COVER VOL 7 copy
International Peer Reviewed Journal
267
Rhodium Interaction with Human
NRG1 Gene of Schizophrenia
RUKHSANA NAWAZ
rukshar.gul@gmail.com
Dr. Panjwani Center for Molecular Medicine
and Drug Research, ICCBS, University of Karachi
ERUM ZAHIR
erum_zahir@hotmail.com
Departments of Chemistry, University of Karachi,
Karachi, Pakistan
FATIMA SHAD KANEEZ
ftmshad@yahoo.com
Human Physiology, PAP RSB Institute of Health Sciences,
University Brunei Darussalam,
Jalan Tungku Link, Brunei Darussalam
Abstract - Rhodium (II) acetate [Rh2 (O2CCH3)4]
could be used as an indicator for single nucleotide
polymorphism (SNPs) involved in the onset of
schizophrenia. Rhodium (Rh1) has affinity to make
covalent interactions with neuregulin (NRG1) gene at
SNPs mutation. Binding effects of Rh1 has been studied
under different molar concentrations at different time
periods. In this study we used Rh1 to evaluate its
interaction with NRG1 gene in Schizophrenic patients
of Pakistan. Rh-NRG1 adduct were amplified by PCR
and visualized on agarose gel electrophoresis. Here
Vol. 7 · January 2012
Print ISSN 20123981 • Electronic ISSN 2244-0445
International Peer Reviewed Journal
doi: http://dx.doi.org/10.7719/jpair.v7i1.164
JPAIR Multidisciplinary Journal
JPAIR: Multidisciplinary Journal
268
we show Rh1 binding with NRG1 gene was inhibited
with increasing concentration ranges from 0.5 -3
µM. It has been noted that upon binding with NRG1
gene Rh1 decreased the mobility and intensity of the
DNA bands. Noticeably Rh1 didn’t inhibit the activity
of Mun1 restriction enzyme having specific CAAA
cleavage site. After the digestion of NRG1 gene having
SNPs mutation combining with Rh1 proves its covalent
binding only with Guanine or Thymine and not with
Adenine or Cytosine. This is a novel study that shows
rhodium can covalently binds with human dsDNA and
can inhibit its amplification. The effect of Rh1 to target
different SNPs mutations (normally occurs in genetic
diseases such as schizophrenia) can be identified by
using this technique. There are variations between
human populations, so a SNP allele that is common in
one geographical or ethnic group may be much rarer
in another, and Rh1 can act as a useful tool to identify
SNPs of schizophrenic genes.
Keywords - Pakistani Population, Schizophrenia,
Single Nucleotide polymorphism (SNP), Neuregulin
(NRG1), Rhodium (Rh)
INTRODUCTION
Schizophrenia is a chronic, severe, and multifactorial brain
disorder. NRG1 gene with SNPs mutation shows the increase risk
for schizophrenia. Neuregulin (NRG1) is the strongest leading
schizophrenia susceptibility gene. NRG1 was first implicated in
schizophrenia in an Icelandic population (Stefansson, H, et al.,
2002).Human NRG1 gene is located on chromosome 8p22-13 and is
approximately 1.2 Mb long including more than 30 exons and several
large introns (Paul J.H., Amanda, J.L., 2006). Recently 13 SNPs have
been typed for schizophrenia in NRG1 gene(M Gardner, et al., 2006;
Amanda J. Law et al., 2006) Previous studies have shown DNA
International Peer Reviewed Journal
269
interactions with heavy metals such as zinc (Zn), rhodium (Rh) and
copper (Cu) (Katsuyuki, A. Abdus, S., 2002; Rahman M.d.M, et al., 2008)
Early studies have demonstrated that interaction of rhodium occurred
only with poly Adenine but not with poly Guanine or poly Cytosine
(J.L. Bear Jr, et al., 1975; J.L. Bear 1986; E. Tselepi-Kalouli, et al., 1990
). Studies done on Rh using L121 cell line have revealed that rhodium
could be used as an anti-tumor metal when they form adduct with
carboxylate (R.A. Howard, et al., 1979).Metal based anti-tumor drugs
play very beneficial role in identifying biological activities (Helen, T,
et al., 2003), such as to detect mismatch base pairs, to identify single
nucleotide polymorphism (SNPs) mutations and in cancers. Adducts
are also important for understanding the mechanism of the biological
activities of antipsychotic agents. Recently it has been shown that Rh
has the ability to recognized mismatch base pairs in double stranded
DNA molecule (dsDNA) and detected SNPs within the genome. This
provided the general approach to the discovery of SNPs in amplified
regions of the dsDNA (Jonathan, R.H, et al., 2004; Henrik Junicke, et
al., 2003).
The purpose of this study was to explore rhodium’s covalent
attachment with NRG1 gene. Since rhodium has ability to target double
stranded DNA by forming various covalent adducts, our study can be
useful in the synthesis of rhodium based antipsychotics drugs for the
treatment of schizophrenia. In this study we have selected the single
nucleotide polymorphism (SNPs) primer (rs3924999, G38A) for NRG1
gene (Yang, J.Z, et al., 2003). Interaction between NRG1 and rhodium
acetate were investigated under different molar ratio at different time
durations As detect rhodium binding effect with NRG1 gene, Mun1
restriction enzyme was used to cleaved NRG1 gene and to check the
binding of rhodium whether it bound with G, C or A.
The purpose of this study is to explore rhodium’s covalent
attachment with NRG1 gene. As rhodium has ability to target double
stranded DNA by forming various covalent adducts. Our study can be
useful in the synthesis of rhodium based antipsychotics drugs for the
treatment of schizophrenia.
JPAIR: Multidisciplinary Journal
270
Fig. 1. Structure and atom numbering of Rhodium
adduct (Helen, et al., 2003)
International Peer Reviewed Journal
271
Experimental Method
DNA extraction
Venous blood samples werecollected from identified subjects after
getting human ethic approval from Jinnah Post Graduate Medical
Centre (JPMC) hospital. The samples were stored in 3 % EDTA
solution in falcon tubes for 3 hrs. Genomic DNA was extracted using
the phenol–chloroform method as described previously (Debomoy K.
Lahiri and Bill Schnabel. 1993). Concentration of DNA was determined
by using UV absorbance at 260 and 280 nm. The ratio of 260/280 nm
was 1.76 which is close to 1.8.
Preparation of Rh (l) adduct with Human NRG1 gene
The isolated human DNA was combined with rhodium. Rhodium
acetate was purchased from (MERCK& Co. Inc., U.S). NRG1 gene was
prepared for Rh(1) binding at the concentration of µM (5, 3, 1, 0.5,
0.1) and nM (10, 5, 1, 0.5, 0.3 and 0.1) were dissolved in 1mM sodium
phosphate buffer at PH 7 containing 3mM NaCl2. The reaction mixture
was incubated at 37 ◦C for 24, 48 and 72 hours in dark as to protect
from light-induced disturbance during the incubation (Md. Masudur
Rahman, et al., 2007).
Preparations of PCR mixture for Rhodium treated DNA adduct
We used two sets of DNA sample. One set was treated with
rhodium but not used for PCR to serve as control. The sequence of
the primer was as follows for the rs3924999: Forward primer sequence
are 5`ACTGGTTTCACACCGAAGGAC 3`, and reverse sequence 5`
CCAAGATGAGATCCATTTTCGC 3` (Yang et al., 2003)While other
set was treated with Rhodium and used for PCR reaction, we have
used SNPs primer (rs3924999) for PCR reaction. PCR reactions were
performed in 0.2 ml PCR tubes contained a reaction volume of 50ul (1x
PCR buffer, 1.5mM MgCl2, 10mM primer forward and reverse, 100uM
of dNTPs, 3 U of Taq polymerase and 200ng/ul template of human
genomic DNA). PCR conditions used for amplification of NRG1
JPAIR: Multidisciplinary Journal
272
gene includes an initial denaturation at 94◦C for 5 min, followed by
35 cycles at 94◦C for 30 sec, 55–62◦C for 40 sec, 72◦C for 1 min, and a
final elongation at 72◦C for 10 min. rs3924999 was designed to amplify
246bp. After the PCR amplification these samples were run on gel to
determine the change in mobility and intensity of the DNA adduct. All
the DNA samples were incubated with Rhodium adduct for 24, 48 and
72 hrs and the binding reaction were carried out with IµM DNA and
plus Rh at different molar concentration as described earlier.
Digestion of the adducts by restriction enzymes
The digestion reaction was carried out by incubating the PCR
adduct product SNP rs3924999) samples with MunI restriction
enzyme at 37oC for 4 hrs and Tru1I at 55oC for 4 hrs, both enzymes
were purchased from Fermentas (International Inc, Canada). The
PCR adduct products were run in 2% (w/v) agarose gel in tris borate
EDTA (TBE) buffer. The gel electrophoresis was carried out at 80 V for
1 hr and 45 minutes and washed with Milli Q water for 10 minutes to
visualize the DNA The gel photographs were taken by Gel Doc system
(Alpha Innotech Flour ChemTM).
RESULTS AND DISCUSSION
Rhodium metal was used to make adduct by combining it with
genomic DNA and NRG1 gene as to see whether these adducts changes
their inhibitory properties (DNA replication, DNA band intensity and
mobility) with time and concentration. The effects of these adduct with
non-amplified, amplified and digested products were investigated. We
observed slow DNA bands movement in non-amplified adduct with
an increase rhodium concentration (from 10 nM to 5 µM). There were
no changes found in the DNA band intensity after 24 hrs. incubation
(Fig. 2a). However, longer incubation (72 hrs) with high levels of
Rh-acetate leads to decreased band intensity (Fig. 2b). These results
clearly illustrated the potency of Rhodium’s inhibitory actions that
start at 1nM and can reach maximally at 5µM. This indicates a time
dependent Rh binding affinity towards the Neuregulin gene 1. On the
other hand only decreased band intensity was observed in amplified
International Peer Reviewed Journal
273
adduct after 24 hrs of incubation with Rh-acetate with no changes
in band movements (Fig. 3a). Present result shows an inhibition of
DNA bands with increasing concentration of Rh-acetate. For example
bands strength decreases from 0.1 nM - 100 nM concentrations and
gradually disappears at 0.5 µM – 5 µM after 48 hrs of incubation (Fig.
3b). Complete disappearance of the bands were observed after 72 hrs
of incubation at 5 nM and onwards (Fig 3c). Amplified adducts were
digested with restriction enzyme Mun1 that has a capability to cleave
the DNA at CAAA sequence. The result showed bands after digestion
with Mun1 from 0.1 nM to 3 nM confirmed the binding of Rhodium
with G and not with C or A (Fig. 4).
DNA-Rhodium adduct samples (Without PCR)
Fig. 2(a & b). Agarose gel electrophoresis exhibit interaction
between rhodium acetate and genomic DNA (non amplified) in TBE
buffer at pH 8, incubated for 24hrs at 37◦C. Lane 1 untreated (Native)
DNA, lanes 2 to 12 are for rhodium DNA complex at different
concentrations.
Fig. 2a. 24 hrs incubated samples without PCR
Fig. 2b. 72 hrs incubated samples without PCR
Native = DNA without treated Rhodium
JPAIR: Multidisciplinary Journal
274
DNA-Rhodium adduct samples with PCR
Fig. 3 (a, b & c ) 2% agarose gel of the PCR product (246bp) of NRG1
gene. Lane L corresponds to molecular marker of 100 bp; Native lane
indicates the amplified product of NRG1 without treated Rh. Lane 2 to
12 rhodium treated amplified product of NRG1 gene.
Fig. 3a. After 24 hrs incubation with PCR samples (SNP rs3924999)
Fig. 3b. After 48 hrs of incubation
Fig. 3c. 72 hrs incubated PCR samples
L= ladder (Known sequence marker)
Native = DNA without treated with Rhodium
International Peer Reviewed Journal
275
Restriction Digestion
In Fig.4 Rhodium treated amplified product (72hrs incubated)
were digested with Mun1 restriction enzyme. Lane 1 to 12 exhibits
rhodium acetate treated samples while lane 13 shows native sample
(without rhodium).
Rhodium is a transitional metal and a member of platinum group.
Previous studies have revealed the interaction of Rh1 form complexes
with plasmid DNA and confirmed their binding effects on the mobility
dependent on conformations (H.M. Ushay, et al., 1981; S.E. Sherman,
S.J. Lippard., 1987; G.L. Cohen, t al., 1979). Rh upon binding with the
plasmid DNA changes the circular closed confirmation (CCC) to the
open confirmation (OC) with decreased mobility in gel electrophoresis.
As Rh has ability to make covalent bond with the nucleotides many
studies shows that Rh1 can be used as an anti-tumor agent for the
treatment of cancer (R.A. Howard, et al., 1979). Jonathan and colleagues
2004 has revealed that Rh1 is the best target agent for the detection of
mismatch base pairs in genomic DNA (Helen, T, et al., 2003). Earlier
studies on Rh also revealed that Rh is used to induce inhibitory effects
on DNA amplification by using plasmid DNA (Md. Masudur Rahman,
et al., 2007). This can be taken in account for high binding affinity of
the metal with DNA regardless of the source (plasmid, genomic DNA
or oligonucleotides).
The present study emphasize on the time dependent reaction
of Rh binding with human NRG1 gene period. Further study has
Fig. 4. Digested PCR product after 72 hrs incubation
L = ladder (Known sequence of DNA)
Native = DNA without treated Rhodium
JPAIR: Multidisciplinary Journal
276
extended to visualize its binding effects on the replication of NRG1
and on endonuclease activity. Here two types of Rh-NRG1 adduct has
been prepared. The first group contains a non amplified NRG1 gene
whereas; the second group contains an amplified NRG1 gene. Both
groups received same treatments including incubation times (24, 48
and 72hrs) and Rh concentration (0.1 nM – 5 µM).
Gel electrophoresis was carried out for the visualization of the
Rh and NRG1 interaction at different concentratiheon and incubation
time. Representative gel images shown are in Fig.2 in which the Rh
-DNA adduct was allowed to move in electric filed toward anode, the
mobility was slow (Fig. 2a and 2b) and band intensity decreased. These
results indicated that Rhodium binding with genomic DNA increases
with increase the Rh1 concentration and reaction time (24 and 72 hrs).
This study suggests at Rhodium acetate complex has positive charge
which neutralized the negatively charged PO4 group of the DNA there
by resulting in stable complex formation and decreased mobility as
described in previous study (Ali Arslantas, et al., 2007).
Fig.3 shows that 246bp amplified product of NRG1 gene was
inhibited by Rh1 at different concentrations. Amount of the amplified
product of NRG1 gene decreased with increased the amount of Rh1 at
different reaction times. Fig.3a 24 hrs incubated PCR adduct rhodium
slightly affect the DNA replication but changes the mobility and intensity
of DNA bands with increasing Rhodium concentration. Fig.3b shows
the 48hrs incubation bands from 0.l up to 100nM concentration, which
get lighter and gradually disappeared at 500nM onwards, indicating
that DNA amplification is inhibited with increasing incubation time.
In fig.3c after 72 hrs incubated samples the amplification was inhibited
by rhodium from lower concentration of 5nM onwards and gradually
disappeared. In this study we also investigated the interaction of
human genomic DNA with Rhodium acetate and found covalent
interaction with DNA at nucleotide mismatch site (cytosine and
adenine) when digested with MunI enzyme which acts on cutting sites
CAAA. Our results exhibited heterozygous mutation on Agarose gel
showing 3 bands (one allele mutation) instead of 4 bans (two allele
mutations) confirmed that Rhodium didn’t have binding site for
adenine and cytosine. It seems that rhodium bind with specific bases
of the DNA and inhibited PCR amplification. These results confirm
International Peer Reviewed Journal
277
earlier experiments indicating that rhodium acetate bind with guanine
rather than adenine and cytosine (Mun1I has binding site at CAAA).
Literature indicates when rhodium bind with DNA it prevents the
DNA to replicate as it interacts with N7 and O6 of guanine forming
the rhodium adduct. This adduct breaks the hydrogen bond especially
at O6 position in the DNA structure (10).
This study clearly demonstrated that Rh complexes neutralized the
negative charge DNA which further inhibited the DNA amplification
due to covalent bond formation with guanine or cytosine bases at
position N7 and O6.
ACKNOWLEDGMENT
We gratefully acknowledge Dr. Sonia Siddiqui for her constant
support regarding the paper writing. Funding for this study was
provided by Higher Education Commission (HEC) of Pakistan. The
HEC had no role in study design, in the collection, analysis and
interpretation of data; in the writing of the report; and the decision to
submit the paper for publication.
LITERATURE CITED
Bear Jr., J.L., H.B. Gray, L. Rainen, I.M. Chang, R. Howard, G. Serio,
A.P. Kimball, Cancer Chemother. Rep. 59 (1975) 611–620.
Bear, J.L.
Rhodium compounds for antitumor use, in precious metals
1985, in: E.D. Zysk, J.A. Bonucci, (Eds.), International Precious
Metals, Proceedings of the Ninth International Precious Metals
Institute Conference, Allentown, PA, 1986, pp. 337–344.
Arslantas, A., Devrim, A. K., & Necefoglu, H. (2007). The interaction
of sheep genomic DNA with a cobalt (II) complex containing
p-Nitrobenzoate and N, N-Diethylnicotinamide ligands. International
Journal of Molecular Sciences, 8(12), 1225-1233.
JPAIR: Multidisciplinary Journal
278
Chifotides, H.T., K.M. Koshlap, L.M. Prez, and K.R. Dunbar.
2003. Novel Binding Interactions of the DNA Fragment d(pGpG)
Cross-Linked by the Antitumor Active Compound Tetrakis
(carboxylato) dirhodium (II,II) J. Am. Chem. Soc., 125 (35),
10714-10724.
Cohen, G.L., W.R. Bauer, J.K. Barton, S.J. Lippard,
Science 203 (1979) 1014– 1016.
Gardner, M., A. González-Neira, O. Lao, F. Calafell, J. Bertranpetit and
D. Comas.,
2006. Extreme population differences across Neuregulin 1 gene,
with implications for association studies Extreme population
differences across Neuregulin 1 gene: Molecular Psychiatry 11,
6675.
Helen, T., Chifotides., Karl, M., Koshlap, L., Prez, M., Kim, R.,
2003. Novel Binding Interactions of the DNA Fragment d(pGpG)
Cross-Linked by the Antitumor Active Compound Tetrakis(.
carboxylato) dirhodium(II,II). J. Am. Chem. Soc., 125(35),
10714-10724.
Howard, R.A., A.P. Kimball, J.L. Bear,
Cancer Res. 39 (1979) 2568–2573. Jonathan, R.H., M.D., Johnson.,
Jacqueline, K., Barton., 2004. Single-nucleotide polymorphism
discovery by targeted DNA photo cleavage. PNAS, 101(39).
Junicke, H., J.R. Hart, J. Kisko, O. Glebov, I.R. Kirsch, and J.K. Barton.,
2003 A rhodium (III) comples for high affinity DNA base pair
mismatch recognition. PNAS 100(7): 3737–3742
Katsuyuki, A., S. Abdus,
2002 Interligand interactions affecting specific metal bonding to
nucleic acid bases. A case of [Rh2(OAc)4], [Rh2(HNOCCF3)4],
and [Rh2(OAc)2(HNOCCF3)2] toward purine nucleobases
and nucleosides. Inorganica Chimica Acta 339, 427-437.
Lahiri, D.K. and B. Schnabel.
International Peer Reviewed Journal
279
1993 DNA isolation by a rapid method from human blood samples:
Effects of MgCl, EDTA, storage time, and temperature on DNA
yield and quality. Biochemical Genetics, 31(7-8): 321-328.
Law, A.J., et al.,
2006 Neuregulin 1 transcripts are differentially expressed in
schizophrenia and regulated by 5_ SNPs associated with the
disease. PNAS, 103(17): 6747–6752.
Paul J.H., Amanda, J.L.,
2006. Neuregulin 1 and Schizophrenia: Genetics, Gene Expression,
and neurobiology. Biological Psychiatric 60(2), 132-140.
Rahman M.d.M., Komatsu, J., Shinji, K., Akira, M.,
2008. Attachment of heavy metal to DNA molecules for rapid
analysis. IEEE 2, 775-777.
Rahman, Md. M., H. Yasuda, S. Katsura, A. Mizuno,
2007. Inhibition of endonuclease cleavage and DNA replication of E.
coli plasmid by the antitumor rhodium(II) complex. Archives
of Biochemistry and Biophysics 464 (2007) 28–35).
Stefansson, H., Sigurdsson, E., Steinthorsdottir, V., Bjornsdottir, S.,
Sigmundsson, T., Ghosh, S., Brynjolfsson, J., Gunnarsdottir, S.,
Ivarsson, O., Chou, T.T., Hjaltason, O., Birgisdottir, B., Jonsson,
H., Gudnadottir, V.G., Gudmundsdottir, E., Bjornsson, A.,
Ingvarsson, B., Ingason, A., Sigfusson, S., Hardardottir, H.,
Harvey, R.P., Lai, D., Zhou, M., Brunner, D., Mutel, V., Gonzalo,
A., Lemke, G., Sainz, J., Johannesson, G., Andresson, T.,
Gudbjartsson, D., Manolescu, A., Frigge, M.L., Gurney, M.E.,
Kong, A., Gulcher, J.R., Petursson, H., Stefansson, K., 2002.
Neuregulin 1 and susceptibility to schizophrenia. Am. J. Hum.
Genet. 71(4), 877–892.
Sherman, S.E., S.J. Lippard, Chem.
Rev. 87 (1987) 1153. Tselepi-Kalouli, E., N. Katsaros, J. Inorg.
Biochem. 40 (1990) 95–102. (16). Ushay, H.M., T.D. Tullius, S.J.
JPAIR: Multidisciplinary Journal
280
Lippard, Biochemistry 20 (1981) 3744–3748. Yang, J.Z., Si, T.M.,
Ruan, Y., Ling, Y.S, Han, Y.H., Wang, X.L., Zhou, M., Zhang,
H.Y., Kong, Q.M., Liu, C., Zhang, D.R., Yu, Y.Q., Liu, S.Z., Ju, G.Z., Shu,
L., Ma, D.L., Zhang, D.,
2003. Association study of neuregulin 1 gene with schizophrenia.
Molecular Psychiatry 8, 706–709.
Pursuant to the international character of this publication, the journal is
indexed by the following agencies: (1)Public Knowledge Project, a consortium of
Simon Fraser University Library, the School of Education of Stanford University,
and the British Columbia University, Canada; (2) E-International Scientific Research
Journal Consortium; (3) Philippine E-Journals; and (4) Google Scholar.