608/zvjz.2019.14139.1055 https://dx.doi.org/10.21608/zvjz.2019.14139.1055 the c. perfringens isolated from broiler chickens (r. d. eraky and w. a. abd el-ghany) 13 mannanoligosaccharide and other intestinal products to control necrotic enteritis. j. appl. poult. res. 12: 60–64. hussein, s.z. and f.a. mustfa. 1999. necrotic enteritis in broiler chicken in assiut governorate. assiut vet. med. j. 41(82):239– 246. johansson, a., a. aspan, m. kaldhusdal and b.e. engstrom. 2010. genetic diversity and prevalence of netb in clostridium perfringens isolated from a broiler flock affected by mild necrotic enteritis. vet. microbiol. 144(1-2):87–92. https:// doi.org/10.1016/j.vetmic.2009.12.017 kalender, h. and h.b. ertas. 2005. isolation of clostridium perfringens from chickens and detection of the alpha toxin gene by polymerase chain reaction (pcr). turk. j. vet. anim. sci. 29:847–851. kaneko, i., k. miyamoto, k. mimura, n. yumine, h. utsunomiya, s. akimoto and b.a. mcclane. 2011. detection of enterotoxigenic clostridium perfringens in meat samples by using molecular methods. appl. environ. microbiol. 77(21):7526–7532. https://dx.doi.org/10.1128%2faem.06216 -11 keyburn, a.l., x.x. yan, t.l. bannam, f. van immerseel, j.i. rood and r.j. moore. 2010. association between avian necrotic enteritis and clostridium perfringens strains expressing netb toxin. vet. res. 41(2):21– 21. https://doi.org/10.1051/vetres/2009069 kimy, b.y., j.y. kim, c. lee, j. kwon, j. kang, j.k. rhee, m.s. jeong, d. young, y.d. nam and s.w. roh. 2017. complete genome sequence of clostridium perfringens cba7123 isolated from a faecal sample from korea. gut pathog. 9: 32. https://doi.org/10.1186/s13099-017-0181-1 kiu, r and l.j. hall. 2018. an update on the human and animal enteric pathogen clostridium perfringens. emerg. microbes infect. 7: 141. https://dx.doi.org/10.1038% 2fs41426-018-0144-8 kocher, a. 2003. nutritional manipulation of necrotic enteritis outbreak in broilers. recent adv. anim. nutri. australia, 14:111– 116. kumar, n.p., n.v. kumar and a. karthik. 2019. molecular detection and characterization of clostridium perfringens toxin genes causing necrotic enteritis in broiler chickens. trop. anim. health prod. 51(6):1559– 1569. https://doi.org/10.1007/s11250-01901847-9 li, j., v. adams, t.l. bannam, k. miyamoto, j.p. garcia and a. francisco. 2013. toxin plasmids of clostridium perfringens. microbiol. mol. biol. rev. 77(2):208–233. https:// doi.org/10.1128/mmbr.00062-12 li, j., d. paredes-sabja, m.r. sarker and b.a. mcclane 2016. clostridium perfringens sporulation and sporulation-associated toxin production. microbiol. 4(3):1–27. https:// doi.org/10.1128/microbiolspec. tbs-00222015 li, z., w. wang, d. liu and y. guo, 2018. effects of lactobacillus acidophilus on the growth performance and intestinal health of broilers challenged with clostridium perfringens. j. anim. sci. biotechnol. 9: 25. https://doi.org/10.1186/s40104-018-0243-3 long, j. and r. truscott. 1976. necrotic enteritis in broiler chickens. iii. reproduction of the disease. can. j. comp. med. 40(1): 53–59. lovland, a. and m. kaldhusdal 2001. severely impaired production performance in broiler flocks with high incidence of clostridium perfringens-associated hepatitis. avian pathol. 30(1):73–81. https:// doi.org/10.1080/03079450020023230 lovland, a., m. kaldhusdal, k. redhead, e. skjerve and a. lillehaug. 2004. maternal vaccination against subclinical necrotic enteritis in broilers. avian pathol. 33:83–92. https:// doi.org/10.1080/0379450310001636255 lukinmaa, s., e. takkunen and a. siitonen 2002. molecular epidemiology of clostridium perfringens related to food-borne outbreaks of disease in finland from 1984 to 1999. appl. environ. microbiol. 68(8):3744 –3749. https://dx.doi.org/10.1128% https://doi.org/10.1016/j.vetmic.2009.12.017 https://doi.org/10.1016/j.vetmic.2009.12.017 https://dx.doi.org/10.1128%2faem.06216-11 https://dx.doi.org/10.1128%2faem.06216-11 https://doi.org/10.1051/vetres/2009069 https://www.ncbi.nlm.nih.gov/pubmed/?term=kim%20yb%5bauthor%5d&cauthor=true&cauthor_uid=28588654 https://doi.org/10.1186/s13099-017-0181-1 https://dx.doi.org/10.1038%2fs41426-018-0144-8 https://dx.doi.org/10.1038%2fs41426-018-0144-8 https://doi.org/10.1007/s11250-019-01847-9 https://doi.org/10.1007/s11250-019-01847-9 https://doi.org/10.1128/mmbr.00062-12 https://doi.org/10.1128/mmbr.00062-12 https://doi.org/10.1128/microbiolspec https://doi.org/10.1128/microbiolspec https://doi.org/10.1186/s40104-018-0243-3 https://doi.org/10.1080/03079450020023230 https://doi.org/10.1080/03079450020023230 https://doi.org/10.1080/0379450310001636255 https://doi.org/10.1080/0379450310001636255 https://dx.doi.org/10.1128%2faem.68.8.3744-3749.2002 14 j. indonesian trop.anim.agric. 47(1):1-16, march 2022 2faem.68.8.3744-3749.2002 manfreda, g., v. bondioli, a. de cesare and franchini, a. 2006. quantitative evaluation of clostridium perfringens in italian broilers. poult. sci. 62: 91–99. mateos, g.g., r. lazaro and m.i. gracia. 2002. the feasibility of using nutritional modifications to replace drugs in poultry feed. j. appl. poult. res. 11(4): 437–452. https:// doi.org/10.1093/japr/ 11.4.437 matsuda, a., m.s. aung, m. kawaguchiya, a. sumi, m. nakamura, y. horino, m. ito, s.h. nobumichi and n. kobayashil. 2019. prevalence and genetic diversity of toxin genes in clinical isolates of clostridium perfringens: coexistence of alpha-toxin variant and binary enterotoxin genes (bec/ cpile). toxins (basel). 11(6): 326. https:// doi.org/10.3390/toxins11060326 mehtaz, s., p. borah, r.k. sharma and a. chakraborty. 2013. antibiogram of clostridium perfringens isolated from animals and foods. indian vet. j. 90(1):54–60. miwa, n., t. nishina, s. kubo, m. atsumi and h. honda. 1998. amount of enterotoxigenic clostridium perfringens in meat detected by nest pcr. int. j. food microbiol. 42(3):195–200. https://doi.org/10.1016/ s0168-1605(98)00082-8 miyamoto, k., j. li and b.a. mc clane. 2012. enterotoxigenic clostridium perfringens detection and identification. microbes environ. 27: 343–349. https:// dx.doi.org/10.1264%2fjsme2.me12002 moore, r.j. 2015. necrotic enteritis in chickens an important disease caused by clostridium perfringens. microbiol. aust. 36(3):118– 119. moore, r.j. 2016. necrotic enteritis predisposing factors in broiler chickens. avian pathol. 45(3):275–281. https:// doi.org/10.1080/03079457.2016.1150587 mwangi, s., j. timmons, s. fitz-coy and s. parveen. 2019. characterization of clostridium perfringens recovered from broiler chicken affected by necrotic enteritis. poult. sci. 98(1):128–135. https:// doi.org/10.3382/ps/pey332 national committee for clinical laboratory standards (nccls) 2007. performance standards for antimicrobial susceptibility testing; fifteenth informational supplement according to clsi. clsi document m100-s15. clinical and laboratory standards institute, wayne, pa. opengart, k. 2008. necrotic enteritis. (y. saif, a.m. fadly, j.r. glisson, l.r. mcdougald, l.k. nolan and d.e. swayne eds). diseases of poultry. 12th ed. iowa, usa: iowa state university press. p. 872–879. osman, k.m., y.a. soliman, z.m.s. amin and m. aly. 2012. prevalence of clostridium perfringens type a isolates in commercial broiler chickens and parent broiler breeder hens in egypt. rev. sci. tech. 31(3): 931– 941. https://doi.org/10.20506/rst.31.3.2169 park, j.y., s. kim, j.y. oh, h.r. kim, i. jang and h.s. lee. 2015. characterization of clostridium perfringens isolates obtained from 2010 to 2012 from chickens with necrotic enteritis in korea. poult. sci., 94(6): 1158–1164. https://doi.org/10.3382/ps/ pev037 parish, we. 1961. necrotic enteritis in fowl (gallus gallus domesticus). histopathology of the disease and isolation of strain of clostridium welchii. j. comp. pathol. 71:377–393. prescott, j.f., v.r. parreira, i. mehdizadeh gohari, d. lepp and j. gong 2016. the pathogenesis of necrotic enteritis in chickens: what we know and what we need to know: a review. avian pathol. 45: 288–294. https:// doi.org/10.1080/03079457.2016.1139688 profeta, f., c.e. di francesco, a. di provvido, m. scacchia, a. alessiani, e. di giannatale, g.marruchella, m. orsini, t. toscani and f. marsilio. 2020. prevalence of netbpositive clostridium perfringens in italian poultry flocks by environmental sampling. j. vet. diagn. invest. 32: 252–258. https:// doi:10.1177/1040638719885841 rasha, m. 2009. studies on clostridial microorhttps://dx.doi.org/10.1128%2faem.68.8.3744-3749.2002 https://doi.org/10.1093/japr/ https://doi.org/10.1093/japr/ https://www.ncbi.nlm.nih.gov/pmc/articles/pmc6628447/ https://doi.org/10.3390/toxins11060326 https://doi.org/10.3390/toxins11060326 https://doi.org/10.1016/s0168-1605(98)00082-8 https://doi.org/10.1016/s0168-1605(98)00082-8 https://dx.doi.org/10.1264%2fjsme2.me12002 https://dx.doi.org/10.1264%2fjsme2.me12002 https://doi.org/10.1080/03079457.2016.1150587 https://doi.org/10.1080/03079457.2016.1150587 https://doi.org/10.3382/ps/pey332 https://doi.org/10.3382/ps/pey332 https://doi.org/10.20506/rst.31.3.2169 https://doi.org/10.3382/ps/pev037 https://doi.org/10.3382/ps/pev037 https://doi.org/10.1080/03079457.2016.1139688 https://doi.org/10.1080/03079457.2016.1139688 https://doi:10.1177/1040638719885841 https://doi:10.1177/1040638719885841 the c. perfringens isolated from broiler chickens (r. d. eraky and w. a. abd el-ghany) 15 ganisms’ infection in poultry and trials for vaccination. m. v. sc. thesis. faculty of veterinary medicine, minufiya university, egypt. rood, j. i., a.l. keyburn and r.j. moore. 2016. netb and necrotic enteritis: the hole movable story, avian pathol. 45 (3):295–301. https:// doi.org/10.1080/03079457.2016.1158781 rood, j. i., v. adams, j. lacey, d. lyras, b.a. mcclane, s.b. melville, r.j. moore, m.r. popoff, m.r. sarker and j.g. songer. 2018. expansion of the clostridium perfringens toxin-based typing scheme. anaerobe 53:5– 10. https://doi.org/10.1016/ j.anaerobe.2018.04.011 sasaki, j., m. goryo, m. makara, k. nakamura and k. okada. 2003. necrotic hepatitis due to clostridium perfringens infection in newly hatched broiler chicks. j. vet. med. sci. 65(11):1249–1251. https:// doi.org/10.1292/jvms.65.1249 skinner, j.t., s. bauer, v. young, g. pauling and j. wilson. 2010. an economic analysis of the impact of subclinical (mild) necrotic enteritis in broiler chickens. avian dis. 54 (4): 1237–1240. https:// doi.org/10.1637/9399-052110-reg.1 thi, t.n., h. vu-khacorcid and t.n. duc. 2021. characterisation of clostridium perfringens isolated from chickens in vietnam. vet. med-czech. 66: 431–439. https:// doi.org/10.17221/209/2020-vetmed timbermont, l., a. lanckriet, a.r. gholamiandehkordi, f. pasmans, a. martel, f. haesebrouck, r. ducatelle and f. van immerseel, 2009. origin of clostridium perfringens isolates determines the ability to induce necrotic enteritis in broilers. comp. immunol. microbiol.infect. dis. 32 (6): 503–512. https://doi.org/10.1016/ j.cimid.2008.07.001 timbermont, l., f. haesebrouck, r. ducatelle and f. vanimmerseel. 2011. necrotic enteritis in broilers: an updated review on the pathogenesis. avian pathol. 40(4):341–347. https:// doi.org/10.1080/03079457.2011.590967 to, h., t. suzuki, f. kawahara, k. uetsuka, s. nagai, and t. nunoya. 2017. experimental induction of necrotic enteritis in chickens by a netb-positive japanese isolate of clostridium perfringens. j. vet. med. sci. 79: 350– 358. https://doi.org/10.1292/jvms.16-0500 tolooe, a., b. shojadoost, s.m. peighambar and y. tamaddon. 2011. prevalence of netb gene among clostridium perfringens isolates obtained from healthy and diseased chicks. j. anim. vet. adv. 10:106–110. van immerseel, f., j.i. rood, r.j. moore and r.w. titball. 2008. rethinking our understanding of the pathogenesis of necrotic enteritis in chickens. trends microbiol. 17 (1):32–36. https://doi.org/10.1016/ j.tim.2008.09.005 wade, b., a.l. keyburn, v. haring, m. ford, j.i. rood and r.j. moore. 2020. two putative zinc metalloproteases contribute to the virulence of clostridium perfringens strains that cause avian necrotic enteritis. j. vet. diagn. invest. 32: 259–267. https:// doi.org/10.1177/1040638719898689 wei, b., s.y. cha, j.f. zhang, k. shang, h.c. park, j. kang, k.j. lee, m. kang and h.k. jang. 2020. antimicrobial susceptibility and association with toxin determinants in clostridium perfringens isolates from chickens. microorganisms 8: 825. https:// doi.org/10.3390/ microorganisms8111825 willis, a.t. 1977. characteristics of the pathogenic and related clostridia. anaerobic bacteriology. clinical and laboratory practice. (3 rd eds). london. butterworth-heinemann. p. 370 wu, s.b., n. rodgers and m. choct. 2010. optimized necrotic enteritis model producing clinical and subclinical infection of clostridium perfringens in broiler chickens. avian dis. 54(3):1058–1065. https:// doi.org/10.1637/9338-032910-reg.1 yang, w.y., c.h. chou and c. wang. 2018. characterization of toxin genes and quantitative analysis of netb in necrotic enteritis (ne)-producing and non-ne-producing https://doi.org/10.1080/03079457.2016.1158781 https://doi.org/10.1080/03079457.2016.1158781 https://doi.org/10.1016/j.anaerobe.2018.04.011 https://doi.org/10.1016/j.anaerobe.2018.04.011 https://www.semanticscholar.org/author/k.-okada/47541965 https://doi.org/10.1292/jvms.65.1249 https://doi.org/10.1292/jvms.65.1249 https://doi.org/10.1637/9399-052110-reg.1 https://doi.org/10.1637/9399-052110-reg.1 https://doi.org/10.17221/209/2020-vetmed https://doi.org/10.17221/209/2020-vetmed https://doi.org/10.1016/j.cimid.2008.07.001 https://doi.org/10.1016/j.cimid.2008.07.001 https://doi.org/10.1080/03079457.2011.590967 https://doi.org/10.1080/03079457.2011.590967 https://doi.org/10.1292/jvms.16-0500 https://doi.org/10.1016/j.tim.2008.09.005 https://doi.org/10.1016/j.tim.2008.09.005 https://doi.org/10.1177/1040638719898689 https://doi.org/10.1177/1040638719898689 https://doi.org/10.3390/ https://doi.org/10.3390/ https://doi.org/10.1637/9338-032910-reg.1 https://doi.org/10.1637/9338-032910-reg.1 16 j. indonesian trop.anim.agric. 47(1):1-16, march 2022 clostridium perfringens isolated from chickens. anaerobe, 54: 115–120. https:// doi.org/10.1016/j.anaerobe.2018.08.010 yoo, h.s., s.u. lee, k.y. park and y.h. park. 1997. molecular typing and epidemiological survey of prevalence of clostridium perfringens types by multiplex pcr. j. clin. microbiol. 35(1):228–232. https:// doi.org/10.1128/jcm.35.1.228-232.1997 zhang, b., l. gan, m.s. shahid, z. lv, h. fan, d. liu and y. guo. 2019. in vivo and in vitro protective effect of arginine against intestinal inflammatory response induced by clostridium perfringens in broiler chickens. j. anim. sci. biotechnol. 10: 73. https://doi.org/10.1186/s40104-019-0371-4 https://doi.org/10.1016/j.anaerobe.2018.08.010 https://doi.org/10.1016/j.anaerobe.2018.08.010 https://doi.org/10.1128/jcm.35.1.228-232.1997 https://doi.org/10.1128/jcm.35.1.228-232.1997 ovarian response of dairy cows to progesterone combined on estrus synchronization using gnrh-pgf2α based protocol a. l. toleng, m. yusuf, hasbi and a. r. m. putri faculty of animal science, hasanuddin university, makassar 90245 indonesia corresponding e-mail: latief.toleng@yahoo.com received july 01, 2013; accepted august 26, 2013 abstrak penelitian ini bertujuan untuk mengevaluasi respon ovarium melalui perlakuan sinkronisasi berahi dengan menggunakan kombinasi gnrh dan pgf2α dengan progesteron pada sapi perah dengan sistim perkandangan diikat dalam kandang. sebanyak 20 ekor induk fh dengan tahapan siklus berahi yang berbeda digunakan dalam penelitian ini. ternak secara acak dibagi dalam dua kelompok perlakuan dengan dan tanpa cidr (controlled internal drug release). semua ternak diinjeksi 10 mg gnrh i.m pada awal perlakuan (h0) tanpa memperhatikan tahapan siklus berahi, diikuti penyuntikan 25 mg pgf2α i.m 7 hari kemudian. cidr dimasukkan secara intravagina pada kelompok perlakuan cidr saat injeksi gnrh dan dilepas pada saat injeksi pgf2α. tanda-tanda berahi diamati dua kali sehari dimulai pada hari kedua setelah perlakuan kecuali pada kelompok cidr, tanda-tanda berahi mulai diamati pada hari ke-8. sampel darah diambil pada semua ternak pada hari perlakuan gnrh, pgf2α dan hari ke-10 pelaksanaan perlakuan untuk mengetahui konsentrasi hormon progesteron. hasil penelitian ini menunjukkan bahwa 30% ternak pada perlakuan tanpa cidr menunjukkaan tanda-tanda berahi sebelum penyuntikan pgf2α. pemberian cidr dalam sinkronisasi berahi dengan gnrh-pgf2α mencegah terjadinnya berahi dini dan mempertahankan konsentrasi progesteron yang tinggi pada saat injeksi pgf2α. dapat disimpulkan bahwa pemberian cidr dalam sinkronisasi berahi khususnya dengan gnrh-pgf2α efektif menyinkronkan berahi pada ternak sapi perah dan mencegah terjadinya berahi dini. kata kunci: sapi perah, cidr, sinkronisasi berahi, ovarium, berahi dini abstract the objective of this study was to evaluate the response of ovaries in estrus synchronization protocol using gnrh-pgf2α based protocol combined progestin in a herd with tie-stall housing system. a total of 20 holstein friesian cows at different stages of estrus cycle in a dairy herd were enrolled in the present study. the cows were randomly allocated into two treatment groups; with and without cidr (controlled internal drug release) insertion. all cows received 100 µg of gnrh i.m. at the beginning of the treatment (d 0) without regard to the stages of the estrus cycle followed by 25 mg pgf2α im 7days later. cows in cidr group were inserted cidr into the vagina at the time of gnrh administration and were removed on the day of pgf2α administration. estrus signs were checked twice daily starting on day-2 after initiation of the protocol, except cows in cidr group the estrus signs were checked starting on day-8 of the protocol. the animals showing estrus signs were noted. blood samples were collected from all animals on the days of gnrh and pgf2α treatments and on day-10 after initiation of protocol for progesterone concentration. the results of this study showed that 30% animals in cows without cidr insertion showed estrus signs prior to pgf2α injection. involving cidr to synchronized estrus with gnrh-pgf2α based protocol avoided the occurrence of premature estrus and maintained high progesterone concentration on the day of pgf2α administration. it is concluded that ovarian response after involving cidr in the protocol for estrus synchronization especially using combination of gnrh and pgf2α were much effective to synchronize the initiation of estrus in dairy cows. likewise, the use of progesterone avoided premature estrus. keywords: dairy cows, cidr, synchronization of estrus, ovaries, premature estrus. 156 j.indonesian trop.anim.agric. 38(3) september 2013 introduction one of the problems in reproductive management for the cows in tie-stall housing system is a difficulty in detecting estrus accurately. this due to that estrus detection based on solely secondary estrus signs without any interaction among the animals to show primary estrus sign particularly standing estrus. on the other hand, to achieve high pregnancy rate in a dairy herd, it is necessary to detect estrus accurately and inseminated the cows timely with proven high quality sire. esslemont and kossaibati (2000) stated that to be a good fertility management, 95% cows in the herd after calving must be served by keeping the average calving to first service interval to less than 70 days, more than 55% overall heat detection rate, and 50% or more of pregnancy rate. requirements to achieve this target or high reproductive efficiency in the dairy herd are a disease-free transition period, high submission rates to ai, and high conception rate per service (roche et al., 2000). to avoid the difficulty of detecting estrus in the herd, estrus synchronization or estrus induction is a reproductive technology that commonly used to facilitate artificial insemination (ai). this technology has widely been used as an important tool for increasing ai submission rate in beef and dairy herds (macmillan and peterson, 1993; xu and burton, 1999; lucy et al., 2001) and to reduce the need for estrus detection (dejarnette et al., 2001). recently, the most commonly protocol used for synchronization of estrus is gnrh-pgf2α based-protocol. synchronization protocols that regulate follicular development with a gnrh injection 7 days prior to a luteolytic dose of pgf2α not only improve estrus detection rates and synchrony of estrus (wolfenson et al., 1994; twagiramungu et al., 1995), but also induce fertile estrus cycles in both cyclic and anestrus bovine females (stevenson et al., 2000). however, gnrh-pgf2α based-protocol for synchronizing estrus sometimes does not work properly resulting in premature estrus. this may be because of the increased odds of administering the first gnrh in the absence of a dominant follicle (haugian and wiltbank, 2002), leading to a low follicle turnover success and failure to induce a new follicular wave. as a consequence, corpus luteum (cl) is absent at the day of prostaglandin f2α (pgf2α) injection and estrus (premature estrus) and ovulation occurs around the day of pgf2α injection (dejarnette et al., 2001). to avoid this consequence, involving progestin in the protocol have often been used to increase the synchronized estrus (ambrosse et al., 2005; cavalieri et al., 2006; yusuf et al., 2010). therefore, the objective of this study was to evaluate the response of ovaries in estrus synchronization protocol using gnrh-pgf2α based protocol combined progestin (cidr=controlled internal drug release) in a herd with tie-stall housing system. materials and methods dairy cows and herd management this study was conducted in a dairy farm with a herd size of 44 cows and 14 of them were in lactation. cows in the herd were housed in tiestall barns. the cows were milked once daily in the morning time at approximately from 6:00 to 7:00 am. feedstuffs consisted of napier grass or rice straw, concentrate, and mineral supplements. the parity of the cows ranged from one to two. cows detected in estrus were artificially inseminated (ai) by inseminator/technician approximately 2-6 hours later using frozen/thawed semen from proven holstein friesian sires. the voluntary waiting period (vwp) of the herd was determined 40 days after calving. clinical examination and selection of cows prior to initiate the estrus synchronization, clinical examination was implemented by the authors with the help of local technician and/or management staffs of the herd. all cows were subjected to trans-rectal palpation for pregnancy status and/or the genitalia to asses uterine conditions and ovarian structures. trans-rectal palpation of the uterine was performed to determine the consistency of uterine including contraction, elasticity, tonicity, symmetry of uterine horns, and the presence of any fluid in the uterus (gautam et al., 2010). the presence of any palpable ovarian structures, ovarian cysts was defined as one or more follicle-like structures >25 mm in diameter without a concurrent corpus luteum (cl). ovaries without palpable structures (i.e. ovarian follicles > 10 mm in diameter and/or a functional cl) were considered inactive (yusuf et al., 2010), otherwise were considered active. cows that did not become pregnant during clinical examination and had not suffering from ovarian response on estrus synchronization (a.l. toleng et al.) 157 any type of ovarian cysts were selected to the protocol for synchronization of estrus. protocols for synchronization of estrus of 44 cows were examined in a herd, 20 cows at different stages of estrus cycle were selected and allocated into two treatment groups. all cows received 100 µg of gnrh-analogue (fertirelin acetate, conceral®, schering-plough animal health, tokyo, japan) im at the beginning of the treatment (d 0) without regard to the stages of the estrus cycle followed by 25 mg pgf2α (dinoprost; norbrook laboratories limited, newry, bt35 6jp) im 7 days later (figure 1 and 2). the animals were randomly allocated into two treated groups (cidr and without cidr). at the time of gnrh administration, the cidr group cows, a cidr (eazi-breed cidr®, livestock improvement association of japan, tokyo, japan) was inserted into the vagina of each cow. the cidr was removed on the day of pgf2α administration (figure 2). estrus signs were checked twice daily starting on day-2 after initiation of the protocol for the group of cows without cidr insertion (figure 1) and starting on day-8 for the group of cows with cidr insertion until five days after pgf2α injection (figure 2). the animals showing estrus signs were noted. those cows showing clear uterine contraction were confirmed to have been in estrus. blood sampling blood samples were collected from all animals on the days of gnrh and pgf2α treatments and on day-10 after initiation of protocol via jugular vein or coccygeal venipuncture into heparinized vacuum tubes (figure 1 and 2). after collection, the samples were centrifuged within 2 hours at 1500 x g for 15 minutes to collect plasma. the plasma was stored at -20ºc until assayed for progesterone concentration. hormone assay and case definition plasma progesterone concentration was determined using radioimmunoassay (ria) technique (izotope, institute of isotopes, ltd. 1535 budafest, pf.: 851). effect of treatment was evaluated based on plasma progesterone concentrations at the days of gnrh treatment (day-0), pgf2α treatment (day7), and day 10. progesterone concentrations below 1.0 ng/ml were considered low and indicative of the absence of cl, while progesterone concentrations of 1.0 ng/ml or higher were considered as an indicative of functional cl and were referred as high (cordoba and fricke, 2002; rivera et al., 2004; yusuf et al., 2010). cows showed high progesterone concentrations on day7 were considered to have positive response to gnrh treatment, and cows showed high progesterone concentrations on day-7 and low on day-10 were considered to have positive response to gnrh and pgf2α treatments. statistical analysis all calculations were carried out using the statistical package spss 16.0 for windows (spss inc., chicago, il, usa). differences in percentages of luteal phase and follicular phase or inactive ovaries in each group of cows with and without cidr insertion, high concentration of progesterone on day-7, and high concentration of progesterone on day-7 and low in day-10 among the groups were analyzed using chi-square test. results and discussion stage of estrus cycle prior to estrus synchronization in the present study, the animals were allocated into two different treatment groups; with and without cidr for estrus synchronization. this division was conducted randomly to each group for their stages of estrus cycle. the stages of estrus cycle at different treatment at the initiation of estrus synchronization are shown in table 1. table 1 shows that after randomly allocated the cows at different treatment, cows treated with cidr in the protocol had 70% in luteal phase at the initiation of estrus synchronization. this was indicated by high progesterone concentration (≥1 ng/ml). the remaining 30% of the cows in this treatment were in follicular phase or inactive ovaries at the initiation of estrus synchronization; indicated by low progesterone concentration (<1 ng/ml). chi-square analysis showed that cidr treated cows with luteal phase had significantly higher (p<0.01) than in follicular phase or inactive ovaries. for the group of cows treated without cidr in the protocol, comparison between cows in luteal phase and in follicular phase or inactive ovaries was similar (50% each). totally, out of 20 animals used in the present study, 12 or 60% cows were in luteal phase, 158 j.indonesian trop.anim.agric. 38(3) september 2013 higher (p<0.05) than the cows in follicular phase or inactive ovaries (8 cows; 40%). this result was in agreement with the previous study (galvao and santos, 2010) using 466 lactating holstein cows reported that 59.4% of the cows were in luteal phase and the remaining 40.6% were in follicular phase or inactive ovaries. the importance of these reproductive physiological statuses prior to synchronized or induced estrus has been well studied by bartolome et al. (2005) in order to apply estrus synchronization protocols in regard to the stage of estrus cycle at the beginning of the treatment. for example, their study suggests that heatsynch protocol increased pregnancy rate for cows in metestrus at the time of initiation of the treatment regime, and the ovsynch protocol was more effective for cows with ovarian cysts. basically, synchronization of estrus in cattle implies the manipulation of the estrus cycle or induction of estrus to bring a large percentage of cattle in a herd into estrus at predetermined time (odde, 1990) and to reduce the need for estrus detection (dejarnette et al., 2001). this technique has widely been used as an important tool for increasing ai submission rate in beef and dairy herds (macmillan and peterson 1993; xu and burton 1999; lucy et al., 2001). otherwise, efficient and accurate detection of estrus are fundamental for successful reproductive management when no fixed-time ai protocols are implemented (heersche and nebel, 1994; stevenson et al., 2008). this reproductive protocol, however, requires daily observation for signs of estrus and may result in extended interval from puberty to pregnancy depending on estrus detection efficiency and accuracy (stevenson et al., 2008). this implies that since the dairy or beef cattle producers have a difficulty to detect estrus in a certain time especially in tie-stall housing system, estrus synchronization is an alternative way for successful reproductive management. ovarian response on estrus synchronization (a.l. toleng et al.) 159 figure 2. estrus synchronization protocol, blood samples collection, and detection of estrus for the group of cows with cidr insertion response of ovaries after cidr or without cidr based on plasma progesterone concentrations in the present study, response of ovaries at different protocol was based on high progesterone concentration on day-7 after initiation of estrus synchronization. table 2 shows that all cows treated with cidr in estrus synchronization protocol showed high progesterone concentration on day-7. while the group of cows without cidr insertion were significantly (p<0.05) lower number of cows had high progesterone concentration on day-7 (70%). this indicated that cows treated cidr in estrus synchronization protocol using combination of gnrh and pgf2α were much effective than without cidr insertion. in the group of cows without cidr insertion, 3 of 10 cows showed signs of estrus before pgf2α administration (day-7). this means that involved cidr in the protocol avoided premature estrus. study of martinez et al. (2007) in beef heifers showed that inclusion of an intravaginal progesterone device (cidr) in a gnrh-based timed-artificial insemination (tai) regimen prevented premature estrus between the first injection of gnrh and pgf2α treatment and enhanced the pregnancy rate. likewise, the study of lucy et al. (2001) showed that treatment of heifers with intravaginal progesterone inserts and pgf2α has resulted in tighter estrus synchrony compared with heifers synchronized with 1 injection of pgf2α alone, with approximately 84 and 57% of heifers displaying signs of estrus during the first 3 d after treatment, respectively. on the other hand, out of 20 cows used in the present study, 17 cows or 85% were in luteal phase or had high progesterone concentration on day-7, and subsequently implicated the effectively of applying estrus synchronization. out of 10 cows without cidr insertion, only 4 or 40% cows with high progesterone concentration on day-7 and low on day-10. while those cows with cidr insertion, number of cows with high progesterone concentration on day-7 and low on day-10 were 8 cows (80%), or showed significantly (p<0.01) higher than the group of cows without cidr insertion (table 2). on day-7 of treatment regimen concurrently with cidr 160 j.indonesian trop.anim.agric. 38(3) september 2013 table 2. response of ovaries to estrus synchronization protocol in dairy cows on day-7 treated and concentration of progesterone in dairy cows in which high on day-7 and low in day-10 treated with or without cidr variable treatment cidr without cidr no. of cows examined 10 10 no. of cows with luteal phase (%) 10 (100)a 7 (70)b no. of cows with high concentration of progesterone on day-7 and low in day-10 (%) 8 (80)a 4 (40)b a,b different superscript in the same row indicate significantly different (p<0.05) table 1. stages of estrus cycle in dairy cows at the initiation of estrus synchronization treatment no. of cows luteal phase (%) follicular phase/ inactive ovaries (%) p-value cidr 10 70 30 < 0.01 without cidr 10 50 50 1.000 total 20 60 40 0.046 removal for the cidr group cows, injection of pgf2α were implemented to all cows, except those cows showed premature estrus. injection of pgf2α causes luteolysis of cl present and allows the cows to express estrus because of the reduced progesterone concentration (stevenson et al., 2008). conclusions it can be concluded that ovarian response after involving cidr in the protocol for estrus synchronization especially using combination of gnrh and pgf2α were much effective to synchronize the initiation of estrus in dairy cows. likewise, the use of progesterone avoided premature estrus. acknowledgments the authors are thankful to the livestock service of sinjai regency, indonesia and the technicians of the herd for their cooperation and kind help in collecting data. the sincere thanks are due to the students for their help during clinical examination. references ambrose, d.j., j.p. kastelic, r. rajamahendran, m. aali, and n. dinn. 2005. progesterone (cidr)-based timed ai protocols using gnrh, porcine lh or estradiol cypionate for dairy heifers: ovarian and endocrine responses and pregnancy rates. theriogenology 64: 1457-1474. bartolome, j.a., f.t. silvestre, s. kamimura, a.c.m. arteche, p. melendez, d. kelbert, j. mchale, k. swift, l.f. archbald, and w.w. thatcher. 2005. resynchronization of ovulation and timed insemination in lactating dairy cows i: use of the ovsynch and heatsynch protocols after nonpregnancy diagnosis by ultrasonography. theriogeneology. 63: 1617–1627. cavalieri, j., g. hepworth, v.m. smart, m. ryan, and k.l. macmillan. 2006. reproductive performance of lactating dairy cows and heifers resynchronized for a second insemination with an intravaginal progesterone-releasing aid for 7 or 8 d with estradiol benzoate injected at the time of aid insertion and 24 h after removal. theriogenology 67: 824-834. cordoba, m.c., and p.m. fricke. 2002. initiation of the breeding season in a grazing-based dairy by synchronization of ovulation. j. dairy sci. 85: 1752-1763. dejarnette, j.m,, r.r. salverson, and c.e. marshall. 2001. incidence of premature estrus in lactating dairy cows and conception rates to standing estrus or fixedtime inseminations after synchronization using gnrh and pgf2α. anim. reprod. sci. 67: 27-35. esslemont, r.j., and m.a. kossaibati. 2000. the use of databases to manage fertility. anim. reprod. sci. 60-61: 725-741. galvao, k.n., and j.e.p. santos. 2010. factors affecting synchronization and conception rate after the ovsynch protocol in lactating holstein cows. reprod. dom. anim. 45: 439–446. gautam, g., t. nakao, k. koike, s.t. long, m. yusuf, r.m.s.b.k. ranasinghe, and a. hayashi. 2010. spontaneous recovery or persistence of postpartum endometritis and risk factors for its persistence in holstein cows. theriogenology. 73: 168-179. heersche, g.jr., and r.l. nebel. 1994. measuring efficiency and accuracy of detection of estrus. j dairy sci 77: 2754-2761. lucy, m.c., h.j. billings, w.r. butler, l.r. ehnis, m.j. fields, d.j. kesler, j.e. kinder, r.c. mattos, r.e. short, w.w. thatcher, r.p. wettemann, j.v. yelich, and h.d. hafs. 2001. efficacy of an intravaginal progesterone insert and an injection of pg pgf2α for synchronizing estrus and shortening the interval to pregnancy in postpartum beef cows, peripubertal beef heifers, and dairy heifers. j. anim. sci. 79: 982-995. macmillan, k.l., and w.w. thatcher. 1991. effects of an agonist of gonadotropinreleasing hormone on ovarian follicles in cattle. biol. reprod. 45: 883–889. martinez, m.f., j.p. kastelic, m.g. colazo, and r.j. mapletoft. 2007. effects of estradiol on gonadotrophin release, estrus and ovulation in cidr-treated beef cattle. dom. anim. endoc. 33: 77-90. odde, k.g. 1990. a review of synchronization of estrus in postpartum cattle. j. anim. sci. 68: 817-830. rivera, h., h. lopez, and p.m. fricke. 2004. fertility of holstein dairy heifers after synchronization of ovulation and timed ai or ai after removed tail chalk. j. dairy sci. ovarian response on estrus synchronization (a.l. toleng et al.) 161 87: 2051-2061. roche, j.f., d. mackey, and m.d. diskin. 2000. reproductive management of postpartum cows. anim. reprod. sci., 60-61: 703-712. stevenson, j.l., j.c. dalton, j.e.p. santos, r. sartori, a. ahmadzadeh, and r.c. chebel, 2008. effect of synchronization protocols on follicular development and estradiol and progesterone concentrations of dairy heifers. j. dairy sci. 91:3045-3056. stevenson, j.s., j.f. smith, and d.e. hawkins. 2000. reproductive outcomes for dairy heifers treated with combination of prostaglandin f2α, norgestomet, and gonadotropin-releasing hormone. j. dairy sci. 83: 2008-2015. twagiramungu, h., l.a. guilbault, and j.j. dufour. 1995. synchronization of follicular waves with a gonadotropin-releasing hormone agonist to increase the precision of estrus in cattle: a review. j. anim. sci. 73: 3141-3151. wolfenson, d., w.w. thatcher, j.d. savio, l. badinga, and m.c. lucy. 1994. the effect of a gnrh analogue on the dynamics of follicular development and synchronization of estrus in lactating dairy cows. theriogenology. 42: 633-644. xu, z.z., and l.j. burton. 1999. reproductive performance of dairy heifers after estrus synchronization and fixed-time artificial insemination. j. dairy sci. 82: 910-917. yusuf, m., t. nakao, c. yoshida, s.t. long, s. fujita, y. inayoshi, and y. furuya. 2010. comparison in effect of heatsynch with heat detection aids and cidr-heatsynch in dairy heifers. reprod. dom. anim. 45:500504. 162 j.indonesian trop.anim.agric. 38(3) september 2013 the influence of using fish fermented by lactic acid bacteria as feed substitution on serum lipid profile of broilers s. sumarsih1, t. yudiarti1, c. s. utama1, e. s, rahayu2 and e. harmayani2 1faculty of animal agriculture, diponegoro university tembalang campus, semarang 50275 indonesia 2faculty of food technology, gadjah mada university, yogyakarta, indonesia coresponding e-mail: ssumarsih71@yahoo.com received november 16, 2009; accepted june 08, 2010 abstract the study was aimed to examine the effect of the use of fish fermented by lactic acid bacteria (lab) as a subtitution for fish meal on serum lipid profile of broiler. one hundred and twenty five dayold broiler chicks of cp 707 strains were divided into five groups for five treatments. a completely randomized design was used in this experiment. the treatments were 0 (control), 2, 4, 6 and 8% fish fermented by lab substitution of basal diet containing 8% fish meal. the parameters were blood lipid profile including total cholesterol, low density lipoprotein (ldl) and high density lipoprotein (hdl) cholesterol and triglycerides. data was analyzed by one-way analysis of variance (anova). when the f test indicated a significant effect, the differences between the mean values were analyzed by duncan’s multiple range test. results showed that using fish silage fermented by lab on broiler ’s feed did not affect total cholesterol and hdl cholesterol, but significantly affect (p<0.05) levels of ldl cholesterol and serum triglycerides of broilers. based on serum lipid profile, it could be concluded that fish fermented by lab can be used as a substitute for the 100% fish meal in broiler ’s feed. keywords : fish fermented, lactic acid bacteria, lipid profile introduction there is a tendency towards increased consumption of fat in which parallel with the growing prosperity of the indonesian people. nationally, indonesian people are still unable to reach the recommended number of nutrient adequacy. about 9% of the population consume more fat than standard safety considered. this fact is supported by the results of the household health survey which showed that death caused by vascular disease was very low in 1970, number seven position in 1986, first rank in 1992 and still in the same position right now. one risk factor for vascular disease (cardiovascular, hypertension) is high blood cholesterol levels. same efforts to prevent or reduce blood vessel disease are to lower fat intake or to consume food that is hipokolesterolemik. broilers produce meat that contains fat and cholesterol. excessive fat deposition in meat and abdominal cavity is one of the main problems in the production of broilers (leenstra, 1985). fat and cholesterol content of broiler’s meat consumed influenced by feedstuffs. fish meal is one of broiler ’s feedstuff content as a source of crude protein. fulfillment of fish meal for feed ingredients is still dependent on imports, since domestic production can only provide about 5% of that required, while the use of fish meal tended to increase from year to year. one of the alternative products that can replace the role of fish meal as a source of animal protein is fermented fish. the advantage of fermented fish compared to fish meal is 1) it is high quality and it can be used at any seasons throughout the year; 2) it can be given practically for cattle; 3) preparation method is relatively easy and does not require any special skills /high; 4) the products have a long usage time. fermented fish is product of microbiologically fish preservation process using lactic acid bacteria (junianto, 2003). lactic acid bacteria are bacteria that are able to produce lactic acid as a result of fermentation of carbohydrates. lactic acid works to prevent the development of microbial spoilage. lactobacillus sp is a lactic acid bacteria that have a potential as probiotics (purwandhani and rahayu, 2003) and its stability can be maintained during storage by dry cell preparation as a probiotics powder (hartati and 124 j.indonesian trop.anim.agric. 35(2) june 2010 harmayani, 2006). lactic acid bacteria are also known as the agent for hypercholesterolemia prevention, as reflected in the high content of high density lipoprotein cholesterol (hdl) and low content of low density lipoprotein cholesterol (ldl) in the experimental animals (harmayani, 2002). this study was aimed to examine the effect of the use of fish fermented by lactic acid bacteria (lab) as a substitution for fish meal on lipid profile (total cholesterol, ldl, hdl and triglycerides) of broilers serum. results are expected to provide information on the use of fish meal fermented by lactic acid bacteria (lab) as a substitute for fish meal in broiler. the hypothesis of this research was the using of fish meal fermented by lab will decrease total cholesterol, ldl and triglycerides and increase hdl of broilers serum. materials and methods broilers, diet and samples collection one hundred and twenty five day-old broiler chicks of cp 707 strains were allocated in five cages that floor was made of litter and which was supported by a 40 watt lamp, drinker and feeder. the new castle disease vaccine strains lasota was conducted when the broilers aged 5 days. the feed and water were provided ad libitum. br-1 commercial was given at the age of 1-14 days. feed’s treatment was given starting from twoweek-old chickens and terminated at the age of 4 weeks. feed was made iso-protein and iso-energy (20% crude protein and 3000 kcals of me / kg) containing 8% fish meal. blood samples were collected from chickens of each treatment. blood was withdrawn from the wing vein and the serum samples were analyzed for lipid profile (total cholesterol, hdl cholesterol, ldl cholesterol and triglycerides) content. analysis was carried out by spectrophotometry commercial kit. fish silage fish silage was made by adding lactobacillus sp isolates 2% (w/w) and rice bran as a source of easily digested carbohydrates as much as 4% (w/w) of the weight of fresh fish. fish was fermented in anaerobic condition for two weeks. the treatment was using fish silage that was dried with oven at 40 ºc and milled into flour. lactic acid bacteria as starter was isolated from caecum’s broilers with mrs medium-1% caco3 plus 10 ppm sikloheksamat to suppress the growth of yeast and 10 ppm sodium azide to suppress micro aerobic (rahayu, 2003). identification of lactic acid bacteria was done by examining the phenotypic traits that appear based on morphological, biochemical and physiological based on bergey's manual of determinative bacteriology (holt et al., 1999). experimental design one hundred and twenty five day-old broiler chicks of cp 707 strains were divided into five treatments. a completely randomized design was used in this study. there were five replications for each treatment, and five chickens in each replication. the treatments were 0 (control), 2, 4, 6 and 8% fish silage substitution of basal diet containing 8% of fish meal. the parameters were blood lipid profile including total cholesterol, ldl and hdl cholesterol and triglycerides. data was analyzed by one-way analysis of variance (anova). when the f test indicated a significant effect, the differences between the mean values were analyzed by the procedures of duncan’s multiple range test (steel and torrie, 1981). results and discussion table 1 shows that the average of total cholesterol level of blood broiler serum receiving rations of fish fermented by lactic acid bacteria (lab) as a substitution for fish meal were not significantly different from control. this indicated that there is no change in cholesterol metabolism in the body of broiler chickens. ration nutrient content did not differ among the treatments, which cause the total cholesterol did not differ. lactic acid bacterias can not change the nutrient but have a potential as probiotics so nutrient content did not differ among the treatments. cholesterol levels are influenced by different nutritional components in foods (linder, 1985). cholesterol metabolism is catalyzed by enzymes in the body hydroxy methyl glutaril co-a (hmg co-a). the reaction controls rate of cholesterol synthesis. hmg co-a disconnect the co-a that is then reduced to form as early mevalonat acid formation in cholesterol. enzyme hmg-co-a is directly inhibited by dietary cholesterol intake. when cholesterol diet consumed is less, than more cholesterol is synthesized by the liver that causes a reduction of total cholesterol (hermier, 1997) influence of the use of fish fermented for broilers (s. sumarsih et al.) 125 total cholesterol in the blood can not describe the effect of cholesterol on health but the type of cholesterol provides a major influence on health conditions. there are two types of cholesterol, which gives a different impact on health, that is ldl cholesterol provide negative effects, while hdl cholesterol had a positive impact on health. therefore, to know the effect of cholesterol is not only observe seen the changes of total cholesterol in the blood but also the types of cholesterol (linder, 1985). mean blood serum levels of hdl cholesterol of broiler receiving rations of fish fermented by lab as a substitution for fish meal were not significantly different from control (table 2). this indicated that transport of cholesterol from tissues back to the heart was not different. high levels of hdl cholesterol in the blood serum will accelerate the transport of cholesterol from the cell edge, which means reducing the accumulation of cholesterol from the blood vessel wall (linder, 1985). the hdl cholesterol plays a role in transporting cholesterol from body tissues to the liver to be converted into bile acids and then excreted in the bile as the main road into the mechanism of intestinal cholesterol removal from the body (montgomery et al., 1983). the mean levels of ldl cholesterol in the control treatment was significantly higher (p < 0.05) than those in other treatments (table 3). this means that diet containing fish fermented by lab capable to lower ldl cholesterol and triglycerides. research by harmayani (2002) showed that lab are also known as the agent for hypercholesterolemia prevention, as reflected in the high content of high density lipoprotein cholesterol (hdl) and low content of low density lipoprotein cholesterol (ldl) in the experimental animals. ldl cholesterol is the end product of vldl (very low density lipoproteins) with high cholesterol ester content (linder,1985). table 4 shows that blood serum triglyceride levels of broiler chickens receiving the control diet was significantly higher (p<0.05) than those of broilers receiving diets containing fish meal fermented by lab as a substitution for fish meal. the high level of ldl cholesterol is usually followed by high level of triglycerides. lipids from the diet, mainly the triglyceride hydrolysis, is absorbed and reprocessed in the intestinal mucosa cells into several lipoprotein particles are transported in the form of vldl and then converted to ldl by the liver (hermier, 1997). vldl is the form of triglycerides that is transported from the liver to the tissue outside the liver. the vldl triglyceride that is reduced the density of particles is thus gradually transformed into ldl cholesterol (montgomery et al., 1983). triglycerides are lipids that are stored as energy reserves in the form of fat tissue (frandson, 1992). it was stated by montgomery et al. (1993) that triglycerides from digested food after 2-monoasilgliserol forming compounds and fatty acids are absorbed into the mucosal cells. enzymes within the cell by catalyzing monoasilgliserol asilkoa forming 1,2diacylglycerol can be asilazed into triglycerides and transported back into the porta as portomikron (annison, 1983). portomikron is hydrolyzed by lipoprotein lipase in the capillary walls into fatty acids and glycerol. fatty acids in the blood as free fatty acid (ffa) and is bound by serum albumin and glycerol back to the liver to be converted into dihydroxy acetone phosphate and enter the glycolytic pathway. results of this study showed that the use of fish meal fermented by lab can be used as a substitution for the 100% fish meal in broiler. lab has a positive influence on serum lipid profile of broiler as indicated by the low levels of ldl cholesterol and triglycerides blood serum of broilers. 126 j.indonesian trop.anim.agric. 35(2) june 2010 table 1. total serum cholesterol blood broiler chickens fed fish fermented by lactic acid bacteria (lab) treatment u1 u2 u3 u4 u5 avg ..............................................mg / dl............................................... ... 0 98.41 112.34 95.89 114.80 112.51 106.73 0.02 98.12 94.88 91.23 116.14 120.03 104.08 0.04 89.45 113.17 99.96 74.59 88.99 92.83 0.06 73.80 100.86 97.87 86.88 94.70 90.82 0.08 88.04 118.54 93.35 85.10 72.96 91.60 conclusion fish fermented by lab can be used as a substitution for the 100% fish meal in broiler. using fish fermented by lab on broiler’s feed did not have a significant effect on the total cholesterol and hdl cholesterol, but significantly lower the ldl cholesterol and serum triglycerides content in broilers. acknowledgments the authors extend gratitude to the directorate general of higher education, and the ministry of national education of the republic of indonesia which have funded this research through program hibah pekerti no. 124a/h7.2/kp / 2009. references anison, e. f. 1983. lipid metabolism. in: bell, d. j. and b. m. freeman (ed). physioloy and biochemistry of domestic fowl. vol. 4. academic press, new york ltd.. p: 165-174 frandson, r. d. 1992. anatomy and physiology influence of the use of fish fermented for broilers (s. sumarsih et al.) 127 table 2. serum of hdl cholesterol in blood of broiler chickens fed fish fermented by lactic acid bacteria (bal) as fish meal substitution treatment u1 u2 u3 u4 u5 avg ....................................... mg / dl ....................................... 0 1.13 1.88 2.57 1.01 4.11 2.14 0.02 0.50 1.51 4.27 3.14 3.14 2.76 0.04 3.14 1.38 1.63 2.70 2.70 2.03 0.06 2.37 1.63 1.50 3.28 3.28 2.30 0.08 1.64 2.01 2.01 2.39 2.39 2.14 table 3. serum of ldl cholesterol in blood of broiler chickens fed fish fermented treatment u1 u2 u3 u4 u5 avg 0 77.43 82.75 72.56 96.10 92.43 0.02 71.41 67.08 64.52 78.81 84.38 0.04 76.01 88.31 76.51 62.89 67.77 0.06 55.03 69.71 76.55 69.44 74.44 0.08 58.08 89.69 62.18 66.45 57.89 a-b: the different superscript in the same column indicate the differ significantly (p<0.05) by lacticacid bacteria (lab) as fish meal substitution ...........................................mg / dl ........................................ 84.25a 73.24b 74.30b 69.03b 66.86b table 4. tligliserid a lev el in blo od o f broiler chickens fed fish fermented by lactic acid bacteria (lab) as fish meal sub stitu tion treatment u1 u2 u3 u4 u5 avg .......................................... mg / d l.............................................. 0 1 27.9 0 129.60 1 20.7 0 181 .60 157.70 0.02 1 02.4 0 140.40 95.3 0 71 .50 83.20 0.04 5 1.5 0 117.40 1 09.1 0 52 .00 82.60 0.06 9 2.0 0 147.60 1 04.1 0 73 .50 84.90 0.08 1 41.6 0 139.20 1 45.8 0 85 .10 73.40 a-b: the different sup erscrip t in the same column in dicate th e differ significantly (p<0 .05) 1 43.5 0a 98.56b 82.60b 100.42b 117.02b of farm animals. colorado state university. fort collins, colorado harmayani, e. 2002. cholesterol reduction effect of probiotic cultures. proceedings of the 2 nd indonesian biotechnology conference, yogyakarta, 18-19 jan 2002. p. 302-308 hartati, s and e. harmayani. 2006. preparasi sel kering lactobacillus sp dad 13 dan kestabilannya sebagai bubuk probiotik. j. mikrobiologi indonesia. 11(1):1-4 hermier, d. 1997. lipoprotein metabolism and fattening in poultry, the journal of nutrition. 127: 805s-808s holt, j. g., n. r. krieg, p. h. a. sneath, j. t. staley and s. t. willem. 1999. bergey's manual of determinative bacteriology. 9th edition. willey & willey. baltimore, p 3-6. junianto. 2003. teknik penanganan ikan. penebar swadaya, jakarta leenstra, f. r. 1985. effect of age, sex, genotype and environment on fat deposition in broiler chicken. poult. sci. 42: 12-25 linder, m. c. 1985. nutritional biochemistry and metabolism. elswier sciences publishing company, inc. california montgomery, r., r. l. dryer., r. w. conway and a. a. spector. 1983. biochemistry: a case oriented approach. msby company, iowa. purwandhani, s. n. and rahayu, e. s. 2003. isolasi dan seleksi lactobacillus yang berpotensi sebagai agensia probiotik. agritech 23 (2): 67-74. rahayu, e. s. 2003. lactic acid bacteria unfermented food of indonesian origin. journal agritek. 23 (23): 75-84 steel, r. g. d. and j. h. torrie. 1981. principles and procedures of statistics. mcgraw hill book co.. inc., n. y. 128 j.indonesian trop.anim.agric. 35(2) june 2010 growth analysis in rabbit using gompertz non-linear model a. setiaji, sutopo and e. kurnianto faculty of animal and agricultural sciences, diponegoro university, tembalang campus, semarang 50275, central java – indonesia corresponding e-mail: asep_down@yahoo.com received march 02; accepted may 08, 2013 abstrak penelitian ini bertujuan untuk membandingkan pola kurva pertumbuhan tiga bangsa kelinci. tiga bangsa kelinci yang digunakan dalam penelitian ini adalah satu bangsa kelinci lokal (il), dua bangsa kelinci impor flamish giant (fg) dan rex (r). bobot badan sebagai parameter penelitian dicatat pada masing-masing bangsa dari lahir sampai umur 63 hari dengan selang waktu tiga hari. data dikelompokkan berdasarkan jenis kelamin, kemudian dirata-ratakan untuk analisis pola pertumbuhan. data bobot badan dianalisis mengunakan rumus gompertz. parameter kurva pertumbuhan digunakan untuk menduga pertumbuhan. hasil analisis menunjukkan bobot badan antara kelinci jantan dan betina dalam satu bangsa tidak berbeda nyata, sedangkan hasil analisis bobot badan antar bangsa menunjukan perbedaan (p<0.05). pertumbuhan relatif tiga bangsa kelinci menunjukkan berbeda nyata (p<0.05) baik pada jenis kelamin jantan maupun betina. pendugaan bobot badan dewasa pada fg memiliki nilai tertinggi diikuti r dan il dengan nilai terendah. koefisien determinasi analisis gompertz model pada pertumbuhan kelinci sangat tinggi (r2 = 0.999). kata kunci: gompertz model, kurva pertumbuhan, bobot badan, kelinci abstract an experiment was conducted to compare the growth curve of rabbit. three breeds of rabbit, namely indonesian local rabbit (il), flamish giant (fg) and rex (r) were used in the study. individual body weights of each breed was measured from birth to 63 days of age with 3-days interval. those periodical data were separated into different sex, be then it was averaged to analysis growth pattern. growth curve parameters were estimated to fit growth data. there was no difference in body weight between sexs within breed. indonesian local rabbit had the lowest body weight. the results showed that growth curve paramaters among three breeds were significantly different (p<0.05) for both sexes. fg had the highest value of asymptotic mature weight, followed by r and il. in conclusion, gompertz model was excellent fit for the growth data in rabbit with a high coefficient determination (r2 = 0.999). keywords : gompertz model, growth curve, body weight, rabbit introduction in the tropic, rabbit became important small livestock and meat source. they have high productivity on reproduction but in indonesian, rabbit development is less than poultry and ruminant. breeding and genetic were the vital aspects of rabbit production which urgently needed in tropics to ensure a high success rate of rabbit development program. unfortunately, there was preference in indonesian farmers to raise exotic breed of rabbit. they had a notion that local breeds are genetically inferior. a serious consequence of this practice was the possibility loss of local germplasm. in other side, potential of imported breeds could not be optimised because their ability to adapt to tropic environment was low. lebas et al. (1997) reported that low productivity of imported breeds as a result of unsuccessful environmental adaptation. in all cases, breed evaluation tests (local versus imported breed) should be priority to be carried out. attention has been given to the body weight as a consequence of the growth. growth curve is a figure of individual ability to express its genetic potential to maximum size 92 j.indonesian trop.anim.agric. 38(2) june 2013 under the existing environmental condition. some studies on growth curve have been reported. suparyanto (2001) used three non-linear growth curves of von bertalanffy, logistic and gompertz to analysis the relationship of body weight and age. one of non-linear model have been used to describe growth patterns is gompertz model. according to lenart (2011), the gompertz distribution was widely used to describe the distribution of adult body. this model based on the exact central moments and defined with higher accuracy approximations. by solving the maximum-likelihood estimates analytically, the dimension of the optimization problem can be reduced, both in the case of discrete and continuous data. gompertz model has been used to analysis the growth of mice (kurnianto et al., 1998), dog (helmink et al., 2000) sheep (suparyanto et al., 2001), rabbit (blasco et al., 2003), lamb (lambe et al., 2006), pig (strathe et al., 2010) and cattle (forni et al., 2009; budimulyati et al., 2012). several researches about growth of rabbit were analysed with logarithmic model (rao et al., 1997), stochastic model (sampaio et al., 2005) and general linear mixed model (mcnitt and lukehfar, 2005). the objective of this study was to compare growth curve of rabbit between imported and indonesia local breeds. materials and methods materials three breeds of rabbit were used in this study, namely flamish giant (fg), rex (r) and indonesian local rabbits (il). the number of rabbit used in each genetic group of the male fg, r and il rabbits were 16, 16 and 9 heads, respectively. meanwhile, the female number of respective breed was 16, 12 and 8, respectively. the study was conducted in temanggung regency – central java, under temperature ranging from 18 to 25°c. methods the offsprings were obtained from mating of two buck and six doe for each breed (mating ratio 1:3). after weaning, feeding was provided ad libitum by automatic feeder and drink was given by nipple. they were fed a complete, pelletized diet containing 19.71% of crude protein, 23.46% of fiber and 1.77% of fat throughout the experiment. body weights were recorded individually at 3-days interval from birth to 63 days of age. data analysis sas (1990) was used to analyze the data of body weights on three breed using general linear model (glm). differences between male and female body weight were tested by t-test. growth curve parameters were estimated from average of body weights using gompertz model (dastidar, 2006) and analyzed using gauss-newton method of sas (1990). gompertz model was chosen based on an earlier study suggesting this model provided a fit for weight data in mice compared to logistic and asymptotic models (kurnianto et al., 1997). growth curve parameters were used in expecting weight data within each breed. the gompertz model was formulated as: yt = a exp [-b exp (kt)] where, yt: body weight (g) at age of t (weeks); a: asymptotic (mature) weight; b: intregration constant, time scale parameter of no specific biological significance; k: growth rate constant, which a logarithmic function of degree of maturity in body weight changes linearly time unit; exp: base of natural logarithm (2.7183). other parameters derived from the model used were age and weight at the point of inflection designated as ti and yi, respectively. ti = 1nb/ k and yi = a / exp the deferences in mean growth parameters between sexes within breed was tested using ttest, whereas mean comparison for similar sex among breeds was tested by duncan’s range multiple test. results and discussion body weight preliminary analysis showed that there was no significantly difference of body weights between male and female at all breeds. body weights of three breeds of rabbit from birth to 63 days of age is presented in table 1. the average birth weight of fg was 56.16 g, il was 53.49 g and r was 96.42 g. birth weights showed lower body weight than the previous experiment that was 66.7 g (sartika et al., 1998), 49.78 g (suc et al.,1996) and 61.3 g (rahardjo, 1988), for flamish giant, indonesian local rabbit and rex, respectively. body weights of male were not significant different in 0 until 3 days of age, while from 6 growth analysis in rabbit (a. setiaji et al.) 93 days to 63 days of age showed significant difference (p<0.05). fg show similarity to r, but not similar to il. except in 9 and 15 days of age, fg was similar to il and r but did not show similarity between il and r. in female, body weights showed significant different among three breeds (p<0.05) from birth until 63 days of age, except in 9 days of age. birth weight of fg is differed to il and r, but il show similarity to r. r was similar to fg and il, but did not showed similarity between fg and il in 12 until 21 days of age. meanwhile, in 24 until 63 days of age il 94 j.indonesian trop.anim.agric. 38(2) june 2013 table 1. body weights of three breeds of rabbit age (day) male female flamish giant local rex flamish giant local rex ……………………………………………... (g) …………………………………………………………. 0 52.00±6.06 46.67±11.77 49.00±5.56 60.31±14.09k 45.25±12.37l 47.42±5.50l 3 62.31±11.15 55.00±13.13 61.50±8.94 71.50±20.09k 55.88±11.88l 60.00±8.830kl 6 79.69±15.22a 65.56±15.68b 84.62±9.54a 86.56±21.50k 68.38±13.90l 80.42±10.05kl 9 96.44±18.87ab 86.89±14.58b 104.62±8.72a 102.69±22.35 87.50±15.11 101.00±9.67 12 129.00±22.78a 111.11±16.27b 127.06±13.74a 142.44±31.14k 113.38±14.09l 123.58±13.98kl 15 151.12±27.37ab 133.56±19.50b 156.06±18.23a 167.56±32.05k 136.12±17.22l 151.17±24.19kl 18 180.75±37.98a 138.67±21.48b 184.19±22.64a 195.94±52.96k 146.12±17.30l 179.33±20.71kl 21 211.25±43.83a 158.22±23.84b 210.56±23.48a 230.12±66.65k 166.50±19.24l 204.58±23.21kl 24 257.81±45.78a 184.33±18.87b 242.12±25.13a 267.00±49.84k 189.88±15.26l 243.17±19.66k 27 296.00±41.93a 211.11±20.26b 278.75±34.90a 302.69±53.82k 215.12±15.85l 281.58±29.12k 30 321.06±50.79a 246.78±29.60b 312.69±39.19a 328.31±51.05k 245.00±29.03l 318.83±30.25k 33 368.94±63.43a 271.44±20.67b 364.50±51.18a 376.62±57.37k 274.00±19.71l 361.67±33.54k 36 408.12±69.57a 294.22±22.57b 379.88±54.66a 408.69±70.31k 297.00±21.28l 389.50±41.60k 39 440.25±72.64a 316.89±24.52b 407.88±55.57a 445.56±70.45k 319.75±25.48l 410.58±48.51k 42 472.94±81.97a 352.67±32.54b 435.50±68.10a 483.25±62.65k 356.75±29.28l 453.17±62.37k 45 482.19±71.68a 383.89±32.51b 452.31±80.28a 496.44±48.68k 383.38±36.14l 478.08±76.10k 48 526.44±92.30a 384.33±25.98b 490.75±86.61a 537.19±71.17k 386.12±25.38l 514.42±92.15k 51 564.25±100.80a 392.88±21.09b 530.38±91.67a 581.38±82.88k 395.12±19.43 l 556.58±110.67k 54 606.69±110.75a 407.22±20.74b 573.50±89.62a 627.44±97.39k 408.50±16.88 l 605.08±113.69k 57 650.25±124.99a 419.22±17.82b 613.12±86.14a 674.44±111.85k 419.38±15.22 l 643.50±114.84k 60 694.25±141.24a 431.89±14.62b 644.19±96.91a 723.31±126.76k 439.00±19.20 l 684.91±130.49k 63 750.12±144.10a 443.33±12.79b 674.69±111.25a 779.06±121.59k 444.50±9.55 l 714.92±136.57k different superscripts in the same rows shows significant different (p< 0.05): a,b,c : different superscripts in the same rows shows significant different within male between breed. k,l,m : different superscripts in the same rows shows significant different within female between breed. a,b : different superscripts at the fg breed between male and female indicate significantly different. r,s : different superscripts at the il breed between male and female indicate significantly different. x,y : different superscripts at the r breed between male and female indicate significantly different. show significantly difference with fg and r, but fg was similar with r. il had the lowest body weight. according to farrell and raharjo (1984) local rabbit was smaller than the imported breed. growth curve paramaters means of growth curve paramaters for each breed are presented in table 2. asymptotic weight (a) among three breed were significantly different (p<0.01) for both sexes. the highest of a value was achieved by fg, in which for males and females were 1249.77 and 1521.78, respectively. meanwhile, the smallest of a value was attained by il, that was 558.21 for males and 559.19 for females. according to the american rabbit breeders association (2011), body weight of fg achieved 5.890 g for male and 6.350 g for female. the research indicated that flamish giant was adapted with the tropic. it was stated by brahmantiyo (2008) that fg which raised by indonesian farmers was diverged from the pure breed character. the growth rate constant (k) among three breed were high significantly different (p < 0.01) for both sexes. the highest and smallest k value for both sexes were il and fg respectively. the results demonstrated that indonesian local rabbit matured earlier than other breeds. it was stated by kurnianto et al. (1998) that large of k values indicated early maturing individuals, whereas small k values indicated late maturing individuals. point of inflection was corresponds to two parameters, namely age at point inflection (ti) and weight at point of inflection (yi). autoacceleration stage was replaced be autoretardation stage in this point. this analysis showed that fg was the oldest and the largest at the point of inflection for both sexes as shown the highest ti and yi values, 41.32 days and 459.76 g; 48.12 days and 559.83 g, respectively for male and female. there was relationship between the k value and ti. the rabbit breed with higher k value reached the ti at a younger age. it was found il had point inflection at the youngest age among three breeds. fitting of growth model illustration of growth patterns of this study was based on a set of data by averaging individual estimated from body weights. mean of body weight was computed at each age for each breed. fitted gompertz model to body weight is illustrated in figure 1 for male and figure 2 for growth analysis in rabbit (a. setiaji et al.) 95 table 2. estimated growth curve parameters of gompertz model (a, b, k, ti and yi) for each breed estimated parameter breed flamish giant local rex male (16) (9) (16) a 1249.77 ± 100.5a 558.21 ± 23.44c 1107.38 ± 74.18b b 3.16 ± 0.06a 2.74 ± 0.08c 3.00 ± 0.05b k 0.0279 ± 0.002c 0.04 ± 0.002a 0.03 ± 0.001b ti 41.32 a 24.91b 39.02c yi 459.76 a 205.35b 407.38c r2 0.999 0.999 0.999 female (16) (8) (12) a 1521.78 ± 150.4a 559.19 ± 20.47c 1258.87 ± 74.38b b 3.17 ± 0.06b 2.69 ± 0.07c 3.18 ± 0.04a k 0.02 ± 0.002c 0.04 ± 0.002a 0.03 ± 0.001b ti 48.12 a 24.55c 42.60b yi 559.83 a 205.71c 463.11b r2 0.999 0.999 0.999 different superscripts in the same rows shows significant different (p< 0.05) number in bracket is the number of sample female. growth model to weight data showed that fg had the fastest growth performance, followed with r and il was slowest. it indicated that type of breed was influence growth performance. reported by mcnitt and lukefahr (2005) that growth performance of californian, new zealand white, palomino and white satin were difference one another. the growth performance of rabbits reported from tropical countries was in contrast to observed in temperate regions (lukefahr and cheeke, 1991). the lower result might due to the heat stress factor. the means residual of estimated body weight from observed data is illustrated in figure 3 for male and figure 4 for female. the figures showed fg’s residual was similar to r, but il had the opposigh the gompertz model tended to over estimated and underestimated, it provided an excellent fit for growth data as shown by the high coefficient of determination (r2 = 0.999). according to khan et al. (2013), the high coefficient of determination was reliable on estimation. conclusion indonesian local rabbit had the lowest growth performance, whereas flamish giant had the fastest. the import rabbit grew faster than the local rabbit of indonesia. gompertz model was excellent fit for the growth data with a high 96 j.indonesian trop.anim.agric. 38(2) june 2013 figure 1. gompertz growth curves fitted to body weight at male, flamish giant (□) local (*) rex (○). figure 2. gompertz growth curves fitted to body weight at female, flamish giant (□) local (*) rex (○). figure 3. residual plot of the estimated body weight from the observed body weight from birth to 63 days at male flamish giant (□) local (*) rex(○). figure 4. residual plot of the estimated body weight from the observed body weight from birth to 63 days at female flamish giant (□) local (*) rex (○). coefficient determination. references arba (the american rabbit breeder association). 2011. official guidebook to raising better rabbits & cavies. american rabbit breeder association, inc. bloomington, illinois 61702. blasco, a., m. piles and l. varona. 2003. a bayesian analysis of the sffect of selection for growth rate on growth curves in rabbits. genet. sel. evol. 35:21-41. brahmantiyo b. 2008. kajian potensi genetik ternak kelinci di bogor , jawa barat dan magelang, jawa tengah. disertasi. sekolah pasca sarjana, institut pertanian bogor. budimulyati, l.s., r.r. noor, a. saefuddin and c. talib. 2012. comparison on accuracy of logistic, gompertz and von bertalanffy models in predicting growth of new born calf until first mating of holstein friesian heifers. j. indonesian trop. anim. agric. 37(3):151160. dastidar, s.g. 2006. gompertz: a scilab program for estimating gompertz curve using gaussnewton method of least squares. j. stat. soft. 15:1-12. farrel, d.j. and y.c. raharjo. 1984. the potential for meat production from rabbits. central research institute for animal science. bogor. forni, s., m. piles, a. blasco, l. varona, h.n. oliveir and r.b. lobo. 2009. comparison of different nonlinear functions to describe nelore cattle growth. j. anim. sci. 87:496506. helmink, s.k., r.d. shanks and e.a. leighton. 2000. breed and sex differences in growth curves for two breeds of dog guides. j. anim. sci. 78:27-32. khan, m.s., s. ahmad, z. a. swati, s. akhtar and a. rahman. 2013. gestational age estimation in kari sheep using non-conventional ultrasonographic parameter. sarhad j. agric. 29(1):105-112. kurnianto, e., a. shinjo and d. suga. 1997. comparison of three growth curve models for describing the growth patterns in wild and laboratory mice. j. vet. epidemol. 1:49-55. kurnianto, e., a. shinjo and d. suga. 1998. analysis of growth in intersubspecific crossing of mice using gompertz model. asian-aust. j. anim. sci. 11:84-88. lambe, n.r., e.a. navajas, g. simm and l. bunger. 2006. a genetic investigation of various growth models to describe growth of lambs of two contrasting breeds j. anim. sci. 84:2642-2654. lebas, f., p.coudert, h. de rochambeau and r.g. thebault. 1997. the rabbit:husbandry, health and production. fao animal production and health series 21. rome. italy. lenart, a. 2011. the gompertz distribution and maximum likelihood estimation of its parameters. max-planck-institut für demogra fische forschung max planck institute for demographic research konrad-zuse-strasse 1 · d-18057 rostock · germany. 1-19. lukefahr, s.d. and p.r. cheeke. 1991. rabbit project planning strategies for the developing countries. i. practical considerations. world anim. rev. 68, 60-70. mcnitt, j.i. and s.d. lukefahr. 2005. breed and environmental effects on postweaning growth of rabbits. j. anim. sci. 71:1996-2005. raharjo y. c. 1988. rex breed alternatif untuk pengembangan kelinci. kumpulan makalah seminar ekspor ternak potong. departemen pertanian, jakarta. rao, d.r., g.r. sunki, w. m. johnson and c.p. chen. 1997. postnatal growth of new zealand white rabbit (oryctolagus cuniculus). j. anim. sci. 44:1021-1025. sampaio, i.m.b., w.m. ferreira and a.f. bastos. 2005. the use of a stochastic model of rabbit growth for culling. world rabbit sci. 13:107112. sartika t., t. antawijaya and k. diwyanto. 1998. peluang ternak kelinci sebagai sumber daging yang potensial di indonesia. wartazoa. 7(2):47-54. sas/stat. 1990. sas user’s guide. version 6. 4th ed., sas inst. inc., cary, north carolina. strathe, a.b., a. danfear, h. sorensen and e. kebreab. 2010. a multilevel nonlinear mixed-effects approach to model growth in pigs. j. anim. sci. 88:638-649. suc, ng.q., d.v. bink, l.t.t. iba and t.r. preston. 1996. effect of housing system (cage versus undergraound shelter) on performance of rabbits on farm. livestock research for rural development. 8 (40) suparyanto, a., subandriyo, t.r. wiradarya and h.h. martojo. 2001. non-linear growth analysis of sumatera thin sheep and its cross breeds. jurnal ilmu ternak dan veteriner 6(4):259-264. growth analysis in rabbit (a. setiaji et al.) 97 some factors influencing the income of kaligesing goat farmers in borobudur subdistrict, magelang regency, central java, indonesia a. setiadi, s.i. santoso, l.k. nuswantara and sunarso faculty of animal science and agriculture, diponegoro university, tembalang campus, semarang, 50275 indonesia corresponding email : agus_setiadi2006@yahoo.co.id received october 09, 2012; accepted november 20, 2012 abstrak tujuan penelitian ini adalah untuk mengetahui jumlah pendapatan yang didapatkan oleh peternak dan mengetahui pengaruh beberapa faktor terhadap pendapatan peternak. penelitian survei dilakukan pada 47 peternak kambing ras kaligesing di desa giripurno kecamatan borobudur, kabupaten magelang dengan cara interview dan observasi. data sekunder dan primer diambil untuk menjawab penelitian. karakteristik responden, total penerimaan, biaya produksi dan total pendapatan dicatat dan diamati selama 6 bulan. statistika deskriptif dan one sample t-test digunakan untuk menganalisis data. analisis jalur dengan tetrad iv digunakan untuk menentukan model. peternak kambing perah ratarata memelihara 10 ekor. total penerimaan yang didapatkan perbulan sebesar rp. 4.975.500, biaya yang dikeluarkan sebesar rp. 1.865.200. pendapatan yang didapatkan sebesar rp. 3.110.300. pendapatan yang didapatkan lebih besar dari upah minimum regional (umr). harga susu dan kualitas susu mempengaruhi jumlah susu yang terjual. jumlah susu yang terjual mempengaruhi pendapatan. harga susu secara langsung mempengaruhi pendapatan namun kualitas susu tidak secara langsung mempengaruhi pendapatan. perbaikan kualitas susu dengan manipulasi pakan perlu dilakukan. kata kunci: kambing ras kaligesing, penerimaan, biaya, pendapatan, model abstract the objectives of study to determine the income is obtained by kaligesing goat farmer and to determine the effect of some factors on the income. survey method was conducted in this study, 47 (forty seven) farmers in giripurno village, borobudur subdistrict, magelang regency through interview and observation. secondary and primary data were obtained to answer the objective. respondent characteristic, total revenue, total cost production, and total income were observed for 6 months observation. descriptive analysis and one sample t-test was used to analyze the data. path analysis with tetrad iv was used to determine the model. dairy goat farmer in the study area rear goat were 10 heads on average. total revenue obtained was idr 4,975,500, total cost spent was idr 1,865,200, and total income was idr 3,110,300. milk price and quality of the milk have influenced the number of milk sold. the number of milk sold has influenced the income significantly. milk price has influenced directly to the income while quality of milk has not directly influenced the income of farmer. hence, improvement of quality of goat milk through diet manipulation is needed. keywords: kaligesing goat, revenue, cost, income, model introduction increasing of human population leads increasing the livestock product such as milk. at present, milk attracts the interest of consumer, because of its benefit. milk goat is believed contain high n-3 pufa. some researchers (el badry et al., 2007; dommels et al., 2002; tschakert, 2007; givens et al., 2006) stated that n-3 pufa have positive effect on human health. dairy goat produce goat milk which many function for human (pihlanto, 2006)), goat milk 308 j.indonesian trop.anim.agric. 37(4) december 2012 contain high cla (pihlanto, 2006), omega 3 (pihlanto, 2006; huffman et al., 2011). milk believed can reduce the diabetes, cancer risks (parodi, 1997). thorsdottir et al. (2004) omega 3 contained in milk could prevent type 2 diabetes in men and coronary heart disease in woman. kaligesing goat is an indigenous goat from indonesia. kaligesing goat was announced as local breed from central java by ministry of agriculture through decisien letter no. 2591/kpts/pd.400/7/2010 on 19 july 2010. this goat usually are raised in upland area such as purworejo regency and magelang regency. contributions of kaligesing rearing are 1) provide goat milk to the consumer, 2) provide additional income for the farmer ’s family, 3) reduce poverty in rural area. budisatria and udo (2012) stated there are some factors influencing the income of goat farmer in central java such as farmer behavior, capital, quality of goat and price. improvement of those factors will influence the income of farmer. the income is obtained by farmer will influence the livelihood especially in rural area. intensification is one approach to increase the productivity and income of smallholder farmer (moll et al., 2007; udo et al., 2011). kaligesing goat farming usually does by farmers in rural area as additional income beside their main income. dairy goat farming contributes improve the livelihood especially for small scale farmers in rural area in central java. the cold weather of area support goat development. central java governments through department of animal husbandry and animal health always do some program to develop kaligesing goat. the efforts show positive effect on increasing the number of kaligesing goat in some area in central java. the price of milk and quality of milk are fluctuated; those factors are hypothesized influence income of the farmers. the objectives of study was to determine the income obtained by kaligesing goat farmer and to determine the effect of some factors on the income. materials and methods study area the study was conducted in giripurno village, borobudur subdistrict, magelang, central java province. giripurno village is located in 700 m upper than sea. all of goat farmers in giripurno are member of “sari makmur” group which won the 2nd best farmer group in indonesia. the village is very fit with kaligesing goat requirement condition. the extension service and farming management were very good, so the success of the group could be followed by other group in indonesia which interest to develop kaligesing goat. the study was conducted for 6 months, start from april to august 2012. forty seven farmers member of goat farmer group were chosen as respondents. data collection survey method was used in the study. secondary data and primary data were collected from depth interview with the goat farmers which helped questionnaire. characteristics respondents such as age, educational background, number of family, number of goat, experience time were observed. secondary data was obtained from the farmer recording. as the second best group performance in indonesia, recording of farmer were completed. secondary data are consisted of milk price, quality of milk recorded is based on milk fat and color, number of milk sold, monthly revenue, monthly cost of production and monthly income were computed to determine the income obtained by goat farmers. statistical analysis descriptive analysis and one sample t-test were used in the study. descriptive analyses were used to determine the characteristics of the respondents. one sample t-test was used to compare the income obtained by the goat farmers and minimum regional salary. spss version 16 was used to help the analysis. tetrad 4 was used to determine the optimum economic model which influences the income of goat milk farmers. all of data were converted to score before analysis conducted (ghozali, 2010). model of factors influencing the dairy goat farmer would follow: y = b1mp+b2qm+b3nms where: y = income of dairy goat farmer (idr) mp = milk price (idr) qm = quality of milk (score) nms = number of milk sold (liter) y is income of dairy goat farmers calculated by total revenue minus total cost, milk price (mp) is average price of milk a month, score was used to measure the quality of milk (qm) where factors influencing income of kaligesing goat farmers (a. setiadi et al.) 309 1=bad; 2= fair and 3=good. number of milk sold (nms) was computed by total number sold a month. results and discussion goat farmers characteristics most of the farmers were 41-64 years old, showed that almost goat farmers still in productive age. productive age of the farmers would support the goat development. government of magelang always support the farmers through provide some trainings such as artificial insemination, milk processing, and recording data. finding the result showed 46.8% of the farmers were junior high schools passed, and just 2.1% graduated from university. almost all farmers have experience more than 5 years. usually farmers rear goat in high number (table 1). the numbers of goats raised by farmers usually more than 10 because they found goat farming were profitable. at present the price of milk was idr 15,000 to 20,000 per liter. dairy goat business has been cultivated since early 2000. the high price of milk, and high price of kid had attracted almost the farmers residence culture the goat. the area also is rich on leguminous which support goat business. availability of feed is major factor attract people raise dairy goat in the area. some training were done to increase skill and ability of the farmers. cost of production cost of production consisted fix cost and variable cost. feed cost was the highest cost spent by farmers. total fix cost spent by farmers include goat depreciation, facility depreciation and cage depreciation. variable spent by farmers include feed, salt, artificial insemination, labor, cage repair, plastic and other cost. total cost spent by farmers per month was idr 1,865,200. feed cost was the main cost in goat rearing. usually farmers fed goat with calliandra and other leguminous which grow well in surrounding area. concentrates feeding were given to goat in small unit. some farmers hire labor to looking for leguminous, labor cost spent by farmers was idr 400,000 per month on average (table 2). revenue revenue was obtained by farmers per month was idr 4,975,500. total revenue obtained from fresh goat milk sold per month was idr 3,600,000, the revenue obtained from kid goat sold was idr 160,000, the revenue obtained from selling feces was idr 15,500, and additional value from goat reared was idr 1,200,000. based on observation, farmers very satisfy raised goat (table 3). as shown in table 3. total revenue dominant came from selling fresh goat milk. during the study the price of goat milk was high. the condition lead the revenue was high too. income income was computed by subtracting revenue was obtained with cost of production spent by farmers. the income obtained from raising goat was idr 3,110,300 (table4). the condition result was in good livelihood in the area. as shown in table 5. the income was obtained by farmers was higher than minimum regional salary of magelang district, the condition supported by some research was done by some 310 j.indonesian trop.anim.agric. 37(4) december 2012 table 1. kaligesing goat farmers’ characteristics identity number(persons) (%) age( year) 15-40 41-64 >64 20 26 1 47.9 50.1 2.1 educational background elementary junior high school senior high shool university 21 22 3 1 44.7 46.8 6.4 2.1 main job farmers non farmers 35 12 74.5 25.5 family number 1-4 5-7 7-9 20 26 1 47.9 50.1 2.1 farmers experience 1-10 11-20 21-30 21 20 6 4.3 68.1 27.6 goat numbers 10-24 25-44 45-61 41 5 1 87.2 10.7 2.1 researchers (lindenlauf et al., 2010; hansson and ferguson, 2011). they conclude that small ruminant research could improve the livelihood in rural area. improvement of market, feed availability and price of the product would improve the goat business. the goat rearing in order to improve livelihood in rural area could be implemented. strategy to develop goat such as provide better feed, better milk price is needed to improve the goat development. the high income was obtained by farmers generate from kaligesing goat rearing showed kaligesing goat are potential to develop in magelang subdistrict. factors influencing the income as shown in figure 1, the model was fit. chi square was small, degree of freedom was 1 and probability was 0.65. milk price influence number of milk sold significantly (p<0.05). result showed that the increasing of milk price also would increase the income. if milk price increase by idr 1 hence income would increase by idr 0.18 when the other factors constant (table 6). quality of milk significantly influence the number milk sold. the increasing quality of milk by 1 score would increase the number of milk sold by 0.04 liter. number of milk sold influenced significantly the income. the number of milk sold increased by 1 liter enhances the income by idr 0.37 when the other factors constant. quality of milk was not significantly (p>0.05) influenced the income. coefficient obtained in path analisis was -0.07, it means that quality of goat milk need to improve. result of study showed the quality of milk was fair category. improvement of milk quality will increase milk sold and finally will increase the income. further research on improvement of milk quality through diet manipulation is needed. the result was supported by panin and mahabile (1997) which stated the increasing of milk quality will increase the selling of number of product. milk price would influence the profitability of goat milk hence would increase the welfare of farmers in rural area. based on path analysis, to increase the factors influencing income of kaligesing goat farmers (a. setiadi et al.) 311 table 3. revenue obtained by goat farmers item average (idr/10 goats/month) fresh goat milk sold 3,600,000 kid goat sold 160,000 feces sold 15,500 goat additional value added 1,200,000 total 4,975,500 table 2. cost of production goat raising in study area cost average (idr/10 goats/month) fix cost goat depreciation facility depreciation cage depreciation 459,000 5,600 10,000 variable cost feed salt medicine artificial insemination labor cage repair plastic other cost 923,500 2,600 4,000 5,000 400,000 20,000 23,000 12,500 total 1,865,200 currency 1usd $ = idr 9,300 table 4. average income obtained by goat farmers item average(idr/10 goats/month) revenue 4,975,500 cost of production 1,865,200 income 3,110,300 table 5. one sample t-test comparison between income and minimum regional salary item average(idr/10 goats/month) income 3,110,300 minimum regional salary 960,000 income of dairy goat farmer could be conducted through improvement of goat milk price. milk quality could be improved by diet manipulation. further research is needed through goat feeding trial on milk quality. improvement of milk quality would increase the milk price and finally would increase the income.. conclusion based on the research, goat farming was able to generate additional income for farmer. the income obtained was higher than the minimum regional salary in magelang regency. milk price and quality of milk sold have influenced the number of milk sold. milk price significantly influenced the income, while quality of milk sold was not significantly influenced the income. number of milk sold influenced significantly the income. further research on effect of alternative feed resources is needed on goat milk quality to enhance the number milk sold. production of high quality of goat milk would increase the price and finally would increase the farmer ’s income. acknowledgments the authors thank to diponegoro university which fund the research through hibah kompetitif dana pnbp undip no contract 259.4/un7.5/pg/2012, and farmers in giripurno village who very cooperative to fill the questionnaire. references budisatria, i.g.s and. h.m.j. udo. 2012. goat based aid programme in central java: an effective for the poor and vulnerable? small ruminant research. 2:12-28 huffman, s.l., r.k. harika., a. eilander., and s.j.m. osendarp. essential fats: how do they affect growth and developments of infants and young children in developing countries? a literature review. maternal and child nutrition. 7 (suppl.3) pp 44-65 ghozali, i. 2010. structural equation modeling: mencari hubungan kausalitas antar variabel pendekatan induktif dengan program tetrad iv. badan penerbit universitas diponegoro. gursoy, o. 2006. economics and profitability of sheep and goat production in turkey under new support regimes and market conditions. small ruminant research 62:181-191 hansson, h, and r. ferguson. 2011. factors influencing the strategic decision to further develop dairy production-a study of farmers in central sweden. livestock science. 135:110-123 moll, h.a.j., s.j. stall., and m.n.m. ibrahim. 2007. smallholder dairy production and markets: a comparison of production systems in zambia, kenya and sri lanka. agricultural systems. 94:593-603 muller-lindenlauf, m., c. deittert., and u. kopke. 2010. assesment of environemntal effects, animal welfare and milk quality among organic dairy farms. livestock science.128:140-148 panin, a., and m. mahabile. 1997. profitability and household income contribution of small ruminants to small-scale farmers in botswana. small ruminant research. 25:915 parodi, p.w. 1997. cows‘milk fat components as potential anticarcinogenic agents. j. nutr. 127: 1055-1060 312 j.indonesian trop.anim.agric. 37(4) december 2012 figure 1. model to increase the goat farmer income 0.18 -0.07 0.37 0.04 0.45 milk price quality of milk number of milk sold income model fit: chi square = 0.2 degree of freedom=1 probability = 0.65 pihlanto, a. 2006. antioxidative peptides derived from milk proteins. international dairy journal. 16:1306-1314 thorsdottir, i., j. hill, and a.ramel. 2004. omega 3 fatty acid supply from milk associates with lower type 2 diabetes in men and coronary heart disease in women. preventive medicine. 39:630-634 tschakert, p. 2007. environmental services and poverty reduction: options for smallholders in the sahel. agricultural systems. 94:75-86 udo, h.m.j., h.a. aklilu., l.t. phong., r.h. bosma., i.g.s. budisatria., b.r. patil., t. samdup and b.o. bepe. 2011. impact of intensification of different types of livestock production in smallholder crop-livestock systems. livestock science.139:22-29 factors influencing income of kaligesing goat farmers (a. setiadi et al.) 313 the effect of calcium and phosphorus dietary level on egg production of the bantul local duck h. sasongko1, t. yuwanta1, zuprizal1, supadmo1 and i. widiyono2 1faculty of animal science, gadjah mada university, jl. fauna no.3, bulaksumur yogyakarta 55281indonesia 2faculty of veterinary medicine, gadjah mada university, jl. fauna no.2, bulaksumur yogyakarta 55281indonesia corresponding e-mail : herusasongko@yahoo.com received september 30, 2012; accepted november 11, 2012 abstrak penelitian ini dilakukan untuk mengetahui pengaruh beberapa level kalsium dan fosfor pakan terhadap performa produksi itik bantul. sebanyak 270 itik betina umur 26 minggu digunakan dalam penelitian ini menggunakan rancangan pola faktorial 3x3, yaitu 3 level ca: 3,75, 3,25 dan 2,75% dengan 3 level p: 0,45, 0,35, dan 0,25%. masing-masing perlakuan menggunakan 3 replikasi kandang, setiap kandang berisi 10 ekor itik. penelitian dilaksanakan selama 12 minggu produksi. data yang dicatat meliputi: (a) konsumsi pakan (g/ekor/hari), (b) produksi telur (% hda), dan (c) konversi pakan. semua data yang diperoleh selama penelitian dianalisis menggunakan analisis ragam pola faktorial dengan program komputer spss. semua variabel yang diteliti menunjukkan hasil yang tidak berbeda nyata secara. peningkatan level ca pakan menunjukkan tren peningkatan produksi telur. rerata konsumsi pakan bervariasi 151-159 g/ekor/hari; produksi telur 75-84%, dan konversi pakan 184-212 g/butir. kata kunci: level kalsium dan fosfor, itik lokal, produksi telur abstract this study was conducted to determine the effect of various calcium and phosphorus levels on the production performance of bantul duck. a total of 270 female ducks, 26 weeks age, were used in the study with a 3x3 factorial treatment, which is a combination of three levels of ca: 3.75; 3.25 and 2.75% and three levels of p: 0.45, 0.35 and 0.25%. each treatment occupied three replication cages, each of which consisted of 10 ducks. the experiment was conducted for 12 weeks.. data recorded were: (a) feed intake (g/duck/day), (b) egg production (% hda), and (c) feed conversion. all quantitative data obtained during the study were analyzed by analysis of variance (anova) using spss computer program. the results of the variables recorded did not show significantly difference. increasing ca level on feed showed an increasing trend of egg production. the average feed consumption ranged at 151-159 g/duck/day; egg production was 75-84%, and the feed conversion was 184-212 g/egg. keywords: calcium and phosphorus levels, local duck, egg production introduction in indonesia there are several kinds of local duck, one of them is bantul duck in bantul, yogyakarta province. bantul duck is known for its high egg production and many of them are developed as layer duck by the farmer. these ducks use scavenging system on paddy field after harvest and along the river. the herdsman bring the duck from one place to another, where there are sufficient feeds, such as spilled rice, small snail, worm, little fish, etc. in line with the growing needs of eggs, and the limited grazing area, breeding ducks have been much evolved into intensive systems. in intensive rearing system, all nutrients should be obtained from food because ducks do not have a chance to get from nature. one important nutrient for eggs production after protein and energy is mineral. mineral plays a very important role in poultry layer production because 97% of the egg shell consists of minerals component. the large type of mineral is calcium, calcium and phosphorus dietary level in local duck (h. sasongko et al.) 257 whose compounds as calcite cac03, about 95% of the total weight of eggshell (nys and gautron, 2007). the presence of ca is known to have close links with the mineral phosphorus. thus, the discussion of ca is always associated with the phosphorus in formula ca: p ratios (lukic et al., 2009). there was a general trend that metabolizable calcium decreased with the increases in calcium levels in the diet. chen and sen (1989) reported that diet containing calcium levels of 2, 3 and 4% for tsaiya duck, resulted in metabolizable calcium 62.84, 57.06, and 45.63%, respectively. levels of ca, vitamin d and p must be adequate and ca dietary inclusion rates in particular should be increased to an appropriate levels in layer-diet before sexual maturity (about 14 weeks of age). most dietary interventions are ineffective if hens are already in lay, since effects will only be on non-structural woven medullary bone (fleming, 2008). for brown laying hens of 47 weeks of age, the feed intake of 115 g per hen per day with a dietary ca content of 3.5% is sufficient to complete 0.27% available phosphorus (ap) in wheat-based diet and 0.30% ap in maize-based diet without added phytase (skřivan, 2010). especially for ducks, scott and dean (1991) in their book, nutrition and management of ducks, did not discuss much mineral for layer duck. the study was more about the meat of the duck. there are several examples of mineral requirement for ducks, which are pekin breeder 2.85% ca and 0.35% p (available); khaki chambell 3.5% ca and 0.42% p, as well as for the wild duck 3.5% ca and 0.4% p. the requirement set by the nrc (1994) for the pekin duck breeder is ca 2.75% and p 0.35%. chen et al. (1980) cited scott and dean (1991), who conducted research on tsaisya laying ducks, obtained that on 2.75% ca, p level for maximum eggshell strength was 0.46% and for maximum egg production and feed conversion was 0.56%. in the further study the requirement ca for tsaisya was 3.0% and khaki cambell was 3.25%. meanwhile, the sni (2006) mineral requirements for laying ducks were 3.0 4.0% ca and 0.6 1.0% for total phosphorus with a minimum of 0.35% available phosphorus. the standard mineral requirement for duck is very importan for production and reproduction, however, up to now there is no clear standard mineral requirements for the local ducks in indonesia, including bantul duck. the standard used by farmers for laying ducks generally still follows the mineral requirement for chicken, or refers to overseas standard. obviously, the standard is not appropriate for the indonesian local ducks because of the different nature, characteristics, and climate where they grow ducks. therefore, the study was conducted to determine the effect of the ca and p on egg production of bantul duck. materials and methods materials the main material of this study was 270 bantul ducks and feed treatment consisting of soybean meal, corn, rice bran, fish meal, limestone, dicalcium phosphate, and vitaminmineral premix (table 1). methods the experiment was conducted by using a completely randomized factorial design, 3x3, which was 3 ca levels: 2.75, 3.25 and 3.75% and p 3 levels: 0.25; 0.35 and 0.45%; thus, there were 9 treatments (table 2). feed prepared in iso protein and calories, with 17.2% cp and 2850 kcal me / kg (table 1). each treatment used three replication cages, of which each (1 x 3 m2) consisted of 10 ducks. feed and water were given ad libitum. the experiment was conducted for 12 weeks. data collected for 12 weeks were: (a) eggs production (%), (b) the average of feed intake (g/duck/day), and (c) average feed conversion by comparing the amount of feed weight to egg weight. data analysis the experiment was conducted by using a 3×3 factorial design. the main effects were concentration of calcium (ca), concentration of phosphorus (p) in the diets and the interaction among these two factors (ca × p). the data were analyzed by the analysis of variance (anova) using the spss software. all the differences were considered non-significant at 5%. results and discussion the data for egg performance, feed intake (fi) and feed conversion ratio (fcr) are presented in table 3. in the present study, all data were not statistically significant between treatments. 258 j.indonesian trop.anim.agric. 37(4) december 2012 feed consumption the average of feed consumption for the nine treatments ranged from 150.7 to 158.6 g/duck/day (table 3). feed intake of the study was smaller than the one managed by the farmers in general, which is about 160 to 200 g/duck/day (sasongko, 2010). chen and shen (1987) who conducted research on tsaiya, taiwan local ducks, calcium and phosphorus dietary level in local duck (h. sasongko et al.) 259 table 1. ingredients and calculated nutrient composition of experimental diets ingredients treatments* a b c d e f g h i corn 62.27 62.27 62.27 62.27 62.27 62.27 62.27 62.27 62.27 soybean meal 18.79 18.79 18.79 18.79 18.79 18.79 18.79 18.79 18.79 rice polishing 2.57 2.57 2.57 2.57 2.57 2.57 2.57 2.57 2.57 fish meal 2.73 2.73 2.73 2.73 2.73 2.73 2.73 2.73 2.73 mbm 2.83 2.83 2.83 2.83 2.83 2.83 2.83 2.83 2.83 crude palm oil 1.10 1.10 1.10 1.10 1.10 1.10 1.10 1.10 1.10 l-lysine hcl 0.20 0.20 0.20 0.20 0.20 0.20 0.20 0.20 0.20 dl-methionine 0.10 0.10 0.10 0.10 0.10 0.10 0.10 0.10 0.10 kalmiral (mineral mix) 0.04 0.04 0.04 0.04 0.04 0.04 0.04 0.04 0.04 kalvimix (vitamin mix) 0.02 0.02 0.02 0.02 0.02 0.02 0.02 0.02 0.02 salt 0.28 0.28 0.28 0.28 0.28 0.28 0.28 0.28 0.28 limestone 7.83 8.16 8.50 6.51 6.85 7.18 5.20 5.51 5.87 dcp 1.12 0.56 0.01 1.12 0.56 0.01 1.12 0.56 0.01 filler 0.13 0.35 0.56 1.44 1.66 1.88 2.76 3.00 3.20 total 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 calculated nutrient cp (%) 17.2 17.2 17.2 17.2 17.2 17.2 17.2 17.2 17.2 me (kcal/kg) 2850 2850 2850 2850 2850 2850 2850 2850 2850 ca (%) 3.75 3.75 3.75 3.25 3.25 3.25 2.75 2.75 2.75 p avialable (%) 0.45 0.35 0.25 0.45 0.35 0.25 0.45 0.35 0.25 fiber (%) 2.48 2.48 2.48 2.48 2.48 2.48 2.48 2.48 2.48 fat (%) 5.00 5.00 5.00 5.00 5.00 5.00 5.00 5.00 5.00 linoleic acid (%) 1.70 1.70 1.70 1.70 1.70 1.70 1.70 1.70 1.70 lysine (%) 1.06 1.06 1.06 1.06 1.06 1.06 1.06 1.06 1.06 methionine (%) 0.40 0.40 0.40 0.40 0.40 0.40 0.40 0.40 0.40 methionine+cystine (%) 0.62 0.62 0.62 0.62 0.62 0.62 0.62 0.62 0.62 tryptophan (%) 0.17 0.17 0.17 0.17 0.17 0.17 0.17 0.17 0.17 arginine (%) 1.09 1.09 1.09 1.09 1.09 1.09 1.09 1.09 1.09 isoleucine (%) 0.71 0.71 0.71 0.71 0.71 0.71 0.71 0.71 0.71 valine (%) 0.86 0.86 0.86 0.86 0.86 0.86 0.86 0.86 0.86 ca:p ratio 8.3 10.7 15 7.2 9.3 13 6 7.9 11 *: a (ca 3.75%, p0.45%); b (ca 3,25%, p 0.45%); c (ca 2.75%, p0,45%); d (ca2.75%, p0.35%); e (ca 3.25%, p 0.35%); f (ca 2.75%, p.0.35%); g (ca 3.75%, p0.25%); h (ca 3.25%, p 0.25%) and i (ca 2.75%, p 0.25%). with the body size was almost the similar to the bantul duck, showed the results of feed intake ranged from 205 to 225 g/duck /day with feed on mash form. feed used in this study was generally pellet, while farmers usually give mash. egg production the level of ca and p treatments showed no different on egg production. the average of egg production for 12 weeks (3 months), ranged from 71.8 to 84.4% (table 3.). egg production for this study was relatively higher than the production from the farmers, which was about 65% (sasongko, 2010). as shown in figure 1, the average of egg production indicated an increasing trend with increasing ca content in the feed. similar to figure 2, at all levels of p, egg production showed an increasing trend of increasing ca. in all treatment groups, p levels from 0.25 to 0.45 % levels showed a consistent picture of the same production of ca. these results were in accordance with the findings of many researchers. ducks dietary at 3.75% ca showed the highest values of egg production during the whole experimental periods compared to 3,25 and 2,75% ca (figure 2). chen and shen (1989), showed that feed with ca 1 to 5% with the same level of p 0.4% in tsaiya ducks, showed decreased egg production by ca 2% level, while the ca between 3 to 5% levels did not show significant difference in egg production. kesavarz (1990) using 2 and 3.5% ca levels for the laying hens producing significantly different egg production, which were 76.2 and 79.2% respectively. roland et al. (1996) reported that increasing dietary ca level linearly increased egg production. chamber et al. (1996) reported that increased ca on feed increased egg production.the other research, solarte-narvaez et al. (2006), stated ca on white laying hens with 2.6, 3.0 and 3.4% levels, resulting in egg production respectively 77.6, 81, and 83.1% . a similar study conducted by sultana et al. (2007) stated that the quail given ca 3% produced higher egg than 2.75 and 2.5%.. also navaezsolarte et al. (2008) reported that increasing dietary ca had a quadratic effect on egg production and egg mass. as dietary ca level increased from 2.6 to 3.8%, egg production also increased from 77.6 to 83.1%, resulting in a 5.6% increase. however, further increase of dietary ca from 3.4 to 4.2%, had no improvement of egg production. 260 j.indonesian trop.anim.agric. 37(4) december 2012 table 2. factorial experiment design ca-3.751 ca-3.252 ca-2.753 p-0.454 a b c p-0.355 d e f p-0.256 g h i a-i : feed treatments, 1ca = 3.75%, 2ca = 3.25%, 3ca = 2.75%, 4p = 0.45%, 5p = 0.35%, 6p = 0.25%, figure 1. eggs production of 3 phosphorus levels: 0.45% ( ); 0.35% ( ), and 0.25% ( ) within 3 calcium levels (3.75; 3.25, and 2.75%) 40 50 60 70 80 90 100 ca-3.75 ca-3.25 ca-2.75 calcium levels eg g p ro d u ct io n ( % ) figure 1. eggs production of 3 calcium levels: 3.75% ( ); 3.25% ( ), and 2.75% ( ) within 3 phosporus levels (0.45; 0.35, and 0.25%) 40 50 60 70 80 90 100 p-0.45 p-0.35 p-0.25 phosphorus levels eg g p ro d uc ti o n (% ) feed conversion ratio the results of the calculation of feed conversion ratio (fcr) (g feed / g egg) are shown in table 3. based on the statistical analysis, the level of ca and p treatments showed no significant difference in results (p> 0.05) on frc. the results of feed conversion ranged from 2.73 (ca 3.75%, p 0.45%) to 3.22 (2.75% ca, 0.35% p) (table 3). according the graph in figure 3, it is clear that decreasing levels of ca tend to increase feed conversion ratio. based on the results presented in figure 3, it can be seen that the decrease in ca levels at all levels of p, increasing the feed conversion. based on the calculation of feed conversion for the production of each egg, it was found out that the average yield was 182.2 g (ca 3.75, p 0.45%) to 212.4 g (ca 2.75, p 0.25%), as shown in table 3, apparently, the conversion of feed in grams per gram egg produced similar results of feed conversion per egg produced. a decrease in the calcium content of feed tends to increase the amount of feed used to produce each egg. at each level of p, the pattern of feed conversion results showed similarities, i.e. at p 0.45; 0.35, and 0.25 decrease in ca content increases the amount of feed (figure 4), while the phosphorus levels did not show a different pattern. conclusion calcium and phosphorus with the levels of 3.75 to 2.75% and 0.45 to 0.25%, respectively, calcium and phosphorus dietary level in local duck (h. sasongko et al.) 261 figure 3. feed conversion ratio (g/ g egg) of 3 calcium levels: 3.75% ( ); 3,25% ( ), and 2.75% ( ) within 3 phosporus levels (0.45; 0.35, and 0.25%) 80 100 120 140 160 180 200 220 240 260 p-0.45 p-0.35 p-0.25 phosphorus levels fe e d c o n ve rs io n r at io ( g fe e d /e gg ) figure 4. fed conversion ratio (g/egg) of 3 calcium levels: 3.75% ( ); 3.25% ( ), and 2.75% ( ) within 3 phosporus levels (0.45; 0.35, and 0.25%) 40 50 60 70 80 90 100 p-0.45 p-0.35 p-0.25 phosphorus levels eg g p ro d u ct io n ( % ) table 3. feed intake, egg production and feed conversion during 12 weeks experiment. parameters treatments a b c d e f g h i feed intake (g/duck/day) 152.8 151.7 155.2 154.1 150.7 158.6 151.9 151.6 154.3 egg production (%) 83.9 78.5 73.3 78.7 75.4 76.6 84.4 78.6 72.6 feed conversion (g feed/g egg) 2.7 3.1 3.1 2.9 3.0 3.1 3.1 3.4 3.2 feed conversion (g feed/egg) 182.8 199.4 207.0 193.9 201.5 219.0 184.7 203.3 214.1 treatments explanation are similar to table 1. did not show statistically significant difference on production performance. increasing ca level on feed showed an increasing trend of egg production. the average feed consumption ranged from 151-159 g/duck/day; egg production was 75-84%, and the feed conversion was 184212 g/egg. references chamber, g.d., k.c. sadler and r.p. breitenbach. 1996. effects of dietary calcium levels on egg production and bone structure of pheasants. wildlife management 30: 65-73 chen, w.l. and t.f. shen. 1989. comparative ttudies on the ulitilization of calcium between laying tsaiya duck and leghorn hen. asian-aust. j. anim. sci. 2 (2): 67-75. de-vries, s., r.p. kwakkel and j. djikstra, 2010. dynamics of calcium and phosphorus metabolism in laying hens. in: phosphorus and calcium utilization and requirements in farm animal. cab international. fleming, r.h. 2008. nutritional factors affecting poultry bone health. proceeding of the nutrition society 67, 177-183. university of ulster, coleraine on16–19 july 2007 keshavarz, k and r.e. austic. 1990 effects of dietary minerals on acid-base balance and eggshell quality in chickens. j. nutr. 120(11):1360-1369. lukić, m., z. pavlovski, z. škrbić. 2009. mineral nutrition of modern poultry genotypes. biotechnology in animal husbandry 25(5-6): 399-409. narváez-solarte, w., h.s. rotagno, p.r. soares, l.f. uribe-velazquez and m.a. silva. 2006. nutritional requirement of calcium in white laying hens from 46-62 weeks of age. poult. sci. 5 (2): 181-184. national research council, 1984. nutrient requirements for poultry. 8th rev. ed. national academy press, washington, dc. nys, y., and j. gautron, 2007. structure and formation of the egg shell. in: bioactive egg compounds. reiner huopalahti, rosina lópez-fandino, marc anton, rüdiger schade. springer – verlag berlin heidelberg, roland, d.a. sr., m.m. bryant and h.w. rabon, 1996. influence of calcium and environmental temperature on performance of first cycle (phase 1) commercial leghorn. poult. sci. 75: 62-68 sasongko, h. 2010. feeding management evaluation of duck farmer group in brebes. proceedings of the 5th international seminar on tropical animal production, universitas gadjah mada, october 2010. pp. 364-367. scott, m.l. and w.f. dean. 1991. nutrition and management of ducks. ml scott of ithaca (ithaca, ny) skřivan, m., m. englmaierová and v. skřivanová 2010. effect of different phosphorus levels on the performance and egg quality of laying hens fed wheat and maize-based diets. czech j. anim. sci. 55 (10): 420–427 sni. 2006. standar nasional indonesia pakan itik petelur. sni 01-3910-2006 262 j.indonesian trop.anim.agric. 37(4) december 2012 the use of microsatellite markers to study genetic diversity in indonesian sheep jakaria1, m.s.a. zein2, s. sulandari2, subandriyo3 and muladno1 1faculty of animal science, bogor agricultural university, jl agatis, darmaga campus, bogor 16680 indonesia 2indonesian institute of sciences, jl. raya bogor km 46, cibinong 16911, bogor indonesia 3indonesian center for animal science research and development (icasrd), jl. veteran iii po box 221, 16002, bogor indonesia correspondence e-mail: jakaria@ipb.ac.id received january 9, 2012; accepted february 18, 2012 abstrak tujuan penelitian ini adalah mempelajari keragaman genetik populasi domba di indonesia menggunakan penciri dna mikrosatelit. sebanyak 18 lokus dna mikrosatelit digunakan untuk menentukan genotipe populasi domba indonesia. sampel darah domba yang digunakan sebanyak 200 ekor berasal dari populasi domba garut tipe tangkas, domba garut tipe daging, domba purbalingga, domba batur dan domba jember diektraksi dna total dengan menggunakan metode salting out. data lokus dna mikrosatelit dianalisis menggunakan program popgene 3.2. hasil penelitian menunjukkan bahwa diperoleh sebanyak 180 alel dari 17 lokus dna mikrosatelit, sedangkan rataan jumlah alel adalah 10 alel (6 sampai 18 alel) dari lima populasi domba indonesia (domba garut tipe tangkas, domba garut tipe daging, domba purbalingga, domba batur dan domba jember). nilai heterosigositas observasi (h o) dan heterosigostas harapan (he) diperoleh masing-masing 0,5749 dan 0,6896, sedangkan nilai genetik diferensiasi untuk inbreeding antar populasi (fis), dalam populasi (fit) dan rataan diferensiasi genetik (fst) masing-masing 0,1006; 0,1647 dan 0,0712. jarak genetik dan pohon genetik menunjukkan bahwa populasi domba indonesia berbeda antara populasi domba garut tipe tangkas, domba garut tipe daging, domba purbalingga, domba batur dan domba jember. berdasarkan hasil penelitian dapat disimpulkan bahwa diperlukan strategi program pemuliaan, pelestarian dan pemanfaatan secara berkelanjutan pada setiap populasi domba di indonesia. kata-kata kunci: domba indonesia, penciri dna mikrosatelit, keragaman genetik abstract the purpose of this research was to study genetic diversity in indonesian sheep population using microsatellite markers. a total of 18 microsatellite loci have been used for genotyping indonesian sheep. total sheep blood 200 samples were extracted from garut sheep of fighting and meat types, purbalingga sheep, batur sheep and jember sheep populations by using a salting out method. microsatellite loci data were analyzed using popgene 3.2 software. based on this study obtained 180 alleles from 17 microsatellite loci, while average number of alleles was 6.10 alleles (6 to 18 alleles) from five indonesian sheep populations (garut sheep of fighting type, garut sheep of meat type, purbalingga sheep, batur sheep and jember sheep population). the average of observed heterozygosity (ho) and expected heterozygosity (he) values were 0.5749 and 0.6896, respectively, while the genetic differentiation for inbreeding among population (fis), within population (fit) and average genetic differentiation (fst) were 0.1006, 0.1647 and 0.0712, respectively. genetic distance and genetic tree showed that indonesian sheep population was distinct from garut sheep of fighting and meat types, purbalingga sheep, batur sheep and jember sheep population. based on this results were needed a strategy for conservation and breeding programs in each indonesian sheep population. keywords: indonesian sheep, microsatellite marker, genetic diversity introduction indonesian sheep is generally maintained extensively by small holder farmers and only a small part reared intensively. besides that, sheep breeding is an important livestock sector, as a genetic diversity in indonesian sheep (jakaria et al.) 1 major source of meat and small part as social culture. indonesia has two types of sheep which are very popular throughout the country, i.e. thin tail type and fat tail type sheep (devendra and mcleroy, 1992). in addition, there are also fighting type sheep, so called garut sheep. indonesian thin and fat tail sheep have several advantages; especially they are well adapted to the hard environment, able to utilize low-quality feed, prolific (inounu et al., 1986), early puberty (sutama et al., 1988) and resistance to internal parasites (romjali et al., 1998). as one of the indonesian animal genetic resources, sheep plays an important role for small holder farmers. so, it is expected that sheep rearing may provide benefits for food availability needed, agricultural and social development of society in the future. moreover, genetic attention on indonesian sheep is still very limited. according to baumung et al. (2004), dna microsatellite is one of the popular markers used to estimate genetic diversity in livestock. dna microsatellite sequences are valuable genetic markers due to their dense distribution in the genome, great variation, co-dominant inheritance and easy genotyping. in recent years, they have been extensively used in parentage testing, linkage analyses, population genetics and other genetic studies (goldstein and pollock, 1997). several studies have reported that dna microsatellite marker have been widely used to study genetic diversity in spanish sheep (arranz et al., 2001), european sheep (peter et al., 2007), meat type sheep in china (chen et al., 2009) and ganjam sheep (arora et al. 2010). based on the lack of genetic information about garut sheep of fighting and meat types, purbalingga sheep, batur sheep and jember sheep populations as indonesian local sheep, so microsatellite markers became one of the reasons where this research was conducted to determine the genetic diversity in indonesian sheep population especially garut sheep of fighting type, garut sheep of meat type, purbalingga sheep, batur sheep and jember sheep populations. material and methods two hundred blood samples of unrelated animals were collected from five sheep populations in garut regency of west java, purbalingga and banjarnegara regencies in central java, and jember regency in east java (table 1). blood sample was taken through the vena jugular's and preserved in the magic buffer (anticoagulant, antifungal and antibacterial), and then stored in freezer. sheep total genomic was extracted by using salting-out method (mburu and hanotte, 2005). a total of 18 microsatellite markers used in this study were selected from the international society for animal genetics (isag) lists (fao, 1998) as follows ilsts05, mcm527, srcpsp05, oarfcb128, huj616, oarhh47, ilsts11, dyms1, bm8125, oarfcb226, oarae129, oarjmp29, srcrsp9, maf214, oarcp34, oarfbc203, maf09, maf65, respectively (table 2). amplification of these 18 microsatellite loci from sheep genomic dna of each individual was carried by using absys pcr machine based a manual of microsatellite genotyping with special reference to livestock population genetics protocol (mburu and hanotte 2005). genotyping is done using the reaction multi-loading/coloading in abi3130xl automatic sequencer machine. sample analyzed was divided into three co-loading. each co-loading consists of six sets of primer (pcr product) with four colors according to the label used. co-loading 1 consists ilsts5, mcm527, srcpsp05, oarfcb128, huj616 and oarhh47 loci. co-loading 2 consists ilsts11, dyms1, bm8125, oarfcb226, oarae129 and oarjmp29 loci. co-loading 3 consists srcrsp9, maf214, oarcp34, oarfcb203, maf09 and maf65 loci. allele identification of microsatellite loci were analyzed using genemapper software (version 3.7, applied biosystems). number of alleles (na) of each locus and the number of effective alleles (ne) per locus, observed heterozygosity values (ho) and expected heterozigosity (he), f statistics (fis, fit, fst) and genetic distance were calculated using genepop software (v3.2) (raymond and rousset, 2001). the genetic tree constructed using upgma (unweighted pair group method with arithmetic mean) method (nei et al., 1983). results and discussion from 18 loci of dna microsatellite amplified on five sheep populations (garut sheep of fighting type, garut sheep of meat type, purbalingga sheep, batur sheep and jember sheep population), only one locus (oarhh47 locus) did not successfully amplified (figure 1 and 2). 2 j.indonesian trop.anim.agric. 37(1) march 2012 seventeen of dna microsatellite loci used, 180 alleles were found in five indonesian sheep populations. the number of alleles per locus (na) varied from six alleles (srcrsp5 and bm8125 loci) to 18 alleles (oarfcb304 locus) with the average and standard deviation 10.6 and 3.7, respectively, for all populations. the number of alleles (na) and effective allele number (ne) in the total population are presented in table 3, while the average number of alleles (mna) and the average effective number of alleles (mne) are presented in table 4. these results showed high average number of alleles (10.6) in all indonesian sheep population breeds, while the number of alleles between population is lower (6.4) than all populations. the average number effective of allele is high (3.7) in jember sheep population, but low (2.7) in garut sheep of fight type population. the average number of alleles in each population is not different significantly (6.2 to 6.5). the average and standard deviation of the observed heterozygosity (ho) and expected heterozygosity (he) in indonesian sheep populations are 0.5749±0.1236 and 0.6878±0.1065, respectively (table 5). the average heterozygosity value was high in indonesian sheep population based on the observed (ho) and the expected heterozygosity (he) values. this result indicated that the genetic diversity within population of indonesian sheep were still high. seventeen microsatellite loci were used effectively to explain the genetic diversity between and within indonesian sheep populations. based on the seventeen microsatellite loci used in this study, 9 loci have number of alleles (na) more than 10 alleles, i.e. mcm527, huj616, dyms1, oarfcb226, oarae129, oarjmp29, maf214, oarfcb304 and maf209, loci. high number of alleles in each microsatellite locus would affect genetic variability (polymorphic) in indonesian sheep that displayed on all population. eight loci having less than 10 alleles are ilsts05, srcrsp5, oarfcb128, ilsts11, srcrsp9, bm8125, oarcp34, and maf65 loci. this result showed that indonesian sheep population has the allele number higher then ganjam sheep population. arora et al. (2010) reported that 137 alleles from 25 loci of microsatellite dna marker were found in ganjam sheep. f statistics (fis, fit and fst) analysis showed that inbreeding rate between (fis) and within (fit) populations are 0.1006 (10.06%) and 0.1647 (16.47%) respectively, whereas genetic differentiation (fst) between population is 0.0712 (7.12%) (table 6). high genetic diversity in indonesian sheep population indicated nonappearance of an intensive selection program and there is no depression inbreeding. the inbreeding rate value on between (fis) and within (fit) population are 0.1006 (10.06%) and 0.1647 (16.47%), respectively, which is relatively low. in contrast, the results of inbreeding rate in the chinese sheep populations (dorset, texel, blacksufolk, tan, han, hybrid th) are 0.5272 (52.72%) and 0.5602 (56.02%), for fis and fit respectively, whereas the expected heterozygosities (0.8177) were higher than the observed heterozygosities (0.3838), showing that homozygous individuals are more than common, and inbreeding is serious in the tested populations (chen et al., 2009). in contrast to our study results genetic diversity in indonesian sheep (jakaria et al.) 3 table 1. summary of sheep population samples population location type utility blood sample garut 1 small holder farmer, wanaraja-garut regency-west java. thin tail fighting 40 garut 2 small holder farmer, wanaraja-garut regency-west java. thin tail meat 40 purbalingga small holder farmer, kaligondangpurbalingga, central java. thin tail meat 40 batur small holder farmer, baturbanjarnegara,central java. fat tail meat 40 jember upt garahan-jember-east java fat tail meat 40 showed that the observed (ho) and expected (he) heterozygosity on indonesian native sheep populations were similar. genetic tree constructed on the basic of genetic distances among populations are divided into four major groups namely, garut sheep (thin 4 j.indonesian trop.anim.agric. 37(1) march 2012 table 2. the primer sequences, label and temperature annealing of the used microsatellite marker locus name sequences 5’à 3’ forward/ reverse label ta (oc) allele size (bp) chromosomal location ilsts005 ggaagcaatgaaatctatagcc tgttctgtgagtttgtaagc 6fam 55 174-218 7 mcm527 gtccattgcctcaaatcaattc aaaccacttgactactccccaa ned 56 165-187 5 srcrsp5 ggactctaccaactgagctacaag gtttctttgaaatgaagctaaagcaatgc vic 55 126-158 18 oarfcb128 attaaagcatcttctctttatttcctcgc cagctgagcaactaagacatacatgcg 6fam 56 96-130 2 huj616 ttcaaactacacattgacaggg ggacctttggcaatggaagg pet 58 114-160 13 oarhh47 tttattgacaaactctcttcctaactccacc gtagttatttaaaaaaatatcatacctcttaagg ned 56 130-152 18 ilsts11 gcttgctacatggaaagtgc ctaaaatgcagagccctacc 6fam 61 256-294 9 dyms1 aacaacatcaaacagtaagag catagtaacagatcttcctaca ned 56 159-211 20 bm8125 ctctatctgtggaaaaggtggg gggggttagacttcaacatacg ned 52 110-130 1 oarfcb226 ctatatgttgcctttcccttcctgc gtgagtcccatagagcataagctc vic 58 119-153 2 oarae129 aatccagtgtgtgaaagactaatccag gtagatcaagatatagaatatttttcaacacc 6fam 56 133-159 5 oarjmp29 gtatacacgtggacaccgctttgtac gaagtggcaagattcagaggggaag pet 56 96-150 24 srcrsp9 agaggatctggaaatggaatc gcactcttttcagccctaatg 6fam 55 99-135 12 maf214 gggtgatcttagggaggttttggagg aatgcaggagatctgaggcagggacg 6fam 58 174-282 16 oarcp34 gctgaacaatgtgatatgttcagg gggacaatactgtcttagatgctgc pet 57 112-130 3 oarfcb304 ccctaggagctttcaataaagaatcgg cgctgctgtcaactgggtcaggg vic 58 150-188 19 maf209 gatcacaaaaagttggatacaaccgtgg tcatgcacttaagtatgtaggatgctg vic 65 109-135 17 maf65 aaaggccagagtatgcaattaggag ccactcctcctgagaatataacatg ned 56 123-163 15 6fam= blue color, ned= yellow color, vic= green color and pet = red color, ta = temperature annealing a tail sheep), purbalingga sheep (thin tail sheep) and then batur and jember sheep (fat tail sheep) showed that exactly indonesian sheep populations were distinct (table 7; figure 3). garut sheep population (fight and meat types) and jember sheep population (fat tail type) had a distant of genetic tree, whereas the closest genetic distance was found in both garut sheep population, namely fighting and meat types sheep populations. genetic tree in five indonesian sheep genetic diversity in indonesian sheep (jakaria et al.) 5 figure 1. pcr product example of dna microsetellite map214 locus by 1.5% agarose gel electrophoresis. m: marker 100 bp; line 1-14 : sample number figure 2. genotyping result example of dna microsatellite maf214 locus by using abi3130xl sequencer automatice machine. (a): 183/243 genotype heterozygote; (b) 183/183 homozygote genotype; (c) 243/243 homozygote genotype populations showed distinctive from others. garut sheep groups (fights and meat types) showed that genetic distance are closer to purbalingga sheep compared to jember sheep population. a genetic distance among indonesian sheep populations was supported by the average genetic differentiation (fst) (7.12%). other studies reported that average genetic differentiation (fst) 7% found in spanish 6 j.indonesian trop.anim.agric. 37(1) march 2012 table 3. number af allele (na) and number effective of allele (ne) for 17 loci in indonesian sheep population locus total sample*) number of allele (na) effective number of allele (ne) ilsts05 193 9 2.1 mcm527 188 13 4.4 srcrsp5 188 6 2.4 oarfcb128 193 9 5.3 huj616 193 14 2.8 ilsts11 185 7 2.3 srcrsp9 193 7 2.9 dyms1 182 15 4.9 bm8125 184 6 2.2 oarfcb226 182 16 3.6 oarae129 185 10 3.2 oarjmp29 185 10 2.5 maf214 195 10 2.9 oarcp34 181 7 3.4 oarfcb304 192 18 7.9 maf209 192 14 5.4 maf65 178 9 4.0 mean 187.5 10.6 3.7 st. dev 3.7 1.5 *) total sample each locus analyzed from 200 samples table 4. mean number of allele (mna) and mean number effective of allele (mne) for 17 loci in five indonesian native sheep populations population total sample*) mna mne garut-1 37 6.4 ± 2.21 2.7 ± 0.84 garut-2 38 6.2 ± 2.09 3.1 ± 1.09 purbalingga 37 6.4 ± 2.37 3.1 ± 1.24 batur 38 6.4 ± 2.26 3.2 ± 1.41 jember 38 6.5 ± 2.45 3.7 ± 1.58 *) total sample each population analyzed from 40 samples sheep (arranz et al., 2001), 6.98% in meat type sheep china (chen et al., 2009) and 5.7% in european sheep (peter et al., 2007). these results showed that genetic differentiation values in indonesian sheep population higher than spanish sheep population, china's meat type sheep population and european sheep population, respectively. a certainty, dna microsatellite marker was very useful in the study of genetic diversity, genetic differentiation, and genetic tree. it can be applied widely in livestock, including indonesian sheep population, i.e. garut sheep including garut sheep as fighting and meat types, batur sheep, genetic diversity in indonesian sheep (jakaria et al.) 7 table 5. mean and standard deviation of observed (ho) and expected (he) heterozygosity for 17 microsatellite loci in indonesian native sheep population total sample*) ho he garut-1 37 0.5389 ± 0.1507 0.6084 ± 0.1062 garut-2 38 0.5674 ± 0.1509 0.6353 ± 0.1207 purbalingga 37 0.5640 ± 0.1593 0.6465 ± 0.1173 batur 38 0.5432 ± 0.2028 0.6242 ± 0.1682 jember 38 0.6559 ± 0.2011 0.6759 ± 0.1418 total 188 0.5749 ± 0.1236 0.6878 ± 0.1065 *) total sample each population success analyzed from 40 samples table 6. fis, fit and fst for 17 loci in indonesian sheep population locus fis fit fst ilsts05 0.0788 0.1372 0.0634 mcm527 0.0051 0.0832 0.0785 srcrsp5 0.5304 0.5607 0.0645 oarfcb128 0.0558 0.1629 0.1135 huj616 0.1203 0.1559 0.0405 ilsts11 0.0544 0.1365 0.0868 srcrsp9 0.0356 0.1201 0.0876 dyms1 0.0513 0.1080 0.0598 bm8125 0.0649 0.1192 0.0580 oarfcb226 -0.0382 0.0174 0.0536 oarae129 0.2527 0.3125 0.0800 oarjmp29 -0.0314 0.0063 0.0366 maf214 0.1054 0.1579 0.0587 oarcp34 0.0886 0.1591 0.0773 oarfcb304 0.1496 0.2084 0.0692 maf209 0.0910 0.1506 0.0655 maf65 0.1483 0.2346 0.1013 mean 0.1006 0.1647 0.0712 a purbalingga sheep and jember sheep. based on this study, it is necessary to conserve and to design appropriate breeding strategies to indonesian sheep populations especially garut sheep (fighting and meat type), purbalingga sheep, batur sheep and jember sheep population to ensure continuity of animal genetic resources in the future. conclusion indonesian sheep populations have a high genetic diversity in garut sheep, purbalingga sheep, batur sheep and jember sheep populations. this result indicated can be used as basic information for utilization, conservation and genetic improvement programs in indonesian sheep population breeds. acknowledgments authors thank to iaea (international atomic energy agency) for funding this research (contract number: crp d.3.10.25). authors also thank to prof. han jianlin for genotyping analysis in laboratory of livestock and forage genetic resources, caas-ilri jllfgr beijing, china. finally, authors thank to eryk andreas, msc for assisting in data analysis. references arora, r., s. bhatia and a. jain 2010. morphological and genetic characterization of ganjam sheep. anim. genet. resour. 46:19. arranz, j. j., y. bayon., and f. s. primitivo. 2001. genetic variation at microsatellite loci in spanish sheep. small rum. res. 39:3-10. baumung, r., h. simianer, and i. hoffmann. 2004. genetic diversity studies in farm animals a survey. j. anim. breed. and genet. 121:361–73. boyce, w. m., p. w. hedrick, n. e. m. cockett, s. kalinowski, m. c. penedo and r. r. ramey. 1996. genetic variation of major histocompatibility complex and microsatellite loci: a comparison in bighorn sheep. genet. 145:42-433. chen, r. j., z. p. yang, d. j. ji, d.y. qu, y. l. li, y.j. mao and d. l. huang. 2009. analysis of genetic polymorphism in six meat sheep breeds and genetic distances between them. czech j. anim. sci. 54:461-467. davindra, r.v. and g.b. mcleroy. 1992. sheep breeds. in elbs, editor. goat and sheep production in the tropics. england, longman group ltd. fao, 1998. secondary guidelines for development of national farm animal genetic resources management plans: measurement of domestic animal diversity (modad): recommended microsatellite 8 j.indonesian trop.anim.agric. 37(1) march 2012 table 7. genetic distance of five indonesian native sheep populations population purbalingga jember garut-1 garut-2 batur purbalingga 0.8607 0.8680 0.8628 0.8421 jember 0.1500 0.7557 0.7630 0.7620 garut-1 0.1415 0.2801 0.9372 0.8271 garut-2 0.1476 0.2705 0.0649 0.8424 batur 0.1719 0.2719 0.1899 0.1715 nei's genetic identity (above diagonal) and genetic distance (below diagonal) figure 3. dendrogram of genetic tree in indonesian sheep by using upgma method, (p): branching distance value in percentage 7.1 3.3 3.2 3.2 garut-1 garut-2 batur jember 3.9 1.7 8.8 12.1p purbalingga markers. food and agriculture organization, rome. goldstein, d.b. and d. d. pollock. 1997. launching microsatellites: a review of mutation processes and methods of phylogenetic inference. j. hered. 88:335-342. inounu, i., subandriyo, n. tomas, p. sitorus, and m. bell. 1986. lambing characteristic of javanese thin-tail ewe at cicadas experiment station and under vellage condation. j. anim. sci. 2:79-82. mason, i. l. 1980. prolific tropical sheep fao. animal production and health paper. fao. rome 17:65-74. mburu, d. and o. hanotte. 2005. a practical approach to microsatellite genotyping with special renference to livestock population genetics. ilri nairobi, kenya. nei, m., f. tajima and y. tateno. 1983. accuracy of estimated phylogenetic trees from molecular date. j. mol. biol. and evol. 19:153-170. peter, c., m. bruford, t. perez, s. dalamitra, g. hewitt and g. erhardt. 2007. genetic diversity and subdivision of 57 european and middle-eastern sheep breeds. anim. genet. 38:37-44. raymond, m. and f. rousset. 2001. genepop (3.3). population genetics software for exact tests and ecumenicism (eb/ol) (http:www:wbiomed.curtin.edu.au/ genepop). romjali, e., v. s. pandey, r.m. gatenby, m. doloksaribu, h. sakul and a. verhulst. 1998. genetic resistence of different genotype of sheep to natural infections with gastrointestinal nematodes. anim. sci. 64:97-104. sutama, i.k., t. n. edey and i.c. fletcher. 1988. study on reproduction of javanese thin-tail ewes. aus. agric. res. 39:703-711. genetic diversity in indonesian sheep (jakaria et al.) 9 j. indonesian trop. anim. agric. 40(2):87-92, june 2015 pissn 2087-8273 eissn 2460-6278 level of estrogen hormone and estrus performance of different postpartum estrus of jawa randu goat a. d. tanjung, e. t. setiatin and d. samsudewa faculty of animal and agricultural sciences, diponegoro university, tembalang campus, semarang 50275, central java indonesia corresponding e-mail : etsetiatin@gmail.com received april 13, 2015; accepted may 24, 2015 abstrak penelitian ini bertujuan untuk mengetahui kualitas reproduksi kambing jawa randu dengan estrus postpartum (epp) abnormal dibandingkan dengan kambing jawa randu dengan epp normal (n = 16 kambing) dilihat dari kadar hormon estrogen dan tampilan estrus. data yang diperoleh dianalisis secara deskriptif dan secara non parametrik menggunakan mann whitney u-test dengan bantuan statistical package for the social science (spss) 16. hasil analisis deskriptif pada kadar hormon estrogen menunjukkan bahwa epp normal memiliki kadar yang lebih tinggi (133,8; 141,5; 155,6; 162;25, 167;75 pg/ml) dibandingkan dengan kadar hormon estrogen kambing jawa randu epp abnormal (109,9; 111,35; 101,2; 132,2; 142,45 pg/ml). hasil analisis mann whitney u-test untuk ferning dan kelimpahan lendir serviks menunjukkan tidak terdapat perbedaan antara kambing jawa randu epp normal dibandingkan kambing jawa randu epp abnormal. jawa randu dengan epp normal mempunyai kadar estrogen yang lebih tinggi dibandingkan dengan epp abnormal. tetapi, kelimpahan dan lendir serviks antara kedua kelompok kambing tidak berbeda. kata kunci : kambing jawa randu, estrus postpartum, estrogen, lendir serviks, ferning abstract the purpose of this research was to determine the reproductive quality of normal compared with abnormal postpartum estrus (ppe) of jawa randu goats (n = 16 goats) on estrogen hormon level and estrus profile. total samples were 16 jawa randu goats. the data were analyzed descriptively and non parametric data were analyzed using mann whitney u-test of statistical package for the social science (spss) 16. descriptive statistics was used on estrogen hormone and resulting that normal postpartum estrus (ppe) jawa randu goats had a better level (133.8; 141.5; 155.6; 162.25; 167.75 pg/ml) compared with abnormal postpartum estrus of jawa randu goat (109.9; 111.35; 101.2; 132.2; 142.45 pg/ml). mann whitney u-test used for the abundance of cervical mucus and ferning showed non significantly different of postpartum estrus between both groups. jawa randu goats with normal ppe had a higher estrogen level than abnormal ppe goats. however, for the abundance and ferning of cervical mucus, between the two groups of goats was not different. keywords : jawa randu goat, postpartum estrus, estrogen, cervical mucus, ferning introduction animals living in tropical climates get heat stress. high temperatures affect the development of animal reproduction. the reproductive performance of animals in the tropics generally is determined by several factors, those are genetics, management, physical environment and nutrition (smith and akinbamijo, 2000). one of the factors determining the efficiency of animal reproduction is succes in observation of estrus appereance. failure in estrus detection can lead to mating and pregnancy failure. according to hafez and hafez (2000), estrus postpartum estrus of jawa randu goats (a.d. tanjung et al.) 87 in goat is the period of time when the female is sexually receptive to buck. goats are seasonally polyestrus. estrus is correlated with the greatest ovarian follicular development and with enhanced release of estrogen. estrogen, a female sex hormone from the ovary, acts on the female to cause the induction of behavioral estrus. previous study showed that interval from kidding to postpartum estrus (ppe) interval of black bengal goat ranged between 16-136 days with an average of 30 days (chowdhury et al., 2002), while murdjito et al. (2011) reported that bligon goats showed postpartum estrus around 45-180 days with an average of 95 days. knowledge of normal time of postpartum estrus is very important in the management of reproduction. the postpartum estrus is said to be normal if it occurs in most females. study on postpartum estrus relating to estrogen hormone level is lack. of that reason, this study was conducted to determine the differences between normal and abnormal postpartum estrus based on the estrogen level in goat. material and methods materials sixteen jawa randu goats were used in this study with average weight of 35-45 kg and having second kidding period. the goats originated from 2 farmers group spreading over 2 villages, namely pegongsoran and penggarit village. experimental design the jawa randu goats were divided evenly into two groups namely normal and abnormal postpartum estrus. determination of normal postpartum estrus was chosen a goat having history estrus before 3 months after kidding. moreover, abnormal postpartum estrus was goat having estrus after 3 months after kidding. this study animals were reared on intensively and feed concentrate as much as 200 g and 4 kg forage (field grass, gamal leaves (gliricidia sepium) and lamtoro leaves (leucaena leucocephala)) / head / day. water was provided ad libitum. goats was synchronized their estrus used progesteron hormone by vaginal sponge. parameters measured estrogen hormone level blood sampling performed on day 0 (time of synchronized estrus), day 8 (mid of synchronized estrus), day 14 (end of synchronized estrus), day 16 and day 17. blood was collected using a vacuum tube, 70% cotton and alcohol. blood was drawn through the jugular vein in the neck of jawa randu goat. blood was obtained in vacuum tube. it was centrifuged for 10 minutes at a speed of 2.500 rpm. blood serum was analyzed using elisa. abundance of cervical mucus observations on the ferning and abundance of cervical mucus were performed at the 18, 24, 33, 42 and 48 h after the releasing of the vaginal sponge. abundance of cervical mucus was observed the presence of mucus from the vulva, which were categorized into 4. score 1: there was no mucus obtained, score 2 : cervical mucus appeared transparent, low quantity and hanging at the tip of the vulva, score 3 : mucus was transparent, and the quantity being seen hanging from the vulva and around the tip of the tail, score 4 : the mucus was transparent, the quantity abundance was found at the tip of the vulva, around the tail, around the thighs and up to the cage floor. ferning modified tools as the compose of a plastic sheath and syringe were used to collect the mucus from cervix. mucus was dropped on top of glass objects then observed under the microscope. assessment of cervical mucus ferning scores modifying from (mardiati, 2003) categorized into 6 levels. the score of ferning was as follows: score 1 : no ferning formed (no crystallization, a thick-walled structure in the form of air bubbles), score 2 : ferning formed in small and scattered pattern (there was only stems crystallization primer), score 3 : ferning formation consisting of stem ferning primary, secondary and tertiary (ferning covered less than half the field of view), score 4 : ferning formation consisting of stem ferning primary, secondary and tertiary (ferning covered than half the field of view), score 5 : ferning formation consisting of stem ferning primary, secondary and tertiary (ferning covered more than 75% of te area of the field of view), 6 : ferning almost covering all the entire field of view (the formation of a fern leaf with the stem of primary, secondary and tertiary. data analysis estrogen level was analyzed descriptively, whereas abundance and ferning of cervical data 88 j.indonesian trop.anim.agric. 40(2):87-92, june 2015 were analized by non parametric of mann whitney u-test. results and discussion estrogen level estrogen level was the main parameter that used by previous researcher (mayor et al., 2007; siregar, 2009 and widiyono et al., 2011) to examine the status of goats estrus. these hormone played a role in influencing several physiological changes in the goats when come into estrus phase. the estrogen level of normal ppe was higher than abnormal ppe of jawa randu goats. figure 1 shows that the estrogen level between normal and abnormal postpartum estrus (ppe) of jawa randu goats relatively had a similar pattern. the average of estrogen level on normal ppe goats was higher (133.8; 141.5; 155.6; 162.25; 167.75 pg/ml) than abnormal ppe goats (109.9; 111.35; 101.2; 132.2; 142.45 pg/ml). mcdougall and compton (2005) reported that estrogen had a dynamics throughout the estrus cycle. the dynamics of estrogen cycle was related to other hormones mechanism. siregar (2009) reported that estrogen level of local goats was 62.21 ± 12.86 up to 79.89 ± 14.41 pg/ml. problem in follicular development might lead the lower estrogen level on abnormal ppe compared to normal ppe. secretion of fsh was not optimum and led the disruption of estrogen secretion at follicle ovary. that condition was affected by secretion of gonadotropin-releasing hormone (gnrh) that was not respond by anterior pitutary. senger (1999) reported that low body weight, body condition and also stress of lactation or high prolactin levels were the reason of slow ppe. estrogen has a close relationship with the role of follicles in the ovaries. inhibition of follicle development affected to the lower estrogen production. estrogen located in the anthrum of follicle and produced by theca interna cells. finally, estrogen was absorbed and circulated through the blood vessels to the target organ. toelihere (1981) suggested that low levels of gonadotropin hormones mainly fsh may lead to postpartum ovarian hypofunction. lower estrogen secretion by abnormal ppe led goats difficult to expresse the estrus signs as in normal ppe goats. abundance of cervical mucus estrogen increased during proestrus phase to estrus phase. this phase lead jawa randu goats showed physiological changes in the reproductive tracks (mucus discharge and swollen vulva) and their behaviors (bleating, frequent tail wagging, postpartum estrus of jawa randu goats (a.d. tanjung et al.) 89 figure 1. estrogen level of jawa randu goats. □: normal pospartum estrus; ◊: abnormal postpartum estrus 133.8 141.5 155.6 162.25 167.75 109.9 111.35 101.2 132.2 142.45 40 60 80 100 120 140 160 180 200 0 8 14 16 17 days of observation e st ro ge n l ev el (p g/ m l )) )) pacing down the fence line and standing in heat). the results of this study indicated that different ppe had no effect on abundance of cervical mucus (figure 2). there was no significant difference of cervical mucus between normal ppe and abnormal ppe goats. the abundance of cervical mucus increased since 18 hours to 42 hours of 90 j.indonesian trop.anim.agric. 40(2):87-92, june 2015 figure 2. abundance of cervical mucus of jawa randu goats. □: normal pospartum estrus; ◊: abnormal postpartum estrus 1.8751.875 2.25 2.75 2 1.5 1.75 3 2.5 2.75 0 0.5 1 1.5 2 2.5 3 3.5 4 18 24 33 42 48 hours of observation a bu nd an ce s co re figure 3. ferning crystallization of jawa randu goats score 2 score 3 score 5 score 6score 4 score 1 proestrus phase and decreased at 48 hours due to estrogen. cervical mucus was used for the preparation of the reproductive tract due to sperm deposition. it increased before ovulation occured. cervical mucus was produced by cervix. according to dewantiningrum (2008), the changes in the permeability of the cells in the cervix became more sensitive to stimulate gradient hydrostatics. the cervic cells became smaller than usual and followed by intercellular size, so that the higher permeability resulted in higher fluid drainage. ferning ferning was visible pattern in a dried specimen of cervical mucus. ferning was the crystallization of sodium chloride in the cervical mucus under estrogen effect (figure 3). sutiyono et al. (2008) stated that the ferning of cervical mucus correlated with estrogen level. there was no significant difference ferning of cervical mucus between normal ppe and abnormal ppe goats (figure 4). ferning of normal ppe goats raised gradually, beginning from 18 to 42 hours observation. this condition was not occurred at abnormal ppe goats because ferning raised gradually started from 42 hours of observation. this condition was affected to the estrogen level at the same time. estrogen of abnormal ppe goats increased higher than normal ppe goats. according to mardiati (2003), the raised of cervical mucus production was followed by an increase in ferning of cervical mucus. sutiyono et al. (2008) also reported that an increasing estrogen level and began the formation of follicle de graaf affected the incidence rate of cervical mucus ferning. conclusion jawa randu goats with normal ppe had a higher estrogen level than abnormal ppe goats. however, there was no differences in the abundance and ferning of cervical mucus between normal ppe and abnormal ppe. references chowdhury, s.a, m. s. a. bhuiyan and s. faruk. 2002. rearing black bengal goat under semiintensive management physiological and reproductive performances. asian-aust. j. anim. sci. 15(4):477-484 dewantiningrum, j. 2008. perbedaan pengaruh clomiphene citrate dan letrozole terhadap folikel, endometrium dan lendir serviks uji klinik pada wanita infertil dengan siklus haid tidak teratur. thesis. diponegoro university, semarang. hafez, b. and e.s.e. hafez. 2000. reproduction postpartum estrus of jawa randu goats (a.d. tanjung et al.) 91 figure 4. ferning of jawa randu goats. □: normal pospartum estrus; ◊: abnormal postpartum estrus 1.25 1.375 1.25 1.875 1.375 1.25 1.75 1.5 1.6251.625 0.5 1 1.5 2 2.5 18 24 33 42 48 hours of observation fe rn in g sc or e in farm animals. 7th ed. baltimore, lippincot, williams & wilkins. mardiati, s.m. 2003. kadar na lendir serviks serta kadar garam na dan k lendir mulut pada berbagai struktur daun pakis (tes ferning). thesis. universitas diponegoro, semarang. mayor, p.h., d.a. galvez, e. gimaraes, l. galius and m. loper-bejar. 2007. serum estradiol 17 beta, vaginal cytology and vulval appearance as predictor of estrous cyclicity the female collared peccary (tayassu tajacu) from estern amazon region. reprod sci. 97: 165-174 mcdougall, s. and c. compton. 2005. reproductive performance of anestrous dairy cows treated with progesterone and estradiol benzoate. j. dairy sci. 88:2388 murdjito, g., budisatria, panjono, n. ngadiyono and b. endan. 2011. kinerja kambing bligon yang dipelihara peternak di desa giri sekar, panggang, gunung kidul. buletin peternakan. 35(2):86-95 rao, s. 1997. genetic analysis of sheep discrete reproductive traits using simulation and field data. dissertation. virginia polytechnic institute and state university, blacksburg, virginia. senger, p.l. 1999. pathway to pregnancy and parturition. current conception inc, washington. siregar, t.n. 2009. profil hormon estrogen dan progesteron pada siklus berahi kambing lokal. j. ked. hewan. 3(2):240-247 smith, o. b. and o. o. akinbamijo. 2000. micronutrients and reproduction in farm animals. j. anim. reprod. sci. 60 : 549-560. sutiyono, e.t. setiatin, s. kuncara and mayasari. 2008. pengaruh pemberian ekstrak hipofisa terhadap birahi dan fertilitas pada domba yang birahinya diserentakkan dengan progesteron. j. indonesian tropical animal agriculture. 33(1):20-26 toelihere, m.r. 1981. ilmu kemajiran pada ternak sapi. institut pertanian bogor, bogor. widiyono, i., p. p. putro, sarmin, p. astuti and c.m. airin. 2011. kadar estradiol dan progesteron serum, tampilan vulva dan sitologi apus vagina kambing bligon selama siklus birahi. j. vet. sci. 12(4):263-268 92 j.indonesian trop.anim.agric. 40(2):87-92, june 2015 amino acid profile of earthworm and earthworm meal (lumbricus rubellus) for animal feedstuff l. istiqomah, a. sofyan, e. damayanti and h. julendra division of feed and animal nutrition research unit for development of chemical engineering processes indonesian institute of sciences (lipi) jl. jogja wonosari km. 31, gading, playen, gunungkidul, yogyakarta, 55861 corresponding email: ps_uty@yahoo.com received november 3, 2009; accepted november 30, 2009 abstract earthworm meal (lumbricus rubellus) has become one of natural material that could be used as feed additive. powdering method of earthworm was done by using formic acid addition. the study was carried out (1) to evaluate the essential amino acid profile of earthworm and earthworm meal, (2) to calculate the value of essential amino acid index (eaai) of both materials. a modified eaai equation was developed from the essential amino acid profile of earthworm and earthworm meal. the result showed that essential amino acid of earthworm was dominated by histidine (0.63% of dry matter basis), meanwhile the earthworm meal was dominated by isoleucine (1.98% of dry matter basis). the non essential amino acid of earthworm and earthworm meal was dominated by glutamic acid (1.52% and 3.60% of dry matter basis respectively). the value of essential amino acid index obtained from earthworm meal was higher (58.67%) than those from earthworm (21.23%). it is concluded that powdering method of earthworm by using formic acid addition had higher amino acid balance than earthworm. keywords: amino acid, earthworm meal, feed additive l. rubellus introduction fish meal is the conventional source of animal protein in poultry feed and it has been valued for its balanced amino acids, vitamin content, palatability and growth factors (tacon, 1993). because of the increasing cost of high quality fish meal required for poultry feed and due to declining stocks of fish from capture fishery and competition for feed in animal husbandry, there is now need to search for alternative sources of animal protein for poultry feeds especially in developing countries (sales and janssens, 2006). these alternatives must be able to supply adequate indispensable and dispensable amino acid requirements of the fish or sufficient amino nitrogen to enable their synthesis. many scientists have reported the possible use of some alternative animal protein feedstuffs to fish meal such as earthworm meal (hilton, 1983; yaqub, 1991; edwards, 1998; sogbesan and ugwumba, 2006; sogbesan and madu, 2008). as a feed supplement, it has been found that earthworm is equal to or surpass fish meal and meat meal as an animal protein source for poultry. the biological value has positive correlation with amino acid balance (rama rao et al., 1964). meanwhile the amino acid balance could be calculated by essential amino acid index (eaai) (oser, 1951 cit. mitchell and block, 1946). the increase of eaai value will enhance nutrient absorption (raghunath and narasinga rao, 1984). there were some treatments that could increase the eaai value in physically or mechanically way, one of that was powdering method. previous study showed that earthworm meal of lumbricus rubellus had 65.63% crude protein content (damayanti et al., 2008), earthworm meal of lumbricus terestris contained 32.60% protein (julendra, 2003), and earthworm meal of perionyx excavatus contained 57.2% crude protein and had complete amino acid (tram et al., 2005) although the special quality of earthworm meal has been known well as potential fish meal replacement as protein source (yaqub, 1991), but it’s still necessary to study about the essential amino acid composition in earthworm meal. the experiments were carried out (1) to evaluate the profile of essential amino acid composition of earthworm and earthworm meals, amino acid of earthworm meal ( l. istiqomah et al.) 253 (2) to the value of essential amino acid index (eaai) of both materials. materials and methods earthworm meal preparation based on united states patent us005128148a (ishii et al., 1992), disclosed processing for the production of dried earthworm powder which comprises the steps of leaving a species of 1 kg earthworms lumbricus rubellus, allolobophora caliginosa or pheretima comunissima in 2 – 4 litres fresh water or slightly acidic aqueous solution such as malate acid, citrate acid, phospate acid, tartate acid, lactic acid and succinate acid with comparison of ph average 5.2 – 6.2, kept in 8 – 150c temperature for 2.5 – 18 hours until the alimentary canal thereof is freed of soil, wet-grinding the earthworm, and freezedrying and then vacuum drying the resulting suspension under a vacuum of 10 mmhg or below for 10 to 100 hours while raising the temperature gradually from -600c to 800c. this steps would produced dried earthworm powder. based on edwards (1985) method, the earthworm washed using water to separate manure from outside skin and fecal (fecal mud) then kept in cold water (140 c) for 24 hours. formic acid (80%) was added around 3% of earthworm body weight. the earthworm was grinded and dried using oven 500c for 12 hours and sheaved to achieve homogenize powder. in this study, earthworm meal (l. rubellus) was produced by using modified method from edwards (1985). earthworm sample was separated from media then washed using water and kept in the refrigerator (40c) for 12 hours. formic acid (3% v/w) was added into earthworm and dried by using oven 500c for 10-12 hours. dried sample was grinded and sheaved become to particle size + 40 mesh. nutrient composition proximately of earthworm meal was summarized on table 1. analyzing amino acid amino acid of earthworm meal was analyzed by using high performance liquid chromatography (hplc). chloride acid 6n (10 ml) was added into 2 gram of earthworm meal and kept in highly temperature of disclosed reaction cylinder. sample was hydrolysed by autoclave (1100c) for 20 hours then preserved in well-closed state at room temperature. after that, sample was evaporated in 500c temperature then neutralized by naoh 6n addition. the sample was filtered by 0.45 μm millex filter paper using vacuum filter. before the sample was injected to the hplc, 275 μl opa solution (0,01 g phetaldialdehyde, 9 ml methanol, 40 ml buffer borax ph 9.1, 100 μl 2-mercaptoethanol were added into 25 μl sample, vortex and being reacted for 5 minutes. the hplc operation was c18 column, move phase a: sodium acetate ph 5.0; b : 80 meoh / 15 buffer acetate / 5 thf (v/v/v), rate flow 1.5 ml/minute, detector : fluorescence λ excitation 340 nm; λ emission 450 nm. observed variables variables measured were essential amino acid composition in earthworm and earthworm meals and also essential amino acid index in both materials. amino acid composition was analyzed by hplc. eaai value was calculated by oser equation (1951) cit. mitchell and block (1946) with mathematical model: log eaai= 1 10 [log 100xa1 at1 log 100xa2 at2 ...log 100xan atn ] note: a1: first, …(1,2,3,4.......n) essential amino acid rate from experiment sample at1: first, …(1,2,3,4.......n) essential amino acid rate from standard (whole egg) results and discussion earthworm meal l. rubellus had high protein content and it was very important as nutrient source for animal. protein content of earthworm meal was equal to fish meal (55-60% crude 254 j.indonesian trop.anim.agric. 34(4) december 2009 composition earthworm meal moisture 9.03 crude protein 63.06 ether extract 18.5 crude fiber 0.19 nitrogen free extract 12.41 organic matter 94.16 ash 5.81 * dry matter basis (%) table 1. nutrient composition of earthworm meal protein) as protein source for poultry feed. earthworm meal had also containing bioactive ‘lumbricin’ in which able to inhibit pathogenic bacteria (cho et al., 1998). sofyan et al. (2008) reported that earthworm meal with or without chitosan capable to reduce e. coli colonization and improve protein retention in broiler chicken. formic acid addition (3%) into the earthworm meal could increase the crude protein rate and produced low ph. the formic acid addition into earthworm before entering the grinding process was estimated could protect the earthworm meal from decomposer microbes, therefore it capable to maintain the highly protein content and also bioactive compound. earthworm l. rubellus contained ‘lumbricin i’ which had antibacterial activity, included in peptide group which contained 62 amino acids (salzet et al., 2006). amino acid utilized as proteins are primary constituents of structural and protective tissues, including skin, feathers, bone, ligaments, as well as muscles and organs. amino acids are used as poultry feed supplement for optimum performance and also used in livestock health care (nosb, 2001). as feed supplement amino acids form protein. of the 22 amino acids found in body proteins, the national research council lists 13 as essential in poultry diets, and these must be consumed in feed. these 13 are: arginine, glycine, histidine, isoleucine, leucine, lysine, methionine, cystine, phenylalanine, proline, threonine, tryptophan, and valine (nrc 1994). five of them that are deemed critcial in poultry rations are methionine, cystine, lysine, tryptophan, and arginine (north, 1990). amino acid analysis with hplc showed that earthworm and earthworm meal l. rubellus had essential and non essential amino acid content (table 2). the highest essential amino acid of earthworm was dominated by histidine (0.63% of dry matter basis) and earthworm meal was dominated by isoleucine (1.98% of dry matter basis). histidine was essential for protein synthesis, involved in carnitine and haemoglobin synthesis. it was effective in alergic disease and tension of the autonomic nervous system, meanwhile isoleucine was involved in protein synthesis, energy production and muscle building. tram et al. (2005) reported that the highest essential amino acid composition of p. excavatus was leucine (3.47% and 0.76% of dry matter basis respectively). the non essential amino acid of earthworm and earthworm meal was dominated by glutamic acid (1.52% and 3.60% of dry matter basis respectively). this result also similar to previous experiments reported by tram et al (2005) that the highest non essential amino acid composition of perionyx excavatus was glutamic amino acid of earthworm meal ( l. istiqomah et al.) 255 table 2. amino acid composition of earthworm and earthworm meal amino acid* essential 0.45 1.03 0.52 1.3 methionine 0.35 1.72 1.2 0.22 0.47 1.98 2.74 0.47 0.45 1.03 1.25 0.52 histidine 0.63 1.91 2.87 0.26 arginine 0.56 1.24 0.4 0.65 lysine 0.51 1.43 0.13 0.76 0.54 1.16 3.47 0.76 0.31 0.39 tyrosine 0.43 0.82 non essential 0.98 2.38 3.18 1.16 1.52 3.6 7.13 1.42 0.54 0.7 2.45 0.5 glycine 0.35 0.55 alanine 0.32 0.99 0.54 0.71 1.81 0.53 earthworm l. rubellus earthworm meal l. rubellus earthworm meal p. excavatus 1) promin earthworm flour 2) phenyalalanine valine isoleucine threonine leucine cysteine aspartic acid glutamic acid serine proline * dry matter basis (%); 1) tram et al., 2005 acid (7.13% and 1.42% of dry matter basis). glutamic acid was involved in protein synthesis and as source of energy for cells lining the intestine. facilitates immune function and improve anti-inflammatory effects, aids in preventing and healing of peptic ulcer and ulcerative colitis. the high essential amino acid composition of earthworm meal would produce great result when added in animal feedstuff ratio. by protein content rich with amino acids, the earthworm meal presents around 98% of absorption by animal organism due the balance between vitamins and amino acids (promin, 2006). according to table 2, the amino acid contents of earthworm meal were varied depending on species and food source. however, earthworms have been found to accumulate and concentrate methionine and lysine as limiting amino acid found in ecosystem in proportions greater than for other amino acids (pokarzhevskii, et al., 1997). earthworm meal contains all the essential amino acids required in feedstuff. a shortage of the limiting amino acid will constrain animal growth, reduce feed efficiency, and in extreme cases cause a nutritional deficiency. nrc requirements for amino acids and protein are designed to support maximimum growth and production. the recommended levels for methionine in poultry depend on species, stage, and level of feed consumption. for chickens, recommendations for layers range from 0.25% to 0.38% and for broilers 0.32 0.50% (nrc, 1994). amino acid composition both essential and non essential of earthworm meal were higher than those of the earthworm, except cysteine composition which is almost similar (0.31% of dry matter basis of earthworm and 0.39% of dry matter basis of earthworm meal). powdering method could increase the amino acid composition because this method used heating process. quality of powdering method could be performed by amino acid balance which indicated by essential amino acids index (eaai) value (mitchell and block, 1946). highly eaai value on earthworm meal showed that earthworm meal had higher amino acid balance than earthworm (table 3). besides powdering method by formic acid (3%) addition, the amino acid balance (eaai) could be increased by another physical and mechanical treatment such as fermentation and also pelleting (mitchell and block, 1946). this eaai value means that essential amino acid more balance and it could increase the biological value of feed material, absorption and also supporting the poultry growth (rama rao et al., 1964; raghunath and narasinga rao, 1984). conclusion amino acid composition both essential and non essential of earthworm meal were higher than those of earthworm. the value of essential amino acid index obtained from earthworm meal process was higher (58.67%) than earthworm (21.23%). powdering method of earthworm by using formic acid had higher amino acid balance than earthworm. references cho, j.h., c.b. park, y.g. yoon and s.c. kim. 1998. lumbricin i, a novel proline-rich antimicrobial peptide from the earthworm: purification, cdna cloning and molecular characterization. biochim. biophys. acta. 1408 (1): 67-76. cho, i.h., e.s. choi, h.g. lim and h.h. lee. 2004. purification and characterization of six fibrinolytic serine-proteases from earthworm lumbricus rubellus. j. biochem. mol. biol. 37 (2): 199-205. damayanti, e., h. julendra and a. sofyan. 2008. antibacteria activity of earthworm meal (lumbricus rubellus) with different methods to the escherichia coli. proceedings. national food seminar, yogyakarta, january 17, 2008. p. 54–60. edwards, c. a. 1985. production of feed protein from animal waste by earthworms. phil. trans. r. soc. lond. b 310: 299 – 307. edwards, c. a. 1998. the use of earthworms in the breakdown and management of organic wastes, in c.a. edwards (ed.). earthworm ecology: 327-376. boca raton, fl: crc press. 256 j.indonesian trop.anim.agric. 34(4) december 2009 material eaai value (%) 21.23 58.67 whole egg (standard) 100 tabel 3. essential amino acid index (eaai) earthworm l. rubellus earthworm meal l. rubellus hilton, j.w. 1983. potential of freeze-dried worm meal as a replacement for fishmeal in trout diet formulations. aquaculture. 32: 227-283. ishii, y and hisashi m. 1992. process for the production of dried earthworm powder and antihyperlipemic, antidiabetic, antihypertensive and antihypotensive preparation containing dried earthworm powder as active ingredients. united states patent us005128148a. http://www.patents.com/patents-by-category/ chemistry. (accessed: july 9, 2009). julendra, h. 2003. antibacterial activity test of earthworm meal as broiler feedstuff to the bacteria growth of salmonella pullorum with in-vitro method. proceedings. study report of research and development in technical science and knowledge (ipt) 2003. mitchell, h, h, and r, j, block, 1946, some relationships between the amino acid content of proteins and their nutritive values for the rat. j. biological chemistry. 163: 599. north, m.o. and d. d. bell. 1990. commercial chicken production manual, 4th ed. van nostrand reinhold, new york. national organic standards board [nosb]. 2001. methionine. technical advisory panel review for the usda national organic program. organic materials review institute, united states, may 21, 2001. p. 120. national research council [nrc]. 1994. nutrient requirements of poultry. 9th ed. national academy press, washington dc. oser, b. l. 1951 method for integrating essential amino acid content in the nutritional evaluation of protein. j. am. dietetic assn. s7: 396. pokarzhevskii, a.d., d.p. zaboyev, g.n. ganin, and s.a. gordienko. 1997. amino acids in earthworms: are earthworms ecosystemivorous? j. soil biol. biochem. 29: 559-567. raghunath, m. and b.s. narasinga rao. 1984. relationship between relative protein value and some in vitro indices of protein quality. j. biosciences. 6 (5): 655-661. rama rao, p.b., h.w. norton and b.c. johnson. 1964. the amino acid composition and nutritive value of proteins. v. amino acid requirements as a pattern for protein evaluation. j. nutrition. 82: 88-92. sales, j. and janssens, p.j.g. 2003. nutrient requirements of ornamental fish .review. aquatic living resour., 16: 533-540. salzet, m., a. tasiemski, e. cooper. 2006. innate immunity in lophotrochozoans: the annelids. current pharmaceutical design, 12 no. 00. p: 1 – 8 sogbesan, a.o. and c.t. madu. 2008. evaluation of earthworm (hyperiodillus euryaulos, clausen, 1914; oligocheata: eudrilidae) meal as protein feedtuffs in diet for heterobranchus longifilis valenciennes, 1840 (teleostei, clariidae) fingerlings under laboratory condition. j. environmental sci. 2(1): 23-31. sogbesan, a.o. and ugwumba, a.a.a. 2008. nutritional evaluation of termite (macrotermes subhyalinus) meal as animal protein supplements in the diets of heterobranchus longifilis (valenciennes, 1840) fingerlings. turkish j. fisheries. aquatic sci. 8: 149-157. sofyan, a., e. damayanti and h. julendra. 2008. antibacterial activity and retained protein of earthworm meal (lumbricus rubellus) as feed additive combined with chitosan. j. ilmu ternak vet. (jitv) 13(3): 182-188. tacon, a.g.j. 1993. feed ingredients for warm water fish: fish meal and other processed feedstuffs. fao fisheries circular no: 856, fao rome, 64 pp. tram, n.d.q, l.d. ngoan and b. ogle. 2005. culturing earthworms on pig manure and the effect of replacing trash fish by earthworms on the growth performance of catfish (clarias macrocephalus x clarias gariepinus). http://www.mekam.org/msc200305/theses05/tram_p2.pdf (accessed: july 9, 2009). yaqub, h. 1991. earthworm and maggot meals as a potential fish meal replacement. thesis. institute of renewable natural resources u.s.t., kumasi, ghana. amino acid of earthworm meal ( l. istiqomah et al.) 257 http://www.patents.com/patents-by-category/chemistry http://www.patents.com/patents-by-category/chemistry d:\07. jppt-management\# hibah macro nutriens uptake of farage grasses(f. kusmiyati et al.) 205 macro nutrients uptake of forage grasses at different salinity stresses f. kusmiyati, e.d. purbajanti and b.a. kristanto faculty of animal agriculture, diponegoro university, tembalang campus, semarang 50275, central java indonesia corresponding e-mail : fkusmiyati@yahoo.co.id received june 30, 2009; accepted august 7, 2009 abstract the high concentration of sodium chloride (nacl) in saline soils has negative effects on the growth of most plants. the experiment was designed to evaluate macro nutrient uptake (nitrogen, phosphorus and potassium) of forage grasses at different nacl concentrations in growth media. the experiment was conducted in a greenhouse at forage crops laboratory of animal agriculture faculty, diponegoro university. split plot design was used to arrange the experiment. the main plot was forage grasses (elephant grass (pennisetum purpureum ) and king grass (pennisetum hybrida)). the sub plot was nacl concentration in growth media (0, 150, and 300 mm). the nitrogen (n), phosphorus (p) and potassium (k) uptake in shoot and root of plant were measured. the result indicated increasing nacl concentration in growth media significantly decreased the n, p and k uptake in root and shoot of the elephant grass and king grass. the percentage reduction percentage of n, p and k uptake at 150 mm and 300 mm were high in elephant grass and king grass. it can be concluded that based on nitrogen, phosphorus and potassium uptake, elephant grass and king grass are not tolerant to strong and very strong saline soil. keywords : nitrogen uptake, phosphorus uptake, potassium uptake, salinity, forage grasses introduction land use for forage crops moves towards marginal soil such as saline soil. saline soil at java and suma tr a is a pproxima tely 400.000 ha mostly widesprea d a t nor th ja va a nd ea st suma tr a (partohardjono and syam, 1992). soil utilization of saline soil for agriculture faces many obstacles. the most important problem of saline soil is the high concentration of soluble salts (especially nacl and na2s04) that has negative effects on the growth of most plants. salinity is the concentration of dissolved minerals salts present in water and soils on a unit volume or weight basis (majerus, 1996). abrol et al. (1988) classify soil salinity based on conductivity (ec/electrical conductivity) and its effect on crop growth. there are 5 classes: (1) non saline soil with conductivity of 0-2 ds/m, salinity effects are negligible, (2) slightly saline soil with conductivity of 2-4 ds/m, yields of sensitive crops may be restricted, (3) moderately saline soil with conductivity of 4-8 ds/m, yields of many crops are restricted, (4) strongly saline soil with conductivity of 8-16 ds/m, only tolerant crops yield satisfactorily, and (5) very strongly saline soil with conductivity of more than 16 ds/m, only a few very tolerant crops yield satisfactorily. the effect of salinity on plant growth is very complex.. salinity imposes an ionic stress, an osmotic stress and secondary stresses such as nutritional disorders and an oxidative stress. the high osmotic pressure in saline solutions hampers plant water uptake, resulting in physiological drought. (flowers, 1977). sodium (na+) excess in soil particles causes expansion and soil pore closing that aggravate gas transfer with in disperse soil colloid materials (sipayung, 2003). excessive sodium ions at the root surface may disrupt plant potassium uptake that is vital for the maintenance of cell turgor, membrane potential and the activity of many enzymes (xiong and zhu, 2002). leaves of crops growing in saline soil may be smaller and darker blue green in color 206 j.indonesian trop.anim.agric. 34 [3] sept 2009 than the normal leaves. increased succulence often results from salinity. plants in saline soil often have the same appear ance as plants gr owing under moisture stress (drought) conditions, although the wilting of plants is far less prevalent (abrol et al., 1988). salt stress studies generally have been done in liquid media with complete nutrient solution (sopandie, 1990). the advantage of using liquid media is easy to maintain the salt concentrations during the research. the salt concentrations are also more precise according to the treatment. the essential nutrients for crops are sixteen elements that are absorbed from the air and soil. the nutrients that are absorbed from soil can be divided into two classes : macro nutrients and micro nutrients. the macro nutrients are nitrogen (n), phosphorus (p), potassium (k) calcium (ca), magnesium (mg) and sulphur (s). the crops need huge amounts of macro nutrient for their normal growth (hakim et al., 1986). the experiment was designed to evaluate macro nutr ient up ta ke (n itr ogen, phosphor us a nd potassium) of forage grasses at different nacl concentrations in growth media. the obtained results can contribute to better knowledge on forage crop cultivation in saline soil especially about macro nutrient uptake. . materials and methods the research was carried out at forage crops laboratory, animal agriculture faculty of diponegoro university. split plot design was used to arrange the experiment. the main plot was forage grasses (elephant grass (pennisetum purpureum )and king grass (pennisetum hybrida)). the sub plot was nacl concentration in growth media (0, 150, and 300 mm). there were 3 replications. stem cutting were planted in pots containing sand and compost with comparison of 3: 1. the grasses were cut at four weeks after planting in order to have the same initial growth. then, the seedlings were transplanted into pots containing complete nutrient solution based on that used by sopandie (1990).. the complete nutrient solution consists of: ca(no3). 4h2o 1.0 mm; kno3 4.0 mm; nh4no3 0.5 mm; kh 2po 4 1. 0 mm ; mgso 4. 7h 2o 1 . 0 mm; mnso4.h2o 0.05 ppm; cuso4.5h2o 0.02 ppm; znso4.7h2o 0.05 mm; h3bo3 0.5 ppm and feedta 0.034 mm. nacl was added to nutrient solution based on the treatments. the nutrient solution was aerated continuously and renewed once a week. t he gr a sses wer e cut a t six weeks a fter transplanted to the nutrient solution. the nitrogen (n), phosphorus (p) and potassium (k) uptakes in shoot and root of plant were measured. nitrogen was analyzed by kjedahl’s method (aoac, 1975). phosphorus was analyzed by spectrophotometer methods (sulaiman et al., 2005) and potassium was analyzed by flamefotometry method (sulaiman et al., 2005). the n, p and k uptake in shoot and root were calculated using the following formula : n uptake in shoot or root = % n x dry matter of shoot or root p uptake in shoot or root = % p x dry matter of shoot or root k uptake in shoot or root= % k x dry matter of shoot or root the results were analyzed using analysis of variance, then were followed by duncan multiple range test (steel and torrie, 1980). results and discussion the electrical conductivity at 0 mm, 150 mm and 300 mm were equivalent to 0 ds/m, 13.7 ds/m and 27.4 ds/m, respectively. the salinity of nacl concentration in this research can be classified as non saline (0 mm), strongly saline (150 mm) and very strongly saline (300 mm) (abrol et al, 1988). nitrogen (n) uptake based on the analysis of variance, concentration of na cl a ffected n uptake in shoot a nd r oot significantly (p<0.05). there were statistical differences of nitrogen (n) uptake in root between the elephant grass and the king grass. it can be seen in table 1, duncan’s test showed that increasing the nacl concentration in growth media decreased n uptake in shoot and root significantly (p<0.05) . nitrogen uptake either on shoot or root of elephant grass and king grass at nacl 150 mm and 300 mm significantly lower than at 0 mm. crop absorbs nitrogen in the form of nitrate (no3) and ammonium (nh4 +). increasing nacl from 0 macro nutriens uptake of farage grasses(f. kusmiyati et al.) 207 mm to 300 mm resulted in the decline of n uptake in shoot and root of grasses. high salinity affects nitrate uptake at two levels : by direct competition of nitrate and chloride (cl-) and at the membrane level and/or the membrane proteins by changing plasma lemma integrity (cramer et al., 1985). saline condition can influence the different steps of n metabolism such as uptake, reduction and protein synthesis (frechill, 2001). several biochemical processes are affected by salinity, particularly nitrate assimilation. nitrate is the most significant source of nitrogen for plants and frequently limits plant growth. nitrate uptake and nitrate reductase activity (nra) decrease in plants under salt stress. the addition of 600 mmol.l-1 nacl induced a substantial decline in nra by about 64% in roots and 52% in leaves (meloni et al., 2004). high salinity also will decrease the nitrification rate (firestone, 1985). in order for ions/nutrients to be absorbed by plant roots, they must come in contact with the root surface. there are generally three ways in which this contact is affected. these are contact exchange, diffusion of ions in the soil solution and movement of ions by mass flow of water in the soil. movement of ions in the soil solution to the surface of roots is an important factor in ion uptake. this movement is accomplished largely by diffusion and mass flow. mass flow refers to the movement of water together with dissolved electrolytes (ions) through the soil. this movement occurs as a result of rainfall or irrigation but more importantly as a result of the diffusion pressure gradient set up by water absorption by plant roots. nitrate move to the root surface mainly by mass flow (tisdale and nelson, 1975). the primary effect of excess salinity is that it renders less water available to plant (orak and ates, 2005). this is because the osmotic pressure of the soil solution increases as the salt concentration increases (bazzigaluppi et al., 2008). the osmotic pressure at 150 mm and 300 mm nacl were equivalent to 4,932 and 9,864 bars, respectively. less water available for plant will also reduce the n uptake of plant. high salinity also caused plasmolysis. plasmolysis will make the root riot so it decreases the ability for absorbing water and nutrient. leaves of elephant grass and king grass at 150 mm and 300 mm nacl were yellowing or chlorosis. this appearance showed that the grasses were deficient in nitrogen. research by huffaker and rains (1985) showed that the growth of barley at saline soil was inhibited because the low uptake of nitrate and ammonium. at the nacl concentration below 100 mm, the nutrient uptake of barley was not significantly affected. the nitrate uptake at nacl 200 mm was 17 % from control (0 mm nacl), while ammonium uptake was 38 %. the research on saline soil in semarang showed that n fertilizer of 250 kg n/ha produced 28 % higher dry matter yield of elephant grass than n fertilizer of 150 kg n/ha (kusmiyati et al., 2001). manure fertilizer and bed type also affect the growth and dry matter yield of elephant grass in saline soil in semarang. manure fertilizer equal to 150 kg n/ha and bed type resulted high dry matter yield of elephant grass. manure fertilizer and bed type also decreased the na content in saline soil (kusmiyati et al., 2002). table 1. nitrogen uptake (mg/pot) in root and shoot of elephant grass and king grass at different concentration of nacl n uptake in root n uptake in shoot nacl concentration elephant grass king grass mean elephant grass king grass mean 0 mm 150 mm 300 mm 193.2b 87.9d 61.5e 357.9 a 123.2c 62.6e 275.5a 105.6b 62.1c 1512.8b 508.4d 333.0d 3035.6a 852.0c 381.4d 2274.2a 680.2b 357.2b mean 114.2b 181.2a 784,7 1423.0 different superscript in the mean coloumn or row at the same parameter indicated statistically significant differences (p < 0.05) different superscript in the same coloumn and row at the same parameter indicated statistically significant differences (p < 0.05) 208 j.indonesian trop.anim.agric. 34 [3] sept 2009 the reduction of n uptake in elephant grass shoot ranged from 66.4 % to 77.9 %, while in root ranged from 54.5 % to 68.2 %. nitrogen uptake reduction in king grass also high. it ranged from 65.6 % to 82.5 % in shoot and 71.9 % to 87.4 % in root (table 1). the result showed that elephant grass and king grass are not tolerant to strongly and very strongly saline soil. phosphorus (p) uptake phosphorus uptake in shoot and root of grasses at 150 mm and 300 mm nacl significantly lower than at 0 mm (table 2). in elephant grass, p uptake in shoot and root at 150 mm nacl was not significantly different from that at 300 mm. while in king grass, there was significant difference of p uptake at 150 mm and 300 mm (table 2). phosphorus, nitrogen and potassium, is classified as a major nutrient element. it is generally considered that plants absorb most of their phosphorus as the primary orthophosphate ion (h2po -). phosphorus upta ke is a ffected by the ph of the medium surrounding the roots. lower ph values will increase the absorption of the h2po ion, whereas , higher ph values will increase absorption of the hpo4 2 form. in most soils, phosphorus availability is at a maximum in the ph range from 5.5 to 7.0 , the availabity decrease as the ph drops below 5.5 and also decreases as this values goes above 7.0. above ph 7.0, the ions of calcium and magnesium cause precipitation of the added phosphorus and its availability decreases (tisdale and nelson, 1975). ph of saline soil was around 8.5, the phosphorus availability was low, and so the p uptake was low. phosphorus moves from soil to roots by ion diffusion process. plant absorb p by contact exchange (tisdale and nelson, 1975). salinity affects water and air movement, water holding capacity and root penetration (qadir et al., 2008). the inhibited water and air movement in saline soil cause the low movement of p from soils to roots, finally the absorption decreases. the low water holding capacity and root penetration also cause decreasing of p uptake by root plant. phosphorus affects the root growth of plant, cell differentiation, involved in photosynthesis, assimilation and respiration process (lakitan, 2000). the low uptake of p will cause the inhibition all those process, so that the plant growth decrease. the reduction of p uptake in elephant grass root ranged from 56.8 % to 57.8 %, while in shoot ranged from 64.7 % to 68.9 %. phosphorus uptake reduction in king grass also high. it ranged from 63.2 % to 86.4 % in shoot and 38.6 % to 82.8 % in root (table 2). the result showed that elephant grass and king grass are not tolerant to strongly and very strongly saline soil. potassium (k) uptake potassium uptake in shoot and root of grasses at 150 mm and 300 mm significantly lower than at 0 mm. in elephant grass, k uptake in shoot and root at 150 mm was not significantly different from that at 300 mm. while in king grass, there was significant table 2. phosphorus uptake (mg/pot) in root and shoot of elephant grass and king grass at different concentrantion of nacl p uptake in root p uptake in shoot nacl concentration elephant grass king grass mean elephant grass king grass mean 0 mm 150 mm 300 mm 325.4ab 140.6c 137.4c 553.5a 339.9b 95.2d 439.5a 240.3ab 116.3b 591.6b 208.6d 184.2de 1137.4a 418.0c 154.8e 864.5a 313.3b 169.5c mean 201.1 329,5 328.1 570.1 different superscript in the mean coloumn or row at the same parameter indicated statistically significant differences (p < 0.05) different superscript in the same coloumn and row at the same parameter indicated statistically significant differences (p < 0.05) macro nutriens uptake of farage grasses(f. kusmiyati et al.) 209 difference of k uptake at 150 mm and 300 mm (table 3). potassium reaches the root surface by ion diffusion. as a plant root absorbs nutrients from the surrounding soil solution, a diffusion gradient is set up. this gradient result in the continuous movement of additional ions to the root surface and their absorption by plant (tisdale and nelson, 1975). high salinity at growth media cause excessive sodium (na) ions at the root surface. sodium at high concentration has a strong inhibitory effect on potassium uptake by root (xiong and zhu, 2002). sodium ions are not required for the plant growth (tisdale and nelson, 1975). at high salinity, plant will absorb sodium instead of potassium. sodium, once enter the cytoplasm has strong inhibitory effect on the activity of many enzymes. (xiong and zhu, 2002). low k uptake will reduce the plant growth. potassium involved in physiologica l functions such a s car bohydr ate meta bolism or forma tion a nd br ea kdown and translocation of starch, nitrogen metabolism and synthesis of proteins, control and regulation of activities of various essential mineral elements, activation of various enzymes and adjustment of stomata movement and water relation (tisdale and nelson, 1975). the reduction of k uptake in elephant grass root ranged from 47.8 % to 53.8 %, while in shoot ranged from 74.1 % to 75.3 %. potassium uptake reduction in king grass also high. it ranged from 71.8 % to 80.1 % in shoot and 73.1 % to 81.9 % in root. the result showed that elephant grass and king grass are not tolerant to strongly and very strongly saline soil. these results were in accordance with neto et al. (2004). they reported high na concentration on corn that is planted at nacl 100 mm. potassium uptake decrease as much as 36 % at nacl 100 mm. wang et al. (2002) concluded that elephant grass is sensitive plant to high salinity. the dry matter yield decreased 50 % at ec 25 ds/m. conclusion it could be concluded that the nitrogen, phosphorus and potassium uptake in elephant grass and king grass decrease at nacl concentrations of 150 mm and 300 mm. based on nitrogen, phosphorus and potassium uptake, elephant grass and king grass are not tolerant to strongly and very strongly saline soil. acknowledgement this publication is part of research that was funded by a3 competition grant of nutrition and feed depa r tment, fa cult y of anima l agr icult ur e, diponegoro university. we thanks retno widiyawati for her help during the research. references abrol, i.p., j.s.v. yadav and f.i. massaud. 1988. salt-affected soil and their management. fao, rome. aoac. 1975. official methods of analyis. 12th ed. association of official analytical chemists. washington dc., usa. table 3. pottasium uptake (mg/pot) in root and shoot of elephant grass and king grass at different concentrantion of nacl k uptake in root k uptake in shoot nacl concentration elephant grass king grass mean elephant grass king grass mean 0 mm 150 mm 300 mm 90.3b 47.1c 41.7c 265.4a 71.5b 47.9c 177.9a 59.3b 44.8b 1873.2b 485.4d 463.1de 3289.1a 933.3c 653.1e 2581.2a 709.35b 558.1b mean 59.7 128.3 940.6b 1625.2a different superscript in the mean coloumn or row at the same parameter indicated statistically significant differences (p<0.05) different superscript in the same coloumn and row at the same parameter indicated statistically significant differences (p<0.05) 210 j.indonesian trop.anim.agric. 34 [3] sept 2009 bazzigalupi, o., s.m. pistorale and a.h. andres. 2008. salinity tolerance during seed germination from naturalized populations of tall wheatgrass (thiropyrum ponticum). cien. e. inv. agr. 35 (3) : 231-238 cramer gr, a. läuchli and v.s. polito. 1985. displa cement of ca 2+ b y n a + fr om t he plasmalemma of root cells. a primary response to salt stress?. plant physiol. 79:207-277 fir estone, m. k. 1985. m icr obia l nutr ient transformations in saline soils and adaptations of microorganisms to soil salinity in : soil and plant interactions with salinity. agricultural experiment station, univ of california. flowers, t.j., p.f. troke and a.r. yeo. 1977. the mechanism of salt tolerance in halophytes. annual rev. plant. physiol. 28 : 89-121. frechill. s, b. lasa, l. ibarretxe, c. lamsfus and a.trejo. 2001. pea responses to saline stress are affected by the source of nitrogen nutrition (ammonium or nitrate). plant growth regul. 35:171-179. hakim, n., y. nyakpa, a. m., lubis, s. g. nugroho, r. saul., a. diha., g. b. hong and h. h. bailey. 1986 . da sa rda sa r i lmu ta na h. pener bit universitas lampung. huffaker, r. c. and d. w. rains. 1985. n use efficiency as influenced by s assimilation in barley exposed to salinity. in : soil plant interactions with salinity. agr icultura l experiment station, university of california. kusmiyati, f., e. d. purbajanti dan w. slamet. 2001. pengaruh pemupukan kalsium dan nitrogen terhadap produksi dan kualitas hijauan rumput pakan pada tanah salin. jurnal pengembangan peternakan tropis, special edition oktober 2001. kusmiyati, f., r. t. mulatsih dan a. darmawati. 2002. pengaruh pengguludan dan pupuk kandang terhadap pertumbuhan dan produksi hijauan rumput pakan pada tanah salin. jurnal litbang propinsi jawa tengah 1:46-52 lakitan, b. 2000. dasar-dasar fisiologi tumbuhan, pt. raja grafindo persada, jakarta. majerus, m. 1996. plant materials for saline-alkaline soils. usda natural resources conservation services, montana state university. meloni, d.a., m.r. gulotta, c.a. martinez and m.a. olivia. 2004. the effects of salt stress on growth, nitrate reduction , proline and glycinebetaine accumulation in presopis alba. braz. j. plant physiol. 16 (1) : 1-7 neto, a.d., j.t. prisco, j. eneas-ftho, c.f. lacerda, j.v. silva, p.h.a. da costa and e. gomezfilho.2004. effects of salt stress on plant growth, stomata response and solute accumulation of different maize genotype. braz. j. plant physiol. 16 (1) : 8-16 orak, a. and e. ates. 2005. resistance to salinity stress and available water levels at the seedling stage of common vetch (vicia sativa l.). plant soil environt. 51 (2) : 51-56 pa r t oha r djono, s. da n r. m. sya m. 1 992. pengembangan terpadu pertanian lahan rawa pasang surut dan lebak. ppptp, bppp – departemen pertanian, jakarta. qadir, m., a. tubeileh, j. akhtar, a. larbi, p.s. minhas a nd m. a. k ha n. 2 008. p r oductivity enhancement of salt-a ffcted envir onments through crop diversification. land degrad. develop. 19 : 429-453 sipayung, r. 2003. stres garam dan mekanisme toleransi tanaman. usu digital libarry, medan. sopandie, d. 1990. studies on plant responses to salt stress. disser ta tion ph. d. okayama university, japan. steel, r.g.d. dan j.h. torrie. 1980. principle and procedure of statistics. mcgrow-hill book company. sulaiman, suparto dan eviati, 2005. analisis kimia tanah, tanaman, air dan pupuk. balai penelitian tanah, bogor. tisdale s.l. and w.l. nelson. 1975. soil fertility and fertilizers. macmillan publ. co. inc. new york. wang, d. j.a. poss, t.j. donovan, m.c. shannon and s.m. lesch. 2002, biophysical properties and biomass production of elephant grass under saline conditions. j. arid env. 52 (4) : 447 – 456. xiong, l and j.k. zhu. 2002. salt tolerance in the ar a b idopsis book. am. society of p la nt biologists. pp. 1-24 58 j. indonesian trop. anim. agric. 48(1):58-73, march 2023 j i t a a journal of the indonesian tropical animal agriculture accredited by ditjen riset, teknologi dan pengabdian kepada masyarakat no. 164/e/kpt/2021 j. indonesian trop. anim. agric. pissn 2087-8273 eissn 2460-6278 http://ejournal.undip.ac.id/index.php/jitaa 48(1):58-73, march 2023 doi: 10.14710/jitaa.48.1. 58-73 growth performance, intestinal morphology, and carcass traits in broiler chicken fed conocarpus erectus leaf meal m. f. al-qazzaz 1 *, a. m. humam 1 , h. a. aimashhadani 1 , o. a. aljumaili 2 , and h. n. ezzat 1 1 animal production department, faculty of agricultural engineering sciences, university of baghdad, baghdad, iraq 2 community health department, anbar technical institute, middle technical university, baghdad, iraq *corresponding e-mail: mohammed.far@coagri.uobaghdad.edu.iq received january 16, 2023; accepted march 06, 2023 abstract this study evaluated the effects of adding conocarpus erectus leaf meal to the diet on the performance, carcass traits, organ weights, and intestinal morphology of broiler chicken. a total of 396 oneday-old ross 308 broilers were assigned to nine treatments, which included 0, 0.25%, 0.5%, 0.75%, 1%, 1.25%, 1.5%, 1.75%, and 2% c. erectus leaf meal addition to the broiler diet. feed and bird weights were recorded weekly. on slaughter day, the weights of carcasses and organs were individually reported using a digital scale as well as the intestine samples were pooled for tissue analysis. high levels of c. erectus leaf meal reduced (p<0.01) body weight, body weight gain, and feed conversion ratio. the basal diet and 0.25% c. erectus leaf meal diet reported higher (p<0.01) body weight and body weight gain than did the other treatments. birds fed 0.25% c. erectus leaf meal supplementation performed similarly to those fed the basal diet. significantly, with increasing amounts of c. erectus leaf meal in the diets, there was a linear slope decrease in live weight and body weight gain as well as a linear slope rise in the values of feed intake and feed conversion ratio. carcass trait and relative organ weights were not altered among the dietary treatments. feeding 1% c. erectus leaf meal diet decreased (p<0.01) relative abdominal fat weight compared to birds fed the control diet. birds fed dietary c. erectus treatments had higher (p<0.01) villus height, villus width, crypt depth, and lower villus height/ crypt depth ratio than did birds fed the control diet. in conclusion, the study indicated that feeding 0.25% c. erectus leaf meal showed no deleterious effects on the growth performance of the broiler. growth performance and intestinal morphology were linearly reduced when broilers were fed up 2% of c. erectus meal. keywords: broiler, conocarpus erectus, intestinal morphology, performance introduction phytogenic feed additives are increasingly being used in poultry diets after the use of antibiotics as growth promoters in animal feed was banned on january 1, 2006, by the european parliament and the european council. the effect of phytogenic feed additives added to poultry diets mailto:mohammed.far@coagri.uobaghdad.edu.iq feeding conocarpus erectus leaf meal in broiler chicken (m.f. al-qazzaz et al.) 59 has been reported by many researchers (almasari and al-himdany, 2022; atiyah and hamood, 2021). however, many plants have still not been studied for their effect as a feed additive in broiler diets. conocarpus erectus, called button mangrove and buttonwood (english), is a plant of the combretaceae family and is native to the tropical and subtropical areas of the world. the plant is used as a folk remedy for many human diseases (bashir et al., 2015) as well as it is effective to get ride mites in poultry farms (rajabpour et al., 2018). also, it is reported that numerous phytochemical compounds were isolated from c. erectus leaves such as gallic acid, ellagic acid, quercetin, tannin, and saponin (ayoub, 2010; nascimento et al., 2016; tawfeeq et al., 2020). the phytochemicals are secondary metabolites that could be used as safe natural feed additive (hashemi et al., 2008); they possess a positive effect on bird bodies in terms of health, growth, and production (abdel-moneim et al., 2020; lipiński et al., 2017; tayeb et al., 2019). supplementation of plant leaf meals as feed additives in poultry diets due to their content of affective phytochemical compounds was reported (basit et al., 2020; nkukwana et al., 2014; shiraze and hassanabadi, 2019). the phytochemical compounds are capable to improve intestinal histomorphometry (kamboh and zhu, 2014; oliveira et al., 2018), and growth performance (luo et al., 2018). information about the effect of c. erectus leaf meal in poultry research is rare. in farm animal studies, the replacement of berseem hay with up to 30% biologically treated c. erectus meal improved the body weight (bw) of rabbits (ali et al., 2017). the silage made from the conocarpus plant could be cheaper than imported fodder and ease feed shortfall. additionally, the performance of sheep growth was unaffected when corn silage was substituted with dried c. erectus leaves (hoseini and chaji, 2021). the digestion activity of arabian sheep and some fermentation parameters could be improved by treating c. erectus leaves with the bacterium klebsiella pneumoniae and acinetobacter sp (mohammadabadi et al., 2020). studies evaluating the effects of adding c. erectus leaves to broiler diets are scarce. therefore, the objective of the current study is to evaluate the effect of dietary supplementation of c. erectus leaf meal in a broiler diet on the growth performance, carcass traits, organ weights, and intestinal morphology of broilers. materials and methods experimental diets the fresh leaves of c. erectus were collected daily from trees in baghdad city, al-mansour street, and immediately dried inside a shadow room for three days. the dried leaves were stored in polyethylene bags before vacuum sealing. the dried leaves were ground using an electric grinder (model no. tg-1678) before these were added to the treatment diets at numerous levels to choose the best level that could achieve the top result. regarding the treatments, the first treatment consisted of a basal diet (table 1). the second until the ninth treatment consisted of increasing levels (0.25%, 0.5%, 0.75%, 1%, 1.25%, 1.50%, 1.75%, and 2%) of c. erectus added to the basal diet, respectively. management of birds a total of 396 one-day-old ross 308 broilers were randomly assigned to nine treatments after individual weighing using a digital scale. each treatment consisted of four groups with 11 birds each. the birds of each group were housed in a single-floor cage. the experiment was performed in a closed house provided with artificial light using electric bulbs. continuous ad libitum feeding and water were provided during the experimental days. a completed vaccination program was likewise applied for the birds according to standard veterinary practice. the experiment was performed according to the committee approval of the university of baghdad 111/19/10/2021. growth performance body weight (bw) and feed intake (fi) of the birds were measured weekly using a digital scale, and thereafter body weight gain (bwg) file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_6#_enref_6 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_6#_enref_6 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_11#_enref_11 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_15#_enref_15 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_52#_enref_52 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_52#_enref_52 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_12#_enref_12 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_47#_enref_47 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_47#_enref_47 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_58#_enref_58 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_29#_enref_29 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_1#_enref_1 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_37#_enref_37 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_59#_enref_59 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_16#_enref_16 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_48#_enref_48 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_55#_enref_55 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_55#_enref_55 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_34#_enref_34 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_49#_enref_49 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_40#_enref_40 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_8#_enref_8 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_31#_enref_31 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_31#_enref_31 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_45#_enref_45 60 j. indonesian trop. anim. agric. 48(1):58-73, march 2023 and feed conversion ratio (fcr) were calculated. the proximate composition (moisture, crude fiber, crude protein, ash, and ether extract) of c. erectus leaf meal was determined according to standard procedures (george, 2016). carcass traits and organ weights the treatment birds that underwent treatments (two birds from each replicate) were selected for being slaughtered at the end of the experiment. carcass weights of the slaughtered birds were recorded using digital scales. the dressing percentage was calculated according to the formula: (carcass weight / bw) × 100. relative breast muscle weight was calculated according to the formula: (breast weight / bw) × 100. relative organ weights of the tract, heart, liver, gizzard, spleen, abdominal fat, and bursa of fabricius were calculated by dividing the organ weight individually over the bw(alqazzaz et al., 2019). intestinal morphology samples (5 cm/sample) were collected from the birds’ duodenum, jejunum, and ileum of the intestine. the samples were immediately rinsed with phosphate buffer saline and then placed in boxes containing 10% formalin. the samples were washed with distilled water after, and the morphology analysis was performed according to the method described by bancroft and gamble (2008). they were tested using a light microscope (future win joe microscopic imaging program). five replicate slides per intestine were evaluated as part of the treatment. villus height (vh) of the sample referred to the distance between the tip of the villus and the villus crypt junction. crypt depth (cd) referred to the depth of the invagination between the two villi. measurements were conducted using a winjoe ocular table 1. composition of experimental diets ingredients (%) starter period (0-14 d) grower period (15-25 d) finisher period (26-35 d) yellow corn 48.00 48.00 48.00 wheat 9.70 12.80 15.00 soybean meal 33.00 29.10 25.50 protein concentrate a 5.00 5.00 5.00 corn oil 2.00 3.10 4.50 limestone 1.10 1.10 1.10 dicalcium phosphate 0.80 0.50 0.50 salt 0.20 0.20 0.20 vitamin and mineral premix b 0.20 0.20 0.20 calculated analysis crude protein (%) 23.10 21.60 20.04 metabolic energy (kcal/kg) 3001.00 3101.00 3208.50 methionine (%) 0.56 0.48 0.46 lysine (%) 1.30 1.21 1.11 calcium (%) 0.94 0.87 0.86 phosphorus (%) 0.50 0.44 0.44 a provided per kilogram of diet: crude protein 40%, crude fat 5%, crude fiber 2.26%, calcium 5%, phosphorus 4.68%, lysine 3.85%, methionine 3.7%, methionine and cystine 4.12% ,sodium 2.4%, energy 2107 kcal/kg, vit a 200000 i.u., vit d 60000 i.u., vit e 600 mg., vit k 50 mg, vit b1 60mg, vit b2 140 mg, vit b6 80 mg, folic acid 20 mg, biotin 100 mg, iron 1 mg, copper 200 mg, manganese 1.6 mg, zinc 1.6 mg, niacin 700 mg/kg, pantothenic acid 147 mg/kg, vit b12 400 mg/kg, choline, iodine 20 mg, selenium 5 mg, antioxidant (bht) 900 mg. b supplied per kg diet: vitamin a 4000 i.u., vitamin d3 750i.u., vitamin e 500 mcg, vitamin k3 500 mcg, vitamin b1 hcl 250 mcg, vitamin b2 250 mcg, vitamin b6 hcl 100 mcg, vitamin b12 4 mcg, calcium-dpantothenate 2 mcg, niacin 3 mcg, folic acid 25 mcg, manganese sulphate 200 mcg, zinc sulphate 75 mcg, ferrous sulphate 250 mcg, copper sulphate 20 mcg, cobalt sulphate 5 mcg. file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_24#_enref_24 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_9#_enref_9 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_9#_enref_9 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_14#_enref_14 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_14#_enref_14 feeding conocarpus erectus leaf meal in broiler chicken (m.f. al-qazzaz et al.) 61 micrometer(al-rubaee et al., 2020). chemical analysis total phenolic content. the folinciocalteu method described by singleton and rossi (1965) was performed with a slight modification to determine the total phenolic content in the c. erectus leaf samples. at 50°c–55°c, samples of c. erectus leaf were extracted with 300 ml ethanol using a soxhlet extractor for 3–4 h. the samples were filtered using no. 1 filter paper before drying using an evaporator and then kept in storage at 4°c. a sodium carbonate solution of 20% was prepared for the next step. in a 5 ml tube, the aliquot extract sample (150 μl) was mixed with a folin-ciocalteu reagent (500 μl) and sodium carbonate (1.5 ml) using a vortex mixer. the mixture was diluted up to 10 ml with distilled water. the tubes were allowed to stand for 2 h before the absorbance was scanned at 765 nm. a standard calibration curve of gallic acid (sigma-aldrich, germany) was used as the standard to estimate the phenolic amount in c. erectus leaf meal, as expressed in mg gallic acid equivalent per g dry weight. total flavonoid content. the aluminum chloride colorimetric technique was applied to determine the total flavonoid content in c. erectus leaf samples according to the method described by laouini and ouahrani (2017). tannin content. tannin content in the c. erectus leaf samples was determined according to the method described by abdelkader et al. (2014) with slight modifications. briefly, 2 g of extract was blended with ethanol (80%) before heating in a water bath. the process was followed by filtering before ferric chloride was added to the filtrate. tannin content in the sample was inferred from the indicator of dark-green color. the filter process was repeated after mixing 1 ml of the extract with 2 ml of sodium chloride (2%). the final volume was mixed with 5 ml of 1% gelatin solution before the absorption was scanned at 540 nm. saponin content. the double extraction gravimetric method was applied to determine saponin content in the c. erectus leaf samples according to the procedure described by harborne (1973) with a slight amendment. briefly, the samples (5 g/sample) of c. erectus leaf meal were added to the flask containing 50 ml of ethanol (20%) with mixing. the mixture was held in a water bath at 55°c for 90 min and then filtered through whatman filter paper (no. 42). afterwards, the residue was mixed with 50 ml of 20% ethanol and heated at 90°c until the volume was reduced to approximately 40 ml. the samples were vigorously shaken with 40 ml of diethyl table 2. result of phenolic compounds and proximate analysis of c.erectus leaf meal phenolic compounds content total phenolic (mg gallic / gm) 271.80 total flavonoid (mg rutin / gm) 68.00 tannin (%) 58.50 saponin (%) 9.45 glycoside (%) 11.90 gallic acid (ppm) 235.80 apigenin (ppm) 98.70 catechin (ppm) 104.80 quercetin (ppm) 217.90 proximate analysis moisture (%) 5.23 crude protein (%) 6.31 ether extract (%) 4.30 fiber (%) 13.05 ash (%) 70.45 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_7#_enref_7 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_56#_enref_56 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_56#_enref_56 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_36#_enref_36 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_2#_enref_2 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_2#_enref_2 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_28#_enref_28 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_28#_enref_28 62 j. indonesian trop. anim. agric. 48(1):58-73, march 2023 ether in a separate funnel. re-extraction was applied until the aqueous layer color became clear. saponins were extracted using 60 ml of normal butanol. after the samples were washed with 5% aqueous sodium chloride solution, these were dried in a pre-weighed evaporation dish using an evaporator and then held in the oven at 60°c and reweighed after cooling in a desiccator. saponin content in the samples was determined according to the following formula: saponin content (%) = (w2 – w1 / wt.) × 100 w1 = weight of the dried dish w2 = weight of the dried dish + sample wt.= weight of the sample glycoside content. the method of solich et al. (1992) with a slight amendment was applied to determine glycoside content in the c. erectus leaf samples. the samples (10 g/sample) were macerated repeatedly in methanol (80%) at room temperature for 24 h. the extracted samples were concentrated under a vacuum after mixing with 10 ml of baljet’s reagent, which was freshly prepared from 95 ml of 1% picric acid and 5 ml of 10% naoh. after 1 h, 20 ml of distilled water was added to each sample. the samples were scanned at 495 nm using the shimadzu uv/vis spectrophotometer model 1600a (kyoto, japan). the standard curve was made with different concentrations (12.5–100 mg/l) of 10 ml of securidaside. glycoside content in the sample was expressed as mg of securidaside per gm of dried extracts. individual phenolic compounds. the phenolic compounds (gallic acid, apigenin, catechin, and quercetin) of c. erectus leaf samples (10.0 g) were extracted by ethanol (70%) using the brason b-220 ultrasonic bath (smith-kline company, usa) at room temperature for 1 h (mladenovic et al., 2011). the samples were dried at 40°c after the solvent was removed by a rotary evaporator under a vacuum (slovenia). the extract samples were stored at 4°c in glass bottles to protect them from oxidation until analysis. reversed phase hplc analysis was conducted on the samples using a sykamn hplc chromatographic system equipped with a uv detector for quantification of individual phenolic compounds. the temperature of the column (zorbax eclipse plus-c18-osd 0.25 cm, 4.6 mm) was 30°c with a mobile phase involving eluent a (methanol) and eluent b (1% formic acid in water (v/v)). the conditions (initial 0–13 min, 40% b; 14–20 min, 50% b; and flow rate of 0.7 ml/min) of the mobile phase were performed using the gradient system. the volume of the injected samples and the standard were both 100 μl. the photodiode array absorption spectrum was scanned at 280 nm. statistical analysis the treatments were assigned using a completely randomized design, and the collected data were subjected to analysis using the general linear models of the statistical analysis system (version 9.4). the differences among means were compared using tukey’s honestly significant difference (hsd). the simple linear regression model was used to describe the relationship between independent variables of growth performance with dependent variables of c. erectus levels in the diets. results the results of proximate analysis of the c. erectus leaf meal showed that the moisture, crude protein, ether extract, fiber, and ash contents were 5.23%, 6.31%, 4.3%, 13.05%, and 70.45%, respectively (table 2). in the same table, the results of quantitative phytochemical analysis of c. erectus leaf meal were total phenolic (271.8 mg/ g), total flavonoid (68 mg/g), tannin (58.5%), saponin (9.45%), glycoside (11.9%), gallic acid (235.8%), apigenin (98.7ppm), catechin (104.8 ppm), and quercetin (217.9ppm). the growth performance of birds fed dietary treatments of c. erectus meal is revealed in table 3. in the starter period, fi, bwg, fcr, and bw were not affected significantly by the addition of different levels of c. erectus in broiler diets. in the grower period, the dietary treatments of c. erectus meal did not affect fi. significantly, bwg was lowered (p<0.01) when broiler file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_57#_enref_57 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_57#_enref_57 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_44#_enref_44 feeding conocarpus erectus leaf meal in broiler chicken (m.f. al-qazzaz et al.) 63 t a b le 3 . g ro w th p e rf o rm a n c e o f b ir d s f e d d ie ta ry t re a tm e n ts o f c . e re c tu s l e a f m e a l d ie ta ry t re a tm e n ts ( % ) v a ri a b le s p -v a lu e s e m 2 1 .7 5 1 .5 1 .2 5 1 0 .7 5 0 .5 0 .2 5 0 s ta rt e r p e ri o d ( 0 -1 5 d ) 0 .3 3 2 0 .8 1 3 0 5 .4 6 2 9 3 .2 7 3 0 0 .8 5 2 8 9 .7 0 2 9 3 .7 9 2 7 7 .8 8 2 8 5 .7 0 3 0 4 .3 3 2 7 2 .3 0 f i (g ) 0 .0 8 9 .7 6 2 5 7 .6 6 2 5 2 .3 8 2 6 3 .1 1 2 7 3 .3 5 2 6 6 .3 2 2 6 0 .8 1 2 6 1 .7 2 2 6 4 .1 4 2 5 0 .7 5 b w g ( g ) 0 .1 8 0 .0 7 1 .1 8 1 .1 6 1 .1 5 1 .0 6 1 .1 0 1 .0 6 1 .0 9 1 .1 5 1 .0 8 f c r 0 .0 8 9 .7 6 2 9 7 .9 4 2 9 2 .6 6 3 0 3 .3 9 3 1 3 .6 3 3 0 6 .6 0 3 0 1 .0 9 3 0 2 .0 0 3 0 4 .4 2 2 9 1 .0 3 b w ( g ) g ro w e r p e ri o d ( 1 6 -2 5 d ) 0 .1 5 7 9 .7 8 1 4 2 8 .1 0 1 3 1 1 .0 9 1 3 6 3 .2 2 1 3 0 9 .7 0 1 2 6 2 .7 9 1 3 2 8 .4 2 1 2 7 9 .2 1 1 3 2 9 .3 4 1 2 7 1 .7 6 f i (g ) < 0 .0 1 2 8 .8 8 8 6 8 .2 7 d 8 9 6 .8 2 c d 9 2 0 .0 0 b c d 9 6 6 .6 4 a b 9 3 1 .1 2 b c d 9 2 0 .7 6 b c d 9 5 2 .9 7 a b c 1 0 0 6 .0 0 a 9 5 5 .2 4 a b c b w g ( g ) < 0 .0 1 0 .1 0 1 .6 4 a 1 .4 6 a b 1 .4 8 a b 1 .3 5 b 1 .3 6 b 1 .4 4 a b 1 .3 4 b 1 .3 2 b 1 .3 3 b f c r < 0 .0 1 3 3 .0 8 1 1 6 6 .2 1 d 1 1 8 9 .4 9 c d 1 2 2 3 .3 9 b c d 1 2 8 0 .2 7 a b 1 2 3 7 .7 3 a b c d 1 2 2 1 .8 5 b c d 1 2 5 4 .9 7 a b c 1 3 1 0 .4 2 a 1 2 4 6 .2 7 a b c b w ( g ) f in is h e r p e ri o d ( 2 6 -3 5 d ) 0 .3 1 4 5 .3 2 1 3 5 3 .1 3 1 3 3 7 .2 6 1 3 6 8 .3 0 1 4 1 7 .5 3 1 3 7 4 .2 0 1 3 3 7 .0 3 1 3 6 1 .2 5 1 3 8 7 .7 7 1 3 5 9 .1 3 f i (g ) 0 .0 3 5 2 .0 4 7 4 5 .1 6 7 8 3 .8 5 8 2 5 .6 1 8 2 9 .8 5 8 5 3 .6 1 7 5 6 .8 1 7 9 2 .4 2 8 3 2 .8 5 8 5 9 .8 5 b w g ( g ) 0 .1 2 0 .1 2 1 .8 2 1 .7 0 1 .6 5 1 .7 1 1 .6 1 1 .7 9 1 .7 4 1 .6 7 1 .5 8 f c r < 0 .0 1 5 1 .8 7 1 9 1 1 .3 7 d 1 9 7 3 .3 3 d c 2 0 4 9 .0 0 a b c 2 1 1 0 .1 2 a b 2 0 9 1 .3 3 a b c 2 0 1 8 .8 6 b c d 2 0 4 7 .3 9 a b c 2 1 4 3 .2 7 a 2 1 0 6 .0 6 a b b w ( g ) o v e ra ll p e ri o d 0 -3 5 d 0 .0 4 8 1 .8 8 3 0 8 6 .6 8 2 9 4 1 .6 3 3 0 3 2 .3 7 3 0 1 6 .9 2 2 9 3 0 .7 7 2 9 4 3 .3 4 2 9 2 6 .1 6 3 0 2 1 .4 4 2 9 0 3 .3 3 f i (g ) < 0 .0 1 5 5 .6 5 1 8 8 1 .1 6 c 1 9 4 3 .1 2 b c 2 0 1 8 .7 9 a b 2 0 7 9 .9 1 a 2 0 6 1 .1 2 a b 1 9 8 8 .6 5 a b c 2 0 1 7 .1 8 a b 2 1 1 3 .0 6 a 2 0 7 5 .8 5 a b w g ( g ) < 0 .0 1 0 .0 4 1 .6 4 a 1 .5 1 b 1 .5 0 b 1 .4 5 b c 1 .4 2 b c 1 .4 8 b c 1 .4 5 b c 1 .4 3 b c 1 .3 9 c f c r 0 .4 5 1 .5 0 .0 0 .0 0 .0 0 .0 0 .0 2 .2 0 .0 0 .0 0 .0 m o rt a li ty r a te (% ) m e a n s w it h in th e sa m e ro w w it h d if fe re n t su p e rs c ri p ts (a ,b ,c ,d ) a re si g n if ic a n tl y d if fe re n t; m e a n s w it h in th e sa m e ro w w it h n o su p e rs c ri p ts a re n o t si g n if ic a n tl y d if fe re n t. f i, f e e d i n ta k e ; b w g , b o d y w e ig h t g a in , b w , b o d y w e ig h t; f c r , fe e d c o n v e rs io n r a ti o ; s e m , st a n d a rd e rr o r o f th e m e a n . 64 j. indonesian trop. anim. agric. 48(1):58-73, march 2023 diets were accompanied by rising levels of c. erectus meal. also, the birds receiving 2% c. erectus showed the lowest bwg, whereas the birds receiving 0.25% c. erectus showed the highest bwg. in addition, birds fed 0.25% c. erectus meal diet had higher bwg compared with birds fed 0.75%,1%, 1.5%,1.75%, and 2% of c. erectus meal diets. there were no significant differences among bwg of birds fed 0%, 0.25%, 0.5%, and 1.25% c. erectus meal diets. also, the birds fed 0%, 0.5%, 0.75%, 1%, 1.25%, and 1.5% c. erectus meal diets had a similar bwg. in the same line, the bwg was comparable among birds fed 0%,0.5%, 0.75%, 1%, 1.25%, 1.5%, and 1.75% c. erectus meal diets. moreover, there were no significant differences among bwg of birds fed 0.75%, 1%, 1.5%, 1.75%, and 2% c. erectus meal diets. significantly, the effect of the dietary treatments on bw was as similar to their effect on bwg in this period. the poorer (p<0.01) fcr was accompanied by enhancement levels of c. erectus in broiler diets. the birds fed 2% of c. erectus reported the worst fcr among dietary treatments. also, the fcr was similar among birds fed 0%,0.25%, 0.5%, 0.75%, 1%, 1.25%, 1.5%, and 1.75% c. erectus diets. also, no significant differences were observed among the fcr of birds fed 0.75%, 1.5%, 1.75%, and 2% of c. erectus meal. in the finisher period, dietary treatments did not affect (p>0.05) fi, bwg, and fcr. however, bw was lowered (p<0.01) in birds that received high levels of c. erectus meal compared to birds that received low levels of c. erectus meal in their diet; the birds fed 2% of c. erectus meal had the lowest bw. in the overall period, the dietary treatments had no impact on fi and mortality rate. significantly, higher bwg (p<0.01) was observed in birds fed 0%, 0.25%, and 1.25% of c. erectus meal diets compared with birds fed 1.75% and 2% of c. erectus meal diets. there were no significant differences among bwg of birds fed 0%, 0.25%, 0.5%, 0.75%, 1%, 1.25%, and 1.5% c. erectus meal in the diet. also, similar differences were noted in bwg of birds fed 0.5%, 0.75%, 1%, 1.5%, and 1.75% c. erectus meal diets. moreover, the bwg was comparable in birds fed 0.75%, 1.75%, and 2% c. erectus meal diets. the birds fed high levels of c. erectus meal had poor (p<0.01) fcr compared with birds fed low levels of c. erectus meal in the diet. no significant differences were noted among fcr of birds fed 0.25%, 0.5%, 0.75%, 1%, 1.25%, 1.5%, and 1.75% of c. erectus diets. also, the levels 0%, 0.25%, 0.5%, 0.75%, 1%, and 1.25% of c. erectus meal had a similar fcr values. the birds fed 2% of c. erectus meal reported the highest fcr value whereas the birds fed basal diet had the lowest value. the fi, wg, lw, and fcr depended on c. erectus meal levels in the diet were studied (table 4). there was a negative linear regression (p<0.01) for wg and lw with an increase of c. erectus levels in the diets. the value of the slope coefficient of wg was -79.60, and the same value for lw. also, there was a positive linear regression (p<0.01) for fi and fcr values with an increase of c. erectus levels in the diets. the value of the slope coefficient of fi was 51.99, and 0.08 for fcr. the effect of dietary treatments of c. erectus meal on carcass traits and relative organ weight is revealed in table 5. carcass weight and relative weight of organs were similar among treatments of c. erectus meal supplementation, table 4. linear regression of growth performance on c. erectus levels in broiler diets intercept slop parameters estimate estimate se p-value r-square fi (g) 2926.07 51.99 22.80 0.02 0.13 wg (g) 2089.40 -79.60 17.18 0.01 0.38 lw (g) 2129.68 -79.60 17.18 0.01 0.38 fcr 1.39 0.08 0.01 0.01 0.53 fi = feed intake; bwg = body weight gain, bw = body weight; fcr = feed conversion ratio feeding conocarpus erectus leaf meal in broiler chicken (m.f. al-qazzaz et al.) 65 t a b le 5 . r e la ti v e c a rc a ss t ra it s a n d o rg a n w e ig h ts o f b ir d s f e d d ie ta ry t re a tm e n ts o f c . e re c tu s l e a f m e a l v a ri a b le s d ie ta ry t re a tm e n ts ( % ) 0 0 .2 5 0 .5 0 .7 5 1 1 .2 5 1 .5 1 .7 5 2 s e m p v a lu e c a rc a ss ( g m ) 1 6 6 7 .2 5 1 6 5 4 .7 5 1 5 8 7 .2 5 1 7 1 0 1 6 2 7 .2 5 1 6 9 9 .2 5 1 5 6 9 .2 5 1 6 5 9 .2 5 1 6 3 5 .2 5 7 9 .4 9 0 .2 4 b re a st ( % ) 2 9 .7 7 2 8 .7 8 2 9 .9 6 3 1 .0 6 3 0 .2 9 3 2 .3 3 2 8 .8 2 9 .6 5 2 9 .8 7 1 .4 9 0 .0 6 d re ss in g ( % ) 7 5 .2 5 7 4 .2 5 7 4 .7 5 7 5 .7 5 7 5 7 7 7 4 7 6 7 6 .2 5 2 .0 5 0 .5 2 t ra c t (% ) 4 .5 3 5 .9 3 4 .7 4 .1 7 4 .9 8 4 .3 5 4 .0 2 4 .1 9 4 .7 5 1 .0 6 0 .4 9 h e a rt ( % ) 0 .5 6 0 .5 2 0 .5 0 .4 5 0 .4 5 0 .4 6 0 .5 1 0 .4 9 0 .5 1 0 .0 5 0 .1 1 l iv e r (% ) 2 .1 9 1 .7 2 2 .0 1 1 .8 5 2 .0 5 1 .8 3 1 .8 5 2 .0 1 1 .9 1 0 .2 4 0 .2 6 g iz z a rd ( % ) 1 .6 6 1 .8 1 1 .9 4 1 .7 1 1 .5 6 1 .4 3 1 .6 2 1 .6 1 .6 6 0 .2 3 0 .1 9 s p le e n ( % ) 0 .1 1 0 .1 2 0 .1 0 .0 9 0 .1 0 .0 7 0 .1 1 0 .0 9 0 .1 2 0 .0 2 0 .3 9 a b d o m in a l fa t (% ) 0 .9 8 a 0 .6 4 a b 0 .8 8 a b 0 .7 7 a b 0 .5 6 b 0 .6 6 a b 0 .8 8 a b 0 .8 3 a b 0 .7 6 a b 0 .1 4 < 0 .0 1 b u rs a o f fa b ri c iu s( % ) 0 .0 6 0 .0 6 0 .0 7 0 .1 2 0 .1 1 0 .0 7 0 .0 7 0 .0 7 0 .0 8 0 .0 4 0 .4 0 m e a n s w it h in t h e s a m e r o w w it h d if fe re n t su p e rs c ri p ts ( a , b ) a re s ig n if ic a n tl y d if fe re n t; m e a n s w it h in t h e s a m e r o w w it h n o s u p e rs c ri p ts a re n o t si g n if ic a n tl y d if fe re n t; s e m , st a n d a rd e rr o r o f th e m e a n . 66 j. indonesian trop. anim. agric. 48(1):58-73, march 2023 excluding abdominal fat (p<0.01). birds fed 1% of the c. erectus diet had lower (p<0.01) relative abdominal fat weight than did birds fed the basal diet. there was a lack of differences because the dietary treatments of c. erectus meal supplementation excluded the treatment supplemented with 1% c. erectus meal in terms of relative abdominal fat weight. the intestinal morphology of birds fed dietary treatments are shown in table 6. dietary treatments of c. erectus meal increased vh in the intestines of birds. birds fed 1.25% and 2% c. erectus meal diets revealed a significant (p<0.01) rise in vh of the birds’ intestine compared to birds fed the control diet. birds fed a 2% c. erectus meal diet had higher vh compared to birds fed diets containing 0%, and 1.75% of c. erectus meal. there were no significant differences among vh of birds fed 0.25%, 0.5%, 0.75%, 1%, 1.25%, and 2% c. erectus meal diets. furthermore, vh was similar in birds fed levels of 0%, 0.25%, 0.5%, 0.75%, 1%, 1.5%, and 1.75 % of c. erectus meal. birds fed dietary treatments of c. erectus meal also had significantly increased (p<0.01) cd compared with birds fed the control diet. no significant differences among cd of birds fed 0.5%, 0.75%, 1%, 1.5%, and 1.75% of % c. erectus meal diets. also, the birds fed 0.25%, and 2% of c. erectus meal diets had similar cd. in addition, the intestine of birds fed 0.25%, and 1% of c. erectus diets had higher (p<0.01) vw compared with birds fed 0%, 0.5%, 1.25%, 1.75%, and 2% of c. erectus meal diets. there was a lack of differences among vw of birds fed 0.25%, 0.75%, 1%, and 1.5% c. erectus diets. furthermore, the birds fed levels of 0.5%, 0.75%, 1.25%, 1.5%, and 2% of c. erectus meal had similar vw. in addition, the birds fed 0%, 0.5%, 1.25%, 1.75%, and 2% of c. erectus diets had the same vw. dietary treatments of c. erectus meal significantly lowered (p<0.01) the vh/cd ratio compared with the control diet. there were no significant differences between birds fed 0% c. erectus meal and birds fed 1.25% c. erectus meal on vh/cd ratio. also, a similar vh/cd ratio was observed in birds fed 0.75%, 1%, 1.25%, 1.5%, and 1.75% of c. erectus meal diets. in addition, birds fed diets supplemented with c. erectus meal at 0.5%, 0.75%,1%, 1.5%, and 1.75% had the same vh/cd ratio. no significant differences among the vh/cd ratio of birds fed 0.25%, 0.5%, 1.75%, and 2% c. erectus meal. discussion the formulation of broiler diets with phytogenic additives is critical. few studies have evaluated c. erectus meals in animal diets. in this study, the results of the phytochemical analysis table 6. morphology indicators of birds fed dietary treatments of c. erectus leaf meal dietary treatments (%) vh (μm) vw (μm) cd (μm) vh/cd ratio (μm.μm) -1 0 336.99 c 56.92 c 62.08 c 5.53 a 0.25 395.13 abc 77.83 a 137.40 a 2.95 d 0.50 382.36 abc 63.25 bc 102.13 b 3.74 cd 0.75 398.60 abc 69.55 ba 92.84 b 4.39 bc 1.00 393.53 abc 79.37 a 95.72 b 4.26 bc 1.25 424.56 ab 60.01 bc 91.08 b 5.08 ab 1.50 365.77 bc 69.17 ab 88.64 b 4.39 bc 1.75 343.51 c 57.74 c 87.10 b 3.99 bcd 2.00 433.62 a 60.76 bc 149.12 a 2.95 d sem 56.85 9.57 20.27 0.95 p-value <0.01 <0.01 <0.01 <0.01 means within the same row with different superscripts (a,b,c,d) are significantly different; sem = standard error of mean; vh = villus height; vw = villus width; cd = crypt depth; vh/cd = villus height/ crypt depth. feeding conocarpus erectus leaf meal in broiler chicken (m.f. al-qazzaz et al.) 67 did not agree with hoseini and chaji (2021) who reported higher contents of crude protein (10.5%) and crude fiber (26.1%) and lower contents of ether extract (0.95%), ash (13.3%), and tannin (54%) in c. erectus meal than did the results of the current study. this discrepancy could result from different soil properties, as well as climate and environmental changes in the planted area. in this study, the active compounds (phenolic compounds, flavonoid, tannin, saponin, glycoside, gallic acid, apigenin, catechin, and quercetin) of c. erectus leaf meal were similar to previous studies that detected the phenolic compounds, saponins, flavonoids, and tannins in the aqueous and ethanolic extract of c. erectus (afifi et al., 2021; nascimento et al., 2016). studies showed that various secondary metabolite components, such as saponins, tannins, alkaloids, phenolics, and flavonoids, are available in many parts of plants, particularly medicinal plants (amal et al., 2009; cutter, 2000), and are known to be antioxidants, antimicrobials, and anti-inflammatory (ibrahim et al., 2006; lo and chung, 1999; thompson and collins, 2013; wang et al., 2015; you et al., 2014). it has been reported that environmental factors influence the active compound of the same species of plant (florou-paneri et al., 2019). the supplementation of natural feed additives such as phenolic compounds may essentially affect production performance in poultry (mahfuz et al., 2021). in the present study, diets supplemented with increasing levels of c. erectus meal decreased the growth performance of broilers without significant effect on fi for 0–35 days. the similar fi among treatments indicated that adding c. erectus meal up to 2% did not affect palatability. phytogenic compounds that were added to the diet may affect the animal fi negatively (greathead, 2003). hoseini and chaji (2021) observed no adverse effects on fi in lamb-fed diets containing 50% silage or dried leaf of c. erectus. in the current study, low performance was recorded in birds fed a high level of c. erectus meal in the diet. the increase of c. erectus meal in the diet linearly declined the bw and wg of broiler chicken. this could be due to the high polyphenol content in c. erectus meal may play a role in reducing nutrient utilization, thus affecting negatively bw and wg. brenes et al. (2008) reported a negative effect on poultry performance when using a high concentration of polyphenol compounds in the diet. the inhibition of digestive enzymes because of polyphenol compounds were reported (mcdougall et al., 2005; yilmazer-musa et al., 2012; you et al., 2011), and this could be by the capability of polyphenol compounds in forming complexes with proteins in the digestive system (horigome et al., 1988). this complexation led to a decline in the protein and amino acid digestibility thus negatively effect on bw and wg (ortiz et al., 1993). an earlier study mentioned that decreasing the activity of the digestive enzyme may be due to the capability of polyphenol compounds to form insoluble complexes by binding the nutrients of feed and endogenous proteins in the gut (horigome et al., 1988). in another study, cengiz et al. (2017) reported that high tannin dosage may cause antigrowth in broilers, which could be attributed to the protein-binding capacity, and can reduce nutrient digestibility in birds fed a diet containing a high dose of polyphenol compounds. the type and dosage of the polyphenol compounds as well as the combination with other compounds could affect the absorption and assimilation the nutrients in the bird intestine (martel et al., 2010). also, chamorro et al. (2013) mentioned that the content of polyphenol compounds in grape seed extract added to a diet at 5% decreased wg in the birds. . a similar study carried out by goliomytis et al. (2014) observed that adding 0.5–1 g/kg of dietary quercetin in the diet did not affect the bw of the broiler. in the current study, an increase of c. erectus meal by up to 2% in the diet led to a decrease in the fcr. the present findings are in agreement with those of goliomytis et al. (2014) who reported increasing levels of dietary quercetin in the diet from 0.5 g/kg to 1 g/kg led to a decrease in the fcr of the broiler. feeding birds a 1% c. erectus meal diet lowered the relative abdominal fat weight comfile:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_31#_enref_31 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_4#_enref_4 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_47#_enref_47 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_10#_enref_10 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_21#_enref_21 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_33#_enref_33 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_39#_enref_39 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_39#_enref_39 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_60#_enref_60 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_62#_enref_62 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_66#_enref_66 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_22#_enref_22 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_41#_enref_41 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_27#_enref_27 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_31#_enref_31 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_17#_enref_17 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_43#_enref_43 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_65#_enref_65 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_67#_enref_67 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_30#_enref_30 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_51#_enref_51 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_30#_enref_30 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_30#_enref_30 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_19#_enref_19 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_42#_enref_42 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_20#_enref_20 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_26#_enref_26 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_26#_enref_26 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_26#_enref_26 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_26#_enref_26 68 j. indonesian trop. anim. agric. 48(1):58-73, march 2023 pared to birds fed the basal diet. this could be due to the polyphenol compounds in c. erectus meal (krogdahl, 1985) hindering the digestive enzyme. researchers reported that a high level of gallic acid and quercetin inhibited pancreatic enzymes such as lipase and α-amylase (ganjayi et al., 2017). also, it could be due to the high tannin content that could bind biliary salts and be a barrier to effective fat digestion in poultry (krogdahl, 1985), with a decline in fat absorption. in addition, investigators reported that broiler diets supplemented with leaf meal as a source of polyphenol compounds led to a decrease in the relative abdominal fat weight of broilers (santoso and sartini, 2001). in vitro and in vivo studies likewise mentioned that phenolic compounds have been revealed to possess antiobesity effects (hsu and yen, 2008). by contrast, goliomytis et al. (2014) were unable to detect significant effects among birds fed diets supplemented up to 1 g/kg of dietary quercetin. it has been proven that dietary polyphenol compounds have exhibited anti-obesity properties (liu et al., 2019). villus height, cd, and vw can be used to evaluate the integrity and nutrient absorption of the gastrointestinal system (wright, 2008; xu et al., 2003). feeding c. erectus diets increased vh, cd, and wh in the intestine of birds. the long vh led to an increase in the expression enzymes of brusher border, nutrient transport systems, and absorptive surface area, thus improving the digestive and absorptive function (caspary, 1992). the polyphenolic compounds of c. erectus meal could stimulate epithelial cell mitosis resulting in longer vh in the intestine of birds. the relation between vh and activated cell mitosis was reported by kamboh and zhu (2014). also, the proper villus structure refers to better digestion and absorption(bai et al., 2020). . the increase in the cd of birds fed c. erectus diets referred to a decrease in the number of intestinal epithelial mature cells thus an acceleration of villus renewal, which led to a decline in the upper function of the small intestine. the influence of intestinal mucosa integrity on cd value was reported by sayrafi et al. (2011). the intestinal mucosa damage could be due to the presence of toxic agents in c. erectus meal. nascimento et al. (2016) reported low acute toxicity in swiss albino mice treated with an aqueous extract of c. erectus leaf. shallower vh and cd have been associated with the presence of toxins in the diet (girgis et al., 2010). contrast results were reported by moreno-mendoza et al. (2021) who mentioned that diets supplemented with 1.5% moringa leave meal improved the villus traits of the broiler. omar et al. (2020) reported high vh, vw, and cd in birds-fed diets supplemented with phenolic-rich onion (allium cepa l.) extract. in addition, the decreasing vh/cd ratio in birds that received c. erectus meal led to a decrease in the digestive capacity of the nutrients, and poorer growth performance in the birds. this could be due to the negative influence of polyphenol compounds on mucus secretion (akbarian et al., 2013). the vh/cd ratio is a morphological indicator of intestinal digestive capacity, and a higher ratio refers to superior gut health and a greater capability for absorption in broiler chicken (abolfathi et al., 2019). unlike results that indicated dietary polyphenol-rich grape products effectively increased the vh, and vh/cd ratio in broiler jejunum (viveros et al., 2011). conclusion dietary treatment of 0.25% c. erectus meal had no negative effect on growth performance. by contrast, high levels of c. erectus negatively influenced growth performance and, intestinal morphology. dietary treatments of c. erectus decreased the relative weight of abdominal fat but did not affect carcass traits and organ weights. this study, therefore, suggests that 0.25% c. erectus meal could be supplemented in broiler diets without deleterious effects. references abdel-moneim, a. m. e., a. m. shehata, s. o. alzahrani, m. e. shafi, n. m. mesalam, a. e. taha, a. a. swelum, m. arif, m. fayyaz, file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_35#_enref_35 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_23#_enref_23 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_23#_enref_23 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_35#_enref_35 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_53#_enref_53 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_32#_enref_32 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_26#_enref_26 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_38#_enref_38 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_38#_enref_38 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_63#_enref_63 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_64#_enref_64 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_64#_enref_64 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_18#_enref_18 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_34#_enref_34 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_34#_enref_34 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_13#_enref_13 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_54#_enref_54 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_47#_enref_47 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_47#_enref_47 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_25#_enref_25 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_46#_enref_46 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_50#_enref_50 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_5#_enref_5 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_3#_enref_3 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_61#_enref_61 file:///g:/jitaa-layouting%20page/2023_march_jitaa/al%20qazzaz.docx#_enref_61#_enref_61 feeding conocarpus erectus leaf meal in broiler chicken (m.f. al-qazzaz et al.) 69 and m. e. abd el‐hack. 2020. the role of polyphenols in poultry nutrition. j. anim. physiol. anim. nutr. 104: 1851-1866. https://doi.org/10.1111/jpn.13455 abdelkader, m., b. ahcen, d. rachid, and h. hakim. 2014. phytochemical study and biological activity of sage (salvia officinalis l.). int. j. bioeng. life sci. 8: 1231-1235. abolfathi, m.e., s. a. tabeidian, a. d. foroozandeh shahraki, s. n. tabatabaei, and m. habibian. 2019. comparative effects of n-hexane and methanol extracts of elecampane (inula helenium l.) rhizome on growth performance, carcass traits, feed digestibility, intestinal antioxidant status and ileal microbiota in broiler chickens. arch. anim. nutr. 73: 88-110. https:// doi.org/10.1080/1745039x.2019.1581027 afifi, h. s., h. m. al marzooqi, m. j. tabbaa, and a. a. arran. 2021. phytochemicals of conocarpus spp. as a natural and safe source of phenolic compounds and antioxidants. mol. 26: 1069-1084. https:// doi.org/10.3390/molecules26041069 akbarian, a., a. golian, a. gilani, h. kermanshahi, s. zhaleh, a. akhavan, s. de smet, and j. michiels. 2013. effect of feeding citrus peel extracts on growth performance, serum components, and intestinal morphology of broilers exposed to high ambient temperature during the finisher phase. livest. sci. 157: 490-497. https://doi.org/10.1016/ j.livsci.2013.08.010 al-masari, a., and h. al-himdany. 2022. effect of adding artichoke leaves extractpowder (cynarascolymus l.) to the diet on the productive performanceofbroilers. iraqi j. agric. sci. 53: 9-15. https:// doi.org/10.36103/ijas.v53i1.1500 al-rubaee, s. h., t. s. al-azawi, and a. a. taha. 2020. duodenal histomorphological changes in broilers administered poly d, llactic-coglycolic acid (plga) nanoparticles encapsulated with peptide. iraqi j. vet. med. 44: 80-88. https://doi.org/10.30539/ ijvm.v44i1.945 ali, w., a.-e. ghany, m. a. mahmoud, and l. abdel-mawla. 2017. effect of partial replacement of berseem hay with biologically treated conocarpus on reproductive performance of rabbits. egypt. j. rabbit sci. 27: 289-308. https://doi.org/10.21608/ ejrs.2017.46578 alqazzaz, m., a. a. samsudin, l. h. idris, d. ismail, and h. akit. 2019. effect of energy to protein ratio using alternative feed ingredients on growth performance and nutrient digestibility in broilers. indian j. anim. res. 53: 1069-1073. https://doi.org/10.18805/ ijar.b-1007 amal, a., a. ashraf, and e. hossam. 2009. antioxidant and antimicrobial activities of kaff maryam (anastatica hierochuntica) and doum palm (hyphaene thebaica) cultivated in egypt. biy. bilim. arast. derg. 2: 71-79. https://doi.org/10.3989/gya.064509 atiyah, w. r., and m. f. hamood. 2021. enhancing the productive performance of broiler chickens by adding spirulina platensis compared with probiotic, prebiotics, and oxytetracycline. iraqi j. vet. med. 45: 3136. https://doi.org/10.30539/ ijvm.v45i1.1037 ayoub, n. a. 2010. a trimethoxyellagic acid glucuronide from conocarpus erectus leaves: isolation, characterization and assay of antioxidant capacity. pharm. biol. 48: 328-332. https://doi.org/10.22200/ pjpr.201511-8 bai, m., l. wang, h. liu, k. xu, j. deng, r. huang, and y. yin. 2020. imbalanced dietary methionine-to-sulfur amino acid ratio can affect amino acid profiles, antioxidant capacity, and intestinal morphology of piglets. anim. nutr. 6: 447-456. https:// doi.org/10.1016/j.aninu.2020.03.009 bancroft, j. d., and m. gamble. 2008. theory and practice of histological techniques. elsevier health sciences london. https:// books.google.iq/books? id=dhn2kispfdqc&printsec=frontcover&re dir_esc=y#v=onepage&q&f=false https://doi.org/10.1111/jpn.13455 https://doi.org/10.1080/1745039x.2019.1581027 https://doi.org/10.3390/molecules26041069 https://doi.org/10.1016/j.livsci.2013.08.010 https://doi.org/10.1016/j.livsci.2013.08.010 https://doi.org/10.36103/ijas.v53i1.1500 https://doi.org/10.30539/ijvm.v44i1.945 https://doi.org/10.30539/ijvm.v44i1.945 https://doi.org/10.21608/ejrs.2017.46578 https://doi.org/10.21608/ejrs.2017.46578 https://doi.org/10.18805/ijar.b-1007 https://doi.org/10.18805/ijar.b-1007 https://doi.org/10.3989/gya.064509 https://doi.org/10.30539/ijvm.v45i1.1037 https://doi.org/10.30539/ijvm.v45i1.1037 https://doi.org/10.22200/pjpr.201511-8 https://doi.org/10.22200/pjpr.201511-8 https://doi.org/10.1016/j.aninu.2020.03.009 https://books.google.iq/books?id=dhn2kispfdqc&printsec=frontcover&redir_esc=y#v=onepage&q&f=false https://books.google.iq/books?id=dhn2kispfdqc&printsec=frontcover&redir_esc=y#v=onepage&q&f=false https://books.google.iq/books?id=dhn2kispfdqc&printsec=frontcover&redir_esc=y#v=onepage&q&f=false https://books.google.iq/books?id=dhn2kispfdqc&printsec=frontcover&redir_esc=y#v=onepage&q&f=false 70 j. indonesian trop. anim. agric. 48(1):58-73, march 2023 bashir, m., m. uzair, and b. a. chaudhry. 2015. a review of phytochemical and biological studies on conocarpus erectus (combretaceae). pak. j. pharm. res. 1: 1-8. https://doi.org/10.22200/pjpr.201511-8 basit, m. a., a. k. arifah, t. c. loh, a. a. saleha, a. salleh, u. kaka, and s. b. idris. 2020. effects of graded dose dietary supplementation of piper betle leaf meal and persicaria odorata leaf meal on growth performance, apparent ileal digestibility, and gut morphology in broilers. saudi j. biol. sci. 27: 1503-1513. https://doi.org/10.1016/ j.sjbs.2020.04.017 brenes, a., a. viveros, i. goñí, c. centeno, s. sáyago-ayerdy, i. arija, and f. sauracalixto. 2008. effect of grape pomace concentrate and vitamin e on digestibility of polyphenols and antioxidant activity in chickens. poult. sci. 87: 307-316. https:// doi.org/10.3382/ps.2007-00297 caspary, w. f. 1992. physiology and pathophysiology of intestinal absorption. am. j. clin. nutr. 55: 299s-308s. https:// doi.org/10.1093/ajcn/55.1.299s cengiz, ö., b. h. köksal, o. tatlı, ö. sevim, u. ahsan, s. f. bilgili, and a. g. önol. 2017. effect of dietary tannic acid supplementation in corn-or barley-based diets on growth performance, intestinal viscosity, litter quality, and incidence and severity of footpad dermatitis in broiler chickens. livest. sci. 202: 52-57. https://doi.org/10.1016/ j.livsci.2017.05.016 chamorro, s., a. viveros, c. centeno, c. romero, i. arija, and a. brenes. 2013. effects of dietary grape seed extract on growth performance, amino acid digestibility and plasma lipids and mineral content in broiler chicks. anim. 7: 555-561. https:// doi.org/10.1017/s1751731112001851 cutter, c. n. 2000. antimicrobial effect of herb extracts against escherichia coli o157: h7, listeria monocytogenes, and salmonella typhimurium associated with beef. j. food prot. 63: 601-607. https:// doi.org/10.4315/0362-028x-63.5.601 florou-paneri, p., e. christaki, and i. giannenas. 2019. feed additives: aromatic plants and herbs in animal nutrition and health. academic press. https:// www.sciencedirect.com/ book/9780128147009/feed-additives ganjayi, m. s., b. meriga, b. hari, l. oruganti, s. dasari, and r. mopuri. 2017. polyphenolic rich fraction of terminalia paniculata attenuates obesity through inhibition of pancreatic amylase, lipase and 3t3-l1 adipocyte differentiation. j. nutr. intermed. metab. 10: 19-25. https://doi.org/10.1016/ j.jnim.2017.11.003 george, w. l. 2016. official methods of analysis of aoac international. 20 th ed. aoac international, rockville. https:// www.techstreet.com/standards/officialmethods-of-analysis-of-aoac-international20th-edition-2016?product_id=1937367 girgis, g. n., j. r. barta, m. brash, and t. k. smith. 2010. morphologic changes in the intestine of broiler breeder pullets fed diets naturally contaminated with fusarium mycotoxins with or without coccidial challenge. avian dis. 54: 67-73. https:// doi.org/10.1637/8945-052809-reg.1 goliomytis, m., d. tsoureki, p. simitzis, m. charismiadou, a. hager-theodorides, and s. deligeorgis. 2014. the effects of quercetin dietary supplementation on broiler growth performance, meat quality, and oxidative stability. poult. sci. 93: 1957-1962. https://doi.org/10.3382/ps.2013-03585 greathead, h. 2003. plants and plant extracts for improving animal productivity. proc. nutr. soc. 62: 279-290. https://doi.org/10.1079/ pns2002197 harborne, j. b. 1973. phenolic compounds. in:phytochemical methods. springer, p. 3388. https://link.springer.com/ chapter/10.1007/978-94-009-5921-7_2 hashemi, s., i. zulkifli, m. hair bejo, a. farida, and m. somchit. 2008. acute toxicity study and phytochemical screening of selected herbal aqueous extract in broiler chickens. https://doi.org/10.22200/pjpr.201511-8 https://doi.org/10.1016/j.sjbs.2020.04.017 https://doi.org/10.1016/j.sjbs.2020.04.017 https://doi.org/10.3382/ps.2007-00297 https://doi.org/10.1093/ajcn/55.1.299s https://doi.org/10.1016/j.livsci.2017.05.016 https://doi.org/10.1016/j.livsci.2017.05.016 https://doi.org/10.1017/s1751731112001851 https://doi.org/10.4315/0362-028x-63.5.601 https://www.sciencedirect.com/book/9780128147009/feed-additives https://www.sciencedirect.com/book/9780128147009/feed-additives https://www.sciencedirect.com/book/9780128147009/feed-additives https://doi.org/10.1016/j.jnim.2017.11.003 https://doi.org/10.1016/j.jnim.2017.11.003 https://www.techstreet.com/standards/official-methods-of-analysis-of-aoac-international-20th-edition-2016?product_id=1937367 https://www.techstreet.com/standards/official-methods-of-analysis-of-aoac-international-20th-edition-2016?product_id=1937367 https://www.techstreet.com/standards/official-methods-of-analysis-of-aoac-international-20th-edition-2016?product_id=1937367 https://www.techstreet.com/standards/official-methods-of-analysis-of-aoac-international-20th-edition-2016?product_id=1937367 https://doi.org/10.1637/8945-052809-reg.1 https://doi.org/10.3382/ps.2013-03585 https://doi.org/10.1079/pns2002197 https://doi.org/10.1079/pns2002197 https://link.springer.com/chapter/10.1007/978-94-009-5921-7_2 https://link.springer.com/chapter/10.1007/978-94-009-5921-7_2 feeding conocarpus erectus leaf meal in broiler chicken (m.f. al-qazzaz et al.) 71 int. j. pharmacol. 4: 352-360. https:// doi.org/10.3923/ijp.2008.352.360 horigome, t., r. kumar, and k. okamoto. 1988. effects of condensed tannins prepared from leaves of fodder plants on digestive enzymes in vitro and in the intestine of rats. br. j. nutr. 60: 275-285. https:// doi.org/10.1079/bjn19880099 hoseini, a. f., and m. chaji. 2021. the effect of diets containing dried or ensiled conocarpus leaves on nutrients digestibility and growth performance of finishing lambs. iran. j. anim. sci. res. 13: 13-27. http:// doi.org/10.22067/ijasr.v13i1.83914 hsu, c. l., and g. c. yen. 2008. phenolic compounds: evidence for inhibitory effects against obesity and their underlying molecular signaling mechanisms. mol. nutr. food res. 52: 53-61. https://doi.org/10.1002/ mnfr.200700393 ibrahim, s. a., m. m. salameh, s. phetsomphou, h. yang, and c. w. seo. 2006. application of caffeine, 1,3,7-trimethylxanthine, to control escherichia coli o157:h7. food chem. 99: 645-650. https://doi.org/10.1016/ j.foodchem.2005.08.026 kamboh, a. a., and w. y. zhu. 2014. individual and combined effects of genistein and hesperidin on immunity and intestinal morphometry in lipopolysacharide-challenged broiler chickens. poult. sci. 93: 2175-2183. https://doi.org/10.3382/ps.2014-03971 krogdahl, å. 1985. digestion and absorption of lipids in poultry. j. nutr. 115: 675-685. https://10.1093/jn/115.5.675 laouini, s. e., and m. r. ouahrani. 2017. phytochemical screening, in vitro antioxidant and antibacterial activity of rumex vesicarius l. extract. scientific study & research. chemistry & chemical engineering, biotechnology, food industry. 18: 367-376. lipiński, k., m. mazur, z. antoszkiewicz, and c. purwin. 2017. polyphenols in monogastric nutrition. ann. anim. sci. 17: 41-58. https://doi.org/10.1515/aoas-2016-0042 liu, j., z. he, n. ma, and z. y. chen. 2019. beneficial effects of dietary polyphenols on high-fat diet-induced obesity linking with modulation of gut microbiota. j. agric. food chem. 68: 33-47. https:// doi.org/10.1021/acs.jafc.9b06817 lo, h. h., and j. g. chung. 1999. the effects of plant phenolics, caffeic acid, chlorogenic acid and ferulic acid on arylamine nacetyltransferase activities in human gastrointestinal microflora. anticancer res. 19: 133-139. luo, j., j. song, l. liu, b. xue, g. tian, and y. yang. 2018. effect of epigallocatechin gallate on growth performance and serum biochemical metabolites in heat-stressed broilers. poult. sci. 97: 599-606. https:// doi.org/10.3382/ps/pex353 mahfuz, s., q. shang, and x. piao. 2021. phenolic compounds as natural feed additives in poultry and swine diets: a review. anim. sci. biotechnol. 12: 1-18. https:// doi.org/10.1186/s40104-021-00565-3 martel, f., r. monteiro, and c. calhau. 2010. effect of polyphenols on the intestinal and placental transport of some bioactive compounds. nutr. res. rev. 23: 47-64. https:// doi.org/10.1017/s0954422410000053 mcdougall, g. j., f. shpiro, p. dobson, p. smith, a. blake, and d. stewart. 2005. different polyphenolic components of soft fruits inhibit α-amylase and α-glucosidase. j. agric. food chem. 53: 2760-2766. https://doi.org/10.1021/jf0489926 mladenovic, j., p. mašković, r. pavlovic, b. radovanović, g. aćamović-doković, and m. cvijović. 2011. antioxidant activity of ultrasonic extracts of leek allium porrum l. hem. ind. 65: 473-477. https:// doi.org/10.2298/hemind110301033m mohammadabadi, t., a. jolazadeh, and z. ghezi. 2020. effect of treated conocarpus erectus l. leaves with klebsiella pneumoniae and acinetobacter as tannin-degrading bacteria on digestion activity of rumen microorganisms. biotechnol. anim. husb. 36: 1-16. https://doi.org/10.2298/ bah2001001m https://doi.org/10.3923/ijp.2008.352.360 https://doi.org/10.1079/bjn19880099 http://doi.org/10.22067/ijasr.v13i1.83914 https://doi.org/10.1002/mnfr.200700393 https://doi.org/10.1002/mnfr.200700393 https://doi.org/10.1016/j.foodchem.2005.08.026 https://doi.org/10.1016/j.foodchem.2005.08.026 https://doi.org/10.3382/ps.2014-03971 https://10.1093/jn/115.5.675 https://doi.org/10.1515/aoas-2016-0042 https://doi.org/10.1021/acs.jafc.9b06817 https://doi.org/10.1021/acs.jafc.9b06817 https://doi.org/10.3382/ps/pex353 https://doi.org/10.1186/s40104-021-00565-3 https://doi.org/10.1017/s0954422410000053 https://doi.org/10.1021/jf0489926 https://doi.org/10.2298/hemind110301033m https://doi.org/10.2298/bah2001001m https://doi.org/10.2298/bah2001001m 72 j. indonesian trop. anim. agric. 48(1):58-73, march 2023 moreno-mendoza, y., k. d. lópez-villarreal, c. a. hernández-martínez, l. e. rodrígueztovar, a. c. hernández-coronado, a. sotodomínguez, m. e. hume, and g. méndezzamora. 2021. effect of moringa leaf powder and agave inulin on performance, intestinal morphology, and meat yield of broiler chickens. poult. sci. 100: 738-745. https:// doi.org/10.1016/j.psj.2020.11.058 nascimento, d. k., i. a. souza, a. f. d. oliveira, m. o. barbosa, m. a. santana, d. f. pereira junior, e. c. lira, and j. r. vieira. 2016. phytochemical screening and acute toxicity of aqueous extract of leaves of conocarpus erectus linnaeus in swiss albino mice. an. acad. bras. cienc. 88: 14311437. https://doi.org/10.1590/00013765201620150391 nkukwana, t. t., v. muchenje, e. pieterse, p. j. masika, t. p. mabusela, l. c. hoffman, and k. dzama. 2014. effect of moringa oleifera leaf meal on growth performance, apparent digestibility, digestive organ size and carcass yield in broiler chickens. livest. sci. 161: 139-146. https://doi.org/10.1016/ j.livsci.2014.01.001 oliveira, m. d. d., h. h. d. c. mello, j. h. stringhini, a. g. mascarenhas, e. arnhold, e. c. d. conceição, j. m. d. s. martins, s. júnior, and a. josé. 2018. antioxidant effect of the guava byproduct in the diet of broilers in the starter phase. rev. bras. zootec. 47: 1 -8. https://doi.org/10.1590/rbz4720160290 omar, a. e., h. s. al-khalaifah, w. a. m. mohamed, h. s. a. gharib, a. osman, n. a. al -gabri, and s. a. amer. 2020. effects of phenolic-rich onion (allium cepa l.) extract on the growth performance, behavior, intestinal histology, amino acid digestibility, antioxidant activity, and the immune status of broiler chickens. front. vet. sci. 7: 1-14. https://doi.org/10.3389/fvets.2020.582612 ortiz, l. t., c. centeno, and j. treviño. 1993. tannins in faba bean seeds: effects on the digestion of protein and amino acids in growing chicks. anim. feed sci. technol. 41: 271-278. https://doi.org/10.1016/03778401(93)90002-2 rajabpour, a., a. r. a. mashhadi, and m. r. ghorbani. 2018. acaricidal and repellent properties of some plant extracts against poultry red mite, dermanyssus gallinae (mesostigmata: dermanyssidae). pers. j. acarol. 7: 85-91. https://doi.org/10.22073/ pja.v7i1.34098 santoso, u., and s. sartini. 2001. reduction of fat accumulation in broiler chickens by sauropus androgynus (katuk) leaf meal supplementation. j. anim. sci. 14: 346-350. https://doi.org/10.5713/ajas.2001.346 sayrafi, r., f. soltanalinejad, r. shahrooz, and s. rahimi. 2011. comparative study of the effect of alternative and antibiotic feed additives on the performance and intestinal histomorphometrical parameters of broiler chickens. afr. j. agric. res. 6: 2794-2799. https://doi.org/10.5897/ajar10.1031 shiraze, a., and a. hassanabadi. 2019. estimation of growth parameters of broiler chickens fed with olive leaf powder and αtocopheryl acetate using gompertz model. j. anim. sci. res. 29: 117-129. singleton, v. l., and j. a. rossi. 1965. colorimetry of total phenolics with phosphomolybdic-phosphotungstic acid reagents. am. j. enol. vitic. 16: 144-158. https:// www.ajevonline.org/content/16/3/144 solich, p., v. sedliakova, and r. karlíček. 1992. spectrophotometric determination of cardiac glycosides by flow-injection analysis. anal. chim. acta. 269: 199-203. https:// doi.org/10.1016/0003-2670(92)85403-s tawfeeq, t. a., g. a. jasim, and a. a. nasser. 2020. isolation of umbelliferone from leaves of conocarpus erectus l. cultivated in iraq. al mustansiriyah j. pharm. sci. 20: 82-92. https://doi.org/10.32947/ajps.v20i4.778 tayeb, i., n. artoshi, and b. sögüt. 2019. performance of broiler chicken fed different levels thyme, adiantum, rosemary and their combination. iraqi j. agric. sci. 50: 15221532. https://doi.org/10.36103/ ijas.v50i6.840 https://doi.org/10.1016/j.psj.2020.11.058 https://doi.org/10.1590/0001-3765201620150391 https://doi.org/10.1590/0001-3765201620150391 https://doi.org/10.1016/j.livsci.2014.01.001 https://doi.org/10.1016/j.livsci.2014.01.001 https://doi.org/10.1590/rbz4720160290 https://doi.org/10.3389/fvets.2020.582612 https://doi.org/10.1016/0377-8401(93)90002-2 https://doi.org/10.1016/0377-8401(93)90002-2 https://doi.org/10.22073/pja.v7i1.34098 https://doi.org/10.22073/pja.v7i1.34098 https://doi.org/10.5713/ajas.2001.346 https://doi.org/10.5897/ajar10.1031 https://www.ajevonline.org/content/16/3/144 https://doi.org/10.1016/0003-2670(92)85403-s https://doi.org/10.32947/ajps.v20i4.778 https://doi.org/10.36103/ijas.v50i6.840 https://doi.org/10.36103/ijas.v50i6.840 feeding conocarpus erectus leaf meal in broiler chicken (m.f. al-qazzaz et al.) 73 thompson, m. a., and p. b. collins. 2013. handbook on gallic acid: natural occurrences, antioxidant properties and health implications. nova publishers. https:// novapublishers.com/shop/handbook-ongallic-acid-natural-occurrences-antioxidantproperties-and-health-implications/ viveros, a., s. chamorro, m. pizarro, i. arija, c. centeno, and a. brenes. 2011. effects of dietary polyphenol-rich grape products on intestinal microflora and gut morphology in broiler chicks. poult. sci. 90: 566-578. https://doi.org/10.3382/ps.2010-00889 wang, y., z. li, j. li, y.-f. duan, j. niu, j. wang, z. huang, and h.-z. lin. 2015. effects of dietary chlorogenic acid on growth performance, antioxidant capacity of white shrimp litopenaeus vannamei under normal condition and combined stress of lowsalinity and nitrite. fish shellfish immunol. 43: 337-345. https://doi.org/10.1016/ j.fsi.2015.01.008 wright, h. s. 2008. nutrition education and the elderly. j. nutr. elderly. 1: 3-16. https:// doi.org/10.1300/j052v01n02_02 xu, z., c. hu, m. xia, x. zhan, and m. wang. 2003. effects of dietary fructooligosaccharide on digestive enzyme activities, intestinal microflora and morphology of male broilers. poult. sci. 82: 1030-1036. https:// doi.org/10.1093/ps/82.6.1030 yilmazer-musa, m., a. m. griffith, a. j. michels, e. schneider, and b. frei. 2012. grape seed and tea extracts and catechin 3gallates are potent inhibitors of α-amylase and α-glucosidase activity. j. agric. food chem. 60: 8924-8929. https:// doi.org/10.1021/jf301147n you, j., y. luo, and j. wu. 2014. conjugation of ovotransferrin with catechin shows improved antioxidant activity. j. agric. food chem. 62: 2581-2587. https:// doi.org/10.1021/jf405635q you, q., f. chen, x. wang, p. g. luo, and y. jiang. 2011. inhibitory effects of muscadine anthocyanins on alpha-glucosidase and pancreatic lipase activities. j. agric. food chem. 59: 9506-9511. https:// doi.org/10.1021/jf201452v https://novapublishers.com/shop/handbook-on-gallic-acid-natural-occurrences-antioxidant-properties-and-health-implications/ https://novapublishers.com/shop/handbook-on-gallic-acid-natural-occurrences-antioxidant-properties-and-health-implications/ https://novapublishers.com/shop/handbook-on-gallic-acid-natural-occurrences-antioxidant-properties-and-health-implications/ https://novapublishers.com/shop/handbook-on-gallic-acid-natural-occurrences-antioxidant-properties-and-health-implications/ https://doi.org/10.3382/ps.2010-00889 https://doi.org/10.1016/j.fsi.2015.01.008 https://doi.org/10.1016/j.fsi.2015.01.008 https://doi.org/10.1300/j052v01n02_02 https://doi.org/10.1093/ps/82.6.1030 https://doi.org/10.1021/jf301147n https://doi.org/10.1021/jf405635q https://doi.org/10.1021/jf405635q https://doi.org/10.1021/jf201452v j. indonesian trop. anim. agric. 39(3):188-193, september 2014 issn 2087-8273 the chrome-tanned goat leather for high quality of batik w. pancapalaga1,2, v. p. bintoro1, y. b. pramono1 and s. triatmojo3 1doctorate program of animal science, faculty of animal and agricultural sciences, diponegoro university, tembalang campus, semarang 50275 indonesia 2permanent address: faculty of agriculture and animal sciences, malang muhammadiyah university, jl. raya tlogomas no. 246, malang 65148 indonesia 3faculty of animal science, gajah mada university, jl. fauna, bulaksumur, yogyakarta 55281 indonesia corresponding e-mail: pwehandaka@yahoo.com received july 03, 2014; accepted august 24, 2014 abstrak penelitian bertujuan untuk mengevaluasi kualitas batik kulit yang disamak dengan krom. penelitian dilakukan secara bertahap dengan tahap pertama bertujuan untuk mengevaluasi natrium silika sebagai bahan pelepas lilin batik pada kulit samak krom. penelitian menggunakan rancangan acak lengkap (ral) sebagai perlakuan adalah kosentrasi natrium silika yaitu p1 = 0 , p2 = 2 g/l, p3 = 4 g/l dan p4 = 6 g/l diulang 9 kali. penelitian tahap kedua bertujuan untuk mengevaluasi jenis bahan warna yang digunakan dalam pewarnaan metode batik pada kulit kambing samak krom. penelitian menggunakan rancangan acak lengkap (ral) sebagai perlakuan adalah jenis bahan pewarna yaitu p'1 = asam , p'2 = indigosol, p'3 = napthol dan p'4 = remazol diulang 9 kali. berdasarkan hasil penelitian penggunaan natrium silika kosentrasi 2 g/l menghasilkan prosentasi lilin yang terlepas sebesar 91,4 % serta tidak menurunkan kualitas kulit samak krom. jenis bahan warna asam dan napthol memberikan kuat rekat dan kecerahan warna terbaik serta ketahanan cuci, air, keringat, tekuk dan gosok yang terbaik yaitu 4/5 sampai 5 pada skala abu abu. berdasarkan hasil penelitian kulit kambing samak krom dengan pewarnaan metode batik direkomendasikan menjadi salah satu bahan baku barang-barang kulit. kata kunci : kualitas, batik kulit, samak krom abstract the study aimed to evaluate batik quality by chrome tanned leather. study was conducted in two stages, in which the first stage aimed to evaluate sodium silica as batik wax releasing agent on chrome leather. completely randomized design (crd) was applied in this study. the concentration of sodium silica was treated as treatments, in which tl = 0, t2 = 2 g/l, t3: 4 g/l and t4 = 6 g/l. the second stage of the study was aimed to evaluate the type of dye used in batik method dyeing on chrome-tanned goat leather. crd was used and the treatments were types of dye, i.e. t'1 = acid, t'2= indigosol, t'3 = napthol, t'4 = remazol. in both studies, 9 replicates were applied for each treatment. the use of sodium silicate concentration of 2 g/l resulted in the percentage of release wax of 91.4% and did not degrade the quality of chrome leather. the type of acid dyes and naphthol provided the best adhesion and color brightness and resistance to washing treatment, water, sweat, bend, and rub at 4/5 to 5 on a scale of gray. in conclusion, chrome tanned goat leather with batik dyeing method was recommended to become one of the raw materials of leather goods. keywords: quality, batik leather, chrome tanned 188 j.indonesian trop.anim.agric. 39(3):188-193, september 2014 mailto:pwehandaka@yahoo.com introduction batik is very popular and growing rapidly in indonesia since the recognition of batik by unesco in 2009 as a world cultural heritage from indonesia. currently batik is not only a cloth, but aits application has been developed for chrome – tanned rabbit leather (pancapalaga, 2010), tanned sheepskin with combination (khusniyati, 2007) and the vegetable tanned leather cowhide (kasmudjiastuti et al., 2004). dyeing process for leather batik method is an attempt to show leather motif on the steeplechase system using wax. there are 3 important main factors that are important in the dyeing method; staining of batik wax, batik wax releasing and dyeing (susanto, 1980). staining of batik wax on leather aims to create a motif; the problem is the use of batik wax is continuously in a state of hot liquid. this causes the temperature rising and reach l40°c as it is the temperature of the wax batik, thus it will corrupt the leather when it is attached, because the shrinkage temperature of the skin with chrome tanning materials (laboratory) is 96 120°c and for commercial chrome tanning materials as 84-100°c (o'flalrerty, 1978). the higher temperature of the batik wax, more deep seep into the skin, which will eventually damage the leather and make it hard to be pulled away. gasoline can be used to release batik wax on leather (kamel et al., 2007), yet the use of gasoline is costly and highly inflammable. releasing of batik wax on silk fabric is by using hot water and sodium silica at 2 g/l (susilaning and suheryanto, 20ll). kanagy (1977) stated that the nature of the leather is not resistant to high heat and alkali. in principle, the dyeing method of batik uses cold dyeing so it does not melt the batik wax. according to kamel et al. (2007), the main factors controlling leather dyeing is the physical and chemical properties of the dye in accordance with the structure of the skin, as these can affect the penetration and binding between the dye and skin. staining of skin with batik method using aniline colors materials provide low fastness 3-4 gray scale value. material color pigment combined with a binder at a ratio of 2:1 give the best rub resistance on rabbit leathers batik (pancapalaga, 2010). the material was based on color with no effect on the methanol solvent resistance and bent scrub resistance sheepskins batik (khusniyati, 2007). the affinity of the dye on leather depends on the active substance which is brought by the dye (jocic et al., 2005). there are two active groups of skin, i.e. c00(-) and nh2(+) to assist the skin so that it can be dyed with acid dyes and bases. acidic materials having the quality of anions can color the skin with the existence of traction of groups that are active cation from amine group, whereas when using the alkaline dye it required supporting materials, namely the surface active group of the cation leather could be bound and there will be no rejection of dye bases. then anionic acid dye is one of the positively charged active groups of skin that can bind with acid dyes. this study was conducted in two stages with the objectives were to evaluate sodium silica as batik wax releasing agent on chrome leather and evaluate the type of dye used in batik method dyeing on chrome-tanned goat leather, respectively. materials and methods materials the chrome-tanned goat leather with a thickness of 1.2 mm -1.5 was obtained from the central leather, rubber and plastics yogyakarta. wax release agent such as sodium silica / na2sio3 was obtained at the great hall of batik yogyakarta (ghby). meanwhile, the type of dyeing material composed of color acid dye, indigosol, napthol and remazol were obtained in environment small industries (esi) magetan. methods completely randomized design (crd) was used in the first stage of study. the treatments given were sodium silica concentration as follows: tl = 0, t2 = 2 g/l, t3 = 4 g/l and t4 = 6 g/l. each treatment had 9 replicates. the variables measured were detached candles, tensile strength, sewing strength, enervations and elongation chrome leather. weight percentage of released wax was recorded using weighing scales and calculated using the formula: percentage of wax apart = (initial weight final weight) / initial weight × 100%. tensile strength and elongation testing conducted in accordance with skin of the indonesian national standard (ins.06-17951990) with a tensile strength tester (strength tester). calculation of tensile strength and flexibility used formula of tensile strength = (maximum load tug (kg)/footage sectional area (cm²)). percentage elongation leather = (length of chrome-tanned goat leather for batik (w. pancapalaga et al.) 189 time breaking up original length) / original length x 100%. a test for leather sewing strong was carried out in accordance with indonesian national standard (ins. 06-1117-1989) with kao tioh testing engine. calculations of pull strength and elasticity were calculated with the formula = tensile load stitching/ thick sample (kg/cm). leather enevation was tested in accordance with indonesian national standard (ins 36). all measurements were measured by the tool skin enervation softness tester 300. the treatments in the second stage of the study treatment were a type of dye; t'l = acid t'2= indigozol, t'3=napthol and t'4=remazol. each treatment was repeated 9 times. the variables measured were strong paint adhesion, resistance to washing treatment, sweat resistance, rub resistance and bent resistance. leather endurance test was based on the indonesian national standard (ins). especially for bent resistance was based on ins 06-0996-1989, resistance to washing treatment and perspiration color were based on bs 1006: 1990 uk le and paint adhesion strength was based on ins 06-40851996. the equipment for strong paint adhesion was the satra adhesion of finish tester (std.112). while the equipment to test the robustness washing, water, sweat, rub resistance and bent used crock meter which have fingers with diameter of 1.6 ± 0.01 cm which can move back and forth as far as 10.4 ± 0.3 cm each round, with the force of pressure on the skin of 900 ± 20 g. data analysis data on strong paint adhesion, tensile strength, strong sewing, elasticity and leather enervation were variously tabulated and analyzed. the duncan's multiple range tests was subsequently applied to determine differences between treatments, meanwhile ordinal data such as sweat resistance, water, washing treatment, rub and bent resistance were analyzed using kruskall wallis test. in order to find the difference between the treatments, the mann whitney test was used. results and discussions percentage of released wax and quality of chrome-tanned goat leather the release batik wax on leather could be improved by soaking silica sodium up to 6 g/l (table 1). this was due to alkali silica natrium that was able to break the chains of the bond between the chrome with batik wax. according to rahardja et al (2007), gondorukem content in batik wax was not alkali-resistant. the event of a reaction with an alkaline compound would be a hydrolysis reaction taken place on the carbon chain bridge. therefore, it resulted in chain termination of molecules that ultimately breaking of decreasing of the batik wax bounding force, because the molecular chains become shorter. table 1 shows that sodium silicate as batik wax release agent up to 6 g/l did not damage the structure of chrome leather, such as tensile strength, sewing strength, skin elasticity and enervation. this indicated that the alkali nature of sodium silica was unable to overhaul ties that had bound leather with chrome tanning materials. the bond formed on the chrome-tanned leather was crossed linking; this bond was very strong compared to the electrovalent bond. it was stated by kanagy (1977) that tensile strength, sewing 190 j.indonesian trop.anim.agric. 39(3):188-193, september 2014 table 1. the effect of sodium silicate concentration on the percentage of releasing wax and the quality of chrome tanned goat leather variable concentration of natrium silicate (%) 0 2 4 6 wax regardless (%) 70.70a 91.40b 91.51b 92.38b tensile strength (kg/cm²) 116.11a 116.25a 118.41a 101.77a sewing strength (kg/cm) 62.96a 63.98a 61.27a 65.41a malleability (%) 38.73a 39.776a 35.77a 32.44a enervation (mm) 3.29a 3.11a 3.22a 3.08a different superscript in the same row indicate signficantly differences (p <0.05) strength, flexibility and enervation skin were affected by skin thickness, collagen protein content and density, the magnitude of the angle and thickness of collagen fibers interwoven corium. type of material and color quality of chrome-tanned leather batik in table 2, it appears that the value of adhesion strength toward the type of acid on the leather color of the material was higher than the adhesion strength to the type of material, indigosol color, napthol, and remazol. according to lollar (1978), the bond of the color of the leather material depends on the chemical structure of the material and the color of the active ingredients on the surface of chrome leather. the bonding occurred between chrom3+ with skin proteins through bridge hydroxy groups (oh). in principle, chrome salts would be bond carboxylic acid groups of the protein causing the amount of cationic charge (+) of chrome tanned leather tends to increase. furthermore, chromium salts would be hydrolyzed to release acids that also increased the amount of acidity of leather, thus the higher the value of the acidity of the skin surface, the stronger the acid color paint is bonded. this caused acid color material type has a high adhesion strength. haron et al. (2009) stated that the main mechanism in skin coloration was the formation of salt bonds with the amino group of collagen in the skin. furthermore, it was stated that the acidic or anionic material color dyes had one or more groups auxochrome so3na or so3h that also functioned as a determinant of the level of solubility, in which the fewer the amount of sulfone group, the higher level of acid solubility of the material color. the brightness of the chrome leather batik color was affected by chromium salts, where in principle, chromium salts would be bond carboxylate groups from the protein of the skin, so the chrome tanned leather tends to increase its cationic charge. furthermore, chromium salts would be hydrolyzed to release acids, in which it also increased the acidity of the leather tanned. as a result of these circumstances, the paint on the chrome tanning acid has high bond strength and the penetration would be better and also the evenly distribution of paint on the chrome crosssection of the skin, so that those affect the brightness of the color. the type of acid colors material in batik dyeing method of chrome-tanned goat leather has laundering strength that was higher than most of other type of fabric and colors. many respondents gave score of 5 (very good). the type of acid color material showed greater molecular weight than other types of coloring materials (indigosol, napthol and remazol). according to el-sheshtawy et al. (2006), acid dye had same number of solvent clusters. laundering durability was largely determined by the molecular weight or the large size of the molecule. large molecules had a better washing durability. this is supported by uddin et al. (2010) suggesting that acid dye had good wash resistance and light resistance. resistance properties were strongly influenced by the chrome-tanned goat leather for batik (w. pancapalaga et al.) 191 table 2. the effect of dyeing material type on the color quality of chrome leather batik variable type material dye acid indigosol napthol remazol strong adhesion of paint (g) 201.11b 141.50a 159.00a 144.22a the brightness of the dye (mm) 65.61b 60.34ab 62.01b 51.22a laundering resistance 4-5 4-5 4-5 4 sweat resistance 4-5 4-5 5 4 water resistance 5 4-5 5 4 bent resistance 4-5 4-5 4-5 3-4 rub resistance 5 4-5 4-5 3-4 different superscript in the same row indicate significantly differences (p <0.05) molecular weight and configuration. the highest sweat resistance was achieved in the type of dye napthol. this case indicated that the type of material napthol color in coloring batik methods for chrome tanned goat leather had higher sweat resistance than most other types of fabrics, colors. many respondents gave score of 5 (very good). this indicated that the type of napthol dyes had high affinity to the protein fibers after dye napthol raised with diazonium salts. with this high affinity, it caused sweat compounds containing lots of salt do not damage the leather. the type of napthol dyes in batik coloring for chrome tanned goat leather had the highest water resistance than other types of fabrics, colors. many respondents gave a score of 5 (very good). according to myung et al. (2006), the main characteristic of the dye napthol was its good rubbing resistance as well as wash-resistant and its very good light resistance. high rub resistance was reached on the material type of acid colors of 24.67. this indicated that the type of material in the acid color batik coloring method for chrome-tanned goat leather had high rub resistance than most other types of fabrics and colors. many respondents gave a 4-5 (good). this was because the process of batik dyeing, leather chrome was positively charged, there would be attraction between the molecules of the dye and the surface of the leather, resulting in a very strong bond. bent resistance reached the highest level on the material type of acid colors of 25.50. this indicated that the type of material in the acid color staining method of batik for chrome tanned goatskin had the highest bent resistance than other types of fabrics and colors. many respondents gave a score of 5 (very good). this means that after bent 20,000 times, the cracks in the surface of leather (nerf) was very few. this was presumably due to the type of material, the color staining using acid provide no adjuvant called catalix gs. according to o'flaherty (1978), the fat in the leather affects the bent resistance of leather. high content of fat made the leather bent resistance became higher. on the contrary, if the fat content is low, the bent resistance of the leather became low. for better leather jacket quality, it was required enough fat content, so that the leather jacket had a comfortable flexibility. conclusion the quality of batik by chrome-tanned goat leather could be improved by using sodium silica at 2 g/l as batik wax releasing agent inherent in chrome-tanned goat leather. chrome-tanned goat leather with batik dyeing method was recommended to become one of the raw materials of leather goods. acknowledgment thanks to directorate of higher education, ministry of education and culture of republic of indonesia who registered the patent of the invention under the title: batik method for leather. patent application no. p00201304572. references el-shyshtawy, r.m., s.h. nassar and s.e.nahed. 2006. anionic colouration of acrylic fibre part ii : printing with reactive, acid and direct dyes. j. dyes and pigments. 74(2): 215-222 gustavson, k.h. 1956. the chemistry and reactivity of collagen. academic press inc publisher new york. haroun, a.a. and h.f., mansour. 2005. effect of cationisation on reactive printing of leather and wool . j. dyes and pigments.72(5):8087 haroun, m., k. palmina, a. gurshi. and d. covingto. 2009. potential of vegetable tanning materials and basic aluminium sulphate in sudanese leather industry. j. engineering science and teechnology. 4(1): 20-31 jocic, d., s. vı´lchez. t.topalovic, a. navarro, p. jovancic, m. r. julia and p. erra. 2005. chitosan/acid dye interactions in wool dyeing system. j. carbohydrate polymers. 60 (5):51–59 kanagy, j.r. 1977. physical and performance properties of leather. in: the chemistry and technology of leather. vol. 4, eds. o’flaherty f., w.t. roddy and r.m. lollar. krieger publishing company. florida kamel, m.m., n.f., ali., e.m. khalil and a.saadia. 2007. synthesis of reactive auxiliaries for dye resist treatment of wool. j. applied sciences research. 3(11):12991305 kasmudjiastuti, e. 2004. penerapan sablon pada finishing kulit suede. buletin kulit karet dan plastik. 20(1):15-18 192 j.indonesian trop.anim.agric. 39(3):188-193, september 2014 kasmudjiastuti, e., widhiati and e.s astuti. 1999. finishing batik tulis pada kulit sapi tersamak. buletin kulit karet dan plastik. 25(1): 25-32 khusniyati, i. 2007. pengaruh pengenceran cat basis dengan methanol terhadap ketahanan bengkuk dan gosok cat kulit batik dari kulit domba kombinasi. buletin kulit karet dan plastik. 15(1): 24-30 lollar r.m. 1978. criteria which define tannage in : the chemistry and technology of leather. vol. ii-types of tannage, eds fred o’flaherty, w.t. roddy, r.m. lollar. krieger r.e. publishing company. huntington. new york. myung, j.o., and j.p. kim. 2006. comparison of the resist effectiveness and lveling character of α-bromoacrylamide based and 2,4dichloro-s-triazine based dye-resist agents for wool. j.dye and pigments. 70(6):220225. o’flaherty . 1978. the chemistry and technology of leather litton. volume ii, edes certional publishing co, inc parthasarathi, k. manual on tanning and finishing, consultant unido. pancapalaga, w. and f.w. risky. 2010. rasio pigmen dan binder dalam pewarnaan asam kulit batik. j. protein. 12 : 271-282 purnomo, e. 1995. pengetahuan dasar teknologi penyamakan kulit. akademi teknologi kulit, yogjakarta. rahardja, s., d.setyaningsih. and d.m.s., turnip. 2006. the influence of differences in composition of ingredients, concentrations and types of essential oils on aroma therapy candle-making. j. agric. technol. 2(2):2330 susilaning and suheryanto. 2011. pengaruh kosentrasi natrium silika pada proses pelorodan kain batik sutera. prosiding seminar nasional : pengembangan teknologi kimia untuk pengolahan sumber daya alam indonesia. yogyakarta, 22 februari 2011. p.368-372. susanto, s.1980. the art of indonesia batik handicraft. published by research and development house of leather, rubber and plastic goods industries, yogyakarta. p.5863. uddin, k., and s.hossain . 2010. a comparative study on silk dyeing with acid and reactive dye. intlernational j. engineering & technology ijet-ijens 10(6):21-26 chrome-tanned goat leather for batik (w. pancapalaga et al.) 193 effect of different cryoprotective agents on skim milk and dimitropoulus extender for stallion semen cryopreservation r. i. arifiantini, b. purwantara, t.l. yusuf and d. sajuthi department of clinic, reproduction and pathology, faculty of veterinary medicine bogor agricultural university, darmaga, bogor 16680 indonesia corresponding e-mail: iis_arifiantini@telkom.net received november 17, 2009 ; accepted february 27, 2010 abstract cryoprotective agents (cpas) protect sperm during cryopreservation. the objective of this study was to assess different cpas on stallion semen cryopreservation. skim milk (sm) and dimitropoulos (dv) were the extenders used in this study; each was added by glycerol (gly), combination of ethylene glycol-glycerol (eg+gly) or dimethilformamide (dmf). each semen sample was evaluated and divided equally into six tubes; semen in the three tubes was diluted 1:1 with (sm), while in the remaining tubes the semen was diluted 1:1 by dv. after being diluted, all tubes were centrifuged at 1006xg for 10 minutes. the supernatan discarded, the pellet was rediluted by sm trehalosa or dv trehalose, and added by g, eg+gly, or dmf to reach the final sperm concentration of 200x106/ml. the extended semen was individually packed in 0.3 ml minitube, equilibrated at 4oc for 2 hours, frozen in liquid nitrogen vapor for 10 minutes, and then was stored in liquid nitrogen container at -196 oc. after 24 hours, the semen was thawed at 37 oc for 30 second. there were no significantly different (p>0.05) on the percentages of motile and viable sperm in smt (21.7% and 43.4%, respectively) compared with those extended with dv t extender (26.9% and 50.8%, respectively). dmf demonstrated better results as cpa compared to the others; and dvtdmf combination had the best protection during cryopreservation in this study. keywords: cryopreservation, stallion sperm, sugar, cryoprotective agents introduction stallion semen has low freezing capability; only 24%-40% stallion sperm survived after freezing (linfor et al., 2002; vidament et al., 2002; alvarenga et al., 2004). drastic changes in temperature during chilling, freezing, or thawing of semen, and changes in osmotic pressure during preservation with cryoprotectants cause significant damages on the sperm plasma membrane. cryoprotectant is a substance required in semen freezing. the ideal cryoprotectants have low molecular weight and low toxicity, and should be easily diluted in distilled water (alvarenga et al., 2005). cryoprotectants can be classified based on the basic ingredient; alcohol group (ethylene glycol and alcohol) and amides (methylformamide and dimethylformamide). glycerol penetrates bull sperm within 3-4 minutes (berndtson and foote, 1972); it is not surprising that glycerol is the most commonly used cryoprotectant to freeze bull, ram, buck, and stallion semens. the cryoprotective capacity of a compound is dependent upon both the number of lone-pair electrons the compound contains, the spherical symmetry of the lone-pair electrons, and the solubility of the compound in water (nash, 1996). the toxicity of compounds to cells depends upon both its chemical toxicity to cells (nash, 1996), and its osmotic toxicity (gao et al., 1995), which is induced when the membrane permeability of a penetrating cryoprotectant is much slower than water (gao et al., 1995). the first report on amides as cryoprotectants in the freezing of stallion semen was in the year of 2000; since then, studies on amides, such as methylformamide (mf) and dimethylformamide (dmf) have been popular, although the mechanism of their protection to stallion sperm during freezing was poorly understood. sugars such as glucose and fructose are the major energy source, while high molecular weight-sugars serve as extracellular cryoprotectants. sugars are often used as non68 j.indonesian trop.anim.agric. 35(1) march 2010 mailto:iis_arifiantini@telkom.net penetrating cryoprotectants in combination with penetrating cryoprotectants. differences in the cryoprotectant abilities of different sugars have been demonstrated for bulls and rams. trehalose and sucrose, demonstrated a significant interaction between cooling rates and the presence of sugars (woelders et al., 1997). trehalose is a high molecular weight-sugar, acts as an extracellular cryoprotectant (rudolph and crowe, 1985). supplementation of trehalose and edta in ram semen demonstrated a better preservation to the percentage of motile sperm during cryopreservation than fructose (aisen et al., 2000). however, equine spermatozoa cannot survive freezing without a cryoprotectant. therefore, there is a need to evaluate other cryoprotectants that might be less toxic than glycerol to stallion spermatozoa. this study aimed to evaluate the quality of stallion frozen semen using different cryoprotective agents on skim milk and dimitropoulus extender. materials and methods three stallions used in the study belong to athena stable, cinere-depok; a fourth generation (f4) throughbred, an american pinto, and a warmblood swedish. all stallions were 5-8 years old, healthy, and had demonstrated the best quality on the daily sperm evaluation. an less state all chemical were obtained from merck,kgaa, darmstadt germany. two types of centrifugation extender used in this study were skim milk-glucose (kenney et al., 1975) and dimitropoulos (dv) (ijaz and durchame, 1995). skim milk-glucose extender was composed of 2.4 g skim milk (tropicana slim, plain) and 4 g glucose, which were diluted in 100 ml milli-q water. the mixture was heated for 10 minutes at 92-95 oc, allowed to cool, and then it was filtered, added by 100 mg streptomycin (meiji, japan) and 100,000 iu penicillin (meiji, japan). dv extender consisted of two parts, solution a and solution b. solution a was composed of 12 g glucose and 12 g fructose, which were diluted in 600 ml milli-q water; the mixture was heated for 15 minutes at 95°c, allowed to cool, and then it was stored in the refrigerator for a maximum of a week. solution b was composed of sodium citrate, 9.4 g glycin and 3.5 g sulfanilamide, which were diluted in 1000 ml milli-q water; the mixture was heated until it reached 100°c, allowed to cool, and then it was stored at ambient temperature for a maximum of a week. dv centrifugation extender was made of 30% solution a, 50% stallion semen cryopreservation (r. i. arifiantini et al.) 69 extender amount g eg dmf skim (%) skim milk powder (g) 2.4 5 3&3 5 glucose (g) 4 100 50 streptomycin (mg) 100 penicillin (iu) 100000 1089 1317 1234 dv 50 5 3&3 5 glucose – edta (ml) 25 50 20 0.5 streptomycin (mg) 100 100 100 100 penicillin (iu) 100000 100000 100000 100000 1380 1392 1158 tabel 1. composition of extender mili-q water (ml) trehalosa (mm) osmotic pressure (mosm/kg) lactose 11% (w/v) (ml) trehalose (mm) eggyolk (ml) equex stm (ml) osmotic pressurev(mosm/kg) glukosa – edta consist of : glucose 60 g; sodium citrate 3,70 g; na2 –edta 3,70 g (merck,kgaa, darmstadt germany) ; nahco3 1,20 g (merck,kgaa, darmstadt germany) and milliq water ad 1000 ml. g = glyserol: eg = etylen glykol and glyserol; dmf= dimethilformamid solution b, and 20% egg yolk; the mixture was centrifuged, and then 1000 iu penicillin and 1 mg streptomycin were added per milliliter supernatant. skim milk-based frozen semen extender was supplemented by 50mm trehalose. dv frozen semen extender was composed of 50 ml 11% (w/v) lactose, 25 ml glucose-edta solution (60 g glucose, 3.70 g sodium citrate, 1.20 g nahco3, diluted in 1000 ml milli-q water), 20 ml egg yolk, 0.5 ml equex (orvus es paste, novo, usa), supplemented by 50mm trehalose. each extender 70 j.indonesian trop.anim.agric. 35(1) march 2010 freezing step g eg dmf g eg dmf motile (%) viable (%) after equilibration motile (%) viable (%) after thawing motile (%) viable (%) rr (%) 35.1 19 42.2 41.2 24.7 53.6 tabel 2. mean (±s.e.m.) percentage of progressive motile and viable sperm of stallion frozen semen diluted in skim and dv with different cryoprotective agent skim trehalosa dv trehalosa raw semen 67.5±7.2 a 67.5±7.2 a 67.5±7.2 a 67.5±7.2 a 67.5±7.2 a 67.5±7.2 a 78.4±7.7 a 78.4±7.7 a 78.4±7.7 a 78.4±7.7 a 78.4±7.7 a 78.4±7.7 a 56.0±9.1 b 52.0±9.2 b 57.5±8.9 b 55.5±9.9 b 52.0±11.1 b 57.0±9.8 b 68.5 ±7.0 b 65.9±8.6 b 68.3±7.2 b 71.2±8.7 ab 72.2±7.1 ab 71.3±7.6 ab 23.7±6.4 d 12.8±5.0 e 28.5±5.6 d 27.8±5.5 d 16.7±5.5 e 36.2±7.3 c 45.2±8.5 fg 37.1±8.3 h 48.0±10.3 ef 53.4±10.5d e 39.6±9.0 g h 59.3±12.1 d c different letters in superscript at the same rowdeminstrate significant different (p<0.01); g (gliserol); eg (etilen glikol dan gliserol); dmf(dimethilformamide); sm (spermatozoa motil); sh (spermatozoa hidup) and rr (recovery rate) parameter g dmf g eg&g dmf 16.2±4.5 14.8±2.9 16.1±1.5 16.5±4.5 19.1±2.6 17.6±0.8 19.9±11.5 23.5±5.5 28.2±3.3 27.2±10.0 29.6±5.3 32.3±2.6 dsl (µm) 11.7±2.1 11.2±2.1 12.0±0.8 11.3±1.5 12.6±1.5 12.5±0.8 vap (µm/s) 40.4±9.4 37.9±8.3 40.1±3.9 41.8±11.1 47.9±7.6 43.0±2.4 vcl (µm/s) 59.9±14.3 61.0±15.8 68.9±9.3 69.3±19.8 76.9±7.8 29.8±4.4 29.13±6.0 30.3±2.1 28.7±3.6 31.9±4.4 30.4±2.4 str (%) 72.0±0.1 79.0±0.1 75.0±0.1 69.0±0.1 71.0±0.1 71.0±0.0 lin (%) 50.0±0.1 52.0±0.1 44.0±0.1 43.0±0.1 44.0±0.0 39.0±0.0 wob (%) 66.0±0.1 66.0±0.1 58.0±0.0 61.0±0.1 66.0±0.0 54.0±0.0 3.9±1.0 4.0±0.8 4.7±0.3 4.3±0.3 4.3±0.4 5.0±0.4 bcf (freq) 17.6±3.4 17.7±6.4 17.4±1.3 17.5±5.8 19.3±4.6 17.7±1.1 gly: gliserol, eg: etilen glykol, dmf : dimethilformamide tabel 3. effect of extender, cpas and its combination on the sperm movement evaluate with sperm vision skim trehalosa dv trehalosa eg&gly total motil (%) 65.0±7.5bc 42.0±13.4cd 71.6±11.6ab 69.5±3.8b 47.5±4.9c 78.9±7.6a progresif (%) 28.5±12.8b 11.9±4.3d 35.1±14.8ab 28.5±3.7b 19.5±4.1c 41.5±5.5a dap (µm) dcl (µm) 74.1±14.2 vsl (µm/s) alh (µm) different letters in superscript in the same row demonstrate significant differences (p<0.05) dap: dance average path velocity, dcl: dance curvilinear velocity, dsl: dance straight line, vap: average path velocity, vcl: curvilinear velocity, vsl: straight line velocity, str: straightness, lin: linearity, wo: wobble, alh: amplitude lateral head displacement , bcf: beat cross frequency was added by the cryoprotectant, which conwas 5% glycerol, ethylene glycol (3%)-glycerol (3%) combination or 5% dimethylformamide (dmf) (table 1). semen was collected using a modified artificial vagina which was made of a nishikawa type artificial vagina (japan) with a missouri type semen collecting tube (nasco, fort atkinson, wi); the mouth opening of the collecting tube was covered by gauze to strain out the gel fraction of the ejaculates. macroscopic evaluation on semen samples included volume (ml), color, consistency, and ph (ph-special indicator paper; merck, interval 6-8, scale 0.2). microscopic evaluation on semen samples included percentages of motile sperm and viable sperm, sperm concentration, and sperm morphology. sperm concentration was measured using a neubauer chamber; semen was diluted 1: 100 in 3% nacl. sperm morphology was evaluated on semen smears on glass slides stained with williams. the good quality semen was equally divided into 6 tubes; skim milk-based centrifugation extender was added 1:1 into the first three tubes; dv centrifugation extender was added into the remaining three tubes. extended semen in all tubes was then centrifugated for 15 minutes at 1006 x g; supernatant was discarded, and the pellet was added by the cryoprotectants, with the final sperm concentration was 200x106/ ml. the pellet of three semen samples extended with skim milk was added by trehalose-glycerol (stgly), trehalose-ethylene glycol-gylcerol (steg+gly), or trehalose dmf (stdmf). similarly, the pellet of three semen samples extended with dv was then added with trehaloseglycerol (dvtgly), trehalose-ethylene glycolgylcerol (dvteg+gly), or trehalose dmf (dvtdmf). semen samples were individually packed in 0.3 ml minitub straws, which then arranged in cassettes, equilibrated for two hours at 4-5oc (arifiantini et al., 2007), and frozen in liquid nitrogen vapor (4 cm above the nitrogen level) for 10 minutes before being stored in liquid nitrogen container for 24 hours. straws were thawed in a 37 oc water bath for 30 seconds. motile sperm and viable sperm were evaluated subjectively (quantitatively) on raw semen, and after dilution, after equilibration, and after thawing. as comparison, the quality of thawed semen was evaluated with spermvision (minitüb, tiefenbach, germany) at center of artificial insemination in ungaran, central java, indonesia. data were analysed as a 2x3 factorial analysis by random assignments of groups. each of the two experiments had four replications. when significant differences among treatment were identified, comparisons between means were assessed using duncan's multiple range test (walpole, 1982). results and discussion effects of extender on the quality of frozen semen there were no significant different (p>0.05) on the percentages of motile and viable sperm in skim milk trehalose (21.7% and 43.4%, respectively) compare with those extended with dv trehalose extender (26.9% and 50.8%, respectively) effects of the cryoprotectants on the quality of frozen semen subjective evaluation demonstrated that dmf demonstrated highest percentages of motile and viable sperm (40.5% and 67.8% stallion semen cryopreservation (r. i. arifiantini et al.) 71 casa subjective 65.0±7.5 28.5±12.8 27.4±3.4 48.4±5.1 42.0±13.4 11.9±4.3 15.5±3.1 39.7±6.7 dmf 71.6±11.6 36.2±14.8 31.7±2.9 52.5±6.3 69.5±3.8 28.5±3.7 31.0±3.0 56.4±7.2 47.5±4.9 19.5±4.1 19.1±3.8 39.8±7.3 dmf 78.9±7.6 41.5±5.5 40.2±4.0 64.8±7.0 tabel 4. mean (±s.e.m.) after thawing quality evaluate subjective versus casa extender cryoprotective agent total motile (%) progressive motile (%) progressive motile (%) viable sperm (%) skim trehalose gly eg+gly dv trehalose gly eg+gly st : skim rehalosa ; dvt : dv trehalosa; gly: glycerol; eg :etilen glykol ; dmf : dimethilformamide; data from 2 stallion respectively); followed by glycerol (31.5% and 56.8%, respectively), and combination of ethylene glycol-glycerol (19.3% and 40.1%, respectively). this result compromise with those conducted by casa, dmf had the highest percentages of total motile sperm (74.3%) with progressive motility 37.8%), followed by glycerol (67.2% and 28.5%, respectively) and the lowest of total motile sperm and progressive motile was ethylene glycolglycerol (44.1% and 14.8%, respectively). effects of cryoprotectant and extender on the quality of frozen semen subjective evaluation demonstrated that semen extended with dvtdmf demonstrated post-thaw motility (36.2%), higher than those extended with stdmf (28.5%), dvtg (27.8%), stg (26.7%), dvteg+gly (16.7%) or steg+gly witch only 12.8% (table 2) evaluation using casa aggreement with the subjective evaluation; semen extended with dvtdmf had the highest percentage of progressive motility (41.5%), followed by those extended with stdmf (35.1%), stg (28.5%), or dvtg (28.5%) (table 3). semen extended with steg+gly had the lowest percentages of total motile sperm and sperm with progressive motility which were 42.0% and 11.9%, respectively. studies using sperm vision on the evaluation of stallion sperm were limited; some studies using casa system reported that sperm with rapid average path were those having >30 µm/s curvilinear velocity (vcl). the mean of vcl in this study was 68.4>30 µm/s; the sperm had rapid velocity in all entender groups. the mean percentage of sperm with progressive motility using casa system was different by 1-2% than subjective evaluation; exception was in steg or stdmf, whereas the difference was 4-5% (table 4). this fact suggested that the evaluator’s skill and experience were important on the subjective assessment of sperm motility. cryoprotectants can be classified by their role in cryopreservation into two main groups, namely penetrating agents, which maintain intracellular and extracellular solute concentration, and non-penetrating agents, which maintain only extracellular solute concentration (woelders et al., 1997). based on the main component, cryoprotectants can be classified into alcohol groups (ethylene glycol, glycerol, etc.) and amides (dimethylformamide, acetamide, methylformamide, etc.) (alvarenga et al., 2005). the mechanism of work, type, and concentration are the main three factors which influence the quality of cryoprotectants to protect sperm during cryopreservation. cryoprotectants prevent icecrystals forming; however, they are toxic to sperm during equilibration and post-thawing. stallion sperm are known to be fragile; the right semen extender and cryoprotectant are certainly needed. in this study, dmf in st or dvt demonstrated a better protection on sperm during freezing than glycerol or ethylene glycol-glycerol. this result was different from what was reported by squires et al. (2004), whereas 0.5 m glycerol had a higher percentage of motile sperm (61%) than those with methylformamide (40%) and dimethylformamide (38%). the percentage of motile sperm was increased to 48-54% when higher concentration of mf and dmf (0.6 m or 0.9 m) was used; this was similar to glycerol (52%). the results of this study suggest that dmf had the best protection on stallion sperm during cryopreservation; this was in agreement with some previous studies (alvarenga et al., (2004); medeiros et al. (2002); vidament et al., 2002). the choice of cryoprotectants is based on their ability to protect sperm during freezing, and their low molecular weight, which is important in reducing the high osmolarity-induced sperm toxicity by faster and easier cellular penetration. the molecular weights of ethylene glycol, dmf, and glycerol were 62.07; 73, and 92.10, respectively. the osmotic pressures of steg+gly, stdmf, dvtg, dvteg+gly, and dvtdmf were 1089; 1317 ; 1234 ; 1380 ; 1392 and 1158 mosm/kg, respectively. according to meyers et al. (2004), the volume of stallion sperm is 24.4 µm3, with the tolerance on extender osmolarity varies from150 to 900 mosm/kg, based on these, semen extenders with osmotic pressure close to 900 mosm/kg are stg and dvtdmf. in facts, semen extended with skim trehalose-glycerol had lower post-thawing motility than semen diluted with other extenders which have higher osmotic pressure. it is assumed that the extender’s osmotic pressure, main component of extender, and cryoprotectant’s toxicity influence the quality of frozen semen post-thawing. dv extender combined with cryoprotectants appeared to protect the sperm better during freezing than skim milk extender, which was combined with the same cryoprotectants; this is due to the perfect components of dv extender, 72 j.indonesian trop.anim.agric. 35(1) march 2010 sodium buffer lechitin and lipoprotein from egg yolk. the lipid component of semen extender maintains the integrity of phospholipid bilayer of the cell membrane and protects sperm from cold shock (parks and graham, 1992). it is believed that equex stm (orvus es paste) is able to store more lipids from egg yolk in semen extender. in addition, dv extender contains edta which is a calcium chelating agent (crabo, 2001). previous studies demonstrated that different types and concentrations of cryoprotectants and different breeds of the stallion had different results; the type and concentration of cryoprotectants are carefully selected for every semen samples prior to freezing. in this study, dvtdmf was the best semen extendercryoprotectant combination, followed by dvt glycerol and smtdmf. it was concluded that dimethylformamide was the best cryoprotectant of the stallion semen in this study. stallion sperm have a low tolerance to cold shock; this appears correlated to differences in the phospholipid composition on their plasma membrane. the arachidonic acid (unsaturated fatty acid) in stallion sperm is higher (18.2%) than in bull (3.5%) and ram (4.5-5%) sperm (chow et al., 1986; white, 1993). the inverse proportion of docosapentaenoic acid (dpa; 22:5) and docosahexaenoic acid (dha; 22:6) on phosphatidylcholine and phosphatidylethanolamine may responsible to the sensitivity of stallion spermatozoa to damage during cryopreservation (gadella et al., 2001). white (1993) reported that dpa in bull sperm is very low; while in stallion sperm it reached 17.2%. in contrast, chow et al. (1986) reported that the dha was as high as 61.3% and 61.4% in bull and ram sperm, respectively; while it was 7.6% in stallion sperm. for most substances, melting and freezing points are approximately equal (brown and brown, 2000). the melting points of dha, dpa and arachidonic acid are -44oc, -54oc and -49oc, respectively (vanderjagt et al., 2003). the high dpa and arachidonic acid concentration on stallion sperm plasma membrane with their low melting points are believed contributing to the speed differences between extraand intra-cellular freezings. the high freezing point of the fatty acid on stallion sperm plasma membrane causes lower tolerance to cellular damage than bull or rams sperm. bull, ram, and stallion sperm have differences in osmotic water permeabilities, which are 10.5-10.8 µm min-1atm-1, 8.47 µm min-1atm1, and 26,0 µm min-1atm-1, respectively (noiles et al., 1993). the lower melting point of plasma membrane along with the rapid movement of water from inside the cell during stallion sperm freezing, the faster extracellular freezing; this causes water to move out from inside sperm to the extracellular environment, and sperm become progressively dehydrated. conclusion in this study, dmf demonstrated a better protection to the sperm during semen freezing than glycerol or glycerol-ethylene glycol combination and dv extender combined with dmf had the best results than other semen extender-cryoprotectant combination groups. acknowledgement thanks to the athena stable owners and keeper for supplying the equine semen and bondan achmadi for technical help. references aisen, e.g., h.l alvarez, a. venturino and j.j. garde. 2000. effect trehalose and edta on cryoprotective action of ram semen diluents. theriogenology 53: 1053-1061. arifiantini, r. i., i. supriatna, samsulrizal. 2007. determination of equilibration time during semen processes in stallion using skim milk extender. j. anim. prod. 9(3):145-152 alvarenga, m.a., k.m. leão, f.o. papa, f.c. landim-alvarenga, a.s.l medeiros and g.m. gomes. 2004. the use of alternative cryoprotectors for freezing stallion semen. proceedings of a workshop on transporting gametes and embryos, 2nd-5th october, 2003 brewster, massachusetts: r & w publications. alvarenga, m.a, f.o. papa, f.c. landimalvarenga, a.s.l. medeiros. 2005. amides as cryoprotectants for freezing stallion semen. a. review. anim. reprod. sci. 89 : 105-113. berndtson, w.e. and r.h. foote. 1972. bovine sperm cell volume at various intervals after addition of glycerol at 5 oc. cryobiology 9: 29-33 chow, p.y.w., i.g. white and b.w. pickett. 1986. stallion semen cryopreservation (r. i. arifiantini et al.) 73 stallion sperm and seminal plasma phospholipids and glycerylphosphorylcholine. anim. reprod. sci. 11: 207-213. crabo, b.g. 2001. physiological aspects of stallion semen cryopreservation. aaep proceeding vol. 47: 291-294. gadella, b.m., r. rathi, j.f.h.m. brouwers, t.a.e. stout and b. colenbrander. 2001. capacitation and the acrosome reaction in equine sperm. anim. reprod. sci. 68: 249265. gao, d.y., j. liu, c. liu, l.e. mcgann, p.f. watson and f.w. kleinhaus.1995. prevention of osmotic injury to human spermatozoa during addition and removal of glycerol. hum. reprod. 10:1109–22. ijaz, a and r. durcarme. 1995. effect of various extender and taurine on survival of stallion sperm cooled at 5oc. theriogenology 44: 1039-1050. kenney, r.m., r.v. bergman, w.l. cooper and g.w. morse. 1975. minimal contamination techniques for breeding mares: technique and preliminary findings. proc. am. assoc. equine practnr: 327-336. meyers, s.a., f. tablin and j.h. crowe. 2004. does cellular injury resulting from cryopreservation share traits with sperm capacitation? proceedings of a workshop on transporting gametes and embryos 2nd 5th october 2003 brewster, massachusetts : r & w publications nash, t. 1996. chemical constitution and physical properties of compounds able to protect living cells against damage due to freezing and thawing. in: meryman ht, editor. cryobiology. new york: academic press. pp 179–210. park j.e. and j.k. graham 1992. effects of cryopreservation procedures on sperm membranes. theriogenology 38 : 209-222. rudolph, a.s. and j.w. crowe. 1985. membrane stabilization during freezing: the role of two natural cryoprotectants, trehalose and praline. cryobiology 22: 367-377 squires, e.l, s.l. keith and j.k. graham. 2004. evaluation of alternative cryoprotectants for preserving stallion sperm. theriogenology 62: 1056–1065. vanderjagt, d.j., m.r. trujillo, f.d. thomas, y.s. huang, l.t. chuang and r.h. glew. 2003. phase angle correlates withn-3 fatty acids and cholesterol in red cells of nigerian children with sickle cell disease. lipids health dis.; 2: 2. published online 2003 may 6. doi: 10.1186/1476-511x-2-2. vidament, m., c. daire, j.m. yvon, p. doligez, b. bruneau, m. magistrini and p. ecot. 2002. motility and fertility of stallion semen frozen with glycerol and /or dimethyl formamide. theriogenology. 58: 249-251. walpole re. 1982. introduction to statistics 3rd ed. london. macmillan, white, i.g. 1993. lipids and calcium uptake of sperm in relation to cold shock and preservation: a review. reprod. fertil. dev. 5: 639-658 woelders, h., a. mathiijs and b. engel. 1997. effects of trehalose, and sucrose, osmolality of the freezing medium and cooling rate on viability and intactness of bull sperm after freezing and thawing. cryobiology 35: 93– 105. 74 j.indonesian trop.anim.agric. 35(1) march 2010 d:\07. jppt-management\# hibah effect of feed type and slaughter age on male arab schicken (e. suryanto et al.) 181 the effect of type of feed and slaughter age on the performances and carcass characteristic of male arab chicken e. suryanto, h. sasongko, maryam and r. santosa faculty of animal science, gadjah mada university jl fauna 3, bulaksumur, yogyakarta indonesia, corresponding e-mail: edi_ugm@yahoo.com received july 10, 2009; accepted august 12, 2009 abstract an experiment was conducted to evaluate the effect of type of feed and slaughter age on the performances and carcass characteristics of male arab chicken. thirty six male arab chicken of seven weeks old were divided into two groups, each group consisted of three cages with six chicken in each group. two types of ration consisted of ration one (par-s + corn) containing 2904 kcal me and 17 % cp, and ration two (br ii) containing 3100 kcal me and 19% cp. the chicken were raised for seven weeks, weekly weighed, and randomly taken for slaughter at 12 and 14 week old. the data collected were performances and carcass characteristics of the chicken. the data were analyzed using analysis of variance of completely randomised design. the results showed that the chicken fed br ii consumed more protein and energy (483.7 g cp and 7868.8 kcal me) compared to the chicken fed br i (444.0 g cp and 7586.1 kcal me). besides, the chicken fed br ii produced heavier final body weight (1142.5 g) than the chicken fed with br i (1048.6 g) (p < 0,05). type of ration affected the tenderness of chicken. slaughter age influenced carcass weight and carcass physical composition of the chicken (p<0.05). slaughter age affected the physical characteristic of meat. it could be concluded that male arab chicken fed ration containing higher cp and me (higher feed density) consumed more protein and energy, and finally had heavier final body weight. slaughter age influenced carcass weight, carcass physical composition and meat characteristics of the male arab chicken. introduction trend toward the use of organic poultry production increases since conventional farming may develop health and welfare problems, the most recurrent of which are leg disorders and lameness of the broiler chicken (castellini, 2008). native chickens posses many advantages compared to broiler chickens such as better taste, relatively free of antibiotics and preservative, and higher adaptable to the environment. alders and pym (2009) stated that village poultry (local poultry) played a vital role in many poor rural households in developing countries. they were small, reproduce easily, did not need large investment and scavenge for food, they thrived on kitchen waste, broken grains, earthworms, snails, insects and vegetation. besides, they possed little fat, pleasant flavour, preferred texture in term of meat quality. therefore, it can be an alternative choice of broiler chickens. native chicken has widely been raised by people to produce eggs and meat. female native chicken produces only around 50 eggs per year. male native chicken grows slowly and yields less meat. the cockerels of arab chicken will often be crowing at six weeks of age. males reach a weight of 4.5 ponds and females reach 3.5 ponds (anonymus, 2009). broiler chicken can be harvested at 35 five day old with body weight of approximately 2,0 kg. arab chicken produced more eggs (± 300 eggs per year) than local chicken (anonymous, 2002). the male arab chicken can be raised separately to produce meat. the success of poultry production throughout the world largely comes from the high feed efficiency of poultry compared to many other animal productions. such efficiency is essentially due to the high feed 182 j.indonesian trop.anim.agric. 34 [3] sept 2009 intake of poultry relative to their body weight. furthermore, the potential for good feed efficiency also reinforce through continuous improvement in genetic selection (carre et al., 2008). growth rate of chicken is differed between species and it reaches maximum at 40 days old (hunton, 1995). zulkifli et al. (2000) reported that weight gains of broiler chickens fed commercial feed (22% cp) from 1st week to 6th week were respectively as follows: 125, 202, 345,451, 385 and 299 g/bird/week. age at slaughtering, genetic strains (fastand slowgrowing), physical activity, and pasture intake are key factors in determining meat quality (castellini, 2008). different energy content of ration influenced the physical characteristics of meat such as ph, color and texture. solomon and lynch (1998) reported that meat of animal received high concentrate ration had ph value lower than the low concentrate ration. farmers often feed their native chicken using any kind of feed available and by trial and error in feeding management besides that, they often sell and or slaughter their chicken at old ages, consequently result in the low quality of meat. male arab chicken is potential source of meat derived from poultry. the arab chicken or fayoumis fairly small active chickens that have been raised along the nile river since times before crist/ bc. they are very fast maturing and pullets may start laying a small tinted (off-white) egg by 4 months of age (anonymous, 2009). the studies on their performances and carcass characteristics are very few. the experiment was conducted to investigate the performances and carcass characteristic of male arab chicken which fed different type of ration. materials and methods materials materials used in the experiment were male arab chickens and commercial feed of par-s and corn and br ii rations. the chicken were seven weeks old. par-s+corn was the first type of ration (ration one), containing 2904 kcal me and 17% cp. the ratio of energy and protein of the ration one was 171. br ii was the second type of ration (ration two) containing 3100 kcal me and 19% cp. the ratio of energy and protein of the ration two was 163. the pen used in the experiment had an area of 6 x 1 m and the floor was covered with litter. the pen was divided by metal wire into six cages of 1 x 1 m. the cages were equipped with feed container, water drinker, and lamps. balance of ohaus was used to weigh the feed waste a nd balance of lion for weighing the chicken. methods thirty six male arab chickens of 7 weeks old were randomly divided into two treatments (type of feed). each treatment contained three (3) replications and there were six chicken in each replication. the chickens of the first treatment were fed par-s + corn (br i, ration one) and the chicken of second treatment received br ii (ration two). nutritional contents of the rations are presented in table 1. feed was given twice a day at 08.00 and 15.00 to the male arab chickens. the chickens were kept for 7 weeks. they were given vaccine new castle diseace orally though drinking water. the chickens were weekly weighed, whereas the feed given and feed left were daily weighed during the experiment. the data collected during the experiment were feed, protein and energy consumptions, body weight, weight gain, and feed conversion ratio (fcr). the chickens were taken randomly from each group at 12 and 14 weeks old and slaughtered according to halal method to determine the carcass weight, carcass percentage and carcass physical composition (weight and percentage of carcass parts). carcass parts consisted of breast, thigh, drumstick, wing and back. samples of meat were taken from the breast part of carcass (pectoralis superficialis) (soeparno, 1998) for the determination of physical characteristics of meat such as ph (bouton et al., 1971), water holding capacity/whc (hamm, 1964 cit. soeparno, 1998), cooking loss and tenderness (bouton et al., 1971). completely randomized design was used in this experiment. the data collected were analysed using analysis of variance. any differences between means were funther analysed using duncan new multiple range test. results and discussion performances of arab chicken feed, protein and energy consumptions of male effect of feed type and slaughter age on male arab schicken (e. suryanto et al.) 183 arab chicken are presented in tables 2, 3 and 4, respectively. results of statistical analysis showed that type of feed influenced the feed consumtion of the chicken (p<0.05). the chickens fed par-s+corn consumed more feed amounting to 2710.30 g than the chicken fed br ii (2548. 17 g) dur ing the experiment (p< 0.05). although, the feed consumption of the chickens fed par-s+corn was higher, the chickens significantly consumed less protein (460. 75 g) compared to the chickens fed br ii (488.70 g). this was due to the nutritional content of ration pars+corn that contained less protein and energy (17 % cp, and 2904 kcal me) than ration br ii that contained 19% cp and 3100 kcal me. male arab chicken stopped eating when they have already met the need of energy, therefore the energy intake of both groups of chicken did not differ significantly. this results were in agreement with the study of marks and pesti (1984), that reported that the increase of protein and energy of feed tended to decrease feed consumption. leeson et al. (1992) also reported that an increase of energy and protein in ration caused lower feed consumption. the balance of energy and protein affected the amount of feed consumed by male arab chicken. ration two had narrower balance of energy to protein (163) than the ration one (171). the quality of ration was determined by the energy and protein in it. the lower the energy content of ration would increase the feed consumption (wahju, 2004). since ration one contained lower energy than ration two, the male arab chicken consumed more feed to fulfil their need. age of the chicken affected significantly the feed cons umption a s well a s p r otein a nd ener gy consumptions (p<0.05). as the chicken grew older and increased in their size and their weight, the need of ration also increased. at the beginning of the exper iment the chicken (eight week old) only consumed 313.72 g/bird/week (44.82 g/bird/day), whereas at the end of experiment (14 week old) the feed consumption was 408.75 g/bird/week (58.39 g/ bird/day). lesson and summers (1980) reported that young chicken needed higher protein and then gradually decrease along with the age of the chicken. since the feed consumption increased during the experiment, the protein and energy consumption of the chicken also increased significantly. the need of protein and energy became higher from week to week. the protein and energy intakes of the male arab chicken at eight week old were 56.50 g/bird/ week (8.07 g/bird/day) and 942.60 kcal/bird/week (136.44 kcal/bird/day) respectively, furthermore, the intakes at 14 week old were 73.43 g/bird/day (10.49 g/bird/day) and 1225.73 kcal/bird/week (175.10 kcal/ bird/day), respectively. according to scanes et al. (200 4) ma ny fa ctor s influenced the pr otein consumption of chicken such as strains, protein concentration in ration, the availability of amino acids and growth rate. age of male arab chicken significantly influenced table 1. nutritonal content of ration one (par-s + corn) and ration two (br ii) component par-s 2) corn ration one1) brii (ration two) 2 moisture (%) 12.0 14.0 13.0 12.0 crude protein (%) 19.0 9.0 17.0 19.0 metabolizable energy (kcal / kg) 2800.0 3320.0 2904.0 3100.0 crude fat (%) 4.0 4.0 4.0 4.0 crude fiber (%) 5.5 2.0 4.8 5.0 mineral (%) 7.0 3.3 6.2 6.5 calcium (%) 1.0 0.2 0.8 1.0 phosphorous (%) 0.8 0.3 0.6 0.8 coccidiostat + + + antibiotics + + + note: 1). ration a was the mixture of par-s and corn with the ratio of 4:1 2). feed mill factory of pt japfa comfeed indonesia. 184 j.indonesian trop.anim.agric. 34 [3] sept 2009 the feed, protein and energy consumptions. the consumptions increased along as the age and the body weight of the chicken increased. the effect of age on the consumption was due to the growth rate and the increase of body weight. as the chicken grew older, the body weight increased, and eventually the feed consumption increased as well. north (1984) also stated that feed consumption would increase as the age and the body weight of chicken increased. the final body weights of the male arab chicken fed with par-s+corn was not difference with the male arab chicken fed with br ii. however, the chicken fed br ii tended to have higher final body (1142. 5 g) than the chicken fed with par-s + corn (1026.5 g) (table 5). the higher energy and protein content of ration would resulted in the heavier body weight of table 2. feed consumption of male arab chicken (g/ bird / week) age (week) type of feed 8 9 10 11 12 13 14 total * par-s + corn 305.0 337.4 400.0 416.25 429.15 400.0 422.5 2710.30 br ii 322.43 348.9 368.6 368.33 376.1 368.8 395.0 2548.17 mean 313.72 a 343.15 b 384.3 c 392.29 c 402.63 c 384.40c 408.75c note: a, b, c row means with different superscript are significantly different (p < 0, 05) * significant at p < 0, 05 table 3. protein consumption of male arab chicken (g/ bird / week) age (week) total (g)* type of feed 8 9 10 11 12 13 14 par-s + corn 51.8 57.4 68.0 70.75 72.95 68.0 71.85 460.75 br ii 61.2 66.2 70.0 69.9 71.4 70.0 75.00 483.70 mean 56.5a 61.8 a 69.0b 70.33 b 72.18 b 69.0b 73.43 b note: a, b row means with different superscript are significantly different (p < 0, 05) * significant at p < 0, 05 table 4. energy consumption of male arab chicken (kcal / bird / week) age (week) type of feed 8 9 10 11 12 13 14 total par-s + corn 885.7 979.85 1161.6 1208.8 1246.3 1161.6 1226.95 7870.8 br ii 999.5 1081.5 1142.7 1141.8 1135.7 1143.1 1224.5 7868.8 mean 942.6 a 1030.7 b 1152.2 c 1175.3 c 1191.0c 1152.35c 1225.7 c note: a, b, c row means with different superscript are significantly different (p < 0, 05) effect of feed type and slaughter age on male arab schicken (e. suryanto et al.) 185 the chicken. the weight gain of the male arab chicken from the beginning of experiment till the end of experiment was ranged from 87.5 g/bird/week (12.5g/bird/day) up to 129.5 g/bird/week (18.5 g/bird/day) (table 6). type of feed did not influenced the weight gain of arab chicken. similar to the body weight, the weight gain of the chicken fed br ii tended to have higher final body (769.1 g) than the chicken fed with par-s + corn (695.5 g) (table 6). rahimi and hassanzadeh (2007) reported that the higher protein content of the feed could result in the higher thyroxin and higher plasma growth hormon levels and subsequently impr oved the per forma nce of br oiler chicken. kartikasari et al. (2004) also reported that high protein consumption would produce heavier body weight, since to achieve maximum chicken growth rate largely depend on the availability of protein. the age of chicken influenced the weight gain (p < 0.05). the weight gain was significantly higher at the first until the third week of experiment, and then the weight gain was lower at the following week. busye et al. (1996) stated that the growth rate of chicken was fast at the beginning of the age from hatched up to 6 week old. it was getting slower and at 12 week old the growth rate reduced. the feed conversion ratio (fcr) is presented in table 7. fcr of male arab chicken did not differ between ration par-s+corn and br ii. however, arab chicken fed with br ii ration had lower fcr (3.31) than the chicken fed with par-s+corn (3.91). fcr reflected the physiological ability of chicken in utilized all the nutrients for the growth and the less the fcr meant that the amount of ration used to produce one kg of meat was less as well (wahju, 2004 and scanes et al. 2004). ration containing lower energy and protein content resulted in the higher fcr than ration containing higher energy and protein content. therefore, the consumption of protein by the chicken was lower as well. studies of lee (1987) also reported that ration with low energy produced less body weight and lower table 5. body weight of male arab chicken (g / bird) age (week) type of feed 7 8 9 10 11 12 13 14 par-s + corn 362.5 467.9 542.0 664.5 749.0 850.0 930.0 1026.5 br ii 373.1 551.4 615.8 752.6 843.3 936.0 1052.0 1142.5 mean 367.8a 509.65b 578.9c 708.55d 796,15 e 893.0f 991.0 g 1084.55h note: a, b, c, d, e, f, g, h, row means with different superscript are significantly different (p < 0, 05) table 6. weight gain of male arab chicken (g/ bird) age (week) type of feed 8 9 10 11 12 13 14 total par-s + corn 105.4 74.1 122.5 84.5 101.0 80.0 128.0 695.5 br ii 138.1 104.5 136.8 90.6 92.6 109.3 97.2 769.1 mean 121.75b 89.3 a 129.65b 87.55 a 96.8a 94.65 a 112.6a note: a, b, row means with different superscript are significantly different (p < 0, 05) 186 j.indonesian trop.anim.agric. 34 [3] sept 2009 feed efficiency. the age of chicken influenced the fcr (p < 0.05). fcr of the chicken was relatively low at the 8 – 10 week old, afterward it was higher. it could happen since the feed consumption of the male arab chicken was increased significantly at 10 week old, however starting at 11 week old, the weight gain of the chicken was relatively similar. carcass and meat characteristics the weight of carcass, carcass parts and their percentages of male arab chicken are presented in table 8 and table 9, respectively. the results of statistical analysis showed that type of ration did not influence the weight of carcass and its parts of male arab chicken. however, br ii ration gave higher weight of carcass and its parts than the other ration. slaughtered ages affected the carcass weight and its parts (p < 0.05). the average carcass weight of male arab chicken slaughtered at 12 week and 14 weeks old were 569.25 g/bird and 662.65 g/bird (p< 0.05). breast was the heaviest part of the male arab chicken hat could reach 203.24 g at the age of 14 weeks old. the results of statistical analysis showed that type of feed did not influence the weight of carcass, carcass parts and their percentages of the male arab chicken. age of the chicken significantly affected the weight of carcass and carcass parts. all parts of carcass increased when the chicken became 14 weeks (p < 0.05). the heaviest part of chicken were the breasts of male arab chicken, they were 142.8 g and 174.8 g at 12 and 14 weeks old respectively. the results of the experiment showed that type of ration did not influence the percentages of carcass and its ration of the male arab chicken. the average percentages of carcass of male arab chicken fed with par-s+corn was 62.77% compare to br ii of 62.11%. suda rya ti and ma rya nto (1989) also reported that local pullet chicken had 63.2% of carcass percentage. the age of slaughtering affected the percentages table 7. feed coversion ratio of male arab chicken age (week) type of feed 8 9 10 11 12 13 14 final fcr par-s + corn 2.89 4.55 3.27 4.93 4.25 5.0 3.3 3.91 br ii 2.33 3.34 2.69 4.07 4.06 3.37 4.06 3.31 mean 2.61 a 3.95 bc 2.98 b 4.5 c 4.16 c 4.19 c 3.68 c note: a, b, c row means with different superscript are significantly different (p < 0, 05) table 8. the weight of carcass and its parts of carcass of male arab chicken (g) age (week) 12 14 variable par-s + corn br ii par-s + corn br ii whole carcass 541.8 a 596.7 a 634.3 b 691.0 b breast 134.37 c 157.58 c 181.46 d 203.24 d thigh 101.69 e 111.21 e 123.84 f 132.05 f drumstick 108.13 g 115.54 g 134.72 h 143.39 h wing 87.75 i 98.89 i 113.94 j 122.5 j note: a, b, c, d, e, f, g, h, i, j row means with different superscript are significantly different (p < 0, 05) effect of feed type and slaughter age on male arab schicken (e. suryanto et al.) 187 of carcass of male arab chicken (p < 0.05). carcass percentage of male arab chicken decreased when the chicken slaughtered at older age (14 weeks). the average carcass percentage of male arab chicken slaughtered at 12 week old was 63.75%, whereas at 14 week old it was only 61. 1%. according to mountney (1981), nutritive content of feed, strain and slaughter age influenced the carcass percentage. although carcass percentages decreased significantly at older ages, the percentages of some parts of male arab chicken increased significantly such as breast, thigh, and wing, whereas drumstick of the male arab chicken was not different significantly between the 12 and 14 week old. physical characteristics of meat physical characteristics of meat of male arab chicken fed different type of feed and slaughtered at 12 and 14 weeks old are presented at table 10. the type of feed affected the tenderness of meat of male arab chicken (p<0.05), but it did not influence ph, whc and cl of meat of male arab chicken. ration of par-s+corn resulted in tenderer meat of male arab chicken than ration br ii. soeparno (1998) stated that physical characteristics of meat were influenced by the feed given to the chicken. slaughter age influenced significantly physical cha ra cter istics of mea t of ma le ara b chicken (p<0 . 05). t he mea t of ma le ar a b chicken slaughtered at 12 week old had lower ph values and percentages of cl, but it had higher whc than the meat of male arab chicken slaughtered at 14 weeks old. meat was tenderer at the slaughter age of 12 weeks old. physical characteristics of meat were influenced by many factors including the age of the chicken (soeparno, 1998). table 9. percentage of carcass and carcass parts of male arab chicken slaughtered at 12 and 14 week old (%) age (week) 12 14 variable par-s + corn br ii par-s + corn br ii whole carcass 63.75 a 63.75 a 61.69 b 60.48 b breast 24.8 c 26.4 c 28.6 d 29.4 d thigh 18.8 e 18.6 e 19.5 f 19.1 f drumstick ns 20.0 19.4 21.2 20.8 wing 16.2 g 16.6 g 18.9 h 17.7 h note: a, b, c, d, e, f, g, h, row means with different superscript are significantly different (p < 0, 05) table 10. physical characteristics of meat of male arab chicken age (week) 12 14 variable par-s + corn br ii par-s + corn br ii ph 5.49 a 5.44 a 6.34 c 5.81 b whc (%) 24.17 d 24.27 d 16.20 e 21.28 e cl (%) 9.92 f 10.43 f 15.63 g 15.21 g tenderness (kg/cm2) 1.55 h 1.74 j 1.61 i 1.69 i note: a, b, c, d, e, f, g, h, i, j row means with different superscript are significantly different (p < 0, 05) ; whc : water holding capacity , cl: cooking loss 188 j.indonesian trop.anim.agric. 34 [3] sept 2009 conclusion it could be concluded that male arab chicken fed containing higher cp and me (higher feed density) consumed more protein and energy, and finally they had heavier final body weight. furthermore, slaughter age (12 and 14 weeks) influenced carcass weight, carcass physical composition and meat characteristics of the male arab chicken. references alders, r.g. and r.a.e. pym. 2009. village poultry: still important to millions, eight thousand years after domestication. world’s poul. sci. j. 65:181-190 anonymous. 2002. ayam arab produksi telurnya tinggi. poult.indonesia. 261 : 59 anonymous, 2009. egyptian fa youmi. da ted accesion, 28 th au gust 2009. http :// www. f ea t her s it e. c om/ pou lt r y/ c g d / fa yu / brkfayoumi.html. bouton, p.e., p.v. harris and w.r.shorthose. 1971. the effect of ultimate ph on the ovine muscle mechanical properties. j. food sci. 37:357 busye, j., e.b. kuhn, and e. decyupere. 1996. the use of intermittent lighting in broiler performance and efficiency of nitrogen retention. poult.sci. 75: 589-594 carre, b., s. mignon-grasteau, and h. juin. 2008. breeding for feed efficiency and adaptation to feed in poultry. world’s poult. sci. j. 64:376-390 castellini, c., c. berri, e. le bihan-duval and g. ma rtinyo. 2008. qua lita tive attributes a nd consumer perception of organic and free-range poultry-meat. world’s poult. sci. j. 64:500-512 hamm, r. 1964. the water holding characteristics of meat. csiro, melbouerne, australia. hunton, p. 1995. poultry production. world anim. sci., amsterdam, the netherlands. kartikasari, l.r., soeparno, and setiyono, 2004. kinerja ayam broiler yang mendapat suplementasi methionine pada pakan berkadar protein rendah. buletin peternakan 28 (1), pp 8-14 lee. k. 1987. effect of different methods and severity of growing period feed restriction on growth and laying performance of white leghorn. poult. sci. 66: 694-699 leeson, s. and j.d. summers. 1980. effect of light treatment and diet self selection on laying performance. poult. sci. 59: 11-15 leeson, s., j.d. summers, and j.l. caston. 1992. response of broiler to feed restriction or diet dilution in the finisher period. poult.sci. 71: 20562064 marks, m.l. and g.m. pesti. 1984. the roles of protein levels and diet form on water consumption and abdominal fat pad deposition of broiler. poultry sci. 63:1617-1625 mountney, g.c.. 1981. poultry products technology. t he avi publishing co. inc . , westp or t, connecticut. north, m.o. 1984. commecial chicken production manual. third edition, the avi publishing c. inc., westport, connecticut. rahimi, g. and m. hassanzadeh. 2007. effects of different protein and energy contents of the diet on growth performance and hormonal parameters in two commercial broiler strains. international j. poult. sci. 6 (3): 195-200 scanes, c.g., g. brant, and m.e. ensminger. 2004. poultry production. 4th edition, pearson education inc., new jersey. soeparno. 1998. ilmu dan teknologi daging. cetakan iii. gadjah mada university press. yogyakarta. solomon, m.b. and g.p. lynch. 1988. biochemical, histochemical and palatability characteristics of young ram lambs as affeted by diet and electrical stimulation. j. anim. sci. 66: 1955-1968 sudaryati dan i. maryanto. 1989. komposisi karkas aya m buras pada pemeliharaa n tr adisiona l. prosiding seminar nasional tentang unggas lokal. semarang. halaman 72-74 wahju, j. 2004. ilmu nutrisi ternak dasar. gadjah mada university press, yogyakarta. zulkifli, m.t. norma, d.a. israf and a.r. omart. 2000. the effect of early age feed restriction on subsequent response to high environmental temperatures in female broiler chicken. poultry sci. 79: 1401-1407 effect of feed type and slaughter age on male arab schicken (e. suryanto et al.) 189 j. indonesian trop. anim. agric. 39(2):117-125, june 2014 issn 2087-8273 characteristics of probiotic koumiss from goat milk with addition of roselle extract (hibiscus sabdariffa linn) e. nuraeni, i.i. arief and m. s. soenarno department of animal production and technology, faculty of animal science, bogor agricultural university, jl. agatis, darmaga campus, bogor 16680 indonesia corresponding e-mail : irma_isnafia@yahoo.com received april 08, 2014; accepted may 26, 2014 abstrak susu kambing dan rosella (hibiscus sabdariffa linn) dikenal masyarakat sebagai bahan makanan yang memiliki sifat fungsional untuk kesehatan. penelitian ini menggunakan lactobacillus acidophilus rram-01 dan lactococcus lactis rram-01 sebagai bakteri probiotik, dan saccharomyces cereviceae. tujuan penelitian ini adalah mempelajari karakteristik koumiss (produk fermentasi) probiotik susu kambing dengan penambahan ekstrak rosella. hasil analisis menunjukkan bahwa penambahan ekstrak rosella yang berbeda (0%, 0,5%, dan 1%) pada koumiss probiotik susu kambing tidak mempengaruhi karakteristik kimia maupun mikrobiologi koumiss. pengolahan susu kambing menjadi koumiss dapat menekan pertumbuhan koliform dan memiliki aktivitas penghambatan yang kuat terhadap escherichia coli atcc 25922 melalui uji difusi sumur. analisis mikrobologi menggunakan metode agar tuang. populasi bakteri asam laktat menunjukkan bahwa koumiss telah memenuhi standar produk probiotik (1011 cfu/ml), koliform tidak terdeteksi, sehingga sesuai dengan kriteria badan pengawasan obat dan makanan (bpom) sebagai pangan fungsional probiotik. berdasarkan uji mutu hedonik penambahan ekstrak rosella meningkatkan intensitas warna merah dan kekentalan koumiss, namun tidak berpengaruh terhadap aroma tape dan rasa asam koumiss. kata kunci : koumiss, probiotik, rosella (hibiscus sabdariffa l), susu kambing abstract goat milk and roselle (hibiscus sabdariffa linn) are food ingredients with health functional properties. this research used lactobacillus acidophilus rram-01 and lactococcus lactis rram-01 which had been proven as probiotic, and saccharomyces cereviceae. saccharomyces cereviseae was used to produce specific flavor components in koumiss (bacterial fermentation product). the objective of this research was to study the characteristics of goat milk probiotic koumiss added that with roselle extract. the results showed that the addition of different concentration of roselle extract (0%, 0.5%, and 1%) in the goat milk probiotic koumiss had no effect on chemical and microbiological characteristics of koumiss. goat milk processed into koumiss had ability to suppress the growth of coliform and had strong inhibition activity against escherichia coli atcc 25922 as tested by agar diffusion test. microbiological analysis used in this research was the pour plate method. population of lactic acid bacteria indicated that the product fulfilled standards as probiotics koumiss (1011 cfu/ml), coliform was not detected in the products, therefore the products met the criteria of the national agency of drug and food control (na-dfc) as probiotic functional food. sensory evaluation was conducted by using hedonic quality test. based on the hedonic quality test, addition of different concentrations of roselle extract increased the intensity of red color and koumiss viscosity, but had no effect to the aroma and sourness of koumiss. keywords : goat milk, koumiss, probiotic, roselle (hibiscus sabdariffa linn) fermented milk goat using roselle extract addition (e. nuraeni et al.) 117 introduction koumis is a bacterial fermentation product, derived from middle asia and usually made from horse’s milk fementation with lactic acid and yeast (seydim et al., 2010). common bacteria used as culture starter was lactic acid bacteria that made antimicrobial substrates (lactic acid, bacteriosin, alcohol and h2o2) and has antagonistic characteristic with pathogen bacteria. in rusia, koumis had been used as medicine for tbc caused by mycobacterium tuberculosis (tamime, 2006). koumis is traditional beverage that has well known yet to people in the world and the production is still in limited geography (malacarne et al., 2002). it is caused by the limited supply of horse milk production. the solution is to produce koumiss from other animal milk like goat milk. horse milk production in indonesia is limited in supply and certain area also the production is still low. dairy goat is considered a second rank in milk production after cow’s milk. korhonen and anna (2006) reported that goat milk protein contain bioactive component such as angiotensin conventing enzyme (ace), inhibitory peptides and peptide hypertensive. the component has effect to give immunity for nonimmune disease and to control microorganism infection (hayes et al., 2007). according to the last research, goat milk fermentation can decrease mycobacterium tuberculosis growth because it had the function as natural antiseptic in human body; this property is similar to horse milk fermentation (pana, 2004). red roselle (hibiscus sabdariffa l) is a plant with many functions for our health. roselle contains some nutrition as non hypertension, antioxidant and high content of vitamin c helps digestion process. roselle has been used at agent therapy in treating cancer, treating hypertension and its lipid-lowering. in addition, roselle can also improve sensory value of the product (kustyawati and ramli, 2008). the research about characteristics of goat milk probiotic koumiss added with roselle extract is one way process to know the characteristics of goat milk as raw material to replace horse milk in koumiss production and the effect of roselle to the characteristic of koumiss product. the functional properties of roselle for health is usefull to improve functional characteristic of fermented milk for human’s health therapy. the purposes of this research were to evaluate the chemical and microbiology characteristics, antimicrobial activity, and sensory quality of koumiss probiotic goat milk with different treatments of roselle extract (hibiscus sabdariffa l). materials and methods roselle extraction dry roselle flower was prepared and smoothed in blender. twenty gram of roselle powder was put in erlenmeyer and mixed with 100 ml aquadest. the solvent of roselle was heated in waterbath at temperature of 60ºc for 30 min (hermawan et al.., 2010). koumiss production goat milk was produced from faculty of animal science’s farm. one liter of goat milk was pasteurized at 65°c for 30 min, then cooled to a temperature of 28°c. koumiss starter culture was divided into three equal parts, each part of milk was inoculated with lc. lactis, lb. acidophilus and then incubated at 37°c for 7 h and sc. cereviceae at 25°c for 5 h, respectively. next, it was mixed lc. lactis, lb. acidophilus and sc. cereviceae as much as 3-5% (v/v) into the goat pasteurized milk. the mixture of milk and starter cultures were incubated at 28°c for 24 h to form the desired starter (modified method of rahman et al., 1992). to produce koumiss, one liter of goat milk was pasteurized at 65°c for 30 min, then inoculated with a starter (5%) after temperature reached 28°c. then, it was incubated at 25°c for 18 h (modified method of astawan et al., 2012) (figure1). chemical characteristics analysis the chemical composition of a processed product was the criteria for assessment the quality of the product. koumiss characteristic was analyzed by using aoac method (1995) consisted of ph, total acidity (ta), water, ash, protein, crude fiber, and fat contents. microbiology characteristics analysis the method used in koumiss microbiology enumeration was pour plate method (fardiaz, 1992). colony microbe was enumerated based on plate count standard (pcs) based on bam (2011). antimicrobial activity by agar diffusion test the inhibition test to e. coli bacteria used 118 j.indonesian trop.anim.agric. 39(2):117-125, june 2014 agar diffusion test (arief et al., 2012). the test of sensory characterictic the sensory characteristic test used was the hedonic quality test. the test consisted of color, aroma, viscosity, and sourness. panelists used were trained panelist about 30 people. three samples of koumiss with different roselle extract concentration had already marked with specific code were given to panelists. the scale of value that used in the test was 1, 2, 3, and 4. statistical analysis the experimental design used in this study was a completely randomized design (crd). treatment being tested was the different percentage addition of roselle extract (0%, 0.5%, and 1%). each treatment was repeated for three replication and duplo for each replicate. parametric data were analyzed using analysis of variance (anova) and data were analyzed using the nonparametric kruskal-wallis at the 95% significance level using software statistix 8. tukey test used for significantly difference (p<0.05) tukey test (steel and torrie, 1980). mathematical model used was according to matjik and sumertajaya (2000) as follows: yij = μ + αi + εij where: yij : the response obtained from standard treatment and replicates i-th to j-th μ : average value αi : effect of treatment to level-i εij : error results and discussion morphological examination and total bacteria colonies koumiss starter culture examination was aimed to study the characteristics of the cell wall (gram staining), morphology (form and structure) and to determine the total population from each bacteria. microbial strains used in this study consisted of lactococcus lactis bacteria rram01, lactobacillus acidophilus rram-01 and yeast saccharomyces cereviceae. test results and characteristics of the total population of each bacteria is presented in table 1. lactic acid bacteria population had met the minimum number required in the manufacture of fermented milk that was equal to 108 cfu/ml (salminen and wright, 1998). calculation of population of each type of bacteria, was performed on the starter koumiss and the result fermented milk goat using roselle extract addition (e. nuraeni et al.) 119 figure 1. the process of producing koumiss product pasteurized at 85-90 °c for 30 minutes inoculated with a starter (5%) and incubated again at 25°c for 18 hours koumiss added roselle extract: p1: 0% roselle extract p2: 0.5 % roselle extract p3: 1 % roselle extract goat milk refrigerated (28±1ºc) was population of total lab and yeasts were 2.80 x 1012 cfu/ml and 5.20 x 1011 cfu/ml, respectively. test results showed that the starter culture koumiss demonstrated suitability to the morphological characteristics of each bacteria and yeast. bacterium lactococcus lactis and lactobacillus acidophilus was belongs to the group of gram-positive lactic acid bacteria, according to chandan et al. (2008) chemical characteristics of koumiss the nutritional quality of fresh goat milk was met to sni (2009). water content of fresh goat milk was 84.25 %wb, ash content was 0.78 %wb, peotein content was 3.24 %wb and fat content was 6.54 %wb. coliform was below of sni (2009). koumiss is a type of fermented milk generally made from fermented horse milk using lactic acid bacteria and yeasts. lactic acid bacteria (lab) plays important role in producing lactic acid and yeast which is responsible for producing ethanol and carbon dioxide (surono, 2004). koumiss has similarity with kefir, because koumiss also produces lactic acid and alcohol as well as kefir. the difference lies in the structure of starter cultures used in the manufacture of both types of milk fermentation, where the starter koumiss is not granular (wang et al., 2008). based on the ph value, koumiss is grouped into three types: strong koumiss (ph 3.3-3.9), medium (ph 3.9-4.5), and mild (ph 4.5-5) (danova et al., 2005). the research used application of goat's milk as a raw material for making probiotic koumiss and the addtion of roselle flower extract (hibicuss sabdarifa l) as the treatment. goat milk is milk from a healthy mother goat udder and obtained with the good way (bsn, 1992). goat milk composition per 100 g that used in this research was 87.34% moisture, 0.8% ash, 5.22% fat, 3.9% protein, and 0.19% crude fiber based on wet weight. chemical analysis include total ph, total acidity (ta), moisture content, ash content, protein content, fat content, and crude fiber content. the results presented in table 2. the main results of the metabolism of lactic acid bacteria fermentation were the lactic acid that reduced ph of the final product. the decrease in ph and increase in ta was occurred due to accumulation of organic acid metabolism. koumiss ph values ranged from 3.6 to 3.8. based on the ph value, the resulting koumiss was included in the group of strong koumiss (ph 3.33.9) (danova et al., 2005). low ph value was due to the production of organic acids by lactococcus lactis and lactobacillus achidopillus. total acidity value of koumiss with different treatments fulfilled indonesian standards for flavour fermented milk which were 0.5-2% (bsn, 2009). the addition of roselle extract had no significant different (p>0.05) on ph value and ta. addition of roselle extract had no significant effect to the moisture, ash, protein, fat and crude fiber content. this was caused by addition of small percentage of extract (0%, 0.5%, and 1%). levels of protein and fat in goat milk koumiss were higher than horse milk koumiss. koumiss mare's milk has a protein content of 21% and a fat content of 12% (seydim, 2010). this was caused by differences in the nutritional composition of mare's milk with goat milk (per 100 g). protein and fat content of goat milk is higher than horse milk (chandan et al., 2008). microbiological characteristics koumiss microbiological characteristics observed were total lactic acid bacteria (lab), total yeast and total coliform (table 3). koumiss microbiological characteristics of goat's milk with 120 j.indonesian trop.anim.agric. 39(2):117-125, june 2014 table 1. characteristics and total microbial population bacteria population (cfu/ml) gram stain morphological lactococcus lactis 1.06 x 1010 gram-positive globular, short or long chain. lactobacillus acidophilus 6.40 x 1011 gram-positive rod-shaped, short-chain chains. saccharomyces cereviceae 2.50 x 108 oval-shaped, single-cell morphology the addition of probiotic and roselle extract had no significant different (p>0.05) in relation with the amount of lab, yeasts, and, coliforms. lactic acid bacteria used in this study was lactococcus lactis and lactobacillus achidopillus. each lab had a high population so that the total population of the final product was relatively high. this result was accomplied with yoghurt probiotic added lactobacillus achidopillus could increase population of lactic acid bacteria of the product (astawan et al., 2012). lactobacillus achidopillus rram-01 and lactococcus lactis rram-01 was a probiotic bacterium. lactobacillus acidophillus have been proven as probiotic because it has benebicial fuction such as it could give antimicrobial activities againts pathogenic bacteria (arief et al., 2010), and could prevent hematology health status of rat (astawan et al., 2011) according to the result, lab populations had met with international standards for koumiss probiotic drink that was a minimum of 107 cfu/ml (davidson et al., 2000). probiotics are non pathogenic microbes which when it ingested, produced a positive impact on the health and physiology of the host (commane et al., 2005). probiotic bacteria can affect the physiology directly or indirectly by stimulating the immune system (dewater, 2003). total populations of lab and yeasts koumiss were higher than the total population of the initial starters. these were due to the synergistic relationship between the yeast (saccharomyces cereviceae) with lab (lactococcus lactis and lactobacillus achidopillus). lactic acid bacteria had the ability to break down complex component into simpler components, one of which was lactose. lactose in milk was broken down into simple sugar monomer called glucose and galactose. the sugars could be utilized by yeast as a source of energy, because the yeasts prefer simple sugars rather than complex components, for its growth (seydim et al., 2010). in addition, fermentation by lactococcus lactis and lactobacillus achidopillus produced fermented milk goat using roselle extract addition (e. nuraeni et al.) 121 table 3. microbiological characteristics of goat milk probiotic variable koumiss with increasing roselle extract (log 10 cfu/ml) 0% 0.5% 1% lab 11.42 ± 0.73 12.49 ± 1.33 13.61 ± 0.31 khamir 11.37 ± 1.39 12.55 ± 0.37 12.88 ± 0.51 coliform 0 0 0 table 2. chemical characteristics of koumiss probiotic goat milk variable koumiss with roselle extract 0% 0.5% 1% ph 3.72 ± 0.06 3.78 ± 0.01 3.76 ± 0.06 total acidity (ta) 1.52 ± 0.05 1.56 ± 0.05 1.58 ± 0.04 water (% wb) 85.72 ± 0.14 85.82 ± 0.39 85.67 ± 0.32 ash (% wb) 0.78 ± 0.056 0.76 ± 0.046 0.78 ± 0.040 protein (% wb) 4.04 ± 0.171 4.09 ± 0.387 3.91 ± 0.257 fat (% wb) 6.56 ± 0.137 6.38 ± 0.533 6.60 ± 0.457 crude fiber (% wb) 0.11 ± 0.038 0.16 ± 0.053 0.30 ± 0.164 lactic acid, thereby creating acidic conditions (lower ph) in the fermentation medium. this condition was useful for saccharomyces cereviceae, because saccharomyces cereviceae prefered acidic conditions than alkaline conditions (bennett et al., 1999). the existence of saccharomyces cereviceae was profitable for lactococcus lactis and lactobacillus achidopillus due to metabolites produced by saccharomyces cereviceae, namely organic compounds (ethanol) and carbon dioxide. carbon dioxide balanced oxygen level in the medium and ethanol was able to break down toxic h2o2 into non-toxic compounds with the aid of peroxidase. therefore, the yeast will produce co2 which can balance the levels of oxygen in the medium. the statement was supported by gilliland (1986) which states that excessive oxygen in the growth of bacteria can cause a decrease in cell viability, due to excess oxygen to form hydrogen peroxide which are toxic to cells. microorganisms often used as an indicator of sanitation in food were coliform bacteria. coliform in fresh goat milk was about 2.5 x 102 cfu/ml, while coliform in koumiss was not present at all treatments due to the possibility that colliform would not survive at a low ph. coliform decrease in koumiss was caused by acid production from lab and roselle extract. acid would decrease ph to below ph range of bacteria growth and these acids were in the form of not dissolated and could rapidly diffuse into the microbial cell, causing the cell to be damaged. furthermore acids dissolated would break down into anions and protons, where the proton (h+) will be entered into the cell that causes the metabolic function is compromised, such as the acidification of the cytoplasm, inhibition transfer substrate, synthesis of macromolecules and overall growth bacteria is inhibited (dewater, 2003). inhibitory activity against escherichia coli by roselle extract and antimicrobial koumiss was seen by observing inhibition zone against pathogenic bacteria e. coli with the well diffusion agar method. the amount of inhibition zones was shown in table 4. wide minimum inhibitory zone was one mm, one positive (+) when the clear area between 2-5 mm and strong inhibitory activity (+ +) when more than five mm (jacobsen, 1999). based on the inhibition zone diameter, koumiss had strong inhibitory activity against e.coli. lactobacillus acidophillus could inhibit pathogenic bacteria with strong activities such enteropathogenic e. coli by in vivo analysis (arief et al., 2010). roselle and koumiss extract could inhibit pathogenic bacteria e.coli in a population of 106 cfu/ml, this also supported by rostinawati (2009) which showed that the roselle flower had antibacterial activity. inhibition zone formed on roselle extract was greater than the inhibition zone formed by koumiss which reached zone diameter of 19.37 ± 2.03 mm. this was due to high concentration of flavonoids and organic acids that occured in roselle extract like inhibiscus acid, ascorbic acid, malic acid and protokatekin acids (arelano et al., 2004). inhibition occured because the content of antimicrobials in koumiss were in the form of organic acids, bacteriocins and alcohol (surono, 2004). organoleptic characteristics of koumiss organoleptic test performed in this study was hedonic quality test. the parameters used were color, aroma alcoholic aroma, consistency and flavor. koumiss organoleptic test results is presented in table 5. hedonic quality test results showed that the addition of roselle extract treatment was significant (p<0.05) on the color of koumiss. koumiss with the addition of roselle extract was intended from white to pink. the color difference was caused by the differences concentration in the addition of roselle extract. the red color on koumiss was formed due to the red pigment in the roselle anthocyanin (astawan and andreas, 2008). hedonic quality test results showed that the addition of roselle extract treatment had no significant effect (p > 0.05) to the koumiss aroma. aroma on koumiss was included into weak aroma. aroma was due to a number of volatile components derived from the products that can be detected by the sense of smell (rachmawati, 122 j.indonesian trop.anim.agric. 39(2):117-125, june 2014 table 4. inhibition zone of koumiss and roselle extract against e. coli sample inhibition zone (mm) roselle extract 19.37 ± 2.03 koumiss 8.46 ± 1.10 koumiss 0.5 % roselle extract 9.48 ± 1.95 koumiss 1% roselle extract 8.08 ± 0.77 2001). koumiss aroma associated with total acid and alcohol content. ester component koumiss aroma was affected by the reshuffle resulting from alcohol. ester produced from the reaction between organic acids with alcohols (hesseltine, 1979). hedonic quality test results showed that the addition of roselle extract treatment had significant (p<0.05) effect on the viscosity koumiss which was not added roselle extracts and with added 1% koumiss roselle extract. differences in viscosity at koumiss was influenced by the addition of acid formation due to differences in roselle extract, which caused protein denaturation process at the isoelectric ph so that proteins precipitated to form a gel (sodini et al., 2002). hedonic quality test results showed that the addition of roselle extract treatment had no significant effect (p > 0.05) to the sour taste in koumiss. these results were consistent with the results of testing the acidity (ph) koumiss which also showed that the addition of roselle treatment had no significant effect to the acidity. conclusion the addition of roselle extract different had no affect to the chemical and microbiological characteristics goat milk koumiss probiotic. koumiss goat milk could suppress the growth of coliform and had a strong inhibitory activity against e. coli. population koumiss lactic acid bacteria in probiotic products had met the standards (107 cfu/ml). based on the ph value, the resulting koumiss was strong koumiss group. hedonic quality tests showed that the addition of roselle extract was capable in increasing red color and viscosity of koumiss. references aoac (association of official analytical chemistry). 1995. official methods of analysis. association of official analytical chemistry. bam (bacteriological analytical manual). 2011. aerobic plate count. [internet]. bogor (id): dramaga. [10 october 2012]. http:/cfsan.fdagov/abam/bam.html. bsn (badan standardisasi nasional). 2009. sni. 01-7552-2009: susu fermentasi berperisa. jakarta(id): badan standardisasi nasional. bsn (badan standarisasi nasional). 1992. sni. 01-3141-1992: susu kambing. jakarta (id): badan standardisasi nasional. arelano, h.a., s.f. romero and m.a.c.j. tortoriello. 2004. effectivencess and tolerability of a standardizided extract from hibiscus sabdariffa in patients with mild to moderate hypertention: a controlled and randomized clinical trial. phytomedicine 11:375-382. arief, i.i., b.s.l. jenie, m. astawan and a.b. witarto. 2010. the effectiveness of probiotic lactobacillus plantarum 2c12 and lactobacillus acidophilus 2b4 as antidiarrhea on rat. med. pet. 43:137-143 arief, i.i., b.s.l. jenie , t. suryati, g. ayuningtias and a. fuziawan. 2012. antimicrobial activity of bacteriocin from indigenous fermented milk goat using roselle extract addition (e. nuraeni et al.) 123 table 5. organoleptic characteristics of probiotic goat milk koumiss variable koumiss with addition roselle extract 0% 0.5% 1% colour 1.00 ± 0.00a 1.50 ± 0.51b 1.93 ± 0.52c tapay aroma 2.17 ± 0.75 1.97 ± 0.72 2.10 ± 0.76 viscosity 2.17 ± 0.65a 2.00 ± 1.02ab 2.63 ± 0.81b sour taste 2.40 ± 0.77 2.37 ± 0.76 2.77 ± 0.77 color: 1 = white; 2 = pink; 3 = red; 4 = very red. tapay aroma: 1 = very weak; 2 = weak; 3 = strong; 4 = very strong . viscosity: 1 = very dilute; 2 = rather thick; 3 = thick; 4 = highly viscous. sour taste: 1 = not sour; 2 = slightly acid; 3 = acid; 4 = highly acidic. different small superscript in the same row indicate significantly different results (p <0.05). lactobacillus plantarum 2c12 and its application on beef meatball as biopreservative j. indonesian trop. anim. agric. 37:90-96. astawan, m. and l.k. andreas. 2008. khasiat warna-warni makanan. gramedia. jakarta. astawan, m., t. wresdiyati, i.i. arief and e. suhesti. 2011. hematology profile of rattus norvegicus infected by enteropathogenic escheria coli and fed probiotics. med. pet. 34(1):7-13. astawan, m., t. wresdiyati, suliantri, i.i. arief and r. septiawan. 2012. production of synbiotic yogurt-like using indigenous lactic acid bacteria as functional food. med. pet. 35(1):9-14. bennett, a., r.i. rowe, n. soch and c.d. eckhert. 1999. boron stimulates yeast (saccharomyces cereviceae) growth. university of california. los angeles. chandan, r.c., a.k. nagendra and p. shah p. 2008. dairy processing and qual assurance. wiley-blackwell. usa. commane d, r hughes, c shortt and i rowland. 2005. the potential mechanisms involved in the anticarcinogenicaction of probiotics. mutation research. 591:276-289. danova, s., k. petrov, p. pavlov and p. petrova. 2005. isolation and characterization of lactobacillus strains involved in koumiss fermentation. int. j. dairy technol. 58(2):100-105. davidson, r.h., s.e. duncan, c.r. hackney, w.n. eigel and j.w. boling. 2000. probiotic culture survival and implications in fermented frozen yoghurt characteristics. j. dairy sci. 83:666-673. dewater, j.v. 2003. yogurt and immunity: the health benefits of fermented milk products that contain lactic acid bacteria. in: handbook of fermented functional foods. (e.r. farnworth, ed). crc pr. london. fardiaz, s. 1992. mikrobiologi pangan i. gramedia pustaka utama. jakarta. gilliland, s.e. 1986. the lactobacilli: milk product. in: bacterial starter cultures for foods. (s.e. gililland, ed). crc pr. florida. hayes, m, c. stanton, h. slattery, d. o’sullivan and c. hill. 2007. casein fermentate of lactobacillus animalis dpc6134 contains a range of novel propeptida angiotensinconverting enzyme inhibitors. appl environ microbiol. 73:4658-4667. hermawan, r., e.k. hayati, u.s. budi and a. barizi. 2010. effect of temperature, ph on total concentration and color stability of anthocyanins compound extract roselle calyx (hibiscus sabdariffa l). alchemy. 2(1):104-157. hesseltine, c.w. 1979. microorganisme involves in food fermentation in tropical asia. proceedings, international symposium on mic aspects of food storage process and fermentation in tropical asia, food technol and develop centre, bogor, indonesia, december 10-13, 1979. jacobsen, c.n. 1999. screening of probiotic activities of fourty-seven strain of lactobacillus spp. by in vitro techniques and evaluation of the colonization ability of five selected strains in human. j. appl. environ microbiol. 65(11):4949-4956. korhonen, h. and p. anna. 2006. bioactive peptides: production and functionality. j. dairy sci. 6:945-960. kustyawati, m.e. and s. ramli. 2008. pemanfaatan hasil tanaman hias roselle sebagai bahan minuman. seminar nasional sains dan teknologi ii. universitas lampung, lampung, indonesia, 2008. malacarne, m., m. francesca and s. andrea. 2002. protein and fat composition of mare’s milk: some nutritional remarks with reference to human and cow’s milk. int. dairy j. 12(1):869-871. pana, z.k. 2004. perbandingan pengaruh susu kambing dan susu kuda sumbawa terhadap pertumbuhan mycobacterium tuberculosis secara in vitro. master thesis. institut pertanian bogor, bogor. putri, w.d.r., t.d. widyaningsih and d.w. ningtyas. 2008. dried mixed culture of lactobacillus sp and saccharomyces cereviceae production. j. teknol. indust. pert. 9(2):38-149. rachmawati, n. 2001. pengaruh penambahan tape dan tepung tape ubi kayu (manihot esculenta crantz) terhadap mutu organoleptik dan umur simpan cake tape sebagai salah satu untuk memanfaatkan dan meningkatkan nilai produk tradisional. bachelor thesis. institut pertanian bogor, bogor. rahman, a., f. srikandi, w.p. rahayu, suliantari and c.c. nurwitri. 1992. bahan pengajaran: teknologi fermentasi susu. pusat antar universitas pangan dan gizi, institut pertanian bogor, bogor. 124 j.indonesian trop.anim.agric. 39(2):117-125, june 2014 rostinawati, t. 2009. aktivitas antibakteri ekstrak etanol bunga roselle (hibiscus sabdariffa l) terhadap escherichia coli, salmonella typhi, dan staphylococcus aureus dengan metode difusi agar. bachelor thesis. universitas padjadjaran, bandung. salminen, g. and a. wright. 1998. lactic acid bacteria. dekker inc. new york. seydim, z.g., t. kok-tas and a.k. greene. 2010. kefir and koumiss: microbiology and technology. in: development and manufacture of yoghurt and other functional dairy products. (f. yildiz, ed). crc pr. london. sni. 2009. sni 2981:2009. yoghrt. badan standarisasi nasional, indonesia sodini, a. lucas, m.n. oliveira, f. rameuf and g. corrieu. 2002. effect of milk base and starter culture on acidification, texture, and probiotic cell counts in fermented milk processing. j. dairy sci. 85:2479-2488. steel, r.g.d. and j.h. torrie. 1991. principle procedure of statistics. 2nd ed. mcgrawhill, inc., new york. surono, i.s. 2004. probiotik susu fermentasi dan kesehatan. tri cipta karya. jakarta. tamime, a.y. 2006. fermented milks. a blackwell publishing company. london. wang, j., x. chen, w. liu, m. yang, airidengcaicike and h. zhang. 2008. identification of lactobacillus from koumiss by conventional and molecular methods. eur. food res. technol. 227:1555-1561 fermented milk goat using roselle extract addition (e. nuraeni et al.) 125 materials and methods roselle extraction dry roselle flower was prepared and smoothed in blender. twenty gram of roselle powder was put in erlenmeyer and mixed with 100 ml aquadest. the solvent of roselle was heated in waterbath at temperature of 60ºc for 30 min (hermawan et al.., 2010). the experimental design used in this study was a completely randomized design (crd). treatment being tested was the different percentage addition of roselle extract (0%, 0.5%, and 1%). each treatment was repeated for three replication and duplo for each replicate. parametric data were analyzed using analysis of variance (anova) and data were analyzed using the nonparametric kruskal-wallis at the 95% significance level using software statistix 8. tukey test used for significantly difference (p<0.05) tukey test (steel and torrie, 1980). mathematical model used was according to matjik and sumertajaya (2000) as follows: results and discussion response of different genotypes of broilers to lysine supplementation raised under practical condition b. indarsih and m. h. tamsil faculty of animal science, mataram university, jalan majapahit no 62 mataram, ntb indonesia corresponding e-mail: budiindarsih@gmail.com received april 22, 2012; accepted may 24, 2012 abstrak penelitian ini dilakukan untuk mengevaluasi suplementasi lisine pada broiler komersial umur 4 sampai 42 hari. percobaan faktorial dengan 2 strain (arbor acres dan lohmann) yang dibedakan jantan dan betina sebanyak 450 ekor, kemudian ditimbang dan secara acak ditempatkan pada 60 kadang bambu ukuran 2 m2 dalam bangunan kandang terbuka. starter komersial diberi lisin mono-hcl dengan level 0,0; 0,5; 1,0; 1,5; dan 2,0 g/kg dari umur 4-21 hari, kemudian diberi pakan finisher komersial dari umur 22-42 hari. konsumsi pakan dan pertambahan bobot badan diukur setiap minggu. pada umur 43 hari, 4 ekor untuk setiap ulangan diambil sebagai sampel dan dipotong untuk mengukur parameter karkas. hasil penelitian menunjukkan bahwa penambahan lisin pada ransum komersial meningkatkan berat karkas secara signifikan (p<0,05), dan cenderung meningkatkan daging dada serta menurunkan lemak abdominal. strain arbor acres merespon dengan baik pada pakan dengan lisin yang rendah sedangkan strain lohmann merespon lebih baik pada pakan dengan lisin tinggi. katakunci: lisin, broiler, strain, daging dada, lemak abdominal abstract this study evaluated lysine supplementation of 4 to 42 day of age of two commercial broiler genotypes (arbor acres and lohmann). four hundred and fifty day-old chicks were sexed and randomly distributed into 60 bamboo pens each 2 m2. a starter commercial diet as a basal diet was supplemented with lysine mono-hcl in a 2x2x5 factorial arrangement with lysine levels of 0.0, 0.5, 1.0, 1.5 and 2.0 g/kg fed from 4-21 days of age, and then followed by a finisher diet fed from 22-42 days of age. feed consumption, body weight gain and fcr were determined on weekly basis. on d 43 of experiment, 4 birds per each replicate were processed for carcass parameters. results of the study revealed that lysine supplementation in a starter commercial diet increased significantly carcass weight (p<0.05. improved breast meat and lower abdominal fat were found in lysine supplementation. arbor acres broilers response more efficient in low lysine whilst lohmann broilers were better in a higher level of lysine. keywords: lysine, broiler, genotype, breast meat, abdominal fat introduction responses between and even within a single genotype to different nutrition vary widely. however, differences in nutritional needs were the main factor influencing differences in the carcass, resulting in differences in body composition (moran, l994). this leads to differences in nutritional needs for growth, where one genotype was different from others, especially its response to protein and amino acids (leclercq et al., 1993; sterling et al., 2006). praharaj et al. (2002) studied the interaction between genotypes and dietary lysine content in commercial broiler chicks during the period posthatching to 42 d of age. there was a significant genotype by dietary lysine interaction for body weights at 14 and 28 d of age. labadan et al. (2001) found the estimated lysine requirement for breast muscle growth of the 0 to 2-wk-old broiler (1.32± 0.01%) is substantially higher than the nrc (1984) or nrc (1994) estimates. for fast–growing chickens, age and sex affected the genetic potential for protein deposition (samadi and liebert, 2006; dozier et al., 2009) and there was a variation of energy and broiler genotypes and lysine supplementation (b. indarsih dan m.h.tamsil) 139 protein requirements at different broilers (cherry et al., 1978). referring to bartov and plavnik (l998) that the amino acid levels recommended by nrc (l971, l987, l994) were less appropriate in some experimental circumstances. therefore, some studies revealed the need to correct the proportion levels of crude protein to lysine (harm and russell, l995; labadan et al., 2001). this is due to the fact that the lysine requirement is higher than the nrc (1994) requirement measured with the experimental situation (lehmann et al., 1996; kerr et al., 1999; rezaei et al., 2004; aftab et al., 2007; indarsih and pym, 2010). breast meat deposition can be optimized on feeding at a higher level of lysine in the starter and finisher diets than those recommended by nrc (1994) as studied by rezaei et al. (2004). lysine is one of the limiting amino acids in modern broiler diets and its inclusion in the diet of the several studies is intended to achieve optimal performance (hosseini et al., 2009; viola et al., 2009; nasr and kheiri, 2011) particularly for breast muscle growth (moran and bilgili, 1990; labadan et al., 2001; queentin et al., 2005). however, under the practical condition, efforts to maximize performance are impeded by insufficient supply of amino acids when the nutritional need for each genotype is not completely identified. in addition, most studies examined responses of broilers to lysine or amino acid requirements used the formulated diets based on the experimental condition (labadan et al., 2001; praharaj et al., 2002; sterling et al., 2006). therefore, the following study was conducted to determine the response of different commercial broilers to lysine supplementation. and the specific objective of this work is to examine a standard commercial ration in terms of its applicability for broiler industry under practical condition. materials and methods birds and housing four hundred and fifty day-old chicks of commercial broilers obtained from two national commercial breeding companies were used in this study. these two commercial genotypes (strain 1 = arbor acres = aa; strain 2 = lohmann = ln) were obtained on the same day (n=225 per genotype) and they were then wing banded and sexed by feather sexing. the birds were randomly distributed into 60 bamboo cages of 1 m2 each and were equipped with one hanging feeder and one rounded plastic drinker. a standard commercial diet was offered for the first 3-days of age, and then they were fed an experimental diet supplemented by lysine until 42 day of age. birds were provided 24 hours of light was throughout the experimental period. chicks were vaccinated at the hatchery for marek's disease while newcastle disease vaccination was carried out during the study. experimental diets were provided in crumble form for starter phase and pellet form for finisher phase. the birds were kept in an open–sided house with uncontrolled temperature or varied. feed and water were available ad libitum. environmental temperature was recorded daily. diets and treatments the experiment was in a completely randomized design (crd) in a factorial arrangement. two genotypes, five dietary treatments and two sexes were imposed in this study. the birds were divided into five groups with three replicates each 12 birds (180 birds/ genotype), and fed a commercial starter diet containing 213 g cp/kg diet from d-old-chicks to 3 weeks of age, and then a commercial finisher diet containing 171 g cp/kg diet as a control group. prior to study, feed were analyzed for crude protein, crude fat, and crude fiber (table 1) according to the methods of the association of analytical chemists (aoac, 1990). the experimental diets were a commercial starter diet and supplemented with of 0.00, 0.5, 1.0, 1.5, and 2.0 g/kg lysine mono-hcl. rice hulls were finely grounded to provide 1.0% of the amount of a finisher diet that serves as a dilution. measurement individual body weight of broilers was recorded at the beginning of the experiment and at 9, 16, 23, 30, 37 and 42 days of age thereafter. feed conversion ratio (fcr) was calculated as the ratio between feed intake (fi) and body weight gain (bwg) taking into account in the calculation of dead chickens. breast meat was measured by taking the breast meat to the left and right with the skinless and boneless. abdominal fat was defined as fat around the abdomen, around vent and covering the gizzard. at the end of the experiment on day 42, 4 broilers whose body weights were similar to the 140 j.indonesian trop.anim.agric. 37(2) june 2012 group average were selected from each of the replicate groups in each treatment. after a 12-h fast, birds were stunned with a knife, bled by severing the jugular vein, scalded in water for 11.5 min, and defeathered manually to determine percentage breast meat (bm) and abdominal fat (af). data analysis data were analyzed by anova based on the general linear model (glm) procedure using sas version 6:21 (sas institute inc., 1985). genotype, sex and lysine were as main effects. when differences among means were found, means were compared using duncan's new multiple range test (steel and torrie, 1980 ). results and discussion performance body weight gain, feed intake, feed conversion and final body weight of two different genotypes from hatching until the age of 42 days were presented in table 2. figure 1 and 2 are graphs of body weight gain (g/d) of each commercial broiler chicken in response to lysine supplied diet which were measured weekly. this study demonstrated that increasing dietary lysine have no significant effects on all growth performance parameters measured. however, significant differences in fi, fcr and bw but not bwg due to genotypes were observed (table 2). genotype by dietary lysine interaction was not significant at 42 d of age for bwg, fi, fcr and bw. in terms of bwg, male broilers have a greater response than female broilers to dietary lysine (table 2 and 4) as expected. however, fcr for both sexes was not significant (p>0.05). this indicates that males required a higher level of dietary lysine than females for maximal bwg and dietary digestible lysine for fcr was higher than for bwg (greenwood et al., 2005; dozier et al., 2009; dozier et al., 2010; indarsih and pym, 2010; mehri et al., 2010). male growing chickens gained faster than females due to higher daily feed intake in males (samadi and libiert, 2006) were also observed in this study. in general, broilers fed with a standard commercial diet showed lower bw, providing evidence that lysine supplementation is essential to improve performance. this study found that the 2.0 g/kg lysine added diet resulted in the highest body weight at 42 d of age (2253 g) and with no lysine supplementation performed the lowest body weight in the control birds (2163 g). a better performance in a height lysine is related to a higher amino acid availability to muscle growth and the better efficiency rate of protein and energy in transforming into tissue synthesis and accumulation (nasr et al., 2011). responses of aa birds to an increment of lysine supplementation for bwg varied (figure 1) whilst ln birds responded in a similar manner from hatching to 30 d of age ( figure 2). the average growth rate was 50.6 g/d and 47.5 g/d and the highest responses were in 0.5 g/kg lysine hcl (52.4 g/d) for aa birds and 1.0 g/kg lysine hcl (48.0 g/d) for ln birds respectively. the aa broilers were significantly more efficient than did ln broilers with fcr was 1.871 and 1.923 respectively. these are probably related to the differences in the ratio of synthesis and degradation of body proteins (fatufe et al., 2004). the present findings are consistent with praharaj et al. (2002), sterling et al. (2006), and rack et al. (2009) who observed differences in response to cp and limiting amino acids in different genotypes. feed intake increased linearly in response to the incremental dietary lysine (table 2). this is similar to previous studies reported by some workers (sterling et al., 2006; aftab et al., 2007; viola et al., 2009). however, this study also obtained at the highest feed intake did not increase the abdominal fat. these results corresponded with those of hosseini et al. (2009) who observed an increase in feed intake of excess broiler genotypes and lysine supplementation (b. indarsih dan m.h.tamsil) 141 table 1. chemical composition of commercial diets used (%) starter diet grower diets crude protein* 21.3 17.1 crude fiber 3.4 3.7 crude fat 3.5 5.5 water 12.2 11.7 ash 10.7 10.9 calcium** 0.9 0.8 phosphor 0.7 0.6 * analyzed according to aoac (1976) ** information of manufacture lysine diet was related to higher requirements for energy to support better metabolism of additional lysine. considerable research have reported that broilers fed low cp diet supplemented with essential amino acids, to some extent, could accurate growth depression (hussein and al– batshan, 1999; sterling et al., 2006; abdelmaksoud et al., 2010; khan et al., 2011). lysine was one of the essential amino acids that are very critical primarily in the commercial feed in the tropical regions where the ambient temperature have a contributable effect on feed intake. the low performance of the high temperature was because of the limited ability of chickens to release body heat (gous, l998; ojano-dirain and waldroup, 2002). in warmer conditions (32oc) compared to 22oc, lysine would affect the metabolism of proteins (tabiri et al., 1998; temim et al., 2000), resulting to increasing the requirements of energy. in addition, at hot climate, high protein does not change the protein turnover (temim et al., 2000). low performance in high temperature was due to reduced feed intake (hussein and al-batshan, 1999; faria filho et al., 2007) with a consequent effect was 142 j.indonesian trop.anim.agric. 37(2) june 2012 table 2. effect of sex, strain and dietary treatment on body weight gain (g), feed intake (g), fcr and live body weight (g) of commercial broilers from hatching until 42 days of age treatment gain (g) feed intake (g) fcr (g:g) live weight (g) lysine hcl (g/kg) 0.0 2028 3774 1.862 2163 0.5 2046 3845 1.886 2196 1.0 2066 3977 1.928 2199 1.5 2069 3993 1.929 2210 2.0 2083 4005 1.938 2253 sex male 2140a 4045a 1.895 2245a female 1974b 3791b 1.923 2155b genotype aa 2083 3840b 1.871b 2214a ln 2032 3996a 1.947a 2176b anova df probabilities lysine 4 0.9176 0.1091 0.4179 0.6390 sex 1 0.0002 0.0003 0.3414 0.0186 genotype 1 0.2170 0.0206 0.0001 0.3637 lysine x sex 4 0.7472 0.7325 0.4958 0.2040 lysine x genotype 4 0.2076 0.2156 0.5610 0.5788 sex x genotype 1 0.3305 0.1804 0.9937 0.2359 lysine x sex x genotype 4 0.9958 0.5331 0.6853 0.0105 error 59 a-b values within comparison with different superscripts indicate significantly different (p<0.05) deficiency in other nutrient requirements particularly lysine intake. razuki et al. (2011) reported the differences between genotypes in bw to be genotype dependent. the differences between genotypes in their growth at high ambient temperature were related to their genetic potential for growth rate. for instance, bwg of rose, hubbard, cobb and lohmann from 29-49 d of age were 1032±15.89, 1017±16.90, and 1113±16.30 and 1051±15.89 g at environmental temperature 35-36°c. at the time of the study, the experiment was conducted in an open-sided house with ambient temperature can be categorized quite high with a range between 32-35°c. this condition mainly affects in the control group with no lysine supplementation which showed the lowest total body weight gain than other groups. this is also supported by the data of lower total feed intake compared with the group receiving lysine supplementation (table 2). when refer to the study of temim et al. (2000), it was clear that at heat exposure changes specifically the requirements of some amino acids rather than protein requirements. increasing utilization of the protein fraction of the diet may have caused an increase in the total heat increment metabolized (rack et al., 2009). therefore, improvement in weight gain with the use of low cp diet supplemented with lysine was more likely due to a reduction in heat increment produced by the metabolism of excess proteins (saima et al., 2010). the low protein diet with ideal protein concept improved performance in heat exposure broiler genotypes and lysine supplementation (b. indarsih dan m.h.tamsil) 143 table 3. the influence of lysine level on breast meat, abdominal fat and carcass (g) of broiler genotypes from hatching to 42 days of age treatments breast meat (g) abdominal fat (g) carcass (g) lysine hcl (g/kg) 0.0 337.5 46.7 1563a 0.5 337.9 45.3 1524a 1.0 351.1 49.0 1570a 1.5 332.0 48.6 1516b 2.0 354.7 45.7 1643a sex male 358.1a 46.9b 1619a female 327.7b 47.9a 1485b genotype aa 339.2 46.1 1565 ln 346.2 48.8 1538 lysine 4 0.5595 0.7417 0.8848 sex 1 0.0015 0.0112 0.0008 genotype 1 0.5217 0.1131 0.5442 lysine x sex 4 0.4748 0.6319 0.9170 lysine x genotype 4 0.1169 0.2666 0.0430 sex x genotype 1 0.0867 0.0502 0.0085 lysine x sex x genotype 4 0.3080 0.4959 0.5383 error 99 total 118 a-b values within comparison with different superscripts indicate significantly different (p<0.05) broilers (faria filho et al., 2007). thus, it is possible that low performance broilers reared under practical condition which is mostly raised in different environment, lysine supplementation could eliminate the detrimental effects of high ambient temperature. this suggests that environmental temperature should be taken into account in formulating a diet when broilers are raised in an open –sided house. in regard to the effect of sex for all variables measured, this study showed significant differences (p<0.05) except for feed conversion (table 2). males have demonstrated a better ability to use the feed to be converted into body weight. males genetically have slow feathering growth than females which influence the different needs and use of dietary protein. samadi and liebert (2006) estimated the genetic potential for daily n deposition in fast growing chickens. they reported that daily protein deposition is depending on age and sex. males gain faster from post-hatching to 45 d of age than females. daily protein deposition increase from 11 to 21 g/d for males and 10 to 19 g/d for females respectively. in addition, it was shown by the study of li and nolan (2002) that the daily protein synthesis and degradation rate for male broilers were higher than female broilers, suggesting that protein accretion rate in males was also higher than females. it is much clear that the need for lysine in males was higher than females. genotypes and carcass parameters the results in table 3 indicate that the 2.0 g/kg lysine supplemented in a commercial standard diet improved the carcass weight with no significant effect in breast meat and abdominal fat. genotypes by dietary lysine interaction were not significant for the carcass composition measured, but the response of chicks to increasing dietary lysine level improved breast meat yield and reduced abdominal fat for both genotypes. aa broilers were heavier for dietary lysine supplementation; however, ln broilers had higher breast yields. in addition, aa broilers were more efficient in lower lysine supplementation (1.0 g lysine/kg diet) with the highest percentage of breast meat (16.45±1.97 g/kg) and the lowest abdominal fat (1.79±0.15 g/kg ) (table 4) or 383.36±70.72 and 41.65±5.92 g respectively (data not shown). whilst, ln broilers showed better response in 2.0 g/kg lysine with the highest 144 j.indonesian trop.anim.agric. 37(2) june 2012 table 4. live weight, breast meat and abdominal fat of two different genotypes fed supplemented lysine from 4 to 42 days of age with sem* genotypes male female lysine supplementation ( g/kg) n live weight (kg) breast (% of live weight) fat (% of live weight) live weight (kg) breast (% of live weight) fat (% of live weight) aa 0.0 12* 2.23±0.07 14.86±1.53 1.86±0.55 1.98±0.16 15.04±0.49 2.47±0.60 aa 0.5 12 2.46±0.16 15.27±0.79 1.89±0.52 1.99±0.07 15.03±2.15 2.04±0.46 aa 1.0 12 2.33±0.32 16.45±1.97 1.79±0.15 2.18±0.25 15.33±1.84 2.24±0.60 aa 1.5 11 2.53±0.34 14.58±1.08 1.88±0.36 1.99±0.16 15.33±1.21 2.61±0.74 aa 2.0 12 2.36±0.39 15.52±1.59 1.89±0.55 2.27±0.42 15.09±1.68 2.22±0.70 ln 0.0 12 2.35±0.25 15.64±1.02 2.02±0.39 2.28±0.29 15.95±1.92 2.18±0.41 ln 0.5 12 2.28±0.40 15.49±1.80 2.26±0.72 2.06±0.29 15.37±1.43 2.02±0.22 ln 1.0 11 2.23±0.86 15.56±0.77 2.36±0.83 2.05±0.18 16.58±1.69 2.62±0.57 ln 1.5 12 2.09±0.23 15.06±1.03 2.18±0.46 2.12±0.12 16.31±1.04 2.04±0.36 ln 2.0 13 2.26±0.29 16.90±0.01 2.16±0.74 2.04±0.08 16.20±0.70 2.55±0.48 *sem = standard error mean percentage of breast meat (16.90±0.01 or 380.3±42.45 g) and lower fat (2.16±0.74 or 48.76 ±18.62 g) (data not shown). the present findings are consistent with sterling et al. (2006) and alawumi and fagbuaro (2011) who showed the differences between genotypes in bw and carcass traits to be genotype dependent. it is interesting to note that the reduction in breast meat in males fed with a standard diet with no lysine was larger than females (table 4). this indicates that males are more susceptible to low levels of dietary lysine in both genotypes and aa broilers require low level of dietary lysine. hussein and al-batshan (1999) found that that there is interaction between temperature, sex, dietary protein and lysine breast meat. ojanodirain and waldroup (2002) also observed that increasing dietary lysine (from 1.03 to 1.16%) of moderate heat-stressed (26.7oc) from 3 to 6 week-old male broilers significantly increased breast meat (from 22.99 to 23.55%) and reduced abdominal fat (0.832 to 0.663%). in regard to effect of sex on carcass parameters, this present experiment showed that male broilers had higher value in carcass weight, breast weight and abdominal fat weight (p<0.05) than females. although digestible lysine of the basal diet was not determined, this study was supported by the observations of garcia et al. (2006), who reported differences in digestible lysine requirement for males and females for breast meat deposition. the highest breast meat (379.4±15.5 g) and body weight gain (1591.0±27 g) of male broilers from 21 to 42 days of age due to lysine supplementation have been reported by ghahri et al. (2010). these authors found the lysine requirement averaged 1.097±0.073% and 0.907±0.0046% with linear-broken line estimation at 22% and 18% crude protein for bm and bwg respectively. thus, breast meat yield again was better in diet supplemented lysine, and the implication of this study is that lysine addition in a conventional standard diet is necessary and separated feeding system should also be considered to achieve the optimal performance. conclusion the results of the present study demonstrated that different genotype broilers grown under conventional management practice in uncontrolled environment required different nutritional need. lysine supplementation is more desirable to support the actual growth potential and breast meat yield of fast growing broilers particularly in which a conventional standard commercial diet was used. low performance of particular genotypes was due to their nutritional requirement was not completely fulfilled. acknowledgments the authors wish to thank the technical staff broiler genotypes and lysine supplementation (b. indarsih dan m.h.tamsil) 145 figure 1. gain (g/d) of arbor acres from 9 to 42 day of age at different lysine supplementation (□:control; ◊:0.5; ∆:1.5; x :1.5 and ○:2.0 g/kg lysine mono-hcl) 0 10 20 30 40 50 60 70 80 9 16 23 30 37 42 age (days) g ai n (g /d ))) figure 2. gain (g /d) of lohmann from 9 to 42 day of age at different lysine supplementation (□:control; ◊:0.5; ∆:1.5; x :1.5 and ○:2.0 g/kg lysine mono-hcl) 0 10 20 30 40 50 60 70 9 16 23 30 37 42 age (days) g ai n (g /d ))) of the teaching farm particularly kasri for rearing and slaughtering the animals, and the students for carcass dissections. data presented in this paper was collected at teaching farm of faculty of animal science-mataram university and the funding was provided by tpsdp project–adb loan 1792 ino. references abdel-maksoud, a., f. yan, s. cerrate, c. coto, z. wang and p. w. waldroup. 2010. effect of dietary crude protein, lysine level and amino acid balance on performance of broilers 0 to 18 days of age. int. j. poult. sci. 9(1):21-27. aftab, u., m. ashraf, a. s. mumtaz and z. jiang. 2007. lysine requirement of broiler chickens fed low-density diets under tropical conditions. asian-aust. j. anim. sci. 20(6): 939-943 alawumi, s. o. and s. s. fagbuaro. 2011. productive performance of three commercial genotypes reared in the derived savannah zone of nigeria. int. j. agri. res. 6(11):798804. doi: 10.3923/ijar.2011.798.804 bartov, i. and i. plavnik. 1998. moderate excess of dietary protein increases breast meat yield of broiler chicks. poult. sci. 77: 680-688 cherry, j., p. b. siegel and w. l. beane. 1978. genetic-nutritional relationship characteristic of broiler chickens. poult. sci. 57:14821487. dozier , w. a., iii, a. corzo , m. t. kidd, p. b. tillman and s. l. branton. 2009. digestible lysine requirements of male and female broilers from fourteen to twenty-eight days of age. poult. sci. 88:1676-1682. doi: 10.3382/ps.2008-00539. dozier, w. a., iii , a. corzo , m. t. kidd , p. b. tillman , j. p. mcmurtry and s. l. branton. 2010. digestible lysine requirements of male broilers from 28 to 42 days of age. poult. sci. 89:2173–2182 doi: 10.3382/ps.201000710. faria filho, d.e. , d. m. b. campos, k. a. alfonso-torres, b. s. vieira, p. s. rosa, a. m. vaz, m. macari and r. l. furlan. 2007. protein levels for heat-exposed broilers: performance, nutrients digestibility, and energy and protein metabolism. int. j. poult. sci. 6 (3):187-194 fatufe, a. a. r. timmler, and m. rodehutscord. 2004. response to lysine intake in composition of body weight gain and efficiency of lysine utilization of growing male chickens from two genotypes. poult. sci. 83:1314-1324 garcia, a. r., a. b. batal, and d. h. baker. 2006. variations in the digestible lysine requirement of broiler chickens due to sex, performance parameters, rearing environment, and processing yield characteristics. poult. sci. 85:498–504 ghahri, h., r. gaykani and t. toloie. 2010. effect of dietary crude protein level on performance and lysine requirements of male broiler chickens. afr. j. agric. res. 5(11):1228-1234 gous, r. m. l998. making progress in the nutrition of broilers. poult. sci. 7:111-117. greenwood, m. w., k. r. cramer, r. s. beyer, p. m. clark and k. c. behnke. 2005. influence of feed form on estimated digestible lysine needs of male broilers from sixteen to thirty days of age. j. appl. poult. res. 14:130-135 harms, r. h. and g. b. russell. l995. a reevaluation of the protein and lysine requirement for broiler breeder hens. poult. sci. 74: 581-585. hosseini, s. m., s. m. akbary, n. maheri-sis and a. mirzaei-aghsaghali. 2009. the effect of using excess lysine on the performance and slaughter characteristics of broiler chickens. res. j. biol. sci. 4(2):143-147. hussein, e. o. s. and h. a. al-batshan. 1999. performance and carcass composition of broilers under heat stress : ii. the effect of dietary lysine. asian-aust. j. anim. sci. 12 (6): 923-931. indarsih, b. and r. a. e. pym. 2010. the effect of genotype on response in body composition to variation in dietary protein: energy ratios. j. indonesian trop. anim. agric. 35(2):102108. kerr, b. j., m. t. kidd, k. m. halpin, g. w. mcward and c. l. quarles. 1999. lysine level increase level performance in male broilers. j. appl. poult. res. 8:381-390 khan, s. a., n. ujjan, g. ahmed, m. i. rind, s. a. fazlani, s. faraz, s. ahmed and m. asif. 2011. effect of low protein diet supplemented with or without amino acids on the production of broiler. afric. j. biotechnol . 10 (49):10058-10065 kidd, m. t., b. j. kerr. j. p. allard, s. k. rao and j. t. halley. 2000. limiting amino acid responses in commercial broilers. j. appl. poult. res. 9: 223-233. 146 j.indonesian trop.anim.agric. 37(2) june 2012 labadan, jr. m.c., k. n. hsu, and r. e. austic. 2001. lysine and arginine requirements of broiler chickens at two to three-week intervals to eight weeks of age. poult. sci. 80:599–606. leclercq, b., a. m. chagneau, t. cochard, s. hamzaoui, and m. larbier. l993.comparative utilization of sulfurcontaining amino acids by genetically lean or fat chickens. br. poult. sci. 34: 383-391. leeson, s. 2000. nutrition and quality of the broiler carcass. www.gov.on.ca/ livestock/poultry/facts/carcass.html lehmann, d., m. pack, and h. jeroch. l996. responses of growing and finishing turkey toms to dietary lysine. poult. sci. 75:711718. li, l. and j. v. nolan. 2002. efficiency of protein utilization in male and female broiler chickens. proc. aust. poult. sci. sym. 14:175-178. mehri, m., h. nassiri-moghaddam, h. kermanshahi and m. danesh-mesgaran. 2010. digestible lysine requirements of strain-run broiler chickens from fifteen to twenty-eight days of age. j. anim. vet. adv. 9(17):2321-2324 moran, jr. e. t. and s. f. bilgili. 1990. processing losses, carcass quality, and meat yields of broiler chickens receiving diets marginally deficient to adequate in lysine prior to marketing. poult. sci. 69:702-710 moran, jr. e. t. l994. response of broiler strains differing in body fat to inadequate methionine: live performance and processing yields. poult. sci. 73:1116-1126 nasr, j. and f. kheiri. 2011. increasing amino acids density improves broiler live weight. int. j. poult. sci. 10(7):523-526. nasr, j., f. kheiri, a. solati, a. hajibabaei and m. senemari. 2011. the efficiency of energy and protein of broiler chickens fed on diets with different lysine concentration. j. anim. vet. adv. 10(18):2394-2397 national research council. 1971. nutrient requirements of poultry. sixth edition. national academy of sciences, national research council, washington, dc. national research council. l987. predicting feed intake of food-producing animals. national academy press, washington, dc. national research council. l994. nutrient requirements of poultry ninth revised edition. national academy press, washington, dc. ojano-dirain, c. p. and p. w. waldroup. 2002. protein and amino acid needs of broilers in warm weather: a review. int. j. poult. sci. 1(4):40-46. praharaj, n. k., m. r. reddy, a. k. panda, s. v. rama rao and r. p. sharma. 2002. genotype by dietary lysine interaction for growth and response to sheep red blood cells and escherichia coli inoculation in commercial broiler chicks. asian-aust. j. anim. sci. 15(8):1170-1177 quentin, m., i. bouvarel and m. picard. 2005. effects of crude protein and lysine contents of the diet on growth and body composition of slow-growing commercial broilers from 42 to 77 days of age. anim. res. 54. 113– 122. doi: 10.1051/animres:2005010 rack , a. l., k. g. s. lilly, k. r. beaman, c. k. gehring , and j. s. moritz . 2009. the effect of genotype, choice feeding, and season on organically reared broilers fed diets devoid of synthetic methionine. j. appl. poult. res. 18 :54–65 doi: 10.3382/japr.2008-00053 razuki, w. m., s. a. mukhlis, f. h. jasim and r. f. hamad. 2011. productive performance of four commercial broiler genotypes reared under high ambient temperature. int. j. poult. sci. 10 (2):87-92. rezaei, m., h. nassiri moghaddam, j. pour reza and h. kermanshahi. 2004. the effects of dietary protein and lysine levels on broiler performance, carcass characteristics and n excretion. int. j. poult. sci. 3(2):148-152. sas institute inc. 1996. sas user’s guide: statistics. version 6.12. sas institute inc., cary, nc. saima, m., z. u. khan, m. a. jabbar, a. mehmud, m. m. abbas and a. mahmood. 2010. effect of lysine supplementation in low protein diets on the performance of growing broilers. pakistan vet. j. 30 (1):1720. samadi and f. liebert. 2006. estimation of nitrogen maintenance requirements and potential for nitrogen deposition in fastgrowing chickens depending on age and sex. poult. sci. 85:1421–1429. steel, r. g. d. and j. h. torrie. 1980. principles and procedures of statistics. a biometrical approach. 2nd ed., mcgraw hill inter. book co. tokyo, japan. sterling, k. g., g. m. pesti, and r. i. bakalli. 2006. performance of different broiler broiler genotypes and lysine supplementation (b. indarsih dan m.h.tamsil) 147 genotypes fed diets with varying levels of dietary crude protein and lysine. poult. sci. 85:1045–1054. tabiri, h., k. sato, k. takahashi, m.toyomizu, and y. akiba. 1998. effect of heat stress and dietary tryptophan on performance and plasma amino acids concentration of broiler chickens. proc. 6th asian pacific poultry congress. nagoya, japan, p. 378-379. temim, s., a. m. chagneau, s. guillaumin, j. michel, r. peresson, and s. tesseraud. 2000. does excess dietary protein improve growth performance and carcass characteristics in heat-exposed chickens?. poult. sci.79:312– 317. viola, th., a de m. kessler, aml. ribeiro, icm da silva and r. krás. 2009. the influence of crude protein level in the basal diet on the determination of lysine requirements for broiler performance and part yields. brazilian j. poult. sci. 11 (3):155–160. 148 j.indonesian trop.anim.agric. 37(2) june 2012 j. indonesian trop. anim. agric. 40(1):1-10, march 2015 issn 2087-8273 single nucleotide polymorphisms of lipoprotein lipase gene and its association with marbling quality in local sheeps hidayati*, c. sumantri, r. r. noor, r. priyanto and s. rahayu faculty of animal science, bogor agricultural university, jl. agatis, darmaga campus, bogor 16680 indonesia * permanent address: breeding and genetic laboratory, faculty of agricultural and animal science, state islamic university of sultan syarif kasim riau, kampus ii raja ali haji, jl. hr. soebrantas km 15 panam, pekanbaru 28293 indonesia corresponding e-mail: yati_suska@yahoo.com received november 27, 2014; accepted january 13, 2015 abstrak lipoprotein lipase (lpl) merupakan enzim kunci dalam metabolisme dan transport lipoprotein yang mempengaruhi level trigliserida darah. lpl mengontrol partisi triasilgliserol antara jaringan lemak dan otot serta dapat meningkatkan penyimpanan lemak atau menyediakan energi dalam bentuk asam lemak untuk pertumbuhan otot. penelitian ini bertujuan untuk mengeksplorasi keragaman gen lpl pada domba lokal indonesia dan hubungannya dengan kualitas marbling. total 66 dna genom (260 bp) domba lokal indonesia yang terdiri atas domba ekor tipis sumatera (50 ekor) dan domba garut (16 ekor) digunakan dalam penelitian ini. amplifikasi dna genome menggunakan polymerase chain reaction dan metode direct sequencing digunakan untuk mengidentifikasi keragaman sekuens. hasil sekuens dianalisis menggunakan software bioedit dan mega 5.2. sekuens kemudian disejajarkan menggunakan metode clustal w dengan gen bank x.68308.1. assosiasi keragaman gen lpl dengan kualitas marbling dianalisis menggunakan metode anova satu arah dan uji lanjut menggunakan uji beda nyata terkecil. hasil penelitian menemukan 3 snps baru pada posisi basa g.26>c/g, g.27>g dan c.192 t>c pada domba garut dan insersi g.26>c/g pada domba ekor tipis sumatera. keragaman gen lpl posisi basa c.192 pada domba garut berasosiasi dengan asam lemak heneikosanoat, dimana genotipe tt (0.04%) memiliki kandungan lebih tinggi dibandingkan genotipe cc (0,03%) dan ct (0,02%). kata kunci: gen lpl, snps, lamb, asam-asam lemak, henekosanoat abstract lipoprotein lipase (lpl) is a key enzyme that plays in metabolism and transport lipoprotein and therefore has an influence on blood triglyceride levels. lpl controls triacylglycerol partitioning between adipose tissue and muscle that increases fat storage or provides energy in the form of fatty acids for muscle growth. the research was aimed to explore single nucleotide polymorphisms of lpl gene and to associate snp with marbling quality. a total of 66 genomic dnas consisted of sumatera thin-tail ed sheep (50 heads) and garut sheep (16 heads) were used in this study. polymerase chain reaction was used to amplify genomic dna and direct sequencing method was to identify polymorphism sequences. the sequences were analyzed with bio edit and mega 5.2. the blast sequence was obtained from gene bank x.68308.1. the association between the genotype and marbling quality was analyze by one way anova and further between mean differences were tested using least sgnificant difference. the results showed that 3 novel snps i.e. insertion g.26>c; insertion g.27> g and c.192t>c on garut sheep and a snp insertion g.26>c/g on sumatera thin-tail ed sheep. the diversity of lpl gene at c.192t>c was associated with heneicosanoic acid, whereas tt genotype (0.04%) was higher than cc (0.03%) and ct (0.02%). keywords: lpl gene, snps, lamb, fatty acids, heneicosanoic acid snp c.192 of lpl gene its association with lamb marbling quality (hidayati et al.) 1 introduction meat quality can be defined as factors that affect consumers' assessment of the quality of the meat where the meat quality is associated with polygenic traits (dunner et al., 2013). the consumer’s decision of cooked meats including tenderness, juiciness and flavor, is closely associated with marbling quality (hocquette et al., 2006). marbling or intramuscular fat is the flecks and streaks of fat within the lean sections of meat (guo et al., 2014). depositions of animal body fat were found in the visceral, subcutan, intermuscular and intramuscular. distribution of fat, fatty acid composition and type of muscle fibers, approximately 35% were influenced by genetic (williams, 2008) and varieties of environmental factors. marbling affect consumers' assessment because these fats cannot be separated from the meat, the fat is different from the other parts. fats composed of glycerol esters, cholesterol, phospholipids and fatty acids. fatty acids are grouped into 3 categories: saturated fatty acid (sfa), mono unsaturated fatty acid (mufa) and poly unsaturated fatty acid (pufa). nutritional guidelines suggest that fat intake ranged from 15%-30% of total caloric needs, sfa is limited between 0-10%, mufa 16%, pufa 7% and cholesterol should not exceed 300 mg/day (wong, 1989; chizzolini et al., 1999). sfa consumption that exceeded the needs is suspected as the cause of various diseases such as cardiovascular disease, atherosclerosis and other diseases. heritability of fatty acid composition of scottish blackface sheep marbling was ranged from moderate to high (karamichou et al., 2006), which indicates a large genetic influence. selection of marbling quality using conventional methods, difficult and expensive relatively, so based on phenotype selection, marbling quality rarely included. alternative that can be done is through genomic selection. genomic selection begins with the discovery of candidate genes were associated with desirable traits. one is through the exploration of single nucleotide polymorphisms (snps) of the gene and then associated with the desirable traits. snps are dna sequence variations that when arise a single nucleotide (a, t, c or g) is different from the sequence generally. the among the genes influence marbling quality was lpl gene. sevane et al. (2013) reported that lpl gene diversity in some breeds of cattle was associated with increased fatty acid gamma-linolenic acid and dihomo-arachidonic fatty acids. lipoprotein lipase (lpl) is a major enzyme that plays in metabolism and transport lipoprotein and therefore it has an influence on blood triglyceride levels (wang & eckel, 2009; crissa et al., 2010; holmes et al., 2011). lipoprotein components comprise of cholesterol, triglycerides, phospholipid and apolipoprotein. triglycerdes in vldl are hydrolyzed by lpl in the blood capillaries. lpl controls triacylglycerol partitioning between adipose tissue and muscle that increases fat storage or provides energy in the form of fatty acids for muscle growth (bonnet et al., 2000; ren et al., 2002; dunner et al., 2013). lpl is produced in adipose tissue, heart and skeletal muscle and then transferred to the surface of capillary endothelium. lpl was encoded by the lpl gene consist of 10 exons and 9 introns which were located on chromosome 2 in ovis aries (www.animalgenome.org/cgi-bin/qtldb/oa). lpl gene polymorphisms and its associations with marbling quality has no such studies were conducted in indonesian local sheep. the objectives of this study were to explore snps of lpl gene in the coding region and its association with lamb marbling quality of local sheep. materials and methods materials blood samples from 50 heads sumatera thin tail ed sheep (padang, west sumatera) and 16 heads garut sheep (garut, west java) were collected by using venoject 2-3 ml from jugular vein. the blood samples were preserved in ethanol absolute 96% with ratio of 1:1 and kept in room temperature for laboratory analysis. the intramuscular fat samples were collected from m. longissimus dorsi of garut sheeps to analyze fat, cholesterol and fatty acid composition. dna extraction and amplification using pcr method genomic dna was extracted by using phenol-chloroform technique (sambrook et al. 1989) and modified by using buffer lysis cell (250 µl 1 x ste, 40 µl sds and 10 µl proteinase-k). the dna was purified by adding 40 µl 5m nacl, 400 µl phenol chloroform and 400 µl ciaa (chloroform iso amyl alcohol) and precipitated by using 40 µl 5m nacl and 800 µl ethanol absolute. the precipitation was washed 2 j.indonesian trop.anim.agric. 40(1):1-10, march 2015 once by adding 800 µl of 70% ethanol and centrifuged with the speed of 12.000 rpm for 5 minutes. the ethanol was discarded and evaporated, than the precipitated dna was disolved in 100 µl of 80% te (elution buffer). polymerase chain reaction (pcr) method was used to amplify the fragment of lpl gene. the primers used were designed using the primer blast program from ncbi (http://www.ncbi. nlm.nih.gov/ tools.primer-blast) with reference to genbank accession number x.68308.1. the forward primer sequence was f’5 aaacctgccgcttctagctc-3’ and reverse primer sequence was f’5 tcttgtaatcctgtcggcgg -3’. the primer sequences flanking the base position at 17 to 277 with a length of 260 bp sequence was a small part of the 5’utr and the first exon of lpl gene (figure 1). each pcr reaction was made with cocktail 50 ng (2-3 µl) dna template, 0.25 µm primer forward and reverse, 12.5 µl dream tag green master mix from thermo scientific #k 1081 and dh2o up to 25 µl. samples were initially denaturated at 950c for five minutes and followed by 35 cycles of denaturation at 950c for 45 s, annealing at 580c for one min and extension at 72oc for one min. final extension was at 720c for 5 min. gene amp pcr system 9700 and master cycler personal 22331 eppendorf were used for pcr amplification. pcr products were then separated on 1.5% agarose/0.5 x tbe, stained with 2.5 µl of ethidium bromide (etbr) and calibrated with 100 bp ladder marker. electrophoresis chamber was run on 100 volt power supply for thirty minutes. finally, the gel was visualized under uv transilluminator (figure 2). the pcr product samples were then subjected to direct sequence analysis by dideoxy sequencing in abi 3730 xl automated dna sequencer at the 1st base laboratory singapore. quality of marbling analysis nine of sixteen of male garut sheeps, had aged 8-10 months and weight at slaughtered 22,46 kg was identified of diversity lpl gene at base c.192, consists of tt (n=4), ct (n=2) and cc (n=3), slaughtered and m.longissimus dorsi used to analyze lamb marbling quality. the fat determined with soxhlet method with petroleum eter (aoac, 2005). the cholesterol content was carried out with dye 10 g fecl36h2o in 100 ml glacial asetat acid (aoac, 2005) by spectrometer in absorbance with wavelength of 565 nm. the profile of fatty acids was followed aoac (2005). the lipids after extraction were esterified and methylated with bf3 20%. the methyl esters of fatty acids were separated and quantified in a gas chromatograph (gc-2010 plus shimadzu). data analysis the results of sequences fragment of lpl were analyzed with bioedit (hall, 2011), mega version 5.2 (kumar et al., 2004) and pop gene ver.1.31 (yeh et al., 1999) software. the blast sequence was obtained from gene bank with accession number of x.68308.1. the analyzed sequence was required to ensure the fragment of lpl gene of sheep and to find out the existence of mutation in lpl gene and polymorphisms in the sequences. frequency of gene, genotype and hardy–weinberg equilibrium were estimated by nei and kumar (2000). the observed heterozygosity (ho) and excepted heterozygosity (he) were estimated with popgene 32. the association between the genotype and marbing quality was analyze by one way anova and least significant difference (lsd) used to know different least squares means. the model mathematics is as follows: yij = µ + gi + eij where; yij is the traits measured in animal, µ is the population means, gi is the effect of genotype snp c.192 of lpl gene its association with lamb marbling quality (hidayati et al.) 3 figure 1. lpl amplicon sequence: genbank x.68308.1. the primers sites were underlined and bold. and eij the residual random effect associated with animal traits. results and discussion single nucleotide polymorphisms of lipoprotein gene in sumatera thin tailed and garut sheep sixty six (66) sequences of sumatera thin-tail ed sheep (50) and garut sheep (16) on lpl gene encoding region were aligned with gene bank x.68308.1 (figure 3). the results showed that one snp i.e. insertion at base g.26>g/c (figure 4b and figure 4c). the one snp was reconstructed three diplotypes: diplotype a, d and e (tabel 1). three snps were identified on garut i.e. insertion at g.26>c and g.27>g (figure 4a) and mutation at c.192t>c (figure 5). these mutations were formed 5 diplotypes i.e. a, b, c, f and (table 1). diplotype a was similar to the gene bank sequences x.68308.1. three novel snps in this study has never been reported in other sheep populations even though percentage of lpl gene diversity at base g.26 and g.27 were relatively low in both populations. insertion of at base position g.26>c and g.27>g caused arise stop codon at amino acids at 13, 66 and 73 as was found on diplotype a, while insertion at base g.26> g/c, the stop codon arise of 6 and 15 of amino acids sequence (figure 6). mutation at base g.26 and g.26 were called frameshift mutation that is a mutation that causes a stop codon is not at place properly. with regard to mutation at base c.192 on garut sheep, was identified substitution thymine to cytocine was non synonymous mutation, it changed amino acid (val>ala) while in sumatera thin-tail ed sheep was monomorfic (table 2). frequency of c (0.59) was the predominant than t (0.41) in garut sheep. frequencies of genotype were cc (0.44), ct (0.31) and tt (0.25) and this genotypes frequencies were in hardy-weinberg equilibrium (p>0.05) (table 2). ding et al. (2011) reported that one snp at exon 7 of lpl gene at base 19913 c>t, which changed phenylalanine>serine, responsible for carcass traits and lipid deposition in yak. three snps found in 3’utr of lipoprotein lipase gene g.74 t>c, g.130 t>c and g.133 t>a were associated with cla content on milk sheep (crissa et al., 2010) and other researchers have been no reports on the effect of these 3 snps. association of polymorphisms lipoprotein lipase gene c. 192 with marbling quality of garut lamb as shown in table 3 and table 4, the polymorphisms of lpl gene at base c.192 t>c did not significantly (p>0.05) was affected fat, cholesterol and fatty acid profiles at longissimus dorsi muscle, except on fatty acid profile of saturated fatty acid; one long chain saturated fatty acid heneicosanoic acid (p<0.05). whereas, tt genotype (0.04%) was higher than ct (0.02%) and cc (0.03%). heneicosanoic acid is a minor fatty acid in nature, but the presence of heneicosanoic (21:0) affect the meat quality. the presence of odd long-chain saturated fatty acids indicates accumulation of propionic acid and biotin deficiency. propionate is one of the volatile fatty acids of rumen fermentation. conversion propionate into methyl malonyl coa requires biotin. the methyl malonyl coa was required for elongated fatty acid process by providing two 4 j.indonesian trop.anim.agric. 40(1):1-10, march 2015 figure 2. pcr amplification of lpl gene (260 bp); 0-16 = individual samples; m = dna ladder 100 bp. snp c.192 of lpl gene its association with lamb marbling quality (hidayati et al.) 5 figure 3. alignmented of lipoprotein lipase gene in sumatera thin-tailed sheep and garut sheep figure 4. partial sequences of lpl gene, which showed insertion at g. 26 and g.27 6 j.indonesian trop.anim.agric. 40(1):1-10, march 2015 figure 6. alignmented of amino acids sequences of seven dyplotypes of lpl gene in sumatera thin tailed and garut sheep figure 5. partial sequences of lpl gene with a mutation at base c.192 t>c table 1. diplotypes of lpl gene of sumatera thin tailed sheep and garut sheep at positions of 17 to 278 bases diplotype at mutation frequency (n) c. 26 g.27 c.192 stt garut diplotype a t 0.840 (42) 0.1875 (3) diplotype b c 0.000 (0) 0.3750 (6) diplotype c c/t 0.000 (0) 0.3125 (5) diplotype d c t 0.020( 1) 0.0000 (0) diplotype e g t 0.140 (7) 0.0000 (0) diplotype f c g t 0.000( 0) 0.0625 (1) diplotype g c g c 0.000(.0) 0.0625 (1) total 50 16 stt (sumatera thin tailed sheep). carbon atoms. biotin deficiency could inhibit the formation of methyl malonyl coa and caused odd long-chain fatty acids. in addition, the presence of fatty acids heneicosanoic acid could oxidize omega fatty acids, but the exact mechanism is still unknown. the results of this study indicate that the marbling fat content of garut sheep was 1.60% -1.73%, lower than other sheep breeds such as south african mutton, merino, dormer (cloete et al., 2004), moranda nova, santa inez and crosses dorper x santa inez (costa et al., 2009) as well as cholesterol content (6.10% 8.91%) was lower than reported costa et al. (2009) and mas'ud (2012). it is suspected due to the age of the sheep were used relatively young (8-10 months), where the deposition of marbling not yet formed perfectly. fat deposition was initially formed in the visceral, subcutaneous, intermuscular and last intramuscular. cholesterol is a component of fat, while a little fat content, cholesterol content is also slightly. lpl gene expression was influenced by nutrition, fat depot, adipocyte sizes, insulin levels, propionic acid levels (ren et al., 2002; lee and hossner, 2002) and type of tissue where the gene was expressed (sevane et al., 2013). the gene expression on marbling was lower than intermuscular, subcutaneous and perirenal. in the cattle, lpl was activated on muscles by peroxisome proliferator-activated receptor gamma (pparg), when low glucose levels. pparg previously activated by the sirtuin 1 (sirt1) and peroxisome proliferator-activated receptor gamma coactivator 1 alpha (ppargc1a). lpl leads to increased oxidation snp c.192 of lpl gene its association with lamb marbling quality (hidayati et al.) 7 table 2. frequency of gene, genotype, heterozygosity and χ2 of sumatera thin tailed sheep and garut sheep at base c.192 t>c population n gene frequency genotype frequency heterozygosity χ2 test c t cc ct tt ho he garut 16 0.59 0.41 0.44 0.31 0.25 0.313 0.498 2.379ns stt 50 0.00 1.00 0.00 0.00 1.00 stt = sumatera thin tailed sheep, ns = represent non significantly at p>0.05 table 3. effect of polymorphism of lpl gene at base c.192 on fat, cholesterol, sfa,mufa, pufa and its ratio of lamb marbling of garut sheep variable genotype significancett (n=4) cc (n=2) cc(n=3) mean cv mean cv mean cv fat (%) 1.730 0.68 1.680 0.21 1.600 0.56 ns cholesterol (%) 8.910 0.56 8.050 0.50 6.100 0.39 ns sfa (%) 37.250 0.08 38.250 0.04 39.450 0.14 ns mufa (%) 26.410 0.09 30.650 0.16 29.780 0.21 ns pufa (%) 2.360 0.22 2.360 0.05 2.580 0.41 ns mufa/sfa ratio 0.709 0.14 0.801 0.11 0.755 0.09 ns pufa/sfa ratio 0.063 0.30 0.062 0.01 0.065 0.55 ns sfa = saturated fatty acid; mufa = mono unsaturated ffatty acid; pufa = poly unsaturated fatty acid; cv = coefficient of variance; n = sample size of fatty acids for energy utilization. diversity of lpl gene snp ss65478732 was associated with two poly unsaturated fatty acids i.e. dihomogamma-linolenic acid and arachidonic acid (sevane et al., 2013) oleic was most abundant fatty acid in this study, followed by palmitic, stearic, myristic, palmitoleic and linoleic. several studies have reported that oleic is the major fatty acid was found in sheep (cloete et al., 2004; costa et al., 2009; gallardo et al., 2011; borys et al., 2012; popova, 2014). oleic acid is formed by stearic acid by activity of stearoyl coa desaturase (wood et al., 2008). oleic play an important role in the enhancement of meat characteristics, cell elasticity, tenderness and palatability of meat (smith et al., 2009). while purbowati et al. (2005) was reported the most abundant fatty acids of local male sheep were linoleic, attended oleic, palmitic, stearic, linolenic and palmitoleic. guo et al. (2014) reported that on marbling fat quality in cattle and sheep was determined by 8 j.indonesian trop.anim.agric. 40(1):1-10, march 2015 table 4. association of diversity of lpl gene at base c.192 with fatty acid profile of lamb marbling of garut sheep (% w/w) fatty acids genotype sig.tt (n=4) ct (n=2) cc(n=3) mean cv mean cv mean cv sfa capric acid c 10:0 0.10 0.29 0.09 0.16 0.11 0.16 ns lauric acid c12:0 0.56 0.40 0.41 0.02 0.35 0.34 ns myristic acid c14 0 3.93 0.30 3.21 0.03 3.31 0.06 ns pentadecanoic acid c15:0 0.40 0.21 0.30 0.07 0.29 0.14 ns palmitic acid c16:0 17.68 0.05 18.61 0.15 20.85 0.18 ns heptadecanoic acid c17:0 0.79 0.08 0.77 0.01 0.70 0.06 ns stearic acid c18:0 13.59 0.10 14.71 0.07 13.66 0.15 ns arachidic acid c20:0 0.11 0.20 0.11 0.20 0.09 0.00 ns heneicosanoic acid c21:0 0.04a 0.20 0.02b 0.00 0.03b 0.22 * bahenic acid c22:0 0.05 0.29 0.04 0.35 0.06 0.33 ns mufa myristoleic acid c14:1 0.14 0.28 0.12 0.35 0.11 0.10 ns palmitoleic acid c16:1 1.77 0.06 1.99 0.27 1.90 0.08 ns oleic acid c18:1n9c 24.45 0.10 28.50 0.15 27.71 0.22 ns cis-11-eicosenoic acid c20:1 0.05 0.28 0.05 0.16 0.05 0.29 ns pufa linoleic acid c18:2n6c 1.52 0.19 1.51 0.12 1.68 0.41 ns linolenic acid c18:3n3 0.19 0.65 0.22 0.10 0.24 0.21 ns cis-11,14-eicosedienoic acid c20:2 0.05 0.11 0.04 0.05 0.29 ns cis-8,11,14-eicosetrienoic acid c20:3n6 0.05 0.42 0.06 0.13 0.06 0.37 ns arachidonic acid c20:4n6 0.49 0.36 0.56 0.10 0.54 0.62 ns sfa = saturated fatty acid; mufa = mono unsaturated fatty acid; pufa = poly unsaturated fatty acid; n = samples size; sig. = significancy; * = significant (p<0.05); ns = non significantly (p>0.05) polygenes and there expression influenced by environmental factors such as diseases and feed. according to sondakh et al. (2012), feed has medium chain fatty acids 1.0-1.5% content could be increased unsaturated fatty acids (9.05%17.96%) and decreased saturated fatty acids (6.59%-11.88%). the major genes which are potential include fatty acid binding protein 3 (fabp3), peroxisome proliferator activated receptor gamma (pparg), diacyl glycerol oacyltransferase (dgat1), acetyl coa carboxylase alpha (acaca), fatty acid synthase (fasn), fatty acid binding protein 4 (fabp4), carnitine palmitoyltransferase 1 binding (cptib), steoryl-coa desaturase (scd), peroxisome proliferator activated receptor gamma coactivated 1 alpha (ppargc1a), activating transcription factor 4 (atf4), sreb cleavage activating protein (scap) ( (narukami et al. 2011; sevane et al., 2013; guo et al., 2014). conclusion the results were presented 3 snps of lpl gene insertion g.26>c and g.27> g and a mutation c.192t>c on garut sheep and only one snp insertion g.26>c/g on sumatera thin-tail ed sheep. polymorphisms of lpl gene at base c.192 on garut sheep was associated with saturated fatty acid heneicosanoic, whereas tt genotype (0.04%) had higher percentage than cc (0.03%) and ct (0.02%). this designed primer has the potential as genetic marker of marbling quality of lamb garut sheep on marker assisted selection (mas). references aoac (association of official analytical chemist). 2005. official methods of analysis of the association of official analitycal chemist international. 18th ed. association of official analytical chemists, arlington. bonnet, m., c.leroux, y. faulconnier, j-f hocquette, f. bocqueier, p. martin and y. chilliard. 2000. a lipoprotein lipase activity and mrna are up-regulated by refeeding in adipose tissue and cardiac muscle of sheep. am. soc. nutr. sci.:749-756 borys, b., j. oprzadek, a. borys and m. przegalinska-goraczkowska. 2012. lipid profile of intramuscular fat in lamb meat. anim. sci. papers and reports. 30(1):45-56. chizzolini, e., zanardi, v. dorigoni and s. ghidini. 1999. calorific value and cholesterol content of normal and low-fat meat and meat product. food sci. technol. 10:119-128. cloete, j.j.e., l.c. hoffman, s.w.p. cloete and j.e. fourie. 2004. a comparison between the body composition, carcass characteristics and retail cuts of south african mutton merino and dormer sheep. s. afr. j. anim. sci. 34 (1):44-51 costa, r.g., a.s.m. batista, p.s. azevedo, r.c.r.e. queiroga, m.s. madruga and j.t.a filho. 2009. lipid profile of lamb meat from different genotypes submitted to diets with different energy levels. r. brass. zootec. 38(3):532-538 crisa, a., c. marchitelli, l. pariset, g. gontarini, f. signarelli, r. napolitano, g. catillo, a.valentini and b. moili. 2010. exploring polymorphisms and effects of candidate genes on milk fat quality in dairy sheep. j. dairy sci. 93:3834-3845. ding, x.z., c.n. liang, x. guo, c.f. xing, p.j. bao, m. chu, j. pei, x.s. zhu and p. yan. 2012. a novel single nucleotide polymorphism in exon 7 of lpl gene and its association with carcass traits and visceral fat deposition in yak (bos grunniens) steers. mol. biol. rep. 39:669-673 dunner, s., n. sevane, d. garcia, o. cortes, a. valentini, j.l.williams, b. mangin, j. canon, h. leveziel, and t.g. consortium. 2013. association of genes involved in carcass and meat quality traits in 15 european bovine breeds. livest. sci. 154: 34-44 gollardo ma, r pulido, c gallo. 2011. fatty acid composition of longissimus dorsi muscle of suffolk down lambs fed on different dryland forages. chileanjar 71(4):566-571. guo, b., k. kongsuwan, p.l.g. wood, g. zhou, w. zhang and b.p. dalrympe. 2014. a gene expression estimator of intramuscular fat percentage for use in both cattle and sheep. j. anim. sci. biotechnol. 5(35):1-12. hall, t. 2011. bioedit; an important software for molecular biology. gerf bull. biosci. 2(1): 60-61. hocquette, j. f., g. renand, h. levéziel, b. picard1, i.c. malek. 2006. the potential benefits of genetics and genomics to improve beef quality – a review. anim. sci. papers and reports. 24 3):173-189 snp c.192 of lpl gene its association with lamb marbling quality (hidayati et al.) 9 holmes, r.s., j.l. vandeberg and l.a. cox. 2011. comparative studies of vertebrate lipoprotein lipase: a key enzyme of very low density lipoprotein metabolisms . comp. biochem. physiol. part d. genomics proteomics 6(2):224-234. karamichou, e., r.i. richardson, g.r. nute, k.p. gibson and s.c. bishop. 2006. genetic analysis and quantitative trait loci detection, using a partial genome scan, for intramuscular fatty acid composition in scottish blackface sheep. j. anim. sci. 84:3228-3238. kumar,s., k. tamura and m.nei. 2004. mega3: integrated software for molecular evolutionary genetic analysis and sequence alignment. j. brief. bioinform. 5(2):150163. lee, s.h. and k.l. hossner. 2002. coordinate regulation of ovine adipose tissue gene expression by propionate. j. anim sci 80: 2840-2849. mas’ud, m.s. 2012. produksi, sifat fisik dan sifat kimia daging domba yang diberi ransum mengandung limbah udang. dissertation. bogor agricultural universitybogor narukami, t., s. sasazaki, k. oyama, t. nogi., m. taniguchi and h. mannen. 2011. effect of dna polymorphisms related to fatty acid composition in adipose tissue of holstein cattle. j. anim. sci. 82:406-411 nei, m. and s. kumar. 2000. molecular evolution and phylogenetics. oxford university press: new york. popova, t. 2014. fatty acid composition of longissimus dorsi and semi membranosus muscles during storage in lambs reared in doors and on pasture. emi.j.food agric. 26(3):302-308. purbowati, e., e. baliarti, s.p.s. budhi and w. lestariana. 2005. profil asam lemak daging domba lokal jantan yang dipelihara di pedesaan pada bobot potongan dan lokasi otot yang berbeda. bull. petern. 29(2):62-70 ren, m.q., j. wegner, o. bellmann, g.a. brockmann, f. scheider, f. teuscher and k. ender. 2002. comparing mrna levels of genes encoding leptin, leptin receptor and lipoprotein lipase between dairy and beef cattle. dom. anim. endocrin. 23:371-381 sambrook, j., e.f. fritsch, and t. maniatis. 1989. molecular clonning: a laboratory manual. 2nd ed. cold spring harbor laboratory pr., usa. sevane n, e armstrong, o cortes, p wienar, r pong wong, s dunner and gq consortium. 2013. association of bovine meat quality traits with gene included in the pparg and ppargc1a networks. meat sci. 94:328-335 smith s., b. gill, c.a. lunt dk and brooks, m.a. 2009. regulation of fat and fatty acids composition in beef cattle. asian-aust. j. anim. sci. 22(9):1225-1233 sondakh, e.h.b., l.m.yusiati, h.hartadi and e.suryanto. 2012. the effect of methanogenic inhibitor feed on propionic acid and lamb meat chemical quality. j. indonesian trop. anim. agric. 37(3):183188 wang, h and r.h.eckel. 2009. lipoprotein lipase: from gene to obesity. am. j. physiol. endocrinol. metab. 297:271-288 williams, j.l. 2008. genetic control of meat quality traits. in: meat biotechnology. (f.toldra, ed.). springer sci., llc.p. 21-60 wong, d.w.s. 1989. mechanism and theory in food chemistry. an avi book. new york. wood, j.d., m. enser, a.v. fisher, g.r. nute, p.r. sheard, r.i. richardson, s.i. hughes and f.m. whittingto. 2008. fat deposition, fatty acid composition and meat quality: a review. meat sci. 78:343-358. yeh, f. c., r. c. yang and t. boyle. 1999. popgene version 1.31: microsoft window-based freeware for population genetic analysis. canada university of alberta (can). edmonton, ab. 10 j.indonesian trop.anim.agric. 40(1):1-10, march 2015