jurnal riset biologi dan aplikasinya, volume 3, issue 2, september 2021 diversity of lepidoptera: rhopalocera at selorejo waterfall area, ponorogo district, east java, indonesia siti zulaikha*, m. azmi dwi susanto biology departement, faculty science and technologi, uin sunan ampel surabaya jln. ahmad yani no. 117, jemur wonosari, wonocolo district, surabaya 60237, east java, indonesia *corresponding author: e-mail: zulaikasit456@gmail.com article history abstract received : 5 june 2021 selorejo waterfall is a natural tourist area that is directly adjacent to the sigogor mountain nature reserve and has a beautiful and natural environment. this makes the selorejo waterfall area has a good environment for the sustainability of various species of butterflies. this research aimed to find out the diversity and abundance of butterflies in the selorejo waterfall area. this research was conducted using the visual day flaying method by following the trail in the selorejo waterfall area. this study found 26 species belongs 4 families with 109 individuals in total. the value of the species diversity index at the location of h'= 2.81 moderate category. the diversity of butterflies in the selorejo waterfall area was influenced by the availability of host plants and feed as well as abiotic factors. revised : 2 july 2021 approved : 1 september 2021 published : 30 september 2021 keywords diversity; lepidoptera; butterflies, selorejo waterfall how to cite: zulaikha, s., & susanto, m. a.d. (2021). diversity of lepidoptera: rhopalocera at selorejo waterfall area, ponorogo district, east java, indonesia. jurnal riset biologi dan aplikasinya, 3(2): 68-72. doi: 10.26740/jrba.v3n2.p68-72. introduction butterflies are one of the flying insects in the order of lepidoptera with the characteristics of insects there are scales on their wings with variations, patterns, interesting colors (lestari et al., 2015). the body consists of 3 parts, namely the head (cephal), chest (thoracic) and abdomen. one of the roles of butterflies in an ecosystem is as pollinators. therefore, the existence of various species of butterflies in a location is very helpful in the process of pollination of plants (setiawan et al., 2018). thus, butterflies can be one of the important factors in maintaining the balance of the ecosystem at a location (alfidah et al., 2016). the existence and diversity of butterfly species in a location can be used as a bioindicator of environmental quality. land transfer can lead to a decrease in environmental quality due to the diversity of butterflies losing habitat and host plants and feed that will support their life cycle (adi et al., 2017). in an area that still has a high plant diversity will potentially be a habitat for various species of butterflies, this is because butterflies will choose habitats with a sufficient amount of feed material for their survival (rahayuningsih et al., 2012). selorejo waterfall is a natural tourist area in ngebel district, with a distance of 35 km from the center of ponorogo city which has a beautiful and natural environment, due to its location far from the city, and directly adjacent to the sigogor mountain nature reserve area. there is no scientific research related to the potential of natural resources and the diversity of insects, especially butterflies in selorejo waterfall. this allows the term the lost treasure, which is the loss of a potential without being known and without any conservation efforts. therefore, by conducting this research, data will be obtained regarding biodiversity, especially butterflies as a first step in conservation, so that later appropriate conservation actions can be taken to maintain the preservation of biological butterflies in selorejo waterfall area to be the right habitat for the survival of butterflies. this research aimed to analyze the jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi jurnal riset biologi dan aplikasinya, 3(2): 68-72, september 2021 | 69 diversity of species and abundance of butterflies in the selorejo waterfall tourist area. materials and methods time and location study the study was conducted in january february 2021 on the active hours of butterflies (08.00 am 01.00 pm). this research was conducted in the selorejo waterfall area of toyomerto hamlet, pupus village, ngebel district, ponorogo regency, east java (7o46’27.0”s, 111o40’40.11”e). sampling procedure the tools used during the study are stationary, watches, insect net, gps (global positioning system) to determine the point of the study location, light meters to measure light intensity and thermo-higrometers to measure the temperature and humidity of the environment. the study was conducted at one location along the selorejo waterfall stream in combination with visual day flaying by noting the species and number of individuals. the study also recorded abiotic factors, namely temperature (oc), humidity (%) and light intensity (lx). butterflies were identified using some references (mustari & gunadharma, 2016; baskoro et al., 2018 and ilhamdi et al., 2018). data analysis the butterfly data obtained in the sudy will be analyzed using the shannon-wienner diversity index (h’) (nuraini et al., 2020) and relative abundance (ra) (ilhamdi et al., 2019) with the following formula: diversity index relative abundance index %100/ nxnira = note: h’ = diversity index ra = relative abundance index ni = number of individual species-i n = total number of individuals results and discussion based on the results of identification carried out by butterfly species found in the selorejo waterfall area of ponorogo regency, 4 families from 26 species with 109 individuals (table 1). the results of the analysis of shannonwiener's diversity index in the selorejo waterfall area of ponorogo regency have a value of h' = 2.81, so it can be known that the diversity of butterflies in the selorejo waterfall area is in the moderate category. this shows that the selorejo waterfall area has a fairly good habitat for the survival of various species of butterflies. the value of the butterfly diversity index in the selorejo waterfall area is smaller than the butterfly diversity value in the taman kehati unnes h’ = 3.72 (priyono & abdullah, 2013). while the value of the butterfly diversity index in the selorejo falls area is greater than the butterfly diversity index in the mandor nature reserve with a value of h = 1.7 (florida et al., 2015). the value of diversity index in a region is influenced by the availability of feed plants, in addition butterfly diversity is also influenced by abiotic factors consisting of temperature, humidity and light intensity (ilhamdi et al., 2019). so, if biotic and abiotic factors in an area are adequate, it will be directly proportional to the diversity of butterflies in a location. the temperature in the selorejo waterfall area worth 28.4oc and the environmental humidity value of 74.6% (table 2) belongs to the category that is good for the survival of butterflies, this is because butterflies are poikilothermic organisms and require a warm environmental temperature for the metabolic system to run properly (ashari et al., 2019) and will affect its life activities. the temperature and humidity of the environment in the selorejo waterfall area is related to the high intensity of light entering the environment. this is because the selorejo waterfall area has a little canopy cover and trees at some point. therefore, the canopy is a constituent component of an ecosystem in order to regulate temperature and humidity into a suitable habitat for butterflies. the composition of the family is known that the family nymphalidae has the most abundant found during the study with a value of 35.7% (figure 1). the large number of families nymphalidae because it is known as the most abundant group of butterflies in the rhopalocera sub-order and has more than one host plant and feed (polyfag). in addition, the family nympahlidae is a group of butterflies with a good level of adaptation to the environment so it is very easy to find in nature (borror et al., 2005). 70 | zulaikha & susanto; diversity of lepidoptera: rhopalocera at selorejo waterfall table 1. rhopalocera's diversity and relative abundance at selorejo waterfall family species individual relative abundance papilionidae papilio memnon 3 14.68 troides helena 2 2.75 troides amphrysus 1 0.92 graphium agamemnon 2 1.83 graphium sarpedon 2 1.83 graphium doson 7 6.42 nymphalidae lethe confusa 7 6.42 danaus genutia 7 6.42 hypolimnas bolina 2 1.83 neptis hylas 5 4.59 euploea mulciber 1 0.92 ypthima baldus 3 2.75 ypthima pandocus 1 0.92 junonia hedonia 2 1.83 junonia iphita 1 0.92 mycalesis sp. 2 1.83 parantica aspasia 1 0.92 symberenthia lilaea 3 2.75 pieridae eurema hecabe 22 20.18 catopsilia pomona 1 0.92 delias belisama 2 1.83 letopsia nina 4 3.67 lycaenidae pitecops sp. 2 1.83 heliophorus epicles 1 0.92 coleta rhode 4 3.67 jamides sp. 7 6.42 total 109 100 table 2. abiotic factors in selorejo waterfall area no abiotic factors value 1 temperature 28.4 oc 2 humidity 74.6 % 3 light intensity 23733 lx figure 1. rhopalocera family in selorejo waterfall area jurnal riset biologi dan aplikasinya, 3(2): 68-72, september 2021 | 71 the family nymphalidae has the characteristic of having white, black and orange wings and has variety of wings color patterns (baskoro et al., 2018). the family nymphalidae has a moderate reduced wing front limb, and a front wing shape that forms an angle. in addition, nymphalidae are cosmopolitics butterflies that are widespread and prefer open areas (rohman et al., 2019). based on the analysis of the relative abundance index in the region eurema hecabe (figure 1) has the highest value ar = 20.18 with 22 individuals. eurema hecabe is a species in the family pieridae with low flying ability and agile motion. eurema hecabe has thoracic, abdomen and basic color of yellow-clothed wings with black patches on the elbowing upper wing plot. in addition, eurema hecabe has black patches on the bottom of its wings (baskoro et al., 2018). figure 2. eurema hecabe selorejo waterfall area has open environmental conditions; there are many lower and medium layer plants with trees at some point. during the study eurema hecabe many were found to be doing nectaring on the bidens pilosa plant (family asteraceae) to meet its nutritional sources and bask on rocks close to the flow of water. the amount of feed plants of this species of bidens pilosa is very much found in the selorejo waterfall area, hence it is directly proportional to the abundance of the species of eurema hecabe. according to ilhamdi et al. (2018) states that eurema hecabe is one species that can be found in snuffed out with abundant grasslands and shrubs. mustari & gunadharma (2016) also added that eurema hecabe is a species that likes an open environment and sufficient sunlight. this shows that supportive environmental conditions cause eurema hecabe species to be widely encountered during research. conclussion based on research conducted it was known that the diversity of butterflies in the selorejo waterfall was in moderate category, consisted of 26 species belongs to 4 families. the most common family found in the study was nymphalidae at 35.7%. while the result of the relative abundance of eurema hecabe has a value of ra = 20.18 with 22 individual numbers. references alfida, hanum, u., & eliyanti. (2016). kupu-kupu (rhopalocera) di kawasan hutan kota bni banda aceh. jurnal biotik, 4 (2), 117-127. doi: http://dx.doi.org/10.22373/biotik.v4i2.2906 ashari, f.n., addiniyah, n.r., & airni, h.a. (2019). inventory of diversity butterflies (lepidoptera: rhopalocera) in sumber clangap and waduk selorejo in east java. biota: bio & pend bio. 12(1): 32-37. doi: https://doi.org/10.20414/jb.v12i1.1 baskoro, k., kamaludin, n., & irawan, f. (2018). lepidoptera semarang raya. semarang: departemen biologi universitas diponegoro. borror, d.j., c., a. triplehorn & johnson. (2005). introduction to study of insects 7th edition. c.a, u.s.a: brooks/cole, belmont. florida, m., setyawati, tri, r., & yanti, ari, h. (2015). inventarisasi jenis kupu-kupu pada hutan kerangas di kawasan cagar alam mandor kabupaten landak. jurnal probiont. 4(1), 260265. doi: http://dx.doi.org/10.26418/probiont.v4i1.9794. ilhamdi, m. liwa., al indrus, a & santosa, d. (2018). kupukupu taman wisata suranadi. lombok barat: arga puji press. ilhamdi, m. liwa., al indrus, a & santoso, d. (2019). struktur komunitas kupu-kupu di taman wisata alam suranadi, lombok barat. jurnal biologi tropis. 19(1), 147-153. doi: http://dx.doi.org/10.29303/jbt.v19i2.880 kurniawan, b., apriani, r., & cahayu, s. (2020). keanekaragaman spesies kupu-kupu (lepidoptera) pada habitat eko-wisata taman bunga merangin garden bangko jambi. alhayat: journal of biology and applied biology. 3(1), 1-7. doi: http://dx.doi.org/10.21580/ah.v3i1.6064 lestari, d.f., rizma, d.a.p., ridman, m, purwaningsih, a.d. (2015). diversity of butterflies (insects: lepidoptera) in alas bromo, karanganyar, http://dx.doi.org/10.22373/biotik.v4i2.2906 https://doi.org/10.20414/jb.v12i1.1 http://dx.doi.org/10.26418/probiont.v4i1.9794. http://dx.doi.org/10.29303/jbt.v19i2.880 http://dx.doi.org/10.21580/ah.v3i1.6064 72 | zulaikha & susanto; diversity of lepidoptera: rhopalocera at selorejo waterfall central java. pros sem nas masy biodiv indonesia, 1 (6), 1284-1288. doi: https://doi.org/10.13057/psnmbi/m010604 mustari, a.h & gunadharma, n. (2016). kampus biodiversitas: kupu-kupu di wilayah kampus ipb dramaga. bogor: ipb press. nuraini, u., widhiono., i & riwidiharso, e. (2020). keanekaragaman dan kelimpahan kupu-kupu (lepidoptera: rhopalocera) di cagar alam bantarbolang, jawa tengah. bioeksakta: jurnal ilmiah biologi unsoed. 2(2), 157-164. doi: https://doi.org/10.20884/1.bioe.2020.2.2.1756 priyono, b & abdullah, m. (2013). keanekaragaman jenis kupu-kupu di taman kehati unnes. biosaintifika. 5(2), 101-105. doi: https://doi.org/10.15294/biosaintifika.v5i2.2749 rahayuningsih, m & oqtafiana, r & priyono, b. (2012). keanekaragamn jenis kupu-kupu superfamili papilionidae di dukuh banyuwindu desa limbangan kecamatan limbangan kabupaten kendal. jurnal mipa. 35(1),12-20. rohman, f., efendi, m.a., & andriani, l.r. (2019). bioekologi kupu-kupu. malang: universitas negeri malang. setiawan, r., retno, w., & fatimah,s. (2018). keanekaragaman jenis kupu-kupu (lepidoptera:rhopalocera) di zona rehabilitasi blok curah malang resort wonoasri taman nasional meru betiri. natural science: journal of science and technology. 7 (2), 252 – 258. https://doi.org/10.13057/psnmbi/m010604 https://doi.org/10.20884/1.bioe.2020.2.2.1756 https://doi.org/10.15294/biosaintifika.v5i2.2749 jurnal riset biologi dan aplikasinya, volume 3, issue 2, september 2021 the population of sanderling (calidris alba) in 2020 migration on the south coast of puger, getem, jember abdu rohman1*, ragil satriyo gumilang2 1biology education, faculty of teacher training and education, university of jember 2wetlands international indonesia jln. kalimantan no. 37, kampus tegalboto, jember, jawa timur, 68121, indonesia *corresponding author: e-mail: abdu.fkip@unej.ac.id article history abstract received : 7 april 2021 sanderling (calidris alba) is a species of shorebird that migrates from the northern hemisphere to the southern hemisphere. indonesia is a migration route for east asia-australasia. the southern coastal area of the jember regency, one of the wetlands, especially in east java, has become an air route and a stopover for shorebirds every year. the research objective was to determine the population of sanderling (calidris alba) on the southern coast of puger and getem, jember regency. method of data collection was encounter rates. bird watching was carried out in the morning at 06.00-08.00 am and in the afternoon at 03.30-05.30 pm. data recording included species, number of birds, and other supporting data. data was analyzed using the density index for individual bird species. the results of the study showed that there were a total of 445 individuals. the highest population was found in the river mouths, while the ponds were the minor location. analysis of individual density data showed that the river estuary was the location with the highest number of the four other survey locations. revised : 2 june 2021 approved : 4 september 2021 published : 30 september 2021 keywords population; calidris alba; migration; shorebird how to cite: rohman, a & gumilang, r.s. (2021). the population of sanderling (calidris alba) in 2020 migration on the south coast of puger, getem, jember. jurnal riset biologi dan aplikasinya, 3(2): 63-67. doi: 10.26740/jrba.v3n2.p63-67 introduction sanderlings (calidris alba) is a species of shorebird that migrates from the northern hemisphere to the southern hemisphere (robert et al., 2005; yong et al., 2018). indonesia is a migration route for east asia-australasia (howes et al., 2003; robert et al., 2005). crossland et al. (2010) stated that sanderling had been recorded at several locations on the south coast of java. research by taufiqurrahman et al. (2010) noted that the southern coast of trisik in yogyakarta is a critical location for sanderling's existence. crossland et al. (2014) reported another location, namely glagah beach, a wetland on java's southern coast. this site is an important national and international nonmigratory breeding site for sanderling (calidris alba). another location on the south coast of java, where sanderlings are flying, is the southern coastal area of jember regency. the southern coastal area of the jember regency is one of the wetlands, especially in east java, and is an annual flight route and a stopover for shorebirds. there are several habitats, including mangrove forests, beaches, river estuaries, rice fields, and ponds. this makes the southern coast of jember regency frequently visited by migratory shorebirds (symonds and langslow, 1996; sibuea, 1997; purify et al., 2019). every year, during the migration season, hundreds of waterbirds can be found stopping in this area, hence the south coast of puger, getem is an essential location for migratory shorebirds in jember regency. another phenomenon in the southern coastal area of puger, getem, jember regency is the number of various human activities in this area. for jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi jurnal riset biologi dan aplikasinya, 3(2): 63-67, september 2021 |64 example, fishing, ecotourism, and fishing boat traffic activities (klein et al., 1995; rodgers jr. & schwikert, 2002; clark & koslow, 2008; borgmann, 2011). such conditions in the long term will directly impact the sustainability of migration using the southern coastal area of the jember regency as a stopover, especially in looking for food. also, changes in transit habitat can severely limit migratory populations (studds et al., 2017). efforts are needed to conserve the migration of shorebirds that migrate in one part of the home range is less effective if unsolved threats reduce this species' population and habitat in other places (kirby et al., 2008). therefore, it is essential to maintain the transit habitat to sustain shorebirds' migration, especially sanderling. based on this explanation and the survey results, there was population of sanderling shorebirds (calidris alba), especially in the southern coastal area of puger, getem. therefore, this study aimed to analyze the population of sanderling (calidris alba) on the south coast of puger and getem, jember regency. materials and methods the research location was on the south coast of puger, getem, jember regency, east java province. location coordinates 8.379 latitude 113.406 longitude. the four survey locations were river estuaries, mangrove forests, ponds, and along the southern coastline of puger, getem (figure 1). the research was conducted from february to april 2020. using the tools in this study include binocular binoculars, svbony sv408 spotting scope monocular binoculars, tripod somita st3520, nikon d5300, and 200mm telelens cameras and garmin gps. the data collection method uses encounter rates. every bird found in the estuary area, mangrove forest, ponds, and along the southern coastline of puger, getem jember was observed and counted. the observation was carried out in the morning (06.00-08.00 am) and evening at (03.30-05.30 pm). field data recording included species, number of birds, habitat, and several other supporting factors. the identification was conducted based on morphological characters, namely size, color, and sound as well furthermore, identifying shorebirds using the book by hayman et al. (1991), bhushan, b., et al. (1993), and mackinnon et al. (2010). density data analysis of individual birds was calculated using the method with the formula (alikodra, 1990): d = n a d = density of the bird (indvidual / ha) n = estimated population (individual). a = area represented results and discussion sanderling (calidris alba) is a shorebird species that has a conservation status according to the iucn red list (international union for conservation of nature) is least concern. this bird has the characteristics of relatively small size of about 20 cm, gray with striking black shoulders. looks whiter than other types of soy. at the same time, it was flying on a wing with a white cross. the middle tail is dark with white sides. dark brown iris, black beak, and legs. sounds' clip clip chip when flying (bhushan, et al., 1993, mackinnon et al., 2010). figure 1. location of the survey by calidris alba on the south coast of puger, getem, jember. a. river estuary; b. coastal; c. mangrove forest; d. pond. (source: google map) 65 | rohman & gumilang; the population of sanderling (calidris alba) in 2020 figure 2. population of calidris alba on february 16, 2020 table 1. the population of calidris alba on the south coast of jember no location individuals 1 estuary 231 2 coast 184 3 mangrove forest 40 4 pond 33 total 445 figure 3. proportion of calidris alba on the south coast of puger, getem. the four survey locations were river estuaries, mangrove forests, ponds, and along the southern coastline of puger, getem (figure 1). the total population of sanderling (calidris alba) at four locations was 445 individuals (table 1 and figure 3). the first location was muara sungai, with a total of 231 individuals. then the coastal coast tallied a total of 184 individuals. the total number of mangrove forests is 40 individuals, and the last location of the tambak (fish ponds) area is the calculation of the total number of 33 individuals. taufiqurrahman et al. (2010) stated that sanderling (calidris alba) record with an estimated 1,845 individuals was present on january 2, 2010, at trisik beach, precisely on the south-central coast of java. this location is recognized as a site of international importance because it covers 37% of indonesia's estimated population. in another study, ming ge et al. (2006) stated that adult shorebirds use different migration routes during fall migration or use the same way but do not stop at river mouths. instead, some relied on coastal stopovers for food during their first trip south. the results of data analysis on population density of sanderling (calidris alba) in estuary showed a value of 57.75 (individual/ha). coastal 46 (individual/ha). mangrove forest 8 (individual/ha) and pond 6.6 (individual/ha). estuary is the location with the highest number of the other four survey locations. the location of the pond has the smallest amount of sanderling population density. another study states that several species' presence 47% 38% 8% 7% estuary coast mangrove forest pond jurnal riset biologi dan aplikasinya, 3(2): 63-67, september 2021 |66 in exploiting an area's resources cannot be separated from the company of abundant feed, which makes it the main attraction for a species (hassan-aboushiba et al., 2011; quiroga et al., 2013). research by hagy and kaminsky (2012) recommends: active management of moist-soil wetlands to increase the use of waterbirds. those conservation planners consider increasing the foraging threshold in the carrying capacity model for moist-soil wetlands. conduct additional experiments to explain the foraging threshold in moist soil and other wetlands targeted by the waterfowl management plan by the relevant agencies. conclusion the population of sanderling (calidris alba) on the southern coast of puger and getem, jember regency was 445 individuals. the highest population was found in the river mouths, while the ponds are the minor location. analysis of bird density data shows that estuary of the river is the location with the highest number of individuals from the other four survey locations. acknowledgement we want to thank fellow bird observers throughout indonesia for their enthusiasm and support in data collection. we are grateful to the ministry of environment and forestry, the national partnership for the conservation of migratory birds and their habitats, and wetlands international indonesia to implement the indonesia asian waterbird census 2020. we are also grateful to the people of puger getem for their assistance and hospitality. finally, we would like to thank the lecturers, members of the biology education student ornithology study group, fkip, university of jember. references alikodra h.s. (1990). pengelolaan satwa liar jilid i. departemen pendidikan dan kebudayaan. direktorat jendral pendidikan tinggi pusat antar universitas ilmu hayat ipb. bogor. bhushan, b. (1993). a field guide to the waterbird of asia. wild bird society of japan in collaboration with asian wetland bereau with the assistance of a grant from tokai foundation. kodansha international borgmann, k. l. (2011). a review of human disturbance impacts on waterbirds kathi l. borgmann * audubon california, 376 greenwood beach rd., tiburon, california 94920. waterbirds, 1–23. clark, m. r., & koslow, a. l. (2008). impacts of fisheries on seamounts. seamounts: ecology, fisheries & conservation, 67, 413–441. https://doi.org/10.1002/9780470691953.ch19 crossland, a. c., a. s. sitorus & h. a. chandra. (2010). discovery of an important site for sanderling calidris alba on the south coast of java. stilt, the journal for the east asian-australasian flyway. 1(2): 3-4. borgmann, k. l. (2011). a review of human disturbance impacts on waterbirds kathi l. borgmann * audubon california, 376 greenwood beach rd., tiburon, california 94920. waterbirds, 1–23. clark, m. r., & koslow, a. l. (2008). impacts of fisheries on seamounts. seamounts: ecology, fisheries & conservation. 67, 413–441. https://doi.org/10.1002/9780470691953.ch19 crossland, a. c., a. s. sitorus & h. a. chandra. (2010). discovery of an important site for sanderling calidris alba on the south coast of java. stilt, the journal for the east asian-australasian flyway: 3-4. crossland, a. c., sitorus, a. w & sitorus, a. s. (2014). land use change impactsshorebird habitat at an important site for javan plover charadrius javanicus and sanderling calidris alba in java, indonesia. stilt: the journal for the east asian-australasian flyway 66, 30–36. hagy, h.m. & kaminsky, r. m. (2012). winter waterbird and food dynamics in autumn‐managed moist‐soil wetlands in the mississippi alluvial valley. wildlife society. 36 (3), 512-523. hassan-aboushiba ab, ramli r, sofian-azirun m. (2011). species composition and feeding guilds of birds utilizing palm oil mill effluent (pome) area in carey island, malaysia. 2nd international conference on environmental scienceand technology. singapura (sg): ipcbee. 6, 28-31. howes, j., bakewell, d., & noor, y. r. (2003). panduan studi burung pantai. bogor : wetland international. kirby, j. s., stattersfield, a. j., butchart, s. h. m., evans, m. i., grimmett, r. f. a., jones, v. r., o’sullivan, j., tucker, g. m., & newton, i. (2008). key conservation issues for migratory landand waterbird species on the world’s major flyways. bird conservation international, 18, s49–s73. https://doi.org/10.1017/s0959270908000439 klein, m. l., humphrey, s. r., & percival, h. f. (1995). effects of ecotourism on distribution of waterbirds in a wildlife refuge. conservation biology, 9(6), 1454– 1465.https://doi.org/https://doi.org/10.1046/j.1523 -1739.1995.09061454.x mackinnon, j., phillips, k., & ballen, bv. (2010). burung https://doi.org/10.1002/9780470691953.ch19 67 | rohman & gumilang; the population of sanderling (calidris alba) in 2020 burung di sumatera, jawa, bali dan kalimantan termasuk sabah dan brunei darussalam). puslitbang biologilipi & birdlife internasional-indonesia programme: 146. ming ge, et. al. (2006). use of wetlands at the mouth of the yangtze river by shorebirds during spring and fall migration. 77(4), 347-356 purify, a. et al. (2019). water bird habitat suitability analysis in an urban coastal wetland (case study: lantebung mangrove ecotourism area). iop conf. series: earth and environmental science, 370: 012042. quiroga m, leon e, beltzer a, olguin p. 2013. diet of black-crowned night-herons (nycticorax nycticorax) in wetlands of the parana river’s alluvia valley. ekoloji. 22(88), 43-50. riegen. (2005). crossing the ultimate ecological barrier: evidence for an 11 000-km-long nonstop flight from alaska to new zealand and eastern australia. godwits, the condor. 107 (1): 1–20. rodgers jr., j. a., & schwikert, s. t. (2002). buffer-zone distances to protect foraging and loafing waterbirds from disturbance by personal watercraft and outboard-powered boats. conservation biology. 16(1), 216–224. https://doi.org/https://doi.org/10.1046/j.15231739.2002.00316.x sibuea, t.th, y. rusila-noor, m.j. silvius, dan a. susmianto. (1995). burung bangau, pelatuk besi dan paruh sendok di indonesia. panduan untuk jaringan kerja. jakarta: phpa & wetlands internationalindonesia programme. studds, c., kendall, b., murray, n. (2017). rapid population decline in migratory shorebirds relying on yellow sea tidal mudflats as stopover sites. nat commun. 8: 14895. taufiqurrahman, i., tampubolon, a. m., subekti, h., & ulya, h. z. (2010). pantai trisik, yogyakarta: another internationally important site for sanderling calidris alba in indonesia. stilt. 58, 57. tian b, zhou y, zhang l, yuan l. (2008). analyzing the habitat suitability for migratory birds at the chongming dongtan nature reserve in shanghai, china. estuarine, coastal and shelf science. 80, 296-302. yong, d.l., (2018). challenges and opportunities for transboundary conservation of migratory birds in the east asian-australasian flyway. conservation biology. 32 (3), 740–743. https://onlinelibrary.wiley.com/action/dosearch?contribauthorstored=ge%2c+zhen-ming https://onlinelibrary.wiley.com/toc/15579263/2006/77/4 7 | ariyunita et al.; the first investigation of microplastics contamination in estuarine jurnal riset biologi dan aplikasinya, volume 3, issue 1, march 2021 the first investigation of microplastics contamination in estuarine located in puger district, jember regency, indonesia selvi ariyunita1*, yeny dhokhikah2, wachju subchan3 1,3biology education study program, faculty of teacher training and education, university of jember jln. kalimantan no. 37, kampus tegalboto, sumbersari, jember district, east java 68121, indonesia 2environmental engineering, faculty of engineering, university of jember, kampus tegalboto jln. kalimantan no. 37, kampus tegalboto, sumbersari, jember district, east java 68121, indonesia *corresponding author: e-mail: selvi.ariyunita@unej.ac.id article history abstract received : 1 10 february 2021 microplastics are harmful to the ecosystem and need to solve immediately. detection of microplastic contamination is the first step to reduce plastics pollution. estuarine in puger has a high potential for microplastic pollution related to the multifunction of waters as ports, tourism, fish market, fish processing, and human settlements. however, there are no studies related to microplastic contamination in the area. the objectives of this research were to determine microplastic contamination in the estuarine located in puger district, jember regency, indonesia. the research results were the first evidence to inform the society and local government about the actual condition of plastic pollution, especially in the aquatic ecosystem. the sampling sites were determined by purposive sampling. fifty liters of water from each station (with three repetitions) were taken using a 24v water pump and then filtered using stainless steel filter (mesh 5 mm and 0.2 mm). the filtered samples were placed in a sterile bottle sample, stored at 4 ± 20c. microplastics were counted and categorized according to size, color, and type under a microscope stereo. microplastic abundance was calculated based on the number of microplastic particles identified per liter of sample water (particle/liter). the result showed that the study area was contaminated by microplastics throughout site sampling, with abundances varying from 0.03 particles/liter to 0.19 particles/liter. the highest microplastic abundance found near the fishery market. the microplastics also vary in size, color, and type. according to characterization, the sources of microplastic contamination come from human-based activities. revised : 21 february 2021 approved : 22 march 2021 published : 31 march 2021 keywords microplastics; pollution; characterization; contamination; estuarine how to cite: ariyunita, s., dhokhikah, y., & subchan, w. (2021). the first investigation of microplastics contamination in estuarine located in puger district, jember regency, indonesia. jurnal riset biologi dan aplikasinya, 3(1): 7-12. doi: https://doi.org/10.26740/jrba.v3n1.p7-12. introduction sustainability of the marine ecosystem is one of the purposes of sustainable development goals. a massive problem in the marine ecosystem nowadays is plastic debris contamination from land-based activities and marine-based activities (clark et al., 2016). plastic is a persistent pollutant in the environment. it needs a long time to break down into smaller sizes, reaching micro and nanometer (wagner & lambert, 2018; gesamp joint group of experts on the scientific aspects of marine environmental protection, 2016). its persistent and buoyant properties contributed to widespread microplastics in the marine ecosystem (ng & obbard, 2006). microplastics are plastic with 0.02 mm 5 mm size. microplastics are harmful in the environment because it is difficult to degrade, so this particles accumulate in water bodies, sediments, and organisms to the food chain and end up with humans as top predators in the food chain (jabeen et al., 2017; wagner & lambert, 2018). microplastics in organisms cause a direct effect as irritation to the digestive tract and cause physiological disruptions (brennecke et al., 2015; franzellitti et al., 2019). jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi mailto:selvi.ariyunita@unej.ac.id https://doi.org/10.26740/jrba.v3n1.p7-12 jurnal riset biologi dan aplikasinya, 3(1): 7-12, march 2021 | 8 many studies reported that plastic debris contamination, particularly microplastic occurs in estuarine and coastal in indonesia (joesidawati, 2018; ayuningtyas, 2019; cordova et al., 2019; cordova & hernawan, 2018; taryono et al., 2020). estuarine is a potential area that accumulates plastic debris from land-based sources along river streams and becomes marine ecosystem pollutants (zhao et al., 2014; kurniawan & imron, 2019). bauer-civiello et al. (2019) also clarify that mismanage waste from urban area contribute the input of plastic debris in the environment. it means that areas surrounded by the density of population activitis have more significant potential in contaminating microplastics because of plastic product use (widianarko & hantoro, 2018). this condition can alter the sustainability of the estuary and marine ecosystem. moreover, it can decrease ecosystem productivity. the adverse effect that occurs from the widespread microplastic pollution needs to solve immediately. in this case, detecting microplastic contamination is an urgent step to reduce pollution (xu et al., 2018). although many researchers reported contamination of microplastic in indonesia, there are no reports related to microplastic pollution studies in the estuarine along puger coastal, jember regency. the puger coastal has a high potential for microplastic pollution because of its multifunctional designation of waters as ports, tourism, fishery market place, fish processing industry, and residential areas. moreover, two estuaries (such as bedadung and getem estuary) are critical areas for accumulating various pollutants from land-based activities (wagner & lambert, 2018; xu et al., 2018; maherlsa et al., 2019). this research aimed to determine and characterize microplastic contamination in the estuarine along puger coastal, jember regency. the research results were the first evidence that inform the society and local government about the actual condition of plastic pollution, especially in the aquatic ecosystem. moreover, it hopefully can be used to improve the policy of waste management in jember regency. materials and methods study area the sampling site of this research was the estuarian on the puger coastal, jember regency (figure 1). determination of sampling sites based on purposive sampling adjusted to the designation of waters, including 1). near tambak (near the shrimp pond), latitude: -8,277069 and longitude: 113,540783; 2). estuary getem, latitude: -8,384666 and longitude: 113,411809; 3). estuary bedadung /pelawangan, latitude: -8,382126 and longitude: 113,472933; 4). tempat pelelangan ikan (tpi)/ fishery market, latitude: -8.379272 and longitude: 113,476113. the study was conducted from october 2019 until february 2020. sampling methods fifty liters of water from each station were taken (with three repetitions) using 24 volt water pumping. the sample was then filtered using a stainless steel filter with a mesh stack (size 5 mm and 0,2 mm). the filtered samples were placed in bottle samples and stored at 40c ± 20c. the equipment was rinsed first with ddh2o to avoid contamination. sample preparation the samples were transferred to the erlenmeyer tube and dried in the oven at 80 900c for 24 hours. then added 5 ml of 30% hydrogen peroxide (h2o2) and heated in a water bath at 800c for 24-48 hours. hydrogen peroxide is the destruction solution to degrade the organic material (cordova et al., 2019). microplastics characterization microplastics were identified under microscope stereo by particle size 0.2-5 mm, unsegmented, and unbranched structure. based on the color, microplastics were categorized as black, transparent, and colored. furthermore, based on the shape, microplastics were categorized as fibers, granules, fragments, and foam (cordova et al., 2019). data analysis microplastic abundance was calculated based on the number of microplastic particles identified per liter of sample water (particle/liter). results and discussion abundance of microplastic in the study area the results showed that microplastics contaminated all sampling sites in the study area. the highest microplastic abundance was 0.19 particles/liter, as observed at station 4 (estuarine near fishery market). the lowest microplastic abundance was found at station 3 (bedadung estuarine) with 0.03 particles/liter (figure 2). 9 | ariyunita et al.; the first investigation of microplastics contamination in estuarine figure 1. study area of puger district, jember regency, indonesia types, sizes, and colors of microplastics besides the abundance, microplastics were also characterized into sizes, types, and colors (figure 3 and 4). this characterization is helpful to determine the source of microplastic contamination. the results showed that the identified microplastics were fragments (77.42%) and fiber (22.58%). according to ayuningtyas (2019), microplastic fragment type was more abundant than fiber. the sources of the fragment derived from pieces of pipes, plastic bottles, and plastic bags. in comparison, the type of fiber derived from synthetic fabrics, ship waste fishermen, and fishing gear such as fishing nets and fishing lines. the size range of microplastic determines the potential effect of microplastics in the ecosystem, especially in the organism (zhao et al., 2014). in this study, 40% of the total identified microplastics were between 1-5 mm in size. furthermore, 33% and 27% were respectively for 0.3-0.5 mm and 0.5-1 mm. the high abundance of microplastics in this size range (1-5 mm) indicates that microplastic particles have not been degraded for a long time (cordova et al., 2019). some factors that affected microplastic sizes' distribution are hydrodynamic condition, wind speed, and bio-fouling (afdal et al., 2019). figure 2. abundance of microplastic in the study area jurnal riset biologi dan aplikasinya, 3(1): 7-12, march 2021| 10 figure 3. microplastics characterization based on sizes, types, and colors in each station: 1. near tambak; 2. estuary getem; 3. estuary bedadung; 4. fishery market (a) (b) (c) (d) figure 4. identified microplastics under microscope stereo: (a) 0,5-1 mm; fragment, color; (b) 0.5-1 mm, fiber, color; (c) 0.5-1 mm; fragment, transparent; (d) 0.3-0.5 mm; fiber, color 11 | ariyunita et al.; the first investigation of microplastics contamination in estuarine based on the colors, the identified microplastics were dominated as transparent (45%), colored (39%), and black (16%). domination of transparent and colored microplastic indicated that contamination sources probably come from human activities, such as plastic, packaging, clothing, and fishing (zhao et al., 2014). moreover, the transparent color is harmful and increases the potential for accidentally being eaten because it is hard to distinguish. various colors, sizes, and shapes of plastic fragments similar to natural food resources and alter the potential of this contaminant ingested by the aquatic organism (foekema et al., 2013). microplastic contamination in this study comes from human-based activities that enter the plastic debris in water bodies. the results support the fact that asian rivers transport more plastics toward the ocean (van calcar & van emmerik, 2019). moreover, microplastic availability in estuarine located in puger district, jember regency, can interfere aquatic ecosystem and contribute as a pollutant to the indian ocean. the limited research about plastic debris pollution in jember regency needs further research about bioavailability and microplastic risk in organisms and ecosystems. conclusion this study reported the first evidence that microplastics contaminate estuarine along puger coastal. the highest microplastic abundance was 0.19 particles/liter at near fishery market, followed by near tambak and estuarine getem. the lowest microplastic abundance was found at bedadung estuarine with 0.03 particles/liter. according to sizes, types, and colors, the identified microplastics were respectively between 1-5 mm (40%), 0.3-0.5 mm (33%), and 0.5-1 mm (27%); fragments (77.42%) and fiber (22.58%); transparent (45%), colored (39%), and black (16%). this study provides the first evidence that microplastic contaminate the aquatic ecosystem in jember regency. the data also provide information for the society to reduce plastic waste from the sources and the local government as a basic consideration to improve waste management policy. acknowledgment the author is grateful for full support and funding from pnbp lembaga penelitian dan pengabdian masyarakat (lp2m) university of jember. references afdal, m., werorilangi, s., faizal, a., & tahir, a. (2019). studies on microplastics morphology characteristics in the coastal water of makassar city, south sulawesi, indonesia. international journal of environment, agriculture and biotechnology, 4(4), 1028– 1033. https://doi.org/10.22161/ijeab.4421 ayuningtyas, w. c. (2019). kelimpahan mikroplastik pada perairan di banyuurip, gresik, jawa timur. jfmrjournal of fisheries and marine research, 3(1), 41–45. https://doi.org/10.21776/ub.jfmr.2019.003.01.5 bauer-civiello, a., critchell, k., hoogenboom, m., & hamann, m. (2019). input of plastic debris in an urban tropical river system. marine pollution bulletin, 144(february), 235–242. https://doi.org/10.1016/j.marpolbul.2019.04.070 brennecke, d., ferreira, e. c., costa, t. m. m., appel, d., da gama, b. a. p., & lenz, m. (2015). ingested microplastics (>100μm) are translocated to organs of the tropical fiddler crab uca rapax. marine pollution bulletin, 96(1–2), 491–495. https://doi.org/10.1016/j.marpolbul.2015.05.001 clark, j. r., cole, m., lindeque, p. k., fileman, e., blackford, j., lewis, c., lenton, t. m., & galloway, t. s. (2016). marine microplastic debris: a targeted plan for understanding and quantifying interactions with marine life. frontiers in ecology and the environment, 14(6), 317–324. https://doi.org/10.1002/fee.1297 cordova, m. r., & hernawan, u. e. (2018). microplastics in sumba waters, east nusa tenggara. iop conference series: earth and environmental science, 162(1). https://doi.org/10.1088/1755-1315/162/1/012023 cordova, muhammad reza, purwiyanto, a. i. s., & suteja, y. (2019). abundance and characteristics of microplastics in the northern coastal waters of surabaya, indonesia. marine pollution bulletin, 142(march), 183–188. https://doi.org/10.1016/j.marpolbul.2019.03.040 foekema, e. m., gruijter, c. de, mergia, m. t., franeker, j. a. van, murk, a. j., & koelmans, a. a. (2013). foekema em. plastic in north sea fish. es&t 2013. environmenrtal science & technology, 47, 8818–8824. franzellitti, s., canesi, l., auguste, m., wathsala, r. h. g. r., & fabbri, e. (2019). microplastic exposure and effects in aquatic organisms: a physiological perspective. environmental toxicology and pharmacology, 68(march), 37–51. https://doi.org/10.1016/j.etap.2019.03.009 gesamp joint group of experts on the scientific aspects of marine environmental protection. (2016). sources, fate and effects of microplastics in the marine environment: part 2 of a global assessment. (imo, fao/unescoioc/unido/wmo/iaea/un/unep/undp). in: kershaw, p.j. (ed.), rep. stud. gesamp no. 90 jurnal riset biologi dan aplikasinya, 3(1): 7-12, march 2021| 12 (96 pp). reports and studies gesamp, no. 93, 96 p., 93. jabeen, k., su, l., li, j., yang, d., tong, c., mu, j., & shi, h. (2017). microplastics and mesoplastics in fish from coastal and fresh waters of china. environmental pollution, 221, 141–149. https://doi.org/10.1016/j.envpol.2016.11.055 joesidawati, m. i. (2018). pencemaran mikroplastik di sepanjang pantai kabupaten tuban. seminar nasional hasil penelitian dan pengabdian masyarakat 3, september, 7–15. kurniawan, s. b., & imron, m. f. (2019). environmental technology & innovation seasonal variation of plastic debris accumulation in the estuary of wonorejo river, surabaya , indonesia. environmental technology & innovation, 16, 100490. https://doi.org/10.1016/j.eti.2019.100490 maherlsa, r., purwiyanto, a. i. s., agustriani, f., putri, w. a. e., fauziyah, & ferdiansyah. (2019). identification of surface macro debrisin river flow and estuary of musi river, south sumatera province, indonesia. journal of physics: conference series, 1282(1). https://doi.org/10.1088/1742-6596/1282/1/012106 ng, k. l., & obbard, j. p. (2006). prevalence of microplastics in singapore’s coastal marine environment. marine pollution bulletin, 52(7), 761–767. https://doi.org/10.1016/j.marpolbul.2005.11.017 taryono, pe, e. o. l., wardiatno, y., & mashar, a. (2020). macroplastic distribution, abundance, and composition which flows to cimandiri estuary, west java. iop conference series: earth and environmental science, 420(1). https://doi.org/10.1088/17551315/420/1/012031 van calcar, c. j., & van emmerik, t. h. m. (2019). abundance of plastic debris across european and asian rivers. environmental research letters, 14(12), 124051. https://doi.org/10.1088/1748-9326/ab5468 wagner, m., & lambert, s. (2018). freshwater microplastics the handbook of environmental chemistry 58. https://doi.org/10.1007/978-3-319-61615-5 widianarko, b., & hantoro, i. (2018). mikroplastik mikroplastik dalam seafood seafood dari pantai utara jawa. available at www.unika.ac.id xu, p., peng, g., su, l., gao, y., gao, l., & li, d. (2018). microplastic risk assessment in surface waters: a case study in the changjiang estuary, china. marine pollution bulletin, 133(june), 647–654. https://doi.org/10.1016/j.marpolbul.2018.06.020 zhao, s., zhu, l., wang, t., & li, d. (2014). suspended microplastics in the surface water of the yangtze estuary system, china: first observations on occurrence, distribution. marine pollution bulletin, 86(1–2), 562–568. https://doi.org/10.1016/j.marpolbul.2014.06.032. jurnal riset biologi dan aplikasinya, volume 3, issue 2, september 2021 variation and phenetic relationship of tobacco (nicotiana tabacum l.) in central java and yogyakarta based on morphological characters agung dwi santoso1*, purnomo2 1faculty of biology, universitas gadjah mada 2plant systematics laboratory, faculty of biology, universitas gadjah mada jln. teknika selatan, senolowo, sinduadi, mlati, sleman, yogyakarta 55281 *corresponding author: e-mail: agung.dwi.santoso@mail.ugm.ac.id article history abstract received : 10 june 2021 tobacco (nicotiana tabacum l.) is a plant used as a mixture of cigarettes, and recreational media especially for men. this study aimed to identify variations, and determine the relationship between tobacco cultivars in central java and yogyakarta based on macromorphological and micromorphological characters. sampling locations are determined by surveying locations in both regions. tobacco samples found include 5 cultivars in central java namely 'mantili', 'uler magetan', 'garut', ‘gober boyolali’, 'manila', and 3 cultivars in yogyakarta namely 'siluk', 'java', and 'virginia'. characterization with 23 qualitative macromorphological characters including leaves, and stems, with 9 qualitative and quantitative micromorphological characters including trichome and stomata. descriptive data analysis is done to obtain the typical character of each cultivar, followed by numerical analysis including scoring characters processed with mvsp (multi variate statistical package), clustering with upgma (unweighted pair group method with averages), and calculation of similarity coefficients with simple matching formula. the results showed variations in the macromorphological characters including the shape of the leaf lamina, the base of the leaf, the absence of leaf stalks, and type of leaf venation. tobacco has anisositic stomata, and varies in terms of length, width, and density of stomata. tobacco trichomes are glandular. the result dendrograms form two clusters (a and b) with the similarity index of each cluster above 0.80. cultivars with close relationships such as 'siluk'-'java', and far relationship like 'java'-'manila'. revised : 21 july 2021 approved : 29 august 2021 published : 30 september 2021 keywords tobacco; macromorphology; micromorphology; phenetic relationship how to cite: santosa, a.d., & purnomo. (2021). variation and phenetic relationship of tobacco (nicotiana tabacum l.) in central java and yogyakarta based on morphological characters. jurnal riset biologi dan aplikasinya, 3(2): 73-79. doi: 10.26740/jrba.v3n2.p73-79. introduction tobaccos are commercial plant from the family solanaceae, used widely as offerings in traditional ceremonies, herbal medicine ingredients, and main ingredient of cigarettes for personal entertainment. in indonesia tobaccos could grow around 15 provinces ranging from lowland such as nusa tenggara to highland such as wonosobo (djajadi, 2015). various cultivars appear in indonesia, making tobacco plants widespread and adaptable. many tobacco cultivars appear because of cultivation by crossing various inductees in order to obtain superior offspring with good nicotine levels suitable for cigarette mixtures (amelia, 2012). cultivars are individuals with similar character within species, and are distinguishable from other cultivars (federizzi et al., 2012). the development of cultivars makes identification and characterization become the first step to introduce and developing of tobacco’s cultivation in the community (korir et al., 2012). research of tobacco cultivars such as djumali (2011) about identification jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi jurnal riset biologi dan aplikasinya, 3(2): 54-62, september 2021 |74 and characterization of tobacco cultivars found in temanggung. this research has found various tobacco cultivars such as ‘kemloko-1’,’2’, and ‘3’, ‘dorowati,’ 'mantili', etc. according to this study variations present from leaf morphology such as different sizes and shapes, leaf color, harvest age, and flowers morphology typical in each type of cultivars. the variety character of tobacco cultivars is quite diverse and specific in certain habitats. this is the result of environmental adaptation and the cultivation process carried out by farmers (amelia, 2012; prasetiyo et al., 2016). these adaptive variations are reflected through the morphological and anatomical characters of the plant. variations in morphological characters are still commonly used for the identification process, and grouping different types of cultivars through phenetic approach. the phenetic analysis is an activity that grouping organisms into specific groups based on visible character equations, which exist in organisms regardless of their evolution (arrijani, 2003). this grouping is expected to make it easier for researchers and cultivators to know the genealogy and cultivars’ relationship. variations in organisms become the guideline for choosing inductees with the best quality to produce better offspring. thus, this study was conducted to determine the variation, and relationship of tobacco cultivars in central java and yogyakarta using morphological characters through phenetic analysis. materials and methods this study held from august 2020 to april 2021 in temanggung and yogyakarta. the samples used were leaves, stems, and flowers from eight tobacco cultivars listed in table 1 and pictured in figure 1. the observations are using 23 macromorphological characters and 7 micromorphological characters of qualitative and quantitative chosen from previous study about tobacco. characterization of macromorphological characters using leaves (adaxial side), flowers, fruits, and stems. leaves samples are also taken to be preserved. the leaves are then coated by nail polish to print the leaves surface. the print observed with microscope to characterize the micromorphological characters. the descriptive analysis was done using the existing characters; to obtain the identification key. then cluster analysis used to generate two dendrogram for each observed macromorphological and micromorphological characters. dendrogram construction starts from character scoring and coding, calculation of similarity index with simple matching coefficient formula. description : a=number of second properties of data 1, b=number of properties of the first data 1 second data 0, c=number of properties of the first data 0 second data 1, d=number of properties of the second data 0 (verma and aggarwal, 2019). analysis are continued by constructing similarity matrix using mvsp 3.2a, and clustering with upgma algorithm. table 1. tobacco cultivars studied in this research no cultivar’s name location 1 ‘mantili’ parakan, temanggung, jawa tengah 2 ‘uler magetan’ parakan, temanggung, jawa tengah 3 ‘garut’ parakan, temanggung, jawa tengah 4 ‘gober boyolali’ parakan, temanggung, jawa tengah 5 ‘manila’ parakan, temanggung, jawa tengah 6 ‘virginia’ pleret, bantul, yogyakarta 7 ‘jawa’ pleret, bantul, yogyakarta 8 ‘siluk’ imogiri, bantul, yogyakarta 75 | santoso & purnomo; variation and phenetic relationship of tobacco table 2. scoring and coding of macromorphologicals characters of tobacco cultivars no characters score 1 habit herbs = 0, shrubs = 1 2 leaf position in stem alternate = 0, distichous = 1 3 leaf stipule absent = 0, stipula = 1 4 presence of petiole no = 0, yes =1 5 leaves apex acute = 0, attenuate = 1 6 leaves base truncate = 0, rounded = 1 7 leaves margin entire = 0, waved = 1 8 trichomes on leaves adaxial surface low = 0, moderate = 1 9 lamina shape ovate = 0, lanceolate = 1 10 leaves colour lighter shade= 0, darker shade = 1 11 petiole decurrent = 0, petiolate = 1 12 stomata position epistomatic = 0, amphistomatic = 1 13 leaves venation camptodromus = 0, penninerved = 1 14 stem based of shoots growth monopodial = 0, simpodial = 1 15 stem based of growth direction erect = 0, ascendens = 1 16 flower arrangement raceme = 0, panicle = 1 17 flower type simple = 0, compound = 1 18 flower position axillar = 0, terminal = 1 19 petal colour white = 0, pink = 1 20 sepal colour light green = 0, green = 1 21 corolla symmetry actinomorphic = 0, zygomorphic = 1 22 fruit shape round = 0, elliptical = 1 23 fruit color green = 0, brown = 1 table 3. scoring and coding micromorphologicals characters of tobacco cultivars no characters score 1 stomatal type anisositic = 0, parasitic = 1 2 stomatal length <40 µm = 0, >40 µm = 1 3 stomatal width <20 µm = 0, >20 µm = 1 4 stomatal density <40 individual/mm2 = 0, >40 individual/mm2 = 1 5 trichome’s gland shape round = 0, ellips = 1 6 glandular trichome yes = 0, no = 1 7 trichome length <400 µm = 0, >400 µm = 1 result and discussion morphological character variations the characterization results indicate variations in some characters. macromorphological characters include the shape of the leaf lamina, the base of the leaves, the presence of petiole, and the type of leaf venation. tobacco has anisocytic stomata and glandular type trichomes. morphological characters are commonly used in determining the taxon of organisms either genus, species, or more specifically (awan and murtaza, 2016). the distinctive macromorphological character of tobacco cultivars, is the presence of petiole in some types of cultivars. some cultivars have seated leaves, so the base of the leaves have wider size. this part has a distinctive wavy shape like a wing (figure 2). in contrast to tobacco cultivars with petiolated leaves, where leaf wings are absent. the petiolated leaves will be more rounded because the base of the leaves’ form a certain angle before meeting on the stalk. then the leaves width at the bottom is wider, so it is shaped like an egg. while seated leaves whose the lamina jurnal riset biologi dan aplikasinya, 3(2): 54-62, september 2021 |76 are elongated because the base the leaves’ base does not form a certain angle before meeting on the petiole. micromorphological character variations are quantitative such as stomata density. quantitative character measurements are taken in a certain range as the score. qualitative characters include stomata type, and the trichomes on the sample are likely uniform. stomata belong to anisocytic type where the stoma is surrounded by several neighbouring cells, that can be distinguished by the surrounding epidermis cells (dewi et al., 2015) (figure 3). this type of stomata is also commonly found in other solanaceae (awan and murtaza, 2016; fajri, 2013). the sample also has a uniform type of trichomes which is glandular (figure 4). figure 1. a) tobacco ‘mantili’, b) tobacco ‘uler magetan’, c) tobacco ‘garut’, d) tobacco ‘gober boyolali’, e) tobacco ‘manila’, f) tobacco ‘virginia’, g) tobacco ‘jawa’, h) tobacco ‘siluk’ figure 2. leaves wing on tobacco. w=wing. a b c d e f g h w w 77 | santoso & purnomo; variation and phenetic relationship of tobacco figure 3. anisocytic stomata. s : stoma, nb : neighboring cell. figure 4. glandular trichomes table 4. identification key for tobacco cultivars in central java and yogyakarta macromorphology micromorphology 1. a. leaves petiolate ............................................ 4 b. leaves sessile ................................................. 2 2. a. sessile, apex acute ...................................... ‘mantili’ b. sessile, apex attenuate ............................... 3 3. a. attenuate, lighter shade ............................ ‘garut’ b. attenuate, darker shade ............................. ‘gober boyolali’ 4. a. low trichomes ............................................. 5 b. moderate trichomes .................................... 6 5. a. low trichomes, lighter shade ................. ‘virginia’ b. moderate trichomes, darker shade ........ ‘manila’ 6. a. lamina ovate ................................................ ‘uler magetan’ b. lamina oblong .............................................. 7 7. a. oblong, lighter shade ................................ ‘siluk’ b. oblong, darker shade................................... ‘jawa’ 1. a. stomatal length <40 µm ........ ‘mantili’,‘garut’ b. stomatal length >40 µm ........ 2 2. a. stomatal width <20 µm ......... ‘jawa’,‘siluk’ b. stomatal width >20 µm.......... 3 3. a. stomatal density<40 µm2 ...... ‘manila’,’gober boyolali’ b. stomatal density <40 µm2...... ‘virginia’,’uler magetan’ glandular trichomes on leaves could produce certain secretaries for defence and metabolic aid processes (maryani et al., 2009). in contrast with non-glandular trichomes that are common to plant for defence agents (fajri, 2013). this variations makes the trichomes one of the characters used commonly in plant systematics. the variations of these characters are then arranged as identification key, to find out the distinctive character of each cultivars. a dendrogram then supports the identification key to determine its relationship (table 4). jurnal riset biologi dan aplikasinya, 3(2): 54-62, september 2021 |78 based on dendrograms cultivars samples have a similarity index ranging from 0.50 to 1.00 (figure 5). some cultivars have a similarity index close to 100% although planted in two different regions. 'manila' from central java is closely related to 'virginia' and 'java' from yogyakarta. the close relationship between cultivars grown in two different regions is caused by similar environmental conditions around the plants. the dendrograms show the existence of two clusters a and b based on the presence of petiole, and the density range of stomata. cluster a is a cultivar with petiolated leaves, and cluster b is the sessile leaves. the cluster a has stomatal density >40 ind/mm2, and cluster b has stomatal density <40 ind/mm2. in micromorphologys’ dendrogam the similarities bertween cultivars are 100%. this means that cultivars in each subclaster have high similar characters, thus its relationship are very close. both dendrograms show that the sample will have a closer relationship in one cluster, especially for cultivars that grow in one region such as 'java''siluk'. a lower similarity index means closer relationships with the sample such as 'java'-'manila'. the morphological characters used can also be used to group and know their relationship. the data can be used as a reference to choose iductess with high variation, that when crossed, could produce offspring with better quality for cultivation. figure 5. phenetic relationship dendrogram of tobacco cultivars in central java and yogyakarta based on morphological characters. a=macromorphology, b=micromorphology figure 6. a) petiolate leaves, b) sessile leaves a b 79 | santoso & purnomo; variation and phenetic relationship of tobacco conclusion tobacco cultivars that can be found include 5 cultivars in central java namely 'mantili', 'uler magetan', 'garut', 'scrooge boyolali', 'manila', and 3 cultivars in yogyakarta namely 'siluk', ‘java’, and 'virginia'. variations of morphological characters are used to construct dendrogram. dendrograms form two clusters (a and b) with the similarity index of each cluster above 0.80. cultivars with close relationships are 'siluk'-'java', and far related are 'java'-'manila'. acknowledgements we would like to thank for colaborative research of lecturer and students of faculty of biology, universitas gadjah mada, indonesia with contract number 1014/un1/fbi/ksa/pt.01.03/2021. references amelia, a.l. (2012). hasil kajian beberapa jenis tembakau di indonesia. agrosaint uki toraja. 3 (1), 243-251. arrijani. (2003). kekerabatan fenetik anggota marga knema, horsfieldia, dan myristica di jawa berdasarkan bukti morfologi serbuk sari. biodiversitas. 4 (2), 83-88. awan, a.a., & murtaza, g. (2016). anatomical studies on stomata of solanaceae from muzaffarabad division azad jammu andkashmir, pakistan. science international (lahore). 28 (5), 4701-4706. dewi, n.p.s.r., kriswiyanti, e., & sutara, p.k. (2015). hubungan kekerabatan 12 kultivar brokoli (brassica oleracea l.) berdasarkan karakter anatomi stomata. simbiosis. 3 (1), 291-300. djajadi, d. (2015). tobacco diversity in indonesia. journal of biological researches. 20 (1), 27-32. djumali. (2011). karakter agronomi yang berpengaruh terhadap hasil dan mutu rajangan kering tembakau temanggung. buletin tanaman tembakau, serat & minyak industri. 3 (1), 17-29. fajri, l. (2013). tipe trikoma dan stomata pada beberapa species hyptis (labiatae). eksakta 1, 14, 64-69. federizzi, l.c., carbonell, s.a.m., pacheco, m.t., & nava, i.c. (2012). breeders’ work after cultivar development the stage of recommendation. crop breeding and applied biotechnology. 2(2), 67-74. korir, n.k., han, j., shangguan, l., wang, c., kayesh, e., zhang, y., & fang, j. (2012). plant variety and cultivar identification: advances and prospects. critical reviews in biotechnology. 33(2): 111–115. maryani, prabawani, r.l., & daryono, b.s. (2009). struktur anatomi epidermis daun lima (cucumis melo l.) kultivar melon berdasarkan resistensinya terhadap jamur tepung (sphaerotheca fuliginea poll). biota.14 (2), 105-114. prasetiyo, a., djajadi, & sudarto. (2016). kajian produktivitas dan mutu tembakau temanggung berdasarkan nilai indeks erodibilitas dan kepadatan tanah. jurnal tanah dan sumberdaya lahan. 3 (2), 389399. verma, v., & aggarwal, r.k. (2019). a new similarity measure based on simple matching coefficient for improving the accuracy of collaborative recommendations. i.j. information technology and computer science. 11 (6), 37-49. jurnal riset biologi dan aplikasinya, volume 2, nomor 2, september 2020 analysis condition of coral reef covering in pramuka island waters, seribu islands using line intercept transect (lit) method analisis kondisi tutupan terumbu karang di perairan pulau pramuka, kepulauan seribu menggunakan metode line intercept transect (lit) rega permana*, nora akbarsyah, pringgo k. d. n. y putra, aulia andhikawati department of fisheries, faculty of fisheries and marine science universitas padjajaran abstract the coral reef ecosystem is one of the typical tropical ecosystems with high biodiversity which has an important role both biologically, ecologically, physically as well as socially and economically. several coral reef areas in indonesia were reported to have suffered damage, not only due to climate change which has an impact on rising sea surface temperatures and ocean acidification but also due to anthropogenic factors and irresponsible management of marine tourism. this study aimed to analyze the condition of coral reefs based on covering in pramuka island, which is one of the famous tourist destinations in the seribu islands. the study was conducted using line intercept transect (lit) method at predetermined coordinate points. the results showed that the dominant coral reef life form was acropora submassive (acs), namely 18.9%, and acropora branching (acb) as much as 12.48%. besides, the types of life forms found were coral foliase (9.42%), miliepora coral (9.2%), coral massive (4.8%), acropora encrustring (4.24%), and so on. based on the results of this study, it can be concluded that the condition of coral reefs in pramuka island is still relatively good with a total coral cover percentage of 72.38%. efforts to protect the coral reef ecosystem in this area need to be considered so that its condition can be maintained. abstrak ekosistem terumbu karang merupakan salah satu ekosistem khas kawasan tropis dengan keanekaragaman hayati tinggi yang memiliki peranan penting baik secara biologis, ekologis, fisika maupun sosial dan ekonomi. beberapa kawasan terumbu karang di indonesia dilaporkan mengalami kerusakan selain karena perubahan iklim yang berdampak pada naiknya suhu permukaan air laut dan pengasaman laut, namun juga karena faktor anthropogenic dan pengelolaan pariwisata bahari yang tidak bertanggung jawab. penelitian ini bertujuan untuk menganalisis kondisi terumbu karang berdasarkan penutupan di pulau pramuka yang merupakan salah satu pulau destinasi wisata di kepulauan seribu. penelitian dilakukan dengan menggunakan metode line intercept transect (lit) di titik koordinat yang telah ditentukan. hasil penelitian menunjukkan jenis terumbu karang yang mendominasi adalah acropora submassive (acs) yaitu sebanya 18.9% dan acropora branching (acb) sebanyak 12.48%. selain itu jenis life form yang ditemukan seperti coral foliase (9,42%), coral miliepora (9,2%), coral massive (4,8%), acropora encrustring (4,24%) dan lain sebagainya. berdasarkan hasil penelitian ini dapat disimpulkan bahwa kondisi terumbu karang di pulau pramuka masih tergolong baik dengan persentase total tutupan karang sebesar 72,38%. upaya penjagaan ekosistem terumbu karang di wilayah ini perlu diperhatikan supaya kondisinya dapat terus terjaga. how to cite: permana, r., akbarsyah, n., putra, p. k. d. n. y., & andhikawati, a. (2020). analysis condition of coral reef covering in pramuka island waters, seribu islands using line intercept transect (lit) method. jurnal riset biologi dan aplikasinya, 2(2): 77-81. *corresponding author: e-issn 2655-9927 jln. raya bandung sumedang km.21, hegarmanah, kec. jatinangor, kabupaten sumedang, jawa barat 45363 e-mail: rega.permana@unpad.ac.id jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi article history received : 11 september 2020 approved : 25 september 2020 published : 30 september 2020 keywords: coral reef, line intercept transect, seribu islands kata kunci: terumbu karang, line intercept transect, kepulauan seribu 78 | permana et al. analysis condition of coral reef covering in pramuka island waters introduction coral reef ecosystem is one of the ecosystems with the highest biodiversity among other ecosystems (adey, 2000). in addition, this ecosystem also plays an important ecological role, both biologically and physically as a barrier protective for coastal areas (moberg & forke, 1999; dahuri, 2000). currently, coral reef ecosystems, especially in tropical waters, face various threats, such as the impact of climate change, namely an increase in sea water temperature and ocean acidification which causes coral bleaching (baker et al., 2008). in addition, anthropogenic impacts resulting from human activities are also a threat factor for coral reef ecosystems, including chemical pollution, use of non-environmentally friendly fishing gear and irresponsible tourism activities (edinger et al., 1998; jones, 2007; biggs, 2011). indonesia is one of the countries with the most extensive coral cover in the world, especially in the eastern part of indonesia where there is the center of the coral triangle (coral triangle center) together with five other countries, namely malaysia, the philippines, papua new guinea, timor leste and the solomon islands (clifton, 2009). based on geographic information obtained from satellites, the total area of coral reefs in indonesia is around 2.5 million hectares (hadi et al., 2009). of the total area, only about 6.56% were in the very good category while the rest were in the good category (22.96%), moderate (34.3%) and bad (36.18%). although there are still many local coral reef communities showing very rapid recovery, various surveys show that average live coral cover is decreasing periodically. this is because disturbance or threats to coral reefs are almost always faster than their recovery rate. the seribu islands cluster which is located in dki jakarta province, especially pramuka island, which is the center of administrative activities in the seribu islands, has been reported to experience high environmental pressure, especially from waste pollution and tourism. according to research conducted by suhery et al. (2017), the coral reef ecosystem on pramuka island was in the medium category in the context of vulnerability to oil spills. this was based on the location of the island, which was in the route of tanjung priok port and the indonesian archipelago sea channel i (alki i). therefore, this study aimed to determine the condition of coral reefs in pramuka island as seen from their cover through the method line intercept transect (lit). apart from being relatively easy, this method has also been widely used in the analysis of the condition of coral reef ecosystems (sarbini et al., 2016; wahib, 2019). materials and methods the research was conducted using the method line intercept transect (lit) along 50 meters at a depth of 3-6 meters consisting of one transect. determining the location of the observation station based on purposive sampling technique. the research used manta tow method, which was conducted by snorkeling around the observation location to determine the data collection point (sukmara et al., 2001). observations were then carried out along the 50-meter transect by recording the types of life forms found. the types of life form observed include: coral foliose (cf), acropora submassive (acs), acropora branching (acb), coral milepora (cme), coral massive (cm), acropora encrusting (ace), coral encrusting (ce), coral submassive (cs), acropora digitate (acd), coral tubipora (ctu), coral mushroom (cmf) and also life forms other than coral,namely sponge (sp), rubble (rb), dead coral (dc), and dead coral with algae (dca) (unep, 1993). calculation of coral reef cover is then continued by calculating the area of cover using a simple mathematical equation, namely: furthermore, the percentage of live coral cover is categorized according to the coral reef condition category according to yuliani et al. (2016) which are divided into five categories, namely: (1) very bad category: 0 10% (2) bad category: 11 30% (3) medium category: 31 50% (4) good category: 51 75% (5) very good category: 76 100% results and discussion the condition live coral on the coast of pulau pramuka, seribu island with the lit method, found the percent life coral life form value of 72.38% which is in the good category for the distribution of corals along the transect line, which is about 50 m. from the data obtained, the percentage value of coral cover from the most consecutive was acropora submassive (acs) with a value of 18.9% and acropora branching (acb) with a value of 12.48%, after that coral foliose (cf) which looks jurnal riset biologi dan aplikasinya, 2(2), 77-81, september 2020 | 79 like a sheet leaves with a value of 9.42%, then coral milepora (cml) or fire coral which can be recognized by the presence of a yellow color at the end of the colony, amounting to 9.2%, coral mushroom (cmf) 4.88%, coral massive (cm) 4.8%, acropora encrusting (ace) 4.24%, coral milepora (cme) 3.86%, dead coral still covered with algae (dca) by 3.44%, other types of organisms ( ot) such as sea urchins as much as 2.34%, as for dead corals (dc) as much as 1.9%, then there is coral encrusting (ce) 1.8%, coral submassive (cs)1.72%, acropora digitate (acd) 1%, sponge (sp) 0.9%, coral tubipora (ctu) 0.08%, and rubble (rb) 0.04%. the cover of all life forms observed, both living and not visible in table 1. table 1. observation results of life form at pramuka island beach, seribu islands. life form total length (m) percentage (%) cf 4.71 9.42 cml 4.6 9.2 cmf 2.44 4.88 cm 2.4 4.8 cs 0.86 1.72 cme 1.93 3.86 ce 0.9 1.8 ctu 0.04 0.08 ace 2.12 4.24 acd 0.5 1 acb 6.24 12.48 acs 9.45 18.9 rb 0.02 0.04 dc 0.95 1.9 dca 1.72 3.44 ot 1.17 2.34 sp 0.45 0.9 the dominant coral type in a habitat depends on environmental conditions or the habitat where the coral lives (daniel & santosa, 2014). in habitat, the type of coral that is alive can be dominated by a certain type of coral. it can be seen that the live corals that dominate the pramuka island waters are acropora sub massive (acs) and acropora branching (acb). this was influenced by environmental conditions that are not far from the coastline, where this area usually gets higher environmental pressure such as currents and strong waves and pollution from the land. besides, at this location, the condition of the ecosystem is still good and the type of hard substrate is still supportive and there is nocover sand (s) which can cause poor sedimentation because the sand when exposed to high currents will carry a substrate that can bury coral reefs (adriman et al., 2013). because the type of acropora grows in clear waters and there are wave breaks (sembiring & trianto, 2018). the results of the average percentage of live coral cover in pramuka island, kepulauan seribu can be seen in figure 1. figure 1. analysis of the percentage of coral cover live in pramuka island waters the current parameter at the research location is quite high because it is influenced by the conditions of its open waters and strong winds. the existence of currents and waves in the waters is very important for the survival of coral reefs. the current is needed to bring food in the form of plankton; besides that, it also cleans itself from sediments and to supply oxygen from the free sea. therefore, growth in a place where the water is constantly being stirred up by currents and waves is preferable to calm, sheltered waters. the appearance of dead coral with algae (dca) can be predicted that the dead coral is a type of coral that cannot adapt to strong currents. the emergence of sponges (sp) can also be a serious threat, although only 0.9% were identified, because they live on corals and become coral “drillers” (tioho & roeroe, 2002). several species are dangerous endolites that can damage coral reefs. in addition to their ability to "drill" sponge coral, they also produce siphonodictine compounds, which can inhibit the growth of coral polyps (sullivan et al, 1983). in addition, there are also coral fractures around the transect, the existence of coral fractures at this dive station is thought to be caused by high 80 | permana et al. analysis condition of coral reef covering in pramuka island waters boat traffic along the area, the release and towing of anchors who do not pay attention to the presence of corals and the behavior of divers who easily break the coral. all of these activities fall into the anthropogenic category, namely damage caused by humans. human threats to coral reefs can be detected by looking at visible indications and possible treatments. threats to the coral reef ecosystem can also be caused by natural factors. threats by nature can include hurricanes, tsunami storms, earthquakes and global warming that causes coral bleaching. in addition, predation by cot (crown-of-thorns starfish) can also be a threat to coral reefs (vogler et al., 2008). to support the sustainable use of corals, artificial coral breeding can be carried out by endeavoring for conservation, including by performing coral transplants. conclusion it can be concluded that the condition of coral reefs in pramuka island was classified as good with a percentage of coral cover of 72.38%. the type of coral reef that dominates was acropora submassive (acs), which was 18.9% and acropora branching (acb) at 12.48%. in addition, other types of coral were also found such as coral foliose (cf), coral milepora (cml) or fire coral, cmf, massive coral (cm), acropora encrusting (ace), cme or the same as cml, namely milepora coral, dead coral which are still covered with algae (dca), other types of organisms (ot) such as sea urchins, as for dead corals (dc), coral encrusting (ce), coral submassive (cs), acropora digitate (acd), sponge (sp), coral tubipora (ctu), and rubble (rb). references adey, w. h. (2000). coral reef ecosystems and human health: biodiversity counts! ecosystem health, 6(4), 227236. 10.1046/j.1526-0992.2000.006004227.x. adriman, purbayanto, a., budiharso, s., & damar, a. (2013). pengaruh sedimentasi terhadap terumbu karang di kawasan konservasi laut daerah bintan timur kepulauan riau. berkala perikanan terubuk, 41(1), 90– 101.https://doi.org/http://dx.doi.org/10.31258/teru buk.41.1.90-101. baker, a. c., glynn, p. w., & riegl, b. (2008). climate change and coral reef bleaching: an ecological assessment of long-term impacts, recovery trends and future outlook. estuarine, coastal and shelf science, 80(4),435-471. https://doi.org/10.1016/j.ecss.2008.09.003. biggs, d. (2011). understanding resilience in a vulnerable industry: the case of reef tourism in australia. ecology and society, 16(1). https://doi.org/10.5751/es-03948-160130 clifton, j. (2009). science, funding and participation: key issues for marine protected area networks and the coral triangle initiative. environmental conservation, 36(2), 91–96. https://doi.org/10.1017/s0376892909990075. dahuri, r. (2000). kebijakan dan strategi pengelolaan terumbu karang indonesia. prosiding pengelolaan dan iptek terumbu karang indonesia, 1-16. daniel, d., & santosa, l. w. (2014). karakteristik oseanografis dan pengaruhnya terhadap distribusi dan tutupan terumbu karang di wilayah gugusan pulau pari, kabupaten kep. seribu, dki jakarta. jurnal bumi indonesia, 3(2). http://lib.geo.ugm.ac.id/ojs/index.php/jbi/article/vie w/594/567 edinger, e. n., jompa, j., limmon, g. v., widjatmoko, w., & risk, m. j. (1998). reef degradation and coral biodiversity in indonesia: effects of land-based pollution, destructive fishing practices and changes over time. marine pollution bulletin, 36(8), 617–630. https://doi.org/10.1016/s0025-326x(98)00047-2 hadi, t. ., giyanto, prayudha, b., hafizt, m., budiyanto, a., & suharsono. (2009). terumbu karang indonesia. 39. http://oseanografi.lipi.go.id/haspen/buku status karang 2018 digital.pdf. jones, r. j. (2007). chemical contamination of a coral reef by the grounding of a cruise ship in bermuda. marine pollution bulletin, 54(7): 905-911. https://doi.org/10.1016/j.marpolbul.2007.02.018. moberg, f., & folke, c. (1999). ecological goods and services of coral reef ecosystems. ecological economics, 29(2), 215-233. https://doi.org/10.1016/s09218009(99)00009-9 sarbini, r., kuslani, h., & nugraha, y. (2016). teknik pengamatan tutupan terumbu karang dengan menggunakan transek garis (line intercept transect) di pulau kumbang kepulauan karimun jawa. buletin teknik litkayasa, 14(1), 33–42. https://doi.org/http://dx.doi.org/10.15578/btl.14.1. 2016.33-42 sembiring, y. b., & trianto, a. (2018). studi densitas dan komposisi jenis juvenil karang pada substrat pecahan karang di perairan pulau sambangan , karimunjawa. journal of marine research, 7(4), 248– 256.https://ejournal3.undip.ac.id/index.php/jmr/arti cle/view/25923/23113 suhery, n., damar, a., & effendi, h. (2017). indeks kerentanan ekosistem terumbu karang terhadap tumpahan minyak" kasus pulau pramuka dan pulau belanda di kepulauan seribu. jurnal ilmu dan teknologi kelautan tropis, 9(1), 67–90. https://journal.ipb.ac.id/index.php/jurnalikt/issue/vi ew/1919. sukmara, a., siahainenia, a. ., & rotinsulu, c. (2001). panduan pemantauan terumbu karang berbasismasyarakat dengan metoda manta tow (i). https://www.crc.uri.edu/download/man_0033.pdf. https://www.researchgate.net/deref/http%3a%2f%2fdx.doi.org%2f10.1046%2fj.1526-0992.2000.006004227.x jurnal riset biologi dan aplikasinya, 2(2), 77-81, september 2020 | 81 sullivan, b., faulkner, d. j., & webb, l. (1983). siphonodictidine, a metabolite of the burrowing sponge siphonodictyon sp. that inhibits coral growth. science, 221(4616), 1175-1176. 10.1126/science.221.4616.1175. tioho, h., & roeroe, k. a. (2002). kerusakan terumbu karang akibat proses biologis. ekoton, 2(1), 55–59. https://ejournal.unsrat.ac.id/index.php/ekoton/ar ticle/view/263/209 vogler, c., benzie, j., lessios, h., barber, p., & wörheide, g. (2008). a threat to coral reefs multiplied? four species of crown-of-thorns starfish. biology letters, 4(6), 696– 699. https://doi.org/10.1098/rsbl.2008.0454 wahib, n. k. (2019). kajian efektivitas penggunaan metode lit, pit, dan qt untuk monitoring tutupan substrat. jfmr-journal of fisheries and marine research, 3(3), 331–336. https://doi.org/10.21776/ub.jfmr.2019.003.03.7 yuliani, w., ali, m., & saputri, m. (2016). pengelolaan ekosistem terumbu karang oleh masyarakat di kawasan lhokseudu kecamatan leupung kabupaten aceh besar. jurnal ilmiah mahasiswa pendidikan biologi, 147(1), 11–40. jurnal riset biologi dan aplikasinya, volume 2, nomor 2, september 2020 the phenetic relationship of ferns (polypodiaceae) at the ascent of cemoro kandang, mount lawu hubungan kekerabatan tumbuhan paku famili polypodiaceae di pendakian cemoro kandang, gunung lawu advend sri rizki sianturi* science education department, universitas negeri semarang abstract the fern is one of the highly diverse vascular plant species, which has a unique characteristic. the closely related at the family level because the genera within each family have some uniformity so that the relationship and groupings cannot be distinguished. one example of a diverse fern family is polypodiaceae. consequently, it is necessary to simplify the classification; one of them is through phenetic relationship analysis. this study aimed to analyze the phenetic relationship of the polypodiaceae ferns in climbing cemoro, mouth lawu enclosure, karangayar regency, based on the similarity index on the dendogram. the data were collected using the exploration method and the sporophyte morphological characters were observed. the observations obtained 13 variations of characters. the relationship analysis was carried out with the hierarchical cluster program using spss 23. there were six species found from the polypodiaceae family, there were including belvisia mucronata, goniophlebium sp, lepisorus sp, pyrrosia piloselloides, crypsinus taeniatus and drynaria sparsisora. the finding suggests that six species are divided into two clusters, the group i consisting of goniophlebium sp, lepisorus sp, lepisorus sp, and pyrrosia pilloselloides with a similarity coefficient index of 53% and group ii consisting of drynaria sparsisora, goniophlebium sp, and pyrrosia piloselloides with a similarity index of 46%. abstrak tumbuhan paku salah satu spesies tumbuhan vaskular yang memiliki keragaman tinggi. kedekatan kerabatan pada tingkat famili dikarenakan antara genus dalam tiap famili memiliki beberapa keseragaman, sehingga tidak bisa dibedakan pengelompokannya. salah satu contoh famili tumbuhan paku yang memiliki keragaman adalah polypodiaceae. penelitian ini bertujuan untuk mendeskripsikan hubungan kekerabatan secara fenetik tumbuhan paku famili polypodiaceae di pendakian cemoro kandang gunung lawu, berdasarkan indeks kesamaan pada dendogram. pengumpulan data dilakukan menggunakan metode eksplorasi dan dilakukan pengamatan karakter morfologi sporofit. hasil penelitian diperoleh 13 macam karakter. analisis hubungan kekerabatan dilakukan dengan program hierarchial cluster menggunakan spss 23. terdapat enam spesies yang ditemukan dari famili polypodiaceae di antaranya belvisia mucronata, goniophlebium sp, lepisorus sp, pyrrosia piloselloides, crypsinus taeniatus dan drynaria sparsisora. hasil penelitian menunjukkan bahwa keenam spesies tersebut terbagi menjadi dua klaster, yaitu kelompok i terdiri atas goniophlebium sp, lepisorus sp, dan pyrrosia pilloselloides dengan indeks koefisien kesamaan 53% dan kelompok ii terdiri atas drynaria sparsisora, goniophlebium sp, dan pyrrosia piloselloides dengan indeks kesamaan 46%. how to cite: sianturim a.s.r. (2020). the phenetic relationship of several species of ferns in the polypodiaceae family based on morphological characters on the ascent of cemoro kandang, mount lawu. jurnal riset biologi dan aplikasinya, 2(2): 64-69. *corresponding author: e-issn 2655-9927 jln. sekaran, gunung pati, semarang city, central java 50229 e-mail: advendsririzky@gmail.com jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi article history received : 2 september 2020 approved : 24 september 2020 published : 30 september 2020 keywords: relationship, fern, polypodiaceae, sporophyte morphological kata kunci: kekerabatan, tumbuhan paku, polypodiaceae, morfologi sporofit 65 | sianturi; the phenetic relationship of several species of ferns in the polypodiaceae introduction indonesia is one of the countries that has the highest biodiversity in the world, both plant and animal diversity. one of the species of plant division found in indonesia is ferns (pteridophyta). the number of pteridophyta species in indonesia was 2,197 species and the latest study results in the last 2019 showed that the pteridophyta in indonesia reached 1,611 taxa from 37 families (nurchayati, 2007). this amount is obtained when using the classification basis used in the herbarium bogoriensa (wijayanti et al., 2015). the fern is a division that has corms, meaning that its body can differentiated into three main parts, namely roots, stems, and leaves. besides, this plant also has a vessel/file system in the form of xylem and phloem, which is not found in moss. roots in ferns are like fibers and the ends are protected by calyptra (root caps). the stems of most ferns are not visible because they are in the soil in the form of rhizomes/rhizomes (holtum, 1959). ferns have unique characteristics in sporophyte and gametophyte generation, which is mutually independent. one of the ferns’ unique characteristics lies in the morphological character of the sporophyte, which is used as a determinant of ferns in terms of shape, size, location, and spores’ types (suryadi et al., 2020, apriyanti et al., 2017). ferns are very heterogeneous when viewed in terms of habitus and way of life. based on the habit, there are a few species of ferns with small leaves and a very simple structure. on the others, there were large with leaves that could reach up to two or more with a complex structure. based on the way of life, there are species of ferns that live on the ground (terrestrial), some live on other plants (epiphytes), and also water ferns (hygrophytes). ferns tend to like shady places with a high degree of humidity and cannot stand it. in conditions with limited water availability. there are five families of pteridophytes with the largest proportion included polypodiaceae, thelypteridaceae, pteridaceae, hymenophyllaceae, and cyatheaceae families, which cover almost 50% of the total diversity (tjitrosoepomo, 1993). this value has decreased significantly from the previous pteridophyte diversity data, considering that this time information on the status of scientific names is more widely available and the progress of taxonomic revisions is quite rapid. however, it should be noted that there are still many species richness or taxa under species that have not been revealed and recorded, both their identity and presence in the archipelago. the diversity of ferns is very large in nature, so that ferns are one of the plants that cannot be separated from the effort to simplify the object of study. ferns are the most primitive vascular plants than other vascular plants. the fern has gone through various stages of evolution from the devonian to the present. however, research on the classification and relationship of pteridophyta has not been widely carried out, however, only a few studies on fern relationship have been conducted (nurchayati, 2007). ferns play important roles in maintaining the forest ecosystem (suryadi et al., 2020), therefore, it is required to improve conservation and inventory of relationship to prevent biodiversity extinction. phenetic relationship is a pattern of relationship or total similarity between groups based on their certain characteristics from each group. ferns are often found in humid areas such as mountain areas. one of the habitat ferns is mount lawu, or gunung lawu, this mount massive compound stratovolcano, straddling the border between central java and east java, indonesia. mount lawu has an important function for the protection of natural resources and ecosystems. this area is a buffer zone that limits the distribution of dry-type ecosystems in eastern java and wet-type ecosystems in western java. the high diversity of ferns is caused by environmental factors where the elevation of the area increases, the soil condition changes. according to krebs (1985), soil moisture affects the geographic distribution of most trees in mountain forests and affects the content/ availability of groundwater where the relationship with temperature can affect the balance of plant water. other environmental factors that affect the growth of ferns are temperature, air humidity, soil ph, and light intensity. materials and methods this study was conducted in the cemoro kandang hiking trail, mount lawu, karangayar regency, central java province. the parameters used in the study were morphological characteristics of habitat, stems, roots, leaves, and sorus. the steps of data collection were as follows. (a) the morphological observation of the species include habitat (the type of habitat), stem (color and fiddlehead; color, shape, and stipe characteristics; color and shape of the rachis surface), leaf (type, jurnal riset biologi dan aplikasinya, 2(2), 64-69, september 2020 | 66 location, structure, shape, venation, and costa), root (rhizome and rhizoid) and sorus (location, shape, and color). (b) designing observation table (table of operational taxonomy unit) by providing numeric symbols. the description of operational taxonomy unit feature can be described as number 0 if the feature does not have number 1 as well as if the observed characteristics are in that type. (c) perform calculations using the spss program in the observation table. (d) the determination of the relationship between the ferns of the polypodiaceae family was carried out by measuring the similarity or similarity index (is) and measuring the dissimilarity or dissimilarity index (id) using the following formula: (is) = (hasanuddin & fitriana, 2014) note: id = dissimilarity index is = similarity index ∑c= number of the same characteristics in individuals being compared ∑a = number of individual characteristics a ∑b = number of individual characteristics b analysis of sample data that has been identified in accordance with operational taxonomy unit was then analyzed using taxonomic distance formula to identify the relationship, which will be presented in the form of dendogram. the observed morphological characteristics of ferns consisted of several types (table 1). the sporophyte morphological character data were analyzed using a phenetic approach using the spss 23 hierarcial cluster dendogram program. results and discussion the ferns was found and identified on mount lawu, the cemoro kandang hiking trail consists of 15 families including gleiheniaceae, woodsiaceae, vittariaceae, pteridiaceae, nepheolepidaceae, davalliaceae, polypodiaceae, marattiaceae, lycopodiaceae, dennstaedtiaceae, dipteridaceae, blechnaceae, adiantacea, distributed in 33 species. the highest number of species found were in the polypodiaceae family as many as 6 species. the relationship of several species of ferns in the polypodiaceae family of other species has been previously studied at the purwodadi botanical garden, pasuruan. table 1. list of characters for phenetic analysis of family polypodiaceae no. character character code 1. habitat terrestrial (0), epiphytic (1) 2. leaf single or pinnatifid (0), leaves1 pinnate (1) 3. leaf margins flat (0), pinnatifid (1) 4. build leaves lanset (0), elliptical-lancet (1) 5. leaf shape monomorphic (0), dimorphic (1) 6. rhizome t upright (0), creeping (1) 7. sorus small circle, near midrib (0), linear, marginal (1) 8. sorus location on the lower surface of the leaf, varies (0), at the tip of the fertile leaf spike (1), 9. sorus form sorus linear, ablique, extending from midrib to margin (0), sorus round, forming a single row to several irregular rows (1) 10. sorus size sorus until 2/3 of the leaves are towards the base (0), sorus until ½ 1/3 towards the apex (1) 11. sorus diameter less than 0.1 cm (0), less than 0.2 cm (1) 12. sorus arrangement forming irregular, rather dense (0), regular sorus (1) 13. leaf species there are 1 species, leaves foliage (0), there are 2 species of leaves, nest leaves and foliage leaves (1) 67 | sianturi; the phenetic relationship of several species of ferns in the polypodiaceae the results showed that adiantum caudatum was related to nephrolpeis falcate with a similarity coefficient of 66.7% (nurchayati, 2016). the results of sporophyte morphological observations of the sporophyte family of the polypodiaceae gunung lawu climbing cemoro kandang were obtained as follows: belvisia mucronata epiphytic, short creeping rhizomes, growing 46 tightly, dense scaly, 3 cm long stype, linear lanceolata leaves, single, sterile leaves 15-18 cm long, 2 cm wide, shrinking at the base and tip, curling at the margins, narrowing at junction with fertile leaf, short winged towards the stipe, veins generally not clear, midrib visible on both surfaces, sorus at apical fertile leaf, linear shape with tapered tip, 12 cm long, 0.4 cm wide, sporangium covering the abaxial leaves except midrib (figure 1.a). crypsinus taeniatus terrestrial, creeping rhizome, dense scaly, scales taper slowly to the apex, pale brown, slightly dark in the middle, flat edges slightly jagged, stipe 15-30 cm; pinnate leaf, 30 40 cm long, with 7-10 pairs of pinna, narrow ellipse shape, long apex acuminate, thickened edges, with short serrations of each main vein, round sorus, forming a single row between midrib and pina edge, slightly raised adaxial, a diameter of 2 3 mm. the sporangium is reddish brown in color (figure 1.b). drynaria sparsisora epiphyte, erect rhizome, short scaly, tapering from the round base, stiff, deciduous after growing leaves (base leaves / nest leaves and foliage leaves), dense, short scaly, shrinking, from apex to ovate, dimorphic leaves, foliage, pinnatifid, length 60-70 cm including stipe, sorus generally small, in regular rows, always with irregular space between rows (figure 1.c). goniophlebium sp epiphyte, creeping rhizome, white chalky surface, scaly young part, light brown scales, slightly jagged edges, pinnate leaves, 0.7 cm in diameter, brown, slightly scaly stipe and rachis. sorus forms a single row on each side of the midrib, between the veinlets, the hollow, shallow, yellowish sporangium (figure 1.d). lepisorus sp epiphytic, rhizome spreads long, grows 2 rows of leaves, 1 cm apart, dense scaly, 4 6 cm long, wingless, fertile leaf type is longer than fertile leaves, dark brown scaly at the base, single lamina, 10 12 long cm, 2 cm wide, sorus forms a single row at each midrib, round, 2 mm in diameter, brown sinks in the cavity, adaxial embossed (figure 1.e). pyrrosia pillosellides epiphytes, creeping rhizomes, small scales with long hairy edges, no stype on sterile leaves, 1 cm long fertile leaves, 3-6 cm long sterile leaves, and 1 cm wide, close to blat, sometimes elliptic widened, crossed, tapers slowly to base, wide round apex, very fleshy texture, smooth surface, scattered stellate hairs, clear midrib on half of the leaves from the base, 3-6 cm long and 0.8 cm wide fertile leaves, tapers slowly to the base, wide round apex, very fleshy texture, sorus forms a wide band at the marginal, present in a semicircle from the apex to almost near the base (figure 1.f). figure 1. a) belvisia mucronata; b) crypsinus taeniatus; c) drynaria sparsisora; d) goniophelebium sp; e) lepisorus sp; f) pyrrosia pillosellides a b c d e f jurnal riset biologi dan aplikasinya, 2(2), 64-69, september 2020 | 68 figure 2. dendogram of six species of ferns, family polypodiaceae. a = belvisia mucronata; b = crypsinus taeniatus; c = drynaria sparsisora; d = goniophlebium sp; e = lepisorus sp; f = pyrrosia pillosellides the results of the dendogram construction using 13 morphological features showed that the six species of ferns found were divided into two main clusters, namely cluster i consists of goniophlebium sp, lepisorus sp, and pyrrosia and cluster ii consists of drynaria sparsisora, goniophlebium sp, and pyrrosia piloselloides. the following is the dendogram of the results of cluster analysis of 6 plant species that have been analyzed for their morphological characterization. based on the calculation of the similarity index, goniophlebium sp is closely related to lepisorus sp at a similarity coefficient of 53% and also lepisorus sp is closely related to pyrrosia piloselloides at a coefficient of 53%. drynaria sparsisora and goniophlebium sp are closely related to pyrrosia piloselloides with a similarity coefficient of 46%. then followed by crypsinus taeniatus which is related to goniophlebium sp, lepisorus and pyrrosia piloselloides with a similarity index of 38%. belvisia mucronata is closely related to lepisorus sp and pyrrosia. in addition, the influence of diversity in a type is caused by two factors, namely the environment and traits inherited by genetics (chao & huang, 2018). group i consisted of goniophlebium sp, lepisorus sp, and pyrrosia pillosellides. those that are united based on the same habitat are epiphytes, creeping rhizomes, and have scales on the rhizomes. group ii consisted of drynaria sparsisora, goniophlebium sp, and pyrrosia piloselloides which were united by habitat type characteristics, rhizomes and spore arrangement that were single rows in each midrib sequence. in accordance with the opinion of radford (1986), the closely relationship can be seen by the number of similarities in characters or characteristics, so they have a kinship with a greater similarity coefficient, hence the relationship is closer. this is same opinion with (vasco et al., 2013) opinion that the classification is based on the characters’ correlation so that two plants that have similar characteristics are considered closely relationship than two plants that have few characters in common. based on the dendogram above, a grouping system can also be made among species in the polypodiaceae family based on their relationship. while, apriyanti et al. (2017) stated that more similarities of characteristics they have, the smaller the number of taxonomic distance value based on plant combinations. besides that, it was concluded that the grouping based on the percentage of similarity of qualitative and quantitative characters observed produce a picture of the position of each accession in a dendrogram, generic distance values as well as showing the closeness of relationships or the similarity of characters between accessions. references apriyanti, n., jaya santri, d., & madang, k. (2017). identifikasi tumbuhan paku (pteridophyta) dan kekerabatannya di kawasan air tejun curup tenang bedegung kecamatan tanjung agung kabupaten muara enim. jurnal pembelajaran biologi, 5(2), 113– 69 | sianturi; the phenetic relationship of several species of ferns in the polypodiaceae 116. https://doi.org/identifikasi tumbuhan paku (pteridophyta) dan kekerabatannya di kawasan wisata air terjun curup tenang bedegung kecamatan tanjung agung kabupate muara enim. chao, y. s., & huang, y. m. (2018). spore morphology and its systematic implication in pteris (pteridaceae). plos one, 13(11), 1–22. https://doi.org/10.1371/journal.pone.0207712. fitriana, h. &. (2014). hubungan kekerabatan fenetik 12 spesies anggota familia asteraceae. jurnal edubio tropika, 2(2), 202–205. http://www.jurnal.unsyiah.ac.id/jet/article/view/5 260/4406. holttum, re 1959. flora melesiana, series ii pteridophyta. fern and allies. neterland: new york botanical garden. https://doi.org/10.5962/bhl.title.41457 krebs. 1978. ecology. the experimental analysis of distribution and abudance. london: harper and row publisher. radford, ae 1986. frundamnetal of plant systematic. harper and row publisher inc. new york. nurchayati, n. (2007). hubungan kekerabatan beberapa spesies tumbuhan paku familia polypodiaceae dari karakter morfologi sporofit dan gametofit. jurnal ilmiah progressif, 7(19), 9–18. https://www.google.com/url?sa=t&rct=j&q=&esrc= s&source=web&cd=6&cad=rja&uact=8&ved=0cem qfjaf&url=http://untagbanyuwangi.ac.id/attachments/article/339/hubunga n kekerabatan beberapa spesies tumbuhan paku .pdf&ei=c1ujvddhksyouatf4gqaq&usg=afqjc suryadi, muhibuddin, hasanuddin, samingan, & nurmaliah, c. (2020). phenetic kinship of eight ferns from filicinae class based on morphological and anatomical characteristic. journal of physics: conference series, 1460(1), 0–6. https://doi.org/10.1088/17426596/1460/1/012077. tjitrosoepomo, g. 1993. general taxonomy (basic plant taxonomy). yogyakarta: gadjah mada university press. vasco, a., moran, r. c., & ambrose, b. a. (2013). the evolution, morphology, and development of fern leaves. frontiers in plant science, 4(sep), 1–16. https://doi.org/10.3389/fpls.2013.00345. wijayanti, l.,mahmudati, l., prihanta, w. (2015). studi kekerabatan fenetik genus pteris dengan metode taksimetri. prosiding seminar nasional pendidikan biologi 2015, yang diselenggarakan oleh pendidikan biologi fkip universitas muhhamadiyah malang, 1–10. https://pdfs.semanticscholar.org/faec/bdf4ebb723c96 b6146c4195339d179d2488b.pdf. 1 | rizkiah et al.; distribution patterns of exotic plant chromolaena odorata (l.) jurnal riset biologi dan aplikasinya, volume 3, issue 1, march 2021 distribution patterns of exotic plant chromolaena odorata, in rehabilitation zone at donglo block, resort of wonoasri, meru betiri national park dwi wardatul rizkiah, arif mohammad siddiq, hari sulistiyowati * biology department, faculty of mathematics and natural sciences, universitas negeri jember jln. kalimantan 37, jember, east java 68121, indonesia *corresponding author: e-mail: sulistiyowati.fmipa@unej.ac.id article history abstract received : 7 february 2021 exotic plants are plants that are introduced intentionally or unintentionally from their original habitat to a new habitat. one of the exotic plants that is potentially invasive is chromolaena odorata. these plants are found a lot especially in the rehabilitation zone at donglo block resort of wonoasri, meru betiri national park (mbnp). an initial effort to determine whether this exotic plant was potentially invasive was to use the distribution pattern of a plant population. this study aimed to determine the distribution pattern and area of cover of exotic plants c. odorata in rehabilitation zone at donglo block, resort of wonoasri mbnp. the sampling of c. odorata used the transect plot method systematically, which carried out in donglo block resort of wonoasri mbnp. data analyzed using morisita index. the map of distribution pattern of c. odorata was created using the geographic information system (gis). based on the results of the morisita index, the value (iδ) = 12.39, which means that c. odorata has a clumped distribution pattern. the distribution pattern of c. odorata can also be seen from the visualization of the spatial distribution map, which shows that the growth of c. odorata in plants or overlaps with each other, hence that it looks clustered. the coverage area of c. odorata in the study location was 596,5 m2 or 29.24% of the total area of the study (20,400 m2). based on the results of the coverage area of c. odorata, it was indicated that this exotic species is not yet classified as an invasive species in the area. revised : 7 march 2021 approved : 22 march 2021 published : 31 march 2021 keywords chromolaena odorata; distribution pattern; exotic plants; meru betiri national park how to cite: rizkiah, d.w., siddiq, a.m., & sulistiyowati, h. (2021). distribution patterns of exotic plant chromolaena odorata (l.) in rehabilitation zone at donglo block, resort of wonoasri, meru betiri national park. jurnal riset biologi dan aplikasinya, 3(1):1-6. doi: https://doi.org/10.26740/jrba.v3n1.p1-6. introduction exotic plants are plants that are introduced intentionally or unintentionally from their native habitat to a new habitat (radiansyah et al., 2015). exotic plant species with competitive characters develop faster than native plant species and can become invasive in the future (syah & arbain, 2019). exotic plant species at a higher rate than native plants, and becoming invasive if these plants dominate in their new habitats. this is because exotic plants can absorb more energy and solar energy, which results in a higher growth rate compared to native plant species. one of the exotic plants that is potentially invasive is chromolaena odorata (yuliana & lekitoo, 2018). the type of c. odorata is known by the indonesian people as kirinyuh which is an annual woody herbaceous plant (oktary et al., 2015). this plant is a wild plant that grows well in places with sufficient light, especially in open areas, edges of plantations, grasslands, and forests. one of the areas where kirinyuh plants are found in the meru jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi mailto:sulistiyowati.fmipa@unej.ac.id https://doi.org/10.26740/jrba.v3n1.p1-6 jurnal riset biologi dan aplikasinya, 3(1): 1-6, march 2021 | 2 betiri national park (mbnp), as explained by (susilo, 2018) that kirinyuh is an exotic plant species found in many of these conservation areas. according to (suryawan et al., 2015) that the national park is a biological conservation area where exotic plants are not recommended which could threaten the conservation of native species. based on the results of the 2020 survey, c. odorata is one of the exotic plant species found in various areas of the mbnp rehabilitation zone, particularly in the donglo block, resort of wonoasri. the presence of c. odorata may absorb the restoration of the rehabilitation of land ecosystem. this is because c. odorata is allowed to develop in the rehabilitation zone and it can become invasive in the future (susilo, 2018). initial efforts to identify these exotic plants as potentially invasive could use plant distribution patterns. the distribution pattern is the distribution of organisms in nature that forms an interaction with their environment. the distribution pattern that often occurs in nature is clumped. the distribution of clumped within a population depends on the abiotic and biotic factors in the environment (odum, 1971). based on this, it is necessary to research the distribution pattern and area of coverage of exotic c. odorata plants in the rehabilitation zone of the donglo resort wonoasri block tnmb, as an effort to restore rehabilitation land. materials and methods time and location of research the research was conducted from march to december 2020. data was collected in donglo block, wonoasri resort, mbnp, jember regency, east java (figure 1). the sampling area determined was 2.04 hectares. description of types and data analysis at the ecology laboratory, department of biology, faculty of mathematics and natural sciences, university of jember. data retrieval the initial activity was to verify left-over specimens from in donglo block resort of wonoasri mbnp using the flora of java (backer, 1963). the species verification uses fresh plant specimens which include the roots, stems, leaves and flowers. the method used in collecting of c. odorata plant data was the systematic plot transect method. this method is carried out by systematic exploration of the transect line within the study site, then followed by placing 415 plots of 2x 2 meters with a distance of 2 meters between plots figure 1. map of research locations (a.) location of the donglo block; (b.) location of the wonoasri resort; (c.) mbnp location 3 | rizkiah et al.; distribution patterns of exotic plant chromolaena odorata (l.) and a distance of 5 meters between transects (figure 2). the next step is coordinates mark using garmin 64s gps in the plot when finding c. odorata plants. the coordinate points of c. odorata plants by following the canopy pattern, namely forming coordinate points in the outermost areas of the plant. measurement of the area of population control using the percent cover. this is used to determine what percentage of the plant occupies the research area. abiotic factor data collection was also carried out which included air humidity, soil ph, temperature, wind speed and light intensity. abiotic factor data was collected in each representative sampling area. data analysis the distribution pattern of c. odorata plants can be determined quantitatively by using the formula for the distribution index morisita (iδ) (equation 1) according to krebs (1989) as follows: id = n [ ………………………. (1) note: i = morisita distribution index n = number of plots ∑x = the percent of cover on each plot ∑x2 = the total number of plots squared the distribution pattern was determined using the following criteria iδ = 1, the distribution pattern tends to be random iδ <1, the distribution pattern tends to be even iδ> 1, the distribution pattern tends to be clumped. mapping distribution data of exotic plants of c. odorata data using arcgis 10.1 program. the data required the base map (google earth, 2020) and the coordinate point data for the distribution of c. odorata. the initial stage was to make rectification or registration of the base map on arcmap. the next step is entering the coordinates (overlay) of c. odorata of the delineated results. next step, the digitization and layering are done at note figure 2. the systematic plot transect flow at the study site each point of the coordinates of c. odorata which will then form a spatial distribution map. the final result of the determination using this gis program is in the form of a spatial distribution map of c. odorata in donglo block resort of wonoasri tnmb which is clumped (polygon) with a range of 2-5%, and groups with a range of 6-10% and individuals who live solitary. determination of coverage area of exotic c. odorata plants in the study using the percent cover coverage. the percent cover data for each plot is converted to area data by dividing the percent cover obtained by the number of plots. the results obtained are multiplied by the total area of the study area then divided by the number of plots. abiotic parameter measurements data were analyzed descriptively qualitatively to describe the jurnal riset biologi dan aplikasinya, 3(1): 1-6, march 2021 | 4 environmental conditions where c. odorata was grown in the rehabilitation zone of the wonoasri resort, meru betiri national park. results and discussion distribution patterns of exotic plants chromolaena odorata based on the results of the morisita index analysis, the index value (iδ) = 12.39, which means that the type of c. odorata in the donglo resort wonoasri block mbnp has a clustered distribution pattern. the distribution pattern is said to be grouped by having a morisita index value >1 (krebs, 1989). the distribution pattern of c. odorata can also be seen from the results of the spatial distribution map (figure 3). the map showed that c. odorata grows rapidly or overlaps with each other so that it appears clustered. based on the map, 27% of the individuals living in solitary lives and groups of 73% of the total individuals found. it can be seen on the map that c. odorata clumped (polygons) with a range of 2-5%, and clumped with a range of 6-10% and individuals who live solitary lives (waypoints). clumped distribution patterns occur when environmental conditions tend to be different and some individuals choose an environment that suits their life needs. this is inline with susetiono (2004) stated that a population tends to clumped because it chosen an appropriate place to support its life. the pattern of clustered distribution is influenced by abiotic factors and biotic factors (odum, 1993). abiotic factors at the research location, based on five environmental parameters including light intensity, air humidity, temperature, wind speed, and soil ph. the following is the result of the total range of parameters for the measurement of abiotic environmental conditions carried out at ten sampling points, which can be seen in table 1. the results of table 1 showed that the abiotic parameters in the study location can still be tolerated by c. odorata. light intensity at the study sites ranged from (146-959 lux) which supported the growth of c. odorata. this is following ambika (2006) showed that c. odorata can grow in the 504500 lux range. these plants grow in groups on land that is free of shade. the presence of shade will increase in leaf size to capture incoming light, so that the conditions of the shaded plants slowly expand the size of the leaves (suci & heddy, 2018). the temperature and humidity parameters at the research location were between 32.1-39.8oc and the humidity ranged from 41.9-71.8% rh. according to tripathi et al. (2011) that temperatures above 20oc can increase the germination of c. odorata. temperature and air environment are components of microclimate that greatly affect growth and pay attention to good environmental conditions for plants (wijayanto & nurunnajah, 2012). soil ph parameters at the study sites were between 6.8-7 supporting the growth of c. odorata. this is consistent with the statement of mandal & joshi (2014) that c. odorata can grow with various figure 3. map of the distribution pattern of c. odorata in the rehabilitation zone of the donglo resort wonoasri block mbnp 5 | rizkiah et al.; distribution patterns of exotic plant chromolaena odorata (l.) table 1. abiotic measurement results no abiotic parameters total 1 light intensity (lux) 146-959 2 humidity (%rh) 41.9-71.8 3 temperature (oc) 32.1-39.8 4 soil ph 5.5-7 5 wind velocity (m/s) 0.1-2.4 soil conditions in the ph range 4-8. the wind speed parameter was 0.1-2.4 m/s, is sufficient to support the distribution of c. odorata seeds to the surrounding area. this is also seen in the numerous seeds of c. odorata, which are easily recognized by the wind due to the presence of needle-shaped hairs. according to suharjo & aeny (2011) c. odorata is a plant that can continue to grow well in less fertile areas, and a strong wind that blows and there is no human intervention (empty land) will get a high c. odorata population. another factor that influences the distribution of this species is the reproductive phase. this plant reproduces by seeds or propagules that grow around its female. this is following the statement of lestari et al (2017), which states that the distribution patterns of plants tend to be clustered because reproductive plants produce seeds that fall close to their parents. according to prawiradiputra (2007), c. odorata can experience spread through cut stems, branches and the base of the stem which will sprout again, and the seeds that fall to the ground will germinate, so they can spread to form a shade. coverage area of c. odorata exotic plants the coverage area of c. odorata in the study location was 596.5 m2 or 29.24% of the total area of the study (20,400 m2). according to short and coles (2001), the extent of the relationship is closely related to habitat and morphological form. morphological factors that can affect the extent of coverage include roots, leaves, and seeds. the type of c. odorata has a taproot system that has many branches and a long cone shape, thus expanding the root area which can absorb water and nutrients. this plant also has characteristics on the surface of the wap leaves or what is commonly referred to as trichomes. trichoma is a derivative from the epidermis which means hairs. the function of trichomes reduces the incidence of evaporation, temperature changes, and mechanical disturbances (dewi et al., 2015). this is a form of protection from morphological adaptation so that these plants can survive growing and developing. many c. odorata seeds in the presence of needle-shaped hair are commonly referred to as papus. papus is persistent inside the fruit and opens outward like an umbrella that helps it float in the air (silalahi, 2015), hence it can expand the distribution area because the seeds are easily known with the help of the wind. the morphological characters of c. odorata are also influenced by the habitat. c. odorata species grow in clumped on land that is free from shade and based on the results of this area of cover, c. odorata is not yet included in the invasive species category in donglo block resort of wonoasri mbnp. this was possible due to competition with other introduced plants that were deliberately planted by rehabilitated land farmers, such as the presence of pureria javanica. therefore, the distribution of the exotic plants of c. odorata is not yet widespread in donglo resort wonoasri mbnp. conclusion the conclusion of this study is the distribution pattern of the exotic plants of c. odorata in rehabilitation zone at donglo block, resort of wonoasri mbnp is clumped. this is also supported by the map of the spatial distribution pattern of c. odorata which shows an overlap between close individuals with a grouping percentage of 73%. based on the results of the coverage area of c. odorata, it is indicated that this exotic species is not classified as an invasive species category in the area. acknowledgment this research activity was carried out thanks to the support of the tropical natural resources conservation (t-nrc) of the university of jember and the conservation of natural resources of the meru betiri national park. references ambika, s. (2006). effect of light quality and intensity on emergence, growth and reproduction in chromolaena odorata. proceedings of the seventh international workshop on biological control and management of chromolaena odorata and mikania micrantha, 2002, 14– 27. available at http://jprsolutions.info. backer, c., and reinier, c. b. v. b. 1963. flora of java. universitas michigan: p. noordhoff. dewi, v. p., hindun, i., & wahyuni, s. (2015). studi trikoma daun pada famili solanaceae sebagai sumber belajar biologi. jpbi (jurnal pendidikan jurnal riset biologi dan aplikasinya, 3(1): 1-6, march 2021 | 6 biologi indonesia), 1(2), 209–218. https://doi.org/https://doi.org/10.22219/jpbi.v1i2.3 332. google earth. 2020. https://earth.google.com/web/@8.38025995,113.69595945,30.16696257a,11499.39845 315d,35y,0h,45t,0r/data=cksasrjdciuwedjkzdy5 zwyzotfmogy4yzu6mhg0zmfmndbjmjnho tm1ndjkgyurwncxcdaiqkpuxy1a1xakghxb2 5vyxnyargciaeoag [accessed on 11 april 2020] krebs, c. j. 1989. ecologycal methodology. new york (us): harper and row publisher. lestari, e.p., dharmono, d., & amintari, s. (2017). pola distribusi tumbuhan mahar di desa batu tangga kecamatan batang alai timur kabupaten hulu sungai tengah. available at https://www.semanticscholar.org/paper/poladistribusi-tumbuhan-mahar-(kleinhovia-hospitalestaridharmono/a260d9610611b0cb8bdaedb5da3ca6b8c14 6eb0d. mandal, g., & joshi, s. p. (2014). invasion establishment and habitat suitability of chromolaena odorata (l.) king and robinson over time and space in the western himalayan forests of india. journal of asia-pacific biodiversity, 7(4), 391–400. https://doi.org/10.1016/j.japb.2014.09.002. oktary, a. p., ridhwan, m., & armi. (2015). ekstrak daun kirinyuh (eupatorium odoratum) dan lalat buah (drosophila melanogaster). serambi akademica, iii(2), 335–342. https://doi.org/https://doi.org/10.32672/jsa.v7i2. odum, e. p. 1993. dasar-dasar ekologi. edisi ke-3. yogjakarta: gadjah mada university press. odum, e. p. 1971. fundamental of ecology third edition. london (gb): wb saunders company press. prawiradiputra, b. (2007). ki rinyuh (chromolaena odorata (l) r.m. king dan h. robinson): gulma padang rumput yang merugikan. 17(1), 46–52. radiansyah, d. a., adi, s., wandojo, s., soekisman, t., daisy, j. d., titiek, s., budi, s., islana, e., sugeng, h., fauziah., ridwan, a., awliya, p. a., & nararya, g. 2015. strategi nasional dan arahan rencana aksi pengelolaan jenis asing invasif di indonesia. jakarta: deputi bidang pengendalian kerusakan lingkungan dan perubahan iklim, kementrian lingkungan hidup dan kehutanan republik indonesia. silalahi, m. 2015. bahan ajar morfologi tumbuhan. jakarta: universitas kristen indonesia short, f.t. and coles, r. 2001. global seagrass research methods. the netherlands: elsevier publishing. suci, c. w., & heddy, s. (2018). pengaruh intensitas cahaya terhadap keragaan tanaman puring (codiaeum variegetum). jurnal produksi tanaman, 6(1), 161–169. http://protan.studentjournal.ub.ac.id/index.php/prot an/article/view/627. suharjo, r., & aeny, t. n. (2011). eksplorasi potensi gulma siam ( chromolaena odorata ). jurnal hama dan penyakit tumbuhan tropika, 11(2), 201–209. https://doi.org/https://doi.org/10.23960/j.hptt.2112 01-209. suryawan, d., sutyarto, e., umaya, r., kurnia, a & hadiyan, y. (2015). sebaran invasive alien species acacia decurrens pada kawasan taman nasional gunung merapi. pros sem nas masy biodiv indon, 1(4), 738–742. https://doi.org/10.13057/psnmbi/m010409. susetiono. 2004. fauna padang lamun tanjung merah selat lembeh. jakarta: pusat penelitian oseanografi, lipi. susilo, a. (2018). inventarisasi jenis tumbuhan asing berpotensi invasif di taman nasional meru betiri. seminar nasional pendidikan biologi dan saintek, 3, 260–270. syah, t. & arbain. (2019). assessment of sesbania sesban as a putative invasive species in urban area of sangatta, east kalimantan. jurnal ilmu pertanian indonesia, 24(4), 304–312. https://doi.org/10.18343/jipi.24.4.304. tripathi, r. s., yadav, a. s., & kushwaha, s. p. s. (2011). biology of chromolaena odorata, ageratina adenophora and ageratina riparia: a review. invasive alien plants: an ecological appraisal for the indian subcontinent, august 2016, 43–56. https://doi.org/10.1079/9781845939076.0043. wijayanto, n. & n. (2012). intensitas cahaya, suhu, kelembaban dan perakaran lateral mahoni (swietenia macrophylla king.) di rph babakan madang, bkph bogor, kph bogor. jurnal silvikultur tropika, 3(1), 8–13. yuliana, s., & lekitoo, k. (2018). deteksi dan identifikasi jenis tumbuhan asing invasif di taman wisata alam gunung meja manokwari, papua barat. faloak, 2(2), 89–102. https://doi.org/https://doi.org/10.20886/jpkf.2018.2 .2.89-102. jurnal riset biologi dan aplikasinya, volume 4, issue 2, september 2022 an additional information of tarenna (rubiaceae) in madura island novita kartika indah1* & ashari bagus setiawan 1 departement of biology, faculty of mathematics and natural sciences, universitas negeri surabaya jl. ketintang, gayungan, surabaya 60231, east java, indonesia 2 sma al-wildan 4 islamic school jakarta, jl haji nudin, lebak bulus, cilandak, south jakarta, indonesia *corresponding author e-mail: novitaindah@unesa.ac.id article history abstract received : 2 may 2022 tarenna is a genus of relatives of ixora which is found in forests. tarenna is different from ixora which is known as an ornamental plant. the purpose of this study was to find the genus tarenna in madura natural habitat to preserved or conserved before this genus became extinct. observations were made on morphological characters. the morphological characteristics observed included: stature, stems, leaves, inflorescences, flowers, fruits, and seeds. ixora has a corolla of various flowers while tarenna only has a white corolla but smells good. recent exploration and collection of tarenna in madura island indicated that two species are a new record for java and madura island, namely t. costata and t. fragrans. existence of t. costata in this area not only as a new record for madura island, but also as a new record for java. tarenna fragrans was firstly reported in madura island as a new distributional record for this area. an updated of identification key, several descriptions, and documentations, as well as a distributional map are provided. revised : 16 august 2022 approved : 14 september 2022 published : 30 september 2022 keywords tarena, identification, ixora, how to cite: indah, n.k & setiawan, a, b. (2022). an additional information of tarenna (rubiaceae) in madura island. jurnal riset biologi dan aplikasinya, 4(2): 90-95. doi: 10.26740/jrba. v4n2.p.90-95. introduction the genus of tarenna is less known to the public. tarenna is unknown or almost never heard of in contrast to its relatives in the rubiaceae family. the genus of tarenna is a member of subfamily lxoroideae, along with lxora, pavetta, and rutidea. they were classified in tribe pavettae based on the following characters namely shrubs, rarely climbers or trees; stipules interpetiolar, margin entire (fimbrate in rutidae); on the lower leaf surface raphides absent; inflorescence terminal; corolla lobes contorted to the left; ovary 2 (--7) locular, each axillary placenta with 1 to 28 ovules; fleshy fruits; one to many seeds per locule; exotesta cells sometimes parenchyma-like; stylar pollen present, 3 or 4 (rarely 5) of colporate pollen grains . tarenna was first published by gaertner in 1788 with the speciment type of tarenna zeylanica. t. zeylanica is from africa. because the boundaries of the original genera were rather narrow, other genera were born which were considered more suitable to accommodate the new species collected from the field, such as webera and stylocoryna. in the writing of sumatran flora by miquel in 1862 and the list of sumatran plant species written by boerlage in 1891, two genera names were listed, namely stylocoryna and webera, which turned out to be the same taxon as tarenna. in addition, because the morphological characteristics of this genus are like pavetta and ixora. if the specimen does not have generative organs, the taxonomist will have identification errors. as a result, several species of pavetta and ixora were transferred to tarenna, as was done by bremekamp (1934) for p. macroptera, p. meyeri, and p. astericus. other researchers who carried out the transfer of several species of the webera genus (w salicina and w. longifolia and so on) to tarenna included ridley (1923). merril (1921) transferred several species from pavetta (p. eucrantha and p. palawanensis) and stylocoryna (s. angustifolia and s. jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi 91 |indah & setiawan; an additional information of tarenna (rubiaceae) in madura island adpressa). wong in 1989 moved randia mussaendoides to tarenna. bremekamp (1939) said that pavetta and tarenna were very similar, the difference was only in the number of crown lobes. this similarity causes frequent errors in identification, especially if it is only based on the vegetative parts. diagnostic character of tarenna is leaves usually ± acuminate and aristate; stipules triangular-lanceolate or ovate, always erect, sometimes aristate. inflorescences terminal on main and leafy lateral branches or subterminal is on very short leafless branches, lax or compact; flowers pedicellate or sometimes shortly so, sometimes pedicels accrescent in fruit; fragrant, hermaphrodite, (4–)5-merous, pedicellate or less often sessile in mostly corymbose; bracts sometimes present but inconspicuous; bracteoles present, often on the (oliver 1877; ridley, 1923; backer and brink jr., 1965; fosberg et al., 1993; indah, 199; wfo, 2017). the forest is habitat of the genus tarenna, this genus is rarely used as an ornamental plant or medicinal plant. members of this genus are very numerous, about 368 species, while tarenna in java based on flora of java there are only three species (backer & van bakhuizen, 1963) namely t. dasyphylla, t. fragrans, and t. laxiflora. according to the publication records, all above come from forests in java. however, only t. fragrans can still be found and is still stored in the form of living plants in the purwodadi botanical gardens. tarenna was never reported growing on madura island. the morphological character of tarenna is similar to ixora. the most important diagnostic character between ixora and the tarenna is the color of the flowers. the ixora flower color is more attractive than tarenna. tarenna has a white flower color and/or yellowish-white while the color of tarenna flowers varies. the purpose of this study was to find the genus tarenna in its natural habitat to preserved or conserved before this genus became extinct. materials and methods this research was conducted in octobernovember 2021 in bangkalan, sampang, pamekasan, and sumenep regencies using the cruising method (rugayah et al.,2004). the parts of plant collected include parts of branches with leaves, inflorescences and flowers, and fruit. each specimen was collected in two branches as duplicates. the recorded data includes collection numbers, name of collectors, habitat and elevation, coordinate positions, local names, utilization, and morphological characteristics. the procedure for making herbarium follows djarwaningsih (2002). the specimens were dried and made into an herbarium. then the herbarium specimens were observed and described. observations were made on morphological characters. the morphological characteristics observed included: stature, stems, leaves, inflorescences, flowers, fruits, and seeds. all specimens were documented using the sma725f/ds mobile device. indumentum, flower, and seed shape characteristics were observed using a nikon smz-745 stereo microscope. this activity was carried out at the biology laboratory of building c1 (isdb), surabaya state university. then matching activity with several related herbarium specimens was carried out at herbarium bogoriense (bo) and virtually via herbarium leiden (https://bioportal.naturalis.nl/). the collected specimens were identified using flora of java 2 (backer & bakhuizen van den brink 1963), tarenna species (rubiaceae) in sumatra (indah, 1999), a taxonomic revision of tarenna gaertn. and triflorensia s.t. reynolds (rubiaceae: ixoroideae: pavetteae) in australia (reynold & foster 2005), and a checklist of the genus tarenna gaertn. (rubiaceae) in thailand (kesonbua & chantaranothai, 2008). the terminology used follows harris & harris (1994) and rifai & puryadi (2008). all specimens were stored in herbarium bogoriense (bo). characters observed included stature, leaves (shape, size, upper and lower surfaces, trichomes, and petioles), stipules shape, inflorescences (inflorescence type, petal and crown shape, petal and crown estivation, length of crown tube, crown color, and flower odor), fruit shape and fruit color, and seeds (shape and number of seeds). morphological characters were used for identification process and creating key identifications. results and discussion two species of tarenna which are new records for java and madura island, namely t. costata (miq.) merr. and t. fragrans (blume) koord. & valeton is found in sampang regency, east java. the key to the latest identification of tarenna species in java, descriptions and morphological characteristics of t. costata and t. fragrans are shown in figure 1 and figure 2, respectively, and a distribution map of each species is shown in figure 3. the description of each species is described. below this https://bioportal.naturalis.nl/ jurnal riset biologi dan aplikasinya, 4(2): 90-95, september 2022 |92 key to tarenna species in java 1a. leaf base cuneate to attenuate, bark smooth with rounded scars, flower pedicels absent …... t. costata b.leaf base attenuate, flower pedicels 1-3 mm, bark smooth without rounded scars …………………………………………………………………………………………………2 2a. primary veins of upper leaf surface glabrescent to glabrous …………………..…… t. laxiflora b. primary veins of upper leaf surface pubescent to velutinous …………………. … 3 3a. inflorescence subterminal, unscented flowers………………………….... t. dasyphyla b. inflorescence terminal, fragrant flower …………………………... t. fragrans areas with few human inhabitants. in this study, the maximum number for each species per catch was limited to 3 individuals only with a carapace width >15 centimeters, and the rest were released to their habitat again, based on the decree of ministry. tarenna costata (miq.) merr., philipp. j. sci. 17: 472 (1920); indah, the species of tarenna (rubiaceae) in sumatra, thesis (1999) 45 – stylocoryna costata miq., fl. ned. ind. 2: 203 (1857). webera costata (miq.) hook.f., fl. brit. india 3: 103 (1880). tipe: sumatra, sumatra barat, pasaman, bonjol, teisjmann 1051, st., sd., (holo: bo!). tree, up to 30 m tall. bark smooth with rounded scars, dippled reddish to orange brown. inner bark pale brown. twig quadrangular, orange brown-brown, velutinous to glabrescent. leaves coriaceous, obovate, 2-30 by 0.7-14.5 cm, base cuneate to attenuate, apex obtuse to acute and cuspidate, upper surface sparsely to densely pubescent, smooth to the touch, primary vein pubescent, secondary veins 6-14 pairs, flat, tertiary veins obscure; lower surface pubescent, primary vein densely pubescent, secondary veins prominent, tertiary veins slightly visible to distinct, secondary and tertiary veins as ladder like connections; petioles pubescent, 1-2 cm; stipules persistent, lobes triangular with mucronate apex, 3-6 mm long, lower surface pubescent, costa subprominent. inflorescence terminalis, corymbose, peduncle 1.54 cm longer than petiole, rachis 0.7-2 cm long, peduncles and rachis pubescent; bract linear, apex acuminate, 0.2-0.7 by 0.05 cm, with velutinous indumentum. figure 1. tarenna costata (miq.) merr. a. stature; b. complete branch; c. adaxial surface of the leaf; d. the abaxial surface of the leaf; e. fruiting; f. fruit; g. stipula. photo documentation by ashari bagus setiawan 93 |indah & setiawan; an additional information of tarenna (rubiaceae) in madura island flowers whitish yellow, sessits; calyx 1-2 mm long, with pubescent indumentum, lobe triangular, imbricate, 0.5-1 mm, pubescent; corolla tube 0.3-0.6 cm long, outside densely pubescent, petal imbricate, apex obtuse, 0.3-0.4 cm long, outside pubescent; anthers 3-4.5 mm long; many ovules, stigma clavata, 0.7-0.8 cm long. fruit globular, 0.2-0.6 cm diam., dull greyish green to green. seed 36-48, trapezoid, irregular, suberect, surface reticulate, 0.1-0.2 cm long by 0.1-0.3 cm wide. local name: unknown. distribution: peninsular malaysia, sumatra, borneo, and the philippines. in this study, it was found in the sumber omben area, omben district, sampang regency, madura island (east java). habitat: this plant was found in secondary forest at an altitude of 4-250 m above sea level. (indah, 1999). where in this study, the specimen was found in a mixed forest area near the omben source area which was dominated by syzygium sp. (130 m above sea level.). observed specimens: ashari b. setiawan & thobib hasan al yamini 011, 012. note: the inflorescence has a pubescent indumentum. utilization: this species is not utilized by the local community. tarenna fragrans (blume) koord. & valeton, meded. lands plantentuin 59: 77 (1902); backer & bakh. f., fl. java. 2: 308 (1965); indah, the species of tarenna (rubiaceae) in sumatra, thesis (1999) 50 – wahlenbergia fragrans blume, catalogus 15 (1823). tipe: indonesia, jawa, blume 1333 (holo: l!). ceriscus fragrans (blume) nees, flora 8: 116 (1825); stylocoryna fragrans (blume) blume, bijdr. 982 (1826); stylocoryna fragilis d.dietr., syn. pl. 1: 794 (1839); stylocoryna albituba miq., fl. ned. ind., eerste bijv. 541 (1861); webera fragrans (blume) hook.f., fl. brit. india 3: 103 (1880); chomelia fragrans (blume) k.schum, nat. pflanzenfam. 4(4): 74 (1891); webera albituba (miq.) boerl., handl. fl. ned. ind. 2(1): 129 (1891). treelet to tree, up to 10 m tall. bark smooth, greyish brown. inner bark brown. twig quadrangular, brown, pubescent to glabrescent. leaves chartaceous to thinly coriaceous, elliptical to obovate, 5-18.5 by 1.2-7.8 cm, base attenuate, apex acuminate, upper surface glabrescent to glabrous, primary vein glabrescent to glabrous, secondary veins 6-13 pairs, flat, tertiary veins obscure; lower surface glabrescent, primary vein glabrescent, secondary veins visible, tertiary veins obscure; petioles pubescent to glabrescent, 0.5-1.5 cm; stipules persistent, lobes triangular with cuspidate apex 5-6 mm long, lower surface pubescent, costa prominent. inflorescence terminal, thyrsa, peduncle 1.5-3.5 cm longer than petiole, rachis 0.5-1.5 cm long, peduncles and rachis pubescent; bract lanceolate become foliar, apex acute, 0.4-0.6 by 0.05-0.1 cm, with pubescent indumentum. figure 2 tarenna fragrans (blume) coord. & valeton. a. stature; b. complete branch; c. adaxial surface of the leaf; d. the abaxial surface of the leaf; e. stipules; f. umbrella inflorescences; g. bracts in flowers. photo documentation by ashari bagus setiawan (a-f) and sketch drawing by novita kartika indah (g). jurnal riset biologi dan aplikasinya, 4(2): 90-95, september 2022 |94 figure 3. distribution of tarenna on madura island. tarenna costata; tarena fragrans flowers white turning cream to pale yellow, subsessils; calyx 1.52.5 mm long, with pubescent indumentum, lobe ovate, imbricate, 0.5-1 mm, pubescent; corolla tube 015-1.6 cm long, outside densely pubescent, petal imbricate, apex obtuse, 0.45 0.6 cm long, outside pubescent; anthers 4.5-5 mm long; many ovules, stigma linear, 1-1.5 cm long. fruit globular, 0.3-0.7 cm diam. seed 40-50 trapezoid, irregular, suberect, surface reticulate, 0.150.3 cm long by 0.15-0.2 cm wide. local name: unknown. distribution: peninsular malaysia, sumatra, java, kalimantan and sulawesi. in this study, it was found in pancor tengah village, ketapang district, sampang regency, madura island (east java). habitat: this plant was found in forests at an altitude of 5-700 meters above sea level (indah, 1999). in this study, the specimen was found in a mixed forest area dominated by teak plants (126 m above sea level.) and people's yards (119 m above sea level.). observed specimens: ashari b. setiawan & thobib hasan al yamini 013, 014. note: fragrant flowers utilization: tarenna fragrans grows wild in the mixed forest under teak tree stands and is utilized by the local community. one of the residents used the flowers as sowing flowers at funeral activities which were mixed with rose, champaca, and ixora. sow flowers are sold in the ketapang market. the owner of the house did not know the location where this plant was first obtained. in kalimantan, its use has been reported as traditional medicine and dye for woven fabrics (royyani & efendi, 2014; kartini & sisillia, 2017). conclusion the results showed that tarenna fragrans and tarenna costata were found in madura. furthermore, it is necessary to conserve these two species, so that they can be developed as an alternative to ornamental plants in the future. acknowledgement this research was carried out with the support of all the academic community of the state university of surabaya, especially biology department, faculty of mathematics and natural sciences, unesa. thanks to dr. rinie pratiwi p., m.sc. as head of the department who had given permission to conduct exploration and dr. sunu kuntjoro, m.si. who gave permission to use the biology department laboratory facilities, especially the taxonomy laboratory, and friends from the botanical kbk and taxonomy families who continue to inspire enthusiasm so that this article can be completed properly references backer, c. a. & bakhuizen v/d brink jr. (1965). flora of java ii. the netherland: noordhoof groningen. 95 |indah & setiawan; an additional information of tarenna (rubiaceae) in madura island corner, e. j. h. 1940. wayside trees of malaya. singapore: government printing office. djarwaningsih, t., siti sunarti, & kartini kramadibrata. (2002). panduan pengelolaan material herbarium serta pengendalian hama terpadu di herbarium bogoriensi. herbarium bogoriense-bidang botani. bogor: pusat penelitian biologi. lipi. fosberg, r., sachet, & oliver, r. (1993). flora micronesia 5: bignoniaceae-rubiaceae. washington dc: smithsonian lnstituion press. harris, j.g & melinda w. harris. (1994). plant identification terminology: an illustrated glossary. spring lake, utah: spring lake publishing. indah, n.k. (1999). the species of tarenna (rubiaceae) in sumatra bogor: ipb (tesis tidak dipublikasikan). kartini, d.e. & l. sisillia. (2017). jenis tumbuhan pewarna alam yang dimanfaatkan oleh masyarakat penenun desa batu lintang kecamatan embaloh hulu kabupaten kapuas hulu. jurnal tengkawang, 7 (2), 84-91. 10.26418/jt.v7i2.23773. kesonbua, w. & pranom chantaranothai. (2008). a checklist of the genus tarenna gaertn. (rubiaceae) in thailand. thai forest bulletin. 36: 18–45. plant identification terminology: an illustrated glosory. utah: spring lake publishing. https://li01.tcithaijo.org/index.php/thaiforestbulletin/article/vie w/24176/20562. merrill, e. d. (1921). studies on philippine rubiaceae iv. phillip. journ. sc. 17,461 -474. 10.3860/pjsb.v1i1.908. oliver, d. (1877). flora tropical africa iii london: reeve & co. reynolds, s.t. & paul i. forster. (2005). a taxonomic revision of tarenna gaertn. and triflorensia s.t.reynolds (rubiaceae: ixoroideae: pavetteae) in australia. austrobaileya. vol. 7 (1): 29-55. https://www.jstor.org/stable/41739010. ridley, h. n. (1923). flora malay peninsula. london: reeve & co. rifai, m. & dedi puryadi. (2008). glosarium biologi. jakarta: pusat bahasa. royyani, m.f. & efendy, o. (2015). kajian etnobotani masyarakat dayak di desa tau lumbis, kabupaten nunukan propinsi kalimantan utara, indonesia. berita biologi., 14 (2), 177-185. 10.14203/beritabiologi.v14i2.1852. rugayah, atik r., f.i. windadadri, & arief hidayat. (2004). pengumpulan data taksonomidalam rugayah, elizabeth a. w., dan praptiwi (ed.) pedoman pengumpulan data keanekaragaman flora. bogor: pusat penelitian biologi lipi. wernham, h.f. (1913). the nomenclature of tarenna. journ. bot. 51 : 58-59. wfo (the world flora online). tarenna gaertn. http://worldfloraonline.org/taxon/wfo4000037591;jsessionid=8cb2b539fe35e1eb8a9d7 440f9c1c490. http://dx.doi.org/10.26418/jt.v7i2.23773 https://li01.tci-thaijo.org/index.php/thaiforestbulletin/article/view/24176/20562 https://li01.tci-thaijo.org/index.php/thaiforestbulletin/article/view/24176/20562 https://li01.tci-thaijo.org/index.php/thaiforestbulletin/article/view/24176/20562 http://dx.doi.org/10.3860/pjsb.v1i1.908 https://www.jstor.org/stable/41739010 http://dx.doi.org/10.14203/beritabiologi.v14i2.1852 jurnal riset biologi dan aplikasinya, volume 4, issue 2, september 2022 dna barcode of homalomena pexa inferred from internal transcribed spacer region risqi aprilianingsih1, baiq farhatul wahidah1, muhammad rifqi hariri2* 1program study of biology, faculty of science and technology, walisongo state islamic university, jl. prof. dr. hamka (kampus ii), ngaliyan, semarang, central java 50185 2research center for biosystematics and evolution national research and innovation agency, jl. raya jakarta-bogor km 46, cibinong, bogor, west java 16911 *corresponding author: e-mail: muhammad.rifqi.hariri@brin.go.id article history abstract received : 10 july 2022 homalomena pexa, a tomentose haired-leaf aroid, was a newly discovered and described plant species in early 2020. this species has currently only been reported from south tapanuli. a molecular study to provide dna sequence is essential in this preliminary investigation. this research aimed to characterize the barcode sequence of h. pexa and estimate the species' position in an araceae phylogenetic tree. this research used its sequence to perform dna barcoding on h. pexa. the sequencing result revealed that 1040 bp nucleotides were effectively amplified. the phylogenetic tree generated using the neighbor-joining method and the kimura 2parameter revealed that h. pexa clustered with h. atrox and h. humilis, with a bootstrap value of 97%. this investigation provided and demonstrated that its sequences could be used to validate and support the proper identification of araceae species. revised : 4 august 2022 approved : 12 september 2022 published : 30 september 2022 keywords dna barcode, its, phylogenetic, homalomena pexa how to cite: aprilianingsih, r., wahidah, b.f & hariri, m.r. (2022). dna barcode of homalomena pexa inferred from internal transcribed spacer region jurnal riset biologi dan aplikasinya, 4(2):68-73. doi: 10.26740/jrba. v4n2.p.69-74. introduction homalomena schott is a genus in the araceae family, having a fairly wide distribution in tropical and subtropical regions, comprising 145 species (powo, 2022). this genus is widely recognized as one of the most popular attractive leaf plants (chen et al., 2007). wong et al. (2020) described a new species, homalomena pexa, with a moderately unusual morphological feature: all parts of the leaves are covered with tomentose trichomes. previously, a coarsely ciliate trichomes on the leaf surface were only reported in h. hasei (boyce and yeng, 2016). in contrast to most homalomena species, which have glossy leaf surfaces. the published information about h. bapexa covers morphological and habitat characteristics. however, the specific location of h. pexa is concealed for the plant's conservation. concealed information also means limited access to the plant's resources. widiyanti and mukarlina (2017) reported that forest fires and land conversion significantly impact araceae's survival in the wild. because the reported plant was not found in many other areas, genetic conservation of novel species that have not been thoroughly investigated is required to provide genetic information. the sequence of dna barcodes is frequently used to determine the species level using molecular techniques in genetic conservation approach. the plastid genome or nucleus, sometimes known as a universal dna barcode, can be used to identify plant species. the rbcl, matk, trnh-psba intergenic spacer (igs), and internal transcribed spacer (its) are some examples of often used regions (cbol, 2009; li et al., 2012; balkanska et al., 2020). the its region has been evaluated as a dna barcode system, yielding more diverse and informative characters (rønsted et al., 2008; li et al., 2012). the jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi 70| aprilianingsih et al.; dna barcode of homalomena pexa inferred from internal transcribed spacer its region was tested and showed a quite clear cluster of homalomena and philodendron, separating both genus in each clade (yeng et al., 2013). dna sequence data will provide an evolutionary measurement to diversity estimates by accounting for genetic distance between species. as a result, phylogenetic diversity can be assessed inside and across ecological communities at various geographic scales, used to aid in the documentation of new species, and used to select priority sites for conservation (kress et al., 2015). they give a paradigm for conservation genomics and highlight key challenges from large-scale data sets (govindaraj et al., 2015). materials and methods plant material preparation the specimen used in this study was a personal living collection of h. pexa (mrh94, figure 1) from south tapanuli (medan) grown in the glasshouse of the research center for plant conservation, botanic gardens, and forestry – national research and innovation agency. a healthy and fresh leaf was taken and placed in a tea bag. to ensure that the specimen dried completely, the tea bag was placed in a plastic bag packed with silica gel and left at room temperature for three days. figure 1. homalomena pexa dna extraction, amplification, and sequencing homalomena pexa whole genomic dna was obtained from the dried leaf using the plant genomic dna kit following the standard protocol provided by the manufacturer (tiangen biotech co., ltd., beijing). the universal its primer following sun et al. (1994) was used to amplify the region. a 50 μl reaction mixture containing 10 ng of the dna template, 1 µm forward and reverse primer, 25 µl of mytaq™ hs red mix (bioline, usa), and 17 µl nuclease-free water was used for the pcr reaction. the pcr conditions of 1 cycle (95 °c for 3 min), 35 cycles (95 °c for 30 sec, 58 °c for 45 sec, and 72 °c for 45 sec), and 1 cycle (72 °c for 5 min) were performed. the pcr products were separated on a 1% agarose gel and photographed using a geldoc uv trans-illuminator (biorad). the pcr product was sent to 1st base for the sequencing process through pt genetika science indonesia service. sequence editing and phylogenetic tree construction the forward and reverse its sequence were constructed into a contig sequence using the clustalw method and then submitted to ncbi blast to determine the homology level (https://blast.ncbi.nlm.nih.gov/) (hung and weng, 2016). a total of 20 homalomena sequences that emerged from the blast results were downloaded for later use in constructing phylogenetic trees (table 1). in addition, the furtadoa mixta sequence was also downloaded and treated as an outgroup. the phylogenic tree was constructed using the neighbor-joining (nj) method and the kimura 2parameter model with 1000 bootstrap replicates (kimura, 1980; felsentein, 1985; saitou and nei, 1987). all the analysis was executed using mega x (kumar et al., 2018). results and discussion homalomena pexa dna samples were effectively extracted and amplified for 1040 base pairs using its primers (figure 2). the amplified sequences included partial 18s ribosomal rna gene sequences, complete its1 sequences, whole 5.8s ribosomal rna gene sequences, complete its2 sequences, and partial 26s ribosomal rna sequences. figure 2. the amplified its sequence from homalomena pexa (s) using 1 kb ladder (l) as a comparison. following blast result on the ncbi website, the its sequence for h. pexa had the highest sequence similarity with h. atrox (jq955571.1) and https://blast.ncbi.nlm.nih.gov/ jurnal riset biologi dan aplikasinya, 4(2): 69-74, september 2022 |71 h. humilis (jq413316.1), with 97.97% and 97.73%, respectively (table 2). the high identity score showed that h. pexa from south tapanuli is closely related to those two species. the phylogenetic tree generated using its sequences revealed that all homalomena species and outgroups are clustered together as a monophyletic clade (figure 3). according to the phylogenetic tree, h. pexa is closely related to h. atrox and h. humilis, which is supported by a high bootstrap value (97%). generally, the its area amplified by the 17se and 26se primers can cover the region with sequences ranging from 573 to 1517 base pairs (gehrig et al., 2001; yeng et al., 2013; hariri et al., table 1. sequence length variation of its region of h. pexa compared to ncbi database no species accession no sequence length (bp) observed specimen 1 homalomena pexa this study 1040 ncbi database sequences ingroup 1 homalomena josefii jx076784.1 952 2 homalomena hanneae jx076779.1 946 3 homalomena sengkenyang jx076789.1 957 4 homalomena rostrata jx076786.1 922 5 homalomena vivens jx076796.1 924 6 homalomena clandestina jx076775.1 952 7 homalomena borneensis jq413327.1 867 8 homalomena punctulata jx076785.1 900 9 homalomena insignis jx076783.1 915 10 homalomena havilandii jx076781.1 907 11 homalomena vagans jx076809.1 904 12 homalomena tonkinensis km580741.1 965 13 homalomena rubescens km580744.1 991 14 homalomena expedita jx076778.1 920 15 homalomena curvata jx076777.1 934 16 homalomena philippinensis dq866881.1 876 17 homalomena humilis jq413316.1 881 18 homalomena atrox jq955571.1 835 19 homalomena asmae jq413317.1 871 outgroup 1 furtadoa mixta km580747.1 958 table 2. partial blast result of h. pexa based on top 10 percent of identity blast result accession no % id e value query cover homalomena atrox jq955571.1 97.97% 0.0 79% homalomena humilis jq413316.1 97.73 % 0.0 83% homalomena philippinensis dq866811.1 96.37% 0.0 83% homalomena expedita jx076778.1 95.84% 0.0 86% homalomena curvata jx076777.1 95.64% 0.0 89% homalomena tonkinensis km580741.1 94.82% 0.0 91% homalomena rubescens km580744.1 94.76% 0.0 91% homalomena borneensis jq413327.1 94.52% 0.0 83% homalomena asmae jq413317.1 92.96% 0.0 83% homalomena insignis jx076783.1 92.54% 0.0 87% 72| aprilianingsih et al.; dna barcode of homalomena pexa inferred from internal transcribed spacer figure 3. dendrogram obtained from a neighbor-joining method with kimura 2-parameter evolution model through 1000 bootstrap replications based on its sequence. figure 4. the full length of its region (sun et al., 1994) jurnal riset biologi dan aplikasinya, 4(2): 69-74, september 2022 |73 2021a; hariri et al., 2021b; irsyam et al., 2021) as shown in figure 4. a relevant result provided by white et al. (1990) and khisor and devi (2009) revealed that a common length for its (its 1 dan its 2) ranged from 900 bp to 1500 bp covered its1, 5.8s rdna dan its2. the length of the its1 and its2 regions varies slightly, with each length appearing to be genus-specific (jobst et al., 1998). according to yeng et al. (2013), the length of its1 ranged between 264 and 406 bp, the length of its2 varied between 326 and 395 bp, and the length of the 5.8s gene bp was consistent across all homalomena taxa studied. blast analyses revealed that its h. pexa sequences were 90% identical to homalomena, 3% to furtadoa, 6% to philodendron, and 2% to adelonema. these findings support the hypothesis that the sample sequence belongs to the genus homalomena, which is supported further by the results of the phylogenetic tree construction. the clustering was built using the genetic distance, which grouped species with low genetic distances into their respective clades. low genetic distance reveals that species within the same group are closely related (clement and donoghue, 2012). homalomena pexa is put in the same clade as h. atrox and h. humilis inside the homalomena cluster, supported by a solid bootstrap value of 97%. based on morphological characteristics, wong et al. (2020) placed h. pexa in the same monophyletic group as h. atrox and h. humilis, namely the chamaecladon clade. a species group is said to be monophyletic if all species found in the branches have a common ancestor (podani, 2010). we used the same outgroup, f. mixta, to differentiate the relatonship among homalomena species because furtadoa and adelonema are homalomena's sister genera (vasconcelos et al., 2018). based on our findings, the its region has relatively significant interspecific variability and it is powerful enough to distinguish similar species among closely related species, including those in the homalomena species complex (jobst et al., 1998; yeng et al., 2013; hariri et al. 2021a; irsyam et al. 2021). given that homalomena is one of the most speciose and taxonomically intractable aroid genera in the asian tropics, the lack of a reliable taxonomy poses significant problems for field workers. a rigorous study aimed at resolving the taxonomy and phylogeny of the genus is desperately needed (li & boyce, 2010). conclusion according to our findings, the its primer utilized in this investigation was successfully amplified and covered the entire its region. using the core barcodes, for example, the homalomena species complex, it could often unambiguously distinguish species belonging to the different major clades. we anticipate that comparable findings will be found in other plant groups. moving forward, we encourage more data to be collected to expand the multilocus barcode to incorporate the extra markers required to accurately distinguish between closely related species. acknowledgment the authors would like to thank the head of the research center for plant conservation, botanic gardens, and forestry-national research and innovation agency for permission to conduct this research in the treub laboratory. we thank both reviewers and the editor for their additional detailed comments on our manuscript. references balkanska, r., stefanova, k., stoikova-grigorova, r., & ignatova, m. (2020). a preliminary assessment of trnh-psba as dna barcode for botanical identification of polyfloral honey samples and comparison with rbcl marker. bulg j agr sci. 26(1), 238-242. https://journal.agrojournal.org/page/download.php ?articleid=2721. boyce, p. c., & yeng, w. s. (2016). studies on homalomeneae (araceae) of sumatera iv: three new ornamental homalomena (chamaecladon clade) species. willdenowia. 46(2), 253-260. https://doi.org/10.3372/wi.46.46206 cbol plant working group. (2009). a dna barcode for land plants. pnas, 106(31), 12794-12797. https://doi.org/10.1073/pnas.0905845106 chen, j., henny, r.j. & liao, f. (2007). aroids are important medicinal plants. acta hortic. 756: 347354. https://doi.org/10.17660/actahortic.2007.756.37 clement, w. l., & donoghue, m. j. 2012. barcoding success as a function of phylogenetic relatedness in viburnum, a clade of woody angiosperms. bmc evol biol. 12(1): 1-13. felsenstein, j. (1985). confidence limits on phylogenies: an approach using the bootstrap. evol. 39(4): 783-791. https://doi.org/10.1111/j.15585646.1985.tb00420.x gehrig, h., gaußmann, o., marx, h., schwarzott, d., & kluge, m. (2001). molecular phylogeny of the genus kalanchoe (crassulaceae) inferred from nucleotide sequences of the its-1 and its-2 regions. plant sci. 160(5), 827-835. https://doi.org/10.1016/s01689452(00)00447-7 govindaraj, m., vetriventhan, m., & srinivasan, m. (2015). importance of genetic diversity assessment in crop plants and its recent advances: an overview of its https://journal.agrojournal.org/page/download.php?articleid=2721 https://journal.agrojournal.org/page/download.php?articleid=2721 https://doi.org/10.3372/wi.46.46206 https://doi.org/10.1073/pnas.0905845106 https://doi.org/10.17660/actahortic.2007.756.37 https://doi.org/10.1111/j.1558-5646.1985.tb00420.x https://doi.org/10.1111/j.1558-5646.1985.tb00420.x https://doi.org/10.1016/s0168-9452(00)00447-7 https://doi.org/10.1016/s0168-9452(00)00447-7 74| aprilianingsih et al.; dna barcode of homalomena pexa inferred from internal transcribed spacer analytical perspectives. genet res inter. https://doi.org/10.1155/2015/431487 hariri, m. r., peniwidiyanti, p., irsyam, a. s. d., irwanto, r. r., martiansyah, i., kusnadi, k., & yuhaeni, e. (2021a). molecular identification and morphological characterization of ficus sp. (moraceae) in bogor botanic gardens. j biodjati. 6(1), 36-44. https://doi.org/10.15575/biodjati.v6i1.10852 hariri, m. r., irsyam, a. s. d., setiawan, a. b., setiawan, e., irwanto, r. r., & atria, m. (2021b). identifikasi molekuler dan karakterisasi morfologi kamandin saebo, tumbuhan obat dari pulau madura. biotika j ilmiah biol. 19(2): 41-48. https://doi.org/10.24198/biotika.v19i2.35627 hung, j. h., & weng, z. (2016). sequence alignment and homology search with blast and clustalw. cold spring harbor protocols, 2016(11), pdb-prot093088. https://doi:10.1101/pdb.prot093088 irsyam, a. s. d., hariri, m. r., peniwidiyanti, p., & irwanto, r. r. (2021). note on the genus dorstenia plum. ex l.(moraceae) in java (indonesia) and noteworthy information on the identity of d. bahiensis through its sequence. biodiversitas j biol divers. 22(8). https://doi.org/10.13057/biodiv/d220832 jobst, j., king, k., & hemleben, v. (1998). molecular evolution of the internal transcribed spacers (its1 and its2) and phylogenetic relationships among species of the family cucurbitaceae. mol phylogenet evol. 9(2): 204-219. https://doi.org/10.1006/mpev.1997.0465 kimura, m. (1980). a simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. j mol evol. 16(2): 111-120. kishor, r., & devi, h. s. (2009). induction of multiple shoots in a monopodial orchid hybrid (aerides vandarum reichb. f× vanda stangeana reichb. f) using thidiazuron and analysis of their genetic stability. pctoc. 97(2): 121-129. kress, w. j., garcía-robledo, c., uriarte, m., & erickson, d. l. 2015. dna barcodes for ecology, evolution, and conservation. trends ecol evol. 30(1): 25-35. https://doi.org/10.1016/j.tree.2014.10.008 kumar, s., stecher, g., li, m., knyaz, c., & tamura, k. (2018). mega x: molecular evolutionary genetics analysis across computing platforms. mol biol evol. 35(6), 1547. https://doi.org/10.1093/molbev/msy096 li, h. & boyce, p. c. (2010). homalomena. fl chi. 23: 17-18. li, h. q., chen, j. y., wang, s., & xiong, s. z. (2012). evaluation of six candidate dna barcoding loci in ficus (moraceae) of china. mol ecol res. 12(5): 783790. https://doi.org/10.1111/j.17550998.2012.03147.x podani, j. (2010). monophyly and paraphyly: a discourse without end?. taxon, 59(4), 1011-1015. https://doi.org/10.1002/tax.594002 powo. (2022). plant of the world online. [online]. available: https://powo.science.kew.org/taxon/urn:lsid:ipni.or g:names:30048023-2 rønsted, n., weiblen, g. d., savolainen, v., & cook, j. m. (2008). phylogeny, biogeography, and ecology of ficus section malvanthera (moraceae). mol phylogenet evol, 48(1), 12-22. https://doi.org/10.1016/j.ympev.2008.04.005 saitou, n., & nei, m. (1987). the neighbor-joining method: a new method for reconstructing phylogenetic trees. mol biol evol, 4(4): 406-425. https://doi.org/10.1093/oxfordjournals.molbev.a04 0454 sun, y., skinner, d. z., liang, g. h., & hulbert, s. h. (1994). phylogenetic analysis of sorghum and related taxa using internal transcribed spacers of nuclear ribosomal dna. theor appl genet, 89(1), 26-32. vasconcelos, s., de lourdes soares, m., sakuragui, c. m., croat, t. b., oliveira, g., & benko-iseppon, a. m. (2018). new insights on the phylogenetic relationships among the traditional philodendron subgenera and the other groups of the homalomena clade (araceae). mol phylogenet evol, 127: 168-178. https://doi.org/10.1016/j.ympev.2018.05.017 white, t. j., bruns, t., lee, s. j. w. t., & taylor, j. (1990). amplification and direct sequencing of fungal ribosomal rna genes for phylogenetics. pcr protocols: a guide to methods and applications, 18(1): 315-322. widiyanti, d. n., & mukarlina, m. t. (2017). inventarisasi tumbuhan araceae di hutan desa subah kecamatan tayan hilir kabupaten sanggau kalimantan barat. j protobiont, 6(3), 207-214. http://dx.doi.org/10.26418/protobiont.v6i3.22478 wong, s. y., boyce, p. c., & hay, a. (2020). studies on homalomeneae (araceae) of sumatera vi: two remarkable new species of homalomena [chamaecladon clade]. webbia, 75(1), 117-122. https://doi.org/10.36253/jopt-7947 yeng, w. s., jean, t. p., kiaw, n. k., othman, a. s., boon, l. h., ahmad, f. b., & boyce, p. c. (2013). phylogeny of asian homalomena (araceae) based on the its region combined with morphological and chemical data. syst bot, 38(3), 589-599. https://doi.org/10.1600/036364413x670430 https://doi.org/10.1155/2015/431487 https://doi.org/10.15575/biodjati.v6i1.10852 https://doi.org/10.24198/biotika.v19i2.35627 https://doi:10.1101/pdb.prot093088 https://doi.org/10.13057/biodiv/d220832 https://doi.org/10.1006/mpev.1997.0465 https://doi.org/10.1016/j.tree.2014.10.008 https://doi.org/10.1093/molbev/msy096 https://doi.org/10.1111/j.1755-0998.2012.03147.x https://doi.org/10.1111/j.1755-0998.2012.03147.x https://doi.org/10.1002/tax.594002 https://powo.science.kew.org/taxon/urn:lsid:ipni.org:names:30048023-2 https://powo.science.kew.org/taxon/urn:lsid:ipni.org:names:30048023-2 https://doi.org/10.1016/j.ympev.2008.04.005 https://doi.org/10.1093/oxfordjournals.molbev.a040454 https://doi.org/10.1093/oxfordjournals.molbev.a040454 https://doi.org/10.1016/j.ympev.2018.05.017 http://dx.doi.org/10.26418/protobiont.v6i3.22478 https://doi.org/10.36253/jopt-7947 https://doi.org/10.1600/036364413x670430 jurnal riset biologi dan aplikasinya, volume 4, issue 2, september 2022 sex determination of sea cucumber acaudina rosettis from madura straits, indonesia dwi winarni*1, lita i.d. lestari1, alfiah hayati1, nithasya nabila1, firas khaleyla2 1department of biology, faculty of science and technology universitas airlangga, indonesia, kampus c universitas airlangga, mulyorejo, surabaya, jawa timur 2department of biology, faculty of mathematics and natural sciences, universitas negeri surabaya, indonesia, jl. ketintang, gayungan, surabaya 60231, east java, indonesia *corresponding author e-mail: dwi-w@fst.unair.ac.id article history abstract received : 10 july 2022 acaudina rosettis is one of the commercial sea cucumber species that is widely consumed on the east coast of surabaya, east java, indonesia. although its abundance in nature has begun to show signs of decreasing, studies on this species are still very limited. this study aimed to examine indicators that can be used to determine the sex of a. rosettis individuals. acaudina rosettis samples were collected from madura strait in the mid of hijri month for three months. the sea cucumber samples were then dissected. body wall without viscera and gonads was weighed. the gonads were then characterized macroscopically and microscopically, prepared into histological slides with hematoxylin-eosin staining. the results showed that a. rosettis samples could be classified into three sex groups based on the type of gamete cells observed in the tubules; male (spermatogenic), female (oogenic), and undetermined sex (no gamete cells found). gonads had three colors; yellow, pink, and orange and were in five stages of reproductive phase; gametogenesis (g), mature (m), spawning (s), and post-spawning (ps). male samples had yellow and orange gonads, female samples were pink and orange, and all undetermined sex were orange. the g gonads were yellow and orange, m were yellow and pink, while s and ps were orange. body wall and gonad weight at the same reproductive phase did not show any difference between males and females. based on the results, gonad color can be used as an indicator of sex determination, but only in g and m reproductive phases. revised : 4 august 2022 approved : 12 september 2022 published : 30 september 2022 keywords acaudina rosettis, sex determination, gonads, madura straits sea cucumber, sex how to cite: winarni, d., lestari, l.i.d., hayati, a., nabila, n & khaleyla, f. (2022). sex determination of sea cucumber acaudina rosettis from madura straits, indonesia. jurnal riset biologi dan aplikasinya, 4(2):83-89. doi: 10.26740/jrba. v4n2.p.83-89. introduction east coast of surabaya is one of most productive areas in surabaya producing sea cucumbers. sea cucumbers are found in the madura strait, located between the island of java and madura. there are two main species sea cucumbers traded commercially in this area; phyllophorus sp. and acaudina rosettis. acaudina rosettis was first identified as a new species from the bay of johor, malaysia (o'loughlin & ong, 2015). previously, the same species was identified as paracaudina australis due to lack of records (winarni et al., 2014). scientific studies showed that this species has high nutritional content; high of protein (20.22%) and low carbohydrates (0.86%), and contained linoleic acid (0.016 %), arachidonic acid (0.032%) and eicosapentaenoic which was found in previous study to be able to help wound healing and tissue formation (widianingsih et al., 2016). results of previous study on east coast of surabaya showed that the distribution level of a. rosettis was in moderate category for 2 years of observation (5.78% and 6.57% of total sea cucumber sample) (winarni et al., 2014). this indicated that there is an effect of trading this species as commercial commodity to its population in the nature. on top of this, this species has not been listed both in the iucn and cites databases. thus, the continuing survival of a. rosettis needs to be noticed. for this reason, various information is jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi mailto:dwi-w@fst.unair.ac.id jurnal riset biologi dan aplikasinya, 4(2): 83-89, september 2022 |84 needed to support conservation efforts to maintain a. rosettis population living in madura strait. one of them is from the aspect of reproductive biology. the study of sea cucumber reproductive biology in indonesian waters is currently very limited and not exceptional for sea cucumbers traded commercially. acaudina rosettis is one of the sea cucumber species that does not show sex dimorphism. the sex of a. rosettis and its reproductive phase could only be determined based on the presence or absence of spermatozoa and ovum in the histologic section in previous study (widianingsih et al. 2018), has also been done for other sea cucumber species. there is still no information regarding the relationship between the macroscopic and microscopic structures of the gonads of a. rosettis and the macroscopic indicators that can be used to determine the sex of the a. rosettis sea cucumber. this study was conducted to complement the existing reproductive biology data of a. rosettis. by knowing clear indicators of sex determination, this information is expected to help implement marine resource management arrangements in the waters around surabaya. materials and methods sample collection and morphology observation samples of a. rosettis were collected from the east coast of surabaya, in the madura strait with a geographic range between 07º12'48.71” to 07º1 5'54.53” south latitude, and between 112º48'16.21'' to 112º52'34, 97' east longitude. sampling period followed qomariyah calendar system or javanese calendar, which was between 15th-20th of hijri month, while in ad calendar august 21st, september 21st, and october 20st respectively. every month, 25 samples of a. rosettis were collected from madura strait. species was identified as a. rosettis based on o’ loughin & ong (2015) (figure 1). the sea cucumbers were anesthetized in mgcl 7% before dissected, removed of its viscera, then body walls were weighed. gonads were weighed fresh, while body walls were dried first using oven at 50◦c to remove water content and weighed until dry weight obtained was constant. the color of the gonads was recorded and the gonads were then fixed in a 10% neutral buffered formalin solution. figure 1. sample of fresh acaudina rosettis collected from madura strait. histology preparation fixed gonadal tubules were then prepared into histological slides. the tubules were dehydrated, embedded in paraffin, and then cut into 4 µm section. the tubules were cut in serial sections at distance of 25 µm to observe the different parts of the tubule. the sections were stained with harris hematoxylin and eosin counterstain then evaluated using light microscope. data analysis total of 20 sections were observed using light microscope to determine sex and reproductive phase of each a. rosettis sample. determination of sex and maturity stage of everyone was based on winarni et al. (2012), where gamete cells and inner epithelium components were identified under magnification up to 1000x. data of gonad color was analyzed descriptively, while data of gonad weight, body wall weight, and their correlation to maturity stage was analyzed statistically using spearman correlation test (p = 0.05). results and discussion gonad histology the histological section of the male gonad is presented in figure 2, while histological section of female gonad in figure 3. the male gonads are indicated by the presence of spermatogenic cells in the tubules, while the female gonads are indicated by the presence of oogenic cells. samples without either gamete cells are determined as undetermined sex. the development of oogenic cells from the female gonadal tubules of a. rosettis is presented in figure 4. previtellogenic oocytes develop from tubular wall, which will become vitellogenic oocytes, followed by post-vitellogenic oocytes. previtellogenic oocytes are indicated by a nucleus, 85 | winarni et al; sex determination of sea cucumber acaudina rosettis from madura straits, indonesia figure 2. histology section of male acaudina rosettis gonads. a: cross-section of a tubule at mature phase; b: inner epithelium structure; ie: inner epithelium; sp: spermatogenic cells; tw: tubule wall; pc: parietal cell; sg: spermatogonia; sc: spermatocyte. figure 3. histology of female acaudina rosettis gonad. a: cross-section of tubule at mature phase; b: inner epithelium structure; o: oocyte; tw: tubule wall; fc: follicular cell; pc: parietal cell; pro: previtellogenic oocyte; n: oocyte nucleus; y: yolk. figure 4. oogenic cells in female acaudina rosettis gonad. a: previtellogenic oocyte; b: vitellogenic oocyte; c: post-vitellogenic oocyte. tw: tubule wall, fc: follicular cell; m: microvilli, jl: jelly layer. figure 5. color morphology of a. rosettis gonads. a: male gonads colored creamy yellow, b: female gonads colored pink, c: undetermined gonads colored yellow. jurnal riset biologi dan aplikasinya, 4(2): 83-89, september 2022 |86 figure 6. percentage of distribution of individual gonad maturity stage to gonad color. g: gametogenesis; m: mature; s: spawn; ps: post spawning; ud; undetermined sex (n=74). bar color represents gonad color (yellow, pink, orange). figure 7. distribution of the number of male and female individuals with a certain gonadal color (n = 74). figure 8. average dry body wall weight of the sea cucumber a. rosettis at various stages of gonadal maturity. g: gametogenesis; m: mature; s: spawning; ps: post-spawning; ud: undetermined sex. 87 | winarni et al; sex determination of sea cucumber acaudina rosettis from madura straits, indonesia figure 9. average gonad weight of sea cucumber a. rosettis at various stages of gonadal maturity. g: gametogenesis; m: mature; s: spawning; ps: post-spawningi; ud: undetermined sex varying in diameter at each stage of gonadal maturation, located in the periphery of the gonadal tubules or in the longitudinal fold, surrounded by follicular cells (figure 4a). vitellogenic oocytes are characterized by larger size than previtellogenic oocytes, have separated from the tubular wall and longitudinal folds, have a centric nucleus, and have formed a jelly layer. the final stage is the postvitellogenic oocyte. most of the post-vitellogenic oocytes were observed in the lumen of the gonadal tubules, with thicker jelly layer compared to vitellogenic oocytes (figure 4b). microvilli were found between follicular cells and oocytes, with thickness measured up to 5.028 µm. this was observed in vitellogenic oocytes (figure 4b). in post-vitellogenic oocytes, the follicular cells were found to be relatively smaller in size, located outside microvilli. microvilli in postvitellogenic oocytes were fewer and shorter than microvilli in vitellogenic oocytes, but had a jelly layer that at mean of 17.334 µm thickness (figure 4c). in male individuals, the presence of follicular cells accompanying spermatogenic cells could not be observed, but instead only parietal cells in the walls of the gonadal tubules was found inner epithelium of adult female gonads tubule a. rosettis was found to be composed of three types of cells; parietal somatic, follicular, and germ cells. the morphology of parietal somatic cells and follicular cells of male and female sample was almost the same, the difference was their position, in regard to oocyte, the follicular cells surrounded the oocyte, while parietal cells were in the inner side of tubule wall (figure 3b). gonad morphology gonad morphology of a. rosettis is presented in figure 5. from the individuals collected, there was a wide range of gonad coloration, ranging from creamy yellow, pinkish yellow, to orange. results showed that of all gonads identified at gametogenesis stage, 25% were colored yellow, the rest were orange. in mature stage, 50% gonads were yellow and the remaining 50% pink, while the gonads at spawning, post-spawning, and undetermined sex stages were all orange (figure 6). male individuals with orange gonads were found to be 21.62%, female individuals were 45.95% individuals, and undetermined sex individuals were 9.46%. the distribution of the number of male and female individuals related to the color of the gonads is presented in figure 7. correlation of reproductive phase to gonad and body wall weight individuals at a certain stage of maturity were found to have varying wall weights. at the gametogenesis stage, the body wall weight reaches 59.1 g, the mature stage has a body wall weight between 24.2-85.2 g, the spawning stage has a body wall weight between 28.8-29.3 g, the post-spawn stage weighs body wall between 28.6-57.5 g (figure 8). based on the wall weight data for each gonad maturity of female a. rosettis, during the gametogenesis stage the body wall weight reaches 35.9-63.3 g, the mature stage has a body wall weight between 18.7-57.7 g, the spawning stage has body wall weight between 21.6-45.1 g, the postspawning stage has a body wall weight between 25.7-56.4 g, while individuals with undetermined sex have a body wall weight between 32.7-62.1 g (figure 9). based on the result of spearman correlation test, the maturity stage of female a. rosettis correlated significantly with gonadal weight (p < jurnal riset biologi dan aplikasinya, 4(2): 83-89, september 2022 |88 0.05), but not with gonad weight. similar to it, in male a. rosettis, maturity stage was also found to be significantly related to gonadal weight (p < 0.05). sea cucumber a. rosettis has gonadal structure in long, branched tubules which open into a duct connected to outside environment. similar structures were also found in various other sea cucumber species, such as holothuria scabra (nontunha et al., 2020), holothuria floridana (ramos-miranda et al., 2017), and holothuria leucospilota (gaudron et al., 2008). as with other sea cucumber, a. rosettis did not show any apparent sexual dimorphism, so sex determination was carried out by microscopic methods to identify type of gamete cells present in the gonads. individuals used in this study was grouped into male, female, and undetermined, as also identified in previous study (leite-castro, et al., 2016). male individuals are indicated by the presence of spermatogenic cells, while female individuals by oogenic cells at various vitellogenic stages. all stages of reproduction from gametogenesis to postspawning could be found in both male and female sea cucumbers. meanwhile, undetermined individuals are individuals who are not found to have certain gamete cells in their gonadal tubules (leite-castro, et al., 2016), presumably because they are in the post-spawning phase. the histological structure development of the tubules at various stages of maturity was found to be similar to the tubular structure of holothuria scabra (rasolofonirina et al., 2007) and stichopus herrmanni (balogh et al., 2019). the observed reproductive phase in the population of a. rosettis from the madura strait tended to show a synchronous nature. the male gamete cells found to compose the inner epithelium of a. rosettis included spermatogonia, spermatocytes, and spermatozoa. spermatozoa ready to be spawned was indicated by round head structure with fairly long tail. this structure was found to be similar to spermatozoa from holothuria scabra (suphamungmee et al., 2018). the female gamete cells had a jelly layer that grows thicker as the oocyte matures, reaching up to 17.334 µm in the post-vitellogenic phase. this jelly layer can also be found in the oocyte of other species, such as holothuria forskali (laguerre et al., 2020). from macroscopic observations, the gonad of a. rosettis were found to have colors ranging from creamy yellow, pinkish, to orange. individuals with creamy yellow gonad color are in the reproductive phase of gametogenesis and maturation. pinkish gonad color was found in individuals in the reproductive maturation phase, while orange color was found in some reproductive phases, including spawning, post-spawning, to gametogenesis, but not in mature phase. based on gender, gonads with creamy yellow color were only found in male individuals, pinkish in female individuals, while orange color was found in both sexes and undetermined individuals. from these indications, orange gonad color could not be used to determine sex, but it was more likely to indicate the reproductive phase of a. rosettis individuals. as also found in australopithecus mollis, color of gonads is associated with the maturity of the female gonads, which can also be used to estimate spawning time (morgan, 2009). orange gonad color appeared in a. rosettis ranging from spawning, post-spawning, undetermined (spent gonad) up to gametogenesis stage, but did not appear during the maturation stage. thus, orange color possibly indicated changes in gonadal tubules to prepare for the release of the gamete cells after they have matured inside the tubules, for example an increase in the amount of nutrients in the tubular wall. the color of the tubules then changes when they enter the gametogenesis stage to maturation. in male individuals, it was indicated by a creamy yellow color tendency, while in female individuals, it was indicated by a pinkish color. gonad color in reproductive stage of gametogenesis until maturation can be used to determine sex. based on result of statistical test, both in female and male a. rosettis samples, maturity stage was correlated significantly to gonad weight, but not with body wall weight. as the gonadal weight changes through various maturity stages, it also indicates the development of gamete cells until they are ready to be spawned. on the other hand, the body wall of sea cucumbers contained various important nutrients used by sea cucumbers to survive, so they are often consumed as food or medicine (zhong, et al., 2007; gao, et al., 2011). as a source of energy for gametogenesis and reproductive cycles, nutrients from the body wall were channeled to the gonads, this would usually be indicated by decrease in body wall weight and color changes. although not significant in the current study, in other study from cucumaria frandosa showed that although the weight of body wall did not change, there was a decrease in energy levels in the body wall when there was an increase of energy 89 | winarni et al; sex determination of sea cucumber acaudina rosettis from madura straits, indonesia in the gonads as the reproductive cycle progresses (hamel & mercier, 1996). conclusion based on the current study, sex determinants of a. rosettis that can be used were color of gonads in the reproductive phase of gametogenesismaturation, where male individual was found to have creamy yellow color while female had a pinkish color. orange color was found in male, female, and undetermined individuals during the spawning to gametogenesis reproductive phase, thus it could not be used as a differentiator but to indicate the spawning period. gonad weight and body wall weight also did not differ between females and males, but their variations could also indicate a. rosettis reproductive phase. references balogh, r., wolfe, k., & byrne, m. (2019). gonad development and spawning of the vulnerable commercial sea cucumber, stichopus herrmanni, in the southern great barrier reef. journal of the marine biological association of the united kingdom, 99(2), 487– 495. https://doi.org/ 10.1017/s0025315418000061 gao, f., xu, q., fei, g., qiang, x. u., & yang, h. (2011). seasonal biochemical changes in composition of body wall tissues of sea cucumber apostichopus japonicus. chinese journal of oceanology and limnology, 29(2), 252-260. https://doi.org/10.1007/s00343-011-0041-7 gaudron, s. m., kohler, s. a., & conand, c. (2008). reproduction of the sea cucumber holothuria leucospilota in the western indian ocean: biological and ecological aspects. invertebrate reproduction and development, 51(1), 19–31. https://doi.org/10.1080/07924259.2008.9652253. hamel, j-f. & mercier, a. (1996). studies on the reproductive biology of the atlantic sea cucumber cucumaria frondosa. spc beche-de-mer information bulletin, 8. laguerre, h., raymond, g., plan, p., améziane, n., bailly, x., & le chevalier, p. (2020). first description of embryonic and larval development, juvenile growth of the black sea-cucumber holothuria forskali (echinodermata: holothuroidea), a new species for aquaculture in the north-eastern atlantic. aquaculture, 521, 734961. https://doi.org/10.1016/j.aquaculture.2020.734961 leite-castro, l.v., de souza junior, j., salmito-vanderley, c.s.b., nunes, j.f., hamel, j.f., & mercier, a. (2016). reproductive biology of the sea cucumber holothuria grisea in brazil: importance of social and environmental factors in breeding coordination. marine biology 163(3), 1–13. doi: 10.1007/s00227016-2842-x/figures/7 morgan, a. d. (2009). spawning of the temperate sea cucumber, australostichopus mollis (levin). journal of the world aquaculture society, 40(3), 363–373. https://doi.org/10.1111/j.1749-7345.2009.00256.x nontunha, n., chaichotranunt, s., poomtong, t., tinikul, y., sobhon, p., & suphamungmee, w. (2020). oocyte development and maturation in the sea cucumber, holothuria scabra. agriculture and natural resources, 54, 491–498. https://li01.tcithaijo.org/index.php/anres/article/view/248301/169 754. o’loughlin, p. m. & ong, j.y. (2015). new tropical caudinid and synaptid sea cucumbers from the johor straits (echinodermata: holothuroidea). the raffles bulletin of zoology, supplement 31, 292-302. ramos-miranda, j., del río-rodríguez, r., floreshernández, d., ramón, ·, rojas-gonzález, i., mónica gómez-solano, juárez-camargo, p. (2017). reproductive cycle of the sea cucumber holothuria floridana in the littorals of campeche, mexico. fisheries science, 83, 699–714. https://doi.org/10.1007/s12562-017-1100-6 rasolofonirina, r., vaitilingon, d., eeckhaut, i., & jangoux, m. (2007). reproductive cycle of edible echinoderms from the southwestern indian ocean, ii: the sandfish holothuria scabra (jaeger, 1833). western indian ocean journal of marine science, 4(1), 61-75. https://doi.org/10.4314/wiojms.v4i1.28474 suphamungmee, w., nontunha, n., chaichotranunt, s., tinikul, y., poomtong, t., & sobhon, p. (2018). electron microscopy reveals the ultrastructure and the chromatin organization of holothuria scabra male germ cells. songklanakarin journal of science and technology, 40(2), 321–328. https://doi.org/10.14456/sjst-psu.2018.42 widianingsih, w., zaenuri, m., anggoro, s., kusumaningrum, h. p., & hartati, r. (2018). preliminary study on gonad maturity stages of the sea cucumber paracaudina australis from kenjeran water, surabaya, indonesia. iop conference series: earth and environmental science, 116(1), 12035. https://doi.org/10.1088/1755-1315/116/1/012035 widianingsih, w., zaenuri, m., anggoro, s., & kusumaningrum, h. p. s. (2016). nutritional value of sea cucumber paracaudina australis (semper, 1868). aquatic procedia, 7, 271–276. https://doi.org/10.1016/j.aqpro.2016.07.038 winarni, d., affandi, m., masithah, e. d., & alfinda, n. k. (2014). struktur komunitas teripang di pantai timur surabaya. jurnal matematika dan ilmu pengetahuan alam, 17(1), 1–6. winarni, d., khaleyla, f., damayanti, h., nugraha, y.f., utami, c.s., oktafiani, d., lestari, l.i., darmanto, w. & hayati, a. (2015). reproductive peak, gonadal cycle, and gametogenic cells determination of sea cucumber paracaudina australis from madura strait, east java, indonesia. international journal of academic reesearch 7, 112-115. zhong, y., khan, m.a., & shahidi, f. (2007). compositional characteristics and antioxidant properties of fresh and processed sea cucumber (cucumaria frondosa). journal of agricultural and food chemistry, 55(4), 1188–1192. https://doi.org/10.1021/jf063085h 38 | fikriani et al. the comparison of sars-cov-2, sars-cov, and mers-cov jurnal riset biologi dan aplikasinya, volume 3, issue 1, march 2021 the comparison of sars-cov-2, sars-cov, and mers-cov genome and spike protein variations choirun nita fikriani1, i kade karisma gita ardana 1, dwi listyorini1,2* 1department of biology, faculty of mathematics and natural sciences, universitas negeri malang 2department of biotechnology, faculty of mathematics and natural sciences, universitas negeri malang jln. semarang 5, malang, east java 65145, indonesia *corresponding author: e-mail: listyorini.aljabari@um.ac.id article history abstract received : 20 february 2021 sars-cov-2 is a virus that has caused covid-19 pandemic. this virus is a new variant of the sars-cov virus and also closely related to mers-cov, which caused similar acute respiratory infections. all these viruses recognize target cells by binding to the receptor binding domain (rbd) on spike protein with receptors. this study aimed to determine the sars-cov-2, mers-cov, and sars-cov genome structure, spike protein sequence differences, and variations of rbd’s receptor binding motif (rbm). this research was using data mining approach. genome sequences were downloaded from ncbi, except for indonesian samples were downloaded from gisaid. genomic structures, spike sequence, and rbd structure were analyzed using bioedit, followed by protein modelling using swissmodel and pymol applications. the result showed that the sars-cov-2, mers-cov, and sars-cov genome shared the same genes yet in different numbers and length. sars-cov-2 spike protein sequence was quite similar to sars-cov spike protein, but very different to the spike protein of mers-cov. there were variations of rbd’s rbm structure due to the mutations occurred among these viruses. it is suggested that these differences may increase the affinity between sars-cov-2 spike protein to its hace2 receptor which caused sarscov-2 becomes more infective and spread wider than sars-cov and mers-cov, in turn. this result expected to be basic information for the development of sarscov-2 introduction inhibition agent and spreading prevention. revised : 14 march 2021 approved : 22 march 2021 published : 31 march 2021 keywords sars-cov-2; mers-cov; sars-cov; spike protein; corona virus genome;rbm how to cite: fikriani, c.n., ardana, i.k.k.g., & listyorini, d. (2021). the comparison of sars-cov-2, sars-cov, and mers-cov genome and spike protein variations. jurnal riset biologi dan aplikasinya, 3(1):38-44. doi: https://doi.org/10.26740/jrba.v3n1.p38-44. introduction sars-cov-2 is a virus that has caused covid-19 pandemic (sahu et al., 2020). the first case of covid-19 pandemic was reported in wuhan, china at the end of december 2019, however cross contamination is estimated to have occurred at the end of november or early december 2019 (mizumoto & chowell, 2020). on march 2, 2020 indonesia reported two confirmed cases of covid-19 (tosepu et al., 2020). sars-cov-2, sars-cov, and mers-cov belong to the same genus, namely beta-coronavirus but differ in their subgenus (saha et al., 2020). all of these viruses cause similar infections in the respiratory tract. mers-cov has caused middle east respiratory syndrome (mers) with the first case in zarqa, jordan on 4 april 2012 (zhu et al., 2020) while sars-cov caused an outbreak of severe acute respiratory syndrome (sars) in east asia (wu et al., 2020) with the first case in foshan, china on november 16, 2002 (zhu et al., 2020). sars-cov-2 recognizes target cells by hydrogen bonding some amino acids with the angiotensin converting enzyme 2 (ace2) protein (wan et al., 2020). protein viral that are responsible for introducing to host cells are known as spike protein especially in the receptor binding domain (rbd) (xia et al., 2020). the bond between rbd and ace2 protein is mediated by several major amino acids or receptor binding motif (rbm) jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi mailto:listyorini.aljabari@um.ac.id https://doi.org/10.26740/jrba.v3n1.p30-367 jurnal riset biologi dan aplikasinya, 3(1): 38-44, march 2021 | 39 (watanabe et al., 2020). sars-cov and merscov also recognize target cells by binding rbd to receptors (hoffmann et al., 2020). mers-cov uses dipeptidyl peptidase (dpp4) as the main receptor (zhou et al., 2020) while sars-cov uses ace2 protein as one of the receptor (devaux et al., 2020). the binding of viral proteins to host cells is very important in the search for an agent to prevent infection. a comparative understanding of sarscov-2, sars-cov, and mers-cov genome structure, spike protein sequence differences, receptor binding motif of receptor binding domain variations revealed in this research were expected to provide an overview of the molecular background which leads to the development of currently unpredicted spreading behavior. furthermore, it also expected that this result would be able to become a source of scientific basic information in the development of candidates for the prevention of virus introduction into host cells and treatment of covid-19. materials and methods the samples in this study were genomic structures and spike protein sequences from sarscov-2, mers-cov, and sars-cov viruses, which were obtained through data mining process from ncbi (https://www.ncbi.nlm.nih.gov) and gisaid (https://www.gisaid.org/) available from march 2020 to june 2020. this research was initiated by downloading genome sequences of sars-cov-2, mers-cov, and sars-cov viruses from ncbi, then analyzing the structure of its structure. to find out the differences of spike protein sequences, the entire sequence of spike gene was downloaded in fasta (.fas) format from ncbi, except of samples from indonesia were obtained from gisaid. open reading frame (orf) was identified using ncbi orf-finder. to determine its differences, spike protein sequences from all samples were aligned using bioedit. multiple alignments of rbd fragments were carried out to identify the rbm differences among those three viruses. protein modelling was carried out using a modeling application in the swissmodel (https://swissmodel.expasy.org) to determine the possible changes occurred. in order to further analysis of the differences in its protein structures due to the mutation found, the superimposition alignment process was carried out using pymol application. the conserved domain was marked and the conformation variations were marked in different color. result and discussion the comparison of sars-cov-2, sars-cov, and mers-cov genome sars-cov-2, sars-cov, and mers-cov genome consisted of 11, 13, and 10 structural and functional genes, which spans for 29.9 kbp, 29.8 kbp, and 30.1 kbp in length, respectively. each gene encodes structural proteins or functional ones. structural genes including membrane (m), envelope (e), nucleocapsid (n), and spike (s), while functional ones consist of several orfs which encodes various proteins including some polymerase enzymes for genome replications (orf1a and orf1ab) and accessories proteins (orf3s up to orf10). looking more carefully on the number and type of genes bears by each virus, we found that all three are bearing some different orf genes. orf1a and orf1ab found in sars-cov-2, sars-cov, and mers-cov, while orf6, orf7a, and orf7b are shared only by sars but not mers corona viruses. orf3, orf4a, orf4b, and orf5 are exclusively found in mers but not sars corona virus, while orf3b, orf8a, orf9a, and orf9b are exclusively found in sars-cov, while orf3a, orf8, and orf10 are exclusively found in sars-cov-2 (figure 1). considering its length and total number of genes, it unveiled that sars-cov-2 & sarscov bear additional gene/s with smaller size compared to mers-cov. it is suggested that genes length do not significantly affect its function. sars-cov-2, sars-cov, and mers-cov share the same structural genes in different length. s, m, n, e genes respectively spend 3822 bp, 669 bp, 1260 bp, 228 bp length in sars-cov-2; 4068 bp, 660 bp, 1243 bp, 249 bp in mers-cov; and 3768 bp, 666 bp, 1269 bp, 231 bp in sars-cov. a slight difference in its length seems also not to affect the proteins encoded. all three demonstrate a full normal physical structure with intact functions. furthermore, focusing on spike protein which plays important role on host recognition, we suggest that 246 bp deletion (82 amino acid shorter) compared to sars-cov spike protein may affect significantly on its protein structure and its function in turn, since protein structure is important in virus shape and morphogenesis (xu et al., 2020). some mutations in sars-cov-2 spike gene have been suggested to be the culprit of this virus different spreading behavior (hartenian et al., 2020). it is supported with the fact https://www.ncbi.nlm.nih.gov/ https://www.gisaid.org/ https://swissmodel.expasy.org/ 40 | fikriani et al. the comparison of sars-cov-2, sars-cov, and mers-cov that spreading rate of sars-cov-2 is higher than sars-cov and mers-cov (zhu et al., 2020). sars-cov spread across 220 countries, sars-cov only spread in 4 countries, and mers-cov spread in 27 countries (who, 2020). indonesian national health ministry (2020) reported that sars-cov-2 was spread across all provinces in indonesia. variation of spike protein sequence in this study we collected 12 samples available from asian, european, and american countries representatives during the data mining time-line of this research. as much as 4 spike rna sequences of sars-cov-2, mers-cov, and sars-cov were downloaded. the accession numbers and protein identity numbers were recorded as of its availability in order to trace back once it was required (table 1). the differences of sars-cov-2, mers-cov, and sars-cov spike protein sequences from each country were identified using multiple alignments which revealed that from 12 samples there were only 2 amino acid differences in sars-cov-2 (table 2), while sars-cov and mers-cov bear 4 (table 3) and 5 (table 4) differences, respectively. from this finding and the fact of the wider area of sars-cov-2 spreading compared to sars-cov and mers-cov, it suggested that the number of mutations could not be a sole reason for its ability to spread, and other factors should be considered, including its receptor in the target cells or organisms. there was no available data on both sars-cov and mers-cov from indonesia. however, learning from the collected samples, china variant of sars-cov bears more mutation than those of other 3 samples. meanwhile it is more random mutation in mers-cov regarding the area (table 3 and 4). yet, since the available data until the end of the research due was very limited, it is not possible to claim any clear conclusion on the mutation rate or its tendency. a phylogenetic approach and additional data are required to understand better for this case. multiple alignment of all samples indicated that spike protein of sarscov-2 has a high similarity to the sars-cov while both sars-cov-2 and sars-cov showing a significant difference to mers-cov. sars-cov-2 spike protein of indonesian samples bear two different amino acid compared to china (wuhan), france, and usa (table 2), while sarscov spike protein is known to have 4 different amino acids (table 3) and mers-cov are 5 different amino acids (table 4). sequence differences by means of any types of mutation or as a natural variation may change the amino acid sequences, which in turn gives rise to a functional divergence of its encoded protein (hulswit et al., 2016), virulence (sicari et al., 2020) and pathogenesis of the virus (mousavizadeh & ghasemi, 2020; abdullahi et al., 2020). spike protein of corona viruses plays role as an intermediary for the introduction of the virus with its receptors on the host cell (xia et al., 2020); it facilitates the fusion of the host cell as the first step of infection (chakraborty & bhattacharjya, 2020). during the infection process, conformation is induced when the virus enters the endosome of the host cell (bai & warshel, 2020). figure 1. genome structure a. sars-cov-2, b. sars-cov, and c. mers-cov jurnal riset biologi dan aplikasinya, 3(1): 38-44, march 2021 | 41 table 1. the data origin of spike (s) gene sequences no. virus data origin sample origin accession number protein id 1 sars-cov-2 ncbi wuhan, china nc_045512.2 yp_009724390.1 2 sars-cov-2 gisaid jakarta, indonesia epi-isl-437192 3 sars-cov-2 ncbi usa fj882945.1 acz72035.1 4 sars-cov-2 ncbi france mt470142.1 qjt72590.1 5 mers-cov ncbi seoul, south korea kx034100.1 anc28711.1 6 mers-cov ncbi thailand kt225476.2 alo51904.1 7 mers-cov ncbi florida, usa kj829365.1 ahz64549.1 8 mers-cov ncbi france 9 sars-cov ncbi beijing, china ay864805.1 aay60780.1 10 sars-cov ncbi hong kong gu553363.1 adc35483.1 11 sars-cov ncbi tennessee, usa fj882945.1 acz72035.1 12 sars-cov ncbi italy ay323977.2 aap72986.1 table 2. sars-cov-2 spike (s) protein mutations no. country amino acid position 572 822 1. wuhan, china t l 2. france t l 3. jakarta, indonesia i f 4. usa t l table 3. sars-cov spike (s) protein mutations no. country amino acid position 77 244 436 863 1. beijing, china d t y t 2. hongkong g i y i 3. tennessee, usa g i h t 4. italy g i y t table 4 mers-cov spike (s) protein mutations no. country amino acid position 683 829 833 914 1193 1. seoul, south korea s s q q a 2. thailand s a q q a 3. tennessee, usa f s r q a 4. france s s q h s note: l = leusine, f = phenylalanine, d = aspartic acid, g = glycine, t = threonine, i = isoleucine, y = tyrosine, h = histidine, s = serine, a = alanine, q = glutamine, and r = arginine. table 5. receptor binding motif variations no. sars-cov-2 sars-cov mers-cov 1. asparagine (n439) arginine (r) proline (p) 2. leucine (l455) tyrosine (y) asparagine (n) 3. phenylalanine (f486) leucine (l) serine (s) 4. glutamine (q493) asparagine (n) glutamic acid (e) 5. glutamine (q498) tyrosine (y) leucine (l) 6. asparagine (n501) threonine (t) serine (s) the high similarity of spike protein sequence unveiled in this research may lead to the understanding of the introduction behavior of both sars-cov-2 and sars-cov which both bind to ace2 as the main receptor (wan et al., 2020). it may also clarify the difference among sars-cov-2 and sars-cov in one side and mers-cov in other side which binds to dipeptidyl peptidase-4 (dpp4) as its main receptor (zhou et al., 2020). 42 | fikriani et al. the comparison of sars-cov-2, sars-cov, and mers-cov we also unveiled the variations in the receptor binding motif, especially in its receptor binding domain (rbd). rbd in spike protein has an important role in determining affinity of the viral binding to introduce into the host cell (de wit et al., 2016). receptor binding motif in rbd sarscov-2 facilitates the binding to hace2 (walls et al., 2020). this variation already been reported to increase the affinity level of sars-cov-2 spike protein to hace2 which to be higher than its counterpart in sars-cov (shang et al., 2020). based on that fact it has been believed to be the reason why sars-cov-2 has become more infective than sars-cov (awasthi & sarkar, 2020). that behaviour suggested to be the result of amino acid residues differences (table 5; figure 2); phenylalanine (f486) in sars-cov-2 interacts with m82, l79, and y83 residues of ace2 while leucine in sars-cov interacts with m82 and l79 residues of ace2 residues (gussow et al., 2020). meanwhile glutamine (q493) in sars-cov-2 exhibits a good van der waals value resulting to the higher affinity than asparagine in sars-cov (figure 3). taken together, those revealed variations suggested to be the cause of higher spread rate of sars-cov-2 compared to sars-cov and mers-cov (zhu et al., 2020). further analysis on the binding affinity between spike protein and its receptors is being done currently. we expect to get better understanding on this virus behavior and find clue in controlling its spreading. figure 2. the difference of receptor binding motif between sars-cov-2, sars-cov, and mers-cov jurnal riset biologi dan aplikasinya, 3(1): 38-44, march 2021 | 43 a c b figure 3. a. receptor binding domain on spike protein, b & c receptor binding motif on receptor binding domain area (yellow=asparagine-arginine, dark blue=leucine-tyrosine, orange=phenylalanine-leusine, green=glutamine-asparagine, red=glutaminetyrosine, and blue=asparagine-threonine) figure 4 receptor binding motif: blue = sars-cov-2 and green = sars-cov figure 4 receptor binding motif: blue = sars-cov-2 and green = sars-cov a. asparagine-arginine, b. leusin-tyrosine, c. phenylalanine-leusine d. glutamine-asparagine, e. glutaminetyrosine, and f. asparagine-threonine conclusion this study revealed that sars-cov-2, mers-cov, and sars-cov genome has the same types of genes with different length, numbers, and sequences. the spike protein sequence of sarscov-2 was quite similar to the spike protein of sars-cov, yet very different from the spike protein of mers-cov. among sars-cov-2, mers-cov, and sars-cov we also revealed the rbm variations of spike’s rbd. we conclude that those variations may cause the different behavior in its introduction process, which leads to the wider spreading of sars-cov-2. current study is working to unveil the binding behavior of this virus. acknowledgements the authors would like to express our gratitude to lp2m universitas negeri malang. this research was funded by hibah skripsi scheme of pnbp um year 2020 to d.l. and c.n.f. references abdullahi, i. n., emeribe, a. u., ajayi, o. a., oderinde, b. s., amadu, d. o., & osuji, a. i. (2020). implications of sars-cov-2 genetic diversity and mutations on pathogenicity of the covid-19 and biomedical interventions. journal of taibah university medical sciences, 15(4), 258–264. https://doi.org/10.1016/j.jtumed.2020.06.005 awasthi, m., & sarkar, d. p. (2020). n-terminal domain ( ntd ) of sars-cov-2 spikeprotein structurally resembles mers-cov ntd sialoside-binding pocket. 1–11. bai, c., & warshel, a. (2020). critical differences between the binding features of the spike proteins of sarscov-2 and sars-cov. journal of physical chemistry b, 124(28), 5907–5912. https://doi.org/10.1021/acs.jpcb.0c04317 chakraborty, h., & bhattacharjya, s. (2020). mechanistic insights of host cell fusion of sars-cov-1 and sars-cov-2 from atomic resolution structure and membrane dynamics. biophysical chemistry, 265(june), 106438. https://doi.org/10.1016/j.bpc.2020.106438 de wit, e., van doremalen, n., falzarano, d., & munster, v. j. (2016). sars and mers: recent insights into emerging coronaviruses. nature reviews microbiology, 14(8), 523–534. https://doi.org/10.1038/nrmicro.2016.81 devaux, c. a., rolain, j. m., & raoult, d. (2020). ace2 receptor polymorphism: susceptibility to sarsgreen=glutamine-asparagine, red=glutaminetyrosine, and blue=asparagine-threonine a b c d e f a # f # e # d # c # b 44 | fikriani et al. the comparison of sars-cov-2, sars-cov, and mers-cov cov-2, hypertension, multi-organ failure, and covid-19 disease outcome. journal of microbiology, immunology and infection, 53(3), 425–435. https://doi.org/10.1016/j.jmii.2020.04.015 gussow, a. b., auslander, n., faure, g., wolf, y. i., zhang, f., & koonin, e. v. (2020). genomic determinants of pathogenicity in sars-cov-2 and other human coronaviruses. proceedings of the national academy of sciences of the united states of america, 117(26), 15193–15199. https://doi.org/10.1073/pnas.2008176117 hartenian, e., nandakumar, d., lari, a., ly, m., tucker, j. m., & glaunsinger, b. a. (2020). the molecular virology of coronaviruses. journal of biological chemistry, 295(37), 12910–12934. https://doi.org/10.1074/jbc.rev120.013930 hoffmann, m., kleine-weber, h., schroeder, s., krüger, n., herrler, t., erichsen, s., schiergens, t. s., herrler, g., wu, n. h., nitsche, a., müller, m. a., drosten, c., & pöhlmann, s. (2020). sars-cov-2 cell entry depends on ace2 and tmprss2 and is blocked by a clinically proven protease inhibitor. cell, 181(2), 271-280.e8. https://doi.org/10.1016/j.cell.2020.02.052 hulswit, r. j. g., de haan, c. a. m., & bosch, b. j. (2016). coronavirus spike protein and tropism changes. in advances in virus research (1st ed., vol. 96). elsevier inc. https://doi.org/10.1016/bs.aivir.2016.08.004 mizumoto, k., & chowell, g. (2020). estimating the risk of 2019 novel coronavirus death during the course of the outbreak in china, 2020. medrxiv, 191–192. https://doi.org/10.1515/9780822396086-023 mousavizadeh, l., & ghasemi, s. (2020). genotype and phenotype of covid-19: their roles in pathogenesis. journal of microbiology, immunology and infection, xxxx, 0–4. https://doi.org/10.1016/j.jmii.2020.03.022 saha, o., shatadru, r. n., rakhi, n. n., islam, i., & rahaman, m. (2020). possible implications from the ongoing outbreak in bangladesh. sahu, k. k., mishra, a. k., & lal, a. (2020). comprehensive update on current outbreak of novel coronavirus infection (2019-ncov). annals of translational medicine, 8(6), 393–393. https://doi.org/10.21037/atm.2020.02.92 shang, j., ye, g., shi, k., wan, y., luo, c., aihara, h., geng, q., auerbach, a., & li, f. (2020). structural basis of receptor recognition by sars-cov-2. nature, 581(7807), 221–224. https://doi.org/10.1038/s41586-020-2179-y sicari, d., chatziioannou, a., koutsandreas, t., sitia, r., & chevet, e. (2020). role of the early secretory pathway in sars-cov-2 infection. journal of cell biology, 219(9), 1–13. https://doi.org/10.1083/jcb.20200600508132020 c tosepu, r., gunawan, j., effendy, d. s., ahmad, l. o. a. i., lestari, h., bahar, h., & asfian, p. (2020). correlation between weather and covid-19 pandemic in jakarta, indonesia. science of the total environment, 725. https://doi.org/10.1016/j.scitotenv.2020.138436 walls, a. c., park, y. j., tortorici, m. a., wall, a., mcguire, a. t., & veesler, d. (2020). structure, function and antigenicity of the sars-cov-2 spike glycoprotein. biorxiv, january. https://doi.org/10.1101/2020.02.19.956581 wan, y., shang, j., graham, r., baric, r. s., & li, f. (2020). receptor recognition by the novel coronavirus from wuhan: an analysis based on decade-long structural studies of sars coronavirus. journal of virology, 94(7), 1–9. https://doi.org/10.1128/jvi.00127-20 watanabe, y., allen, j. d., wrapp, d., mclellan, j. s., & crispin, m. (2020). site-specific glycan analysis of the sars-cov-2 spike. science, 369(6501), 330–333. https://doi.org/10.1126/science.abb9983 wu, y., ho, w., huang, y., jin, d. y., li, s., liu, s. l., liu, x., qiu, j., sang, y., wang, q., yuen, k. y., & zheng, z. m. (2020). sars-cov-2 is an appropriate name for the new coronavirus. the lancet, 395(10228), 949–950. https://doi.org/10.1016/s0140-6736(20)30557-2 xia, s., liu, m., wang, c., xu, w., lan, q., feng, s., qi, f., bao, l., du, l., liu, s., qin, c., sun, f., shi, z., zhu, y., jiang, s., & lu, l. (2020). inhibition of sars-cov-2 (previously 2019-ncov) infection by a highly potent pan-coronavirus fusion inhibitor targeting its spike protein that harbors a high capacity to mediate membrane fusion. cell research, 30(4), 343–355. https://doi.org/10.1038/s41422020-0305-x xu, r., shi, m., li, j., song, p., & li, n. (2020). construction of sars-cov-2 virus-like particles by mammalian expression system. frontiers in bioengineering and biotechnology, 8(july), 1–6. https://doi.org/10.3389/fbioe.2020.00862 zhou, p., yang, x. lou, wang, x. g., hu, b., zhang, l., zhang, w., si, h. r., zhu, y., li, b., huang, c. l., chen, h. d., chen, j., luo, y., guo, h., jiang, r. di, liu, m. q., chen, y., shen, x. r., wang, x., … shi, z. l. (2020). a pneumonia outbreak associated with a new coronavirus of probable bat origin. nature, 579(7798), 270–273. https://doi.org/10.1038/s41586-020-2012-7 zhu, z., lian, x., su, x., wu, w., marraro, g. a., & zeng, y. (2020). from sars and mers to covid-19: a brief summary and comparison of severe acute respiratory infections caused by three highly pathogenic human coronaviruses. respiratory research, 21(1), 1–14. https://doi.org/10.1186/s12931-020-01479-w. jurnal riset biologi dan aplikasinya, volume 4, issue 2, september 2022 the effect of water concentration on growth media on lipid production by oleaginous fungi isolate br 2.2 herin yoga lesti1, miftahul ilmi2* faculty of biology, universitas gadjah mada, jl. teknika sel., senolowo, sinduadi, kec. mlati, kabupaten sleman, daerah istimewa yogyakarta 55281 *corresponding author: e-mail: m.ilmi@ugm.ac.id article history abstract received : 1 july 2022 oleaginous fungi are one of the microorganisms that can accumulate a high number of biomasses quickly (within 96-130 hours) and are often used to produce lipids. the growth of fungi depends on the chemical composition of the environment in which it grows. the growth media of fungi must contain high carbohydrates as a source of nutrients and high nitrogen content. one of the carbon sources that fungi can use in the growth process is glucose. br 2.2 isolate is an oleaginous fungus capable of accumulating 28.44% lipids from the total dry biomass with glucose as a carbon source in 50 ml of growth media. therefore, this study was conducted to determine the effect of variations in the volume of media and incubation time on the production of biomass and lipid isolate br 2.2. biomass and lipid production were analyzed at media with additional water volumes of 10, 20, 30, 40, and 50 ml with 48, 96, and 144 hours of incubation times. the results showed that lipid accumulation and biomass production increased with the reduction of water content in the growth media and reached the highest number in the media volume of 20 ml with an incubation time of 144 hours, i.e., 0.87±0.04 g/l and 12.53±0.29 g/l. it can be concluded that biomass and fungal lipid increased along with incubation time and nutrient concentration. revised : 4 august 2022 approved : 12 september 2022 published : 30 september 2022 keywords oleaginous fungi, glucose, water content, lipid, biomass how to cite: lesti, h.y & ilmi, m. 2022. the effect of water concentration on growth media on lipid production by oleaginous fungi isolate br 2.2. jurnal riset biologi dan aplikasinya, 4(2):51-56. doi: 10.26740/jrba. v4n2.p.51-56. introduction fungi is a group of multicellular and filamentous eukaryotic microorganisms. fungi cells do not contain chlorophyll, resulting in the inability of fungi to carry out the photosynthesis process. therefore, fungi are chemo-organoheterotrophs that obtain energy through oxidation of organic compounds. fungi is an aerobic microorganism that requires oxygen to survive (fifendy, 2017). microorganisms have a high productivity level with a low need for a growth media. microorganisms that can accumulate lipid biomass above 20% are called oleaginous fungi. these microorganisms are often used in lipid production during the growth of secondary metabolites under conditions of excess carbon and limited nutrients. (sergeeva et al., 2008). the high lipid accumulation can be up to 80% compared to bacteria or microalgae and is generally dominated by triglycerides (dey et al., 2014). oleaginous fungi are widely used as a source of lipids in biodiesel production. the use of oleaginous fungi is based on several advantages in the industrial sector compared to other plants and microalgae, namely, oleaginous fungi are easy to grow in bioreactors and have a short life cycle. its short life cycle indicates a fast growth rate of oleaginous fungi and is not affected by space, light, or climate change (shafiq & chechan, 2019). in addition to their short life cycle, these microorganisms have a high growth rate and biomass density and can be grown in conventional bioreactors to maximize yield and productivity. in addition, cells from filamentous fungi are generally easier to harvest than algae and yeasts, especially jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi mailto:m.ilmi@ugm.ac.id jurnal riset biologi dan aplikasinya, 4(2): 51-56, september 2022 | 52 when grown in the form of pellets or mycelia (yang et al., 2019). growth media is divided into three types based on density: solid, semisolid, and liquid media (broth). growth in a solid media generally shows the formation of colonies on the surface of the media, while growth in a liquid media is characterized by increasingly cloudy liquid. the turbidity is caused by the multiplication of microorganism cells (murwani, 2015). each type of microorganism requires a different growth media adapted to each microorganism's nutritional needs. microorganisms need about ten macro elements, namely carbon (c), oxygen (o), hydrogen (h), nitrogen (n), sulfur (s), phosphorus (p), potassium (k), calcium (ca), magnesium (mg), and iron (fe). the first six macro elements are used to synthesize carbohydrates, lipids, proteins, and nucleic acids, while the other four are present in cells as cations. in addition to macro elements, microorganisms also need several microelements such as manganese (mn), zinc (zn), cobalt (co), molybdenum (mo), nickel (ni), and copper (cu). microelements are generally part of enzymes and cofactors (basu et al., 2015). in general, the growth of microorganisms can include two major processes: solid-state fermentation (ssf) and submerged fermentation (smf). ssf is a process for the growth of microorganisms under uncontrolled conditions without the use of excess water during the process (mienda & idi, 2011). smf is a process of growing microorganisms in a liquid media with the optimization of appropriate nutrients. the process involves the growth of microorganisms in a closed reactor containing a fermentation media and a high oxygen concentration (doriya et al., 2016). however, in lipid production, smf method is considered too expensive due to the high cost of bioreactors and substrates (meeuwse, 2011). the large quantity of substrate produced makes it difficult for the substrate disposal process and affects the cost used. smf is known to be so sensitive that it is susceptible to infection, resulting in yield loss and total breakdown of individual batches (manpreet et al., 2005). the main object used in this study was the oleaginous fungi isolate br 2.2, which was isolated from the baturraden botanical gardens, central java, indonesia. a previous study (rizki & ilmi, 2021) found that br 2.2 isolate had the highest lipid concentration (28.44%) of the 19 isolates. in a previous study, lipid production by oleaginous fungi isolates br.2.2 still used the smf method. therefore, with the high cost and the amount of air used by smf, it is necessary to research reducing air in lipid production by br.2.2 oil isolate to make it more economical. departing from the production of isolates obtained, this research is expected to produce a high lipid content with water that is not excessive. materials and methods the research started with the process of rejuvenation and manufacture of spore suspension of br 2.2 isolate. starting from the suspension, lipid production was carried out in the growth media using a shaker incubator subculture of br 2.2 isolate subculture of br 2.2 isolate was made by inoculation technique from culture stock available at the microbiology laboratory, faculty of biology, gadjah mada university. the isolates were inoculated into a potato dextrose agar (pda) growth media slant in a test tube and incubated for 14 days in an incubator at room temperature. suspension preparation and spore calculation of br 2.2 isolate the fungi spore suspension was prepared using the subcultured isolates on slanted pda grown for 14 days. the growth media was added with 10 ml of distilled water mixed with 0.01% triton. using a loop needle, the isolates were suspended by carefully threshing the spores immersed in 0.01% triton solution. the suspension was put into a sterile glass bottle, then tightly closed and stored until used. the number of spores in the suspension was calculated by graded dilution. the dilution results were then calculated using a spectrophotometer at 550 nm. pda was then inoculated using the spread plate method for 14 days based on the concentration obtained. colonies that grow are counted to get total plate count (tpc). the number of microbes in colony forming unit (cfu)/ml from each dilution was obtained. the data spectrophotometer and tpc were used to create a standard curve between abs and cfu/ml values. making growth media with variations of water content fungi biomass production was carried out by the batch fermentation method. the production media is composed of kh2po4 0.125 gr; znso4.h2o 53|lesti & ilmi; the effect of water concentration on growth media on lipid production 0.0005 gr; cuso4.5h2o 0.00005 gr; mnso4 0.0005 gr; mgso4.7h2o 0.025 gr; feso4.7h2o 0.001 gr; cacl2 0.005 gr; yeast extract 0.05 gr; kno3 0.05 gr; glucose 1.5 gr; and varied distilled water amounts (50, 40, 30, 20, and 10 ml). the ph in the media was adjusted to ph 5.5 using hcl and naoh (somashekar et al., 2002). the media was sterilized using an autoclave at a temperature of 121°c with a pressure of 1 atm for 15 minutes. lipid production from br 2.2 with variations in water content an amount of 3.85 ml spore suspension representing 102 cfu was inoculated into media with additional water of 50 ml, 40 ml, 30 ml, 20 ml, and 10 ml. each media variation was carried out in three replications and grown for 48, 96, and 144 hours at 28 °c. the lipid production process was carried out using a shaker at 130 rpm. the formed biomass was separated from the media by filtration using whatman filter paper no. 1. to ensure that no media left, the biomass were washed with sterile distilled water twice fungi biomass calculation and lipid extraction the biomass calculation was carried out on the dry weight of the fungi mycelium. the fungi mycelium was filtered using filter paper (whatman no. 1; diameter 15 cm/150 mm) which was dried in the oven for 24 hours and weighed. the dried biomass was weighed periodically until it reaches a constant weight. the difference between initial and final weight was taken as the dry weight of fungi biomass (barboráková et al., 2012). lipid extraction was carried out by crushing the dry biomass produced by the br.2.2 oleaginous fungi and then homogenized with acid sand in a ratio of 1:2. the homogenization results were then added with chloroform and methanol as much as 20 times the total weight of biomass and acid sand. the ratio of chloroform: methanol added to the mixture of biomass and acid sand was 2:1 (axelsson & gentili, 2014). the mixture was vortexed until each component mixed and then centrifuged for 10 minutes at a speed of 4000 rpm. the supernatant containing lipid was transferred into a sterile 15 ml vial bottle previously weighed and then placed in the oven for the evaporation process. after all, the solvent was evaporated, and only the lipid remains, the bottle is weighed again. lipid accumulation was expressed as grams of lipid per liter of growth media and the percentage of grams of lipid per dry biomass (somashekar et al., 2002). data analysis the analysis was carried out using two-way anova analysis followed by duncan's post-hoc test with the ibm spss statistics 22 application to see a significant difference in the study results with p< 0.05. results and discussion judging from the average data testing results using duncan's analysis test with a significance of p<0.05, it shows that the incubation times of 48 hours, 96 hours, and 144 hours are significantly different. this is indicated by a superscript symbol that differs between incubation times. the incubation time of 48 hours has a mean total biomass yield of 4.54 g/l marked with a superscript symbol a, and an incubation time of 96 hours has an average total biomass yield of 7.17 g/l with a superscript symbol b. an incubation time of 144 hours has a mean biomass yield of—total 9.97 g/l with superscript symbol c. in addition, that the increase in incubation time is directly proportional to the total biomass production produced by br 2.2 isolates, which is indicated by a gradual increase in the average total biomass yield concerning incubation time. viewed from the average total biomass yield based on variations in the volume of media, average biomass yields of 10, 20, 30, 40, and 50 ml are 6.20, 12.53, 9.85, 4.12, and 3.44 g/l, respectively. based on the figure 1, it can be seen that the orange bar shows the results of the treatment for the production of br 2.2 isolate at media with additional 20 ml volume of water. the orange diagram in the 144-hour incubation group had the highest yield compared to the total biomass production under other conditions, which is 12.53 g/l. based on the data shown in figure 2, there is a gradual increase in lipid production in all variations of the water volume of the media. like the results in the test to calculate total biomass, the results in this test, when viewed from the aspect of incubation time, it can be seen that the increase in incubation time is directly proportional to the lipid produced by br 2.2 isolates in all variations of the media. jurnal riset biologi dan aplikasinya, 4(2): 51-56, september 2022 | 54 figure 1. comparison of water volume variations in medium and incubation time on biomass production of br 2.2. isolates. a: group with confidence interval of 2.828-4.717; b: group with confidence interval of 5.6 6.8; c: group with confidence interval of 9.25 10.45; d: group with confidence interval of 11.93 13.22 figure 2. comparison of water volume variations in medium and incubation time on lipid production of br 2.2. isolates. a: group with confidence interval of 0.38 0.54; b: group with confidence interval of 0.55 0.72; c: group with confidence interval of 0.79 0.95 these results, it was also obtained through duncan's test of significance p <0.05, showed that each incubation time was significantly different. the average lipid produced at an incubation time of 48, 96, and 144 hours was 0.49 g/l, 0.63g/l, and 0.75 g/l, respectively. meanwhile, when viewed from the variations of water addition onto media, the 10, 20, 30, 40, and 50ml media produced an average lipid of 0.63 g/l, 0.87 g/l, 0.64 g/l, 0.52 g/l, and 0.46 g/l, respectively. based on all the data presented in figure 2, the treatment at the media volume of 20 ml water for 144 hours produced the most lipids compared to other treatment conditions, namely 0.87±0.04 g/l. filamentous fungi have an important role in the industrial production of biological products and the fermentation industry due to their ability to secrete proteins and enzymes, high growth rates, ease of handling in large-scale production, and lowcost requirements for production compared to other 55|lesti & ilmi; the effect of water concentration on growth media on lipid production microorganisms. the fungi growing process results in high-quality biomass (high protein and fat content) (asadollahzadeh et al., 2018). filamentous fungi grow by elongation and branching of hyphae tips. the process involves the cytoplasm mass flow from the colony's center to the tip of the hyphae. in hyphae, there are porous septa that function to separate hyphae and have the potential to control the movement of molecules within the colony (daly et al., 2020). based on the data obtained, it can also be seen that the increase in incubation time is directly proportional to the total biomass production produced by the br 2.2 isolate, which is indicated by a gradual increase in the average total biomass yield. incubation time allows more fungi to grow, forming more biomass (hosseinpour et al., 2017). the concentration of nutrients in the media has been shown to affect the activity of fungi, especially on sporulation and oxygen consumption. increasing oxygen in culture can produce thicker cell walls than less oxygen, so the dry weight of the biomass formed will be greater. generally, the biomass produced and fungal activity increased with incubation time and nutrient concentration (fuentes et al., 2015). the process of accumulation of lipids in oleaginous fungi is known to produce polyunsaturated fatty acids (pufas) by the smf method and glucose as a source of c (meeuwse, 2011). based on the data shown in figure 2, there is a gradual increase in lipid production in all variations of the water volume of the media. this study resulted in data on the condition that the volume of 20 ml of media water for 144 hours had the most lipid accumulation compared to other treatment conditions, that is, 0.87±0.04 g/l. lipid accumulation by oleaginous fungi mostly occurs when nutrients in the growth media are limited and excess carbon sources are converted to tag storage. the limited supply of nitrogen (n), phosphorus (p), sulfur (s), iron (fe), or zinc (zn) is known to cause lipid accumulation in oleaginous fungi (wu et al., 2010). during the growth phase, the carbon source is regulated for cell growth and, consequently, low lipid content. when nitrogen concentration becomes limited, cell growth stops, and microbial metabolism shifts to lipid accumulation (vazquez-duhalt & greppin, 1987). a rapid decrease in lipid accumulation is seen when cultures are grown in media containing higher inorganic and organic nitrogen sources. at the same time, there will be a higher accumulation of biomass but lower lipid content. the low lipid accumulation that occurs due to the availability of sufficient amounts of nitrogen for producing reproductive enzymes leads to an increase in biomass rather than lipid accumulation. in terms of stress level, lower nitrogen salt concentration creates higher metabolic stress conditions in microbes which triggers lipid accumulation in cells much faster than higher nitrogen concentration where the stress level is relatively low (gohel et al., 2013). conclusion lipid accumulation and biomass production increased with the reduction of water content in the growth media. they reached the highest number in the media volume of 20 ml with an incubation time of 144 hours, i.e., 0.87±0.04 g/l and 12.53±0.29 g/l, respectively. the biomass produced and fungal activity increased with incubation time and nutrient concentration. therefore, even with limited water but high nutrient content, it could still achieve high biomass and lipid production yields without excessive substrate waste. acknowledgment this study was partially funded by universitas gadjah mada through rta project nr. 3143/un1.p.iii/dit-lit/pt/2021. references asadollahzadeh, m., ghasemian, a., saraeian, a., resalati, h., & taherzadeh, m. j. (2018). production of fungal biomass protein by filamentous fungi cultivation on liquid waste streams from pulping process, biores, 13(3), 5013-5031. https://bioresources.cnr.ncsu.edu/resources/produc tion-of-fungal-biomass-protein-by-filamentousfungi-cultivation-on-liquid-waste-streams-frompulping-process/. axelsson, m., & gentili, f. (2014). a single-step method for rapid extraction of total lipids from green microalgae. plos one, 9(2), e89643. https://doi.org/10.1371/journal.pone.0089643. barboráková, z., labuda, r., häubl, g., & tančinová, d. (2012). effect of glucose concentration and growth conditions on the fungal biomass, ph of media and production of fumagillin by a non-pathogenic strain penicillium scabrosum. journal of microbiology, 4, 466– 477.https://www.jmbfs.org/wpcontent/uploads/201 2/01/barborakova.pdf. basu, s., bose, c., ojha, n., das, n., das, j., pal, m., & khurana, s. (2015). evolution of bacterial and fungal https://bioresources.cnr.ncsu.edu/resources/production-of-fungal-biomass-protein-by-filamentous-fungi-cultivation-on-liquid-waste-streams-from-pulping-process/ https://bioresources.cnr.ncsu.edu/resources/production-of-fungal-biomass-protein-by-filamentous-fungi-cultivation-on-liquid-waste-streams-from-pulping-process/ https://bioresources.cnr.ncsu.edu/resources/production-of-fungal-biomass-protein-by-filamentous-fungi-cultivation-on-liquid-waste-streams-from-pulping-process/ https://bioresources.cnr.ncsu.edu/resources/production-of-fungal-biomass-protein-by-filamentous-fungi-cultivation-on-liquid-waste-streams-from-pulping-process/ https://doi.org/10.1371/journal.pone.0089643 https://www.jmbfs.org/wpcontent/uploads/2012/01/barborakova.pdf https://www.jmbfs.org/wpcontent/uploads/2012/01/barborakova.pdf jurnal riset biologi dan aplikasinya, 4(2): 51-56, september 2022 | 56 growth media. bioinformation, 11(4),182. https://doi.org/10.6026%2f97320630011182. daly, p., peng, m., mitchell, h. d., kim, y. m., ansong, c., brewer, h., de gijsel, p., lipton, m. s., markillie, l. m., nicora, c. d., orr, g., wiebenga, a., hildén, k. s., kabel, m. a., baker, s. e., mäkelä, m. r., & de vries, r. p. (2020). colonies of the fungus aspergillus niger are highly differentiated to adapt to local carbon source variation. environmental microbiology, 22(3), 1154–1166. https://doi.org/10.1111/1462-2920.14907. dey, p., mall, n., chattopadhyay, a., chakraborty, m., & maiti, m. k. (2014). enhancement of lipid productivity in oleaginous colletotrichum fungus through genetic transformation using the yeast ctdgat2b gene under model-optimized growth condition. plos one, 9(11), e0187171. https://doi.org/10.1371/journal.pone.0111253. doriya, k., jose, n., gowda, m., & kumar, d. s. (2016). solid-state fermentation vs submerged fermentation for the production of l-asparaginase. advances in food and nutrition research, 78, 115–135. https://doi.org/10.1016/bs.afnr.2016.05.003. fifendy, m. (2017). mikrobiologi. depok: kencana. fuentes, m. e., quiñones, r. a., gutiérrez, m. h., & pantoja, s. (2015). effects of temperature and glucose concentration on the growth and respiration of fungal species isolated from a highly productive coastal upwelling ecosystem. fungal ecology, 13, 135–149. https://doi.org/10.1016/j.funeco.2014.09.006. gohel, h., ghosh, s., & braganza, v. (2013). yeast as a viable and prolonged feedstock for biodiesel production. article in international journal of renewable energy research, 3(1), 126–131. https://doi.org/10.20508/ijrer.v3i1.488.g6115. hosseinpour, l., zareei, m., borjian boroujeni, z., yaghoubi, r., jamal hashemi, s., & author, c. (2017). effect of different incubation temperatures, times, and colored lights on fungal biomass and black pigment (melanin) production in exophiala crusticola. infect epidemiol microbiol, 3(3), 90–95. https://doi.org/10.18869/modares.iem.3.3.90. manpreet, s., sawraj, s., sachin, d., & banerjee, s. (2005). influence of process parameters on the production of metabolites in solid-state fermentation. malalaysian jounal of microbiology, 1(2), 1–9. https://agris.fao.org/agrissearch/search.do?recordid=dj2021067075. meeuwse, p. (2011). production of fungal lipids kinetic modeling and process design. the netherlands. mienda, b., & idi, a. (2011). microbiological features of solid-state fermentation and its applications. an overview model-guided metabolic gene knockouts strategies for enhanced succinic acid production in escherichia coli strain k-12 view project. research in biotechnology, 2(6), 21–26. https://www.researchgate.net/publication/2361771 89. murwani, s. (2015). dasar-dasar mikrobiologi veteriner. malang: ub press. pp 151-151. rizki, m. a. a. h., & ilmi, m. (2021). the potential of oleaginous filamentous fungi isolated from soil of baturraden botanical garden, central java, indonesia. iop conference series: earth and environmental science, 736(1). https://doi.org/10.1088/1755-1315/736/1/012060. sergeeva, y. e., galanina, l. a., andrianova, d. a., & feofilova, e. p. (2008). lipids of filamentous fungi as a material for producing biodiesel fuel. applied biochemistry and microbiology, 44(5), 523–527. https://doi.org/10.1134/s0003683808050128. shafiq, s. a., & chechan, r. a. (2019). influence of different natural media on production of myco-diesel. iop conference series: earth and environmental science, 388(1). https://doi.org/10.1088/17551315/388/1/012054. somashekar, d., venkateshwaran, g., sambaiah, k., & lokesh, b. r. (2002). effect of culture conditions on lipid and gamma-linolenic acid production by mucoraceous fungi. process biochemistry, 38(12), 1719–1724. https://doi.org/10.1016/s00329592(02)00258-3. vazquez-duhalt, r., & greppin, h. (1987). growth and production of cell constituents in batch cultures of botryococcus sudeticus. pergamon journals, 26(4), 885– 889. https://doi.org/10.1016/s00319422(00)82311-0. wu, s., hu, c., jin, g., zhao, x., & zhao, z. k. (2010). phosphate-limitation mediated lipid production by rhodosporidium toruloides. bioresource technology, 101(15), 6124–6129. https://doi.org/10.1016/j.biortech.2010.02.111. yang, y., heidari, f., & hu, b. (2019). fungi (mold)-based lipid production. methods in molecular biology, 1995, 51–89. https://doi.org/10.1007/978-1-4939-94847_3. https://doi.org/10.6026%2f97320630011182 https://doi.org/10.1111/1462-2920.14907 https://doi.org/10.1371/journal.pone.0111253 https://doi.org/10.1016/bs.afnr.2016.05.003 https://doi.org/10.1016/j.funeco.2014.09.006 https://doi.org/10.20508/ijrer.v3i1.488.g6115 https://doi.org/10.18869/modares.iem.3.3.90 https://agris.fao.org/agris-search/search.do?recordid=dj2021067075 https://agris.fao.org/agris-search/search.do?recordid=dj2021067075 https://www.researchgate.net/publication/236177189. https://www.researchgate.net/publication/236177189. https://doi.org/10.1088/1755-1315/736/1/012060 https://doi.org/10.1134/s0003683808050128 https://doi.org/10.1088/1755-1315/388/1/012054 https://doi.org/10.1088/1755-1315/388/1/012054 https://doi.org/10.1016/s0032-9592(02)00258-3 https://doi.org/10.1016/s0032-9592(02)00258-3 https://doi.org/10.1016/s0031-9422(00)82311-0 https://doi.org/10.1016/s0031-9422(00)82311-0 https://doi.org/10.1016/j.biortech.2010.02.111 https://doi.org/10.1007/978-1-4939-9484-7_3 https://doi.org/10.1007/978-1-4939-9484-7_3 jurnal riset biologi dan aplikasinya, volume 4, issue 2, september 2022 on the abundance and occurrence of the mangrove crabs, scylla spp. (crustacea: portunidae) from munjang mangrove, bangka belitung island nadhifah raniah1, henri1*, kurniawan2 1department of biology, faculty of agriculture, fisheries and biology, universitas bangka belitung, jl integrated campus of bangka belitung university, merawang district, bangka regency, bangka belitung islands province, 33172 2department of capture fisheries, faculty of agriculture, fisheries and biology, universitas bangka belitung, jl integrated campus of bangka belitung university, merawang district, bangka regency, bangka belitung islands province 33172 *corresponding author e-mail: biology.henry@gmail.com article history abstract received : 5 may 2022 the mangrove ecosystem is one of the most productive ecosystems on earth. this ecosystem provides a lot of functions for the living organism inhabiting here, such as fishes, mollusks, echinoderms, crustaceans, ect. the mangrove crab is one of the common crustaceans that can be found in the mangrove. this purtunidae crab is very popular due to their role in the food chain as well as for the economic income that has a high value in the market. however, overexploitation may decrease the crab population. this study aimed to investigate the abundance and occurrence of the mangrove crabs from munjang mangrove, bangka belitung island from august 2020 to june 2021 using baited traps with the line transect method at four zones. a total of four species of mangrove crabs, scylla olivacea, s. paramamosain, s. serrata and s. tranquebarica, were found in this location and dominated by s. serrata. shannon diversity index (h’) was a in low category (<1), evenness index range (j) from 0.35 to 0.89, and there was dominant species in this study. the bed sediment iswas dominated by the muddy clay substratum except in zone 4 with sandy. overall, this location is a suitable habitat for the scylla spp. and better management is urgently needed before these crabs are exploited by humans. revised : 12 august 2022 approved : 19 september 2022 published : 30 september 2022 keywords decapoda, estuary, muddy substrate, munjang mangrove portunidae how to cite: raniah, n., henri & kurniawan. (2022). on the abundance and occurrence of the mangrove crabs, scylla spp. (crustacea: portunidae) from munjang mangrove, bangka belitung island. jurnal riset biologi dan aplikasinya, 4(2): 75-82. doi: 10.26740/jrba. v4n2.p.75-82. introduction crustaceans exhibit great the disparity in basic body plans, but disparity of crustaceans is different from crustacean biodiversity, that is, the number of species we have within any group. no one knows for certain the exact number of species within any group organism, although the situation might improve with the appearance of online catalogs for groups. the people who set up these databases and maintain them as new species are added and old species are placed in synonymy provide a muchneeded service toward adequately cataloging the tree of life. nevertheless, as humans, we like number-they are easily understood (schram, 2013). one groups of the crustaceans that have high diversity is malacostraca, which includes crabs, shrimps, and their kin (brusca & martin, 2016). this class has a wide distribution in their habitat, from inland/terrestrial, freshwater to seawater and their occurrence in the habitat plays an important role, especially in food chain (brusca & brusca, 2003). the mangrove ecosystem is one of the most productive ecosystems on earth where the organics and non-organic material accumulate. a lot of living organisms can be found here and most of them have high value in the economic sector/market, from the mangrove trees, fishes, mollusks, crustaceans, and other organisms (alongi, 2009). the mangrove jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi mailto:biology.henry@gmail.com 76 |raniah, henri & kurniawan; on the abundance and occurrence of the mangrove crabs, scylla spp. crabs from the group of scylla spp. are very popular among the other crabs due to their large size and are valued as a source of food, even farmed commercially on a large scale in southeast asia (naylor & drew, 1998; trino et al., 1999; marichamy & rajapackiam, 2001; murniati et al., 2022). the occurrence of these crabs also is influenced by the environmental conditions that always fluctuate every single second, such as temperature, salinity, ph, substratum compositions, hydrological conditions, and even the structure of flora. high temperature and salinity can be tolerated by the scylla spp. (alberts-hubatsch., 2016), however, the absorption of atmospheric co2 lowers ph in seawater (ocean acidification) and brings negative effects or calcification rates of marine organisms’ variety, including crabs (ries et al., 2009; byne, 2011). even though crustaceans with a relatively thick epicuticle seem to be less affected (ries et al., 2009; small et al., 2010), however, early life stage (such as the larvae stage) may get affected. for most of the benthic species, such as crabs, soil sediment proprieties always determine the habitat choice (mokhtari et al., 2015); checon & costa, 2017), especially for burrowing activity (lie et al., 2015) because soil consistency impacts the ability of crabs to dig and maintain the structure of burrows (riberio et al., 2005; mokhtari et al., 2015). at the low tide, intertidal areas are mostly dominated by juveniles and sub-adult crabs that are found under mangrove leaves or in shallow burrows (mirera, 2007), while the large one prefers to live in sub-tidal areas (walton et al., 2006). for the flora, the species scylla olivacea is more abundant on the xylocarpus sp., rhizophora mucronata and bruguiera sp., whereas, s. serrata prefer to sonneratia alba, rhizophora mucronata and bruguiera sp. (yunus & siahainenia, 2019). kurau barat village is in the central bangka regency that covers area of 651,952 hectares including mangrove zone. one of the mangrove zones in this location is also known as munjang mangrove with coverage of about 213 ha, where a lot of important commercial fisheries resources occur. however, a year ago, a total of 30 ha of this mangrove zone has been exploited and converted for tourism which may affect the living organisms, especially the scylla spp. that has a high value in the economic income. unfortunately, the information about some biological notes on the mangrove crabs, scylla spp., in this location is still limited. -hence, this study was carried out to investigate the abundance and occurrence of the mangrove crabs, scylla spp., from munjang mangrove, bangka belitung island. materials and methods study sites the munjang mangrove forest is situated at the 2◦19’21” s and 106◦13’27” e on the east coast of bangka belitung island and covers about 213 ha (see figure 1). the mangrove species in this location consist of sonneratia alba, rhizophora apiculata and bruguiera sexangula. the present study was carried out at 4 sites (zones) of the munjang mangrove which was planted by sonneratia alba, rhizophora apiculata, bruguiera sexangula, exoecaria agallocha, nypa fruticans, xylocarpus granatum, acrostichum speciosum, ceriops tagal, and heritiera littoralis. the condition of these zones is a muddy clay substratum, with a depth water condition (approximately 0.5 to 2 meter). the salinity condition in this area is fluctuated due to the mixing of the freshwater from the inland with the seawater from the east coast of bangka belitung island. sampling methods sampling was carried out at 4 zones of munjang mangrove, bangka belitung island from august 2020 to june 2021. the mangrove crabs, scylla spp. were collected using rattan fish traps (mud crab traps) which were equipped with eels as abit (monopterus albus). the samples were collected using line transect methods with 3 lines and a 50meter distance of each line. in each transect line, 5 x 5 meter plot was made with five replicates 5 meters apart from each other (figure 2). the traps were installed at each zone from 01.00 to 10.00 am considering the active time of the mud crabs. ng (2017) has explained that the best time to catch crabs is at night because many species are nocturnal. burrowing species come out mainly at night. the best time at night varies, from just one to two hours after sunset for some species to well into the early morning hours for others. different species also respond differently to the lunar cycle. crabs are generally less fearful of humans, come out earlier at night, and are generally easier to catch in jurnal riset biologi dan aplikasinya, 4(2): 75-82, september 2022 |77 figure 1. the map showing the study sites at the 4 zones of munjang mangrove, bangka belitung island figure 2. the sample collection technique used 3 line transect with 5 plots (25 m2 each) at each zone in the munjang mangrove, bangka belitung island from august 2020 to june 2021. areas with few human inhabitants. in this study, the maximum number for each species per catch was limited to 3 individuals only with a carapace width >15 centimeters, and the rest were released to their habitat again, based on the decree of ministry number 1 of 2015. all the collected samples from the field were then cleaned from the mud, trash and other materials and stored in a cool box filled with ice temporary before transported to the laboratory. several environmental variables were also measured directly during the sampling session, such as temperature, water depth, and current velocity, meanwhile, do, ph, salinity, and sediment fractions were measured in the laboratory. the temperature was measured using a thermometer, water depth using bathymetry, and velocity using a velocity meter. bed sediment representing recent deposits was collected by scooping the upper 5 cm of the sediment with a plastic spade at 50-150 cm water depth. the sediment was packed and sealed in plastic containers. the collected crabs including the environmental data then transported to the biological laboratory, faculty of agriculture, 78 |raniah, henri & kurniawan; on the abundance and occurrence of the mangrove crabs, scylla spp. fisheries, and biology, universitas bangka belitung for further investigation. in the laboratory, each crab was sorted and identified to the lowest taxonomic unit by observing the morphological characteristics. identification of the species level was performed following ng (1998). after that, the number was counted for analysis and stored in 70% ethanol. for the unfinished environmental data, further examination was conducted to obtain the data. dissolved oxygen was measured using a do meter, ph using a thermometer, and salinity using a refractometer. sediments were air-dried in an oven at 500°c and the samples were passed through standart mesh sieve to separate the grant size or type of the sediment, such as clay, silt, or sand using the shepard triangle method. data analysis for the crabs, all of the data were analyzed descriptively. due to the limited data, the abundance and their relative abundance value were omitted. several indices were used to calculate the data, as follows: shannon-wiener’s diversity index (h’) h’ = where ni is the number of individuals in the abundance of species-i and n is the total number of individuals in the community (magurran, 1988), with the criteria: high (h’>3.22), moderate (1.00≤h’≤3.22) and low (h’<1.00). simpson’s evenness index (j) where h’ is the value of the shannon-weiner diversity index and s is the number of species that occur in the area. simpson’s dominance index (d) where this formula is the result of ni (the number of individuals in the abundance of species-i) which is divided by n (the total number of individuals in the community) and 2 squared (magurran, 1998). the minimum value is 0 and the maximum value is 1. results and discussion environmental variables in this study, the measurement on the variables showed a minor variation from all of 4 zones, except for the water depth. the temperature ranged from 27.1 to 28.1°c with an average of 27.5±0.19°c; water depth ranged from 37 to 90.73 cm with an average of 62.11±2.70 cm; the velocity ranged from 0.34 to 0.55 with an average of 0.46±0.07 m/s; water acidity (ph) ranged from 5.87 to 6.32 with an average of 6.06±0.07; dissolved oxygen ranged from 5.45 to 8.35 mg/l with an average of 6.26±0.70 mg/l; and salinity ranged from 23 to 25 ppt with an average of 24.00±0.07 ppt. detailed information is showed in table 1. shepard triangle examination showed that the bed sediment in this mangrove forest are constructed by sand, silt and clay. the majority of the sediment here was dominated by the clay, followed by silt and sandy substrates; except for the zone 4 that was observed from zone 2, meanwhile lowest in zone 4. the highest percentage of the silt substrates occurred in zone 1 and lowest in zone 3, and the highest percentage of the sandy substrate was observed in zone 4, meanwhile lowest in zone 2. detailed information is provided in figure 3. mangrove crabs species composition with the biological indices a total of species of the mangrove crabs belonging to 52 individual were identified from munjang mangrove, namely scylla olivacea, s. paramamosain, s. serrata and s. tranquebarica (see figure 4). among them, s. serrata was the most abundant with 50% from total of all species and distributed at all 4 zones, meanwhile s. paramamosain was the lowest one with 5 individuals. on the first to the third zone, the crabs consisted of 3 species, meanwhile only 2 species in the last zone. of the biological indices, the diversity value (h’) was ranged from 0.67 to 1 with the highest value was on the first zone and lowest in last zone; the evenness value (j) was ranged from 0.35 to 0.89 with the highest in the second zone and lowest in the first zone; and the dominance value (d) was ranged from 0.39 to 0.52 with the highest in the last zone and lowest in the first zone (table 2). jurnal riset biologi dan aplikasinya, 4(2): 75-82, september 2022 |79 table 1. the result from the measurement of several environmental variables in the munjang mangrove, bangka belitung island from august 2020 to june 2021 zone environmental variables temp. depth current velocity ph do salinity (°c ± sd) (cm ± sd) (m/s ± sd) (value ± sd) (mg/l ± sd) (ppt ± sd) i 27.9 ± 0.37 37.00 ± 1.05 0.34 ± 0.10 6.09 ± 0.02 5.72 ± 1.51 25.0 ± 0.02 ii 28.1 ± 0.06 62.73 ± 2.26 0.55 ± 0.05 5.94 ± 0.11 5.51 ± 0.60 24,0 ± 0.03 iii 27.2 ± 0.06 90.73 ± 5.18 0.45 ± 0.02 5.87 ± 0.11 8.35 ± 0.20 25.0 ± 0.10 iv 27.1 ± 0.26 58.00 ± 2.32 0.51 ± 0.12 6.32 ± 0.02 5.45 ± 0.48 23.0 ± 0.11 x ± sd 27.5 ± 0.19 62.12 ± 2.70 0.46 ± 0.07 6.06 ± 0.07 6.26 ± 0.70 24.00 ± 0.07 figure 3. the composition and percentage of bed sediments in the munjang mangrove, bangka belitung island after examined using the shepard triangle method figure 4. the species of mangrove crabs from munjang mangrove, bangka belitung island. (a) scylla serrata (b) s. olivacea (c) s. tranquebarica, and (d) s. paramamosain 80 |raniah, henri & kurniawan; on the abundance and occurrence of the mangrove crabs, scylla spp. table 2. species composition, individual number and the biological indices of the mangrove crabs from munjang mangrove, bangka belitung island from august 2020 to june 2021 the scylla spp. and biological indices value zone 1 2 3 4 scylla olivacea 3 4 2 0 s. paramamosain 5 0 0 0 s. serrata 9 7 8 2 s. tranquebarica 0 2 7 3 shannon-wiener's diversity index (h') 1 0.98 0.97 0.67 evenness index (j) 0.35 0.89 0.88 0.61 dominance index (d) 0.39 0.40 0.40 0.52 our findings showed that the s.serrata is the predominant species among the mangrove crabs in this location, followed by s. tranquebarica, s. olivaceae and s. paramamosain; although this species is not the dominant one based on dominance index calculation. this result may be affected due to the habitat condition in munjang estuary, such as zonation, the species of mangrove, sediment character and also environmental variables. avianto et al. (2013) reported that the species s.serrata had a wide distribution in the cibako mangrove forest, garut district, west java and was very abundant in the opening/fringing zone, however, its abundant gradually decreased from the intermediate to the landward zone. meanwhile, s. tranquebarica was very abundant in the intermediate zone and s. paramamosain in the landward zone. the abundance of s.serrata was also reported being correlated with the mangrove density and the species of mangrove, mostly from rhizophora spp. (la sara et al., 2014; tahmid et al., 2015). the characteristics of the sediment also influence the presence of the mud crab. the opening/fringing zone is always in contact with the water from inland and also the seawater, hence, the sediment in this area always muddy. the muddy sediment is very rich with organic materials and other living fauna (such as fishes, gastropods, and bivalves) that can be used as food resources for the mud crabs (alberts-hubatsch et al., 2016). the environmental variables also determine the occurrence of the mud crabs in the habitat. the scylla spp., mostly has a wide tolerance to the condition of temperature and salinity. tropical and subtropical condition is very suitable for their lives (avianto et al., 2013; la sara et al., 2014; albertshubatsch et al., 2016; karniati et al., 2021). however, temperatures below 16°c causes them in active (hill, 1980). they also can tolerate the salinity from low conditions to the higher condition (davenport & wong, 1987; hill, 1979; la sara et al., 2014; karniati et al., 2021), however, extreme salinity (more than 64) is lethal for their life (hill, 1979). water and mud depth including the dissolved oxygen also cause an impact on the living of the mud crabs (karniati et al., 2021). overall, our findings in the munjang mangrove forest showed that the condition and characteristics of the mangrove in this area were suitable and supported the occurrence and living of the mud crabs. conclusion four species of the mud crabs (scylla olivacea, s. paramamosain, s. serrata and s. tranquebarica) were live in the munjang mangrove. s. serrata was the predominant species and occured in all study sites. its highest abundance was found in the opening/fringing zone, while s. tranquebarica in the intermediate zone. the diversity of the mud crabs in this study was low (h’<1.00) and no dominant species based on dominance index (d). the condition of environmental variables, such as temperature, salinity, water depth, water velocity, ph and do was very suitable for the mud crabs that live in this mangrove. future management in this mangrove zone is needed due to the potential of the these crabs in economic value or commercial before overexploited. references alberts-hubatsch h, lee sy, meynecke jo, diele k, nordhaus i, wolff m. (2016). life history, movement, and habitat use of scylla serrata (decapoda, portunidae): current knowledge and future challenges. hydrobiologica, 763:5-21. jurnal riset biologi dan aplikasinya, 4(2): 75-82, september 2022 |81 https://link.springer.com/content/pdf/10.1007/s1075 0-015-2393-z.pdf. alongi dm. (2009). the energetics of mangrove forest. springer science & business media, new york, 216 pp. avianto i, sulistiono, setyobudiandi i. (2013). karakteristik habitat dan potensi kepiting bakau (scylla serrata, s.tranquebarica, dan s.olivacea) di hutan mangrove cibako, kabupaten garut, jawa barat. bonorowo wetlands, 3(2), 55-72. https://jurnal.fp.unila.ac.id/index.php/jpbp/article/v iew/203/205. brusca rc, brusca gj. (2003). invertebrates 2nd edition. sinauer associates inc, sunderland, massachusetts, usa, 936 pp. brusca rc, martin jw. (2016). phylum arthropoda, crustaceae: crabs, shrimps, and their kin. in: rc brusca, w moore, sm shuster (eds), invertebrates. 3rd edition. sinauer associates inc., sunderland, massachusetts, usa, pp. 761-841. byne m. (2011). impact of ocean warning and ocean acidification on marine invertebrate life history stages: vulnerablities and potential for persistence in a changing ocean. oceanography and marine biology: an annual review, 49:1-42. 10.1201/b11009-2. checon hh, costa tm. (2017). fiddler crab (crustaceae: ocypodidae) distribution and the relationship between occopancy and mouth appendages. marine biology research, 13(6): 618-629. https://doi.org/10.1080/17451000.2016.1273530 davenport j, wong tm. (1987). responses of adult mud crabs (scylla serrata) (forskal) to salinity and low oxygen tension. comperative biochemistry and physiology, 86a: 43-47. https://doi.org/10.1016/03009629(87)90274-x. hill bj. (1979). biology of the crab scylla serrata (forskal) in the st. lucia system. transactions of the royal society pf south africa, 44, 55-62. https://doi.org/10.1080/00359197909520079. karniati r, sulistiyono n, amelia r, slamet b, bimantara y, basyuni m. (2021). mangrove ecosystem in north sumatra (indonesia) forest serves as a suitable habitat for mud crabs (scylla serrata and s. olivaceae). biodiversitas, 22(3),1489-1496. https://doi.org/10.13057/biodiv/d220353 la sara, aguilar ro, ingles ja, laureta lv. (2014). habitat characteristics and relative abundance of the mud crab scylla serrata (forskal, 1775) in lawele bay, southeast sulawesi, indonesia. ege journal of fisheries and aquatic sciences, 31(1), 11-18. 10.12714/egejfas.2014.31.1.03. li w, chen l, wang k, johnson ja, wang s. (2015). performance of controlled atmosphere/heating block system for assessing insect thermotolerance. biosystems engineering, 135, 1-9. https://doi.org/10.1016/j.biosystemseng.2015.04.006. magurran ae. (1988). ecological diversity and its measurement. princeton university press, pricenton, new jersey, usa, 179 pp. marichamy r, rajapackiam s. (2001). the aquaculture of scylla species in india. asian fisheries society, 14(2): 231-238. 10.33997/j.afs.2001.14.2.014. mirera do. (2017). status of the mud crab fishery in kenya: a review. western indian ocean journal of marine science, 16(1), 35-45. https://www.ajol.info/index.php/wiojms/article/view /152182/153691. mokhtari m, ghaffar ma, usup g, cob zc. (2015). determination of key environmental factors responsible for distribution patterens of fiddler crabs in a tropical mangrove ecosystem. plos one, 10:e0117467. https://doi.org/10.1371/journal.pone.0117467. murniati dc, nugroho da, kartika wd. (2022). fauna jawa seri krustasea (dekapoda) pada ekosistem mangrove dan estuari di pulau jawa. penerbit brin, jakarta, 177 pp. naylor r, drew m. (1998). valuing mangrove resources in kosrae, mironesia. environment and development economics, 3(4): 471-490. https://doi.org/10.1017/s1355770x98000242. ng pkl. (2017). collecting and processing freshwater shrimps and crabs. journal of crustacean biology, 37(1): 115-122. https://doi.org/10.1093/jcbiol/ruw004. ng pkl. (1998). crabs. in: ke carpenter & vh niem (eds), fao species identification guide for fishery purpose. the living marine resources of the western central pacific. volume 2. cephalpods, crustaceans, holothurians and sharks. food and agriculture organization of the united nation, rome, pp. 1045-1154. ribeiro pd, iribarne oo, daleo p. (2005). the relative importance of substratum characteristics and recruitment in determining the spatial distribution of the fiddler crab uca uruguayensis nobili. journal of experimental marine biology and ecology, 314(1), 99111. https://doi.org/10.1016/j.jembe.2004.09.014. ries jb, cohen al, mccorkle dc. (2009). marine calcifiers exhibit mixed responses to co2-induced ocean acidification. geology, 37,1131-1134. https://doi.org/10.1130/g30210a.1. schram fr. (2013). comments on crustacean biodiversity and disparity of body plans. in: l watling, m thiel (eds), the natural history of the crustacea, volume 1, functional morphology and diversity. oxford university press, london, uk, pp. 1-33. small d, calosi p, white d, spicer ji, widdicombe s. (2010). impact of medium-term exposure to co2 https://link.springer.com/content/pdf/10.1007/s10750-015-2393-z.pdf https://link.springer.com/content/pdf/10.1007/s10750-015-2393-z.pdf https://jurnal.fp.unila.ac.id/index.php/jpbp/article/view/203/205 https://jurnal.fp.unila.ac.id/index.php/jpbp/article/view/203/205 http://dx.doi.org/10.1201/b11009-2 https://doi.org/10.1080/17451000.2016.1273530 https://doi.org/10.1016/0300-9629(87)90274-x https://doi.org/10.1016/0300-9629(87)90274-x https://doi.org/10.1080/00359197909520079 https://doi.org/10.13057/biodiv/d220353 http://dx.doi.org/10.12714/egejfas.2014.31.1.03 https://doi.org/10.1016/j.biosystemseng.2015.04.006 http://dx.doi.org/10.33997/j.afs.2001.14.2.014 https://www.ajol.info/index.php/wiojms/article/view/152182/153691 https://www.ajol.info/index.php/wiojms/article/view/152182/153691 https://doi.org/10.1371/journal.pone.0117467 https://doi.org/10.1017/s1355770x98000242 https://doi.org/10.1093/jcbiol/ruw004 https://doi.org/10.1016/j.jembe.2004.09.014 https://doi.org/10.1130/g30210a.1 82 |raniah, henri & kurniawan; on the abundance and occurrence of the mangrove crabs, scylla spp. enriched seawater on the physiological functions of the velvet swimming crab necora puber. aquatic biology, 10: 11-21. 10.3354/ab00266. tahmid m, fahrudin a, wardianto y. (2015). habitat quality mud crab (scylla serrata) in mangrove ecosystem of bintan district, riau islands. jurnal ilmu dan teknologi kelautan tropis, 7(2), 535-551. https://doi.org/10.29244/jitkt.v7i2.11025. trino at, mellamena om, keenan c. (1999). commercial evaluation of monosex pond culture of the mud crab scylla species at three stocking densities in the phipippines. aquaculture, 174(1-2): 109-118. https://doi.org/10.1016/s0044-8486(99)00002-2. walton me, le vay l, truong lm, ut vn. (2006). significance of mangrove-mudflat boundaries as nursery grounds for the mud crab, scylla paramamosain. marine biology, 149, 1199-1207. 10.1007/s00227-0060267-7. yunus m, siahainenia l. (2019). keterkaitan karakateristik habitat dengan kepadatan kepiting bakau pada ekosistem mangrove desa evu kecamatan hoat soarbay kabupaten maluku tenggara. triton: jurnal manajemen sumberdaya perairan, 15(2): 58-68. https://ojs3.unpatti.ac.id/index.php/triton/article/vie w/2541/2498. http://dx.doi.org/10.3354/ab00266 https://doi.org/10.29244/jitkt.v7i2.11025. https://doi.org/10.1016/s0044-8486(99)00002-2 http://dx.doi.org/10.1007/s00227-006-0267-7 http://dx.doi.org/10.1007/s00227-006-0267-7 https://ojs3.unpatti.ac.id/index.php/triton/article/view/2541/2498 https://ojs3.unpatti.ac.id/index.php/triton/article/view/2541/2498 23 | putri et al.; screening of extracellular enzymes on serratia marcescens jurnal riset biologi dan aplikasinya, volume 3, issue 1, march 2021 screening of extracellular enzymes on serratia marcescens strain mbc1 meishy handerlin putri*, kusuma handayani, wawan a. setiawan, berliana damayanti, cindy lukyta ratih, achmad arifiyanto biology departement, faculty of mathematics and natural sciences, lampung university jln. prof soemantri brojonegoro 1, rajabasa district, bandar lampung, lampung 35144, indonesia *corresponding author: e-mail: handerlinmeishy@gmail.com article history abstract received : 14 februari 2021 hydrolase enzymes are a class of enzymes used to break down the organic substrates into simpler molecules. hydrolase enzymes play a role in biocontrol, industry, and public health. one of the hydrolase enzyme producers is bacteria. serratia marcescens strain mbc1 is a collection in the microbiology laboratory of the department of biology, faculty of mathematics and natural sciences, university of lampung which enzymatic activities haven’t been known yet. this research aimed to determine the enzymatic activity of s. marcesescens strain mbc1 that can be used as a candidate for biocontrol agents, biosurfactant producers, industry, or in the health sector. the screening was carried out using a qualitative method plate assay using selective solid media for each test, with three replications for each test. the data obtained were analyzed statistically using non-parametric kruskall wallis test. the lipolytic activity of the s. marcescens strain mbc1 showed high efficacy with an enzymatic index of 5.52 and amylase, cellulases, protease, mannanase, and chitinase with enzymatic indexes, respectively, 4.17, 1.50, 0.69, 0.35, and 0.27. this enzyme activity of this isolate can be used as a candidate for biological control agents, biosurfactant producers, industry, or the health sector. revised : 4 maret 2021 approved : 22 maret 2021 published : 31 maret 2021 keywords hydrolase enzymes; serratia marcescens strain mbc1; enzymatic activity how to cite: putri, m.h., handayani, k., setiawan, w.a., damayanti, b., ratih, c.l., & arifiyanto, a. (2021). screening of extracellular enzymes on serratia marcescens strain mbc1. jurnal riset biologi dan aplikasinya, 3(1): 23-29. doi: https://doi.org/10.26740/jrba.v3n1.p23-29. introduction serratia marcescens is a gram-negative bacteria and a member of the enterobacteriaceae family. this bacteria can be found in water, soil, insects, vertebral digestive, and plant surfaces (kahrarian et al., 2019). s. marcescens strain nmrl 65 has enzymatic activity lipase and protease based on research conducted by mohanram et al. (2020). furthermore, the research on the activity of the cellulase and chitinase enzymes of s. marcescens was also reported by cahyani et al. (2017) and tubkanlu et al. (2019). according to their ability to catalyze a reaction, enzymes can be divided into several groups. one group of enzymes that can catalyze hydrolysis reactions is known as hydrolase enzymes (wardoyo & aprilia, 2018). hydrolase enzymes have an essential role in various reactions in living cells as a catalyst. hydrolase enzymes can be used to break chemical bonds with water and break down organic substrates into simpler molecules (wijaya et al., 2017). cellulases, amylases, proteases, mannanases, and glycosidases were over hydrolase groups. these enzymes will hydrolyze polysaccharides into monosaccharides (puspadewi et al., 2018). in biotechnology, lipase is involved in fatdigesting supplements (mohanasrinivasan et al., 2018). moreover, the amylase enzymes can catalyze cereal foods such as wheat and bread (padmavathi et al., 2018). the extracellular enzymes produced by microorganisms contributed to agriculture sectors, and industrial interests (mohanasrinivasan et al., 2018; susilowati et al., 2018). natural enzymes were outweighed because of safety and also eco-friendly. one of the enzyme producers is bacteria. several bacteria that are jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi https://doi.org/10.26740/jrba.v3n1.p23-29 jurnal riset biologi dan aplikasinya, 3(1): 23-29, march 2021 | 24 capable of producing various types of enzymes are bacillus licheniformis, aspergillus sp. (wijaya et al., 2017) serratia marcescens (cahyani et al., 2017) acinetobacter sp., and pseudomonas sp. (puspadewi et al., 2018). s. marcescens is one of the bacteria with enzymatic capabilities to produce several types of enzymes. s. marcescens strain mbc1 is one of the bacteria culture collection in the microbiology laboratory of fmipa, the university of lampung which was isolated from the agar media contaminated by droshophila sp. and the enzymatic activities haven’t been known yet. therefore, this research to determine the enzymatic activity of s. marcesescens strain mbc1 that can be used as a candidate for biocontrol agents, biosurfactant producers, industry, or in the health sector. materials and methods s. marcescens strain mbc1 bacterial isolate culture tryptic soy agar (tsa) medium was used to culture the bacteria 1.5 g of tsa was dissolved in 100 ml distilled water. the medium was sterilized at autoclave for 15 minutes. s. marcescens bacterial isolate strain mbc1 was cultured on tsa using a streak plate technique and then incubated at room temperature for 24-48 hours. gram staining one loop of serratia marcescens strain mbc1 was added to an object-glass. the smear was stained with crystal violet for one minute. then, it was washed under running water and gram's iodine was added for one minute after that was exposed to acetone for decolorization. then, as a counterstain, dilute safranin was applied and washed after 30 seconds. the gram reaction and morphology were observed microscopically with the help of oil immersion objective after the bacteria was dried. koh string test a loopful of a bacterial colony from the culture plate was emulsified over a glass slide in 3% koh. the suspension was stirred continuously for one minute and then the loop was gently pulled up from it. if the loop lift was sticky within the first 30 seconds of mixing in koh solution, the result was considered positive. enzymatic activity enzymatic activity tests were conducted using qualitative methods with solid fermented agar media. three replications were taken place for each test. lipolytic activity tests were conducted based on the method used by ervina et al. (2020) with modifications. this test uses nutrient agar (na), 1% of olive oil, 0.04% of methyl red, and 0.6% tween-80. a total of one loop of s. marcescens strain mbc1 was grown on the medium using the point method. then the media was incubated at room temperature for 24-48 hours lipolytic activity was characterized by the formation of a clear zone around the bacterial colony. the proteolytic activity test was conducted based on a modified form of pratika et al. (2021). the media composition consisted of nutrient agar (na) and 1% skim milk. one loop of the s. marcescens strain mbc1 isolate was taken and at a point on the medium. then the media was incubated at room temperature for 24-48 hours. positive proteolytic activity had indicated by a clear zone around the bacterial colony on the media’s surface. the amylolytic activity test was conducted based on artha et al. (2019) with modifications using na media supplemented with 1 % starch. s. marcescens strain mbc1 was grown on solid media by point method and incubated at room temperature for 24-48 hours. lugol iodine 1% was poured into the culture to observe the clear zone for identification of amylase activity. a clear zone around the bacterial colony was a positive sign of amylase. the chitinolytic activity tests were conducted based on rosa et al. (2020) by using na that was supplemented with 1% of colloidal chitin media. then the media was incubated at room temperature for 24-48 hours. colloidal chitin was made by dissolving 5 g of chitin powder in 80 ml of concentrated hcl solution for 30 minutes by a magnetic stirrer and left 24 hours at 4◦c. the mixture was filtered using glass wool. the filtrate obtained was added with 40 ml of cold distilled water and homogenized using a magnetic stirrer. then, the filtrate adjusted to the ph. then it was centrifuged at 7,500 rpm for 15 minutes. the filtrate obtained was separated from the supernatant and added with cold distilled water and centrifuged at 7500 rpm for 15 minutes. the filtrate obtained is colloidal chitin which is ready for use. the clear zone was visualized with 0.1% congo red staining and rinsed using 1 m nacl. the cellulose degradation was captured using the method used by artha et al. (2019). the media composition consisted of 1% nutrient agar (na) and 25 | putri et al.; screening of extracellular enzymes on serratia marcescens cmc media. one loop of s. marcescens strain mbc1 was inoculated on the media and incubated at room temperature for 24-48 hours. congo red solution was poured into the culture to observe the clear zone was cellulolytic activity. the mannanolytic activity was approached by the method of sumardi (2005). the media was into two layers. the lower layer medium consisted of yeast extract 0.35%, tryptone 0.35%, mgso4 0.03%, kh2po4 0.245%, ammonium sulfate 0.25% and nacl, 0.2%. while the composition of the top layer media consisted of 0.03% mgso4, 0.245% kh2po4, 0.25% ammonium sulfate, 0.2% nacl and 0.35% locust bean gum (lbg). s. marcescens strain mbc1 was spotted on the medium. then, incubated at room temperature for 24-48 hours. the plate was stained with 0.5% congo red for 15 minutes and then rinsed with 1 m nacl to observe mannanolytic activity in the presence of a clear zone. the determination of enzymatic index calculated using the formula according to the method used by rosa et al (2020). the enzymatic index determination of the results can be calculated using the following formula by rosa et al (2020). the enzymes activity were analyzed using the non-parametric test of kruskall wallis with a significance level of 95%. figure 1. measurement of clear zone ab, cd, ef : diameter of clear zone ab, cd, ef : colony diameter average clear zone diameter (dz) : ab + bc + cd / 3 average colony diameter (dk) : ab + bc + cd / 3 average total clear zone diameter (rdz) : dz1 + dz2 + dz3 / 3 average total colony diameter (rdk) : dk1 + dk2 + dk3 / 3 results and discussion the isolate has been identified as serratia marcescens strain mbc1. it was a gram-negative bacterium which had confirmed by koh 3% test (figure 2). from the gram staining, it can be seen that the bacteria are rounded (cocci) in shape with red color. the enzymatic ability had been calculated based on the colony compared to the clear zone diameter, to obtain the enzymatic index. s. marcescens strain mbc1 isolate has different enzymes activities (figure 3). based on the research that has been done, cellulose concentration 1% was the optimum for the production of cellulase enzymes. the media used for testing the activity of the cellulase enzyme contains a carboxymethyl cellulose (cmc) substrate (halimah et al., 2019). s. marcescens strain mbc1 isolate is known to have enzymatic activity because it can produce a clear zone amount 0.53 mm and is classified as cellulolytic bacteria. based on research by cahyani et al. (2017) s. marcescens has cellulase enzyme activity. the utilization of cellulose has been conducted in various fields, including for the production of paper, fiber, and chemical derivatives plastics, and photographic film. s. marcescens strain mbc1 isolate was able to degrade lipase-selective media by showing the hydrolysis zone around the colony by having a clear zone of 2.03 mm. based on the research by isti’anah et al. (2019) if the ratio extracellular enzyme and activity index value is above 2, it is included in the high extracellular ratio. in this method, the tween80 substrate is used to detect lipase activity because it contains oleic acid esters, that can be hydrolyzed by the bacteria into mono oleic acid. this mono oleic acid will bind with calcium to form color cloudiness around the colony (ervina et al., 2020). jurnal riset biologi dan aplikasinya, 3(1): 23-29, march 2021 | 26 figure 2. a) macroscopic s. marcescens strain mbc1 b) koh test 3% figure 3. clear zone on enzyme activity a) lipase, b) mannanase, c) cellulase, d) amylase, e) chitinase, f) protease in the amylase enzyme activity, an isolate of s. marcescens strain mbc1 was cultured on a medium containing 1% starch substrate. the amylolytic ability was characterized by the formation of a clear zone in bacterial isolates after 0.1 m iodine was dropped (arfah et al., 2020). s. marcescens can produce amylase enzyme with form clear zone. the clear zone was formed because starch has been hydrolyzed to glucose, hence iodine did not absorb in the spiral flow of starch (amylose), whereas the blue color occurs due to the presence of iodine molecules entering the spiral stream of starch (amylose). chitin is a polymer that can be found in fungus and crustacea. the activity of the chitinase enzyme will be positive if it can produce a clear zone, this is caused by the isolate of s. marcescens strain mbc1 can break down the chitin in the medium (linda et 27 | putri et al.; screening of extracellular enzymes on serratia marcescens al., 2018). this is in line with research by okay et al (2013) that used s. marcescens strain mo-1 grown on na plates containing chitin and its chitinase activity was shown via the formation of a clear zone due to chitin degradation. this character will advantage to inhibit fungus and degraded chitin enriched materials. the ability of the s. marcescens strain mbc1 to produce protease was characterized by the formation of a clear zone around the colony on the media with a clear zone of 0.6 mm, as a sign that the bacteria are producing protease to hydrolyze peptone and skim milk by producing protease. the protein contained in the media is a protease inducer. the clear zone was an indicator of the presence of these bacterial isolates being able to utilize protein in the media as a source of nutrition (pratika et al., 2021). this was in line with studies performed by (mohanram et al., 2020). using s. marcescens strain nmrl 65 hydrolyzed casein in skimmed milk agar producing a clear zone around colonies after 48 hours, which indicated the protease enzyme production. the ability of the s. marcescens strain mbc1 to produce protease is characterized by the formation of a clear zone around the colony on the media with a clear zone of 0.6 mm, as a sign that the bacteria was producing protease to hydrolyze peptone and skim milk by producing protease. the protein contained in the media is a protease inducer. the clear zone is an indicator of the presence of these bacterial isolates being able to utilize protein in the media as a source of nutrition (pratika et al., 2021). this is in line with studies performed by (mohanram et al., 2020) using s. marcescens strain nmrl 65 hydrolyzed casein in skimmed milk agar producing a clear zone around colonies after 48 hours which indicated the protease enzyme production. s. marcescens strain mbc1 showed the growth on a substrate containing locust bean gum (lbg) the size of the clear zone is 0.44 mm. this is in line with studies performed by olaniyi & arotupin (2013) that s. marcescens has mannanase activity and has shown the highest ratio of the clear zone to the colony. it by determiner of a clear zone that forms around the bacterial colony after being incubated. lbg which is present in the media is broken down by bacteria as a source of carbon in the metabolic process. this is because bacteria can break down galactomannan with the help of the β-mannanase enzyme complex reaction which produces mannose and mano-oligosaccharides (sumardi, 2005). the enzyme activities of the s. marcescens strain mbc1 showed in table 2. the enzymes activity were analyzed using the non-parametric method of kruskall wallis with a significance level of 95%. the results showed that s. marcescens strain mbc1 had the highest index value on lipase and amylase activity of 5.52 and 4.17. table 2. results of kruskal-wallis enzyme test statistic enzymes average of colony (mm) average of clear zone (mm) enzymatic index lipase 0.33 ± 0.11 2.03 ± 0.32 5.52 amylase 0.34 ± 0.08 1.79 ± 0.68 4.17 cellulase 0.33 ± 0.05 0.53 ± 0.05 1.50 chitinase 1.27 ± 0.15 1.6 ± 0.1 0.27 mannanase 0.73 ± 0.05 0.44 ± 0.05 0.35 protease 0.37 ± 0.05 0.6 ± 0.1 0.69 sig kruskal wallis 0.162 0.011 0.025 enzyme activity was influenced by ph, temperature, and substrate. enzymes have an active site that compatible with the substrate. hence, they can form the appropriate substrate enzymes with maximum results. on the other hand, unoptimized conditions related to ph and temperature conditions influenced conformational change on the enzyme, or even losing its activity (irdawati et al., 2020). s. marcescens strain mbc1 can produce the hydrolase enzyme, it can be used based on the needs. lipase activity had potentially developed jurnal riset biologi dan aplikasinya, 3(1): 23-29, march 2021 | 28 for biosurfactant production. indeed, it often became a preliminary test to determine biosurfactant activity (arifiyanto et al., 2017). the amylase activity also can catalyze cereal foods such as wheat and bread (padmavathi et al., 2018). besides, utilization of cellulase, amylase, and protease enzymes can be utilized in agriculture, industry, marine, and other sectors (arifiyanto et al., 2017). conclusion based on the results, it can be concluded that s. marcescens strain mbc1 exhibits lipase, amylase, cellulase, protease, mannanase, and chitinase activities with the enzymatic index 5.52, 4.17, 1.50, 0.69, 0.35, and 0.27. this enzyme activity of this isolate can be used as a candidate for biological control agents, and is used in biosurfactant producers, industry, or the health sector acknowledgement the authors thank to ms. oni mastuti as a laboratory assistant, who had helped in the process. references arfah, r. a., lestari, y. a., dali, s., muliadi, & liestianty, d. (2020). the isolation of termofil amilolitik bacterium and activity test of harsh extract amylase enzyme from the hot spring at jailolo bay in north maluku. journal of physics: conference series, 1569(4). https://doi.org/10.1088/17426596/1569/4/042050. arifiyanto, a., apriyanti, f. d., purwaningsih, p., kalqutny, s. h., agustina, d., surtiningsih, t., shovitri, m., & zulaika, e. (2017). lead (pb) bioaccumulation; genera bacillus isolate s1 and ss19 as a case study. aip conference proceedings, 1854(1). https://doi.org/10.1063/1.4985394. arifiyanto, a., hapin, a., meishy handerlin, p., berliana, d., & cindy, l. r. (2021). the biological prospective of red-pigmented bacteria cultured from contaminated agar media. biodiversitas, 22(3), 1152– 1159. https://doi.org/10.13057/biodiv/d220310. artha, o. a., sudarno, h, p., & l. a, s. (2019). identification of extracellular enzyme-producing bacteria (proteolytic, cellulolytic, and amylolytic) in the sediment of extensive ponds in tanggulrejo, gresik. iop conference series: earth and environmental science, 236(1). https://doi.org/10.1088/1755-1315/236/1/012003. cahyani, p., wijanarka, & budi, r. (2017). aktivitas spesifik selulase serratia marcescens dengan variasi konsentrasi amonium sulfat ((nh4)2so4) dan ph. jurnal biologi, 6(2), 41–49. retrieved from https://ejournal3.undip.ac.id/index.php/biologi/art icle/view/19535. ervina, e., ekowati, c. n., sumardi, & emantis, r. (2020). lipolytic-screening of bacillus genera as biocontrol candidate in coffee plantation. jurnal ilmiah biologi eksperimen dan keanekaragaman hayati, 7(1), 31–34. http://dx.doi.org/10.23960%2fj_bekh.v7i1.2496. halimah, n., baktir, & purkan, p. (2019). exploration of cellulolytic microorganism as a biocatalyst candidate for liquid fertilizer production. iop conference series: earth and environmental science, 217(1). retrieved from https://iopscience.iop.org/article/10.1088/17551315/217/1/012021/meta. irdawati, putri, n. d., syamsuardi, agustien, a., & rilda, y. (2020). potential of xylanase thermophilic bacteria in the pulp biobleaching process. icobiose 2019, 10, 23–27. https://doi.org/10.2991/absr.k.200807.006. isti’anah, d., ulfah, u., & ahmad, b. (2019). karakterisasi enzim amilase dari bakteri bacillus megaterium pada variasi suhu, ph dan konsentrasi substrat. jurnal riset biologi dan aplikasinya, 1(2), 18–25. http://dx.doi.org/10.26740/jrba.v2n1.p11-17. kahrarian, z., saeed, k., & ahmad, t. (2019). a review of the production of biosurfactant and pigmented prodigyosin by bacteria serrassia marsseñes. asian journal of research in medicine and medical science, 1(1), 18–24. linda, t. m., siregar, s., fitri, w. d., martina, a., lestari, w., roslim, d. i., & hapsoh. (2018). isolation and screening of culturable endophytic bacteria from leaf of rubber plant that produces of chitinase. journal of physics: conference series, 1116(5). https://doi.org/10.1088/17426596/1116/5/05203 8. mohanasrinivasan, v., c. subathra, d., d., j., e., s., & s. jemimah, n. (2018). purification and characterization of extracellular lipase from serratia marcescens vitsd2. proceedings of the national academy of sciences india section b biological sciences, 88(1), 373–381. https://doi.org/10.1007/s40011-016-0763-6. mohanram, r., murlidhar, j. m., & susan, t. (2020). isolation, identification and molecular characterization of serratia marcescens strain nmrl65 an opportunistic human pathogen from the spoiled coconut. international journal of environment and health sciences, 2(2), 81–86. https://doi.org/10.47062/1190.0202.02. okay, s., özdal, m., & kurbanoǧlu, e. b. (2013). characterization, antifungal activity, and cell immobilization of a chitinase from serratia marcescens mo-1. turkish journal of biology, 37(6), 639–644. https://doi.org/10.3906/biy-1208-45. olaniyi, o., & arotupin, d. (2013). isolation and screening of mannanase producing bacteria from agricultural wastes. british microbiology research journal, 3(4), 654–663.https://doi.org/10.9734/bmrj/2013/4221. padmavathi, t., rayavarapu, b., purushothama, r. p., niranjan, n. r., & pavitra, p. v. (2018). screening of potential probiotic lactic acid bacteria and production of amylase and its partial purification. journal of genetic engineering and biotechnology, 16(2), 357–362. https://doi.org/10.1016/j.jgeb.2018.03.005. pratika, m., m, a., & suwastika. (2021). protease activity from bacterial isolates of nepenthes maxima reinw. ex nees. journal of physics: conference series, 1763(1), 012092.https://doi.org/10.1088/17426596/1763/1 /012092. https://doi.org/10.1088/1742-6596/1569/4/042050 https://doi.org/10.1088/1742-6596/1569/4/042050 https://doi.org/10.1063/1.4985394 https://doi.org/10.13057/biodiv/d220310 https://doi.org/10.1088/1755-1315/236/1/012003 http://dx.doi.org/10.23960%2fj_bekh.v7i1.2496 https://iopscience.iop.org/article/10.1088/1755-1315/217/1/012021/meta https://iopscience.iop.org/article/10.1088/1755-1315/217/1/012021/meta https://doi.org/10.2991/absr.k.200807.006 http://dx.doi.org/10.26740/jrba.v2n1.p11-17 https://doi.org/10.1088/17426596/1116/5/052038 https://doi.org/10.1088/17426596/1116/5/052038 https://doi.org/10.1007/s40011-016-0763-6 https://doi.org/10.47062/1190.0202.02 https://doi.org/10.3906/biy-1208-45 https://doi.org/10.9734/bmrj/2013/4221 https://doi.org/10.1016/j.jgeb.2018.03.005 https://doi.org/10.1088/17426596/1763/1/012092 https://doi.org/10.1088/17426596/1763/1/012092 29 | putri et al.; screening of extracellular enzymes on serratia marcescens puspadewi, r., putranti, a., mira, a., & helma, k. (2018). aktivitas ekstraseluler yang berasal dari cladosporium tenuissimum. seminar nasional farmasi (snifa) 4 unjani, 125– 132. rosa, e., c.n, e., tundjung tripeni, h., ahmad, i., ferly, a., & achmad, a. (2020). characterization of entomopathogenic fungi as a natural biological control of american cockroaches (periplaneta americana). biodiversitas, 21(11), 5276–5282. https://doi.org/10.13057/biodiv/d211131. sumardi. (2005). optimasi produksi enzim β -mananase ekstraseluler dari bakteri geobacillus stearothermophilus l-07. jurnal sains teknologi, 11(2), 66–71. susilowati, d. n., indah, s., kristina dwi, a., & erny, y. (2018). penapisan kapang asal lahan sulfat masam kalimantan selatan sebagai penghasil enzim ekstraseluler. ilmu pertanian, 1(21), 65–82. https://doi.org/10.24246/agric.2020.v32.i1.p65-82. tubkanlu, e., aminzadeh, karkhane, alikhajeh, & ghoroghi. (2019). serratia marcescens b4a chitinase thermostability enhancement by s390i quikchange site directed mutagenesis. iranian journal of fisheries sciences, 18(4), 1046–1059. https://doi.org/10.22092/ijfs.2019.119292. wardoyo, f. a., & aprilia, i. k. (2018). peningkatan stabilitas termal dan stabilitas penggunaan berulang enzim lipase melalui imobilisasi pada zeolit alam. jurnal labora medika, 2(1), 1–5. retrieved from https://jurnal.unimus.ac.id/index.php/jlabmed. wijaya, p. s., sri, w & nur, a. (2017). morfologi dan karakterisasi pertumbuhan bakteri asam laktat (um 1.4a) dari proses fermentasi wikau maombo untuk studi awal produksi enzim amilase. jurnal sains dan teknologi pangan, 2(4), 657-663. http://dx.doi.org/10.33772/jstp.v2i5.3745. https://doi.org/10.13057/biodiv/d211131 https://doi.org/10.24246/agric.2020.v32.i1.p65-82 https://jurnal.unimus.ac.id/index.php/jlabmed http://dx.doi.org/10.33772/jstp.v2i5.3745 jurnal riset biologi dan aplikasinya, volume 3, issue 2, september 2021 optimization of various its rdna amplification protocol of yeast isolated from giant honey beehives (apis dorsata) chumaidatul choiriyah, nirmala fitria firdhausi*, esti tyastirin, yuanita rachmawati, moch. irfan hadi biology departement, faculty science and technologi, uin sunan ampel surabaya jln. ahmad yani no. 117, jemur wonosari, wonocolo district, surabaya 60237, east java, indonesia *corresponding author: e-mail: nirmala_firdhausi@yahoo.com article history abstract received : 30 july 2021 indonesia is a country with high variability of microorganisms, including bacteria, yeast, and fungi. yeast isolates could be isolated from the honeycomb of apis dorsata. molecular approaches were used to identify yeast using ribosomal dna gene sequences, called the its gene. the optimum condition for dna extractions and amplifications are needed for the successfully of molecular identification. therefore, it is necessary to optimize the dna extraction and amplification of several protocols to obtain good identification results. this study aimed to compare the effects of dna extraction with various temperatures and different amplification protocols. lipi reference dna extraction protocol with the boiling method and variations in incubation time of 10, 15, and 20 minutes at a temperature of 98° c. meanwhile, for the amplification of yeast dna using a variety of different amplification protocols. the results showed the optimal time of incubation was 10 minutes in k1 isolates with dna purity of 1.896. meanwhile, for isolates k2, k3, and k4 each with a purity of 2.246, 2.335, and 1.748. optimal dna amplification results were indicated by the presense of dna bands for each sample k1, k2, k3, and k4, namely 503, 542, 492, and 526 bp. in this study, it can be concluded that the optimal incubation time for the extraction process is 10 minutes. in addition, the optimal amplification protocol was shown in the dna bands in all sample. revised : 29 august 2021 approved : 10 september 2021 published : 30 september 2021 keywords its rdna; apis dorsata; optimization; pcr amplification; dna extraction how to cite: choiriyah, c., firdhausi, n.f., tyastirin, e., rahmawati, y., & hadi, m. i. (2021). optimization of various its rdna amplification protocol of yeast isolated from giant honey beehives (apis dorsata). jurnal riset biologi dan aplikasinya, 3(2):80-87. doi: 10.26740/jrba.v3n2.p80-87. introduction yeast is a eukaryotic unicellular microorganism from the fungi kingdom that lives as a parasite or saprophyte. in indonesia, yeasts are common microorganism in tropical rain forests. yeast isolates that have been identified from the estimated number of yeast diversity in the world are still around 1% of the total 89 yeast genera listed in the yeast monograph list. there are 37 genera of yeast or about 42% can be found in indonesia, hence the potential for exploring yeast diversity is very large. in addition, the climate and landscape in indonesia are very suitable for the life of microorganisms, including yeast (jumiyati et al., 2012). identification of yeast needs to be done to find new genera or species by exploring various ecosystems in indonesia and believing that there are still many yeasts in nature that have not been found and their numbers are higher than known yeasts (asliha et al., 2014). yeast has been long utilized in various fermented food and beverage productions, such as beer, tapai, and wine. yeast in the fermentation process acts to degrade substrates to formulate the structure, aroma, and texture in food and beverages (sumerta & kanti, 2017). along with jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi jurnal riset biologi dan aplikasinya, 3(2): 80-87, september 2021 |81 technological advances, yeast utilization expands from the industrial sector to the energy sector that develops renewable energy such as bioethanol and biofuel as alternatives to fossil fuel. yeast isolates can be extracted from beehives. beehives are hexagonal cells from wax mixed with propolis sourced from the plants. beehives are used to contain bees, pollen, and larva (rospita et al., 2014). commonly, the conventional identification based on morphology, i.e., macroscopic and microscopic observations were used for identification. conventional identification can also be completed by biochemical and physiological tests, including sugar fermentation ability, vitamin requirements, growth temperature, urease test, carbon and nitrogen element assimilation ability, and cycloheximide resistance (rukmana, 2015; suryaningsih et al., 2018). however, conventional identification has several disadvantages, e.g., the process takes a long time, and it is susceptible to identification mistakes, particularly in closely related species. in addition, it is due to the limited yeast morphological characters for the identification and the lack of references. thus, it is crucial to have a method to overcome these drawbacks, i.e., identification using molecular markers to improve the accuracy of yeast identification (maulana, 2011). yeast identification using the molecular approach is currently performed using genetic sequence data. generally, specific genes used in accurate and rapid yeast identification are ribosomal dna (rdna). it includes the internal transcribed spacer (its), a non-coding area in the ribosomal dna. this study employed this area because the its has high nucleotide sequence variations between species, identifying closely related yeasts species (hartati et al., 2021; maulana, 2011). yeast dna amplification was carried out using the thermo cycler equipment with a pair of forward and reverse primers. the pcr process results were visualized using gel documentary to observe dna band from the pcr product. this successfully process was influenced by yeast dna extraction and amplification that should be carried out optimally. hence, it is necessary to optimize a pcr for yeast its rdna amplification isolated from giant honey beehives (apis dorsata). this optimization process expected to acquire an appropriate protocol for yeast its rdna amplification and be beneficial for studies regarding identification using molecular methods. this study proposed to compare the effects of dna extraction with various temperatures and different amplification protocols. materials and methods this research was conducted from january 2020 july 2020. the tools used in this study included: erlenmeyer flask, petri dish, ose needle, electric stove, micropipette, micropipette tips, microtube, laminar air flow (laf) cabinet, autoclave, vortex mixer, microsentrifuge, dna documentation / transiluminator, spectrophotometer dna quantitave analysis [biodrop], light microscope, thermo cycler [multigene optimax], electrophoresis. the materials used in this study included: yeast isolate that was isolated from apis dorsata honey beehives. samples of beehives were obtained around the darungan lumajang resort, east java (8°12’27”s 112°56’05”e). the potato dextrose agar (pda) was used as a medium to which the antibiotic chloramphenicol was added. yeast dna extraction using nuclease-free water. kit pcr gotaq® green master mix (promega). amplification of yeast dna using its 4 (5'-tcctccgcttattgatgc 3'), and its 5 (5'ggaagtaaaagtcgtaacaagg-3') primer pairs (maulana, 2011). buffer tae, 1 kb dna marker, diamond dye, agarose gel 2%, loading dye. yeast isolation after obtaining the apis dorsata honey beehives sample, the initial stage was carried out by isolating a sample of 10 grams then dissolving it with 90 ml of sterile distilled water and then vortexing. the sample suspension was stored in the electric deep freezer at -80o c. the pda medium was prepared according to the packaging instructions and sterilized in an autoclave for 30 minutes at 121o c, 1 atm pressure. after being sterile, the medium was poured as much as 20 ml on petri dish and added the antibiotic chloramphenicol concentration of 1 mg/ml. meanwhile, for the isolation of yeast i.e, 10 µl of the suspension of the nested sample was poured on the pda medium using the spreader. cultures then incubated at room temperature for three days until yeast colonies were appeared. each appared colony was purified and transferred to a new pda medium. yeast morphology observation yeast morphology was observed using macroscopic observations consists of several parameters such as shape, color, size, texture, 82 | choiriyah et al; optimization of various its rdna amplification protocol of yeast margins, elevation. microscopic observation was observed using binocular microscope (nikon eclipse e100), such as cell shape, budding pattern, and the presence or absence of pseudo hyphae. yeast dna extraction the yeast dna extraction was extracted using the protocol from lipi with the boiling method (kanti et al., 2018). yeast isolates were taken with sterile ose, put in a tube containing 50 µl of nfw (nuclease free water), and vortexed until homogeneous. the samples were then heated at a temperature of 98° c with three variations of the incubation time, namely 10 minutes, 15 minutes, and 20 minutes. after completion of incubation, spin down until there are two layers and the top layer is transferred to a new tube. the concentration and purity of dna were measured using biodrop touch duo version 7144 v1.0.5 at a wavelength of 260 and 280 nm. optimization of yeast dna amplification of various protocols the obtained dna was amplified using go taq® green master mix [promega] protocol. pcr cocktail composition that has been made with a total reaction volume of 25 µl consisting of gotaq® green master mix 12,5 µl; nfw 5,5 µl; its5 forward primer 1 µl; its4 reverse primer 1 µl; and dna template 5 µl. the amplification used three temperature and time control protocols aimed at optimization. the temperature and times during the pcr process were shown in the table 1. the amplification results were performed electrophoresis using 2% agarose gel containing 1 µl of diamond dye nucleic acid (promega), dna ladder 1 kb (thermo scientific), and amplified samples were inserted into each well for 1 hour 15 minutes, a voltage of 50 v. the results were visualized with dna documentation/transiluminator endurotm gds labinet to observed the amplified dna bands. results and discussion yeast isolated from the apis dorsata beehives were grown on a pda medium and obtained four isolates coded by k1, k2, k3, and k4. then, macroscopic and microscopic observations were carried out. both observations estimated that four isolates are different genus. the results of macroscopic and microscopic observations of each yeast isolate were presented in table 2. macroscopically, four yeast isolates were round-shaped. the four isolates were creamy-white in color, thick and slimy in texture, and having different margins for each isolate. it was serrated, wavy for k1 and k2, respectively, and uniformed for k3 and k4. all isolates were raised in elevation. meanwhile, microscopic observation showed that the shape of isolate k1 was oval, isolate k2 and k3 were round-oval, and isolate k4 was ovoid. the yeast isolates obtained varied in size with a length between 2-7 µm and a width between 1-7 µm. the germination pattern of all isolates was multilateral, except for isolate k1 that was monopolar. the appearance of four yeast isolates microscopically under the microscope with 1000x magnification is illustrated in figure 1. table 1. third protocols of temperature and time of yeast dna amplification no. protocols pcr steps temperature ( oc) time cycle 1. maulana (2011) pre-denaturation denaturation annealing extension post-extension 95 95 58 68 68 2’ 15” 30” 1’ 10’40” 40 2. ediningsari (2008) pre-denaturation denaturation annealing extension post-extension 94 94 56 68 68 2’ 15” 30” 1’ 10’40” 40 3. kanti et al, (2018) pre-denaturation denaturation annealing extension post-extension 95 95 55 72 72 1’30” 30” 30” 1’ 15’ 40 note: ‘ minute, “second jurnal riset biologi dan aplikasinya, 3(2): 80-87, september 2021 |83 table 2. observation results of macroscopic and microscopic yeast isolates no characteristics observation of yeast isolates k1 k2 k3 k4 1. macroscopic observation a. shape b. color c. texture d. margin e. elevation 2. microscopic observation a. size b. cell shape c. germination d. pseudohypae (+/-) round round round round creamy creamy creamy-white white thick thick thick thick serrated wavy uniformed uniformed raised raised raised raised (4,5-7x1-4) µm (2-4x3-5) µm (2-6x3-7) µm (3,5-7x2,5-6) µm oval round-oval round-oval ovoid monopolar multilateral multilateral multilateral + figure 1. (a) isolate k1, (b) isolate k2, (c) isolate k3, (d) isolate k4 under a microscope with a magnification of 1000x comparing macroscopic and microscopic observation data of four yeast isolates from the apis dorsata beehive with literature from cletus kurtzman et al., (2011) “the yeast: a taxonomy study” show that isolate k1, k2, k3, and k4 had a similar characteristic with pichia, candida, torulospora, and wickerhamomyces genus yeast, respectively. however, it requires further analysis to obtain an accurate and appropriate result. the molecular analysis was initiated by dna extraction using the boiling method reference protocol from lipi with incubation time variations of 10, 15, and 20 minutes in 98⁰c. this protocol was chosen in this study because it has several advantages, such as minimal materials, fast, and affordable. dna extractions aim to generate dna isolates. the dna extraction results determine the success of subsequent dna analysis processes. therefore, the dna extraction process should be a b c d 84 | choiriyah et al; optimization of various its rdna amplification protocol of yeast carried out carefully and aseptically to avoid contamination. yeast dna extraction results were measured for its concentration and purity. the concentration results of each measurement are presented in table 3. the dna isolate with the highest concentration was k2 during the 10-minute incubation time, i.e., 14.15 µl/mg with a purity of 2.246 (table 3). meanwhile, the lowest concentration was the isolate k4 during the 15minute incubation time, i.e., 0.663 µl/mg with a purity of 2.119. according to sambrook et al., (1989), pure dna isolate has a purity value between 1.75 – 2.0. if the purity value is less than 1.75 then it indicates the presence of protein contamination, while the purity value more than 2.0 indicates the presence of rna contamination. in this study, dna isolates that showed pure dna wthout any protein or rna contamination were isolates coded k1 and k4 with a purity of 1.896 and 1.746, respectively. the pure dna results were obtained from the dna extraction process with an incubation time of 10 minutes. yeast dna isolates showed pure on each isolate was then subjected to amplification. the amplification protocol for the cocktail recipe on the pcr reaction was go taq® green master mix [promega]. primers used on the its rdna target area were primer its4 (reverse) and primer its5 (forward). these primers were universal primers to amplify all its rdna areas in fungi (maulana, 2011). three different temperatures and times during the pcr process was used for optimization based on ediningsari, (2008), maulana, (2011) and kanti et al., (2018) protocols. it was necessary to acquire excellent yeast dna and optimal pcr products for the subsequent analysis. the success in proliferating dna using pcr depends on sufficient template dna, annealing temperature, and appropriate primer selection (nugroho et al., 2013). dna from the pcr product amplification was subjected to electrophoresis and dna bands visualization using gel documentation. the results of yeast dna bands visualization from the three protocols are presented figure 2. based on the three yeast dna amplification protocols showed that the protocol by kanti et al. (2018) generated a dna band for all yeast isolates. it contrasts, maulana (2011) and ediningsari (2008) protocols did not generated dna bands for all yeast isolates, it means that the optimal protocol for amplification of yeast dna is the protocol of kanti, et.al. however, the dna quality from protocol kanti et al., (2018) was less good due to the presence of a smear. smear is dna that is cut into pieces and small size (ekasari et al., 2012). smear’s presence is possibly due to the polysaccharides in yeast isolates that were extracted during the dna extraction. besides polysaccharides, a smear may present due to rna contamination during the dna extraction process (rahayu et al., 2015). table 3. spectrophotometric results data with incubation times of 10, 15, and 20 minutes at the time of yeast dna extraction sample incubation code time spectrophotometric result concentration (µl/mg) λ 260/ λ 280 k1 10’ 15’ 20’ 2.646 1.896 4.922 1.656 6.127 1.644 k2 10’ 15’ 20’ 14.15 2.246 8.501 2.698 8.558 1.413 k3 10’ 15’ 20’ 11.98 2.335 8.436 2.491 12.35 1.387 k4 10’ 15’ 20’ 1.052 1.748 0.663 2.119 1.749 8.721 jurnal riset biologi dan aplikasinya, 3(2): 80-87, september 2021 |85 figure 2. a. dna band protocol ediningsari (2008), b. dna band protocol atit kanti, et al. (2018), c. dna band protocol maulana (2011). table 4. comparison of dna band(s) length results in the three amplification protocol no pcr temperature and time setting protocol length band dna (bp) k1 k2 k3 k4 1 ediningsari (2008) 719 bp 579 bp 588 bp 2 maulana (2011) 457 bp 3 kanti, et al (2018) 503 bp 542 bp 492 bp 526 bp in this study, the dna band of k4 isolate appeared as united, non-smearing using the protocol by maulana, (2011). although the result of dna extraction processes was qualified, however, this protocol did not generate any dna band in the isolates k1, k2, and k3. it might be due to several factors, e.g., a non-adhering primer on target dnas, non-denatured dnas, or unsuitable annealing temperature. annealing temperature that is too high result in low pcr products, while annealing that is too low results in non-specific dna amplification results (prakoso et al., 2016). annealing temperature in the pcr process highly affected the primer adherence process, and hence, a transformation of one degree causes the failure of primer adherence (gusmiaty et al., 2012; nurjayadi et al., 2020). it also applied to the protocol of ediningsari (2008) on the isolate of k4. the length comparison of dna band generated from the three protocols is presented in table 4. a b c 86 | choiriyah et al; optimization of various its rdna amplification protocol of yeast based on table 4, comparing yeast dna band(s) length using three protocols of pcr temperature and time assignment demonstrate different dna band(s) lengths. however, the length of its area ranges from 300-900 bp (citra, 2019; wardani et al., 2020). the difference in dna fragment size (dna fragment polymorphism) of yeast dna amplification results was caused by nucleotide base location distribution in genomes, which became the site of primer adherence. dna band from these different amplifications showed that dna band(s) size influences the population diversity (gusmiaty et al., 2012). conclusions four yeast isolates were successfully isolated from giant honey beehives (apis dorsata) which showed different characteristics observed from macroscopic and microscopic morphology. based on the results of the study, the yeast dna extraction process used the boiling method with temperature variations from lipi has shown the most optimal dna purity with a time of 10 minutes. references asliha, i., asliha, i. n., & alami, n. h. (2014). karakterisasi khamir dari pulau poteran madura. jurnal sains dan seni its, 3(2), e49–e52. https://doi.org/10.12962/j23373520.v3i2.6869 citra, y. (2019). isolasi dan identifikasi khamir pada bunga pisang klutuk (musa balbisiana) serta kemampuannya dalam fermentasi karbohidrat. in skripsi. uin maulana malik ibrahim. cletus kurtzman, j. w. fell, & teun boekhout. (2011). a taxonomic study. in the yeasts. elsevier science. ediningsari, a. r. (2008). identifikasi khamir dari perairan mangrove dan laut cagar alam pulau rambut berdasarkan daerah internal transcribed spacer (its) (pp. 5–20). universitas indonesia. http://lib.ui.ac.id ekasari, t. w. d., retnoningsih, a., & widianti, t. (2012). analisis keanekaragaman kultivar pisang menggunakan penanda pcr-rflp pada internal transcribed spacer (its) dna ribosom. jurnal mipa unnes, 35(1), 113282. https://journal.unnes.ac.id/nju/index.php/jm/article /view/2093 gusmiaty, ., restu, m., & pongtuluran, i. (2012). seleksi primer untuk analisis keragaman genetik jenis bitti (vitex coffassus). perennial, 8(1), 25. https://doi.org/10.24259/perennial.v8i1.211 hartati, s., wiyono, s., hidayat, s. h., & sinaga, m. s. (2021). identifikasi isolat khamir berpotensi sebagai agens antagonis dan uji produksi toksin hemolisin. jurnal agrikultura, 32(2), 190–198. jumiyati, bintari, s. h., & mubarok, i. (2012). isolasi dan identifikasi khamir secara morfologi di tanah kebun wisata pendidikan universitas negeri semarang. biosaintifika: journal of biology & biology education, 4(1), 27–35. https://doi.org/10.15294/biosaintifika.v4i1.2265 kanti, a., ilyas, m., nurkanto, a., sulistiyani, t. r., & meliah, s. (2018). panduan pengelolaan koleksi mikroorganisme indonesian culture collection (inacc). lipi press. maulana, i. (2011). identifikasi isolat-isolat khamir dari saluran pencernaan apis cerana (fabricus, 1793) di apiari berdasarkan data sequence daerah its rdna. in skripsi. fakultas matematika dan ilmu pengetahuan alam departemen biologi. https://doi.org/jakarta: universitas indonesia nugroho, t. t., rambe, e., dewi, a., fitri, r. m., sepryani, h., restuhadi, f., haryani, y., kimia, j., riau, u., agroteknologi, j., raya, j., & km, s. (2013). optimasi isolasi dan amplifikasi its dna ribosomal fungi karbolitik isolat zona inti cagar biosfer giam siak kecilbukit batu. prosiding semirata, 407–412. nurjayadi, m., efrianti, u. r., azizah, n., julio, e., nastassya, l., & saamia, v. (2020). optimum temperature of the amplification of the fljb gene of salmonella typhimurium. empowering science and mathematics for global competitiveness, 53–58. https://doi.org/10.1201/9780429461903-9 prakoso, s. p., wirajana, i. n., & suarsa, i. w. (2016). amplifikasi fragmen gen 18s rrna pada dna metagenomik madu dengan teknik pcr (polymerase chain reaction). indonesian journal of legal and forensic sciences, 2(3), 45–47. rahayu, saryono, & titania nugroho. (2015). isolasi dna dan amplifikasi pcr daerah its rdna fungi endofit umbi tanaman dahlia (dahlia variabilis) lbkurcc69. jom fmipa, 2(1), 100–106. https://jom.unri.ac.id/index.php/jomfmipa/article /view/4311 rospita, o., situmorang, p., & hasanuddin, a. (2014). panduan manual budidaya lebah madu. balai penelitian kehutanan aek neuli. rukmana, s. (2015). perbandingan sekuense kapang trichoderma sp. berdasarkan internal transcribed spacer (its) rdna dengan denggunakandata base ncbi. in skripsi. biologi, fakultas sains dan teknologi, universitas malik ibrahim. sambrook, j., fritsch, f., & maniatis, t. (1989). molecular cloning: laboratory manual. 2nd ed. in cold spring harbor protocols (3td ed.). cold spring harbour lab. press. sumerta, i. n., & kanti, a. (2017). keragaman jenis khamir penghasil etanol yang diisolasi dari makanan fermentasi di kepulauan riau. jurnal biologi indonesia, 13(1), 61–70. https://doi.org/10.47349/jbi/13012017/61 suryaningsih, v., ferniah, r. s., & kusdiyantini, e. (2018). karakteristik morfologi, biokimia, dan molekuler isolat khamir ik-2 hasil isolasi dari jus buah sirsak jurnal riset biologi dan aplikasinya, 3(2): 80-87, september 2021 |87 (annona muricata l.). jurnal biologi, 7(1), 18–25. wardani, d. k., mangunwardoyo, w., & sudiana, i. m. (2020). isolation and identification of wood fungi and its mycoparasites in cibinong science center, lipi cibinong, west java, indonesia. aip conference proceedings, 2242. https://doi.org/10.1063/5.0012550 jurnal riset biologi dan aplikasinya, volume 2, nomor 2, september 2020 addition of carbon sources to pineapple waste media in the production of single cell protein biomass saccharomyces cerevisiae penambahan sumber karbon pada media limbah nanas dalam pembuatan protein sel tunggal biomassa saccharomyces cerevisiae anggi nurmalasari*, shinta maharani agroindustry engineering, faculty of technology and vocational skills education, universitas pendidikan indonesia abstract single-cell protein (scp) is the term used for crude or pure protein derived from simple single or multi-celled microorganisms. pineapple peel contains monosaccharides as much as 10.8% so that it can be used as a fermentation medium in single-cell protein production. the purpose of this study was to determine the effect of adding carbon sources of fructose and sucrose on ph, cell dry weight, and protein content in the manufacture of single-cell proteins. this study used a completely randomized design (crd) with two factors, namely the addition of carbon (fructose, sucrose, and control) and fermentation time (24.48, and 72 hours). the data analysis used the variance test and the duncan multiple range test (dmrt) continued to test with a confidence level of 95%. the results showed that the addition of carbon to the media had a very significant effect on media ph, cell dry weight, and protein content. in the medium with the addition of fructose it has a ph of 3.81; dry weight 0.4203 grams; and protein content 69.08/l. whereas in the media with the addition of sucrose, the ph was 4.33, the dry weight of the cells was 0.3385 grams, and the cells had a protein content of 85.55 mg/l. the addition of a fructose carbon source gave the cell dry weight more than the addition of carbon sucrose abstrak protein sel tunggal (pst) adalah istilah yang digunakan untuk protein kasar atau murni yang berasal dari mikroorganisme bersel satu atau banyak yang sederhana. kulit buah nanas mengandung monosakarida sebanyak 10,8% sehingga dapat dimanfaatkan sebagai media fermentasi pada produksi protein sel tunggal. tujuan penelitian ini adalah untuk menguji pengaruh penambahan sumber karbon fruktosa dan sukrosa terhadap ph, berat kering sel, dan kadar protein dalam pembuatan protein sel tunggal. penelitian ini menggunakan rancangan acak lengkap (ral) dua faktor yaitu penambahan karbon (fruktosa, sukrosa, dan kontrol) dan waktu fermentasi (24,48, dan 72 jam). analisis data menggunakan uji sidik ragam dan uji lanjut duncan multiple range test (dmrt) dengan taraf kepercayaan 95%. hasil penelitian menunjukkan bahwa penambahan karbon pada media memberikan pengaruh yang sangat nyata terhadap ph media, berat kering sel dan kadar protein. media dengan penambahan fruktosa memiliki ph sebesar 3,81; berat kering 0,4203 gram; dan kadar protein 69,08/l. pada media dengan penambahan sukrosa menghasilkan ph sebesar 4,33 dengan berat kering sel sebanyak 0,3385 gram, dan sel memiliki kadar protein sebesar 85,55mg/l. penambahan sumber karbon fruktosa memberikan berat kering sel lebih banyak dibandingkan dengan penambahan karbon sukrosa. how to cite: nurmalasari, a & maharani, s. (2020). addition of carbon sources to pineapple waste media in the production of single cell protein biomass saccharomyces cerevisiae. jurnal riset biologi dan aplikasinya, 2(2), 70-76. *corresponding author: e-issn 2655-9927 jln. dr. setiabudi no.229, isola, kec. sukasari, kota bandung, jawa barat 40154 e-mail: nurmalasarianggi@student.upi.edu jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi article history received : 10 september 2020 approved : 25 september 2020 published : 30 september 2020 keywords: fermentation; pineapple peel; single cell protein; saccharomyces cerevisiae kata kunci: fermentasi; kulit nanas; protein sel tunggal; saccharomyces cerevisiae 71 | nurmalasari & maharani. addition of carbon sources to pineapple waste media introduction the increasing population of humans and animals causes the demand for food and animal feed to increase. food and animal feed must contain good nutritional elements such as protein. a large number of protein needs for humans and animals results in proteins derived from animals and plants that are not sufficient for human and animal populations. since the 1950s, efforts have been made to find alternative sources of protein. among them are single-cell proteins derived from microorganisms. proteins obtained from microorganisms are cheap and compete with other protein sources and can provide good nutritional value depending on the amino acid composition (dhanasekaran et al., 2011). single-cell protein is a term used for crude or pure protein derived from unicellular or multicellular microorganisms, such as bacteria, yeast (yeast), fungi, algae, and protozoa. the microorganism used in this study was s.cerevisiae yeast. when compared to the production of protein from animals and plants, single-cell protein production is more efficient, because it does not require a large area, does not cause waste, and the production process is fast, reproduction of microorganisms such as bacteria and yeast can give greater yields every hour, while algae take less than one day (pawignya, 2011). single-cell proteins can be produced on several different substrates. conventional substrates such as starch, molasses, fruit, and vegetable waste have been used for the manufacture of single-cell proteins (suman et al., 2015; srividya et al., 2014). monosaccharide and disaccharide substrates are mostly used for the manufacture of single-cell proteins because monosaccharides and disaccharides are natural microbial substrates and are renewable raw materials. pineapple fruit is widely used by most indonesians for consumption needs. apart from being consumed fresh, pineapples are also widely used as raw material for the agricultural industry with various products such as processed pineapples, such as jam, sweets, syrup, lunkhead, chips, canned fruit, which are indonesia's leading export products (nastiti et al., 2013). from the various types of processing, pineapple waste will be obtained in large enough quantities. pineapple waste consists of peel waste and pineapple stem waste. waste or by products of pineapple are still limited in use and relatively just thrown away (tahir et al., 2008). the nutritional content of pineapple peels includes water 84.50%, reducing sugar 6.62%, protein 6.4%, and crude fiber 16.7% (nastiti et al., 2013). the sugar content in pineapple peel can be used in making single-cell protein. because microorganisms will use this sugar as a carbon source and as an energy source. carbon sources that can be added to the manufacture of single-cell proteins are monosaccharides and disaccharides (pawignya, 2011). meanwhile, purwitasari et al. (2004) in her study stated that the carbon source added to the manufacture of single-cell proteins comes from coconut water which contains glucose, sucrose, fructose, inositol, and sorbitol. then, the research of pawignya (2011) and masithoh (2012) used sucrose as a carbon source in a single cell protein maker. therefore this study aims to determine the effect of adding types of carbon sources on ph, cell dry weight, and protein content in the manufacture of single-cell proteins. the carbon sources added in this study were fructose and sucrose. fructose is one of the monosaccharide carbohydrates, while sucrose is one of the disaccharide carbohydrates. materials and methods this research was conducted at the quality control laboratory, agricultural product processing technology laboratory and instrument laboratory department of teknologi agroindustri, fptk universitas pendidikan indonesia bandung. this research was conducted using two-factor completely randomized design (crd) experiments, namely the type of carbon source and fermentation time. the carbon source factor consists of three treatments, namely no addition of carbon, the addition of fructose, and the addition of sucrose. while, the fermentation time factor consisted of three fermentation time treatments, namely 24 hours, 48 hours, and 72 hours. the tools used in the manufacture of this single-cell protein are autoclave, shaking incubator, 250 ml erlenmeyer, spirit burner, laminar air flow cabinet, screw tube, loop needle, micropipette. meanwhile, the tools used for single-cell protein analysis are ph meter, centrifuge, analytical balance, oven, desiccator, uv-vis spectrophotometer, and cuvette. the materials used in the manufacture of this single-cell protein are pineapple peel waste, as a source of s. cerevisiae, sucrose, fructose, pda media, aquadest, (nh2)2so4, kh2po4, mgso4, cacl2, ch3cooh, (cuso4.5h2o and knac4h4o6). while, jurnal riset biologi dan aplikasinya, 2(2), 70-76, september 2020 | 72 the materials used for the single-cell protein analysis test are bovine serum albumin (bsa) standard solution (1; 2; 3; 4; 5 mg/l), biuret solution (cuso4.5h2o and knac4h4o6), and 30% naoh solution. the stages of making single-cell protein include isolation of s. cerevisiae, making media for pineapple peel, making a starter, and the fermentation process. 1. s. cerevisiae isolation instant dry yeast containing s. cerevisiae with an additional 9 ml of sterile distilled water, then was diluted up to 10-6. to get a single colony, dilution was carried out so that the growth of s. cerevisiae is not too dense. the inoculum at 10-1 dilution to 10-6 dilution was cultured on pda medium using the slant method, then two inoculums were evenly scratched on the surface, then incubated at 30°c for 48 hours (febriyanti et al., 2017). colony morphology of growing s. cerevisiae is identified macroscopically from the colony form such as pearl grains along the inoculation line, smooth surface texture, and yellowish-white color (septriani, 2009). 2. pineapple peel wasted medium preparation 500 grams of pineapple peel waste was washed, then blended with 500 ml aquadest for 2 minutes with a blender speed of 21,000 rpm. the pineapple solution is filtered using a filter cloth. pineapple filtrate is taken and pasteurized at 610c for 30 minutes and then cooled (pawignya, 2011). this solution is referred to as a fermentation medium. 3. preparation of s. cerevisiae starter solution the starter solution contains purified s. cerevisiae. in making this starter, there are three treatments for adding carbon sources, namely: without adding a carbon source (control) and adding a carbon source in the form of fructose and a carbon source in the form of sucrose. the starter can be made on a source of 20 grams of fructose or sucrose carbon dissolved in 100ml of aquadest, the ph of the solution is adjusted to 5 by adding 1 n ch3cooh solution, then adding 0.1 gram of nutrients (nh2)2so4, 0.1 gram of k2hpo4, 0,05 grams of mgso4, 0.01 grams of nacl, and 0.01 grams of cacl2 (mondal et al., 2012) ). after that, the solution was sterilized at 1210c for 15 minutes. after a solution temperature of ± 290c, the pure culture of s. cerevisiae that had been isolated was inserted in two ose needle colonies into the solution then fermented using a shaking incubator for 2 days at 300c (pawignya, 2011). 4. fermentation process 135 ml of pineapple peel solution was added to the erlenmeyer, after that the ph of the solution was adjusted to 4.5 with the addition of 1n ch3cooh solution and then sterilized at 121oc for 15 minutes. after the solution temperature was ± 290c, the solution was added with 15 ml of starter and fermented for 24 hours, 48 hours, and 72 hours (pawignya, 2011). 5. test method a. media ph measurement (sni-06-6989) measurement of the ph of the control media, fructose media, and sucrose media were carried out at 24, 48, and 72 hours using a ph meter that had been sterilized using a disinfectant. b. measurement of cell dry weight (purwitasari, 2004) 50 ml of media samples centrifuged at 3000 rpm for 10 minutes. the precipitate is taken and transferred into a cup, then dried at 600c for 5 hours. after drying, the cells are extracted by scraping them, then the resulting powder is weighed by the dry weight of the cells and analyzed for protein content. c. biuret method analysis of protein content (aoac, 1995) protein content was measured by the biuret method using a uv-vis spectrophotometer with a wavelength of 550nm. this experiment was conducted by repeating the treatment twice and repeating the test analysis three times. the test analysis was carried out on single-cell proteins, namely ph, cell dry weight, and protein content. data analysis was carried out using the test of variance at the 95% confidence level, for treatments that were significantly different, further tested the duncan multiple range test (dmrt) with a confidence level of 95%. results and discussion single-cell protein is a product of dry cell or microorganism biomass that can be used as a source of protein for food and feed (babazadeh et al., 2014). in this study, the microorganism used was s. cerevisiae. s. cerevisiae contains lots of vitamins, especially vitamin b complex and minerals, so it is very good to be consumed as a dietary supplement for humans and animals. also, the percentage of s. cerevisiae protein content was 45% higher than soy protein by 35% (masithoh & nim, 2012). the manufacture of single-cell protein in this study was carried out by adding a carbon source to the starter. the results of ph testing for each 73 | nurmalasari & maharani. addition of carbon sources to pineapple waste media treatment and fermentation time can be seen in table 1. changes in ph during fermentation of 23, 48, and 72 hours were still in the range of s. cerevisiae growth, namely at 3.72-4.71, so that they did not inhibit the growth of s. cerevisiae. according to pawignya (2011) stated that the ph of s. cerevisiae growth ranged from 3.5-5.5 with an incubation temperature of 25-300c. before fermentation, the pineapple peel waste media in this study was set at ph 4.5, because s. cerevisiae grew well at that ph. during the fermentation time of 24, 48, and 72 hours, the media that was not added with a carbon source (control) had the highest ph of the media than the media with added fructose and sucrose. this is because the control media only uses the carbon source in the pineapple skin, namely glucose as much as 10.8% (dhanasekaran et al., 2011). the addition of sucrose and fructose greatly affects the ph of the media, because this carbon is used by s. cerevisiae in the starter making, resulting in organic acids which lower the ph. sucrose is a disaccharide consisting of glucose and fructose. to hydrolyze disaccharides into monosaccharides, s. cerevisiae uses invertase enzymes (azizah et al., 2012). this hydrolysis process causes the ph of the media with the addition of sucrose carbon to be higher than the addition of fructose carbon because s. cerevisiae needs to hydrolyze disaccharides for the fermentation process, whereas in the fructose medium s. cerevisiae does not need to hydrolyze it first. during fermentation, s. cerevisiae produces zymase and invertase enzymes, under an aerobic conditions the zymase enzyme will break down sucrose into monosaccharides (glucose and fructose) (artiyani, 2011). during fermentation of 0-24 hours, all media experienced a decrease in media ph. this is because during fermentation of s. cerevisiae it produces organic acids such as malic acid, citric acid, acetic acid, tartaric acid, lactic acid, butyric acid, and propionic acid as a by-product (masithoh & nim, 2012). s. cerevisiae has a generation time of 2 hours so that during 24 hours of fermentation, s. cerevisiae has undergone a process of cell addition and has entered a logarithmic growth phase (artiyani, 2011). during 24 hours to 48 hours of fermentation, the ph decreased for each growth medium. the decrease in media ph from 24-48 hours is not as much as fermentation for 0-24 hours due to fermentation of 24-48 hours s. cerevisiae has entered a slow growth phase (pratiwi, 2018). in this phase, the possibility of nutrients has decreased so that the ph decrease is not too much. tablel 1. degree of medium acidity during fermentation carbon source ph time hour 24 48 72 control 4.34 ± 0.04bc 4.27 ± 0.04b 4.71 ± 0.01c fructose 3.83 ± 0.16a 3.72 ± 0.02a 3.81 ± 0.01a sucrose 4.22 ± 0.07b 4.11 ± 0.00ab 4.33 ± 0.02bc note: different letter notations indicate a significant difference in the confidence level of the dmrt test of 95% table 2. cell dry weight (g) fermentation result carbon source cell dry weight (g) time hour 24 48 72 control 0.2804 ± 0.03b 0.2168 ± 0.01a 0.2963 ± 0.00c fructose 0.3757 ± 0.01cd 0.4167 ± 0.05d 0.4203 ± 0.01d sucrose 0.3608 ± 0.01c 0.3712 ± 0.02cd 0.3385 ± 0.03c note: different letter notations indicate a significant difference in the confidence level of the dmrt test of 95% jurnal riset biologi dan aplikasinya, 2(2), 70-76, september 2020 | 74 fermentation at 72 hours has increased ph. this is because the food and nutrients of s.cerevisiae are starting to run low so that they undergo a change in protein in the medium for its metabolic activity.this metabolic process causes the formation of metabolites resulting from protein degradation such as urea and ammonium ions which cause an increase in ph (purwitasari et al., 2004). research conducted by purwitasari (2004) regarding the manufacture of single-cell proteins from coconut waste medium shows that the longer fermentation time of the ph medium increases. also, research conducted by hasibuan (2019) also stated that during fermentation of 0-24 hours the ph of the media has decreased, while during 48-72 the ph of the media has increased. cell dry weight is a method of calculating cells by separating the substrate and cells formed from the fermentation process. the separation process uses a centrifugation technique and the residue that settles is dried at a temperature of 600c for 5 hours. the results of the cell dry weight test for each treatment and fermentation time can be seen in table 2. based on table 2, there is no specific trend from the results of the analysis of the dry weight of cells to the fermentation time. this occurs because the dry weight of impure cells comes from the cells resulting from the fermentation process. several impurities are weighted as dry weight of cells, namely pineapple juice fibers which are filtered during filtering. the increase in dry cell weight is strongly influenced by the rate of growth and the ability of cells to utilize nutrient sources in the media. the more nutrients s.cerevisiae needed for growth, the resulting increase in the number of cells during the incubation time (masithoh & nim, 2012). the incubation time did not give significantly different results, but the longer the incubation time, the dry weight of the cells increased but not too much. apart from the rate of growth, the dry weight of cells is very much influenced by oxygen. oxygen and aeration are very important for the growth of s. cerevisiae because oxygen is quickly absorbed by s. cerevisiae and used to synthesize unsaturated fatty acids and sterols that form cell membranes, oxygen also stimulates the synthesis of molecules needed by s. cerevisiae to carry out metabolism and take up sugar. disaccharides. aeration also has a very important role, according to casselman (2005), continuous agitation/aeration can result in an increase in the number of yeast cells 10 to 15 times. this is evidenced by research conducted by casselman (2005) that agitation with stable and sustainable stirring increases the number of yeast cells compared to the method of stirring. the unstable stirring factor also causes the cell growth process to have no specific tendency for each treatment. based on the analysis of completely randomized design data for cell dry weight, the addition of a carbon source has a very significant effect on cell dry weight. the fermentation time does not affect the dry weight of the cells. based on the dmrt analysis, it is known that the fermentation time of s.cerevisiae on fructose and sucrose media was not significantly different, while in the control medium the fermentation time at 48 hours showed a significant difference in dry weight with fermentation time at 24 and 72 hours. in addition, the addition of carbon fructose and sucrose in the fermentation medium was significantly different from the control media, this is because the controlled media only used glucose contained in pineapple peels. the optimum dry weight of cells in the fermentation medium with the addition of fructose was 0.4203 grams, while the lowest cell dry weight in the controlled media was 0.2168 grams. this is similar to research conducted by masithoh (2012), which shows that the addition of sucrose to single-cell protein-making from rice bran media produces more cell dry weight. analysis of protein content is one way to determine the absorption of nutrients during fermentation by s.cerevisiae cells. the results of testing protein levels in each treatment and fermentation time can be seen in table 3. table 3. protein content (mg/l) fermentation results carbon source protein content (mg/l) time hour 24 48 72 control 89.81 ± 15.18b 73.03 ± 10.96ab 107.8 ± 1.48c fructose 85.05 ± 9.10ab 72.37 ± 7.95a 69.08 ± 0.11a sucrose 89.66 ± 0.71b 77.14 ± 8.00ab 85.55 ± 0.82ab 75 | nurmalasari & maharani. addition of carbon sources to pineapple waste media based on table 3, the cell protein content of fructose media tends to decrease during the fermentation time. meanwhile, the levels of cell protein from sucrose and control media increased. meanwhile, research results conducted by pawignya (2011) states that the longer the fermentation time produces more cell protein levels. the increase in protein levels can be caused by the increase in yeast cells which act as single-cell protein agents because s. cerevisiae consists of 5052% crude protein, 30-37% carbohydrates, 4-5% fat, and 7-8% minerals. (reed & nagodhawithana, 1988). the single-cell protein content produced in the purwitasari (2004) study was 26-38%. the longer the fermentation takes, the less protein content in the purwitasari (2004) study. also, the protein content produced in mashitoh's (2012) study regarding the manufacture of single-cell proteins from bran waste was 29-37%. meanwhile, research conducted by hasibuan (2019) regarding the manufacture of single-cell proteins from rice water waste and pineapple waste is 0.02%. then, research conducted by widanti (2012) regarding the manufacture of single-cell protein from tofu liquid waste has a protein cell content of 0.6%. meanwhile, the optimum protein content in this study was 0.01%. based on the calculation of complete randomized design data analysis of protein content, the addition of carbon sources has a significant effect on cell protein levels. the fermentation time also affects the levels of cell protein significantly. dmrt further test analysis showed that the cell protein levels between the control media, fructose, and sucrose were not significantly different. however, the protein content of the 72-hour fermentation control medium was different from other media. the optimum protein content in the controlled media was 107.8 mg/l, while the lowest protein content in the fructose medium was 69.08 mg/l. this is because the media with added carbon contains 30.8% sugar, this causes s.cerevisiae to experience osmotic pressure. according to wardani et al. (2013) stated that fermentation in a medium containing 25% sugar is classified as fermentation under conditions of high osmotic pressure so that cells experience lysis due to hypertonic medium causing disrupted cell metabolism. conclusion the addition of carbon fructose and sucrose to the starter of single cell protein production affected the ph of the fermentation medium and the dry weight of the cells. the addition of carbon has no effect on protein content. the carbon source in the form of fructose can increase the dry weight of the cells produced, while sucrose can increase the protein content of the resulting dry cells. references aoac. (1995). official methods of analysis of the association of official analytical chemists. washington dc: association of official analytical chemists. https://www.aoac.org/ artiyani, a. (2011). bioetanol dari limbah kulit singkong melalui proses hidrolisis dan fermentasi dengan saccharomyces cerevisiae. prosiding seminar nasional manajemen teknologi xiii. http://eprints.itn.ac.id/2911/1/01. azizah, n., al-baari, a., & mulyani, s. (2012). pengaruh lama fermentasi terhadap kadar alkohol, ph, dan produksi gas pada proses fermentasi bioetanol dari whey dengan substitusi kulit nanas. jurnal aplikasi teknologi pangan, 1(2), 72–77. http://jatp.ift.or.id/index.php/jatp/article/view/73. babazadeh, m., soltani, m., kamali, a., & asl, m. s. (2014). production of single cell protein from stickwater of kilka fish meal factory using lactobacillus plantarum and bacillus licheniformis. iranian scientific fisheries journal, 19(4): 96–101. http://aquaticcommons.org/id/eprint/21797. casselman, r. (2004). yeast propagation and maintenance : principles and practices by mb. : california: the maltose falcons. https://www.semanticscholar.org/paper/yeastpropagation-and-maintenance-%3a-principles-andraines casselman/e5e8ea0b5a6e5bc0d41a3cec881e26a84d0e4d6c . dhanasekaran, d., lawanya, s., & saha, s. (2011). production of single cell protein from pineapple waste. innovative romanian food biotechnology, 8, 26–32. https://www.researchgate.net/publication/235354886_pr oduction_of_single_cell_protein_from_pineapple_waste_usi ng_yeast febriyanti, a. e., sari, c. n., & adisyahputra, a. (2017). efektivitas media pertumbuhan khamir komersial (saccharomyces cerevisiae) untuk fermentasi bioetanol dari eceng gondok (eichhornia crassipes). bioma, 12(2), 112. https://doi.org/10.21009/bioma12(2).6 masithoh, e., & nim, m. (2012). pengaruh konsentrasi sukrosa terhadap pertumbuhan khamir roti saccharomyces cerevisiae pada media bekatul dalam produksi protein sel tunggal [universitas sebelas maret].https://digilib.uns.ac.id/dokumen/detail/28307/ pengaruh-konsentrasi-sukrosa-terhadap-pertumbuhankhamir-roti-saccharomyces-cerevisiae-pada-mediabekatul-dalam-produksi-protein-sel-tunggal. mondal, a.k., sengupta, s., bhowal, j., & bhattacharya, d.k. (2012). utilization of fruit wastes in producing single cell protein. international journal of science, environment and technology, 1(5), 430–438. http://www.ijset.net/vol-5/1/ijset%209.pdf. nastiti, u. n., lastuti, n. d. r., & nurhajati, t. (2013). the decreasing of crude fiber and the increasing of crude protein content of pineapple peel (ananas comosus l. merr) which fermented by cellulolytic bacteria (actinobacillus sp. ml08). agroveteriner, 1(2), 46– 54.http://journal.unair.ac.id/agrovet@the jurnal riset biologi dan aplikasinya, 2(2), 70-76, september 2020 | 76 decreasing-of-crude-fiber-and-the-increasing-of-crudeprotein-content-of-pineapple-peel-(ananas-comosus-l.merr)-which-article-6803-media-49-category-5.html. pawignya, h. (2011). pembuatan protein sel tunggal dari limbah nanas dengan proses fermentasi. prosiding seminar nasional teknik kimia 'kejuangan". pengembangan teknologi kimia untuk pengolahan sumber daya alam indonesia, a05-1-a05-5. https://www.academia.edu/34661948/pembuatan_prote in_sel_tunggal_dari_limbah_nanas_dengan_proses_f ermentasi. pratiwi, l. d. (2018). kajian kinetika pertumbuhan mikroorganisme dan kandungan β-glukan selama fermentasi tempe dengan penambahan saccharomyces cerevisiae. lampung: universitas lampung. https://onesearch.id/record/ios4198.31796. purwitasari, e., pangastuti, a., & setyaningsih, r. (2004). pengaruh media tumbuh terhadap kadar protein saccharomyces cerevisiae dalam pembuatan protein sel tunggal. bioteknologi, 1(2), 37–42. https://doi.org/10.13057/biotek/c010202. purwanto, maria g. m. (2014). perbandingan analisa kadar protein terlarut dengan berbagai metode spektroskopi uv-visible. jurnal sains & teknologi, 7, 2: 64-71. http://repository.ubaya.ac.id/24502/2/purwanto_perban dingan%20analisa_2014.pdf. reed, g. & nagodhawithana, t.w. (1988). technology of yeast usage in winemaking. american journal enology viticology, 39, 83-85. https://www.ajevonline.org/content/39/1/83. septriani, e. e. (2009). isolasi dan identifikasi saccharomyces cerevisiae yang diperoleh dari pg-ps madukismo yogyakarta yang digunakan dalam proses fermentasi alkohol [yogyakarta]. https://repository.usd.ac.id/17106/2/058114148_full.pd f. srividya, a.r., vishnuvarthan, v.j., murugappan, m & dahake, p. g. (2014). international journal for pharmaceutical research scholars (ijprs). international journal for pharmaceutical research scholars (ijprs), 2(i–4), 671– 677. https://www.researchgate.net/publication/25969470 2_single_cell_protein-_a_review. suman, g., nupur, m., anuradha, s., & pradeep, b. (2015). single cell protein production: a review. international journal of current microbiology and applied sciences, 4(9), 251–262. https://doi.org/10.1016/s0167-8760(01)00179-9 tahir, i., sumarsih, s., & astuti, s. (2008). kajian penggunaan limbah buah nenas lokal (ananas. makalah seminar nasional xviii, jurusan kimia fmipa ugm. https://www.academia.edu/25998288/kajian_pen ggunaan_limbah_buah_nenas_lokal_ananas_como sus_l_sebagai_bahan_baku_pembuatan_nata_fruit _waste_of_local_pineapple_ananas_comosus_l_as _nata_media wardani, a. k., nurtyastuti, f., & pertiwi, e. (2013). produksi etanol dari tetes tebu oleh saccharomyces cerevisiae pembentuk flok (nrrl-y 265) ethanol production from cane molasses by flocculant saccharomyces cerevisiae (nrrl-y 265). agritech, 33(2), 131–139. https://doi.org/https://doi.org/10.22146/agritech.9 810. widanti, a. (2012). produksi protein sel tunggal dari limbah cair tahu dengan kultur saccharomyces cerevisiae 3005. yogyakarta: universitas islam negeri sunan kalijaga. http://digilib.uin suka.ac.id/id/eprint/10791. wijaya, a. i. p. (2013). kadar protein dan organoleptik pada berbagai macam tempe dengan variasu bahan dari koro pedang (canavalia ensiformis l. dc) dan kedelai (glycine max (l.) merr). salatiga: universitas kritsten satya wacana. https://repository.uksw.edu/bitstream/123456789/4 677/2/t1_652009016_full%20text.pdf. jurnal riset biologi dan aplikasinya, volume 5, issue 1, march 2023 effects of zinc accumulation on earthworm aporrectodea caliginosa (haplotaxida: lumbricidae) safaa mohammed mahmood* and adnan musa mohammed department of biology, college of education for pure sciences, university of mosul almuharibin district mosul city, iraq *corresponding author: e-mail: mohamedsafaa213@uomosul.edu.iq article history abstract received : 25 october 2022 earthworms are key to the earth's ecosystem, which helps the soil increase its fertility and repair its existing elements, as well as remove contaminants. this study investigated the accumulation of zn in the earthworm aporrectodea caliginosa after 15 days of exposure. the worms were grown in media with different concentrations of zn between 750 and 1500 ppm. each treatment consisted of three replicates, containing 30 worms. a control group without zn was also used. data were analyzed by using duncan multi–range. the results revealed that a. caliginosa had a strong ability to accumulate zn in its tissue compared to the control group. it was noticed that the increase of the heavy metal in the worm´s tissue is associated with the elevation of the metal in its media. the results show a significant loss of weight in the worm´s body and loss in the growth rate; they also shown a decrease in specific growth rate. moreover, there was a significant decrease in the worm length, showing a high effect, especially after 15 days of breeding with all concentrations used in this study. the researchers recommend using earthworms to purify the soil from contaminants because earthworm has a great ability to get rid of all pollutants, whether metals or pesticides or parasites, especially in industrialized countries and agricultural lands. revised : 4 february 2023 approved : 17 march 2023 published : 31 march 2023 keywords bioremediation; bioindicator; heavy metal; soil pollution how to cite: mahmood, s.m. & mohammed, a.m. (2023). effect of zinc accumulation on earthworm aporrectodea caliginosa (haplotaxida: lumbricidae). jurnal riset biologi dan aplikasinya, 5(1): 8-15.doi:10.26740/jrba. v5n1.p.8-15. introduction earthworms are key to the earth's ecosystem, which helps the soil increase its fertility and repair its existing elements, as well as remove contaminants. the zinc element is the second important element of the body in addition to it is considered a toxic element if used with certain concentrations and time periods. one of the most peculiar and special behavior of earthworms is to accumulate heavy metals in their tissues and is quite sensitive to contaminants, which make them good bio-indicators (nahmani & lavelle, 2002). soil is a complex system functioning as habitat group for microorganisms, plants, animals, and humans. contaminated soils have become a nowadays problem since they lead to groundwater contamination and use excessive in agriculture of biochemical compounds in the food and industry (loureiro et al., 2005). bioremediation represents an interesting alternative of decontamination processes of the environmental factors, which increasingly gain attention in the last decades. sources of heavy metals (cd, pb, zn, cu) from agricultural and mining industry. in terms of the sources in the agricultural sector, these can be categorized into, pesticides, manure of animal, and sewage (li et al., 2014). use of polluted wastewater for irrigation purposes has led to increase soil heavy metal concentration effect non-target objects distribution and physiology, especially used zn because zn t enters the metabolism process for living organisms (latha & mahaboob-basha, 2016). heavy metals are known as dangerous pollutants because they are toxic and non-degradable, thus accumulation of jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi mailto:mohamedsafaa213@uomosul.edu.iq https://doi.org/10.26740/jrba.v5n1.p8-15 9| mahmood, s.m. & mohammed, a.m., effects of zinc accumulation on earthworm heavy metals in soil causes many risks to the ecosystem and human life (odoh et al., 2011). utilizing living organisms in decontamination and restoring environmental factors can be efficient and feasible compared with other physical and chemical processes (iordache & borza, 2012). among these organisms are earthworms which have the ability to store heavy metals in their bodies, including zinc and cadmium, for example, and this is done by building a group of proteins known as metallothiones, which are characterized by their low molecular weights and being rich in cysteine, as well as building proteins associated with minerals that are formed as a result of urging certain sites that build new proteins. it is believed that one of the functions of these proteins is to reduce the toxic effect of metals through their association with these proteins and the decrease in the concentrations of minerals present in a free state within the bodies of these worms (hilmy et al., 1988). the implication associated with heavy metal contamination is of great source, specifically in agricultural production system (uzoma et al., 2013). the capacity of earthworms to assimilate metals into their bodies has led to use for cleaning soil from metal (iordache & borza, 2012). the aim of the current study was to assess the efficiency of aporrectodea caliginosa in accumulation zn in the body tissue from polluted soil. compared to other species of earthworms, it was noted in previous research that they have the ability to accumulate heavy metals (latha & mahaboob-basha 2016) .the study also aims at showing the effect of the key biological processes on the weight and growth rate these findings weight and growth rate also point to a possibility to restore their quality by maintaining in appropriate levels the earthworm populations in the agricultural lands, as well as the specific growth rate of the earthworms, which were estimated to rid the soil of contaminants and increase soil fertility. materials and methods experimental organism earthworms (aporrectodea caliginosa) were used as test material in the current study. to determine the effect of zinc and its accumulation in worms’ tissue and its comparison with soil, in addition to its impact on the weight of worms and their relative growth and specific growth rates and lengths. methods of collection earthworm was collected from the upper layer of the earth about 30-50 cm in depth from the gardens of mosul university. the appropriate time for the sampling in spring (april) is early morning. the collected live worms were stored in plastic bags filled with a suitable amount of wet soil. preparation of tested compounds the heavy metal zn used in the study was znso4.7h2o with three different concentrations containing 750, 1000, and 1500 ppm of zn. each treatment consisted of three replicates, containing 30 worms. a control group without zn was also used. determination of growth performance in this study, after taking the weights of the worms treated with zinc concentrations, the mean weight and relative growth were calculated according to the time period using sogbesan & ugwumba (2006) method. calculation of the number of heavy metals accumulated in worms and soil in order to determine the number of heavy metals accumulated in experimental worm bodies (worm tissues) for all the concentrations used in the current study as well as the control group, as well as the soil and their concentrations, these worms were digested by (dai et al., 2004) and (al-safwii 2006). the earthworms were dehydrated at 40°c. after that, a sample of earthworms was taken after grinding, 100 mg were weighed and mixed with 4 ml of concentrated nitric acid and 2 ml of hydrochloric acid, which were left for 12 hours in covered glass bottles and then heated by placing it on a hot plate at high temperature for two hours, the samples were filtered after cooling and then completed to 25 ml with distilled water and then measured by an atomic absorption photometer (apha, 1985). the soil samples were digested. then, 2 g of soil were added to the soil: a mixture of sulfuric acid: nitric: perchlorate 1: 1: 3 and 10 ml of this mixture then heated on a hotplate for two hours. the samples were covered with an hour bottle after the second day, the color became milky then 5 ml of the previous mixture was added back to the samples without heating and left for 30 minutes, the samples were then nominated and sized to 50 ml with distilled water and the samples were ready for measurement with the atomic absorption photometer. jurnal riset biologi dan aplikasinya, 5(1): 8-15, march 2023|10 data analysis all data recorded were computed and analyzed for difference using duncan multi–range. the error rate was less than < 0.05 (al-zubaidy & alfalahy 2016). results and discussion the accumulation of zn in earthworm tissues this study found that there was significant effect of the heavy metal (zn) on earthworm tissues. results shown in (table.1) and (figure1) showed the effect of three concentrations (750, 1000, and 1500 ppm) of zinc on earthworm tissues. there is a significant effect between the different treatments and the control group after 15 days of breeding. the highest accumulation of zn was 1086.602 ppm at concentration of 1500 ppm in the earthworm tissues, and it was significantly different from the lower amount that was noticed in the control 256.801 ppm. the study also showed that the highest accumulation of zn was 642.645 ppm in worm tissue, while it was 498.693 ppm in breeding soil. the results showed the highest accumulation of zn was 1564.505 ppm in worm tissue at a concentration of 1500 ppm while it was less in the soil at the same concentration (608.7 ppm), the reason due to special mechanism in worm body that could accumulate the heavy metals in the tissues of epidermis and digestive tract. this study showed positive accumulated metal increased in earthworm tissues with increasing concentration. the results of this study confirmed the results of tischer (2009) and akber et al. (2011), in which the highest metal amounts of zn and cd were accumulated in the body tissue of earthworm and this accumulation increased with increasing concentration in the chloragogen tissue. in a similar study conducted by iordache & borza (2012), they found in their study the effect of soil polluted by heavy metals (zn, cu, mn, pb) which showed zn accumulation in three species of earthworms (allolophora rosea, lumbricus castaneus and lumbricus rubellus) that collected 123.22, 89.58, and 104.52 ppm of zn in earthworm tissue. similar observation was recorded by usmani and kumar (2015) their studies refer to the important role various species of earthworms can tolerate and bio-accumulate high concentrations of heavy metals like cd and zinc in their tissues which range from 20.4 to 1420 for lead, it is accumulated in nerve cord muscles, cerebral ganglion, seminal vesicles and chloragogen tissue. table1. the accumulation of different concentration of zn in soil and earthworm tissues aporrectodea caliginosa *duncan test, significance level < 0.05 figure 1. the accumulation of different concentration of zn in soil and earthworm tissues place the mean of accumulated zn mean of the concentration effect concentration tissue soil 750 228.4 e 489.934 c 359.167 c 1000 608.677 b 551.535 b-c 580.106 b 1500 1564.5 a 608.7 b 1086.602 a control 169 e 344.603 d 256.801 d mean place 642.645 a 498.693 b 11| mahmood, s.m. & mohammed, a.m., effects of zinc accumulation on earthworm the effect of different concentrations of zinc with three exposure period on the weight of a. caliginosa earthworm results in (table 2) and (figure 2) show the effect of the concentrations (750, 1000, and 1500 ppm) of zn for three period of exposure (5, 10, 15 days). it was found that there was a significant difference between the treatments and the control group. the earthworm’s weight decreases with the increase of zinc concentration. the lowest weight was 0.171, 0.208 g in the concentration 1500, 750 ppm, respectively. the research also indicates the effect of the exposure period on the earthworm’s weight. it was 0.259, 0.231 g in the second and the theird period of exposure (10, 15 days, respectively). the interaction between the zinc concentration and period of the breeding (exposure) has a significant effect as compared with the control treatment during the three periods of exposure. the result shows a decrease in earthworm weight during the third period (15 days of breeding), and weight was 0.134, 0.126 g at the concentrations of 750 and 1500mg/ kg respectively. the conclusion of these results is that the earthworm’s weight decreases with the increasing exposure. song et al. (2005) found that there was a reduction in earthworm weights when applied to soil contaminated with industrial and domestic waste in western shenyang, china. moreover, akber et al. (2011) also made a similar observation in their study, finding that the increasing amount of heavy metal in the soil caused a positive correlation, which determined between increased metal and increased loss in earthworms’ weight. iordache and borza (2012) found soil polluted with heavy metals (zn, cu, mn, and pb) that had an effect on the accumulated zn in three different species of earthworms: allolophora rosea, lumbricus castaneus, and lumbricus rubellus, which affect the earthworms’ weight. this is attributed to the ability of earthworms to store heavy metals in their bodies, including zinc and cadmium, for example, and this is done by building a group of proteins known as metallothiones, which are characterized by their low molecular weights and rich in cysteine, as well as building proteins associated with minerals that are formed as a result of urging certain sites that build new proteins, it is believed that one of the functions of these proteins is to reduce the toxic effect of metals through their association with these proteins and the decrease in the concentrations of minerals present in a free state within the bodies of these worms (hilmy et al.,1988). table 2. effect of different concentrations of zn associated with three intervals of breeding on earthworm weight mean of the concentration effect weight/g time third time 15 days second time 10 days first time 5 days concentration 0.208b 0.134 e 0.234 e 0.256 c-e 750 0.344 a 0.218 c-e 0.277 c-e 0.538 a 1000 0.171 b 0.126 e 0.164 d-e 0.221 e 1500 0.367 a 0.448 ab 0.362 b 0.292 c control 0.231 b 0.259 b 0.326 a mean of time effect *duncan test, significance level < 0.05 figure 2. effect of different concentrations of zn associated with three intervals of breeding on earthworm weight jurnal riset biologi dan aplikasinya, 5(1): 8-15, march 2023|12 the effect of zinc on the relative of a. caliginosa earthworm growth rate results on (table 3) and (figure 3) show the effect of three concentrations (750, 1000, and 1500 ppm) of zinc during three periods of breeding or exposure (5, 10,15 days) on the mean of a. caliginosa earthworm relative growth rate. the results show that all concentrations used in the experiment decreased the earthworm’s relative growth rate, so the lowest effect on relative growth was 61.376 % at the concentration of 1000 ppm. the effect of exposure period did not appear in the periods of 5 and 10 days, but the effect was 79.88% in the 15-day period. also, the results on the above table and figure 3 showed the effect of the interaction between the zinc concentration and period of breeding, as well as the interaction between the periods of 10 and 15 day with all concentrations gave a significant effect, so the relative growth rate decreased in comparison with the control treatment, and it was 42.8%, and 1000 ppm and 15 days of exposure in comparison with the control treatment was 169.5%. the results show that the relative growth rate decreases with increasing exposure periods. a study by morgan and morgan (1993) also found a significant decrease in body mass when they bred the earthworm a. calginosa in soil contaminated with zn. this is in agreement with results of other researchers homa et al. (2003) show reduction in body mass when breeding earthworms in soil polluted with zn and another heavy metal. a study by morgan and morgan (1993) also found a significant decrease in body mass when they bred the earthworm a. calginosa in soil contaminated with zn. study zaltauskaite and sodione (2010) show effect of cd and pb on eisenia fetida earthworm growth, which reduced growth of the worm. results in (table 4) and (figure 4) indicate the effect of the concentrations of 750, 1000, and 1500 mg/kg of zinc for three intervals of breeding (5, 10, and 15 days) on the specific growth rate of earthworms was 2.533%. results also indicate that the period of growth has significant effects on the specific growth rate, which was 9.675, 4.487, and 2.6907% in the three periods (5, 10, and 15 days) respectively. the interaction between concentrations and period of breeding also shows a significant effect, the concentration of 1000 mg/kg gives significant decrease of 4.7, 1.92 and 0.98% during the intervals (5, 10, and 15 days) respectively. similar observation was made by liesch et al. (2010) on the use of biochar containing potentially toxic micronutrients, including as, zn, cu, fe, and on eisenia fetida applied to an artificial soil, which caused loss of weight reaching 100% and the growth rate of earthworm loss reaching 100%. other results confirmed, the results of belmeskine et al. (2012) study, which used the eisenia andrei earthworm in their research. they found toxicity of pcdd/fs mixtures to earthworms during 28-day exposure, there was less effect when earthworms were exposed to c1 (0.1 ng 2, 3, 7, 8-tcdd/g soil), while the worms exposed to c2 (1 ng 2, 3, 7, 8tcdd/g soil) presented pronounced effects and were significantly different from the control. in fact, a reduction in growth rate was obtained at 7, 14 and 21 days and was stable at 28 days. a similar observation was made by latha and mahaboobbasha (2016), who found in their study the effect of zn on many species of earthworms, which changed in body mass and had a steep decrease in body weight. table 3. effect of zn metal on the relative of a. caliginosa earthworm growth rate mean concentration effect mean growth rate stage third time 15 days second time 10 days first time 5 days concentration 138.966 a 169.5 a 136.7 b 110.7 b-c control 77.15 b 53.16 e-f 85.16 c-e 93.13 c-d 750 61.376 b 42.8 f 54 e-f 24.33 c-d 1000 71.906 b 54.04 e-f 69.73 d-f 91.93 c-d 1500 79.88 b 84.647 a-b 97.522 a time effect *duncan test, significance level < 0.05 13| mahmood, s.m. & mohammed, a.m., effects of zinc accumulation on earthworm figure 3. effect of zn on relative growth rate in earthworm table 4. effect of zn metal on specific of a. caliginosa earthworm growth rate mean of the concentration effect the mean of specific growth rate time third time 15 days second time 10day first time 5day concentration 6.620 a 3.5 b 5.336 b 11.026 a control 6.164 a 2.87 c 4.986 b 10.636 a 750 2.533 b 0.98 c 1.92 c 4.7 b 1000 7.153 a 3.413 c 5.706 b 12.34 a 1500 2.6907 c 4.487 b 9.675 a time effect *duncan test, significance level < 0.05 figure 4. effect of zn on growth rate specific of earthworm the effect of zinc on length of a. caliginosa earthworm results on (table 5) and (figure 5) indicate the effect of different concentrations (750, 1000, and1500 ppm) of zinc for the period of breeding (5, 10, and 15 days) on the worm length. our results showed that there were significant effects of zinc concentrations on earthworm length, but the breeding periods have no effect. it is also shown on table 5 and figure 5. the interaction between the zinc concentration and period of breeding decreased the length significantly, and it was jurnal riset biologi dan aplikasinya, 5(1): 8-15, march 2023|14 reached at -1.16, 1.31 and – 1.05 cm under the concentrations of 750, 1000, and 1500 ppm and the times of breeding of 5 , 10 and 15 days respectively . similar observations were made by hasan (2011), who used type of nutrition, which caused reduction in the length of earthworm lumbricus terrestris. the results in this study are in accordance with ogbonna and berebon (2013), which compared the length of worms collected in different areas, such as trees, grass cover, scanty grass cover, and bare grass. table 5. effect zn metal on length of a. caliginosa earthworm *duncan test, significance level < 0.05 figure 5. effect of zn on earthworm length conclusion the results of this study revealed that worms were sensitive to the detection and assessment of soil contamination. therefore, earthworms can be used as bioindicators to measure soil contamination. according to this study, the addition of zinc metal reduces weight, both relative and specific growth rates which increased with increasing concentration and period. the earthworm reduces the concentration of metal on the soil. therefore, the results of this study sustain the bioremediation potential of earthworms for soils polluted with heavy metals as a possibility to restore their quality by maintaining adequate levels of earthworm populations in agricultural lands. acknowledgment the author is very grateful to the university of mosul/ college of education for pure sciences for the facilities they provided, which helped to improve the quality of this work. references al-rawi, k.m & khalafullah, a. (1980). design and analysis of agricultural experiments. mosul: dar al kutb. al-safawi, a.y.t. (2006). environmental pollution of mosul city and treatment methods. phd dissertation, university of mosul. mosul, iraq. akber, m. m., al-saad, h. t., & ghadban, a.m. (2011). bioaccumulation and effect of some heavy metals on worm namalycastis indica (annelida: polychaeta). journal of research basra (science), 37 (15b), 46-51. mean of the concentration effect difference in lengths of worms / cm time third time 15 days second time 10 days first time 5 days concentration 0.434 a 0.663 a 0.22 a-c 0.42 a-b control -1.289 b -1.16 d -1.683 d -1.026 b-d 750 -1.1755 b -1.31 d -1.48 d -0.736 b-d 1000 -0.873 b -1.05 c-d -1.05 c-d -0.52 a-d 1500 -0.714 a -0.998 a -0.465 a time effect 15| mahmood, s.m. & mohammed, a.m., effects of zinc accumulation on earthworm a.p.h.a. 1985. standard methods of the examination of waste and wastewater. 16thedu. american public health association. washington, d. c. belmeskine, h., haddad, s., vandelac, l., sauve, s. & fournier, m. 2012. toxic effects of pcdd/fs mixtures on eisenia andrei earthworms. ecotoxicology and environmental safety, 80, 54–59. https://doi.org/10.1016/j.ecoenv.2012.02.008 dai, j., becquer, t., rouiller, j.h., reversat, g., bernhardreversat, f., nahmani, j. & lavelle, p. (2004). heavy metal accumulation by two earthworm species and its relationship to total and dtpaextractable metals in soils. soil biology & biochemistry, 36, 91-98. https://doi.org/10.1016/j.soilbio.2003.09.001. hasan, m.s. (2011). effect study on nutrition media and different temperature on earthworm growth lumbricus terrestris. (oligochaeta: annelida). journal of babylon university/pure and applied sciences, 19 (2), 617622. hilmy, a.m., abd el–hamid, n.f. & ghazaly, k.s. (1988). biochemical and physiological changes in the tissues and serum of both sexes in portunus pelagicus (l.) following acute exposures to zinc and copper. folia morph, 1, 79-94. pmid: 3391461. homa, j., niklinska, m. & plytyez, b. (2003). effect of heavy metals on coelomocytes of the earthworm allobophpora chlorotica. pedobiologia, 47(5-6): 640645. https://doi.org/10.1078/0031-4056-00239. iordache, m. & borza, i. (2012). the bioremediation potential of earthworms (oligochaeta: lumbicidae) in a soil polluted with heavy metals. journal of food agriculture & environment, 10(2),1183-1186. latha, v. & mahaboob-basha, p. (2016). extent of heavy metal accumulation in sewage irrigated soils and their impact on distribution of earthworm communities: linking chromium and zinc toxicity on growth and reproduction in selected earthworm species. current world environment ,11(1), 279-29. http://dx.doi.org/10.12944/cwe.11.1.34. liesch, a.m., weyers, s.l., gaskin, j.w., and das, k.c. (2010). impact of two different biochars on earthworm growth and survival. annals of environmental science, l 4: 1-9. https://openjournals.neu.edu/aes/journal/article/ view/v4art1. li z., ma z., van der kuijp t.j., yuan z. & huang l. (2014). a review of soil heavy metal pollution from mines in china: pollution and health risk assessment. science total environment, 468–469, 843–853. https://doi.org/10.1016/j.scitotenv.2013.08.090. loureiro, s., soares, a.m.v.m., & nogueira, a.j.a. (2005). terrestrial avoidance behavior tests as screening tool to assess soil contamination. environ pollution, 138, 121-131. https://doi.org/10.1016/j.envpol.2005.02.013. morgan, j.e., & morgan, a.j. (1993). seasonal changes in the tissue-metal (cd, zn, and pb) concentration in two eco physiologically dissimilar earthworm species: pollutionmonitoring implications. environ pollution, 82 (1), 1-7. https://doi.org/10.1016/j.scitotenv.2013.08.090. nahmani, j. & lavelle, p. (2002). effects of heavy metal pollution on soil macrofauna in a grassland of northern france. euro journal soil biology, 38,297300. https://doi.org/10.1016/s11645563(02)01169-x. odoh, r., agbaji, e.b., kagbu, j.a., & thomas, s.a. (2011). heavy metal speciation in agricultural farmland in some selected local government areas of benue state, nigeria. archives. appl. sci. research, 3, 560573. ogbonna, c.b., & berebon, d.p. (2013). observations on the ecology of earthworms and effect on the population dynamics of cellulolytic bacteria in soils across selected habitats in imo state university main campus owerri, nigeria. journal of environmental science, toxicology & food technology, 5(4), 17-22. sogbesan, a.o., & ugwumba, a.a.a. (2006). effect of different substrates on growth and productivity of nigeria semiaridzone earthworm (hyperiodrilus euryaulos clausen1842) (oligochaeta: eudrinae). world journal of zoology,1(2),103-112. song, y., zhou, q., gong, p., & sun, t. (2005). eco toxicity of soil contaminated with industrial and domestic wastewater in western shenyang, china. sci. chem. sci. c. life. sciences, 48(1), 48-56. https://doi.org/10.1007/bf02889801. tischer, s. (2009). earthworms (lumbricidae) as biondicators: the relationship between in soil and in tissue heavy metal content. journal polish of ecology, 57(3), 513-523. usmani, z., & kumar, v. (2015). review paper open access role of earthworms against metal contamination: a review. journal of biodiversity and environmental sciences, 6(1), 414-427. https://innspub.net/roleof-earthworms-against-metal-contamination-areview/. uzoma, k.o., iroha, a.e., chinyere, c.g., sunday, e.a., kelechukwu, d.m., & ahuwaraeze, n.l. (2013). effects of mining effluent contaminated soil treated with fertilizers on growth parameters, chlorophyll and proximate composition of cucurbita pepo vegetable. j. biodiver. environ. sci, 3,1-8. zaltauskaite, j., & sodiene, i. (2010). effects of total cadmium and lead centrations in soil on the growth, reproductionand survival of earthworm eisenia fetida. ekologija. 56(1-2): 10-16. https://doi.org/10.1016/j.ecoenv.2012.02.008 https://doi.org/10.1016/j.soilbio.2003.09.001 https://doi.org/10.1078/0031-4056-00239 http://dx.doi.org/10.12944/cwe.11.1.34 https://openjournals.neu.edu/aes/journal/article/view/v4art1 https://openjournals.neu.edu/aes/journal/article/view/v4art1 https://doi.org/10.1016/j.scitotenv.2013.08.090 https://doi.org/10.1016/j.envpol.2005.02.013 https://doi.org/10.1016/j.scitotenv.2013.08.090 https://doi.org/10.1016/s1164-5563(02)01169-x https://doi.org/10.1016/s1164-5563(02)01169-x https://doi.org/10.1007/bf02889801 https://innspub.net/role-of-earthworms-against-metal-contamination-a-review/ https://innspub.net/role-of-earthworms-against-metal-contamination-a-review/ https://innspub.net/role-of-earthworms-against-metal-contamination-a-review/ jurnal riset biologi dan aplikasinya, volume 4, issue 1, march 2022 isolation and potency test of endophytic bacteria as nitrogen fixer from mangrove plant in lamongan fatimah1,2*, annida izzatul millah1, risky lailatul ayu fadilah1, syarifah salsabila1, zakia asrifah ramly 1, tipuk sugiarti 1, tri nurhariyati 1,2, ni’matuzahroh1,2, moch affandi 1,2 1departement of biology, faculty of science and technology, universitas airlangga, surabaya, kampus c, jl. dr. ir. h. soekarno, mulyorejo surabaya, jawa timur 2university coe research center for bio-molecule engineering, universitas airlangga, kampus c, jl. dr. ir. h. soekarno, mulyorejo surabaya, jawa timur *corresponding author: e-mail: fatimah@fst.unair.ac.id article history abstract received : 1 march 2022 endophytic bacteria are microorganisms that live in plant tissues and some of them contribute to nitrogen fixation for plants. this study aimed to isolate and identify endophytic bacteria from mangroves of kutang beach, lamongan, which potentially as nitrogen fixing bacteria. bacterial isolates were used as candidates for biofertilizers. leaves samples were taken from 10 sampling points. bacterial isolation was initiated by sterilizing the surface of the leaves sample and grinding it aseptically. isolation was carried out with a pour plate method on nutrient agar medium. screening for endophytic bacteria's potential as n-fixing agent was carried out by growing the bacterial isolates on a semi-solid nitrogen free bromothymol blue (nfb) medium. the isolates that produced a positive reaction with a change in the color of the medium to blue were then subjected to macroscopic (shape, color, elevation, and the edge of the colony) and microscopic observations (gram stain and bacterial cell measurements). the isolates showed the fastest change in the color of the medium were identified by the molecular marker of the 16s rrna gene. the data obtained were analyzed descriptively. as many as 20 isolates were obtained from the mangroves of kutang lamongan beach, and ten isolates of twenty potentially as nitrogen-fixing bacteria. the ten nitrogen-fixing bacteria isolates had varying macroscopic characteristics. the microscopic characteristics showed that eight isolates had gram-positive bacilli, and two isolates were gram-negative with varying bacterial sizes. based on the 16s rrna gene sequence, the most potential of nitrogen-fixing bacteria was lmg ii-14 isolate and identified as paenibacillus alvei lmg ii-14 with 99.36% similarity to paenibacillus alvei strain dsm 29 based on the ncbi database. the ten nitrogen fixing isolates that have been obtained can later be used as candidates for biofertilizer composition, especially paenibacillus alvei lmg ii-14. revised : 19 march 2022 approved : 22 march 2022 published : 31 march 2022 keywords endophytic bacteria, nitrogen-fixing bacteria, bio-fertilizer, nfb, lamongan mangrove how to cite: fatimah., fadilah, r.l.a., millah, a.i., nurhariyati, t., irawan, b., ni’matuzahroh, affandi, m., zuhri, a.r.n.i & widhiya, e.w. (2022). ability test of iaa (indole-3-acetic acid) hormone-producing endophytic bacteria from lamongan mangrove. jurnal riset biologi dan aplikasinya, 4(1):26-33. doi: 10.26740/jrba. v4n1.p.26-33. introduction indonesia is an agricultural country where agriculture plays a vital role in the national economy. indonesia faces agricultural issues almost every year, such as declining crop yields, pest attacks, yellowing of plant leaves, and others. nitrogen (n) is an essential element for living organisms, especially plants. element nitrogen is one of the constituents of proteins and plays a role in the photosynthetic process (leghari et al., 2016). jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi mailto:fatimah@fst.unair.ac.id jurnal riset biologi dan aplikasinya, 4(1): 26-33, march 2022 | 27 the nitrogen content in the atmosphere is very high at about 78%, but nitrogen is in the form of molecules, most of which are non-reactive and are not directly absorbed by plants. therefore, it is necessary to convert nitrogen in the air into a molecular form that plants can absorb. nitrogen is only absorbed by + plants in the form of ammonium ions (nh) or nitrate ions (no). atmospheric dinitrogen gas is converted to ammonia (nh) and fixed to the soil by a fixing process (martinezdalmau et al., 2021). chemical nitrogen fertilizers help meet the needs for nitrogen. however, excessive and inappropriate use will decrease soil fertility and soil fertilizing microorganisms, and it causes changes in soil ecosystems (sulistiyani and lisdiyanti, 2016). these negative impacts can occur because some inorganic fertilizers contain heavy metals (such as cadmium and chromium) and high concentrations of radionuclides (savei, 2012). to overcome these problems, farmers are trying to find other alternatives, including using organic fertilizers such as compost (manure or microbial-based fertilizers) known as biological fertilizers or biofertilizers. bacteria that are beneficial to such plants are a type of bacteria that provide many benefits to the host plant and help to withstand a variety of biological and abiotic stresses that can affect growth. these bacteria can live both outside and inside the host plant. bacteria that live outside the host plant are either epiphytes that live on the surface of the leaves of the plant or root spheres that live in the roots of plants in the soil. bacteria that live and reproduce in host plants are called endogenous bacteria, but all of these classes of bacteria share many of the essential properties that promote the growth of host plants (afzal et al., 2019). in addition, it is necessary to understand the nature of the microorganisms before their use as biofertilizers in order to utilize only microorganisms safe for human health; this includes not only the consumer or end user but also those handling the biofertilizers during their production. strains belonging to the genera azospirillum, gluconacetobacter, bacillusor azotobacter, among others, are currently commercialized as biofertilizers for non legumes without any adverse effects being reported to date (celador-lera et al., 2018). n-fixing bacteria are often called diazotrophic bacteria. these bacteria live freely in the root area and plant tissue. they can use air n as a source of n for their growth. the role of bacteria in fixing air nitrogen influences the economic value of agricultural land (ristiati et al., 2008). alfaro & ullrich (2014) have successfully isolated the endophytic bacteria (marinobacterium mangorovicola) from mangrove roots as nitrogenfixing plants. castro et al. (2018) have successfully isolated endophytic bacteria as nitrogen-fixing bacteria from brazilian mangrove forests. the results showed that 38 isolates from 115 isolates as nitrogen-fixing plants. salsabila (2020) has also found six isolates of nitrogen-fixing bacteria from 20 isolates from the soil of the jenu tuban mangrove center. kutang lamongan beach diverse mangrove species. based on the literature search, no information has been found regarding the exploration of nitrogen-fixing endophytic bacteria from the mangroves of kutang lamongan beach. therefore, this study was focused on isolating endophytic bacteria from the mangroves of kutang lamongan beach, then testing the potential of these isolates in fixing nitrogen. endophytic bacteria with nitrogen-fixing ability can be used as biofertilizer candidates. hopefully, it can solve the problem of soil quality degradation due to chemical fertilizer application. materials and methods sample collection the sample used in this study was mangrove leaves at kutang beach, lamongan. sampling was carried out in a coastal area near the mainland with a random sampling method. the samples were put in clean labelled plastics and stored in a cool box. further, sample was carried to the microbiology laboratory of faculty of science and technology, universitas airlangga, endophytic bacteria isolation the samples were cleaned with running water and weighed (20g). next, the sample was immersed in 70% ethanol for one minute and 0.01% hgcl2 solution for five minutes to kill microbes on the leaf surface. the samples were rinsed twice with sterile distilled water for one minute of each. the leaf samples were ground using a mortar aseptically and mixed with 2 ml of sterile distilled water. one ml of the grinded sample was taken and put into a sterile petri dish. all processes were carried out aseptically in laminar airflow (laf) (purwanto et al., 2014; anjum and chandra, 2015). bacterial isolate purification the bacterial colonies with different morphologies and colors were taken to be purified. 28 | fatimah et al., isolation and potency test of endophytic bacteria as nitrogen fixer the purification of bacterial isolates was carried out using the streak plate method. each bacterial colony was taken using a sterile ose and streaked on the na medium. purification was repeated until pure cultures were obtained. bacterial isolates were maintained periodically by transferring pure cultures to slant na medium (ed-har et al., 2017). bacterial preservation can be done by preserving bacteria in 10% glycerol and stored at -80oc. ability testing of bacteria to fix nitrogen the test was started by inoculating endophytic bacterial isolates into nutrient broth (nb) medium for 24 hours. after that, it was taken using a skewer and inserted into the semi-solid nfb medium in a test tube. semi-solid nfb medium was prepared for 1,000 ml of distilled water consisted of 5 g of malic acid; 0.5 g k2hpo4; 0.2 g mgso4.7h2o; 0.1 g nacl; 0.02g cacl2.2h2o; 2 ml micronutrient solution (0.04 g cuso4.5h2o; 0.12g znso4.7h2o; 1.40g h3bo3; 1.0g na2moo4.2h2o; 1.175g mnso4.h2o dissolved in 1000 ml distilled water); 2 ml bromothymol blue; 0.05g feso4.7h2o; 1.8g ag; 4.5g koh. the components of these materials were dissolved in distilled water, heated on a hot plate and stirred until completely dissolved with a ph of 6.5. after the material was dissolved, the medium was poured into 6 ml test tubes. a sterile semisolid nfb medium was used to test the potential of bacterial isolates in fixing nitrogen. furthermore, the bacterial isolates in nfb were incubated at room temperature of 30oc for ten days and observed every day. the positive result was indicated by a color change in the nfb medium from a greenish-yellow color to a bluish color, and a pellicle was formed on the surface of the medium (baldani et al, 2014; quintana et al, 2020; rilling et al, 2018). macroscopic and microscopic characterization of nitrogen-fixing bacteria isolates of endophytic bacteria with nitrogen-fixing ability were characterized macroscopically by observing the bacterial colonie shape, color, elevation, and edge. microscopic characterization was carried out by a gram stain test, cell shape observation, and cell measurement (kaburuan et al, 2014). identification of bacteria using the 16s rrna gene dna isolation of bacterial isolates was carried out according to the promega genomic dna purification kit wizard procedures. the results of genomic dna could be seen on 1% agarose gel. band was obtained, indicating the dna isolation was worked out. the isolated dna was measured using a spectrophotometer at 260 nm and 280 nm to determine the level of dna. measurement of isolated dna was carried out at 260 nm. in comparison, protein measurements were carried out at 280 nm. then, the 16s rrna gene pcr was performed using pcr kit from promega with the following composition, 25 µl pcr mix, universal primers 27f and 1492 r each 2 µl, 2 µl dna template, and 19 µl nuclease free water with total volume 50 µl (wardani et al, 2017). the amplification process using the pcr technique was carried out using universal primers 27 f (5' aga gtt tga tcm tgg gtc ag 3') and 1492 r (5' ggt tacctt gtt acg act t 3') at denaturation conditions of 92oc for five minutes and 95oc for 30 seconds, annealing at 55oc for 45 seconds, extension at 72oc for one minute, and post extension for seven minutes. the result of the 16s rrna gene dna sequence was trimmed to remove low-quality dna sections (<15%) and remove gaps using the bioedit program. furthermore, the dna sequences of the bacterial samples were matched with the data on genebank using blast n via the ncbi (national center for biotechnology information) website to determine the degree of similarity of the sample nucleotide base sequences to the closest bacterial species. results & discussion endophytic bacterial isolates from mangrove leaves in kutang beach, lamongan in this study, 20 isolates of endophytic bacteria from mangrove plants from kutang beach, lamongan, were coded as lmg ii-1 to lmg ii-20 isolates. ten of the 20 bacterial isolates were potential being nitrogen-fixing bacteria. this was indicated by a change in the color of the semi-solid nfb medium from yellow to greenish to blue, and a pellicle formed (figure 1). the screening results can be seen in table 1. furthermore, the endophytic bacterial isolates that had the potential of being nitrogen-fixing bacteria were observed macroscopically, namely size, shape, color, margin, and colony elevation, as well as microscopic character observations, namely the results of gram staining, shape, and size of bacterial cells (table 2; figure 2, 3). jurnal riset biologi dan aplikasinya, 4(1): 26-33, march 2022 | 29 figure 1. the positive reaction of nitrogen-fixing bacteria on semi-solid nfb medium (a). early incubation of nfb medium (yellow); (b). color change of nfb medium containing nitrogen-fixing bacteria from yellow to greenish-yellow; (c). the color of the medium changed from greenish-yellow to blue, and a white pellicle formed on the surface of the medium table 1. screening results of nitrogen-fixing endophytic bacteria isolates from the lamongan mangroves (lmg ii-1 to lmg ii-20). isolat code nfb test isolat code nfb test lmg ii-1 (+) lmg ii-11 (+) lmg ii-2 (+) lmg ii-12 (-) lmg ii-3 (-) lmg ii-13 (+) lmg ii-4 (-) lmg ii-14 (+) lmg ii-5 (-) lmg ii-15 (-) lmg ii-6 (-) lmg ii-16 (-) lmg ii-7 (+) lmg ii-17 (+) lmg ii-8 (-) lmg ii-18 (+) lmg ii-9 (+) lmg ii-19 (+) lmg ii-10 (-) lmg ii-20 (-) table 2. macroscopic and microscopic characteristics of ten nitrogen fixing bacteria isolated from mangrove plant in lamongan isolate code size shape color margin elevation gram stain lmg ii-1 2 x <1 circular yellow entire raised bacilli + lmg ii-2 2 x 1 circular cream entire raised bacilli + lmg ii-7 3 x 1 circular transparent entire raised bacilli + lmg ii-9 2 x <1 circular bone-white entire convex bacilli + lmg ii-11 3 x 1 circular cream entire raised bacilli + lmg ii-13 3 x 1 circular white entire flat bacilli + lmg ii-14 2 x<1 circular yellowish-white entire raised bacilli + lmg ii-17 3 x 1 circular white entire flat bacilli lmg ii-18 3 x 1 irregular white undulate raised bacilli lmg ii-19 2 x 1 circular white entire raised bacilli + a b c 30 | fatimah et al., isolation and potency test of endophytic bacteria as nitrogen fixer figure 2. colony morphology of the isolates of nitrogen-fixing bacteria from mangrove leaves in lamongan; a: lmg-ii 1; b: lmg-ii 2; c: lmgii 7; d: lmg-ii 9; e: lmg-ii 11; f: lmg-ii 13; g: lmg-ii 14; h: lmg-ii 17; i: lmg-ii 18; j: lmg-ii 19 figure 3. cells morphology of the isolates of nitrogen-fixing bacteria from mangrove leaves in lamongan; a: lmg-ii 1; b: lmg-ii 2; c: lmgii 7; d: lmg-ii 9; e: lmg-ii 11; f: lmg-ii 13; g: lmg-ii 14; h: lmg-ii 17; i: lmg-ii 18; j: lmg-ii 19 jurnal riset biologi dan aplikasinya, 4(1): 26-33, march 2022 | 31 the results of the identification of the most potential isolate (lmg ii-14) the results of the quantitative dna test of the lmg ii-14 isolate showed an absorbance value of 0.6308 at 260 nm and 0.3555 at a wavelength of 280 nm. comparison of the two absorbance values of dna samples showed 1.8 (abs 260 nm/abs 280 nm). this indicates that the dna sample was pure. dna is declared pure if it is in the range of 1.8-2.0. if the comparison value is less than 1.8, the dna is still contaminated by phenol and the remaining solvent of dna isolation. if it is more than 2.0, the dna is contaminated by protein. the electrophoresis showed that the dna band was in an area parallel to the ±1500bp marker; this indicated that the 16srrna gene was successfully amplified (figure 4). figure 4. electrophoresis results of 16s rdna of nitrogen-fixing bacteria. m = markers; s1 = lmg ii14 isolate the results of identifying endophytic bacterial isolates with the most potential of being nitrogenfixing plants can be seen in table 3. the identification results based on blast also provide information in query cover and identity percentage, where query cover is the percentage of base length aligned with the blast database. whereas, identity percentage is similarity between the analyzed sequences and the aligned database sequences. the sample used was the fresh part of the leaves. surface sterilization process aimed to clean microbes on the leaf surface and ensure that only endophytic bacteria will be obtained from the isolation of endophytic bacteria. as many as 20 pure isolates of endophytic bacteria were obtained from mangrove leaves, coded lmg ii-1 to lmg ii-20. ten of 20 isolates (with code lmg ii-1, lmg ii-2, lmg ii-7, lmg ii-9, lmg ii-11, lmg ii-13, lmg ii-14, lmg ii17, lmg ii-18, and lmg ii19) have the ability to fix nitrogen, indicated by color change in the nfb medium from yellow to yellowish-green to blue. this result was supported by a study conducted by tam et al. (2018), who successfully isolated 86 isolates from mangroves, of which 41 isolates were known to be able to fix nitrogen. nfb medium is a selective medium that does not contain nitrogen and bacterial isolates that can grow on these mediums and fix free nitrogen (mallombasi, 2018). hidayat (2009) stated that the color change in semi-solid nfb medium occurred due to nitrogenase activity which caused a higher ph. the color of the medium turned blue due to these bacteria groups will fix nitrogen and convert it to ammonium (nh4+) which alkaline that causes the bromthymol blue indicator in the nfb medium composition. based on the results of macroscopic observations, lmg ii-18 isolates had different colony shapes from other isolates, which were irregular in shape with undulate edges. meanwhile, circular bacterial colonies were found in isolates lmg ii-1, lmg ii-2, lmg ii-7, lmg ii-9, lmg ii-11, lmg ii-13, lmg ii-14, lmg ii17, and lmg ii-19, which have the entire colony margins. ten isolates of nitrogen-fixing bacteria had cell sizes range 2-3 μm x <1-1 μm and same cell shape, i.e, bacilli. for gram staining, all isolates are grampositive except lmg ii-17 and lmg ii-18 that were gram-negative. genomic dna obtained from the isolation process was measured for purity to ensure that the dna amplified by the pcr method had the appropriate purity (sukartiningrum, 2012). dna purity was obtained from the absorbance ratio at wavelengths of 260 nm and 280 nm using a spectrophotometer. the dna purity limit ranges from 1.8-2.0. suppose the result of the a260/280 ratio is less than 1.8. in that case, the dna is still not pure due to contamination by phenol and residual dna isolation solvents. in contrast, if the a260/a280 ratio value is more than 2.0, then the resulting dna still contains contaminants in the form of proteins or other compounds (sambrook and russell, 2001). the results of the quantitative dna test of the lmg ii-14 isolate, which is the isolate with the most potential to fix nitrogen, showed the absorbance of 260 nm was 0.6308, the absorbance of 280 nm was 0.3555. dna purity (abs 260 nm/abs 280 nm) was 1.8. 1.5 kb m s1 32 | fatimah et al., isolation and potency test of endophytic bacteria as nitrogen fixer table 4. the results of the identification of 16s rrna nitrogen-fixing bacteria isolate based on the ncbi gene bank database isolate code bp length blast species query cover (%) identity percentage (%) access number lmg ii-14 1173 paenibacillus alvei 98 99.36 nr_042091.1. pcr results through electrophoresis showed that the dna encoding 16s rrna was successfully amplified with pcr products ranging from 1500 bp. based on the analysis results using blast programme, the bacterial isolate lmg ii14 was similar to paenibacillus alvei strain dsm 29 which had a query cover of 98% and a percent identity of 99.36%. query cover is a presentation of the nucleotide length aligned with the databasecontained in blast. at the same time, identity percentage is seen from the maximum identity, which is the highest value of the identity percentage or match between the query sequence and the aligned database sequence (miller et al., 1990 kasi et al., 1990). the percentage of acceptable cover queries was at least 95%, and for sequences with lower readings, a minimum of 75% was applied (narita et al., 2012). based on the result study, it was known that p. alvei has morphological characteristics of circular form, entire edges, raised elevation, yellowish-white color. while microscopic characteristic was bacilli and purple color of gram staining result that indicated gram-positive bacteria. based on a study conducted by prihanto et al. in 2018, he isolated endophytic bacteria on the leaves of the mangroves (sonneratia alba) from sendang biru beach, malang. the morphological characteristics of the p. alvei colonies grown in lba (luria bertani agar) medium are circular, undulating edges, raised elevation, yellowishwhite. microscopically p. alvei are bacillary and purple after gram staining, classifying them as gram-positive bacteria. p. alvei isolate fixing free nitrogen was a discovery. thus, it was necessary to conduct further study on the ability of these isolates to produce nitrogenase enzymes that play a role in the free nitrogen fixation process. conclusion the number of endophytic bacteria isolates from the mangroves of kutang lamongan beach was 20 isolates. ten of them potentially become nitrogenfixing bacteria. the isolates had different macroscopic and microscopics characteristics. lmg ii-14 isolate have the most potential of being nitrogen fixing bacteria and identified as paenibacillus alvei lmg-ii 14 based on molecular markers of the 16s rrna gene. acknowledgment the authors would like to thank the faculty of science and technology universitas airlangga for funding the research through the “puf 2021” scheme. references afzal, i., shinwari, z.k., sikandar, s. and shahzad, s. (2019). plant beneficial endophytic bacteria: mechanisms, diversity, host range and genetic determinants. microbiological research, 221, 36-49 alfaro-espinoza, g., and ullrich, m. s. (2014). marinobacterium mangrovicola sp. nov., a marine nitrogen-fixing bacterium isolated from mangrove roots of rhizophora mangle. int. j. syst. evol. microbiol, 64, 3988–3993. doi: 10.1099/ijs.0.067462-0 anjum, n., and chandra, r. (2015). endophytic bacteria: optimization of isolation procedure from various medicinal plants and their preliminary characterization. asian j pharm clin res, 8(4), 233238 baldani, j. i., reis, v. m., videira, s. s., boddey, l. h., and baldani v. l. d. (2014). the art of isolating nitrogen-fixing bacteria from non-leguminous plants using n-free semi-solid media: a partical guide for microbiologist, plant soil, 413-431 castro, r.a., dourado m.n., almeida j.r., lacava p.t., nave a., melo i.s., azevedo j.l., quencine m.c. (2018). mangrove endophyte promotes reforestation tree (acacia polyphylla) growth, brazilian journal of microbiology, 49, 59-66 celador-lera, l., jiménez-gómez, a., menéndez, e. and rivas, r. (2018) biofertilizers based on bacterial endophytes isolated from cereals: potential solution to enhance these crops. in role of rhizospheric microbes in soil, 175-203. ed-har, a. a., widyastuti, r., dan djajakirana, g. (2017) isolasi dan identifikasi mikroba tanah pendegradasi selulosa dan pektin dari rhizosfer aquilaria malaccensis, buletin tanah dan lahan, 1(1), 58-64 kaburuan, r., hapsoh., dan gusmawartati. (2014). isolasi dan karakterisasi bakteri penambat nitrogen simbiotik tanah gambut cagar biosfer giam siak kecil bukit batu, jurnal agroteknologi, 5(1), 35-39 kasi, p.d., ariandi, eka, p.t. (2019). identifikasi bakteri asam laktat dari limbah cair sagu dengan gen 16s rrna, a scientific journal, 36(1), 35-40 jurnal riset biologi dan aplikasinya, 4(1): 26-33, march 2022 | 33 kearse, m., moir, r., wilson, a., stones-havas, a., cheung, m., sturrock, s., buxton, s., cooper, a., markowitz, s., duran, c., thiere, t., ashton, b., meintjes, p. and drummond, a., 2012, geneious basic: an integrated and extendable dekstop software platform for the organization and analysis of sequence data, bioinformatics application note, 28(12), 1647-1649. leghari, s. j., wahocho, n. a., laghari, g. m., laghari, a. h., bhabhan, g. m., talpur, k. h., bhutto, t. a., wahocho, s. a., and lashari, a. a. (2016). role of nitrogen for plant growth and development: a review. advances in enviromental biology, 10(9), 209218. martinez-dalmau, j., bebel, j., ordonez-fernandez, r. (2021). nitrogen fertilization. a review of the risks associated with the inefficiency of its use and policy responses. sustainability, 13(5625), 1-15 mallombasi n., a. (2018). isolasi dan identifikasi bakteri penambat nitrogen non-simbiotik daerah perakaran padi (oryza sativa) di kelurahan balang kecamatan binamu kabupaten jeneponto, skripsi, uin alauddin makassar miller, g.a., r. baeckwith, c. fellbaum, d. gross and k. miller. (1990). introduction to wordnet: an on-line lexical database, international journal of lexicography, 3, 235-312. narita, v., arif l. a., siti i.m., nuri y. f. (2012). analisis bioinformatika berbasis web untuk eksplorasi enzim kitosanase berdasarkan kemiripan sekuens, jurnal al-azhar indonesia seri sains dan teknologi, 1(4), 197-203 prihanto, a. a., hanan, d.l.t., aziz, a.j., rahmi, n., ken, a.p. (2018). isolasi dan identifikasi bakteri endofit mangrove sonneratia alba penghasil enzim gelatinase dari pantai sendang biru, malang, jawa timur, indonesian journal of halal, 2(1), 31-42 purwanto, u.m.s., pasaribu, f.h., dan bintang, m. (2014). isolasi bakteri endofit dari tanaman sirih hijau (piper betle l.) dan potensinya sebagai penghasil senyawa antibakteri. current biochemistry, 1(1): 5157 quintana, p. l., lovaisa, n. c., rapisarda, v. a., and pedraza, r. o. (2020). the plant growth promoting bacteria gluconacetobacter diazotrophicus and azospirillum brasilense contribute to the iron nutrition of strawberry plants through siderophores production, plant growth regulation, 91,185-199 rilling, j. i., acuria, j. j., sadowsky, m. j., and jorquera m. a. (2018). putative nitrogen-fixing bacteria associated with the rhizosphere and root endosphere of wheat plants grown in an andisol from southern chile, front. microbiol, 9,2710 ristiati, n.p., s. muliadihardja, f. nurlita. (2008). isolasi dan identifikasi bakteri penambat nitrogen non simbiosis dari dalam tanah, j. penelitian dan pengembangan sains & humaniora, 2:68-80 salsabila, s. (2020). skrining isolat bakteri penambat nitrogen dari tanah mangrove jenu tuban dan identifikasi menggunakan gen 16s rrna, skripsi, surabaya: universitas airlangga sambrook, joseph, and rusell, david w. (2001). molecular cloning: a laboratory manual. 3th ed, cold spring harbor laboratory press, book 1&2nowak, bacterial endophytes: potential role in developing sustainable systems of crop production, crit. rev. plant sci., 19, 1– 30, 2000 savei, s. (2012). an agricultural pollutant: chemical fertilizer, international journal of environmental science and development, 3(1), 77-80 sukartiningrum, s.d. (2012). penentuan pohon filogenetik bakteri xilanolitik sistem abdominal rayap tanah berdasarkan 16s rrna, skripsi, departemen kimia, fakultas sains dan teknologi, universitas airlangga sulistiyani, t.r. dan lisdiyanti, p. (2016). keragaman bakteri endofit pada tanaman curcuma heyneana dan potensinya dalam menambat nitrogen, widyariset, 2(2), 106-117 tam, h.t., phuong, t.v., diep, c.n. (2018). isolation and identification of endophytic bacteria associated with rhizophora mucronate and avicennia alba of nam can district, ca mau mangrove ecosystem, international journal of innovations in engineering and technology ijiet, 10(4) , 147-159 wardani, a. k., arlisyah, a., fauziah, a., and fa’ida, t. n. (2017). identifikasi gen transgenik pada produk susu bubuk kedelai dan susu formula soya dengan metode pcr (polymerase chain reaction), agritech, 37(3). 30 | susanto & zulaikha; distribution patterns of exotic plant chromolaena odorata (l.) jurnal riset biologi dan aplikasinya, volume 3, issue 1, march 2021 diversity and community structure of dragonfly and damselfly (odonata) at the selorejo waterfall area, ponorogo regency, east java indonesia muhamad azmi dwi susanto*, siti zulaikha biology departement, faculty of science and technology, uin sunan ampel surabaya jln. ahmad yani no.117, jemur wonosari, wonocolo district, surabaya 60237, east java, indonesia *corresponding author: e-mail: muhammadazmidwi@gmail.com article history abstract received : 20 februari 2021 selorejo waterfall is a natural tourism area that is quite far from downtown ponorogo and directly adjacent to the gunung sigogor nature reserve. hence, this area has the potential as a natural habitat for dragonfly and damselfly. the presence of dragonfly and damselfly species is determined by the type of habitat, canopy conditions, vegetation diversity, and the microclimate that exists in a location. this study aimed to determine the diversity of dragonfly and damselfly and to determine the community structure of dragonflies in selorejo waterfall. the sampling method was visual day flying. the results of research conducted in two streams showed that there were 12 species from 6 families with a total of 230 individuals. the value of species diversity at this location is h '= 2.05. in the community structure at the selorejo waterfall dragonfly, there are differences in the number of species and individuals in the two streams in selorejo waterfall area. the large stream, eight species from four families, 151 individuals in total. meanwhile, in small stream, there were nine species from six families, 79 individuals in total. the differences in the number of species and individual dragonflies in the two streams at selorejo waterfall can be used to describe the diversity and structure of the odonata community in the area. revised : 14 march 2021 approved : 22 march 2021 published : 31 march 2021 keywords diversity; community structure; odonata; microclimate; vegetation how to cite: susanto, m.a.d & zulaikha, s. (2021). diversity and community structure of dragonfly and damselfly (odonata) at the selorejo waterfall area, ponorogo regency, east java indonesia. jurnal riset biologi dan aplikasinya, 3(1): 30-37. doi: https://doi.org/10.26740/jrba.v3n1.p30-37. introduction selorejo waterfall is a natural tourist area located in ngebel district, ponorogo regency, east java, indonesia. the location of selorejo waterfall is quite far from the center of ponorogo city with a quite difficult road access and this tourist location is directly adjacent to the gunung sigogor nature reserve. this makes the environmental conditions at selorejo waterfall still natural with little environmental pollution. the natural environmental conditions of selorejo waterfall have the potential as a natural habitat for various types of insects, especially dragonfly. dragonfly are medium-sized flying insects with attractive body colors and wings. the body structure of dragonfly consists of three parts, namely cephal (head), thorax (chest), and abdomen (stomach). dragonfly have slender bodies with two pairs of wings and have mesh veins. besides, dragonfly also has an antenna, a chewing-type mouth apparatus, and large compound eyes (hanum et al., 2013). in scientific classification, dragonfly is included in the odonata order, this is because dragonfly has toothed-jaws found in the lower labium (rizal & hadi, 2015). in general, odonata is classified into two suborders, namely suborder anisoptera known as dragonfly, and suborder zygoptera is known as damselfly. these two suborders have striking differences, including the distance between the two compound eyes. in the dragonfly, it looks very closely or there is almost no distance between the two compound eyes, while in the damselflies there is a visible distance between the two compound eyes (soendjoto, 2016). suborder anisoptera has wide wings, large body stature with high flight ability. jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi https://doi.org/10.26740/jrba.v3n1.p30-37 jurnal riset biologi dan aplikasinya, 3(1): 30-37, march 2021 | 31 whereas in the suborder zygoptera has a small body stature, the front, and rear wings are of the same size and have weak flying abilities (rahmawati et al., 2019). dragonfly are insects that undergo imperfect metamorphosis. there are three phases in the dragonfly life cycle namely the egg, nymph and adult phases. in the egg and nymph stages of dragonfly live aquatically (bried & hinchliffe, 2018), while the adult phase is terrestrial (laily et al., 2018). as adults, dragonfly will breed around the aquatic environment and female dragonfly will lay their eggs among water plants (setiyono et al., 2017). the existence and distribution of dragonfly species in a location is determined by many factors, including the type of habitat, canopy conditions, diversity of vegetation, and microclimate. therefore, this study aimed to determine the diversity of dragonfly species and to determine the community structure of dragonfly and damselfly in selorejo waterfall, ponorogo regency, east java, indonesia. materials and methods time and location study this research was conducted in januaryfebruary 2021 in the selorejo waterfall area, toyomerto hamlet, ngebel district, ponorogo regency, east java, indonesia. this research was conducted during the active hours of dragonfly, namely 09.00-13.00 by tracing two streams of water in the selorejo waterfall area, namely large stream and small stream. tools and materials of reseach the tools and materials used in the research are stationery, gps (global positioning system), watches, insect nets, cameras, and thermohigrometers. data collection sampling was conducted using the visual day flaying method by following the transect paths along the large stream and small stream of selorejo waterfall. the visual day flaying method was carried out to record all species along with the number of individuals found during the study. in addition to recording the number of species and individuals, this study also recorded microclimate data, namely temperature (c), humidity (%), and light intensity (lx). in the identification process using the dragonfly identification book orr (2005), pamungkas (2016), and setiyono et al., (2017). data analysis the data obtained in the study will be analyzed using the shannon-wiener diversity index (h') (azmi et al., 2006) and relative abundance (ra) (suaskara & joni, 2020). the following is the formula for each analysis: shannon-wiener diversity index: relative abundance index: note: h’ = shannon-wiener diversity index ra = relative abundance ni =total individuals belonging to the i spesies n = total individuals of population result and discussion based on the carried-out inventory at the selorejo waterfall area, the results were 12 species from six families consisting of four species of damselfly and eight species of dragonfly. the number of individuals found was 230 individuals, of which 151 individuals were found in the large stream and 79 individuals were found in the small stream. the diversity index value of dragonfly and damselfly in the selorejo waterfall area is h'= 2.05 (figure 1), this indicated that the diversity value was classified as medium. this statement is supported by hartika et al. (2017), which states that if the shannon-wienner diversity index value 𝐻'= 1.5 to 3.5 then the diversity value is medium. this showed that the environmental conditions in the selorejo waterfall area are good enough to support the natural habitat of dragonflies. the diversity value of dragonflies in selorejo waterfall has a higher value than the diversity value of dragonflies in the tourist area of kakek bodo waterfall, pasuruan regency, namely h'= 1.78 (abdillah et al., 2018; abdillah et al., 2019). meanwhile, the diversity value of dragonflies in selorejo waterfall is lower than the diversity value of dragonflies (odonata) in the secondary forest on the riverbank of kali, kali village, minahasa regency, north sulawesi, which is h'= 2.56 (lino et al., 2019). 32 | susanto & zulaikha; distribution patterns of exotic plant chromolaena odorata (l.) the value of dragonfly species diversity at the small stream area, namely h '= 1.93, was higher than the dragonfly species diversity value at the large stream location, namely h' = 1.69. the presence and number of individual dragonfly species found in the two waterways are different because the two streams have different environmental conditions, habitat types, canopy, and vegetation conditions. according to (herlambang et al., 2016), the main factors that make differences in dragonfly species diversity in each place are factors of food resources, habitat and other factors. several other factors are temperature, humidity, light intensity and availability of food. temperature and humidity affect plants and animals, especially small insects as the main food of dragonflies. in addition, temperature also determines the activity of dragonflies in finding a place to rest, flight time and breeding time (corbet, 1962). light intensity is an abiotic factor that affects the activity of a dragonfly somewhere. this is because the light intensity affects dragonfly activities such as sunbathing and foraging for food. at optimal light intensity, dragonflies will be used for sunbathing and foraging, whereas if the light intensity is too low and too high, dragonflies will be spent resting and shelter (corbet, 1962). vegetation and canopy conditions in a place affect the existence of dragonfly species because the dragonflies need vegetation such as sub-layer plants to lay their eggs when reproducing and can be used for perches (nugrahani et al., 2014). besides, dragonfly larvae need vegetation on river banks to find food and to protect themselves from predators. in adult dragonflies, the vegetation on the banks of the river is used for resting and sunbathing (silva et al., 2010). as for the canopy, several types of dragonflies are used to protect from the high intensity of sunlight (nugrahani et al., 2014). a microclimate is an important factor in providing habitat that supports the sustainability of the dragonfly life cycle (abdillah et al., 2018). microclimate data, showed the temperature and light intensity at small stream (26.5oc and 32767 lx) lower than larger stream (28.4oc and 17488 lx), meanwhile, the humidity at small stream (75.0 c) has a higher value than the large stream (75.0 %) (table 2). the thinner canopy at the large stream makes the light intensity higher and will affect the air temperature at the location. meanwhile, the slightly denser canopy conditions and the presence of many trees on the edge of the small stream, which cause an inhibition of the rate of air temperature and sunlight intensity so that the humidity value in this location has a higher value. the location of the large stream was the main water stream from selorejo waterfall. a large stream was ± 3 m wide and ± 0.5 m deep with many large rocks in the middle. the edge of a large stream is dominated by herbaceous plants like a cyperus rotundus (pocacea family), which also has an open canopy with few trees. with the conditions of vegetation and an open canopy, this stream was a suitable habitat for several dragonfly species to forage and roost. at this location, eight species were found with a total of 151 individuals, which belong to four families, namely the euphaeaidae, calopterygidae, gomphidae, and libellulidae families. at this location, it is dominated by the table 1. dragonfly and damselfly, relative abundance and conservation status suborder & family species relative abundance (%) conservation status large stream small stream zygoptera euphaeaidae euphaea variegata 13.91 7.59 lc calopterygidae vestalis luctuosa 22.52 18.99 lc clorocyphidae rhinocypha anisoptera 0.00 16.46 lc platycnemididae coeliccia membranipes 0.00 22.78 lc anisoptera gomphidae nepogomphus fruhstorferi 0.66 2.53 nt libellulidae diplacodes trivialis 0.66 0.00 lc orthetrum glaucum 9.93 15.19 lc orthetrum pruinosum 11.26 12.66 lc orthetrum sabina 5.96 0.00 lc pantala flavescens 35.10 0.00 lc trithemis festiva 0.00 1.27 lc zygonyx ida 0.00 2.53 lc note: least concern (lc), near threatened (nt). source: dow, 2019a, 2019b; gunther, 2019; dow, 2019c, 2020a; subramanian, 2020; dow, 2009; sharma, 2010; mitra, 2020; boudot et al., 2016; dow, 2020b, 2020 jurnal riset biologi dan aplikasinya, 3(1): 30-37, march 2021 | 33 figure 1. diversity index of shannon-wiener table 2. abiotic factors in selorejo waterfall area location air temperature (c) humidity (%) light intensity (lx) large stream 28.4 74.6 32767 small stream 26.5 75.0 17488 figure 2. family composition of dragonfly and damselfly at the selorejo waterfall libellulidae family with relative abundance a value of 62.91%, dragonfly members of this family are very commonly seen in various places (setiyono et al., 2017). there are three species found in the large stream and not found in the small stream, namely diplacodes trivialis, orthetrum sabina and pantala flavescens. the three species are only found in large stream because this stream has an open canopy habitat type. the diplacodes trivialis species are often found perching on rocks in areas with open canopies, this species is often found flying low above the ground and is often found in rice fields and bushes (pamungkas, 2016). orthetrum sabina species are often found perching on logs and grass, this species is a cannibal dragonfly because it is often found preying on other dragonflies (setiyono et al., 2017). orthetrum sabina species can be found in a variety of habitats and breed in waters with slow to nonflowing flows (pamungkas, 2016). pantala flavescens species are often found in flying conditions in open areas (setiyono et al., 2017), this species has long distance migration capabilities. pantala flavescens species are often found in coastal areas, open areas, tropical areas and areas with temperate climates (low et al., 2017). the location of the small stream is a water stream formed from the branching of the selorejo waterfall; this stream has a width of ± 0.7 m with a depth of ± 0.3 m with a calm water stream. aliran 34 | susanto & zulaikha; distribution patterns of exotic plant chromolaena odorata (l.) kecil has a slightly closed canopy dominated by shrubs and many trees on the banks of the stream. at this location, 9 species were found with a total of 79 individuals, which belong to 6 families, namely the euphaeaidae, calopterygidae, clorocyphida, platycnemididae, gomphidae and libellulidae families. there are four species found only in small streams, namely rhinocypha anisoptera, coeliccia membranipes, trithemis festiva and zygonyx ida. species rhinocypha anisoptera and coeliccia membranipes were only found in small stream sites because this location has a lower temperature and higher humidity value than large stream with a value of 26.5 c and 75.0%, both of these species tend to prefer habitats that have a closed canopy with relatively high humidity. meanwhile, the trithemis festiva and zygonyx ida species can be found in various types of habitats, because dragonflies, which are included in the anisoptera suborder, have high flight abilities. in the rhinocypha anisoptera species found in forest rivers with dense canopies (abdillah & lupiyaningdyah, 2021), coeliccia membranipes species can be found in habitats with dense canopies and high humidity (setiyono et al., 2017). trithemis festiva species can be found in rivers with strong currents, while zygonyx ida is often found in forests on rocky rivers (pamungkas, 2016). the pantala flavescens species (figure 3) is a dragonfly species that has the highest relative abundance value at large stream locations with a value of 35.10% (table 1). the pantala flavescens species is included in the anisoptera suborder, this species was found in the large stream observation sites with the highest number of 53 individuals. this species is characterized by the male, the upper eye is red and gray on the bottom. this species has a predominantly orange color on the thoracic and orange brown on the abdomen (pamungkas, 2016). there is a black line on the top of the abdomen with a line that is getting thicker towards the end of the abdomen. whereas females have a body that is dominated by a pale-yellow color with lower eyes gray and pale pink at the top (setiyono et al, 2017). the pantala flavescens species is a type of migratory dragonfly that has the ability to migrate up to 18,000 km (hobson et al., 2012). this dragonfly is often found in groups with hundreds of individuals. in this study, the pantala flavescens dragonfly was not found at small stream locations, this species was only seen in large streams. this is due to differences in the canopy and vegetation of the two streams, in large streams that have open canopies and vegetation dominated by herbaceous vegetation so that this location becomes the right habitat for the pantala flavescens species. this is supported by pamungkas (2016), which states that the pantala flavescens dragonfly is often found in open areas and is often found flying far from aquatic habitats. the results of the relative abundance showed that the coeliccia membranipes species (figure 4) was the damselfly species which had the highest relative abundance value at small stream locations with a value of 22.78% (table 1). the coeliccia membranipes damselfly is included in the platycnemididae family, this family has a body size ranging from small to medium with the main characteristic of having narrow wings with slightly open nets. this figure 3. pantala flavescens jurnal riset biologi dan aplikasinya, 3(1): 30-37, march 2021 | 35 figure 4. coeliccia membranipes family has features that are almost similar to family coenagrionidae (kalkman & orr, 2015), but the wing tips can be different, namely the wing tips of family coenagrionidae are more rounded (setiyono et al., 2017). coeliccia membranipes is found in small stream observation sites with the highest number of individuals, namely 18 individuals. in the male coeliccia membranipes species, the upper eye is black and blue on the bottom. has a dominant blue color on the thorax with 2 black stripes on the upper thorax. the abdomen is dominated by black with s1 blue, s2 black blue, s9 blue slightly black, and s10 blue (setiyono et al, 2017). females have the same features as males but on the thorax and legs are yellow (pamungkas, 2016). in this study, the coeliccia membranipes damselfly was only found in small stream locations. this is because the small stream where this species is found has a closed canopy and the vegetation is dominated by shrubs, so this location is the right habitat for the coeliccia membranipes species. meanwhile, in large stream locations, coeliccia membranipes species were not found because the location has an open canopy which is not suitable for the habitat of the coeliccia membranipes species. this statement is supported by setiyono et al., (2017), which states that the damselfly coeliccia membranipes can be found in places with dense canopy and high humidity. conclusion based on this study, it can be concluded that there were 12 species of dragonflies with a total of 230 individuals in the selorejo waterfall area. relative abundance results indicate that the pantala flavescens species is the highest species in the big stream area with a value of 35.10%, and the coeliccia membranipes species is the highest species in the small stream area with a value of 22.78%. the index of species diversity at the large stream location has a value of h '= 1.69 and at the small stream location it is h' = 1.93. the total value of the species diversity index in the selorejo waterfall area is h '= 2.05. new ideas are developed which are the essence of the research findings. acknowledgement the authors would like to thank you to the family of kutrik entomology study group and bbksda rkw 06 ponorogo. we also thank m. muhibbuddin abdillah that helps in species identification and writing process. references abdillah, m., alifuddin, f., & nur, f. (2018). diversitas odonata dan peranannya sebagai indikator air di kawasan wisata air terjun kakek bodo kecamatan prigen kabupaten pasuruan abstrak. seminar nasional biologi universitas negeri semarang “eksplorasi keanekaragaman hayati sebagi upaya konservasi di era disrupsi,” november 2018, 322– 328. abdillah, m. m., prakarsa, t. b. p., & tyastirin, e. (2019). odonata diversity at sumber clangap and sumber mangli puncu village sub district of puncu district of kediri. jurnal biodjati, 4(2), 236-243. https://doi.org/10.15575/biodjati.v4i2.4823. abdillah, m. m., & lupiyaningdyah, p. (2021). distribution ,characteristic and behavior of rhinocypha anisoptera selys distribution , characteristic and behavior of rhinocypha anisoptera selys, 1879 (odonata : zygoptera : east java is a large province in java. 36 | susanto & zulaikha; distribution patterns of exotic plant chromolaena odorata (l.) zoologies indonesia, 29(2). azmi, w. ., julia, j., & amirrudin, a. (2006). diversity and distribution of dragonflies (insecta: odonata) in sekayu recreational forest, terengganu a. wahizatulafzan, j. julia, a. amirrudin. journal of sustainability science and management, 1(2), 97–106. bried, jason. t & hinchliffe, robert. p. 2018. improving taxonomic resolution in large-scale freshwater biodiversity monitoring: an example using wetlands and odonata. insect conservation and diversity. 1(1), 1-9. https://doi.org/10.1111/icad.12323. boudot, j.-p., clausnitzer, v., samraoui, b., suhling, f., dijkstra, k.-d.b., schneider, w. & paulson, d.r. 2016. pantala flavescens. the iucn red list of threatened species 2016: e.t59971a65818523. https://dx.doi.org/10.2305/iucn.uk.20163.rlts.t59971a65818523.en. downloaded on 10 february 2021. corbet, p. s. (1962). biology of odonata. annual review of entomology, 25(1), 189-217. https://doi.org/10.1146/annurev.en.25.010180.0012 01. dow, r.a. 2009. orthetrum glaucum. the iucn red list of threatened species 2009: e.t163780a5650496. https://dx.doi.org/10.2305/iucn.uk.20092.rlts.t163780a5650496.en. downloaded on 10 february 2021. dow, r.a. 2019a. euphaea variegata. the iucn red list of threatened species 2019: e.t122209669a122209989. https://dx.doi.org/10.2305/iucn.uk.20192.rlts.t122209669a122209989.en. downloaded on 10 february 2021. dow, r.a. 2019b. vestalis luctuosa. the iucn red list of threatened species 2019: e.t163807a137392306. https://dx.doi.org/10.2305/iucn.uk.20193.rlts.t163807a137392306.en. downloaded on 10 february 2021 dow, r.a. 2019c. coeliccia membranipes. the iucn red list of threatened species 2019: e.t122883843a123029783. https://dx.doi.org/10.2305/iucn.uk.20192.rlts.t122883843a123029783.en. downloaded on 10 february 2021. dow, r.a. 2020a. nepogomphus fruhstorferi. the iucn red list of threatened species 2020: e.t139369530a139404028. https://dx.doi.org/10.2305/iucn.uk.20201.rlts.t139369530a139404028.en. downloaded on 10 february 2021. dow, r.a. 2020b. trithemis festiva. the iucn red list of threatened species 2020: e.t163609a140604365. https://dx.doi.org/10.2305/iucn.uk.20203.rlts.t163609a140604365.en. downloaded on 10 february 2021. dow, r.a. 2020c. zygonyx ida (amended version of 2011 assessment). the iucn red list of threatened species 2020: e.t190852a177350096. https://dx.doi.org/10.2305/iucn.uk.20203.rlts.t190852a177350096.en. downloaded on 10 february 2021. gunther, a. 2019. rhinocypha anisoptera. the iucn red list of threatened species 2019: e.t122801676a122802882. https://dx.doi.org/10.2305/iucn.uk.20193.rlts.t122801676a122802882.en. downloaded on 10 february 2021. hanum, silvy olivia salmah, s. d. (2013). jenis-jenis capung (odonata) di kawasan taman satwa kandi kota sawahlunto, sumatera barat. jurnal biologi universitas andalas, 2 (1)(issn : 2303-2162), 71–76. https://doi.org/https://doi.org/10.25077/jbioua.2. 1.%25p.2013 hartika w., farah d., dan wahdina. (2017). keanekaragaman jenis capung (odonata) pada ruang terbuka hijau kota pontianak. jurnal hutan lestari, 5(2), 156-163. herlambang, a. e. n., hadi, m., & tarwotjo, u. (2016). struktur komunitas capung di kawasan wisata curug lawe benowo ungaran barat. bioma : berkala ilmiah biologi, 18(2), 70. https://doi.org/10.14710/bioma.18.2.70-78. hobson, k. a., anderson, r. c., soto, d. x., & wassenaar, l. i. (2012). isotopic evidence that dragonflies (pantala flavescens) migrating through the maldives come from the northern indian subcontinent. plos one, 7(12), 1-4. https://doi.org/10.1371/journal.pone.0052594. kalkman, v. j., & orr, a. g. (2015). brachytron (issue june 2013). field guide to the damselfies of new guinea. https://www.brachytron.nl/wpcontent/uploads/2018/03/download-fieldguidedragonflies-newguinea-2015.pdf laily, z., rifqiyati, n., kurniawan, a. (2018). keanekaragaman odonata pada habitat perairan dan padang rumput di telaga madirda. jurnal mipa 41(2), 105–110. https://doi.org/https://journal.unnes.ac.id/nju/ind ex.php/jm/article/view/19211 lino, j., koneri, r., & butarbutar, r. r. (2019). keanekaragaman capung ( odonata ) di tepi sungai kali a jurusan. jurnal mipa unsrat online, 8(2), 59–62. retrieved from http://ejournal.unsrat.ac.id/index.php/jmuo%0ake anekaragaman. low, v. l., rashid, n. y., yusoff, a., siow, v.w. y., prakash, b. k., tan, t. k., noorhidayah, m., chen, c.h & & azirun, s. m. (2017). pleistocene demographic expansion and high gene flow in the globe skimmer dragonfly pantala flavescens fabricius (odonata: libellulidae) in peninsular malaysia. zoologischer anzeiger, 266, 23-27. https://doi.org/10.1016/j.jcz.2016.10.002. mitra, a. 2020. orthetrum sabina. the iucn red list of threatened species 2020: e.t165470a83377025.https://dx.doi.org/10.2305/i ucn.uk.20201.rlts.t165470a83377025.en. downloaded on 10 february 2021. nugrahani, m. p. nazar, l. makitan, t. & setiyono, j. (2014). peluit tanda bahaya: capung indikator lingkungan panduan penilaian kualitas lingkungan melalui capung. yogyakarta: indonesia dragonfly society. orr, a. g. 2005. dragonflies of peninsular malaysia and singapore. malaysia: natural histori publications (borneo). pamungkas, b. c. (2016). untring: dragonflies of banyuwangi. yogyakarta: indonesian dragonfly society. rahmawati, l., fajri, s. r., & armiani, s. (2019). keanekaragaman capung jarum (zygoptera) di taman wisata alam kerandangan batu layar kabupaten lombok barat. bioscientist : jurnal ilmiah biologi, 7(1), 16. https://doi.org/10.1111/icad.12323 https://doi.org/10.1146/annurev.en.25.010180.001201 https://doi.org/10.1146/annurev.en.25.010180.001201 https://doi.org/10.1371/journal.pone.0052594 https://doi.org/10.1016/j.jcz.2016.10.002 jurnal riset biologi dan aplikasinya, 3(1): 30-37, march 2021 | 37 https://doi.org/10.33394/bjib.v7i1.2381. rizal, s., & hadi, m. (2015). inventarisasi jenis capung (odonata) pada areal persawahan di desa pundenarum kecamatan karangawen kabupaten demak. bioma : berkala ilmiah biologi, 17(1), 16. https://doi.org/10.14710/bioma.17.1.16-20. rokhaman, e., setyawati, s.m & hidayat, s. 2020. biodiversitas capung subordo anisoptera di sekitar aliran sungai muria desa colo kudus. journal of biology education. 3(1): 1-10. setiyono j, diniarsi s, oscilata enr & budi ns.(2017). dragonfly of yogyakarta. yogyakarta:indonesia dragonfly society. sharma, g. 2010. orthetrum pruinosum. the iucn red list of threatened species 2010: e.t167097a6301540. https://dx.doi.org/10.2305/iucn.uk.20104.rlts.t167097a6301540.en. downloaded on 10 february 2021. silva, d. p., marco, p. de & resende, d.c. (2010). adult odonste abundance and community assemblage measures as indicators of stream ecological integrity: a case study. ecological indicator. 10: 744752. https://doi.org/10.1016/j.ecolind.2009.12.004 suaskara, i. b., & joni, m. (2020). keanekaragaman jenis capung dan pemanfaatan nimfanya sebagai nilai tambah pendapatan di bendungan latu abiansemal. simbiosis, 8(1), 28. https://doi.org/10.24843/jsimbiosis.2020.v08.i01.p 04 subramanian, k.a. 2020. diplacodes trivialis. the iucn red list of threatened species 2020: e.t167372a83371487. https://dx.doi.org/10.2305/iucn.uk.20201.rlts.t167372a83371487.en. downloaded on 10 february 2021. soendjoto, m. a. (2016). capung, predator cantik penghuni perairan. warta konservasi lahan basah, 24(1), 13-18. http://eprints.unlam.ac.id/id/eprint/1025. https://doi.org/10.1016/j.ecolind.2009.12.004 jurnal riset biologi dan aplikasinya, volume 4, issue 1, march 2022 antibacterial activity of garlic added to tempeh against bacillus sp. and escherichia coli adelia ayu fannya prasetya, lusiawati dewi*, risya pramana situmorang faculty of biology, satya wacana christian university, jl. diponegoro 52-60 salatiga indonesia *corresponding author e-mail: lusidewi804@gmail.com article history abstract received : 24 february 2022 tempeh (tempe) has been known to have antibacterial properties due to the presence of glycoprotein compounds, antimicrobial peptides, and flavonoids produced by the fungus rhizopus spp. during the fermentation process. the addition of garlic powder is expected to increase the antibacterial activity of tempeh against contaminant bacteria. this research aimed to analyze the antibacterial activity, water content, and organoleptic properties (taste, aroma, and color) of tempeh with garlic powder supplementation. garlic powder was added to the tempeh fermentation process with various concentrations of 0.15, 0.25, 0.50, and 0.75%. antibacterial activity, water content, and qualitative organoleptic tests were analyzed using paper disk diffusion, gravimetric, and questionnaire methods. the results showed that the addition of garlic powder in all treatments for bacillus sp had shown an inhibitory activity with moderate strength with an inhibitory power of 0.15; 0.25; 0.50; and 0.75% respectively 8±1.71; 10±1.71; 7±0.96; 9±0.58. meanwhile, escherichia coli showed no inhibitory activity. the addition of garlic powder at a concentration of 0.25% reduced the water content to 58.25±0.03. in addition, the addition of garlic powder was not able to affect the color but was able to influence the aroma and taste of tempeh. garlic powder was able to inhibit bacillus sp with the best concentration of 0.25%; the addition of garlic powder can reduce the water content and affect the aroma and taste of tempeh. revised : 19 march 2022 approved : 21 march 2022 published : 31 march 2022 keywords antibacterial activity, fermentation, garlic, tempeh how to cite: prasetya, a.a.f., dewi, l & situmorang, r.p. (2022) antibacterial activity of garlic added to tempeh against bacillus sp. and escherichia coli. jurnal riset biologi dan aplikasinya, 4(1):34-41. doi: 10.26740/jrba. v4n1.p34-41. introduction tempeh (tempe) is a fermented food that is highly demanded among indonesia's due to its high protein. according to banobe et al. (2019), tempeh made from soybeans has a protein content of 27.42%, fat content of 15.94%, carbohydrate content of 49.38%, and water content of 5.43%. a fermentation process using rhizopus spp. is required to make tempeh. the fermentation process will result the formation of white hyphae that resemble thread strands that will envelop soybeans. the number of hyphae will be affected by the duration of the fermentation, and if there are more, they can bind soybeans into a single unit. because of the dense mycelium, the tempeh structure will become compact and dense (barus et al., 2019). during the fermentation process, various types of natural additives can be added to tempeh, such as spices to improve the product's nutrition, taste, function, and attractiveness. according to rahmi et al. (2018), garlic (allium sativum) is one of the sources of natural additive. allicin, alliinase, s-allil cysteine, diallyl sulfide, and allyl methyl trisulfide are all found in garlic bulbs. when compared to other types of thiosulfate compounds, allicin have the highest composition, approximately 70-80%. this allicin compound is responsible for the flavor and aroma of garlic. the allinase enzyme converts the aline compound into allicin when the garlic jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi mailto:lusidewi804@gmail.com jurnal riset biologi dan aplikasinya, 4(1): 34-41, march 2022 | 35 bulb is destroyed (moulia et al., 2018). in addition, allicin has antimicrobial properties for both grampositive and gram-negative bacteria, as well as antifungal properties (salima, 2015). basically, rhizopus spp. can produce antibacterial compounds such as glycoproteins, antimicrobial peptides, and flavonoids on their own during the tempeh fermentation process (noviana et al., 2018). the addition of garlic powder is expected to be a solution for increasing the inhibitory power on the growth of unwanted gram-negative and gram-positive bacteria. the addition of garlic to the tempeh fermentation process can achieve the proper concentration of allicin compounds to inhibit contaminant bacteria in tempeh. however, another potential finding is that the identification process of excessive concentrations has the potential to inhibit the metabolic process and growth of rhizopus spp. this antibacterial property can be tested by looking at a bright inhibition zone around the colony's growth. because the active compounds in the extract inhibit the bacterial growth, this zone indicates the absence of it (mawaddah et al., 2018). in this study, garlic bulbs was powdered and added to the tempeh fermentation process at various concentrations to increase the nutritional value and antibacterial properties tempeh. through this process, allicin compounds from garlic bulbs that are antibacterial are not removed to determine the level of antibacterial activity or strength produced by adding garlic bulbs during the tempeh fermentation process. rahmi et al. (2018) experimented with the addition of garlic during the tempeh fermentation process, and it has been shown to improve the quality of tempeh's taste, aroma, color, and texture. but the difference is the research conducted by (rahmi et al., 2018) only reviewed the nutritional content, even though the compounds contained in garlic have the potential to not only increase nutritional content but also have the potential to inhibit contaminant bacteria if tempeh is made in an unhygienic way. according to rahmi et al. (2018), garlic can also increase protein levels in tempeh. however, it can also increase several types of essential and nonessential amino acids, even though not significantly. it might because of the soybeans was soaked in garlic and steamed for 15-20 minutes. this treatment causes the loss of allicin compounds attached to soybean seeds since these compounds are thermolabile. allicin compounds have numerous health benefits, including being a source of antioxidants that can prevent the body producing nitrate dioxide (sudjatini, 2020), having antidiabetic properties (lisiswanti and haryanto, 2017), and being able to lower blood pressure, reduce platelet aggregation, prevent hyperlipidemia and boost immunity (rahman, 2014). this study aimed to determine the effect of garlic powder addition to the antibacterial activity, water content, and organoleptic properties of tempeh. materials and methods this research was conducted in september – november 2021 at the microbiology and biochemistry laboratory, faculty of biology, satya wacana christian university. the materials used in this study included garlic bulbs (allium sativum), boiled soybeans from tempeh maker in gamasan, bandungan, central java, tempeh yeast (raprima, indonesia), ethyl acetate (degrees of analysis, merck millipore, germany), nutrient agar (merck millipore, germany), nacl (degrees of analysis, merck millipore, germany), tetracycline antibiotics 30 mcg (oxoid, usa), filter paper, and disk paper (oxoid, usa). samples preparation garlic powder was made by drying garlic bulbs in a dehydrator at 60°c for 1–3 hours. when the garlic bulbs have dried, then crushed using blender until turned into powder and ready to be added in tempeh fermentation process. the process of making tempeh begins by inoculating 2 grams of starter inoculum into 100 grams of boiled soybeans, then garlic powder was added with concentrations of 0%(control), 0.15, 0.25, 0.50, and 0.75%. the mixtures were put in a plastic ziplock and then punched with a toothpick to keep oxygen circulating during the tempeh fermentation. then incubated at room temperature for 48 hours. antibacterial activity assay an antibacterial test was carried out using a disk diffusion assay. the tempeh was extracted by maceration method using ethyl acetate. fifty grams of mashed tempeh were mixed with ethyl acetate until all sample parts were submerged. the container was closed and stored at room temperature in the dark for three days under stirring conditions at a speed of 150 rpm. the ethyl acetate solvent was changed daily to maximize the obtained extract. the macerate was concentrated using a rotary vacuum evaporator at 45°c. the resulting thick section was aerated with nitrogen gas to evaporate the remaining solvent completely. the antibacterial test was carried out against 36 | prasetya et al., antibacterial activity of garlic added to tempeh bacillus subtilis atcc 6275 and escherichia coli atcc 8739. the 0.5 mfu bacteria were prepared and spread on na media. the paper disk containing the extract under various concentrations was placed in the plate. tetracycline was used as a positive control. the samples were incubated at 37°c for 24 hours. antibacterial activity was seen by measuring the diameter of the inhibition zone formed around the colony. the strength category of antibacterial activity was based on (mawaddah et al., 2018) namely ≤ 5 mm, weak; 5–10 mm, medium; 10–20 mm, strong;  20 mm, very strong. to determine the antibacterial group, the media was incubated for 5 days at 37°c to determine whether the inhibition zone remains or disappears. the results then tested statistically using one way anova. water content assay the water content test was carried out by the gravimetric method. the porcelain cup was heated using an oven at 100°c for 1 hour and cooled using a desiccator for 20 minutes. the weight of the cup was obtained by measuring the cold porcelain cup (w0). the tempeh samples were weighed as much as 2 grams using an analytical balance. then the samples were placed into a porcelain cup. before being heated, the porcelain cup and samples were weighed using an analytical balance (w1) and then heated using an oven at 100°c for 5 hours. furthermore, the porcelain cup was cooled using a desiccator for 20 minutes and weighed using an analytical balance. the heating process was repeated until a constant weight (w2). the water content in tempeh was calculated using the formula (laksono et al., 2019): the results then tested statistically using one way anova. organoleptic test in the organoleptic test, the color, aroma, and taste were observed. this test was conducted on 25 untrained panelists. tempeh is fried with the same standard of fire and old. the scores for the observed indicators are: 5=very preferable, 4= preferable, 3= neutral, 2= dislike, 1= very dislike. the results then tested statistically using friedman test. results and discussion the effect of garlic powder addition to the antibacterial activity of tempeh antibacterial activity is a test used to determine the strength or ability of antibacterial substances to inhibit the growth of bacteria (afriani et al., 2017). the results of the one way anova test with a 5% level of antibacterial activity against bacillus sp showed that each treatment with the addition of garlic powder showed a significant difference in the effect on the antibacterial activity of tempeh (p<0.05) (table 1). the result shown inhibition of the growth of bacillus sp. that might be caused by an antibacterial compound from allicin (table 2, figure 1). this compound has been known to have antimicrobial activity by blocking the synthesis of rna, dna, and protein (purwantiningsih et al., 2019). allicin compounds can also inhibit the synthesis of phospholipids in the bacterial cell wall, which results in increases the permeability of the cell wall (purwantiningsih et al., 2019). increases the permeability of cell wall also causes the sulfhydryl and disulfide groups in cystine and cysteine to undergo lysis, as a result protease enzymes cannot synthesize and the cell proliferation process becomes inhibited (purwantiningsih et al., 2019). in addition, garlic contains several flavonoid compounds that can interfere with cell membrane permeability by forming hydrogen bonds with extracellular proteins and integral proteins on bacterial cell membranes. this bond involves absorption reactions and occurs in the hydrophilic part of the membrane. furthermore, the phenol– protein complex will enter the cell membrane and cause protein precipitation, resulting in the inactivation of enzymes in bacteria, disruption of the nutrient transport process, and increased membrane permeability (purwantiningsih et al., 2019). increased membrane permeability can also cause metabolic enzymes to diffuse out of the cell so that the reaction for the formation of atp as an energy source for cell growth cannot run properly (mawaddah et al., 2018). based on research conducted by soraya et al. (2018), garlic also contains tannin compounds that can inhibit the performance of proteolytic enzymes so that protein macromolecules cannot be broken down into their constituent amino acids. as a result, bacteria cannot use protein molecules to support their growth. the bacterial inhibition mechanism can also be caused by the presence of glycoprotein compounds, jurnal riset biologi dan aplikasinya, 4(1): 34-41, march 2022 | 37 table 1. one way anova test of antibacterial activity of garlic tempeh against bacillus sp. anova sum of squares df mean square f sig. between groups 19.800 4 4.950 3.375 .037 within groups 22.000 15 1.467 total 41.800 19 table 2. strength category of antibacterial activity of garlic tempeh against bacillus sp. treatments antibacterial activity inhibition zone diameter (mm) category* positive control (tetracycline) 25 very strong negative control (0 %) 8±0.50 medium 0.15% 8±1.71 medium 0.25% 10±1.71 medium 0.50% 7±0.96 medium 0.75% 9±0.58 medium note: *category based on (mawaddah et al., 2018) ≤ 5 mm, weak; 5–10 mm, medium; 10–20 mm, strong;  20 mm, very strong table 3. strength category of antibacterial activity of garlic tempeh against escherichia coli treatments antibacterial activity inhibition zone diameter(mm) category* positive control (tetracycline) 27 very strong negative control (0%) 0±0 no inhibitory zone 0.15% 0±0 no inhibitory zone 0.25% 0±0 no inhibitory zone 0.50% 0±0 no inhibitory zone 0.75% 0±0 no inhibitory zone note: *category based on (mawaddah et al., 2018) ≤ 5 mm, weak; 5–10 mm, medium; 10–20 mm, strong;  20 mm, very strong antimicrobial peptides, and flavonoids produced by the fungus rhizopus spp. itself (noviana et al., 2018). based on noviana et al. (2018), glycoprotein compounds can bind to iron which acts as a cofactor for various enzyme performances in the cellular respiration system and as a cytochrome component in bacterial cells, the presence of this bond will cause iron deficiency and inhibit the growth bacillus sp. glycoprotein compounds can only inhibit the growth of bacillus sp. as a gram-positive bacteria because its cell structure is simple and it has a thin cell wall ranging from 25-30 μm. the cell wall consists of one layer composed of 90% peptidoglycan and 1–4% lipids, so it causes glycoproteins can penetrate cell walls more easily (noviana et al., 2018). then antimicrobial peptides are also able to act as antibacterial compounds by modifying the outer structure of the cell membrane, which causes depolarization and increased membrane permeability, that these peptides are also able to inhibit the synthesis of proteins, dna, and rna from bacteria (noviana et al., 2018). furthermore, flavonoid compounds act as antibacterial agents by disrupting cell membrane permeability (noviana et al., 2018). the presence of natural antimicrobial compounds in tempeh caused the control treatment to show inhibitory activity against bacillus sp. the inhibition category was classified as moderate because the diameter of the inhibition zone against bacillus sp. was about 5-10 mm (table 2). it might be caused by the concentration of garlic powder being too small so that the effect on 38 | prasetya et al., antibacterial activity of garlic added to tempeh antibacterial properties was not significant. furthermore, allicin has unstable properties during storage at room temperature; therefore, the compound will be further metabolized into an ajoene compound, which has another name, diallyl disulfide or vinylidene (purwantiningsih et al., 2019). the presence of ajoene compounds causes the low antibacterial properties of garlic tempeh because this compound has a antibacterial properties weaker than allicin (purwantiningsih et al., 2019). another factor might be caused by the extraction process, which cannot completely extract polar compounds. the solvent used in this study was ethyl acetate, which has semi-polar properties so that compounds such as flavonoids cannot be adequately extracted (mawaddah et al., 2018). based on research conducted by kemit et al. (2016), flavonoids are polar compounds due to their structure being composed of hydroxyl groups, so this means only solvents that have polar properties are able to extract them completely. the antibacterial compounds in tempeh have a bacteriostatic mechanism of action (figure 3). that can only inhibit the growth of bacillus sp. bacteria without killing it because when incubated for 24 hours at 37°c, it can show inhibitory activity, but when further incubated for up to 5 days. the clear zone, which indicates the inhibition zone, has begun to disappear (mawaddah et al., 2018). based on the strength test of antibacterial activity, the results showed that the addition of garlic powder at a concentration of 0.25% showed the best inhibitory power against bacillus sp. bacteria. in contrast, the higher concentration of garlic powder showed decreased antibacterial activity. it might be due to the garlic powder inhibiting the growth of rhizopus spp., hence natural antibacterial compounds in tempeh cannot be produced properly (noviana et al., 2018). although the garlic tempeh extract showed antibacterial activity against bacillus sp. (table 3, figure 2), its active compounds could not inhibit the growth of e. coli bacteria because there is no inhibition zone formed. it might be due to e. coli belonging to gram-negative bacteria, which has a more complex cell wall component. it consists of three layers lipoproteins, lipopolysaccharides, and peptidoglycan (noviana et al., 2018). the lipoprotein layer contains hydrophilic protein porin, making it difficult for antimicrobial compounds to enter bacterial cells (noviana et al., 2018). the antibacterial activity of allicin against gram-negative bacteria occurs through 2 mechanisms, that is damaging the cell wall and inhibiting the synthesis of rna molecules (lestari et al., 2018). the process of cell wall destruction occurs by inhibiting the formation of the peptidoglycan layer, which gives strength to the bacterial cell wall. allicin compound is able to penetrate the lipopolysaccharide layer of gramnegative bacteria and cause membran permeability to increase. allicin is also able to attack the phospholipid layer and cause it to break down into glycerol and phosphoric acid then followed cell lysis (lestari et al., 2018). then the process of of inhibiting rna synthesis occurs by forming bond with the dna dependent rna polymerase enzym (lestari et al., 2018). the effect of garlic powder added to the water content of tempeh tempeh without garlic powder treatment gets the highest percentage of water content, which was 62.50±0.03% (table 2). the addition of garlic powder reduces tempeh’s water content up to 58.25±0.03% at a concentration of 0.25%. it shows that the concentration of 0.25% garlic powder did not inhibit the growth of the rhizopus spp. the decreasing of water content happen because of the water produced through the fermentation process can still be reused by rhizopus spp. to carry out the respiration (purwanto and weliana, 2018). the respiration process often involves the performance of hydrolytic enzymes from rhizopus spp. so, the decreasing water content indicates the fermentation activity of rhizopus spp increase. this is due to in this hydrolysis process, the free water contained in the substrate will be reduced and used as a reagent and be converted into bound water (budiono, 2016). this statement was also similar to purwanto and weliana (2018), the high rate of respiration and fermentation activity could reduce the percentage of the water content of tempeh. meanwhile, the addition of garlic powder under concentrations of 0.50 and 0.75% increases the water content tempeh. this could be due to decreased respiration rate due to damage to hydrolytic enzymes from the fungus rhizopus spp due to thiosulfinate compounds (allicin), so growth and fermentation activity decreased (purwanto and weliana, 2018). but beside on table 4 all treatments did not show any difference with the control because the significance value was >0.05. based on the results of all water content measurements obtained, it is possible to conclude that all treatments produced results that met the sni standard of 65 %. jurnal riset biologi dan aplikasinya, 4(1): 34-41, march 2022 | 39 a b figure 1. antibacterial activity of garlic tempeh against bacillus sp bacteria. note: negative control and positive control (a), treatment of garlic tempeh with concentration of 0.15, 0.25, 0.50, and 0.75% (b) a b figure 2. antibacterial activity of garlic tempeh against e. coli bacteria. note: negative control and positive control (a), treatment of garlic tempeh with concentration of 0.15, 0.25, 0.50, and 0.75% (b) a b figure 3. antibacterial activity after incubation for 5 days. note: bacillus sp (a), escherichia coli (b) table 4. one way anova test of water content on tempeh added with garlic anova water_content sum of squares df mean square f sig. between groups 47.300 4 11.825 1.513 ,248 within groups 117.250 15 7.817 total 164.550 19 40 | prasetya et al., antibacterial activity of garlic added to tempeh table 5. value of water content of tempeh added with garlic with different concentrations concentration (%) water content (%)* control 62.50±0.03 0.15 59.75±0.02 0.25 58.25±0.03 0.50 60.13±0.02 0.75 61.25±0.04 table 6. organoleptic test results of garlic tempeh parameters treatments (rating 1-5) significance value of friedman test 0% 0.15% 0.25% 0.50% 0.75% color 3.5 3.4 3.4 3.4 3.2 0.685 aroma 3.2 3.2 3.9 3.0 2.9 0.014 taste 3.6 3.4 4.0 3.04 3.2 0.025 the effect of the addition of garlic powder to the organoleptic properties of tempeh the organoleptic test aims to determine the level of presence of the panelists to tempeh added with garlic powder at different concentrations. table 6 shows the results for the color parameters of all types of tempeh obtained a fairly good value, that met on a scale of 3, and for concentration of 0.15, 0.25, 0.50%, the same value was obtained, that is 3.4. hence it can conclude that all treatments were well received by the panelists. then for the aroma, the results obtained for concentrations 0f 0.15, 0.25. 0.50% also obtained a good assessment and a concentration 0.25% which has the highest value. and the concentration of 0.75%, the lowest value was obtained because the addition of garlic powder that was too high could cause a pungent odor due to organosulfur compounds (pratama, 2017). then for the taste, all types of tempeh can be well received by the panelists and the concentration 0f 0.25% which has the highest value. based on the table 6, it shows that all treatments had no significant effect on color parameters (p > 0.05). it is because garlic powder only contained flavonoid, which has colorless characteristics, and flavone that gave yellowish-white color to garlic. according to zhafira (2018), the addition of garlic powder tends not to contribute significantly to the color of tempeh (zhafira, 2018). for the following parameter, garlic powder affected the aroma of tempeh (p<0.05) because garlic bulbs contained allicin compounds. although allicin compounds are easily oxidized, the oxidation product still forms organosulfur compounds (pratama, 2017). in terms of taste parameters, the results of adding garlic powder could affect tempeh's taste. the panelists recommended the highest concentration of 0.25 %. this could be because the application of garlic powder at that concentration does not inhibit the fermentation process by rhizopus spp, so it does not affect the original taste of tempeh. on the other hand, the presence of organosulfur compounds in garlic such as allin, s-methyl-cysteine, allinase, spropylcysteine, allicin, s–allyl cysteine, s–ethyl– cysteine, dialill sulfide, allyl methyl trisulfide, dialill disulfide, dialill trisulfide, and methyl allyl trisulfide (moulia et al., 2018). conclusion based on the findings, the addition of garlic powder to the tempeh fermentation process affected the antibacterial activity for bacillus sp. and the concentration of 0,25%, which provided the most excellent inhibitory activity but had no effect on e. coli. aside from that, the addition of 0.25 percent garlic powder reduced the water content to58.25±0.03. the addition of garlic powder can then affect the aroma and taste of tempeh in the organoleptic test. jurnal riset biologi dan aplikasinya, 4(1): 34-41, march 2022 | 41 references badan standardisasi nasional. 2015. tempe kedelai. in tempe kedelai sni 344 : 2015. badan standardisasi nasional, jakarta. afriani, n., yusmarini, & pato, u. (2017). aktivitas antimikroba lactobacillus plantarum 1 yang diisolasi dari industri pengolahan pati sagu terhadap bakteri patogen escherichia coli fncc-19 dan staphylococcus aureus fncc-15. jom faperta, 4(2), 1–12. banobe, c. ., kusumawati, i. g. a. w., & wiradnyani, n. . (2019). nilai zat gizi makro dan aktivitas antioksidan tempe kedelai (glycine maz l.) kombinasi biji kecipir (psophocarpus tetragonolobus l.). pro food (jurnal ilmu dan teknologi pangan, 5(2), 486–495. barus, t., salim, d. p., & hartanti, a. t. (2019). kualitas tempe menggunakan rhizopus delemar tb 26 dan r. delemar tb 37 yang diisolasi dari inokulum tradisional tempe “daun waru.” jurnal aplikasi teknologi pangan, 8(4), 143–148. budiono, r. a. (2016). pengaruh jenis kapang terhadap aktivitas fermentasi tempe saga pohon (adenanthera pavonina l.) [skripsi]. jakarta: fakultas sains dan teknologi, universitas islam negeri syarif hidayatullah. kemit, n., widarta, i. w. r., & nocianitri, k. a. (2016). pengaruh jenis pelarut dan waktu maserasi terhadap kandungan senyawa flavonoid dan aktivitas antioksidan ekstrak daun alpukat (persea americana mill). jurnal ilmu dan teknologi pangan, 5(2), 130– 141. laksono, a. s., marniza, & rosalina, y. (2019). karakteristik mutu tempe kedelai lokal varietas anjasmoro dengan variasi lama perebusan dan penggunaan jenis pengemas. jurnal agroindustri, 9(1), 8–18. lestari, s. r., witjoro, a., & poejiani, s. (2018). the potential of single garlic oil in inhibiting the growth and damaging the membrane of pseudomonas aeruginosa bacteria. journal of tropical biodiversity and biotechnology, 3(3), 67–72. https://doi.org/10.22146/jtbb.33498 lisiswanti, r., & haryanto, f. p. (2017). allicin pada bawang putih ( allium sativum ) sebagai terapi alternatif diabetes melitus tipe 2. majority, 6(2), 31– 36. mawaddah, n., fakhrurrazi, & rosmaidar. (2018). aktivitas antibakteri ekstrak tempe terhadap bakteri staphylococcus aureus. jurnal ilmiah mahasiswa veteran, 2(3), 230–241. moulia, m. n., syarief, r., iriani, e. s., & kusumaningrum, h. d. (2018). antimikroba ekstrak bawang putih. jurnal pangan, 27(1), 55–66. noviana, a., dieny, f. f., rustanti, n., anjani, g., & afifah, d. n. (2018). antimicrobial activity of tempeh gembus hydrolyzate. iop conference series earth and environmental science, 116(1), 1–7. pratama, m. (2017). identifikasi atribut dan rasa rempah dengan profiled test. jurnal agroindustri halal, 3(2), 126–132. pratiwi, r. h. (2017). mekanisme pertahanan bakteri patogen terhadap antibiotik. jurnal pro-life, 4(3), 418–429. purwantiningsih, t. i., rusae, a., & freitas, z. (2019). uji in vitro antibakteri ekstrak bawang putih sebagai bahan alami untuk menghambat bakteri staphylococcus aureus dan escherichia coli. sains peternakan, 17(1), 1–4. purwanto, y. a., & weliana. (2018). kualitas tempe kedelai pada berbagai suhu penyimpanan. journal of agrobased industry, 35(2), 106–112. rahman, m. s. (2014). allicin and other functional active components in garlic : health benefits and bioavailibility. international journal of food properties, 10(2), 245–268. rahmi, s. l., mursyid, & wulansari, d. (2018). formulasi tempe berbumbu serta pengujian kandungan gizi. industria : jurnal teknologi dan manajemen agroindustri, 7(1), 57–65. salima, j. (2015). antibacterial activity of garlic (allium sativum l.). majority, 4(2), 30–39. soraya, c., chismirina, s., & novita, r. (2018). pengaruh perasan bawang putih (allium sativum l.) sebagai bahan irigasi saluran akar dalam menghambat pertumbuhan enterococcus faecalis secara in vitro. cakradonya dental journal, 10(1), 1–9. sudjatini. (2020). pengaruh cara pengolahan terhadap aktivitas antioksidan ekstrak bawang putih (allium sativum l.) varietas kating dan sinco. agrotech jurnal ilmiah teknologi pertanian, 3(1), 1–7. wiryadana, k. a., pinatih, k. j. p., & hendrayana, m. a. (2019). uji daya hambat kombinasi siproflaksasin dengan obat non antibiotik artesunat, diklofenak dan loperamid terhadap pertumbuhan isolat klinis escherichia coli. e-jurnal medika, 8(3), 1–8. zhafira, r. (2018). pengaruh lama aging terhadap sifat fisik, kimia, dan aktivitas antioksidan produk bawang hitam lanang. jurnal pangan dan agroindustri, 6(1), 34–42. jurnal riset biologi dan aplikasinya, volume 5, issue 1, march 2023 etlingera (zingiberaceae) in bogor botanic gardens: potential benefits and its conservation status yeyen novitasari research center for plant conservation, botanic gardens, and forestry, nasional research and innovation agency (brin) jl. raya jakarta-bogor km 46, cibinong, jawa barat, 16911, indonesia *corresponding author e-mail: yeyen.novitasari@brin.go.id article history abstract received : 6 december 2022 indonesia is one of mega biodiverse countries in the world, with a high global biodiversity index and many vascular plant species. however, not all plant species are known in terms of their uses, potential benefits, and conservation status. one of example is genus etlingera, where further studies are required. therefore, this study aimed to provide information on the potential benefits and uses of the genus etlingera and to investigate its conservation status. the study was conducted using the method of literature study, an inventory of potential uses, and an inventory of the genus etlingera living in bogor botanic gardens through direct observation. six species of the genus etlingera were collected from the bogor botanic gardens, namely etlingera brevilabrum, e. elatior, e. hemisphaerica, e. loerzingii, e. megalocheilos, and e. walang, conservation status of three species (e. brevilabrum, e. hemisphaerica, and e. megalocheilos) is least concern (lc), two species (e. elatior and e. walang) are data deficient (dd), and one species (e. loerzingii) is vulnerable (vu). all species are commonly used as spices, condiments, cosmetics, and traditional medicine to cure various diseases, possibly also as ornamental plants. the secondary metabolites present in some species, namely e. brevilabrum, e. elatior, and e. hemisphaerica can be used as antimicrobial, antifungal, and antioxidant agents. revised : 4 february 2023 approved : 15 march 2023 published : 31 march 2023 keywords ethnobotany; ginger; preservation; traditional medicine how to cite: novitasari, y. (2023). etlingera (zingiberaceae) in bogor botanic gardens: potential benefits and its conservation status. jurnal riset biologi dan aplikasinya, 5(1):1-7. doi: 10.26740/jrba.v5n1.p.1-7. introduction indonesia is the second mega biodiverse country in the world, with a global biodiversity index of 418.78 and a number of 19.232 vascular plant species (nash, 2022; darajati et al., 2016). some of these plant species are commonly used by indonesians for many purposes, such as medicines, food, and ornamental plants (bahtiar et al., 2017). zingiberaceae or ginger family is a family of flowering plants with 1300 species in 52 genera of perennial herbs with tuberous rhizomes, distributed in tropical africa, asia, and america (tamokou et al., 2017). the genera of zingiberaceae in bogor botanic gardens are alpinia, amomum, boesenbergia, curcuma, etlingera, globba, hedychium, hornstedtia, kaempferia, languas, nanochilus, plagiostachys, and zingiber (ariati et al., 2019). the genus etlingera is easy to find in the malesian region, especially in the humid forests of sumatra. some etlingera species are used as ornamental plants in botanical gardens and tropical parks (poulsen et al., 2009). there are approximately 200 species of etlingera in the world and 74 species in malesia (puspitaningrum et al., 2017; poulsen, 2012; newman et al., 2004). bogor botanic gardens is an ex-situ conservation area that serves as a repository of plant diversity from various regions in indonesia, especially lowland forest ecosystem. as the oldest botanical garden in southeast asia, according to jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi mailto:yeyen.novitasari@brin.go.id https://doi.org/10.26740/jrba.v5n1.p1-7 jurnal riset biologi dan aplikasinya, 5(1): 1-7, march 2023 | 2 republic of indonesia presidential decree no. 93 of 2011, it has played an important role in plant conservation, research, education, tourism, and environmental services. hence, bogor botanic gardens, along with other botanical gardens in indonesia, is required to carry out research and preservation activities to maintain and enhance the diversity of its plant collections (pemerintah republik indonesia, 2011). however, there is lack of information on plant collections in bogor botanic gardens, especially those of the genus etlingera, regarding their potential uses and the need for conservation. thus, this research aimed to provide valuable insight into the potential benefits and the utilization of the genus etlingera and studied its conservation status. materials and methods research area the study was conducted at bogor botanic gardens from september to october 2022. the bogor botanic gardens is in the heart of bogor, west java, indonesia and is situated at an altitude of about 265 meters above sea level. the average temperature in bogor is around 26°c, and the humidity level is usually approximately 70%. bogor receives significant yearly rainfall, with an annual average of 3500-4000 millimeters. the heaviest precipitation occurs in december and january. the bogor botanic gardens was established in 1817 and covers an area of around 87 hectares (figure 1). the garden maintains a collection of plants from the lowland rainforest ecosystem and has 12.370 specimens from all over indonesia. data collection the research was conducted using the method of literature study, inventory of potential benefits, and direct observation of living plant collections in bogor botanic gardens to match the data from bogor botanic gardens’ catalog with the actual condition in the garden, whether the collected plants were still alive or dead, and to count the amount of living collections. primary data were collected through direct observation of the living plant collections at bogor botanic gardens to verify and confirm the living plant collections, especially the genus etlingera in the garden, which matched the data in the registration book and the carrymaps application. through this direct observation, that obtained the current status and number of living collections and species of the genus etlingera in bogor botanic gardens. secondary data, such as general information about the plants, inventory potential, native range, population trend, and plants conservation status, were retrieved from the iucn red list of threatened species and global biodiversity information facility (gbif), and uses of the plants was collected through literature studies related to the objectives of this study. the collection data were then explained descriptively. result and discussion genus etlingera in bogor botanic gardens and its conservation status there are six species of the genus etlingera in bogor botanic gardens (table 1). six etlingera species are rhizomatous herbs that grow in the wet tropical biome (ariati et al., 2019; olander, 2019; olander, 2020; poulsen et al., 2009; poulsen and olander, 2019b; poulsen and olander, 2019a; poulsen et al., 2019; saw, 2019). all species of the genus etlingera in bogor botanic gardens are native to the region of malesia, according to the figure 1. the map showing the study sites at bogor botanic gardens 3|novitasari., etlingera (zingiberaceae) in bogor botanic gardens iucn red list of threatened species. the population trends of five species of the genus etlingera in bogor botanic gardens are unknown, except for e. loerzingii, which is declining since this species is endemic to sumatra on the lower slopes of barisan mountains. endemic species are particularly vulnerable to threats such as habitat loss, climate change, and human activities (olander, 2020; poulsen et al., 2009). in addition, sumatran forests are under constant threat (wwf, 2019), and satellite imagery shows habitat destruction and conversion in some areas where the species has been found (gfw, 2023). e. walang is also endemic to java (table 1). all plant collections of the genus etlingera in bogor botanical gardens shown in figure 2. the conservation statuses of six species of the genus etlingera in bogor botanic gardens vary from data deficient, least concern, to vulnerable based on iucn red list of threatened species. etlingera elatior and e. walang are considered to be data deficient (dd). these species are reasonably well studied, but data on the distribution and native range are subject to considerable uncertainty. the native range of e. elatior may be sumatra or borneo. however, some sources give the range of this species as peninsular malaysia and thailand. it is also difficult to distinguish which collection is native or cultivated. therefore, a genetic study is needed to determine the correct native range of e. elatior (poulsen and olander, 2019a). on the other hand, the distribution of e. walang is uncertain, despite the fact that this species is endemic to java and has been recorded from blambangan and western java (olander, 2019). three species, namely etlingera brevilabrum, e. hemisphaerica, and e. megalocheilos, are classified as least concern according to iucn red list of threatened species. these species exist in many places, some of which are protected areas. their range extends from java and sumatra across peninsular malaysia to thailand. however, the habitat of e. hemisphaerica has decreased, and is considered as a rare species that has difficulty adapting to disturbed areas. therefore, a population size and decline study are needed to protect the species from threats (saw, 2019). in contrast, e. megalocheilos is one of the most tolerant species to disturbance and can thrive in a completely open habitat (poulsen and olander, 2019b). furthermore, although habitat quality has decreased, e. brevilabrum had been found in deforested and disturbed areas and grows well. therefore, these species have been categorized as table 1. species of the genus etlingera in bogor botanical gardens (ariati et al., 2019; olander, 2019; olander, 2020; poulsen et al., 2009; poulsen and olander, 2019b; poulsen and olander, 2019a; poulsen et al., 2019; saw, 2019) no. species number of plant collections source native range population trends conservation status 1 etlingera brevilabrum (valeton) r.m. smith 2 central kalimantan borneo to the philippines unknown least concern (lc) 2 etlingera elatior (jack) r.m. smith 6 java, central and east kalimantan, south sulawesi, and sumatra peninsula thailand to west malesia unknown data deficient (dd) 3 etlingera hemisphaerica (blume) r.m. smith 2 scotlands indonesia (sumatra to java), malaysia, thailand unknown least concern (lc) 4 etlingera loerzingii (val.) r.m. smith 2 north sumatra sumatra decreasing vulnerable (vu) 5 etlingera megalocheilos (griff.) a.d. poulsen 1 south kalimantan west malesia unknown least concern (lc) 6 etlingera walang (blume) r.m. smith 2 west java and south sulawesi java unknown data deficient (dd) jurnal riset biologi dan aplikasinya, 5(1): 1-7, march 2023 | 4 figure 2. living plant collections of the genus etlingera in bogor botanic gardens, a). e. brevilabrum, b). e. elatior, c). e. hemisphaerica, d). e. loerzingii, e). e. megalocheilos, f). e. walang least concern (poulsen et al., 2019). one of the six species of the genus etlingera in bogor botanic gardens, e. loerzingii, is considered vulnerable because this species is endemic to sumatra and exists in six locations. it also has a small range (olander, 2020). 2.2 utilization and potential benefits of the genus etlingera in bogor botanical gardens etlingera brevilabrum the fruits of e. brevilabrum are edible, and the leaves are used for medicinal and roofing purposes (poulsen et al., 2019). the extract of e. brevilabrum contains β-sitosterol, stigmasterol, phenols, phenolic acids, flavonoids, and hydroxycinnamic acid derivatives. seventy-seven compounds of essential oils from eight groups of compounds were found in the rhizomes, stems, and leaves of e. brevilabrum. these compounds may have antimutagenic and antioxidant activity, antigenotoxic capacity, and lymphocyte potency (mahdavi et al., 2013a; mahdavi et al., 2013b, mahdavi, 2014). in addition, the liquid smoke of fresh and dried leaves of e. brevilabrum contains ten different classes of organic compounds. the presence of phenols, carboxylic acids, aliphatic acids, esters, and aromatic acids can potentially be used to cure some skin problems (mahdavi, 2014). strong antioxidant activity and excellent antimicrobial and antifungal activity have been demonstrated in the smoke liquid of e. brevilabrum. it can inhibit the growth of 14 microorganisms (mahdavi et al., 2018). etlingera elatior e. elatior, commonly known as torch ginger, is cultivated for its aromatic and decorative flowering shoots. in indonesia, this plant has been cultivated for hundreds of years. the arils surrounding the seeds, leafy shoots, and young shoots are edible and used as a forest snack and for medicinal purposes. however, this species is also known as an ornamental plant (poulsen, 2012; poulsen and olander, 2019a). the plant is potentially developed as an ornamental plant and cropped flower in bedugul (oktavia et al., 2019). e. elatior is used in traditional medicine by the natives of gayo and kabanjahe, balinese, and local people in samosir island to treat cold, fever, cough, digestive (diarrhea) system problems, muscles and joints problems, the reproductive system, ear infections, hypertension, diabetes, antioxidants, anti-proliferative, anticancer, antimicrobial agents, as a shampoo, as eye drops, to increase breast milk production, skin whitening, anti-aging, and to improve maternal fitness postpartum. there are 99 types of essential oils in the leaves, 62 in the rhizomes, 26 in the stem, and 95 in the flowers (silalahi, 2016, 2017; hartini and sahromi, 2016; purwoko et al., 2019; saudah et al., 2021). due to the high antioxidant and flavonoid contents in e. elatior, the powder of the e. elatior flowers can be used as a substitute for making cookies (sari et al., 2022). in addition, the entire plant parts of e. elatior, such as shoots, stems, flowers, seeds, and fruits, have a high phenolic content, with the fruits containing the largest amounts of phenols. almost all parts contain monoterpenes, terpenoids, sesquiterpenes, saponins, steroids, flavonoids, triterpenoids, alkaloids, and tannins. the plant extract can be used as an anticancer agent, especially an antileukemic agent (rusanti et al., 2017), antioxidant (maimulyanti and prihadi, 2015), insect repellents and termiticides (rislyana et al., 2015), antibacterial and antifungal agents to inhibit salmonella thypi, shigella sp., aspergillus flavus, streptococcus mutans, and in fish spoilage (angin, 2015; suryani et al., 2019; nasution et al., 2020; a b c d e f 5|novitasari., etlingera (zingiberaceae) in bogor botanic gardens nurlaili et al., 2022). furthermore, the leaf and flower extracts of e. elatior can be used as a natural protein preservative, for example, in tilapia (oreochromis niloticus) (nurlaili et al., 2022). e. elatior can also be used as a functional food and to make jelly sweets (muawanah et al., 2012). in addition, the leaf extract of e. elatior can heal wounds in rabbits (oryctolagus cuniculus) effectively (nastity et al., 2015). etlingera hemisphaerica e. hemisphaerica is commonly known as the black tulip, helani tulip ginger, or tulip ginger. as with e. elatior, the immature inflorescences are used to flavor food or spice in indonesia. e. hemisphaerica and e. elatior can substitute for each other, as both have similar uses. due to the attractive color of the inflorescence and some variations in the involucre bracts, this species has high potential as an ornamental plant (saw, 2019; handayani and ariyanti, 2015). the half-ripe fruits are mixed raw into various salad or vegetable dishes, while the ripe fruits are made into fruit sweets. the stem of the plant can be eaten raw, cooked, or steamed (ibrahim and setyowati, 2016; lim, 2014). according to ruyani et al. (2018) and umar et al. (2021), the leaf extract of e. hemisphaerica contains tannins, saponins, alkaloids, flavonoids, antioxidants, minerals, and vitamin c. the leaves are used for wound cleansing, as an antibacterial agent against staphylococcus aureus and bacillus cereus, as an immunomodulator or immunostimulant, have a protective effect against hgcl2 toxicity, can improve the evaluation of the stage of spermatogenesis, and potentially lower blood glucose and triglyceride levels (ruyani et al., 2014; gresinta, 2019; noverita and sinaga, 2021). in addition, e. hemisphaerica has sour flowers, and the fruit has a fragrant smell to treat skin problems, cancer, and tumors. etlingera loerzingii the vegetative shoots and inflorescences are edible, delicious, aromatic, sour, and sweet in taste and smell. e. loerzingii has great potential as an ornamental plant like e. elatior (olander, 2020; poulsen et al., 2009). etlingera megalocheilos e. megalocheilos is used as food. the fruits are sweet and edible, even if they are unpleasant (poulsen and olander, 2019b). the leaves and rhizomes of e. megalocheilos contain many chemical compounds such as camphene, monoterpenes, sesquiterpenes, verbenol, aromadendrene, azulene, borneol, myrcene, and sabinene. this species has enormous potential to be used as a natural preservative, herbal products, foods, cosmetics, nutraceuticals, and ornamental plants (trimanto and hapsari, 2018). etlingera walang the leaves can be used as a condiment. the crushed leaves have an unpleasant smell similar to that of the rice bug, leptocorisa acuta (walang sangit in indonesian). more historically significant is the practice of burning leaves in the rice field in western java to drive away this pest. although no detailed information on the use of e. walang, as a ginger plant is available, this species can potentially be used as a spice, ornamentals, and traditional medicine (olander, 2019; pitopang et al., 2020; jansen, 2022). conclusion the six etlingera species recorded from the bogor botanic garden have varying conservation statuses. three species are of least concern, two are data deficient, and one is vulnerable. these plants are used for various purposes, such as spices, seasonings, cosmetics, and traditional medicine. they are also used for ornamental purposes. the secondary metabolites contained in some of these plants have antimicrobial, antifungal, and antioxidant properties that make them valuable for various applications. conservation efforts are necessary for vulnerable species such as etlingera loerzingii, which could be extinct if not protected. collecting more information on the species with data deficiencies (e. elatior and e. walang) is also essential to accurately assessing their conservation status. the bogor botanic gardens and other botanical gardens are critical in conserving plant species and preserving their genetic diversity. acknowledgment the author would like to thank all staffs in bogor botanic gardens who helped in obtaining the data. thus, the author can complete this work. references angin, m. i. b. p. (2015). karakterisasi senyawa kimia dan uji aktivitas antibakteri minyak atsiri bunga kecombrang (etlingera elatior) yang diisolasi dengan destilasi stahl. agrica ekstensia, 9(1), 27– 33. ariati, s. r., astuti, r. s., supriyatna, i., yuswandi, a. y., setiawan, a., saftaningsih, d., & pribadi, d. o. (2019). an alphabetical list of plant species cultivated in the bogor botanic gardens. https://doi.org/10.14203/press.107. https://doi.org/10.14203/press.107 jurnal riset biologi dan aplikasinya, 5(1): 1-7, march 2023 | 6 bahtiar, a., vichitphan, k., & han, j. (2017). leguminous plants in the indonesian archipelago: traditional uses and secondary metabolites. natural product communications, 12(3), 461–472. https://journals.sagepub.com/doi/pdf/10.1177/19 34578x1701200338. darajati, w., pratiwi, s., herwinda, e., radiansyah, a. d., nalang, v. s., nooryanto, b., rahajoe, j. s., ubaidillah, r., maryanto, i., kurniawan, r., prasetyo, t. a., rahim, a., jefferson, j., & hakim, f. (2016). indonesian biodiversity strategy and action plan 2015-2020. http://ksdae.menlhk.go.id/assets/publikasi/buku_ ibsap%202015-2020.pdf. gfw. (2023). global forest watch. available at: http://www.globalforestwatch.org/ gresinta, e. (2019). uji potensi ekstrak daun etlingera hemisphaerica terhadap jumlah leukosit mus musculus. simposium nasional ilmiah dengan tema: (peningkatan kualitas publikasi ilmiah melalui hasil riset dan pengabdian kepada masyarakat), 978–623. https://doi.org/10.30998/simponi.v0i0.476. handayani, d., & ariyanti, n. s. (2015). perbedaan vegetatif dua jenis ekonomi etlingera yang dipakai penduduk bogor. floribunda, 5(2), 48–52. https://doi.org/10.32556/floribunda.v5i2.2015.12 8. hartini, s., & sahromi. (2016). kebun raya samosir: studi tentang kekayaan flora dan potensinya. pros sem nas masy biodiv indon, 243–249. https://doi.org/10.13057/psnmbi/m020221. ibrahim, h., & setyowati, f.m. (2016). etlingera (prosea). plantuse english, 4 may 2016. available at: https://uses.plantnetproject.org/e/index.php?title=etlingera_(prose a)&oldid=222063. (accessed: 7 october 2022). jansen, p. c. m. (2022). etlingera walang. (prosea). plant resources of south-east asia. available at: http://uses.plantnetproject.org/en/etlingera_walang_(prosea). (accessed: 12 october 2022). lim, t. k. 2014. etlingera hemisphaerica. in edible medicinal and non-medicinal plants (vol. 8, pp. 844–846). springer. the netherlands. https://doi.org/10.1007/978-94-017-8748-2_74 mahdavi b., yaacob w. a., din l. b., & aisha, m. a. s. 2013a. essential oil composition of three airdried parts of etlingera brevilabrum. journal of essential oil-bearing plants, 16(1), 17-22. https://doi.org/10.1080/0972060x.2013.764200. mahdavi, b. (2014). chemical constituents of the aerial parts of etlingera brevilabrum (zingiberaceae). der pharma chemica, 6(2), 360–365. http://derpharmachemica.com/archive.html. mahdavi, b., yaacob, w. a., & din, l. b. (2018). phytochemical study of medicinal smokes from etlingera brevilabrum leaves. journal of herbal medicine. 13(2018), 52–62. https://doi.org/10.1016/j.hermed.2018.04.001. mahdavi, b., yaacob, w. a., din, l. b., & jahangirian, h. (2013). antioxidant activity of consecutive extracts of the base, stem and leaves of etlingera brevilabrum. asian journal of chemistry, 25(7), 3937– 3941. https://doi.org/10.14233/ajchem.2013.13851. maimulyanti, a., & prihadi, a. r. (2015). chemical composition, phytochemical and antioxidant activity from extract of etlingera elatior flower from indonesia. journal of pharmacognosy and phytochemistry, 3(6), 233–238. http://www.phytojournal.com/vol3issue6/issue_ march_2015/4-1-34.1.pdf. muawanah, a., djajanegara, i., sa’duddin, a., sukandar, d., and radiastuti, n. (2012). penggunaan bunga kecombrang (etlingera elatior) dalam proses formulasi permen jelly. valensi, 2(4), 526–533. https://doi.org/10.15408/jkv.v2i4.270. nash, m. h. (2022). the 201 most (& least) biodiverse countries in 2022 – the swiftest. the swiftest. https://theswiftest.com/biodiversity-index/. nastity, g. h., mukhriani, and halim, r. m. (2015). uji efek penyembuhan luka sayat ekstrak etanol daun kecombrang (etlingera elatior) dalam bentuk sediaan gel terhadap kelinci (oryctolagus cuniculus). jk fik uinam, 3(2), 54–58. https://doi.org/10.24252/jurfar.v3i2.2206. nasution, y. r., duniaji, a. s., and arihantana, n. m. i. h. (2020). aktivitas antijamur ekstrak kecombrang (etlingera elatior) terhadap aspergillus flavus fncc 6109. jurnal itepa, 9(2), 127–135. newman, m., lhuillier, a., & poulsen, a. d. (2004). checklist of the zingiberaceae of malesia. blumea supplement, 16, 1–168. noverita, & sinaga, e. (2021). antibacterial bioactivity from extract of reundeu caret (staurogyne longata) and honje (etlingera hemisphaerica). journal of tropical biodiversity, 2(1), 21–32. nurlaili, n., maulida, a., theresia, c., sandika, f. a., & hairah, u. (2022). aplikasi ekstrak tanaman kecombrang (etlingera elatior) sebagai pengawet alami pada daging ikan nila (oreochromis niloticus). jurnal sains dan kesehatan, 4(2), 198– 204. https://doi.org/10.25026/jsk.v4i2.1110. oktavia g. a. e., kuswantoro f., & wardhani, p. k. (2019). traditional utilization of ginger torch (etlingera elatior (jack) r.m.sm.) in bedugul, bali and its conservation in bali botanic garden. aip conference proceedings, 2120, 0300171–0300177. https://doi.org/10.1063/1.5115621. olander, s. b. (2019). etlingera walang. the iucn red list of threatened species. https://doi.org/http://dx.doi.org/10.2305/iucn. uk.2019-3.rlts.t117325529a124282427.en. olander, s. b. (2020). etlingera loerzingii. the iucn red list of threatened species. https://doi.org/https://dx.doi.org/10.2305/iuc n.uk.2020-2.rlts.t117321028a124282197.en. pemerintah republik indonesia. (2011). peraturan presiden republik indonesia nomor 93 tahun 2011 tentang kebun raya (pp. 1–12). pitopang, r., umrah, harso, w., nurainas, & zubair, m. s. (2020). some botanical aspects and antifungal activity of etlingera flexuosa (zingiberaceae) from central sulawesi, indonesia. biodiversitas, 21(8), 3547–3553. https://doi.org/10.13057/biodiv/d210817. poulsen, a. d., ardiyani, m., & kusuma, y. w. c. (2009). etlingera loerzingii (zingiberaceae) a gorgeous torch ginger from sumatra grown in botanic gardens. buletin kebun raya indonesia, 12(1), 5–10. https://doi.org/10.14203/bkr.v12i1.76. poulsen ad. (2012). etlingera of sulawesi. kota kinabalu: natural history publications. poulsen, a. d., and olander, s. b. (2019a). etlingera elatior, torch ginger. the iucn red list of threatened species. https://journals.sagepub.com/doi/pdf/10.1177/1934578x1701200338 https://journals.sagepub.com/doi/pdf/10.1177/1934578x1701200338 http://ksdae.menlhk.go.id/assets/publikasi/buku_ibsap%202015-2020.pdf http://ksdae.menlhk.go.id/assets/publikasi/buku_ibsap%202015-2020.pdf http://www.globalforestwatch.org/ https://doi.org/10.30998/simponi.v0i0.476 https://doi.org/10.32556/floribunda.v5i2.2015.128 https://doi.org/10.32556/floribunda.v5i2.2015.128 https://doi.org/10.13057/psnmbi/m020221 https://uses.plantnet-project.org/e/index.php?title=etlingera_(prosea)&oldid=222063 https://uses.plantnet-project.org/e/index.php?title=etlingera_(prosea)&oldid=222063 https://uses.plantnet-project.org/e/index.php?title=etlingera_(prosea)&oldid=222063 http://uses.plantnet-project.org/en/etlingera_walang_(prosea) http://uses.plantnet-project.org/en/etlingera_walang_(prosea) https://doi.org/10.1007/978-94-017-8748-2_74 https://doi.org/10.1080/0972060x.2013.764200 http://derpharmachemica.com/archive.html https://doi.org/10.1016/j.hermed.2018.04.001 https://doi.org/10.14233/ajchem.2013.13851 http://www.phytojournal.com/vol3issue6/issue_march_2015/4-1-34.1.pdf http://www.phytojournal.com/vol3issue6/issue_march_2015/4-1-34.1.pdf https://doi.org/10.15408/jkv.v2i4.270 https://theswiftest.com/biodiversity-index/ https://doi.org/10.24252/jurfar.v3i2.2206 https://doi.org/10.25026/jsk.v4i2.1110 https://doi.org/10.1063/1.5115621 https://doi.org/http:/dx.doi.org/10.2305/iucn.uk.2019-3.rlts.t117325529a124282427.en https://doi.org/http:/dx.doi.org/10.2305/iucn.uk.2019-3.rlts.t117325529a124282427.en https://doi.org/https:/dx.doi.org/10.2305/iucn.uk.2020-2.rlts.t117321028a124282197.en https://doi.org/https:/dx.doi.org/10.2305/iucn.uk.2020-2.rlts.t117321028a124282197.en https://doi.org/10.13057/biodiv/d210817 https://doi.org/10.14203/bkr.v12i1.76 7|novitasari., etlingera (zingiberaceae) in bogor botanic gardens https://doi.org/http://dx.doi.org/10.2305/iucn. uk.2019-1.rlts.t117234456a124279013.en. poulsen, a. d., & olander, s. b. (2019b). etlingera megalocheilos. the iucn red list of threatened species. https://doi.org/http://dx.doi.org/10.2305/iucn. uk.2019-2.rlts.t117321541a124282227.en. poulsen, a. d., olander, s. b., & docot, r. v. a. (2019). etlingera brevilabrum. the iucn red list of threatened species. https://doi.org/http://dx.doi.org/10.2305/iucn. uk.2019-2.rlts.t117317653a124282017.en. purwoko, a., turnip, h., and maser, w. h. (2019). the pattern of etlingera elatior cultivation in agroforestry systems and its use as traditional medicines and food by local people of kabanjahe, north sumatra, indonesia. biodiversitas, 20(7), 1998–2003. https://doi.org/10.13057/biodiv/d200728. puspitaningrum, d., mustaqim, w. a., & ardiyani, m. (2017). a new record of etlingera pauciflora (zingiberaceae) in java, indonesia. reinwardtia, 16(1): 1–4. https://doi.org/10.14203/reinwardtia.v16i1.2825. rislyana, f., harlia, & sitorus, b. (2015). bioaktivitas ekstrak batang kecombrang (etlingera elatior (jack) r.m.sm.) terhadap rayap coptotermes curvignathus. sp. jurnal kimia katulistiwa, 4(3), 9– 15. https://jurnal.untan.ac.id/index.php/jkkmipa/arti cle/view/9769/9538. rusanti, a., sukandar, d., rudiana, t., & adawiah. (2017). profil fraksi sitotoksik terhadap sel murine leukemia p-388 dari ekstrak biji honje (etlingera elatior). jurnal kimia valensi, 3(1). https://doi.org/10.15408/jkv.v0i0.3640. ruyani, a., putri, r. z. e., jundara, p., gresinta, e., ansori, i., & sundaryono, a. (2018). protective effect of leaf ethanolic extract etlingera hemisphaerica blume against mercuric chloride toxicity in blood of mice. journal of dietary supplements, 16(1), 51–65. https://doi.org/10.1080/19390211.2018.1429516. ruyani, a., sundaryono, a., rozi, z. f., samitra, d., & gresinta, e. (2014). potential assessment of leaf ethanolic extract honje (etlingera hemisphaerica) in regulating glucose and triglycerides on mice (mus musculus). international journal of sciences, 3(1), 70–76. http://www.ijsciences.com. sari, i. p., devi, m., & rohajatien, u. (2022). pengaruh subtitusi bunga kecombrang (etlingera elatior) terhadap kapasitas antioksidan cookies. journal of food technology and agroindustry, 4(1), 32–40. https://doi.org/10.24929/jfta.v4i1.1866. saudah, fitmawati, roslim, d. i., zumaidar, darusman, and ernilasari. (2021). ethnobotany etlingera elatior (jack) r.m. smith (cikala) in ethnic gayo. proceedings of the 3rd kobi congress, international and national conferences (kobicinc 2020), 205– 209. https://doi.org/10.2991/absr.k.210621.034. saw, l. g. (2019). etlingera hemisphaerica, black tulip. the iucn red list of threatened species. https://doi.org/http://dx.doi.org/10.2305/iucn. uk.2019-3.rlts.t117319869a124282147.en. silalahi, m. 2016. etlingera elatior (jack) r. m. smith: manfaat dan aktivitas biologi. prosiding seminar nasional pendidikan biologi dan biologi, jurusan pendidikan biologi, fakultas mipa, universitas negeri yogyakarta, b011–b0112. https://www.researchgate.net/publication/31121 8835 silalahi, m. (2017). senyawa metabolit sekunder pada etlingera elatior (jack) r. m. smith. seminar nasional pendidikan biologi dan saintek ii, 41–47. suryani n., nurjanah d., indriatmoko d. d. (2019). aktivitas antibakteri ekstrak batang kecombrang (etlingera elatior (jack) r.m.sm.) terhadap bakteri plak gigi streptococcus mutans. j. kartika kimia, 2(1), 23-29. tamokou j. d. d, mbaveng a.t., and kuete v. (2017). antimicrobial activities of african medicinal spices and vegetables therapeutic potential against metabolic, inflammatory, infectious and system diseases. united kingdom: academic press, elsevier pp. 207-237. trimanto, and hapsari, l. (2018). short communication: a new record of etlingera megalocheilos (griff.) a.d. poulsen (zingiberaceae) in sulawesi, indonesia. biodiversitas, 19(4), 1227–1235. https://doi.org/10.13057/biodiv/d190407. umar, l. a., shadar, s. h. a., sari, k., taurina, h., asteria, m., and ruyani, a. (2021). efek daun etlingera hemisphaerica pada perbaikan skoring spermatogenesis tikus putih (rattus norvegicus) yang diinduksi hgcl2. bioedusains:jurnal pendidikan biologi dan sains. 4(2): 346–354. https://doi.org/10.31539/bioedusains.v4i2.2169. wwf (world wildlife fund). (2019). deforestation in borneo and sumatra. available at: http://wwf.panda.org/our_work/forests/deforesta tion_fronts/deforestation_in_borneo_and_sumatr/ https://doi.org/http:/dx.doi.org/10.2305/iucn.uk.2019-1.rlts.t117234456a124279013.en https://doi.org/http:/dx.doi.org/10.2305/iucn.uk.2019-1.rlts.t117234456a124279013.en https://doi.org/http:/dx.doi.org/10.2305/iucn.uk.2019-2.rlts.t117321541a124282227.en https://doi.org/http:/dx.doi.org/10.2305/iucn.uk.2019-2.rlts.t117321541a124282227.en https://doi.org/http:/dx.doi.org/10.2305/iucn.uk.2019-2.rlts.t117317653a124282017.en https://doi.org/http:/dx.doi.org/10.2305/iucn.uk.2019-2.rlts.t117317653a124282017.en https://doi.org/10.13057/biodiv/d200728 https://doi.org/10.14203/reinwardtia.v16i1.2825 https://jurnal.untan.ac.id/index.php/jkkmipa/article/view/9769/9538 https://jurnal.untan.ac.id/index.php/jkkmipa/article/view/9769/9538 https://doi.org/10.15408/jkv.v0i0.3640 https://doi.org/10.1080/19390211.2018.1429516 http://www.ijsciences.com/ https://doi.org/10.24929/jfta.v4i1.1866 https://doi.org/10.2991/absr.k.210621.034 https://doi.org/http:/dx.doi.org/10.2305/iucn.uk.2019-3.rlts.t117319869a124282147.en https://doi.org/http:/dx.doi.org/10.2305/iucn.uk.2019-3.rlts.t117319869a124282147.en https://www.researchgate.net/publication/311218835 https://www.researchgate.net/publication/311218835 https://doi.org/10.13057/biodiv/d190407 https://doi.org/10.31539/bioedusains.v4i2.2169 http://wwf.panda.org/our_work/forests/deforestation_fronts/deforestation_in_borneo_and_sumatr/ http://wwf.panda.org/our_work/forests/deforestation_fronts/deforestation_in_borneo_and_sumatr/ jurnal riset biologi dan aplikasinya, volume 4, issue 1, march 2022 ability test of iaa (indole-3-acetic acid) hormone-producing endophytic bacteria from lamongan mangrove fatimah1,2*, risky lailatul ayu fadilah1, annida izzatul millah1, tri nurhariyati1,2, bambang irawan1, ni’matuzahroh1,2, moch affandi1,2, afifa rini nur izza zuhri1, eva watamtin widhiya1, syarifah salsabila1, zakia asrifah ramly1 1departement of biology, faculty of science and technology, universitas airlangga, surabaya, kampus c, jl. dr. ir. h. soekarno, mulyorejo surabaya, jawa timur 2university coe research center for bio-molecule engineering, universitas airlangga, kampus c, jl. dr. ir. h. soekarno, mulyorejo surabaya, jawa timur *corresponding author: e-mail: fatimah@fst.unair.ac.id article history abstract received : 1 march 2022 most of the plant-associated bacteria can synthesize active biological components of phytohormones such as auxin. this study aimed to examine the potency of 61 endophytic bacteria isolates from the mangroves at kutang beach, lamongan in producing iaa hormone and to identify types of isolates effecting the concentration of iaa, morphological characteristics of isolates, as well as endophytic bacterial species that have the most potential to produce iaa hormone. screening of endophytic bacteria isolates was performed using the colorimetric method and the production of iaa was carried out using the spectrophotometric method. iaa production by endophytic bacteria was analyzed descriptively and statistically. one-way anova was employed to determine the effect of the isolate type on the concentration of iaa. the most potential isolates to produce iaa hormone are identified by 16s rrna gene marker. the screening results showed that 12 isolates of endophytic bacteria have the potential to produce iaa hormones (2.0-9.3 ppm), coded with lmg 7, 15, 31, 32, 43, 53, 54, 55, 56, 57, 62, and 63. the results of the one-way anova test suggested that the type of isolates did not affect the concentration of iaa produced by endophytic bacteria. the twelve isolates had different morphological characters and those were gram-positive bacilli with cell sizes ranging from 1.5 µm 3 µm. the highest concentration of iaa was produced by lmg 15 (9.3 ppm). lmg 15 was identified as bacillus cereus strain lmg 15, having 99.33% similarity to bacillus cereus strain iam 12605. revised : 28 march 2022 approved : 30 march 2022 published : 31 march 2022 keywords endophytic bacteria, iaa hormone, biofertilizer, lamongan mangrove, bacillus cereus strain lmg 15. how to cite: fatimah., fadilah, r.l.a., millah, a.i., nurhariyati, t., irawan, b., ni’matuzahroh, affandi, m., zuhri, a.r.n.i & widhiya, e.w. (2022). ability test of iaa (indole-3-acetic acid) hormone-producing endophytic bacteria from lamongan mangrove. jurnal riset biologi dan aplikasinya, 4(1):42-50. doi: 10.26740/jrba.v4n1.p.42-50. introduction indonesia has a very large agricultural sector. fertilizer accounts for 20% of the success of agricultural production. currently, modern farmers are very dependent on the use of synthetic fertilizers to obtain optimum crop productivity. the continuous use of synthetic fertilizers since the 1970s has started to have negative environmental impacts, such as the decrease in soil organic matter content, soil permeability, soil microbial populations, and soil vulnerability to erosion (herdiyanto et al., 2015). in addition, farmers face the inadequate provision of subsidized fertilizer. in december 1998, the indonesian government removed subsidies for fertilizer, which made farmers unable to buy non-subsidized fertilizers due to the jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi mailto:fatimah@fst.unair.ac.id jurnal riset biologi dan aplikasinya, 4(1): 1-8, march 2022 | 43 high prices. to avoid soil damage due to the use of synthetic fertilizers and the current high price of fertilizers, researchers attempt to develop a biofertilizer. biofertilizer contains live microorganisms for plant nutrients (herdiyanto et al., 2015). microorganisms contained in biofertilizers are generally groups of n-fixing microorganisms, phosphate solubilizers, decomposers of organic matter, and phytohormones-producing bacteria such as gibberellins, cytokinins, and iaa (indole-3acetic acid) (kartikawati et al., 2017). iaa hormone is an endogenous auxin that plays a role in cell enlargement and the formation of xylem and phloem tissue, inhibits the growth of side shoots, stimulates abscission, and also affects the development and elongation of roots. in preparing the biofertilizer formula, the researchers tried to find potential microbes that produce iaa hormones by exploring various places. bacteria that have ability to produce iaa consist of soil bacteria (apine and jadhav, 2011), epiphytes, endophytes (duca et al., 2014; liu et al., 2017; white et al., 2019), marine bacteria (duca et al., 2014), meliotropes (duca et al., 2014) and cyanobacteria (sergeeva et al., 2002). endophytic microbes can be isolated from plant parts. each higher plant can contain endophytic microbes that have the potential to produce secondary metabolites which are assumed to be the result of coevolution or genetic transfer from their host plants into endophytic microbes (radji, 2005). exploration of endophytic microbes from mangroves in indonesia has not been widely studied. oktafiyanto et al. (2017) have succeeded in isolating endophytic bacteria from mangrove forests originating from the coast of indramayu, jakarta, yogyakarta, and banyuwangi. the result suggests that endophytic bacteria isolates can be used as biocontrols for wilt disease caused by ralstonia solanacearum as well as meloidogyne incognita, the main pathogen that causes stunted plants, easy wilting, leaves yellowing, and roots ringing in tomato. there were not many studies that revealed the potential of endophytic bacteria in mangroves to produce iaa hormones. irawan et al. (2019) have succeeded in isolating 61 endophytic bacteria from the stems, leaves, and roots of the mangroves at kutang beach, lamongan. this study aimed to determine the potential of those 61 isolates to produce iaa hormones, to know the types of isolates affecting the concentration produced, to characterize the macroscopic and microscopic morphology of the isolates, and to identify the most potential endophytic bacteria species in producing iaa hormone. the most potential iaa producing bacteria can be used as one of the constituents for biofertilizer formula as an alternative way in overcoming problems caused by the use of chemical fertilizers. materials and methods rejuvenation of endophyte bacteria isolates sixty-one isolates of pure endophytic bacteria were rejuvenated in slanted na media, then incubated at 37˚c for 24 hours. screening of iaa hormone-producing endophytic bacteria isolates screening of 61 isolates of endophytic bacteria that have been isolated from the mangrove’s plants at kutang beach was based on their ability to produce iaa hormone. each isolate was cultured into bottles containing 24 ml of nb media (700 ppm l-tryptophan) and incubated at room temperature for 24 hours. fifteen ml of isolate culture was centrifuged for 20 minutes at 5,000 rpm to obtain the supernatant. a total of 1 ml of the supernatant was reacted with 4 ml of salkowski's reagent and incubated in a dark room for 15 minutes. iaa hormone-producing bacteria was seen by observing the color change in the supernatant culture of bacterial isolates from yellow to pink or transparent pink. measurement of iaa concentration the turbidity of the 61 bacterial isolates culture was equalized (od = 0.5) at a wavelength of 580 nm. each bacterial isolate was cultivated in the same way as the screening stage. the concentration of iaa produced by the isolates was measured using a spectrophotometer at a wavelength of 530 nm. the concentration of iaa was calculated after being compared with the standard iaa curve (pattern and glick, 2002 with modification). the iaa standard curve was made by creating a synthetic iaa stock solution with a concentration of 200 ppm, or 0.01 g synthetic iaa in 50 ml methanol. the iaa standard curve from the spectrophotometric results shows the relationship between the iaa standard solution (x) and its absorbance (y). the equation obtained was as follows: y = a + bx (y = absorbance; a = intercept; b = slope/regression coefficient; x = concentration). 44|fatimah., ability test of iaa (indole-3-acetic acid) hormone-producing endophytic macroscopic and microscopic characterization of endophytic bacteria isolates bacterial isolates that have the potential to produce iaa hormone were characterized macroscopically by observing colony morphology which included color, shape, elevation, and colony margins. meanwhile, microscopic characterization was carried out by gram staining and measurement of bacterial cells. identification of bacteria species using 16s rrna gene isolation of genomic dna from bacterial isolates that have the most potential to produce iaa hormone was carried out according to the procedures listed in the promega genomic dna purification kit wizard. the results of genomic dna observations can be seen on agarose gel electrophoresis with 1% agarose through the appearance of bands indicating that the dna sample has been isolated. the isolated dna was then quantitatively tested using a spectrophotometer at a wavelength of 260 nm and 280 nm to determine its purity level. measurement of isolated dna was carried out at a wavelength of 260 nm, while measurement of protein was carried out at a wavelength of 280 nm. then, pcr was performed on 16s rrna gene using universal primers 27f and 1492 r. the results of the dna sequence of the 16s rrna gene were trimmed using the bioedit program to remove the low-quality dna (<15%) and to remove the gap. then, the forward and reverse sequences were aligned, the consensus was made, and the gaps in consensus are eliminated. the consensus is translated by changing the translation frame until it does not find a stop codon. then, multiple sequence alignment was performed to determine the difference in nucleotide base sequences between samples (kearse et al., 2012). the dna sequences of the bacterial samples were matched with the data on genebank using blast n via the ncbi (national center for biotechnology information) website to determine the degree of similarity of the sampled nucleotide base sequences to the closest bacterial species. data analysis data were analyzed using one-way anova with a significant degree of 5%. the dna samples of endophytic bacteria that have the most potential to produce iaa hormone were identified molecularly with the 16s rrna gene marker. data from 16s rrna gene sequencing were analyzed using bioedit 7.04 software to obtain nitrogen base consensus data. then, dna sequences of endophytic bacteria that have the most potential to produce iaa hormone were matched on genebank using blast n through the ncbi (national center for biotechnology information) website. results and discussion screening of iaa hormone-producing endophytic bacteria isolates screening of endophytic bacterial isolates was tested qualitatively using the colorimetric method by observing the color change in the bacterial culture supernatant from yellow to pink after being reacted with salkowski's reagent. based on the results of the qualitative iaa screening test (figure 1), there were 12 isolates of endophytic bacteria from the mangroves at kutang beach, lamongan that produced the iaa hormone, coded with lmg (7, 15, 31, 32, 43, 53, 54, 55, 56, 57, 62, 63) with iaa concentrations ranging from 2 9.3 ppm. the color change in the bacterial culture supernatant from yellow to pink after being reacted with salkowski's reagent occurred due to a reaction between iaa produced by bacteria and fe contained in salkowski's reagent, forming a complex compound [fe2(oh)2(ia)4], indicated by ia, which is indole-3-acetate. jurnal riset biologi dan aplikasinya, 4(1): 1-8, march 2022 | 45 figure 1. results of qualitative test on potential iaa hormone-producing endophytic bacteria isolates table 1. iaa hormone concentration produced by endophytic bacteria codes average of iaa concentration (ppm) lmg 7 3.9 lmg 15 9.3 lmg 31 4.1 lmg 32 3.3 lmg 43 7.4 lmg 53 3.2 lmg 54 4.0 lmg 55 2.8 lmg 56 2.6 lmg 57 2.0 lmg 62 3.3 lmg 63 2.8 figure 2. iaa standard curve the production of iaa by isolates of potential endophytic bacteria the production of iaa by 12 isolates of potential endophytic bacteria was quantitatively carried out using the spectrophotometric method. table 1 show the concentration of iaa hormone produced by isolates of endophytic bacteria. 46|fatimah., ability test of iaa (indole-3-acetic acid) hormone-producing endophytic the iaa concentration of the endophytic bacterial samples was calculated based on the iaa standard curve. iaa standard curve was made to obtain an equation (value x) for calculating the iaa concentration from the bacterial isolate supernatant. the iaa concentration value obtained is expressed in ppm units. figure 2 is the standard iaa curve that has been made, and the linear regression value is 0.9973. based on table 1, it can be seen that the levels of iaa hormone produced by the endophytic bacteria from the mangroves at kutang beach varied greatly at 24 hours incubation time. the highest levels of iaa were produced by isolates coded lmg 15 at 9.3 ppm. and based on the results of the anova test, the types of isolates have no significant effect on the concentration of iaa produced. however, the isolate with the code lmg 15 was identified as the best isolate because it was able to produce iaa with the highest concentration at 24 hours of incubation. it is possible that the bacteria were in a stationary phase, and thus the iaa produced was high. ramadhani et al. (2020) report that bacteria with the highest concentration of iaa at a certain incubation period indicated that bacteria were in the stationary phase. the difference in the concentration of iaa produced by bacteria is also influenced by the metabolic ability of each bacterium in utilizing media containing tryptophan. tryptophan is an amino acid that functions as a precursor in the biosynthesis of iaa in plants and microorganisms (patil, 2011). in general, iaa biosynthetic pathways are divided into two groups, trp-independent and trp-dependent. in the trp-independent pathway, bacteria do not use tryptophan as a precursor but instead use indole-3-glycerol phosphate (igp). however, the intermediate pathway and the genes involved in trp-independent are still not defined. meanwhile, in trp-dependent pathway, there are five biosynthetic pathways in bacteria. they are indole-3-acetamide (iam), indole-3-pyruvic acid (ipa), tryptamine (tra), tryptophan side-chain oxidase, and indole-3-acetonitrile (ian), with ipa, iam, and ian become the main biosynthetic pathways of iaa in bacteria. in general, the bacteria capable of synthesizing iaa are plant growth promoting bacteria (pgpb) such as rhizobium, bradyrhizobium, bukholderia, azotobacter, acinetobacter, bacillus, and paenibacillus polymixy (ahemad et al., 2014). acuna et al. (2011) report that paenibacillus sp. and bacillus sp. are able to produce iaa with low concentrations (1.4-1.9 ppm) in a medium that does not contain tryptophan. the range of iaa concentrations produced by endophytic bacteria to increase plant growth varies greatly, from low to high concentrations. bacteria that produce high concentrations of iaa can increase the growth and yield of wheat (khalid et al., 2004). bacteria that produce constant low concentrations of iaa can also increase plant growth (tsavkelova et al., 2007). this is in accordance with astriani et al. (2016) who reports that the rhizobacteria bacillus thuringiensis producing an iaa of 3.99 ppm is capable of promoting root elongation in oil palm seeds. lwin et al. (2012) report that bacillus sp. with an iaa range from 53.1 ppm to an optimal 71.1 ppm is capable of spurring soybean growth. wahyudi et al. (2011) add that bacillus sp. with an iaa concentration of 15.2 ppm was able to increase the growth of shoots, primary roots, and lateral roots. macroscopic and microscopic characterization of endophytic bacteria isolates twelve isolates that have the potential to produce iaa hormone were characterized macroscopically and microscopically. the macroscopic characterizations observed include color, shape, elevation, edge, and consistency of endophytic bacterial colonies on nutrient agar (na) media. while the microscopic characterization observed include cell shape and gram staining using a 1000x magnification microscope. figure 3 and figure 4 show the colony and cell morphology of 12 potential iaa hormone-producing bacteria isolates. meanwhile, macroscopic and microscopic characteristics of endophytic bacteria from the mangroves at kutang beach are presented in table 2. jurnal riset biologi dan aplikasinya, 4(1): 1-8, march 2022 | 47 figure 3. colony morphology of endophytic bacteria isolates; a: lmg-7; b: lmg-15, c: lmg-31; d: lmg-32; e: lmg-43; f: lmg-53; g: lmg-54; h: lmg-55; i: lmg-56; j: lmg-57; k: lmg-62; l: lmg-63 figure 4 . cell morphology of endophytic bacteria isolates; a: lmg-7; b: lmg-15, c: lmg-31; d: lmg-32; e: lmg-43; f: lmg-53; g: lmg-54; h: lmg-55; i: lmg-56; j: lmg-57; k: lmg-62; l: lmg-63 figure 5. results of electrophoresis of the dna pcr product of lmg 15 isolate with universal primers (m=dna marker, 1 kb; pcr product of 16s rrna gene of lmg-15 1.5 kb m s 2 48|fatimah., ability test of iaa (indole-3-acetic acid) hormone-producing endophytic table 2. macroscopic and microscopic characteristics of iaa hormone-producing endophytic bacteria codes colour shape edge elevation cell lenght cell shape, gram stain lmg 7 white irreguler entire convex 2.5 bacile, positive lmg 15 white irreguler entire raised 1.5 bacile, positive lmg 31 white irreguler undulate raised 2.5 bacile, positive lmg 32 white irreguler curled raised 2.0 bacile, positive lmg 43 white circular entire raised 3.0 bacile, positive lmg 53 white circular entire raised 2.0 bacile, positive lmg54 white circular entire flat 2.0 bacile, positive lmg 55 white irreguler undulate raised 2.0 bacile, positive lmg 56 white circular curled flat 2.0 bacile, positive lmg 57 white irreguler rhizoid flat 2.0 bacile, positive lmg 62 white filamentou s filiform flat 2.5 bacile, positive lmg 63 white irreguler curled flat 3.0 bacile, positive table 3. bacterial strains based on the ncbi database of lmg 15 isolate sequences based on the macroscopic characterization, 12 isolates of endophytic bacteria that produced iaa had varied shape, elevation, and colony edges. meanwhile, based on microscopic characterization, it was found that the 12 isolates of endophytic bacteria that produced iaa were gram-positive bacteria in the form of bacilli with bacterial cell lengths ranging from 1.5 µm to 3 µm. several studies that have been conducted regarding the isolation and characterization of endophytic bacteria have shown that endophytic bacteria can be either gram-positive or gram-negative in various forms (suhandono et al., 2016; ying et al., 2016). according to idris et al. (2007), iaa synthesization of gram-negative bacteria are highly dependent on tryptophan as important intermediates through indole-3-pyruvic acid (ipa), indole-3-acetamide (iam), and indole-3-acetonitrile (ian). meanwhile, gram-positive bacteria do not depend on the presence of external tryptophan to produce iaa and can synthesize iaa in various ways, but the main route is still the ipa pathway (vandeputte et al., 2005; idris et al., 2007). identification of bacteria species using 16s rrna gene based on the ability to produce iaa hormone, it was found that isolate with the most potential to produce iaa hormone was lmg 15. lmg 15 was identified using a molecular marker of the 16s rrna gene. the dna sample isolation process was carried out using the wizard genomic dna purification kit (promega). the results of dna isolation through confirmation with a microdrop spectrophotometer showed a purity level of 1.9, which indicated good dna purity of lmg 15. confirmation of dna isolation is significant to determine whether the sample will be used in the next stage. the samples were then sent to 1st base pt. genetics science in the form of dna amplicons for sequencing. the results of dna amplification of endophytic bacteria with the most potential for producing iaa hormones using universal primers 27f (5' – aga gtt tga tcm tgg ctc ag – 3') and 1492r (5' –cgg tta cct tgt tac gac tt–3') were observed through electrophoresis indicating that the dna bands are parallel to the marker. the results of electrophoresis of the dna pcr product of lmg 15 isolate with universal primers can be seen in figure 5. strain species access code max values query cover (%) e-value percent identification (%) notes bacillus cereus iam 12605 nr115526.1 1079 46 0.0 99.33 partial sequence jurnal riset biologi dan aplikasinya, 4(1): 1-8, march 2022 | 49 furthermore, the obtained sequences were compared with the nucleotide sequences contained in the ncbi database through the blast program to determine the level of similarity between the sequences of the lmg 15 isolate and the sequences contained in the database. one bacterial strain with the highest value, query cover, percent identification, and the lowest e-value with isolate lmg 15 is presented in table 3. from the data obtained, it is known that the lmg 15 value has the highest similarity with bacillus cereus strain iam 12605 (percent identification value 99.33% and query cover 46%). the query cover value indicates the percentage of 16s rrna gene sequences in the sample isolate that were successfully aligned with the gene sequences contained in the ncbi database. meanwhile, the equations of the two sequences are expressed in percent identification (ncbi news, 2006/7). in this study, the contig results obtained are around 1272 bp. according to janda and abbott (2007), the ideal sequence for microbial identification is around 1300-1500 bp. lmg 15 was the isolate that produced the highest concentration of iaa (9.3 ppm). the isolate was then identified based on the 16s rrna gene sequence. the 16s rrna gene sequence analyzed in this study was the result of pcr amplicon sequencing from lmg 15 dna using primers 27f (5' – agagtttgatcmtggctcag – 3') and 1492r (5' – cggttaccttgttacgactt – 3'). the obtained sequence is compared to the nucleotide sequences contained in the ncbi database through the blast program to determine the level of similarity of the lmg 15 sequences to the sequences contained in the database. it is expected that the lmg 15 isolate coded as bacillus cereus strain lmg 15 can be used as one of the constituents for biofertilizer formulas as an alternative way in overcoming problems caused by the use of chemical fertilizers. conclusion there were 12 isolates of endophytic bacteria from the lamongan mangrove plant that produced the hormone iaa with concentrations ranging from 2-9,3 ppm. based on macroscopic characterization, potential iaa-producing endophytic bacteria isolates had varied shapes, elevations, and colony edges. meanwhile, based on microscopic characterization, potential iaa-producing endophytic bacteria isolates were gram-positive bacteria in the form of bacilli with bacterial cell lengths ranging from 1.5 µm-3 µm. based on16s rrna gene-analysis, lmg 15 isolate was identified as bacillus cereus strain lmg 15, having a similarity of 99.33% to bacillus cereus strain iam 12605. acknowledgment the authors would like to thank the faculty of science and technology universitas airlangga for funding the research through the “puf 2021” scheme. references acuna, j. j. jorquera, m. a. martinez, o. a. menezesblackbum, d. greiner, p. dan mora, m. l. (2011). indole acetic acid and phytase activity produced by rhizosphere bacilli as affected by ph and metals. journal soil science plant nutrition, 3 (11), 1-12. http://dx.doi.org/10.4067/s071895162011000300001 ahemad, munees dan mulugeta, k. (2014). mechanism and application of plant growth promoting rhizobacteria: current perpective. journal of king saud universityscience, 26, 1-20. https://doi.org/10.1016/j.jksus.2013.05.001 apine, o. a. and j.p. jadhav, 2011. optimization of medium for indole-3-acetic acid production using pantoea agglomerans strain pvm. j. appl. microbiol, 110(5), 1235–1244. duca, d., j. lorv, c. l. patten, d. rose and b.r. glick, 2014. indole-3-acetic acid in plant – microbe interactions. antonie van leeuwenhoek, 106, 85–125. herdiyanto, d. dan setiawan, a. (2015). upaya peningkatan kualitas tanah melalui sosialisasi pupuk hayati, pupuk organik, dan olah tanah konservasi di desa sukamanah dan desa nanggerang kecamatan cigalontang kabupaten tasikmalaya. dharmakarya jurnal aplikasi ipteks untuk masyarakat, 4(1), 47-53. 10.24198/dharmakarya. v4i2.10028 idris, e. e. iglesias, d. j. talon, m. dan borris, r. (2007). tryptophan-dependent production of indole-3-acetic acid (iaa) affects level of plant growth promotion by bacillus amyloliquefaciens fzb24. molecular plantmicrobe interactions, 20(6), 619-626. doi:10.1094/mpmi-20-6-0619 irawan, bambang. fatimah. intan, a. p. moch, affandi. ketut, w. lilik, b.p. dan thin, s. (2019). development of mangrove healthy condition (mhc) index based on their symbiotic organisms. ecology, enviroment and conservation. 2019 (pp. s37-s42). link url. https://www2.scopus.com/inward/record.uri?eid=2 -s2.085070670260&partnerid=40&md5=ddce70f68ddbdf d822748f3a85c7a341. janda, j. m. dan abbott, s. l. (2007). 16s rrna gene sequencing for bacterial identification in the diagnostic laboratory: pluses, perils, and pitfalls. journal of clinical microbiology, 45(9), 2761-2764. kartikawati, a. trisilawati, o. dan darwati, i. (2017). pemanfaatan pupuk hayati (biofertilizer) pada tanaman rempah dan obat/biofertilizer utilization on spices and medicinal plants, perspektif, 16(1), 3343. http://dx.doi.org/10.21082/psp.v16n1.2017.3343 http://dx.doi.org/10.21082/psp.v16n1.2017.33-43 http://dx.doi.org/10.21082/psp.v16n1.2017.33-43 50|fatimah., ability test of iaa (indole-3-acetic acid) hormone-producing endophytic kearse, m. moir, r. wilson, a. stones-havas, a. cheung, m. sturrock, s. buxton, s. cooper, a. markowitz, s. duran, c. thiere, t. ashton, b. meintjes, p. dan drummond, a. 2012. geneious basic: an integrated and extendable dekstop software platform for the organization and analysis of sequence data. bioinformatics aplication note, 28(12), 1647-1649. doi: 10.1093/bioinformatics/bts199 khalid, a. arshad, m. dan zahir, z.a. (2004). screening plant growth-promoting rhizobacteria for improving growth and yield of wheat. journal of applied microbiology, 96, 473-480. 10.1046/j.13652672.2003. 02161.x liu, h., l.c. carvalhais, m. crawford, e. singh, p.g. dennis, c. m. pieterse and schenk, p. m., 2017. inner plant values: diversity, colonization and benefits from endophytic bacteria. front. microbiol, 8 , 2552. lwin, k.m. moe, m.m. tar, t. dan aung, z.m. (2012). isolation of plant hormone indole-3-acetic acid producing rhizobacteria and study on their effects on maize seedling. engineering journal, 16(5), 138-144. https://doi.org/10.4186/ej.2012.16.5.137 ncbi news. (2006/7). new database and view options for nucleotide blast services. 15(2). diakses melalui https://www.ncbi.nlm.nih.gov/web/newsltr/v15n 2/blview.html pada tanggal 22 mei 2021. patil, v. (2011). production of indole acetic acid by azotobacter sp, recent research science and technology. 3(12), 14-16. link url: https://updatepublishing.com/journal/index.php/rr st/article/view/839 patten, c.l. dan glick, b.r. (2002). role of pseudomonas putida indole acetic acid in development of the host plant root system, applied and environmental microbiology, 68(8), 3795-3801. 10.1128/aem.68.8.3795-3801.2002 radji m. (2005). peranan bioteknologi dan mikroba endofit dalam pengembangan obat herbal. majalah ilmu kefarmasian, 2: 113-126, 10.7454/psr. v2i3.3388 ramadhani, s. i. sitoresmi, s. p. agung, a. w. rina, r. t. s. dan achmad, a. r. (2020). quantitative assay of indole acetic acid-producing bacteria isolated from several lakes in east java, indonesia. biodiverstitas journal of biological diversity, 21(11), 54485454. https://doi.org/10.13057/biodiv/d211153 sergeeva, e., a. liaimer and bergman. (2002). evidence for production of the phytohormone indole-3-acetic acid by cyanobacteria. planta, 215(2), 229–238. suhandono, s. kusumawardhani, m. k. dan aditiawati, p. (2016). isolation and molecular identification of endophytic bacteria from rambutan fruit (nephelium lappaceum l.) cultivar binjai. hayati journal of bioscience, 23: 39-44. tsavkelova, e. a. cherdyntseva, t. a. klimova, s. y. shestakov, a. i. botina, s. g. dan netrusov, a. i. (2007). orchid-associated bacteria produce indole-3acetic acid, promote seed germination, and increase their microbial yield in response to exogenous auxin. j arch microbiol, 188(6), 655-664. 10.1007/s00203007-0286-x vandeputte, o. oden, s. mol, a. vereecke, d. goethals, k. el jaziri, m. dan prinsen, e. (2005). biosynthesis of auxin by the gram-positive phytopathogen rhodococcus fascians is controlled by compounds specific to infected plant tissues. applied and environmental microbiology, 71(3), 1169-1177. 10.1128/aem.71.3.1169-1177.2005 wahyudi, a.t. astuti, r.p. widyawati, a. meryandini, a. nawangsih, a.a. (2011). characterization of bacillus sp. strains isolated from rhizosfere of soybean plants for their use as potential plant growth for promoting rhizobacteria. journal of microbiology and antimicrobials, 3, 34-40. link https://www.internationalscholarsjournals.com/arti cles/characterization-of-bacillus-sp-strains-isolatedfrom-rhizosphere-of-soybean-plants-for-their-use-aspotential-plant-gro.pdf white, j. f., k.l. kingsley, q. zhang, r.verma, n. obi, s. dvinskikh, m.t. elmore, s.k. verma, s. k. gond and kowalski, k. p., 2019. review: endophytic microbes and their potential applications in crop management. pest manag. sci, 75(10), 2558–2565. ying, w. cheng-de, y. yu-ling, y. yu-qin, w. zhen-fen, z. dan li-x. (2016). the diversity and potential function of endophytic bacteria isolated from kobreasia capillifolia at alpine grasslands on the tibetan plateau, china. journal of integrative agriculture, 15(9), 2153-2162. 10.1016/s20953119(15)61248-5g. https://www.ncbi.nlm.nih.gov/web/newsltr/v15n2/blview.html https://www.ncbi.nlm.nih.gov/web/newsltr/v15n2/blview.html jurnal riset biologi dan aplikasinya, volume 5, issue 1, march 2023 diversity of moss species (bryophyta) in senggani ravine tourism area, tulungagung regency desi kartikasari*, gading anon widodo, nur habibah, rakhmi zahratul asna uin sayyid ali rahmatullah jln. mayor sujadi no.46, kudusan, plosokandang, kedungwaru, tulungagung regency, east java, 66221, indonesia *corresponding author e-mail: desi.kartikasari88@gmail.com article history abstract received : 18 november 2023 moss plants (bryophyta) are found in every habitat, and their presence in an ecosystem is controlled by environmental circumstances. the senggani ravine tourism area is a popular tourist attraction comprising a pine forest with extensive moss communities. this work aimed to assess the diversity of mosses (bryophyta) in the senggani ravine tourism area for the first time. in june 2022, exploratory descriptive research of moss diversity was undertaken by a free walk around the senggani ravine tourism area from a predetermined position point (purposive sampling) using observation, documentation, literature study, and measurement of abiotic elements for data collection. based on the results, twenty species of mosses were identified and can be divided into four classes, namely the bryopsida, polytrichopsida, jungermanniopsida, and marchantiopsida. the species identified were barbulla indica, fissidens purpusillus, fissidens biformis, fissidens biformis, octoblepharum albidum, rhizonium punctatum, mnium hornum, philonotis marchica, fontinalis antipyretica, hypnum cupressiform, polytrichastrum formosum, lejeunea flava, lejeunea cavifolia, bazzania prareupta, bazzania vittata, riccia junghuhniana, marchantia emarginata, marchantia polymorpha, dumortiera hirsuta, and lunularia cruciate. abiotic factor measurements revealed that zone 3, which has a soil ph of 6, an air temperature of 24.1 c°, an 84% humidity level, and 200 cd of light cm-1, is the most favorable area for moss growth. we can infer that the senggani ravine tourism area is still primarily undisturbed because the moss flora is still quite diverse and varied. revised : 4 february 2023 accepted : 12 march 2023 published : 31 march 2023 keywords biodiversity assessment; bryophytes; indonesia; plant taxonomy how to cite: kartikasari, d., widodo, g.a., habib, n., & asna, r.z. (2023). diversity of moss species (bryophyta) in senggani ravine tourism area, tulungagung regency. jurnal riset biologi dan aplikasinya, 5(1):43-51. doi: 10.26740/jrba. v5n1.p.43-51. introduction senggani ravine is a tourist destination in nglurup village, sendang district, tulungagung regency. known for its campgrounds and home to a magnificent pine forest, it is a popular tourist attraction. it features a cool and humid microclimate and has fertile soil. the predominance of dense and gloomy trees, as well as grass and other vegetation indicates that these environmental circumstances enable the establishment of various species like mosses (effendi et al., 2018). mosses (bryophyta) are a group of plants with 15,000 species, the second largest after the flowering plants that dominate the indonesian mainland. the presence of mosses in an ecosystem is influenced by environmental circumstances. mosses grow in every habitat. they are able to live and grow on a variety of surfaces, including soil, rocks, sand, litter, tree trunks, and even water. numerous abiotic elements can affect the growth of mosses (mulyani et al., 2015). according to bawaihaty et al. (2014), environmental circumstances such as temperature, humidity, light, altitude, climate, and availability of nutrients have a significant impact on the population and variety of mosses within an ecosystem. the growth of mosses exerts positive effects on the local ecosystem, particularly for other plants. using rock mineralization, decomposition, and carbon fixation, mosses have the potential to balance the nutrient content of the soil (lukitasari, 2018). according to perwati et al. (2015), mosses jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi mailto:desi.kartikasari88@gmail.com https://doi.org/10.26740/jrba.v5n1.p43-51 https://doi.org/10.26740/jrba.v5n1.p43-51 jurnal riset biologi dan aplikasinya, 5(1): 43-51, march 2023| 44 play a significant role in tropical forest areas, particularly in highland regions. in addition to serving as a home for other organisms, moss plants also serve as groundwater balancers, oxygen suppliers, nutrient cycle inhibitors, ornamental plants, medicinals, and are able to detect pollution levels or environmental changes. research on the variety of mosses in the senggani ravine tourism area, is conducted due to their significant ecological function and to address the lack of existing studies on mosses in the region. this reseach aimed to assess the diversity of mosses (bryophyta) in the senggani ravine tourism area. by doing this research, it is anticipated to reveal more about the variety of mosses there and their ecological advantages. materials and methods location and time of observation the research was carried out in the senggani gorge region, nglurup village, sendang district, tulungagung regency in june 2022. senggani ravine is a region in the highlands that is about 800 m above sea level, has an average temperature of 25.6 c°, and 82.3% relative humidity. sampling involved in situ research through direct observations by researchers in their natural environments (moelong, 2017). this research employed a descriptive exploratory strategy with cruising approaches (sundra, 2016). by using three specified observation points (purposive sampling) as a reference for the observation area that can be shown on a map, researchers used free roaming (cruising method) to directly explore the senggani ravine tourism area (figure 1). figure 1. the senggani ravine tourism area, nglurup village, sendang district, tulungagung regency are all included on a map of the research locations 45|kartikasari et al., diversity of moss species (bryophyta) in senggani ravine tourism area zone i is at the coordinate point (s 07°54'57.19" e 111°49'34.05"), zone ii is at the coordinate point (s 07°54'53.44" e 111°49'33.80"), and zone iii is at the coordinate point (s 07°54'57.00" e 111°49'31.88"). this research was not focused on establishing a particular hypothesis but limited to descriptions being observed using tools for gathering observation data, documentation, and literature studies (arikunto, 2002). a realme 3 android camera and a nikon 25 mm prosumer macro lens, as well as writing supplies and books for identifying mosses, were used in the investigation. references such as lukitasari (2016; 2018) and additional sources including articles, journals, and books were consulted. instruments for measuring abiotic factors were employed (anemometer, gps etrex30x, az 885 infrared psychrometer, three way soil meter, and ma-30 military altimeter ex 284). following collection, the specimens were identified and given a descriptive analysis based on their traits and abiotic components. results and discussion moss species diversity (bryophyta) the research identified 20 species of mosses (bryophyta) that are native of senggani ravine tourist area. a total of 20 species were collected, classified into 15 moss plant families comprising 11 moss/leaf moss species (bryophyta) and 9 liverwort species (marchantiophyta) (table 1). according to field observations, zone iii exhibited up to 13 more species than zones i or ii combined, which is the highest level of species diversity. moss plants can grow on a wide range of surfaces, including soil, rocks, tree roots, tree trunks, weathered logs, and cliffs edge. the mosses that dominated the senggani ravine tourism area belonged to the bryophyta division (leaf/true mosses) (table 1) which is the group of moss plants with the highest number of species in the world when compared to other moss groups, which is estimated at 12,000 species (mulyani et al., 2015). according to research by goffinet et al. (2008), the bryopsida class, which encompasses 95% of the moss species globally, is the biggest group of mosses. true mosses with leaves (bryophyta) are classified as having a greater level of development than other forms of mosses, in which stems can already be distinguished from leaves. when compared to earlier studies on mosses, such as those carried out at peucari bueng jantho waterfall, aceh besar district by raihan et al. (2018), a relatively high diversity of moss species was observed by azwir et al. (2022) in the forest of mesjid raya district, aceh besar district, and by endang (2020) along the kaburan-burana river basin, batauga district, south buton regency, but further study is needed. other studies were also undertaken in the vicinity of mount ungaran by mulyani et al. (2015), and on mount prau, blumah, central java region by linah et al. (2021). some of these variations in yield may be the consequence of various and unique environmental factors impacting upon the capacity of certain moss species to develop and adapt. furthermore, human actions such as land clearing those results in increased light intensity in the moss habitat, as well as other environmental degradation, might alter the variety of moss species in certain areas (liannah et al., 2021). figure 3 illustrates the variations between the properties of mosses belonging to the bryophyta (true mosses) group. bryophyta, or true mosses, typically consist of entire plant-like structures (roots/rhizoids, leaves, and stems). on the stems of moss, which have upright, spirally arranged leaves, buds grow for reproduction. leaf/true mosses are able to grow on soil, grass, rock, tree trunks, and roots. andreaeales, sphagnales, and bryales are the three orders that comprise the group of true mosses (mosses) (lukitasari, 2018). barbula indica barbula indica has a height of 5-15 mm, smooth brown rhizomes, stems erect and occasionally branched, dark brown to reddish brown. lanceolate leaves, grow upright on the stem, when dry the leaves will turn brown. the arrangement of the leaves is alternate, dense so that it looks stacked on top of each other, with small toothed leaf margins, leaf tips rounded, large costa ending at the leaf tip. setae erect, occasionally bent, measuring 1 cm or more, capsules are round, cylindrical, measuring 1.5 mm and have an elongated capsule cover. this type of moss is found growing in groups, dense and growing upright on calcareous soil with open environmental conditions. eddy (1998) argues that barbula indica is a small, green or yellowish plant with a height of more than 1 cm. stem simple or branched. leaves narrow, apex (leaf tip) rounded, often emarginated (heart-shaped). setae short, spherical cylindrical capsule, up to 1.5 mm long, narrowly conical capsule cover. it grows on rocks, soil and walls, especially in damp and calcareous places. fissidens perpusillus this plant has a flat form, shoots that grow vertically, varying body sizes, a yellowish-green hue, and a filoid fingered, pointy tip (ristanto et al., 2021). the stems are so short and concealed by jurnal riset biologi dan aplikasinya, 5(1): 43-51, march 2023| 46 leaves that they appear to be nonexistent. the stems are short and completely covered by leaves. on the stem, the leaves are organized in two rows, are lanceolate, have flat, small-toothed margins, and are pointy at the tip/base. fissidens perpusillus develops in clusters and spreads on moist and damp rock surfaces (endang et al., 2020). fessidens biformis belongs to the fissidentaceae group. almost often found growing on rock substrate. it has a leaf morphology that is wide, upright and clustered, the tips are pointed, finger-like and stacked in a row, has a short stalk that is not visible, capsules and setae are about 1 cm long (febrianti, 2015). fessidens astroviridis fissidens astroviridis is commonly found in soil substrates but is also found in rocks. this moss has a dull green color and looks comb-shaped when viewed from above (febrianti, 2015). the individual size of f. atroviridis reaches 5 mm. the leaves are lanceolate with a pointed tip (raihan et al., 2018). leaf anatomy has a size of 1 µm with an irregular rectangular shape. the stem is almost invisible because it is covered with a collection of thread-like leaves and rhizoids. environmental conditions have a significant influence on moss. differences of each species of mosses to environmental factors will affect the level of adaptation, species composition, and distribution of mosses (pasaribu, 2013). octoblepharum albidum the leaves ranged in color from pale green to white, have an elongated, pointed form, and are thick. the sporophyte of o. albidum is readily discernible. the top of the sporangium is known as the spore box. it forms colonies and adheres to the stem of pine trees and is found in both wet and dry forests. therefore, the senggani ravine tourism area is an ideal habitat for o. albidum because it is shady and cool. rhizonium punctatum the oval leaves of this plant, which frequently grow next to one another, shrink when dry. r. punctatum has dark red stems that eventually turn reddish-brown as they mature. green protonematous rhizoids specialize in asexual reproduction. this species inhabits dark, moist, and damp soil and rocks (tomovic et al., 2021). table 1. list of the bryophytes (mosses) that can be found in senggani gorge no. scientific name family substrate location zone 1 zone ii zone iii leaf moss (bryophyta) 1 barbulla indica pottiaceae soil, rocks + 2 fissidens purpusillus fissidentaceae rocks + 3 fissidens biformis fissidentaceae tree trunks + 4 fissidens astroviridis fissidentaceae soil + + + 5 octoblepharum albidum leucophanaceae soil, tree trunk + + 6 rhizonium punctatum mniaceae soil, rocks + + 7 mnium hornum mniaceae soil + 8 philonotis marchica bartramiaceae soil + + 9 fontinalis antipyretica fontinalaceae soil + 10 hypnum cupressiforme hypnaceae soil, rocks + + + 11 polytrichastrum formosum polytrichaceae soil + liver moss (marchantiophyta) 1 lejeunea flava lejeuneaceae soil, roots, rocks + 2 lejeunea cavifolia lejeuneaceae soil, roots, rocks + 3 bazzania prareupta lepidoziaceae soil, weathered wood + 4 bazzania vittata lepidoziaceae soil, weathered wood + + + 5 riccia junghuhniana ricciaceae soil + 6 marchantia emarginata marchantiaceae soil + 7 marchantia polymorpha marchantiaceae soil + + 8 dumortiera hirsuta dumortieraceae soil, rocks + + 9 lunularia cruciata lunulariaceae rocks + 47|kartikasari et al., diversity of moss species (bryophyta) in senggani ravine tourism area figure 3. leaf mosses (bryophyta) were found in the senggani ravine tourism area. a. barbulla indica b. fissidens purpusillus c. fissidens biformis, d. octoblepharum albidum, e. rhizonium punctatum, f. mnium stellare, g. mnium hornum, h. philonotis marchica, i. fontinalis antipyretica, j. hypnum cupressiforme, k. polytrichastrum formosum mnium hornum the leaves of mnium hornum are distinctively golden green in color, slightly elongated, and have a pointed leaf tip. this moss species thrives on moist and humid soil (marom et al., 2017). philonotis marchica the spores of philonotis marchica are round. the leaves are green, weeny, serrated, and arranged along the stems. the cells of the leaf blades appear to be wider near the base. it can survive on moist and damp soil surfaces. fontinalis antipyretica it can grow transversely branched and reach up to 60 cm in length. its leaves are oval, slightly stiff, and arranged in an overlapping pattern. there are tiny spores on this moss plant at the time of collection. this huge moss can be seen growing on damp, wet rocks and soil (lukitasari, 2018). hypnum cupressiforme hypnum cupressiforme is a species of moss that may grow on damp surfaces of soil and rocks. its green leaves are long, curled, and have pointed tips. because the leaves grow densely on the stem's surface, the stem is almost completely covered by a b h c d g f e i k j a jurnal riset biologi dan aplikasinya, 5(1): 43-51, march 2023| 48 the leaves. the branches are irregularly pinnate and the branches either spread or ascendant. polytrichastrum formosum polytrichastrum formosum is a medium-sized plant with tall and unbranched main stems. the leaves bloom like flowers and become dull when dry. on the leaf surface, tall lamellae cells can be detected. this species can be found on moist and damp soil surfaces as well as flooded soil surfaces (asthana et al., 2012). liveworts (marchantiophyta) figure 4 depicts the species of liverworts (marchantiophyta) discovered in several zones of the research area, with apparent variances in their characteristics. liverworts are distinguished from other mosses by the presence of a thallus connected to the substrate and leaves made up of lined and thickened cells. the genital organs of liverworts are usually found on the surface and are protected by a unicellular root structure (lukitasari, 2018). lejeunea flava lejeunea flava features a small and pale green circular thallus, varied leaf sizes between large (lobes) and small (lobules), and flat and blunt edges. small trunk, dense, creeping, and branching growth. the branching, however, is almost unnoticeable since it is covered with an incubous leaf arrangement (lower leaves covering the top leaves) or overlaps. l. flava colonizes soil, trees, and rock substrates (angeles et al., 2020). lejeunea cavifolia the trunk of lejeuna cavifolia is dense, flat, and interwined with soil, bark, roots, and pebbles. it has a small thallus that is spherical, smooth, and pale green. this moss's stem spreads over the substrate, usually with two uneven branches, the edges are flat and blunt, the lower leaves covering the higher leaves or overlap each other, and it is divided between large leaves (lobes) and little leaves (lobule). l. cavifolia grows on rotten wood, roots, rocks, and soil in shaded and moist areas (putna and mezaka, 2014). bazzania prareupta the leaves of bazzania prareupta are almost square in shape, green in color, flat at the basal borders, and rounded at the ends with a slightly curved inward center. the leaves are succubous (two upper covering the lower leaf), have cilia (tapering at the tip of the leaf), and have amphigastria. it has a small stem that is covered with leaves, of the frullania branching type, and is linked to soil and worn wood surfaces (lestari and ariyanti, 2017). bazzania vittata bazzania vittata has a little green stem with a trunk branch that looks like a frulllania or is formed like a fork but is short and unusual. the leaves are closely packed, neighboring leaves overlap, the base of the leaf is flat, the ventral leaf is attached, the leaf edge is flat, and the top of the leaf is 2-3 serrated, blunt, and rough. the ventral leaves are closely spaced, circular to the square in form, and have thin walls. b. vittata is frequently found clinging to soil substrates and worn wood (lestari and ariyanti, 2017). riccia junghuhniana riccia junghuhniana nees & lindenb belongs to the ricciaceae family. riccia junghuhniana is a liverwort that grows on the surface of the substrate like on the ground. r. junghuhniana has a thalus that is flush with the substrate, has midribs on the dorsal side of the thalus. thalus branched dichotomous, light green and shiny. live in groups by forming floral or circular patterns. when it has dried the thallus is yellowish in color (lianah, et al., 2021). marchantia emarginata marchantia emarginata has a branched and stiff thallus that is dark green and leafless. it has a smooth surface, no midrib/midrib spreads across the soil surface, and when it is dried, the edges turn brown. the ribbon-like leaves of m. emarginata are distinguished by forked, fleshy branches and the presence of brood buds, despite the absence of a petiole on the stem. the thallus and the root are the only components of the gametophyte structure. roots (rhizoids) aid in the attachment of the thallus to the substrate and are typically grouped in clusters (wen and huang, 2017). marchantia polymorpha marchantia polymorpha has a green thallus, no leaves, and grows creeping on the ground. the upper thallus has a hexagonal pattern, the tip and base of the thallus are blunt, porous, black striped, and has a thick stiff texture on the thallus (febriansah et al., 2019). there is a gemmae cup, which is used for vegetative reproduction, and spores are used for generative reproduction. the archegonial stem is brownish green, and the archegoniophore is green, lobe-shaped like an umbrella. it has many roots (rhizoids) that aid in adhering to the soil surface (sholihat and kurnia, 2021). dumortiera hirsuta dumortiera hirsuta is a dark green ribbon-shaped plant with dichotomous branches. the thallus has a blunt, rounded tip with a v-shaped indentation in 49|kartikasari et al., diversity of moss species (bryophyta) in senggani ravine tourism area the middle, a spore cup, and flat margins. the surface is slick and striped in a white hexagonal pattern, and there a few downy hairs. similar to other forms of mosses, it uses rhizoid (roots) to adhere to the substrate. the substrate of d. hirsuta consists of soil and rocks (karomah et al., 2020). figure 4. liverworts (marchantiophyta) spotted in the senggani gorge's tourism zone. a. lejeunea flava, b. lejeunea cavifolia, c. bazzania prareupta, d. bazzania vittata, e. riccia junghuhniana, f. marchantia emarginata, g. marchantia polymorpha, h. dumortiera hirsuta, and i. lunularia cruciate table 2. each zone's moss plant abiotic environmental conditions parameters location zone i zone ii zone iii air temperature (c°) 27.4 25.4 24.1 humidity (%) 80 83 84 light intensity (cd) 500 250 200 altitude of the place (m a.s.l) 815 818 838 soil moisture (%) 6 7 7 soil ph 7 7 6 wind speed (m/s) 1.7 1.2 2.0 environmental factors the environmental parameters affecting mosses in the tourism area of senggani ravine differ significantly in the three observation zones. however, in general, the climate in the senggani ravine is cold, humid, and chilly. consequently, based on the measurements of environmental abiotic parameters, it has been determined that the environmental conditions in the senggani gorge tourism area are compatible with the features of the moss plant's habitat and conducive to its reproduction. table 2 displays the abiotic environmental conditions of each moss zone. a b c d e f g h jurnal riset biologi dan aplikasinya, 5(1): 43-51, march 2023| 50 table 2 indicates that zone 3 has the highest altitude (838 m above sea level), is characterized by dense, shady trees, and has an air temperature of 24.1 c°. the air humidity is 84%, the light intensity is 200 cd, the soil wetness is 7, the soil ph is 6, and the wind speed is 2.0 m s-1. this substantially supports the habitat of moss plants where humidity and light intensity greatly affect the number of moss species, as proven by the fact that zone 3 is home to as many as 13 kinds of mosses. the intensity of sunlight has a significant effect on the air temperature and humidity, which in turn has a significant effect on the distribution of mosses. the less intense the sunshine, the greater the relative humidity and the lower the air temperature. the optimal air humidity for moss growth is between 70 and 98%, and soil ph has a significant impact on moss growth; moss thrives in the ph range of 4.9 to 8.3. (wati, et al., 2016). conclusion based on the outcome of the research, it can be inferred that the diversity of mosses (bryophyta) in the senggani ravine area is extremely diverse and varied, indicating that the area is still mostly undeveloped. there are 20 species of mosses (bryophyta) divided into four classes: bryopsida, polytrichopsida, jungermanniopsida, and marchantiopsida. zone 3 is a region that strongly favors moss habitat due to its height (838 m a.s.l), air temperature 24.1 c°, air humidity 84%, light intensity 200 candelas per square meter, and soil ph 6. as oxygen sources, water absorbers, pollutant absorbers, anti-erosion agents, aesthetic and medicinal plants, moss plants play a vital function in the environment. references angeles e. j. a., magat b. m., & jalandoni r. s. d. (2020). distribution of bryophytes in the university of the philippines diliman, quezon city, philippines. annals of plant sciences, 9 (8), 3957-3969. https://doi.org/10.5281/aps.2020.9.8.1. arikunto, s. (2002). metodologi penelitian sudatu pendekatan proposal. pt. rineka cipta. jakarta. asthana, a.k., sahu, v., & nath, v. (2012). polytrichastrum formosum (hedw.) g.l. smith in india. bryology laboratory, 33 (1), 87-90. https://doi.org/10.7872/cryb.v33.iss1.2012.087. azwir, maulida, jalaluddin., & saputra, s. (2022). inventarisasi keanekaragaman tumbuhan lumut (bryophyta) di hutan kecamata mesjid raya kabupaten aceh besar sebagai media pembelajaran biologi. jurnal biologi education, 10(1), 94-102. https://doi.org/10.32672/jbe.v10i1.4386. bawaihaty, n. i., & hilwan, i. (2014). keanekaragaman dan peran ekologi bryophyta di hutan sesaot lombok, nusa tenggara barat. jurnal silfikultur tropika, 5(1), 13-17. effendi, r., salsabila, h., & malik, a. (2018). pemahaman tentang lingkungan berkelanjutan. jurnal modul, 18(2), 75-82. https://doi.org/10.14710/mdl.18.2.2018.75-82. endang, t., jumiati., & pramesti, d. (2020). inventarisasi jenis-jenis lumut (bryophita) di kecamatan batauga kebupaten buton selatan. jurnal biologi tropis, 20(2), 161-172. https://doi.org/10.29303/jbt.v20i2.1807. febriansah, r., eni, s., & arbaul, f. (2019). identifikasi keanekaragaman marchantiophyta di kawasan air terjun parangkikis pagerwojo tulungagung. jurnal biologi dan pembelajarannya, 6(2), 17-21. https://doi.org/10.29407/jbp.v6i2.14795. febrianti, g.n. (2015). identifikasi tumbuhan lumut (bryophyta) di lingkungan universitas jember serta pemanfaatanya sebagai buku nonteks. skripsi. universitas jember, jember. (tidak diterbitkan). goffinet, b. (2008). bryophyte biology. cambridge university press. uk hugonnot, v., & celle, j. (2012). asexual reproduction by leaf fragmentation in mnium stelleare hedw. journal of bryology, 34 (1), 67-70. karomah, s. d., gurnita., & ibrahim, y. (2020). identifikasi jenis-jenis tumbuhan lumut hati (marchantiophyta) di hutan cagar alam situ patenggang. biosfer: j.bio. & pend.bio, 5(2), 21-25. https://doi.org/10.23969/biosfer.v5i2.3479. kirschner, r., nebel, m., & t. butterfass, t. (2010). observations on fertile populations of lunularia cruciata (l.) dumort. ex lindb. (marchantiopsida: lunulariaceae) in germany. stuttgarter beiträge zur naturkunde a. neue serie 3, 363–371. koponen, t., & higuchi, m. (2020). revision and checklist of philonotis (bartramiaceae, bryophyta) in pakistan, with the status of p. trachyphylla dixon & badhw. and note on mnium riparium mitt. (mniaceae). national museum of nature, 46 (2), 5564. https://doi.org/10.5735/085.057.0402. liannah, kusumawari, n., rochmah, f., orsida, f., mukhlisi, ahmad, m.u., & nadhifah, a. (2021). bryophyte diversity in mountain prau, blumah village, central java. jurnal biodjati, 6(1), 23-35. https://doi.org/10.15575/biodjati.v6i1.11693. lukitasari, m. (2016). mengenal tumbuhan lumut (bryophyta) deskripsi, klasifikasi, potensi dan cara mempelajarinya. magetan: cv. ae media grafika. lukitasari, m. (2018). mengenal tumbuhan lumut (bryophyta): deskripsi, klasifikasi, potensi dan cara mempelajarinya. magetan: cv. ae media grafika. lestari, r. w., & ariyanti, n. s. (2017). bazzania (marchantiophyta: lepidoziaceae) di taman nasional gunung leuser (sumatra). floribunda. 5(7), 227-238. marom, k., nasrulloh, s.q., zulaekhah, e., isa, a.k., dan firmansyah, m.a. (2017). keanekaragaman jenis lumut (bryophyta) di sekitar sumber air asin sendang jaka tawa banyurip grobogan. seminar nasional sains dan enttrepreneurship iv (prosiding). universitas pgri semarang. moelong, l.j. (2017). metode penelitian klualitatif. bandung: pt. remaja rosdakarya. mulyani, e., perwati, l. k. dan murningsih, m. (2015). lumut daun epifit di zona tropik kawasan gunung ungaran, jawa tengah. bioma: berkala https://doi.org/10.5281/aps.2020.9.8.1 https://doi.org/10.7872/cryb.v33.iss1.2012.087 https://doi.org/10.32672/jbe.v10i1.4386 https://doi.org/10.14710/mdl.18.2.2018.75-82 https://doi.org/10.29303/jbt.v20i2.1807 https://doi.org/10.29407/jbp.v6i2.14795 https://doi.org/10.23969/biosfer.v5i2.3479 https://doi.org/10.5735/085.057.0402 https://doi.org/10.15575/biodjati.v6i1.11693 51|kartikasari et al., diversity of moss species (bryophyta) in senggani ravine tourism area ilmiah biologi. 16(2), 76-82. https://doi.org/10.14710/bioma.16.2.76-82. nasuha, a., sari, d., & windarsih, g. (2021). identifikasi morfologi ceratodon dan leucobryum albidum di kawassan hutan kota serang, banten. tropical bioscience: journale of bilogical science, 1 (1), 11-20. https://doi.org/10.32678/tropicalbiosci.v1i1.4361. perwati, k. l., rahadian, r., & baskoro, k. (2015). perbandingan komposisi tumbuhan lumut epifit pada hutan alam, kebun kopi dan kebun teh di sepanjang gradien ketinggian gunung ungaran, jawa tengah. bioma: berkala ilmiah biologi, 17(2), 83-93. https://doi.org/10.14710/bioma.17.2.8393. raihan, c., nurasiah, & zahara, n. (2018). keanekaragaman tumbuhan lumut (bryophyta) di air terjun peucari bueng jantho kabupaten aceh besar. prosiding seminar nasional biotik (prosiding). prodi biologi ftk uin ar-raniry. ristanto, r.h., syahira, h.q., yuanisa, a.t., amalia, a., lianita, r., azzahra, a., & sigit, d.v. (2021). mosses at the bodogol natural conservation education center: species, diversity indeks, and evenness indeks. jpbio (jurnal pendidikan biologi), 6 (2), 220-230. https://doi.org/10.31932/jpbio.v6i2.1308. roziaty, e., agustina, p., & rohmah, s.n. (2019). inventory of epiphytic moss in the tree trunk zonation of jumog waterfall ngargoyoso tawangmangu karanganyar central java, indonesia. jurnal ilmiah biologi, 7 (2), 73-79. https://doi.org/10.24252/bio.v7i2.6336. rusidi, henri, dan santi, r. (2021). keanekaragaman jenis lumut (bryophyta) di bukit nenek taman wisata alam gunung permisan, kabupaten bangka selatan. jurnal biologi udayana, 25 (2), 137-146. pasaribu, n. 2013. studi pendahuluan lumut di lau kawar, kabupaten karo. [prosiding]. semirata fmipa universitas lampung. p.193-198 putna s., dan mezaka a. (2014). distribution of five interesting woodland key habitat bryophyte indicator species in latvia. acta biol. univ. daugavp, 14 (1), 67-74. https://www.researchgate.net/journal/actabiologica-universitatis-daugavpiliensis-14078953. solihat, s. s., & kurnia, m.f. (2021). identifikasi morfologi marchantia polymorpha dan leucobryum glaucum di bojong menteng, kecamatan cijeruk, kabupaten bogor, jawa barat. journal of biological science, 1 (1), 29-38. https://doi.org/10.32678/tropicalbiosci.v1i1.4360. sopacua g., tamaela k. a., sopratu p., & selehulano k. (2020). inventarisasi tumbuhan lumut di kawasan air potang-potang negeri itawaka kabupaten maluku tengah. jurnal ilmiah wahana pendidikan, 6 (4), 611-618. https://doi.org/10.5281/zenodo.4297891. sundra, i.k. (2016). metode dan tenik analisis flora dan fauna darat. biologi fmipa universitas udayana. denpasar. tomovic, g., sabovljevic, m.s., denchev, t.t., denchev, c.m., niketic, m., boycheva, p., ivanov, d., sabanovic, e., djordjevic, v., kutmar, l., stefanut, s., pantovic, j., grdovic, s., kuzmanovic, n., masic, e., & lazarevic, p. (2021). new records and noteworthy data of plants, algae and fungi in se europe and adjacent regions, 4. botanica serbica, 45 (1), 129-136. http://dx.doi.org/10.2298/botserb2201125s. wati, t.k., kiswardiana, b., & sulistyarsi, a. (2016). keanekaragaman hayati tanaman lumut (bryophyta) di hutan sekitar waduk kedung brubus kecamatan keceng kabupaten madiun. jurnal florea, 3(1), 46. http://ejournal.unipma.ac.id/index.php/jf/article/view/7 87. wen, l. y., & huang s. (2017). marchantia l. (marchantiaceae-marchantiophyta) in taiwan. taiwania, 62(1), 55‒62. https://doi.org/10.14710/bioma.16.2.76-82 https://doi.org/10.32678/tropicalbiosci.v1i1.4361 https://doi.org/10.14710/bioma.17.2.83-93 https://doi.org/10.14710/bioma.17.2.83-93 https://doi.org/10.31932/jpbio.v6i2.1308 https://doi.org/10.24252/bio.v7i2.6336 https://www.researchgate.net/journal/acta-biologica-universitatis-daugavpiliensis-1407-8953 https://www.researchgate.net/journal/acta-biologica-universitatis-daugavpiliensis-1407-8953 https://www.researchgate.net/journal/acta-biologica-universitatis-daugavpiliensis-1407-8953 https://doi.org/10.32678/tropicalbiosci.v1i1.4360 https://doi.org/10.5281/zenodo.4297891 http://dx.doi.org/10.2298/botserb2201125s http://e-journal.unipma.ac.id/index.php/jf/article/view/787 http://e-journal.unipma.ac.id/index.php/jf/article/view/787 http://e-journal.unipma.ac.id/index.php/jf/article/view/787 jurnal riset biologi dan aplikasinya, volume 3, issue 2, september 2021 diversity of butterflies (hexapoda: lepidoptera: rhopalocera) around campus 4 of universitas ahmad dahlan ichsan luqmana indra putra1*, haris setiawan2, tasya aulia putri3 1 laboratory of ecology and systematics, faculty of applied science and technology, ahmad dahlan university; 2laboratory of animal structure and physiology, faculty of applied science and technology, ahmad dahlan university; 3biology department, faculty of applied science and technology, ahmad dahlan university jln. ring road selatan, tamanan, banguntapan, bantul, yogyakarta 55191, indonesia *corresponding author: e-mail: ichsan.luqmana@bio.uad.ac.id article history abstract received : 24 may 2021 the conversion of land functions can result in a decrease of environmental quality, which can reduce the diversity of butterflies. this study aimed to determine the diversity level and to find the most abundant and less abundant butterfly species around campus 4 uad. the sampling was done at campus area, vacant land, rice fields and housing sites. each of these sites had 2 plots and consisted of 5 subplots, respectively. sampling was carried out four times, which was done in the morning at 08.00 11.00 and in the afternoon at 15.00 17.00. butterflies caught using a sweep net. the data were analyzed by inferential analysis, namely pearson correlation test. the calculation of the diversity level of butterflies was carried out by calculating the importance value index, the diversity shannon-wiener index, and the simpson dominance index. the results showed that the diversity level of shannon wiener index of butterflies around the campus 4 uad showed a low level (0.67). the species of butterflies found around campus 4 uad were acraea violae, aphrissa statira, appias libythea, appias olferna, catopsilia pyranthe, catopsilia scylla, danaus chrysippus, elymnias hypermnestra, junonia almana, and junonia atlites. the most abundant butterfly was c. pyranthe with 125 individuals whereas the least abundant was a. libythea with 1 individual. this suggested that the ecosystem around campus 4 uad is disturbed category; causing instability of the diversity that exists, including butterflies. revised : 20 july 2021 approved : 2 september 2021 published : 30 september 2021 keywords butterfly; diversity; dominance; rhopalocera; shannon wiener. how to cite: putra, i.l.i., setiawan, h., & putri, t.a. (2021). diversity of butterfly species (hexapoda: lepidoptera: rhopalocera) around universitas ahmad dahlan campus 4. jurnal riset biologi dan aplikasinya, 3 (2): 54-62. doi: 10.26740/jrba.v3n2.p54-62. introduction changes in land functions that are increasing by humans, such as building homes and places to do business, will cause the available land decrease continuously (pewista & harini, 2013). the longer of functional changes in the ecosystem, the faster decreasing in environmental quality which will disturb the balance of the ecosystem (thom & seidl, 2016). this was added by (triyogo et al., 2016), another problem of land use change that can arise is a decrease in the level of diversity. the decline in diversity can occur because the land, which was originally a habitat for living things, has changed its function into student boarding houses and food stalls. some of the organisms can be affected by the conversion of land use, for example butterflies (hexapoda: lepidoptera: rhopalocera). butterflies are one of the insects that must be protected from extinction and population decline (sea et al., 2012). butterflies have important values for humans and the environment, such as maintaining the balance of ecosystems and jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi jurnal riset biologi dan aplikasinya, 3(2): 54-62, september 2021 | 55 enriching biodiversity (susilawati, 2010). according to (septiana et al., 2019), the existence of butterflies in nature has various important functions, namely as flower pollinators, ecosystem components, and bio-indicators. according to diana et al., (2015), land use change in ecosystem, habitat and resources can affect the level of diversity of butterflies in these habitats. this is made clear by diana et al., (2015), which states that butterflies are insects that can respond to environmental changes, such as vegetation degradation and pollutions. research on butterfly diversity in pinang masak campus, jambi university found 143 individuals from 5 butterfly families, namely papilionidae, pieridae, nymphalidae, lycaenidae and hesperiidae (dewi et al., 2016). the species of butterflies that were found in abundance were junonia orithya followed by acraea terpsicore and eurema hecabe. because of habitat alternation in around campus 4 of universitas ahmad dahlan (uad), yogyakarta due to campus development, it can affect the diversity and abundance of butterflies in this area. given the importance of the ecological function of butterflies in nature, this research is important to do to provide a database of butterflies around campus 4 uad in a sustainable conservation effort. the purpose of this study was to determine the diversity level of butterfly species and to find the dominant and less dominant butterfly species around the campus area 4 yogyakarta. materials and methods location determinations and sampling points the research locations were carried out at the area of campus 4 universitas ahmad dahlan (uad). the research locations consisted of campus areas, vacant land, housing, and rice fields. each area has 2 plots with a size of each plot measuring 750 m2. each plot consisted of 5 subplots with a size of 15 m x 10 m. butterfly sampling and abiotic factors measurement sampling was carried out four times. the time interval for sampling was once a week. butterfly samples were taken in the morning from 08.00 11.00 am and continued in the afternoon at 03.00 05.00 pm. the selection of data collection time was based on the active time of most butterfly species. butterflies were caught using a sweepnet. the captured butterflies were put into papilot paper so that the butterfly wings are not damaged. butterflies were killed by pressing their thoracic part in papillot paper. the dead butterfly was placed on the sterofoam and pinned in the thorax using a pin and its wings were spread out using papillot paper. furthermore, the butterflies were dried using a cardboard box given an incandescent lamp of 10 watts for 2 days. after that, a species label and a description of where it was found on each specimen was given. measurements of abiotic factors in the field were air temperature, air humidity, wind speed, and light intensity. air temperature and humidity was measured using a thermo-hygrometer. wind speed was measured using the anemometer benetech. light intensity was measured using lux meter smart sensor. host plant observation the host plant of butterfly’s observation was done by observing the adult butterflies. flowering plants visited by butterflies were recorded. the literatures were also used to confirm the host plant of the butterflies in the sampling areas. butterfly identification the dried butterflies were then identified based on the characters of the thorax, abdomen, and ornaments on the dorsal and ventral wings. identification was carried out by comparing the morphological characteristics of the samples with the identification book (ruslan dkk., 2020; resasco, 2009). data analysis data analysis of abundance of butterflies and abiotic factors in this study were analyzed used normality test and pearson correlation test. the calculation of the diversity level of butterflies was done by calculating the importance value index and diversity index using the formula shannon-wiener and the simpson dominance index with the formula (help et al., 1998): importance value index density = relative density = x 100% frequency = relative frequency = x 100% importance value index = relative density + relative frequency 56 | putra et al; diversity of butterfly species (hexapoda: lepidoptera: rhopalocera) shannon-wiener diversity index (h’) h’ = −∑ 𝑝𝑖 ln 𝑝𝑖 𝑝𝑖 = note: h′: shannon-wiener diversity index 𝑝𝑖 = ni/n ni: number of species individual at-i n : total amount of species individual shannon-wiener diversity index criteria: h’< 2 = low diversity 2<h’<3 = medium diversity h’<3 = high diversity (lestari et al., 2018). dominance index (d) butterfly species dominance was counted using simpson dominance index (d): d = x 100% note: d: dominance index ni: individual species amount n: total species amount (lestari et al., 2018) results and discussion butterfly diversity index (lepidoptera: rhopalocera) around campus 4 uad based on the results of the research that has been done, the shannon-winner diversity index value found around the campus 4 uad area was 0.67. the results obtained in this study obtained the index value of butterfly species diversity around the campus 4 uad, which was low (h '<1). the results showed that the highest ivi value was found in species c. pyranthe of 80.11 with a density of 125 individuals. while the lowest ivi value was found in species a. libythea of 1.23 with a density of 1 (table 1). the important value index shows the species that dominate the research location (hidayat, 2018). this was supported by the statement from mawazin & subiakto (2013), that the inp value is used to determine the dominance of a species in a community. saharjo & gago (2011) added that the greater the ivi value of a species, the greater the level of control over the community, and vice versa. the results obtained in this study obtained the index value of butterfly species diversity around the area of campus 4 uad, which was low (h '<1). the low diversity index value indicated that there are factors that influence the existence and abundance of butterfly species around campus 4 of uad yogyakarta. table 1. species diversity index and inp of butterfly around campus 4 uad yogyakarta note: pi: species amount at-i; d: density; dr: relative density; dom: dominance; f: frequency, fr: relative frequency; inp: important value index no species species amount pi log pi pi log pi d dr dom f fr inp 1 acraea violae 25 0.10 -1.01 -0.10 25 9.80 0.10 19 15.97 25.77 2 aphrissa statira 16 0.06 -1.20 -0.08 16 6.27 0.06 9 7.56 13.84 3 appias libythea 1 0.004 -2.41 -0.01 1 0.39 0.00 1 0.84 1.23 4 appias olferna 16 0.06 -1.20 -0.08 16 6.27 0.06 11 9.24 15.52 5 catopsilia pyranthe 125 0.49 -0.31 -0.15 125 49.02 0.49 37 31.09 80.11 6 catopsilia scylla 2 0.01 -2.11 -0.02 2 0.78 0.01 1 0.84 1.62 7 danaus chrysippus 55 0.22 -0.67 -0.14 55 21.57 0.22 31 26.05 47.62 8 elymnias hypermnes tra 4 0.02 -1.80 -0.03 4 1.57 0.02 3 2.52 4.09 9 junonia almana 9 0.04 -1.45 -0.05 9 3.53 0.04 5 4.20 7.73 10 junonia atlites 2 0.01 -2.11 -0.02 2 0.78 0.01 2 1.68 2.46 total 255 1.00 -14.26 -0.67 255 100.00 1.00 119 100.00 200.00 jurnal riset biologi dan aplikasinya, 3(2): 54-62, september 2021 | 57 this factor is in the form of changing the function of the existing green area. this was consistent with research from koh & sodhi (2004), where the diversity and abundance of butterflies in areas that have changed their function is lower than in natural ecosystems. the change in function conversion is due to massive changes that have occurred around the campus area 4, resulting in reduced green open land and conversion of other land functions into boarding houses or food stalls. according to research by fattorini (2011), several types of insects such as butterflies and beetles have become extinct due to land conversion and loss of green open space. the reduction in green open land available, of course, can have a direct effect on the life of butterflies (diana et al., 2015), both in terms of flying for food and the opportunity to find a partner, or choosing the location of oviposition (diana et al., 2015). the important value index shows the species that dominate the research location (hidayat, 2018). this was supported by the statement from mawazin & subiakto (2013), that the inp value is used to determine the dominance of a species in a community. saharjo & gago (2011) added that the greater the ivi value of a species, the greater the level of control over the community, and vice versa. the results obtained in this study obtained the index value of butterfly species diversity around the area of campus 4 uad, which was low (h '<1). the low diversity index value indicated that there are factors that influence the existence and abundance of butterfly species around campus 4 of uad yogyakarta. this factor is in the form of changing the function of the existing green area. this was consistent with research from koh & sodhi (2004), where the diversity and abundance of butterflies in areas that have changed their function is lower than in natural ecosystems. the change in function conversion is due to massive changes that have occurred around the campus area 4, resulting in reduced green open land and conversion of other land functions into boarding houses or food stalls. according to research by fattorini (2011), several types of insects such as butterflies and beetles have become extinct due to land conversion and loss of green open space. the reduction in green open land available, of course, can have a direct effect on the life of butterflies (diana et al., 2015), both in terms of flying for food and the opportunity to find a partner, or choosing the location of oviposition (diana et al., 2015). apart from the direct effect, changes in land use change also have an indirect effect on butterfly life. the indirect effect of land use change on butterfly life is the reduction in vegetation as butterfly food (mogan et al., 2018). this is consistent with research from ngatimin et al., (2017), which states that the diversity of butterfly species in bantimurung-bulusaraung national park has low index values in various habitats that are thought to have occurred for forest function conversion and illegal hunting. another study from koh & sodhi (2004), found that protected areas have a higher diversity of butterfly species than areas that have undergone land conversion. in addition, lestari et al (2015), butterflies face the threat of extinction caused by the conversion of land functions from natural ecosystems to agricultural or residential ecosystems. according to research from (setiawan et al., 2018), getting the results of natural ecosystems with conditions that are still maintained or habitats that have not been degraded, especially in conservation areas, have a higher level of diversity and abundance of butterflies than ecosystems that have changed function, either the threat of land conversion into agricultural land (setiawan et al., 2018), plantation areas (basuki, 2019), or into residential land (bahar et al., 2016). in addition to reducing green open space, land use conversion to settlement can also affect the diversity of butterflies in an ecosystem. according to sumah & apriniarti (2019), human activities, such as in residential areas, tend to have low levels of butterfly diversity at these locations. this is consistent with research from ngatimin et al. (2017), who obtained the butterfly species diversity index results in very low criteria at the pattunuang resort in maros regency. the low number of individuals found is thought to be due to longstanding poaching and the destruction of butterfly habitat due to forest conversion to agricultural land and settlements. according to septiana et al. (2019), if land clearing is carried out continuously and converted into residential areas, it can disrupt the survival of butterflies and even experience local extinction. in line with this, previous researches (kyerematen et al., 2014; tam & bonebrake, 2016) stated that the large number of forest conversion to residential and industrial areas will result in the habitat being pressed for butterflies. urgent habitat or low land availability from an organism will increase competition for these organisms, both competition for space (kusumawati, 2018), competition for food, shelter and getting a partner. 58 | putra et al; diversity of butterfly species (hexapoda: lepidoptera: rhopalocera) this is in accordance with the statement from septiana et al. (2019), which stated that the diversity of butterflies was disrupted, which is due to the continuous conversion of land into residential areas. change of land use or land degradation can cause a decrease in the type of vegetation in an ecosystem. the fewer types of vegetation that exist in an ecosystem, the fewer types of butterflies will be found in that location (nino, 2019). this is due to the limited food contained in the ecosystem. the more limited the availability of available food resources, the more limited the number of species and abundance of individuals an organism, one of which is butterflies, will also be limited (rahayuningsih et al., 2012). the existence of land conversion in indonesia, among others, can result in decreased plant species diversity which has an impact on decreasing butterfly species diversity. in line with this statement, dewi et al. (2016) also found the diversity and abundance of individual butterflies that are low in natural ecosystems that have turned into campus areas. mogan et al. (2018), also found the value of diversity and low abundance in locations that have been converted into plantations. figure 1. butterfly species that found in the sampling areas; (a) a. violae, (b) a. statira, (c) a. libythea, (d) a. olferna, (e) c. pyranthe, (f) c. scylla, (g) d. chrysippus, (h) e. hypermnestra, (i) j. almana and (1j) j. altites a d e f g c b h i j jurnal riset biologi dan aplikasinya, 3(2): 54-62, september 2021 | 59 table 2. host plant and nectary plant found around campus 4 areas species campus 4 empty land paddy field housing muntingia calabura √ √ √ √ tridax procumbens √ √ √ √ chromolaena odorata √ √ √ √ cyperus rotundus √ √ √ √ mangifera indica √ √ oryza sativa √ zea mays. √ senna alata √ √ note: √ = found; = not found table 3. butterfly species abundance found in campus 4 uad areas this study found that plants were thought to be host plants and a source of nectar from the butterflies obtained (table 2). santosa (2017) stated that the diversity of butterflies species found was largely determined by differences in plant vegetation in an area. dewi et al. (2016) stated that the low diversity and abundance of butterfly species, especially the papilionidae family, around the pinang masak campus, jambi university, allegedly due to the lack of variation in food sources in the area. whereas, mogan et al. (2018) found that the number of species found at the sam ratulangi university campus was lower because it was greatly influenced by the diversity of vegetation as a host plant and a source of nectar for butterflies. this is in line with the statement from koneri & saroyo (2011), that differences in the diversity index of butterfly species in a habitat are strongly influenced by the vegetation of the butterfly host plants. the variety and heterogeneity of the vegetation will affect the existence and diversity of butterflies. this is in line with lamatoa et al. (2013), which stated that the difference in the number of butterfly species found depends on the diversity of plants as food and a host source for these butterflies. abundance of butterfly species around campus 4 ahmad dahlan university based on the result of the study, the highest abundance of butterfly species was c. pyranthe in 4 areas, while the lowest abundance was a. libythea (table 3). based on the table above, the nymphalidae family has the highest number of species compared to the pieridae family. according to rahayu & basukriadi (2012), the nymphalidae family is a family that has the highest number of species, the widest distribution, and a variety of forage plants. khyade et al. (2018); nylin & nylin, (1988), which states that the nymphalidae family tends to be polyphagous, that isthey have more than one type of food preference. (mogan et al., 2018), stated that this was due to the ability to adapt to environmental conditions so that species from the nymphalidae family could be found at each research location. this is consistent with research by (rahayu & basukriadi, 2012), who found species from the nymphalidae family in several types of ecosystems. the large number of butterfly species from the nymphalidae family is thought to be because around the campus area 4 there are several plants that are suitable to support the life of the nymphalidae family butterflies. there are a lot of plants that are a source of food for members of the family species campus 4 empty land paddy field housing total nymphalidae acraea violae 5 8 8 4 25 aphrissa statira 3 0 8 5 16 danaus chrysippus 37 10 6 2 55 elymnias hypermnestra 0 0 0 4 4 junonia almana 0 5 3 1 9 junonia atlites 0 2 0 0 2 pieridae appias libythea 0 1 0 0 1 appias olferna 0 12 4 0 16 catopsilia pyranthe 7 36 57 25 125 catopsilia scylla 0 2 0 0 2 total 52 76 86 41 60 | putra et al; diversity of butterfly species (hexapoda: lepidoptera: rhopalocera) nymphalidae family, including those from the annonaceae, fabaceae, leguminoceae and astreracea families. this is what causes members of the nymphalidae family to be everywhere with a large number of species (khyade et al., 2018). the simpson dominance index value of butterflies around the campus of 4 uad yogyakarta was obtained at 1.00. according to (sirait et al., 2018), the criteria for the dominance index range from 0 1, where if the dominance index value is close to 0 it shows that no species dominates, whereas if the dominance index value is close to 1 it indicates that certain species dominate at that location. the factors that can influence the presence and dominance of butterflies in an ecosystem are environmental factors (lestari et al., 2020). butterflies are cold-blooded (poikilothermic) animals whose activities are strongly influenced by the temperature of their environment. this research was carried out where the ambient temperature was ± 370c. butterflies are most active at 370c, if the temperature is more than 370c, the butterflies will look for shelter. in addition to air temperature, humidity also affects the presence and dominance of butterflies in an ecosystem. the humidity needed by butterflies ranges from 49-84%. according to (florida et al., 2015), butterflies like habitats with high humidity because it can reduce the risk of dehydration. butterflies are animals that are active during the day when light intensity is high, because butterflies use the sun's heat to help fly. added by (rahayuningsih et al., 2012), light will provide heat energy so that it raises body temperature and metabolism becomes faster. increasing body temperature in butterfly larvae will accelerate the development and life cycle of these butterfly larvae (rahayuningsih et al., 2012). butterflies can respond to environmental changes, both in terms of vegetation and in terms of pollution levels. therefore, it is necessary to observe several environmental factors that may affect the presence of butterfly species in each ecosystem. in this research, the relationship between the parameters of the insect community with environmental parameters was analyzed by using correlation analysis pearson. the results obtained were then tested for the correlation between abiotic factors and the abundance of butterflies using pearson correlation. based on the significance of correlation pearson's in the 4 research areas between, it was found that air temperature and light intensity had a strong correlation because the sig (2-tailed) value was 0.950> 0.05 (table 4). based on the significance of correlation pearson's in the 4 research areas between the average individual butterfly and the abiotic factor, it can be concluded that there is a negative correlation. sharm and joshi (2009) stated that the diversity of insect species is correlated with the structural constituents of a habitat and the diversity of vegetation forms. another factor that may correlate with the abundance of butterfly species around the campus area 4 is the diversity of vegetation. according to septiana et al. (2019), the distribution of butterflies is very closely related to plant vegetation. this is because the female butterfly chooses one or several types of forage plants. conclusion it can be concluded that the diversity level of butterfly species in the area of campus 4 uad was low. the species of butterfly that dominated in this area was c. pyranthe, while the less dominant was a. libythea. references bahar, i., atmowidi, t., & peggie, d. (2016). keanekaragaman kupu-kupu superfamili papilionoidea (lepidoptera) di kawasan hutan pendidikan gunung walat sukabumi, jawa barat. zoo indonesia, 25(1), 71– 82. dewi, b., hamidah, a., & siburian, j. (2016). keanekaragaman dan kelimpahan jenis kupu-kupu (lepidoptera; rhopalocera) di sekitar kampus pinang masak universitas jambi diversity. jurnal biospecies, 9(2), 32–38. diana, p., djamahar, r., & isfaeni, h. (2015). hubungan karakteristik lanskap dengan preferensi situs oviposisi kupu-kupu di ruang terbuka hijau kawasan jakarta timur. bioma, 11(1), 22. https://doi.org/10.21009/bioma11(1).3 fattorini, s. (2011). insect extinction by urbanization: a long term study in rome. biological conservation, 144(1), 370–375. https://doi.org/https://doi.org/10.1016/j.biocon.201 0.09.014 florida, m., setyawati, t. r., & yanti, a. h. (2015). inventarisasi jenis kupu-kupu pada hutan kerangas di kawasan cagar alam mandor kabupaten landak. protobiont, 4(1), 260–265. help, c. h. r., herman, p. m. j., & soetaert, k. (1998). indices of diversity and evenness. océanis, 24(2459), 61–87. jurnal riset biologi dan aplikasinya, 3(2): 54-62, september 2021 | 61 hidayat, m. (2018). analisis vegetasi dan keanekaragaman tumbuhan di kawasan manifestasi geotermal ie suum kecamatan mesjid raya kabupaten aceh besar. biotik: jurnal ilmiah biologi teknologi dan kependidikan, 5(2), 114. https://doi.org/10.22373/biotik.v5i2.3019 khyade, v. b., gaikwad, p. m., & vare, p. r. (2018). explanation of nymphalidae butterflies. international academic journal of science and engineering, 05(02), 87–110. https://doi.org/10.9756/iajse/v5i1/1810029 koh, l. p., & sodhi, n. s. (2004). importance of reserves, fragments, and parks for butterfly conservation in a tropical urban landscape. ecological applications, 14(6), 1695–1708. https://doi.org/10.1890/03-5269 koneri, r., & saroyo. (2011). keanekaragaman kupu-kupu (lepidoptera) pada empat tipe habitat di hutan lindung gunung klabat, sulawesi utara. biosfera, 28(2), 85-92. doi: 10.20884/1.mib.2011.28.2.264 kusumawati, d. e. (2018). pengaruh kompetisi intraspesifik dan interspesifik terhadap pertumbuhan tanaman jagung (zea mays) dan kacang hijau (vigna radiata). agroradix, 1(2), 28–33. kyerematen, r., akaumoah-boateng, a., acquah-lamptey, d., & anderson, s. (2014). land use type affects butterfly diversity: a case study of the university of ghana, main campus , legon. journal of biodiversity and enviromental sciences, 5(5), 205–214. lamatoa, d. c., koneri, r., siahaan, r., & maabuat, p. v. (2013). populasi kupu-kupu (lepidoptera ) di pulau mantehage, sulawesi utara. jurnal ilmiah sains, 13(1), 52. https://doi.org/10.35799/jis.13.1.2013.2032 lestari, d. f., putri, r. d. a., ridwan, m., & purwaningsih, a. d. (2015). keanekaragaman kupu-kupu (insekta: lepidoptera) di wana wisata alas bromo, bkph lawu utara, karanganyar, jawa tengah. pros sem nas masy biodiv indon, 1(6), 1284-1288. doi://10.13057/psnmbi/m010604.https://doi.org/1 0.13057/psnmbi/m010604 lestari, m., widhiono, i., & darsono, d. (2020). keanekaragaman dan kemerataan spesies kupukupu (lepidoptera: nymphalidae) di hutan cagar alam bantarbolang, pemalang, jawa tengah. bioeksakta : jurnal ilmiah biologi unsoed, 2(1), 16. https://doi.org/10.20884/1.bioe.2020.2.1.1911 lestari, v. c., erawan, t. s., melanie, m., kasmara, h., & hermawan, w. (2018). keanekaragaman jenis kupukupu familia nymphalidae dan pieridae di kawasan cirengganis dan padang rumput cikamal cagar alam pananjung pangandaran. agrikultura, 29(1), 1. https://doi.org/10.24198/agrikultura.v29i1.16920 mawazin, & subiakto, a. (2013). species diversity and composition of logged over peat swamp forest in riau. forest rehabilitation, 1, 59–73. mogan, y., koneri, r., & baideng, e. (2018). keanekaragaman kupu-kupu (lepidoptera) di kampus universitas sam ratulangi, manado (diversity of butterfly (lepidoptera) in campus of sam ratulangi university, manado). jurnal bios logos, 8(2), 59. https://doi.org/10.35799/jbl.8.2.2018.23357 ngatimin, s. n. a., abdullah, t., nasruddin, a., & gassa, a. (2017). pengenalan jenis kupu-kupu pada murid sd 129 inpres kecamatan bantimurung, kabupaten maros sulawesi selatan. jurnal hutan dan masyarakat, 9(1), 30. https://doi.org/10.24259/jhm.v9i1.1975 nino, m. m. (2019) keanekaragaman kupu-kupu (lepidoptera) di sekitar pinggiran sungai maslete kabupaten timor tengah utara. bio-edu, 4(2), 50-58. https://doi.org/10.32938/jbe.v4i2.386. nylin, s., & nylin, s. (1988). host plant specialization and seasonality in a polyphagous butterfly, polygonia calbum (nymphalidae). oikos, 53(3), 381. https://doi.org/10.2307/3565539 pewista, i., & hartini, r. (2013). faktor dan pengaruh alih fungsi lahan pertanian terhadap kondisi sosial ekonomi penduduk di kabupaten bantul. kasus daerah perkotaan, pinggiran dan pedesaan tahun 2001-2010. jurnal bumi indonesia, 2(2), 96-103. rahayu, s. e., & basukriadi, a. (2012). kelimpahan dan keanekaragaman spesies kupu-kupu (lepidoptera; rhopalocera) pada berbagai tipe habitat di hutan kota muhammad sabki kota jambi. jurnal biospecies, 5(2), 40–48 rahayu, s. e., & basukriadi, a. (2012). kelimpahan dan keanekaragaman spesies kupu-kupu (lepidoptera; rhopalocera) pada berbagai tipe habitat di hutan kota muhammad sabki kota jambi. jurnal biospecies, 5(2), 40–48. rahayuningsih, m., oqta, r., priyono, b., biologi, j., matematika, f., alam, p., & semarang, u. n. (2012). keanekaragaman jenis kupu-kupu superfamili papilionoidae di dukuh banyuwindu desa limbangan kecamatan limbangan kabupaten kendal. jurnal mipa unnes, 35(1), 115160. resasco, j. (2009). butterfly field guide. santa monica: santa monica mountains national recreataion area national park service. ruslan, h., tobing, i. s. & andayaningsih, d. (2020). biodiversitas kupu-kupu (lepidoptera: papilionoidea) di kawasan hutan kota jakarta. jakarta: lpuunas. saharjo, b. h., & gago, c. (2011). suksesi alami paska kebakaran pada hutan sekunder di desa fatuquero, kecamatan railaco, kabupaten ermera-timor leste. 40– 45. retrieved from https://202.124.205.241/handle/123456789/54463 santosa, y. (2017). keanekaragaman kupu-kupu di berbagai tipe https://doi.org/10.20884/1.mib.2011.28.2.264 62 | putra et al; diversity of butterfly species (hexapoda: lepidoptera: rhopalocera) tutupan lahan perkebunan kelapa sawit ptpn v tamora, kampar, riau. 3, 110–116. https://doi.org/10.13057/psnmbi/m030119 sea, n., sutra, m., & salmah, s. (2006). spesies kupu-kupu ( rhopalocera ) di tanjung balai karimun kabupaten karimun , kepulauan riau species of butterflies ( rhopalocera ) in tanjung balai karimun , karimun regency , riau archipelago. 1(1), 35–44. septiana, s., yulisah, t., & samitra, d. (2019). kelimpahan dan keanekaragaman kupu-kupu di kecamatan tugumulyo kabupaten musi rawas. pro-life, 6(1), 55. https://doi.org/10.33541/pro-life.v6i1.939 setiawan, r., wimbaningrum, r., & fatimah, s. (2018). keanekaragaman jenis kupu-kupu (lepidoptera: rhopalocera) di zona rehabilitasi blok curah malang resort wonoasri taman nasional meru betiri. natural science: journal of science and technology, 7(2), 252-258. septiana, s., yulisah, t., & samitra, d. (2019). kelimpahan dan keanekaragaman kupu-kupu di kecamatan tugumulyo kabupaten musi rawas. pro-life, 6(1), 55. https://doi.org/10.33541/prolife.v6i1.939 sirait, m., rahmatia, f., & pattulloh, p. (2018). komparasi indeks keanekaragaman dan indeks dominansi fitoplankton di sungai ciliwung jakarta (comparison of diversity index and dominant index of phytoplankton at ciliwung river jakarta). jurnal kelautan: indonesian journal of marine science and technology, 11(1), 75. https://doi.org/10.21107/jk.v11i1.3338 sumah, a. s. w., & apriniarti, m. s. (2019). kupu-kupu papilionidae (lepidoptera) di kawasan cifor, bogor, indonesia. jurnal biologi tropis, 19(2), 197. https://doi.org/10.29303/jbt.v19i2.1309 susilawati. (2010). keragaman lepidoptera pada dukuh dan kebun karet di desa mandiangin kabupaten banjar. jurnal hutan tropis, 11(29), 18-23. tam, k. c., & bonebrake, t. c. (2016). butterfly diversity, habitat and vegetation usage in hong kong urban parks. urban ecosystems, 19(2), 721–733. https://doi.org/10.1007/s11252-015-0484-2 thom, d., & seidl, r. (2016). natural disturbance impacts on ecosystem services and biodiversity in temperate and boreal forests. biological reviews of the cambridge philosophical society, 91(3), 760–781. https://doi.org/10.1111/brv.12193 triyogo, a., anshorulloh, a. j., & widyastuti, s. m. (2016). populasi serangga pada tingkat perkembangan agroforestri jati yang berbeda insect populations at different stages of teak based-agroforestry system pendahuluan metode penelitian. jurnal biota, 1(april), 75–84. jurnal riset biologi dan aplikasinya, volume 4, issue 1, march 2022 beta-glucosidase 1 (bgl1) gene analysis in mutant and wild-type of penicillium sp. id10-t065 vilya syafriana1,4*, sukma nuswantara2, wibowo mangunwardoyo1, puspita lisdiyanti3 1 department of biology, faculty of mathematics and natural sciences, university of indonesia (ui). kampus ui gedung e lt. 2, jln. lingkar kampus raya, pondok cina, beji, kota depok 16424, jawa barat, indonesia 2 research centre for genetic engineering, national research and innovation agency (brin), indonesia. jl. raya bogor km. 46, cibinong 16911, west java, indonesia 3 research centre for biosystematics and evolution, national research and innovation agency (brin), indonesia. jl. raya bogor km. 46, cibinong 16911, west java, indonesia 4faculty of pharmacy, national institute of science and technology (istn), indonesia. jl. moh kahfi ii, srengseng sawah 12640, jagakarsa, jakarta, indonesia *corresponding author e-mail: v.syafriana@istn.ac.id article history abstract received : 26 november 2021 in the previous study, penicillium sp. id10-t065 has been mutated using ultraviolet (uv), ethyl methyl sulfonate (ems) and the combination of uv-ems to increase betaglucosidase (bgl) activity. there were three mutants selected, uv13 (uv mutant), em31 (ems mutant), and um23 (uv-ems mutant). this study examined the mutations in the bgl gene encoding (bgl1) as well as sequence differences between mutants and wildtype of penicillium sp. id10-t065. the gene analysis was performed by pcr amplification and sequencing of the bgl1 gene. the results of bgl1 gene sequences (600 bp) from mutants were aligned with the wild-type, it was discovered that there were base alterations from position 2025 to 2050. mutant uv13 showed the highest base alterations (7 bases) which occurred at position 2027 (t→c); 2036 (t→g); 2040 (t→g); 2047 (g→c); and 2048-2050 (ttg→gga). mutant em31 showed alterations in five bases at positions 2034 (g→a), 2036 (t→g), 2037 (g→c), 2044 (g→c), and 2047 (g→t). mutant um23 showed two base alterations at position 2025 (t→a) and 2037 (g→c). uv irradiation and ems mutation resulted in transition and transversion dna, whereas the combination of uv-ems mutation resulted in transversion mutations. base alterations in uv13 and em31 mutants, causing missense and silent mutation, while in um23 mutant only silent mutations occur. the bgl1 gene analysis showed that mutation using uv light was more effective than using ems or a combination of uv-ems in penicillium sp. id10-t065. revised : 2 february 2022 approved : 2 march 2022 published : 31 march 2022 keywords base alteration, beta-glucosidase, mutation, penicillium, transition, transversion how to cite: syafriana,v., nuswantara, s., mangunwardoyo,w & lisdiyanti,p. (2022). beta-glucosidase 1 (bgl1) gene analysis in mutant and wild-type of penicillium sp. id10-t065. jurnal riset biologi dan aplikasinya, 4(1):1-8. doi: 10.26740/jrba.v4n1.p1-8. introduction beta-glucosidase (bgl) as one of the cellulase complexes has an essential role in cellulose hydrolysis. bgl is involved in the conversion of cellobiose to glucose at the end of the hydrolysis process (keller et al., 2020; srivastava et al., 2019). this action will reduce cellobiose accumulation in a cell which can inhibit the secretion of endoglucanase (eg) and cellobiohydrolase (cbh) (singh et al., 2016; sørensen et al., 2013). bgl productivity in bacteria and fungi is considered low for industrial scale. therefore the improvement of bgl activity is needed (lynd et al., 2002; srivastava et al., 2019). bgl activity could be improved through random mutation or genetic engineering (singh et al., 2017). strain jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi mailto:v.syafriana@istn.ac.id jurnal riset biologi dan aplikasinya, 4(1): 1-8, march 2022 | 2 improvement through mutation can reduce industrial costs, elevate productivity, and emerge a special character (afifi et al., 2014). a mutation is an alteration made to the dna sequence of an organism. in most cases, mutations are harmful, but they can occasionally lead to a better-adapted organism to its environment with improved biocatalytic performance. the potential of a microorganism to mutate is an important property conferred by dna since it creates new variations in the gene pool (de nicolás-santiago et al., 2006; habibi & pezeshki, 2013). it has been reported that random mutation followed by screening can improve enzyme activities in fungi. random mutation can be done using a chemical, physic, or combine agent called mutagen (adrio & demain, 2006; a. singh et al., 2017). these were several mutagens that have been reported that could improve bgl activity: proton beam, ultraviolet (uv) radiation, nitric acid (hno2), ethidium bromide (etbr), n-nitro-nnitrosoguanidine (ntg), and ethyl methyl sulfonate (ems) (jung et al., 2012). uv light is one of the best physical mutagens for mutations in fungi. uv light can cause dna damage and induce mutations. a chemical mutagen which is widely used in mutagenesis study is ems. ems is an alkylating agent that will alkylate guanine or thymine base, causing transition base pairs (habibi & pezeshki, 2013; hogg 2005). the combined mutation of uv-ems can induce a wide genetic variability (el-bondkly & keera, 2007). several studies using a combination of uv light and ems have proved the increase in the production of commercial enzymes, such as lipases (el-bondkly & keera, 2007); α-amylase (shafique et al., 2009); phosphatase (rajeshkumar & ilyas, 2011); and ligninase (ramzan et al., 2014). mutation using uv light and ems in fungi was reported can increase the activity of bgl (chandra et al., 2009; ega et al., 2020; ike et al., 2010; liu et al., 2013; syafriana et al., 2014). however, information on the base changes that occur after a random mutation in the coding gene of the bgl mutant with wild-type was underreported. it was reported only by ega et al. (2020) which found that there was a base substitution in bglh gene of bacillus subtilis after shuffling mutation using the ems, ntg, and uv. larue et al., (2016) reported another base alteration in the bgl gene, demonstrating that after directed mutagenesis in aspergillus niger resulted in several substitution mutations. the substitution causes changes in several amino acids, which probably affected the substrate’s hydrolysis. however, analysis of alteration in bgl gene after random mutations in penicillium has not been reported. the research that has been published was only in eg1 gene by caniago et al. (2015). it was reported that sequence analysis of eg1 gene on wild-type strains and mutants of penicillium oxalicum showed that some changes in nucleotide bases cause amino acid mutation. bases mutation which was occurred in eg1 gene could influence the enhancement of endoglucanase activity in the mutant (caniago et al., 2015). we have been mutated penicillium sp. id10t065 using uv irradiation, ems, and the combination of uv-ems (syafriana et al., 2014). the results showed that bgl activity in selected mutants was increased. this study examined the mutations in the bgl gene encoding (bgl1) as well as sequence differences between mutants and wildtype of penicillium sp. id10-t065. materials and methods sample dna of mutants uv13, em31, and um23, also wild-type of penicillium sp. id10-t065 were obtained from laboratory of applied microbiology, research center for biotechnology, indonesian institute of sciences. mutant uv13 was mutated by uv irradiation; em31 was mutated using ems; while um23 was mutated by a combination of uv irradiation and ems (syafriana et al., 2014). primers primers were designed based on bgl1 gene from reference strain penicillium brasilianum with accession number ef527403 (krogh et al., 2010). we designed five pairs of primers (table 1). among those five primers, we chose bg2 to amplify our mutants and wild-type gene. primers were edited using bioedit sequence alignment editor and dna star programme. optimization was done by varying the annealing temperature ± 5. optimization results showed that only bg2 primers meet the requirements based on the band formed in electrophoresis. bg1, bg3, and bg5 bands were not detected, while bg4 bands were too thin. data analysis the dna sequences of a bgl1 gene from mutants and wild-type were aligned to be compared with each other using bioedit sequence alignment editor. the base alterations and the amino changes among wild-type and mutants were analyzed to see the pattern of mutation that occurred (luo et al., 2016; saitou, 2013). 3 | syafriana et al; beta-glucosidase 1 (bgl1) gene analysis table 1. five pairs’ primers of bgl1 name of primer tm (melting point) (°c) sequences 5’-3’ number of bases g-c content (%) base pair (bp) bg1 f1 61.4 5'-gccattgcgcagcccataca-3' 20 60.0 430 bg1 r1 59.3 5'-aagcggaggaataatctgcgaacc-3' 24 50.0 bg2 f2 59.2 5'-tggccgccgcaacattt-3' 17 58.8 389 bg2 r2 63.3 5'-accagcgcgaacggcatcag-3' 20 65.0 bg3 f3 60.2 5'-tcggcgctagctggacttgata-3' 22 54.5 947 bg3 r3 61.0 5'-cgacttttggcccaggtgaacg-3' 22 59.1 bg4 f4 61.0 5'-cgttcacctgggccaaaagtcg-3' 22 59.1 425 bg4 r4 61.4 5'-cgcgtggggtgggataaagtct-3' 22 59.1 bg5 f5 57.8 5'-tgacctccgtgttgtgaagaagta-3' 24 45.8 453 bg5 r5 56.8 5'-tgaccgggcagcagataaaa-3' 20 50.0 results and discussion dna sequences alignment results of dna sequences alignment of bgl1 from wild-type and three mutants were shown in figure 1. sequence alignment showed base alterations from base 2025 2050 (figure 1). the results showed that the mutant uv13 had the most alteration (7 bases) compared to em31 (5 bases) and um23 (2 bases). base alterations from mutant uv13 were showed at base position 2027 (t→c); base 2036 (t→g); base 2040 (t→g); base 2047 (g→c); base 2048 (t→g); base 2049; (t→g); base 2050 (g→a). meanwhile, mutant em31 showed five alterations from base 2034 (g→a), base 2036 (t→g), base 2037 (g→c), base 2044 (g→c), and base 2047 (g→t). whereas the mutant um23 has two alterations which were at base position 2025 (t→a) and 2037 (g→c). these alterations were in line with the results of the enzyme bgl activity which showed that the highest activity value was mutant uv13, followed by em31, and um23 (syafriana et al., 2014). these findings support the hypothesis that the number of mutations has an impact on bgl activity. mutation analysis the mechanisms of mutation that occurred in mutants uv13, em31, and um23 were summarized in table 2. the data showed that all isolates had substitution mutation, which is a mutation that occurs as a result of the replacement of one base by another base. if a substitution is between chemically similar bases, such as between purines (adenine and guanine) or pyrimidines (cytosine and thymine), it is called transition. if a substitution is between a purine and a pyrimidine, or vice versa, it is called transversion (saitou, 2013). the data showed that transversion substitution occurred about 11 events (5 events at uv13, 4 events at em31, and 2 events at um23); while the transition was about three events (2 events at uv13 and 1 event at em31) (table 2). these events contradicted the literature, which stated that transitions happen more frequently than transversions (luo et al., 2016; porceddu & camiolo, 2017; saitou, 2013). the process of a transversion is known more complicated than transition due to different structures between purine (bicyclic structure) and pyrimidine (single ring structure) (luo et al., 2016). single base alteration showed that transversion from t→g was the most frequent event (5 events), followed by g→c (4 events). these findings were also inversely proportional to the claim that the most common transversion alteration is the c→a alteration (saitou, 2013). in transition, the data showed that g→a (2 events) was higher than t→c (1 event). even though this result showed no significance, but it suited the literature which said guanine and cytosine had the highest frequencies of transition (porceddu & camiolo, 2017). g:c → a:t more frequent than a:t → g:c (luo et al., 2016; saitou, 2013). besides single base, we also analyzed the changes that happen in a codon (triplet) and in amino acid translated. the analysis revealed that the amino acid sequence had changed, but that some had remained the same despite the base changes (table 2). uv-irradiation mutation mutations that occurred in mutant uv13 at base positions 2027 and 2050 showed a transition substitution. substitution at base-2027 was a pyrimidine base transition in which thymine was replaced by cytosine. while substitution on the base 2050 revealed purine base transition event in which guanine was replaced by adenine (table 2) (hogg, 2005; saitou, 2013). jurnal riset biologi dan aplikasinya, 4(1): 1-8, march 2022 | 4 1970 1980 1990 2000 2010 2020 2030 ....|....|....|....|....|....|....|....|....|....|....|....|....|....| wt --ctcctcacgctcccctcgttttgatctt---tctggtttttttttttttttttccccccccatatttt serserargserproargpheaspleu serglyphephephephepheserproproilephe uv13 --ctcctcacgctcccctcgttttgatctt---tctggtttttttttttttttttccccccccatacttt serserargserproargpheaspleu serglyphephephephepheserproproileleu em31 --ctcctcacgctcccctcgttttgatctt---tctggtttttttttttttttttccccccccatatttt serserargserproargpheaspleu serglyphephephephepheserproproilephe um23 --ctcctcacgctcccctcgttttgatctt---tctggtttttttttttttttttccccccccaaatttt serserargserproargpheaspleu serglyphephephephepheserproprolysphe 2040 2050 2060 2070 2080 2090 2100 ....|....|....|....|....|....|....|....|....|....|....|....|....|....| wt ccggatgcctttcgccgttgaaaa--------------------------------------------- serglycysleuserproleulys uv13 ccggaggccgttcgcccggaaaaaaa------------------------------------------- serglyglyargserproglylyslys em31 ccgaagccctttcccctttgaaaa--------------------------------------------- serglualaleuserproleulys um23 ccggatccctttcgccgttgaaaaa-------------------------------------------- serglyserleuserproleulys figure 1. sequence alignment of the reference strain, mutants, and wild-type of penicillium sp. id10-t065 table 2. mutation analysis of mutants penicillium sp. id10-t065 mutant code base number base alteration mechanisms of mutation triplet changes amino acid changes results of mutation uv13 2027 t → c transition ttt → ctt phe → leu missense mutation 2036 t → g transversion tgc → ggc cys → gly missense mutation 2040 t → g transversion ctt → cgt leu → arg missense mutation 2047 g → c transversion ccg → ccc pro → pro silent mutation 2048 t → g transversion ttg → gga leu → lys missense mutation 2049 t → g transversion 2050 g → a transition em31 2034 g → a transition gga → gaa gly → glu missense mutation 2036 t → g transversion tgc → gcc cys → ala missense mutation 2037 g → c transversion 2044 g → c transversion tcg → tcc ser → ser silent mutation 2047 g → t transversion ccg → cct pro → pro silent mutation um23 2025 t → a transversion ata → aaa ile → lys missense mutation 2037 g → c transversion tgc → tcc cys → ser missense mutation note: → : shows alteration in base/amino acid sequence a : adenine ala : alanine gly: glycine phe : phenylalanine g : guanine arg : arginine ile : isoleucine pro : proline c : cytosine cys : cysteine leu : leucine ser : serine t : thymine glu : glutamate lys : lysine 5 | syafriana et al; beta-glucosidase 1 (bgl1) gene analysis base alterations at base positions 2036, 2040, 2048, and 2050 showed similar changes, which were thymine replaced by guanine; whereas at base position 2047, guanine became cytosine (table 2). this kind of substitution is referred to as a transversion mutation, in which a purine is replaced with a pyrimidine or vice versa (hogg, 2005; saitou, 2013). the mutations that occurred also affected the translation of the amino acids. substitution at base 2027 caused an alteration from phenylalanine into leucine; the substitution at base 2036 altered cysteine into glycine; whereas substitution at base2040 altered leucine into arginine. the next base alteration was on the three bases sequence at positions 2048-2050. the three bases were a triplet codon that will be translated into mrna. the triplet changes caused an alteration in the amino acid leucine into lysine (table 2). this type of mutation referred to as a missense mutation, caused a change in amino acid translation (habibi & pezeshki, 2013; saitou, 2013). base alteration at position 2047 didn’t affect the translation of amino acids. the amino acid at that position was persistently proline (table 2). that type of mutation does not alter an amino acid translation is known as silent mutation (habibi & pezeshki, 2013). this happened because one amino acid can be coded by multiple codons, for example, amino acid proline can be coded by ccu, cca, ccg, and ccc (saitou, 2013; voet & voet, 2011). uv irradiation is one of the inducers which can affect a mutation. uv irradiation affects the structure of pyrimidine (cytosine = c and thymine = t). pyrimidine is sensitive to uv light, so it is easily modified when uv light is absorbed into the cell. uv absorption can lead to the formation of pyrimidine dimers in two adjacent pyrimidine bases that can damage the structure of the dna chain or hinder the passage of the replication process (de nicolás-santiago et al., 2006; irfan et al., 2011; shafique et al., 2009). the damage is caused by photochemical reactions triggered by uv energy absorption on dna bases. the double bonds in the pyrimidine bases (either thymine or cytosine) absorb uv light, causing the adjacent pyrimidine bases to react (figure 2) (goodsell, 2004; ikehata & ono, 2011). sequence analysis showed that the nucleotide changes that occurred in the mutant uv13 were a position adjacent pyrimidine bases, namely tt (at base position 2027, 2048-2050); ct (base position 2040); and cc (base position 2047), except at the base 2036 (t adjacent to purine) (figure 1). a base substitution mutation of cytosine into thymine is the most common mutation due to uv irradiation, even though there may be transversion, frameshift mutations, duplications and deletions (ikehata & ono, 2011; livneh et al., 1993). figure 2. formation of pyrimidine dimers induced by uv light (source: hogg, 2005) ems mutations mutations in the mutant em31 indicated substitution mutations (transitions and transversions). transition mutation was found at base position 2034 which altered guanine into adenine, whereas transversion mutations occurred at the base 2036 (thymine into guanine), 2037 and 2044 (guanine into cytosine), as well as to the 2047 base (guanine into thymine) (table 2). this substitution caused an alteration in amino acid translation (missense mutation), there was glycine into glutamate (at base position 2034), and cysteine into alanine (at base position 2036--2037). besides that, it was also found a silent mutation event in mutant em31. it was found at base position 2044 (constantly serine) and base position 2047 (constantly proline) (table 2). alkylating agents such as ems works on the base guanine or thymine by adding an alkyl group to the oxygen atoms bonded to hydrogen bonding (position 6). the addition of alkyl groups to form a new molecule, namely alkylguanine or alkylthymine (figure 3). alkylguanine pairs with thymine (can be not paired with cytosine), while alkylthymine pairs with guanine (can be not paired with adenine) (hogg, 2005; hooley et al., 1988; sega, 1984). this resulted in a change of gc base pairs into the at or of ta into cg (figure 3). mutations in the mutants em31 showed a pattern that ems could cause a change in the guanine bases (at base 2034, 2037, 2044 and 2047), and thymine (at base 2036) (table 2). this indicated that there was the addition of an ethyl group to the two bases, resulting in errors of base pairs. ems in small amounts can also induce transversion of g/c jurnal riset biologi dan aplikasinya, 4(1): 1-8, march 2022 | 6 figure 3. mechanism of an alkylating agent in dna bases (source: griffiths et al., 2000) to c/g as can be seen at the base 2037; or transition a/t to g/c as can be seen at the base 2036 (kim et al., 2006; sega, 1984). combination mutation of uv and ems transversion mutations were observed in a mutant combination of uv-ems (um23), with thymine being replaced by adenine (at base 2025) and guanine being replaced by cytosine (at base 2037). change at base 2025 led to the reading of the amino acid isoleucine altered into lysine and change at base 2037 altered serine into cysteine (missense mutation) (table 2). uv and ems interactions are not associated with an increase in the mutation or gene conversion, but a combination of both mutagens affects the possibility of dna repair processes inhibition. combined treatment with uv and certain alkylating agents (mms or mnng) in human and chinese hamster ovary cells has revealed inhibition of excision repair of uv-induced lesions. these results indicated that the inhibition of repair might be due to the alkylation of repair enzymes, thus leading to reduced enzyme activity (ager & haynes, 1990). based on the results of the activity of the mutant enzyme um23 (syafriana et al., 2014), the enzyme activity decreased when uv and ems mutations were combined. this indicates that there was inhibition of the mutant enzyme’s pathway at um23. the results of gene analysis revealed that the base alterations caused by mutations had an impact on bgl’s increased activity. mutant uv13 is a mutant with the highest number of mutated bases compared to em31 and um23. the results of bgl activity in the previous study showed that the mutant uv13 (5.53 u/ml) has bgl activity higher than em31(4.26 u/ml) and um23(1.75 u/ml) (syafriana et al., 2014). this indicated that the mutation using uv light was more effective than ems or a combination of uv and ems to increase the yield of bgl activity. the effectiveness of uv as mutagen was also reported by de nicolás-santiago et al. (2006) who got increased activity of mannanase, cellulase and xylanase in aspergillus niger mutant uam-gs1 after exposure to uv light for 3 minutes. increased activity of the enzyme was thought to be related to alterations in promoter zones of the genes coding of the enzyme due to uv exposure. this radiation might have deregulated the transcription of the mrna corresponding to the enzyme, leading to an increased secretion production. since uv radiation affects mainly the hydrogen bonds of pyrimidine bases (c + t), the most vulnerable regulatory sequences must have been those containing the highest concentration of c + t. it also suggested that the promoter zone was strongly affected by the uv radiation and it might have affected the mechanism of cellulolytic enzymes expression. conclusion it was concluded that mutant uv13 showed the highest base alterations (7 bases) compared to the other two mutants, em31 (5 bases) and um23 (2 bases). uv irradiation and ems mutation resulted in transition and transversion dna, whereas the combination of uv-ems mutation resulted in transversion mutations. base alterations in uv13 and em31 mutants, causing missense and silent mutation, while in um23 mutant only silent mutations occur. the bgl1 gene analysis showed that mutation using uv light was more effective 7 | syafriana et al; beta-glucosidase 1 (bgl1) gene analysis than using ems or a combination of uv-ems in penicillium sp. id10-t065. acknowledgment we would like to express our gratitude to miranti nurindah sari for her assistance with technical laboratory work and to dr. yantyati widyastuti for her laboratory advice. the research fund of the lipi research centre for biotechnology supported this study in 2014. references adrio, j. l., & demain, a. l. (2006). genetic improvementof processes yielding microbial products. fems microbiology reviews, 30(2), 187–214. https://doi.org/10.1111/j.1574-6976.2005.00009.x. afifi, a. f., abo-elmagd, h. i., & housseiny, m. m. (2014). improvement of alkaline protease production by penicillium chrysogenum nrrl 792 through physical and chemical mutation, optimization, characterization and genetic variation between mutant and wild-type strains. annals of microbiology, 64(2), 521–530. https://doi.org/10.1007/s13213-013-0685-y ager, d. d., & haynes, r. h. (1990). analysis of interactions between mutagens, i. heat and ultraviolet light in saccharomyces cerevisiae. mutation research fundamental and molecular mechanisms of mutagenesis, 232(2), 313–326. https://doi.org/10.1016/00275107(90)90138-t caniago, a., mangunwardoyo, w., nuswantara, s., & lisdiyanti, p. (2015). improvement of endoglucanase activity in penicillium oxalicum id10-t065 by ultra violet irradiation and ethidium bromide mutation. annales bogorienses, 19(2), 27–38. doi: http://dx.doi.org/10.14203/ann.bogor.2015.v1 9.n2.27-38 chandra, m., kalra, a., sangwan, n. s., gaurav, s. s., darokar, m. p., & sangwan, r. s. (2009). development of a mutant of trichoderma citrinoviride for enhanced production of cellulases. bioresource technology, 100(4), 1659–1662. https://doi.org/10.1016/j.biortech.2008.09.011 de nicolás-santiago, s., regalado-gonzález, c., garcíaalmendárez, b., fernández, f. j., téllez-jurado, a., & huerta-ochoa, s. (2006). physiological, morphological, and mannanase production studies on aspergillus niger uam-gs1 mutants. electronic journal of biotechnology, 9(1), 50–60. https://doi.org/10.2225/vol9-issue1-fulltext-2 ega, s. l., drendel, g., petrovski, s., egidi, e., franks, a. e., & muddada, s. (2020). comparative analysis of structural variations due to genome shuffling of bacillus subtilis vs15 for improved cellulase production. international journal of molecular sciences, 21(4). https://doi.org/10.3390/ijms21041299 el-bondkly, a. m., & keera, a. a. (2007). uvand ems induced mutations affecting synthesis of alkaloids and lipase in uvand emsinduced mutations affecting synthesis of alkaloids and lipase in. penicillium roquefortii. arab j biotechnol, 10, 241–248. goodsell, d. s. (2004). the molecular perspective: ultraviolet light and pyrimidine dimers. the oncologist, 6(3), 298–299. https://doi.org/10.1634/theoncologist.6-3-298 griffiths, a. j. f., miller, j.h., suzuki, d.t., leontin, r.c., & gelbart, w.m. (2000). an introduction to genetic analysis. 7th ed. new york: w.h. freeman. from http//www.ncbi.nlm.nih.gov/books/nbk 21936. habibi, m. b., & pezeshki, n. p. (2013). bacterial mutation; types, mechanisms and mutant detection methods: a review. european scientific journal, 4(december), 1857–7881. https://doi.org/10.19044/esj.2013.v9n10p%25p hogg, s. (2005). essential microbiology. west sussex: john wiley & sons, ltd. hooley, p., shawcross, s. g., & strike, p. (1988). an adaptive response to alkylating agents in aspergillus nidulans. current genetics, 14(5), 445–449. https://doi.org/10.1007/bf00521267 ike, m., park, j. y., tabuse, m., & tokuyasu, k. (2010). cellulase production on glucose-based media by the uv-irradiated mutants of trichoderma reesei. applied microbiology and biotechnology, 87(6), 2059–2066. https://doi.org/10.1007/s00253-010-2683-3 ikehata, h., & ono, t. (2011). the mechanisms of uv mutagenesis. journal of radiation research, 52(2), 115– 125. https://doi.org/10.1269/jrr.10175 irfan, m., javed, j., & syed, q. (2011). uv mutagenesis of aspergillus niger for enzyme production in submerged fermentation. j. biochem. mol. biol, 44(4), 137–140. jung, y. r., shin, h. y., yoo, h. y., um, y., & kim, s. w. (2012). production of cellulases and β-glucosidase in trichoderma reesei mutated by proton beam irradiation. korean journal of chemical engineering, 29(7), 925–930. https://doi.org/10.1007/s11814-0110272-5 keller, m. b., sørensen, t. h., krogh, k. b. r. m., wogulis, m., borch, k., & westh, p. (2020). activity of fungal β-glucosidases on cellulose. biotechnology for biofuels, 13(1), 1–7. https://doi.org/10.1186/s13068-02001762-4 kim, y., schumaker, k. s., & zhu, j.-k. (2006). ems mutagenesis of arabidopsis. methods in molecular biology, 323(6), 101–103. https://doi.org/10.1385/159745-003-0:101 krogh, k. b. r. m., harris, p. v., olsen, c. l., johansen, k. s., hojer-pedersen, j., borjesson, j., & olsson, l. (2010). characterization and kinetic analysis of a thermostable gh3 β-glucosidase from penicillium brasilianum. applied microbiology and biotechnology, 86(1), 143–154. https://doi.org/10.1007/s00253-0092181-7 larue, k., melgar, m., & martin, v. j. j. (2016). directed evolution of a fungal β-glucosidase in saccharomyces cerevisiae. biotechnology for biofuels, 9(1), 1–15. https://doi.org/10.1186/s13068-016-0470-9 liu, g., zhang, l., wei, x., zou, g., qin, y., ma, l., li, j., zheng, h., wang, s., wang, c., xun, l., zhao, g. p., zhou, z., & qu, y. (2013). genomic and secretomic analyses reveal unique features of the lignocellulolytic enzyme system of penicillium decumbens. plos one, 8(2). https://doi.org/10.1371/journal.pone.0055185 livneh, z., cohen-fix, o., skaliter, r., & elizur, t. (1993). replication of damaged dna and the molecular mechanism of ultraviolet light mutagenesis. critical reviews in biochemistry and molecular biology, 28(6), 465–513. https://doi.org/10.3109/10409239309085136 luo, g. h., li, x. h., han, z. j., zhang, z. c., yang, q., guo, h. f., & fang, j. c. (2016). transition and transversion mutations are biased towards gc in http://dx.doi.org/10.14203/ann.bogor.2015.v19.n2.27-38 http://dx.doi.org/10.14203/ann.bogor.2015.v19.n2.27-38 https://doi.org/10.19044/esj.2013.v9n10p%25p jurnal riset biologi dan aplikasinya, 4(1): 1-8, march 2022 | 8 transposons of chilo suppressalis (lepidoptera: pyralidae). genes, 7(10). https://doi.org/10.3390/genes7100072 lynd, l. r., weimer, p. j., zyl, w. h. van, & isak, s. (2002). microbial cellulose utilization : fundamentals and biotechnology microbial cellulose utilization : fundamentals and biotechnology downloaded from http://mmbr.asm.org/ on february 6 , 2013 by indian institute of technology madras. microbiology and molecular biology reviews, 66(3), 506–577. https://doi.org/10.1128/mmbr.66.3.506 porceddu, a., & camiolo, s. (2017). patterns of spontaneous nucleotide substitutions in grape processed pseudogenes. diversity, 9(4). https://doi.org/10.3390/d9040045 rajeshkumar, j., & ilyas, m. (2011). production of phosphatase by mutated fungal strains. international multidisciplinary research, 1(5), 23–29. https://updatepublishing.com/journal/index.php/im rj/article/view/1454. ramzan, m., asgher, m., sheikh, m. a., & bhatti, h. n. (2014). hyperproduction of manganese peroxidase through chemical mutagenesis of trametes versicolor ibl-04 and optimization of process parameters. bioresources, 8(3), 3953–3966. https://doi.org/10.15376/biores.8.3.3953-3966 saitou, n. (2013). introduction to evolutionary genomics. in:evolution today. scudder g.& reveal j. (eds.), 17, 139–144. https://doi.org/10.1007/978-1-4471-53047 sega, g. a. (1984). a review of the genetic effects of ethyl methanesulfonate. mutation research/reviews in genetic toxicology, 134(2–3), 113–142. https://doi.org/10.1016/0165-1110(84)90007-1 shafique, s., bajwa, r., & shafique, s. (2009). mutation of alternaria tenuissima fcbp-252 for hyper-active αamylase. indian journal of experimental biology, 47(7), 591–596. pmid: 19761044. singh, a., patel, a. k., adsul, m., & singhania, r. r. (2017). genetic modification: a tool for enhancing cellulase secretion. biofuel research journal, 4(2), 600–610. https://doi.org/10.18331/brj2017.4.2.5 singh, g., verma, a. k., & kumar, v. (2016). catalytic properties, functional attributes and industrial applications of β-glucosidases. 3 biotech, 6(1), 1–14. https://doi.org/10.1007/s13205-015-0328-z sørensen, a., lübeck, m., lübeck, p. s., & ahring, b. k. (2013). fungal beta-glucosidases: a bottleneck in industrial use of lignocellulosic materials. biomolecules, 3(3), 612–631. https://doi.org/10.3390/biom3030612 srivastava, n., rathour, r., jha, s., pandey, k., srivastava, m., thakur, v. k., sengar, r. s., gupta, v. k., mazumder, p. b., khan, a. f., & mishra, p. k. (2019). microbial beta glucosidase enzymes: recent advances in biomass conversation for biofuels application. biomolecules, 9(6), 1–23. https://doi.org/10.3390/biom9060220 syafriana, v., nuswantara, s., mangunwardoyo, w., & lisdiyanti, p. (2014). enhancement of β -glucosidase activity in penicillium sp. by random mutation with ultraviolet and ethyl methyl sulfonate. annales bogorienses, 18(2), 27-33. doi: http://dx.doi.org/10.14203/ann.bogor.2014.v18.n2.2 7-33 voet, d. & voet, j.g. (2011). biochemistry. 4th ed. new jersey: john wiley & sons, inc. jurnal riset biologi dan aplikasinya, volume 4, issue 1, march 2022 in silico study of secondary metabolites in dendrobium spp. as sars-cov-2 antivirus on main protease (mpro) anggiresti kinasih1,2, alim el hakim1,2, dyah ayu puspita arum1,2, aulia noor ramadhani1,2, endang semiarti1,3* 1faculty of biology, universitas gadjah mada, sleman, jln. teknika selatan, sekip utara, bulaksumur yogyakarta 2biology orchid study club, faculty of biology universitas gadjah mada, special region of yogyakarta, jln. teknika selatan, sekip utara, bulaksumur yogyakarta 3laboratory of biotechnology, faculty of biology, universitas gadjah mada, special region of yogyakarta, jln. teknika selatan, sekip utara, bulaksumur yogyakarta *corresponding author: e-mail: endsemi@ ugm.ac.id article history abstract received : 25 february 2022 infection and deaths cases by sars-cov-2 still increase and have not decreased significantly. main protease (mpro) is playing an important role in the replication of sars-cov-2 life cycle and causes of rapid transmission. natural compounds are potential to be antiviral candidates with high bioavailability and low cytotoxicity. orchids of dendrobium genus have high diversity in indonesia. dendrobium has been used as traditional chinese medicine and contains a group of secondary metabolites with antiviral activity. this study aimed to determine the potential of secondary metabolites of dendrobium orchids as antiviral candidates against mpro sars-cov-2 with in silico molecular docking. secondary metabolites obtained from the knapsack and pubchem act as ligands. n3 inhibitors as native ligands were obtained from the rcsb. mpro sars-cov-2 (6lu7) as a target macromolecule. molecular docking was carried out using the online covid-19 docking server using autodock vina device. the most negative binding affinity value for each ligand compared to the native ligand binding affinity. visualization with discovery studio software has been used to observe the protein amino acid residues contact for each ligand. the binding affinity of the native ligand inhibitor n3 is -7.5 kcal/mol. based on the results of mpro docking, three phytochemicals from dendrobium spp., i.e., dendrocandin b, denthyrsinone, and denthyrsinol compounds have binding affinities of -7.7 kcal/mol, -7.9 kcal/mol, and -8.1 kcal/mol, respectively. it can be concluded that in dendrobium orchid, denthyrsinol has the highest chance of binding so it has the potential to inhibit the mpro sars-cov-2 activity. revised : 14 march 2022 approved : 25 march 2022 published : 31 march 2022 keywords antiviral, docking, dendrobium, mpro, sars-cov-2s how to cite: kinasih, a., hakim, a.l., arum, d.a.p., ramadhani, a.n., putra, a.c.d.s & semiarti, e. (2022). in silico study of secondary metabolites in dendrobium spp. as sars-cov-2 antivirus on main protease (mpro). jurnal riset biologi dan aplikasinya, 4(1):19-25. doi: 10.26740/jrba. v4n1.p19-25. introduction the pandemic of covid-19 caused by positive-sense rna of β-coronaviridae known as severe acute respiratory syndrome coronavirus 2 (sars-cov-2). the first case started to spread in wuhan, china, in december 2019 (coronaviridae study group of the international committee on taxonomy of viruses, 2020; holshue et al. 2020). there were 2-3% infection and death cases caused by sars-cov-2 and continue to increase without any significant decreasing number (hamid et al. 2020). world health organization (who) reported that for now on, effective treatment using antiviral agents against sars-cov-2 is still not available (pandey et al. 2020). several symptoms of covid19 disease are sputum production (28%), headache jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi jurnal riset biologi dan aplikasinya, 4(1): 19-25, march 2022 | 20 (8%), hemoptysis (5%), and diarrhea (3%) (huang et al. 2020). according to several studies, other symptoms such as anosmia, fever, cough, alveolar destruction, and acute pneumonia was detected after ten days of infection with more severe symptoms on comorbid patients and old patients >70 years old (chen et al. 2020; li et al. 2020; tian et al. 2020; wang w et al. 2020; zhu et al. 2020). indonesia is known as a country with high biodiversity that has several plants used as traditional medicine, one of them is orchids (darmawati et al. 2018; fandani et al. 2018). orchids include in the orchidaceae family with high distribution over the world and very abundance in species richness. there are almost 5000 of 30.000 species of orchids can be found in the indonesia archipelago (sapto, 2009). the genus of dendrobium become the second largest genus in the orchidaceae family (moudi et al., 2013). dendrobium has been used as natural traditional medicine in china and the studies show that some of the species contain secondary metabolites group with antiviral activity (fan et al. 2001). particular of secondary metabolites group as flavonoids, alkaloids, derivatives of bibenzyl have potential in the medication field (gutierrez, 2010). herbal medication is a treatment using complex mixture of plant organic compounds (ren et al. 2020). a secondary metabolite is an intermediate substance which do not have a role in the main metabolic processes, specifically and has a certain function in each plant family (semiarti et al., 2020). plant secondary metabolite useful for inhibitor of specific disease with lower side effect also beneficial as alternative of an antiviral candidate with high bioavailability and low cytotoxic effect (umadevi et al. 2020). catechins, zingerols, gingerols, alicins, quercetins, and epitacetin reported have inhibition activity towards sars-cov-2 by in silico study (khaerunnisa et al. 2020). the quest of antiviral candidates from the natural substance as anti-sars-cov-2 facing challenges due to differences in genome sequence with sars-cov-1 or mers-cov (septiana, 2020). the antiviral candidate analysis in botany sectors should be started with in silico study (trivedi et al. 2020). in silico study expected to optimize research process and prevent loss in in vitro and in vivo steps, appropriately, accurately, rapidly, and effectively (sumon et al. 2021). mostly researches that discusses the effects of the secondary metabolite is still in progress of in vitro testing and the in vivo testing effectiveness is not yet guaranteed (septiana, 2020). experimental research to find drug candidates from natural substance is difficult in the pandemic condition. in silico method approach based on molecular docking need to be done due to it is relatively fast and safe. the aim of this study was to determine the potential of secondary metabolite on dendrobium orchid species as an antiviral candidate on main protease (mpro) sars-cov-2 using molecular docking by in silico method. materials and methods molecular docking secondary metabolites of dendrobium listed from knapsack: metabolite ecology. 3-dimension structure of secondary metabolites downloaded from pubchem databases with .sdf format. molecular docking conducted at online platform small molecule covid-19 docking server parameter https://ncov.schanglab.org.cn/index.php. (kong, 2020). structure of secondary metabolites act as ligand in docking. sars-cov2 main protease (mpro) with pdb id: 6lu7 selected as target (jin et al. 2020). centre coordinate of grid box set in x = −10.85 å; y = 12.58 å; z = 68.72 å and the size of grid box 30 å (r=12) (vicidomini et al. 2021). rate of exhaustiveness in 12. the higher rate of exhaustiveness would get a more constant result (forli, 2016). the result downloaded in .zip format ligand profiling binding affinity score between target and ligand which lower than inhibitor n3 (table 1) as native ligand would analyzed furthermore by ligand profiling. manifesting ligand profile by lipinski's rule of five that is hydrogen bond donors (the total number of nitrogens–hydrogen and oxygen– hydrogen bonds), hydrogen bond acceptors (all nitrogen or oxygen atoms), molecular mass less, and lipophilicity (log p) conducted by http://www.swissadme.ch/index.php data visualization ligand and target 3-dimension structure conformation visualized in software discovery studio 2020. the three strongest ligand and target interaction analyzed the amino acid residue contact and interaction in binding pocket. results and discussion dendrobium is generally found growing well in high areas or mountainous areas 1400-1600 m above sea level, in a fairly humid and foggy environment, and with a mild average temperature (lam et al., 2015). in this study, secondary metabolites of the genus dendrobium acted as http://www.swissadme.ch/index.php 21 | kinasih et al; in silico study of secondary metabolites in dendrobium spp. ligand-independent variables. secondary metabolites composed of dendrobium polysaccharide compounds have antiviral activity (hwang et al., 2012). binding of secondary metabolites to viral nucleoprotein regions can inhibit oligomerization and export of viral nucleoproteins (ti et al., 2021). medioresinol is capable of causing the accumulation of intracellular ros and apoptosis of microbial cells (hwang et al., 2012). terpenoids in dendrobium nobile play a role in the proliferative activity of murine t and b lymphocytes as antiviral immunomodulators (singh et al., 2012). naringenin is believed to have potential as a treatment compound that can inhibit sars-cov in mpro and ace2 (tutunchi et al., 2020). the main protease (mpro) is known to play an important role in the live replication process of sars-cov-2 and is one of the causes of rapid transmission (purwaniati and asnawi, 2020). the mpro structure of sars-cov-2 consists of a and b chains (zhang et al. 2020). mpro, also called the 3cl protease, is a 33.8-kda cysteine protease that mediates functional polypeptide maturation in the assembly of viral replication machinery (cui et al. 2020). the role of mpro in the life cycle of sarscov-2 uses one of the important targets in the design of covid-19 antivirals (purwaniati and asnawi, 2020). in this study, mpro sars-cov-2 (6lu7) was used as a macromolecular target. n3 inhibitors or known as michael acceptor inhibitors have been investigated to be able to inhibit the virus and specifically inhibit mpro sarscov (yang et al. 2005). in this study, n3 inhibitors were used as native ligands obtained from the rcsb website (jain and mujwar, 2020). the n3 inhibitor covalently binds to sars-cov-2 mpro via the michael reaction and blocks its active site (griffin, 2020; xue et al. 2008). n3 cytotoxicity 50% concentration of 133μm, ebselen and n3 antiviral activity had the strongest effect at 10 m concentration for vero cells infected by sars-cov2, n inhibitor compounds were able to penetrate cell membranes to access more targeted targets (jin et al., 2020). table 1. ligand profiling secondary metabolite of dendrobium secondary metabolites binding affinity kcal/mol bioavailability score lipinski's rule logp violation h-bond mr (g/mol) donor acceptor medioresinol -8 0.55 3.29 0 2 7 388.41 denthyrsinol -8.1 0.55 3.98 0 4 6 478.49 dendroside d -8.2 0.17 2.21 3 9 14 592.63 nobilin e -8 0.55 3.38 1 3 8 544.59 (+)-lirioresinol b -7.9 0.55 3.52 0 2 8 418.44 denthyrsinone -7.9 0.56 2.41 1 3 8 522.50 naringenin -7.8 0.55 1.75 0 3 5 272.25 dendrocandin b -7.7 0.55 4.24 0 2 8 482.52 4,4'-dihydroxy-3,5 dimethoxybibenzyl -7.6 0.55 2.67 0 2 4 274.31 acanthoside b -7.6 0.17 3.5 2 5 13 580.58 inhibitor n3 -7.5 table 2. binding affinity and binding pocket secondary metabolites of dendrobium with mpro species secondary metabolites binding affinity (kcal/mol) bio-availability score binding pocket dendrobium thysiflorum denthyrsinol -8.1 0.55 asn142, cys145, glu166, gly143, leu27, ser144, thr26 dendrobium thysiflorum denthyrsinone -7.9 0.56 cys145, glu166, gly143, his163, his41, phe140 dendrobium candidum dendrocandin b -7.7 0.55 cys145, glu166, his163, his172, his41, met165, met49, phe140, thr190, thr25 inhibitor n3 -7.5 0.17 asn142, cys145, gln189, glu166, his163, his41, leu27, met49 jurnal riset biologi dan aplikasinya, 4(1): 19-25, march 2022 | 22 figure 1. visualization of strongest conformation secondary metabolites of dendrobium spp., with mpro a. dendrocandin, b. denthyrsinone, c. denthyrsinol, d. inhibitor n3 in this research, an insilico study was conducted with the mechanism of the stages (1) ligand preparation, (2) target preparation, (3) target ligand molecule docking, (4) ligand-protein interaction visualization, and (5) data analysis (sari et al. .2020). molecular docking is a popular method in in silico studies, especially to initiate drug design (de ruyck et al. 2016). the docking process is divided into two types, namely blind docking and oriented docking (pradani et al., 2021). blind docking is a docking process without knowing the exact location of the active site of the receptor, while oriented docking is done after knowing the exact location of the active site of the receptor (syahputra et al., 2014). molecular docking can be done with the pyrx software using the autodock tool. in this study, molecular docking was carried out with the online covid-19 docking server using the autodock vina device (vicidomini et al. 2021). autodock vina and codock pp were used as docking engines to predict the binding mode between covid-19 targets and potential ligands. covid-19 docking server is economically and operationally easy to use (kong et al. 2020). one of the studies using the online covid-19 docking server is pendyala and patras (2020), which examines several bioactive compounds in food ingredients to inhibit mpro covid-19. research conducted by barik et al. (2020) also used the online covid-19 docking server as a method to analyze the types of bonds in chloroquine, hydroxychloroquine, ramdesivir and arbidol compounds. the web-based docking platform has been validated by its developers with the evaluation of re-docking trials for targets, including mpro with n3 inhibitors (vicidomini et al. 2021). the most negative binding affinity value for each ligand compared to the native ligand binding affinity (chen et al. 2016; xue et al. 2008). based on the results in table 1., there are 10 secondary metabolites of dendrobium with a lower binding affinity value than the native ligand inhibitor n3. the metabolites dendroside d, denthyrsinol, medioresinol, and nobilin e respectively had the lowest binding affinity, namely -8.2 kcal/mol, -8.1 kcal/mol, -8 kcal/mol, and -8 kcal/mol. binding affinity indicates the strength of the drug to bind to the receptor (arwansyah et al. 2014). the lower the binding affinity value, the higher the affinity between the receptor and the ligand and vice versa (prabowo and santoso, 2018). the smaller the binding affinity value, the more stable the interaction between the ligand and the receptor (arwansyah et al. 2014). the ligand profile in table 1 shows that of the 10 secondary metabolites of dendrobium, only dendroside d and acanthoside b are not potential drugs because they have violation >2 (wells and mcgee, 2008). the profile of ligands according to lipinski's five rules includes molecular weight, logp (lipophilicity), number of hydrogen bond donors, number of hydrogen bond acceptors, and violation (rachmania et al. 2015). lipinski's rule describes the solubility of certain compounds to penetrate cell membranes by passive diffusion (syahputra et al. 2014). compounds are more permeable and active as ligands if they have <5 hydrogen bond donors, <10 hydrogen bond acceptors, molecular mass <500 da, and logp value <5 (afriza et al. 2018). the value of mr (molecular weight), h-donor and h-acceptor is a measure of the permeability of a drug to be able to pass through the lipid bilayer of a cell (suhadi et al. 2019). lipophilicity is defined as the logarithm of the ratio of the hydrophobicity of the drug partitioning into the organic phase to the aqueous phase and is referred to as logp (ivanovic et al. 2019; utomo et al. 2017). violation is related to the potential for dependence and the amounts of illegal drugs used (wells and mcgee, 2008). hydrogen bonds generally act as a facilitator to increase the binding affinity of ligands by moving 23 | kinasih et al; in silico study of secondary metabolites in dendrobium spp. protein-bound water molecules into a large volume of solvent (chen et al., 2016). visualization of ligand-protein interactions of 10 secondary metabolites showed that there were only 3 strongest metabolite modes. secondary metabolites with the strongest mode against mpro were found in dendrobium thysiflorum and dendrobium candidum orchids. the strongest metabolite mode in terms of the lowest binding affinity and interactions with the most hydrogen bonds, especially on key amino acids. based on the results of table 2, the metabolites that have the highest probability of binding to mpro are dendrocandin b, denthyrsinone, and denthyrsinol. denthyrsinol has the lowest binding affinity of -8.1 kcal/mol which is predicted to be more stable when bound to mpro. the interactions formed by denthyrsinol and mpro are hydrogen bonds, electrostatic interactions, and hydrophobicity with the amino acids gly143, leu27, ser144, thr26 and asn142, cys145, glu166 as key amino acids. the interaction between the ligand and the protein receptor is expected to inhibit the performance of mpro sars-cov-2 (trott and olson, 2010). conclusion based on molecular docking using in silico method, it can be concluded that denthyrsinol is a the most potential secondary metabolite in orchid dendrobium thyrsiflorum as an antiviral candidate on main protease (mpro) sars-cov-2. references afriza, d., suriyah, w. h., & ichwan, s. j. a. (2018). in silico analysis of molecular interactions between the antiapoptotic protein survivin and dentatin, nordentatin, and quercetin. journal of physics: conference series, 1073(3), 0–7. https://doi.org/10.1088/17426596/1073/3/032001. arwansyah, a., ambarsari, l. and sumaryada, t.i. (2014). simulasi docking senyawa kurkumin dan analognya sebagai inhibitor reseptor androgen pada kanker prostat [english: “docking simulation of curcumin and its analogues as androgen receptor inhibitors in prostate cancer”]. current biochemistry, 1(1): 11-19. barik, a., rai, g., & modi, g. (2020). molecular docking and binding mode analysis of selected fda approved drugs against covid-19 selected key protein targets: an effort towards drug repurposing to identify the combination therapy to combat covid-19. http://arxiv.org/abs/2004.06447. chen, d., oezguen, n., urvil, p., ferguson, c., dann, s. m., & savidge, t. c. (2016). regulation of protein-ligand binding affinity by hydrogen bond pairing. science advances, 2(3). https://doi.org/10.1126/sciadv.1501240. chen, n., zhou, m., dong, x., qu, j., gong, f., han, y., qiu, y., wang, j., liu, y., wei, y., xia, j., yu, t., zhang, x., & zhang, l. (2020). epidemiological and clinical characteristics of 99 cases of 2019 novel coronavirus pneumonia in wuhan, china: a descriptive study. the lancet, 395(10223), 507–513. https://doi.org/10.1016/s0140-6736(20)30211-7. coronaviridae study group of the international committee on taxonomy of viruses. (2020). the species severe acute respiratory syndrome-related coronavirus: classifying 2019-ncov and naming it sars-cov-2. nature microbiology, 5(4): 536-544. cui, w., y. kailin, and y. haitao. (2020). recent progress in the drug development targeting sars-cov-2 main protease as treatment for covid-19. frontiers in molecular biosciences, 7(398): 1-10. doi: 10.3389/fmolb.2020.616341 darmawati, i. a. p., rai, i. n., dwiyani, r., & astarini, i. a. (2018). short communication: the diversity of wild dendrobium (orchidaceae) in central bali, indonesia. biodiversitas, 19(3), 1110–1116. https://doi.org/10.13057/biodiv/d190345. de ruyck, j., brysbaert, g., blossey, r., & lensink, m. f. (2016). molecular docking as a popular tool in drug design, an in silico travel. advances and applications in bioinformatics and chemistry, 9(1), 1–11. https://doi.org/10.2147/aabc.s105289. fan, c., wang, w., wang, y., qin, g., & zhao, w. (2001). chemical constituents from dendrobium densiflorum. phytochemistry, 57(8), 1255–1258. https://doi.org/10.1016/s0031-9422(01)00168-6. fandani, h. s., mallomasang, s. n., & korja, i. n. (2018). keanekaragaman jenis anggrek pada beberapa penangkaran di desa ampera dan desa karunia kecamatan palolo kabupaten sigi. jurnal warta rimba, 6(9), 14–20. forli, s., huey, r., pique, m. e., sanner, m., goodsell, d. s., & arthur, j. (2016). 00006565-201002000-00017. 11(5), 905–919. https://doi.org/10.1038/nprot.2016.051.computation al griffin, j. w. d. (2020). sars-cov and sars-cov-2 main protease residue interaction networks change when bound to inhibitor n3. journal of structural biology, 211(3), 107575. https://doi.org/10.1016/j.jsb.2020.107575. gutiérrez, r. m. p. (2010). orchids: a review of uses in traditional medicine, its phytochemistry and pharmacology. journal of medicinal plants research, 4(8), 592–638. https://doi.org/10.5897/jmpr10.012. hamid, s., mir, m. y., & rohela, g. k. (2020). novel coronavirus disease (covid-19): a pandemic (epidemiology, pathogenesis and potential therapeutics). new microbes and new infections, 35, 100679. https://doi.org/10.1016/j.nmni.2020.100679. holshue, m. l., debolt, c., lindquist, s., lofy, k. h., wiesman, j., bruce, h., spitters, c., ericson, k., wilkerson, s., tural, a., diaz, g., cohn, a., fox, l., patel, a., gerber, s. i., kim, l., tong, s., lu, x., lindstrom, s., pillai, s. k. (2020). first case of 2019 novel coronavirus in the united states. new england journal of medicine, 382(10), 929–936. https://doi.org/10.1056/nejmoa2001191. huang, m., tang, t., pang, p., li, m., ma, r., lu, j., shu, j., you, y., chen, b., liang, j., hong, z., chen, h., kong, l., qin, d., pei, d., xia, j., jiang, s., & shan, h. (2020). treating covid-19 with chloroquine. journal of molecular cell biology, 12(4), 322–325. https://doi.org/10.1093/jmcb/mjaa014. hwang, j. h., hwang, i. s., liu, q. h., woo, e. r., & lee, d. g. (2012). medioresinol leads to intracellular ros accumulation and mitochondria-mediated apoptotic cell death in candida albicans. biochimie, 94(8), 1784– jurnal riset biologi dan aplikasinya, 4(1): 19-25, march 2022 | 24 1793. https://doi.org/10.1016/j.biochi.2012.04.010. ivanović, v., rančić, m., arsić, b., & pavlović, a. (2020). lipinski’s rule of five, famous extensions and famous exceptions. popular scientific article, 3(1), 171–177. jain, r., & mujwar, s. (2020). repurposing metocurine as main protease inhibitor to develop novel antiviral therapy for covid-19. structural chemistry, 31(6), 2487–2499. https://doi.org/10.1007/s11224-02001605-w. jin, z., du, x., xu, y., deng, y., liu, m., zhao, y., zhang, b., li, x., zhang, l., peng, c., duan, y., yu, j., wang, l., yang, k., liu, f., jiang, r., yang, x., you, t., liu, x., yang, h. (2020). structure of mpro from sarscov-2 and discovery of its inhibitors. nature, 582(7811), 289–293. https://doi.org/10.1038/s41586020-2223-y. khaerunnisa, s., kurniawan, h., awaluddin, r., suhartati, s., & soetjipto, s. (2020). potential inhibitor of covid19 main protease (mpro) from several medicinal plant compounds by molecular docking study molecular docking, adme-toxicity prediction, and evaluation of curcumin derivative compound as inhibitor inflamation on rheumathoid arth. preprints, march. https://doi.org/10.20944/preprints202003.0226.v1. kong, r., yang, g., xue, r., liu, m., wang, f., hu, j., guo, x., & chang, s. (2020). covid-19 docking server: a meta server for docking small molecules, peptides and antibodies against potential targets of covid-19. bioinformatics, 36(20), 5109–5111. https://doi.org/10.1093/bioinformatics/btaa645. lam, y., ng, t. b., yao, r. m., shi, j., xu, k., sze, s. c. w., & zhang, k. y. (2015). evaluation of chemical constituents and important mechanism of pharmacological biology in dendrobium plants. evidence-based complementary and alternative medicine, 2015. https://doi.org/10.1155/2015/841752. li, x., geng, m., peng, y., meng, l., & lu, s. (2020). molecular immune pathogenesis and diagnosis of covid-19. journal of pharmaceutical analysis, 10(2), 102–108. https://doi.org/10.1016/j.jpha.2020.03.001 moudi, m., go, r., yong, c., yien, s., & nazre, m. (2013). a review on molecular systematic of the genus dendrobium sw . 2 (april), 71–78. pandey, p., rane, j. s., chatterjee, a., kumar, a., & ray, s. (2020). targeting sars-cov-2 spike protein of covid-19 with naturally occurring phytochemicals: an in silco study for drug development. chemrxiv. https://doi.org/10.26434/chemrxiv.12094203.v1 pendyala, b., & patrasa, a. (2020). in silico screening of food bioactive compounds to predict potential inhibitors of covid-19 main protease (m. chemrxiv, 11–44). prabowo, s.a.a.e.and santoso,b, 2018. profil in silico interaksi senyawa alam ketumbar dan adas bintang sebagai inhibitor peptida deformilase mycobacterium tuberculosis (3svj dan 1ws1) menggunakan bantuan pyrx-vina [english: “in silico profile of interaction of coriander and star anise natural compounds as peptide deformylase inhibitors of mycobacterium tuberculosis (3svj and 1ws1) using pyrx-vina assistance”]. proceeding of the urecol, pp.402-408. pradani, t.c., manampiring, a.e., kepel, b.j., budiarso, f.d. and bodhi, w., 2021. molecular docking terhadap senyawa kurkumin dan arturmeron pada tumbuhan kunyit (curcuma longa linn.) yang berpotensi menghambat virus corona [english: “molecular docking of curcumin and arturmeron compounds in turmeric plants (curcuma longa linn.) potentially inhibiting corona virus”]. ebiomedik 9(2): 208-214. purwaniati, and a. asnawi. (2020). target kerja obat antivirus covid-19: review drug target of antivirus covid-19: review. jurnal farmagazine, 7(2): 30-42 rachmania, r. a., supardi, and o. a. larasati. (2015). in silico analysis of diterpenoid lactone compounds of bitter herbs (andrographis paniculate nees) on alphaglucosidase receptor as antidiabetic type ii agents. pharmacy,12(2): 210-222. rane, j. s., chatterjee, a., kumar, a., & ray, s. (2020). targeting sars-cov-2 spike protein of covid-19 with naturally occurring phytochemicals: an in silco study for drug development. chemrxiv, https://doi.org/10.26434/chemrxiv.12094203.v1. sari, i.w., junaidin, j. and pratiwi, d., 2020. studi molecular docking senyawa flavonoid herba kumis kucing (orthosiphon stamineus b.) pada reseptor αglukosidase sebagai antidiabetes tipe 2 [english: “. molecular docking study of flavonoid compounds of cat's whisker herb (orthosiphon stamineus b.) on -glucosidase receptors as type 2 antidiabetic”]. jurnal farmagazine, 7(2), pp.54-60. semiarti, e., purwantoro, a., & puspita sari, i. (2020). biotechnology approaches on characterization, mass propagation, and breeding of indonesian orchids dendrobium lineale (rolfe.) and vanda tricolor (lindl.) with its phytochemistry, 1–14. https://doi.org/10.1007/978-3-030-11257-8_12-1. septiana, e., 2020. prospek senyawa bahan alam sebagai antivirus dalam menghambat sars-cov-2 [english: “prospects of natural compounds as antivirals in inhibiting sars-cov-2”]. biotrends 11(1): 30-38. singh, siddhartha singh, amit kumar, sunil kumar, mukul pandey, pramod singh, & mayanglambam. (2012). medicinal properties and uses of orchids: a concise review. elixir appl. botany, 2012 (november), 11627–11634. https://www.researchgate.net/publication/2921311 92_medicinal_properties_and_uses_of_orchids_a_co ncise_review suhadi, a., rizarullah, r., & feriyani, f. (2019). simulasi docking senyawa aktif daun binahong sebagai inhibitor enzyme aldose reductase. sel jurnal penelitian kesehatan, 6(2), 55–65. https://doi.org/10.22435/sel.v6i2.1651 sumon, t. a., hussain, m. a., hasan, m. t., hasan, m., jang, w. j., bhuiya, e. h., chowdhury, a. a. m., sharifuzzaman, s. m., brown, c. l., kwon, h. j., & lee, e. w. (2021). a revisit to the research updates of drugs, vaccines, and bioinformatics approaches in combating covid-19 pandemic. frontiers in molecular biosciences, 7. https://doi.org/10.3389/fmolb.2020.585899. suryadi budi utomo, fajar sanubari, budi utami, dan n. d. n., & program. (2017). aktivitas analgesik senyawa turunan meperidin menggunakan metode semiempiris am1 analysis of a quantitative relationship between the structure and analgesic activity of meperidin derivatives using. (jurnal kimia dan pendidikan kimia, 2 (3), 158–168. syahputra, g., l. ambarsari, and t. sumaryada. (2014). simulasi docking kurkumin enol, bisdemetoksikurkumin dan analognya sebagai inhibitor enzim12-lipoksigenase [english: “docking simulation of enol curcumin, 25 | kinasih et al; in silico study of secondary metabolites in dendrobium spp. bisdemethoxycurcumin and their analogues as enzyme 12-lipoxygenase inhibitors”]. jurnal biofisika, 10 (1): 55-67 ti, h., zhuang, z., yu, q., & wang, s. (2021). progress of plant medicine derived extracts and alkaloids on modulating viral infections and inflammation. drug design, development and therapy, 15, 1385–1408. https://doi.org/10.2147/dddt.s299120 tian, s., hu, n., lou, j., chen, k., kang, x., xiang, z., chen, h., wang, d., liu, n., liu, d., chen, g., zhang, y., li, d., li, j., lian, h., niu, s., zhang, l., & zhang, j. (2020). characteristics of covid-19 infection in beijing. journal of infection, 80 (4), 401–406. https://doi.org/10.1016/j.jinf.2020.02.018 trivedi, g. n., karlekar, j. t., dhameliya, h. a., & panchal, h. (2020). a review on the novel coronavirus disease based on in-silico analysis of various drugs and target proteins. journal of pure and applied microbiology, 14 (1), 849–860. https://doi.org/10.22207/jpam.14.spl1.22 trott, o., & olson, a. j. (2009). autodock vina: improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading. journal of computational chemistry, 31(2), na-na. https://doi.org/10.1002/jcc.21334 tutunchi, h., naeini, f., ostadrahimi, a., & hosseinzadehattar, m. j. (2020). naringenin, a flavanone with antiviral and anti-inflammatory effects: a promising treatment strategy against covid-19. phytotherapy research, 34 (12), 3137–3147. https://doi.org/10.1002/ptr.6781 umadevi, p., manivannan, s., fayad, a. m., & shelvy, s. (2020)p. in silico analysis of phytochemicals as potential inhibitors of proteases involved in sarscov-2 infection. journal of biomolecular structure and dynamics, 0 (0), 1–9. https://doi.org/10.1080/07391102.2020.1866669. utomo, s. b., f. sanubari, b. utami, and n. d. nurhayati. (2017). analisis hubungan kuantitatif struktur dan aktivitas analgesik senyawa turunan meperidin menggunakan metode semiempiris am1 [english: “analysis of the quantitative relationship of the structure and analgesic activity of meperidine derivative compounds using the am1. semiempirical method”]. jurnal kimia dan pendidikan kimia, 2(3): 158-168 vicidomini, c., roviello, v., & roviello, g. n. (2021). in silico investigation on the interaction of chiral phytochemicals from opuntia ficus-indica with sarscov-2 mpro. symmetry, 13(6). https://doi.org/10.3390/sym13061041. wang, c., horby, p.w., hayden, f.g. and gao, g.f. (2020). a novel coronavirus outbreak of global health concern. the lancet, 395 (10223): 470-473. wang, w., tang, j., & wei, f. 2020. updated understanding of the outbreak of 2019 novel coronavirus (2019ncov) in wuhan, china. journal of medical virology, 92 (4), 441–447. https://doi.org/10.1002/jmv.25689. wang, z., zhao, m., cui, h., li, j., & wang, m. (2020). transcriptomic landscape of medicinal dendrobium reveals genes associated with the biosynthesis of bioactive components. frontiers in plant science, 11 (april), 1–11. https://doi.org/10.3389/fpls.2020.00391 wells, j. e., & mcgee, m. a. (2008). violations of the usual sequence of drug initiation: prevalence and associations with the development of dependence in the new zealand mental health survey. journal of studies on alcohol and drugs, 69 (6), 789–795. https://doi.org/10.15288/jsad.2008.69.789. xue, x., yu, h., yang, h., xue, f., wu, z., shen, w., li, j., zhou, z., ding, y., zhao, q., zhang, x. c., liao, m., bartlam, m., & rao, z. (2008). structures of two coronavirus main proteases: implications for substrate binding and antiviral drug design. journal of virology, 82 (5), 2515–2527. https://doi.org/10.1128/jvi.02114-07 zhu, n., zhang, d., wang, w., li, x., yang, b., song, j., zhao, x., huang, b., shi, w., lu, r., niu, p., zhan, f., ma, x., wang, d., xu, w., wu, g., gao, g. f., & tan, w. (2020). a novel coronavirus from patients with pneumonia in china, 2019. new england journal of medicine, 382(8), 727–733. https://doi.org/10.1056/nejmoa2001017. jurnal riset biologi dan aplikasinya, volume 3, issue 2, september 2021 s-d614g mutation reveals the euro-america and east-asia origin sars-cov-2 virus spread in indonesia nina bunga anggraini1, dwi listyorini1,2* 1department of biology, faculty of mathematics and natural sciences, universitas negeri malang 2department of biotechnology, faculty of mathematics and natural sciences, universitas negeri malang jln. semarang 5, malang, east java 65145, indonesia *corresponding author: e-mail: listyorini.aljabari@um.ac.id article history abstract received : 30 april 2021 covid-19 is a pandemic caused by the severe acute respiratory syndrome coronavirus 2 (sars-cov-2) virus. the first case was found in the city of wuhan, hubei province, china. the first case in indonesia was reported in march 2020 and currently there are 0.5 million cases with a death rate of 3.1%. this rapid increase in cases is thought to due to presence of the mutant strain s-d614g, which causes a faster rate of infection and spread. the purpose of this study was to determine the presence of s-d614g mutations in indonesian samples in order to find the origin of covid-19 which was spread in indonesia based on the spike gene sequences and the rdrp genes from 25 countries, and one control sequence china/wuhan-hu-1 obtained from the ncbi and gisaid databases. mutation analysis was carried out through multiple alignments using bioedit software. phylogenetic tree reconstruction using mega6 software with the neighbor joining method. this study found mutation of s-d614g in one indonesian sample, namely the indonesian/sby9 sample along with 23 samples from europe, america, and africa. the phylogenetic tree reconstruction confirmed these findings; the mutated samples were closely related to samples from these continents, while the nonmutated indonesian samples were closely related to sample from east asia. these findings indicate that the origin of the sars-cov-2 virus in indonesia possibly came from the east asia cluster and the european-american cluster. revised : 5 july 2021 approved : 25 august 2021 published : 30 september 2021 keywords covid-19; sars-cov-2 virus; sd614g mutation; spike gene and rdrp gene; phylogenetics how to cite: anggraini, n.b., & listyorini, d. (2021). s-d614g mutation reveals the euro-america and east-asia origin sars-cov-2 virus spread in indonesia. jurnal riset biologi dan aplikasinya, 3(2):45-53. doi: 10.26740/jrba.v3n2.p45-53 introduction covid-19 is a pandemic caused by the severe acute respiratory syndrome coronavirus (sarscov-2) (decaro & lorusso, 2020; gralinski & menachery, 2020). this virus attacks human respiratory system (rhotan et al., 2020). early 2020 this virus shocked the world with the surge of infected patients. the origin of this case began the discovery of pneumonia cluster cases with unclear etiology from wuhan city, hubei province, china, according to the information released by world health organization (who) on december 31, 2019 (shreen et al., 2020). that case continued to develop until there are reports of fatality and cases reported outside china (safrizal et al., 2020). as of november 19, 2020 there were 56,564,475 cases worldwide with the number of deaths reaching 1,354,858 (worldometer, 2020). the global covid-19 outbreak is a pandemic that is very important to be taken seriously. based on the predictive value set by the cdc around 20-60% of the population worldwide will be infected by this virus (baud et al., 2020). coronavirus was confirmed for the first time in indonesia at march 2020 (indonesian ministry of health, 2020). a patient was confirmed positive for jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi jurnal riset biologi dan aplikasinya, 3(2): 45-53, september 2021 | 46 covid-19 after attending an event in jakarta where the patient had been in contact with a foreigner, the patient complained of fever, cough and blown (who, 2020). as of november 2020, there were 478,720 cases of covid-19 in indonesia and the death rate reached 15,530 or 3,2% of confirmed cases (worldmeter.info, 2020; satgas penanganan covid-19, 2020). corona virus is transmitted by aerosol droplet or nasopharyngeal droplets of patient (mao et al., 2020). aerosol or nasopharyngeal droplets are transmitted when people come into direct contact with patient (safrizal et al., 2020; huang et al., 2020). several efforts to prevent the transmission rate of covid-19 have been carried out, such as physical distancing, sels-quarantine, early detection, and basic protection in the form of wearing masks when traveling and lockdowns area (who, 2020; susilo et al., 2020). sars-cov-2 virus is included in the subgenus sarbecovirus, genus betacoronavirus, and the coronaviridae family (khot & nadkar, 2020) which has incubation symptoms similar to sars-cov 2016, there are fever, dry cough, blown, and various other symptoms different from each individual (safrizal et al., 2020; gorbalenya et al., 2020; jin et al., 2020). the incubation period for this virus is between 5-14 days (jin et al., 2020). the recovery rate from the covid-19 reached 36% (mahase et al., 2020), even so this virus is an obstacle to human activities in various fields such as economy, development and education (schleicher, 2020; wren-lewis, 2020). sars-cov-2 virus has spread throughout the world along with the mobilization of its host cell (zheng et al., 2020). differences in climatic conditions, environment and host cell antibodies will make the virus adapt or even mutate (sanjuán & domingo-calap, 2016). mutations that have an impact on the spread of sars-cov-2 are mutations in the 614th amino acid position of spike protein or called s-d614g mutation, that is substitution of the aspartate to glycine (laha et al., 2020; hu et al., 2020). this mutation causes the virus become more pathogenic and spread faster (korber et al., 2020). research on the spike protein is mostly carried out due to the important role of this protein in inserting the genetic material of the sars-cov-2 virus into host cells through the ace2 receptor (shang et al., 2020; tay et al., 2020). according to biswas & majumder (2020) there are two type of sars-cov-2, there are type (o) and type (a2a). type (o) is a type that does not have mutations in the spike protein. type a2a is a variant of sarscov-2 that has a mutation in the amino acid sd614g. the crucial process after the insertion of the virus into host cell is the replication facilitated by the rdrp gene (lung et al., 2020). this gene produces the rna polymerase enzyme which is needed in the replication process (zhu et al., 2020). the length of this gene is from 182 to 881 base pairs, that will be translated into protein with 60 to 269 amino acids long as orf1ab polyprotein (parikesit & nurdiansyah, 2020). phylogenetic tree reconstruction will provide information on the relationship, similarity based on genes and the origin of sars-cov-2 in indonesia (turista et al., 2020). information about the relationship and origin of sars-cov-2 in indonesia can be a source to find out the type of sars-cov-2 in indonesia. therefore, the right steps can be found to overcome the covid-19 pandemic in indonesia. hence, more in-depth research is needed the distribution, types of viruses and mutations that occur to be used as the basis for appropriate prevention and treatment efforts in the future. this research aimed to determine the presence of sd614g mutations in indonesian samples in order to find the origin of covid-19 which was spread in indonesia based on the spike gene sequences and the rdrp genes from 25 countries, and one control sequence china/wuhan-hu-1 obtained from the ncbi and gisaid databases materials and methods this research was included in a qualitative descriptive study conducted in the biotechnology room, o4 building, laboratorium sentral mineral dan material maju, universitas negeri malang in june to august 2020. the samples of this study were 50 sars-cov-2 spike and rdrp genes sequences from 25 countries obtained through data mining from the national center for biotechnology information (ncbi) database and the global initative on sharing all influenza data (gisaid). the control sequences used were rna sequences of spike and rdrp sars-cov-2 genes from wuhan china (wuhan-hu-1). the tools used are bioedit for alignment sequences process and mega6 software for phylogenetic tree reconstruction using neighbour joining method. data analysis was by observing the 1842th base to determine the presence of base substitution from adenine (a) to guanine (g). analysis of the relationship and origin of the sars47 | anggraini & listyorini; s-d614g mutation reveals the euro-america and east-asia cov-2 viruses based on the formed phylogenetic tree. results and discussion multiple alignment result of spike gene using bioedit software showed there was an 1842th base change in some samples from base a to g (table 1). the multiple alignment result of spike gene sequences using bioedit software showed that there was mutation on 1842th base in several samples of the spike gene, from base a to g (table 1). this base substitution result in a change in the amino acid aspartate (gat) to glycine (ggt) (eaaswarkhanth et al., 2020; hu et al., 2020). table.1 mutations a>g cause a change in the amino acid aspartate (s-d614) to glycine (s-g614). no sample origin accession number a-g 1 indonesia /jakarta 1 epi_isl_467370 a 2 indonesia/jakarta 2 epi_isl_437192 a 3 indonesia/jakarta 3 epi_isl_437191 a 4 indonesia/jakarta 4 epi_isl_437190 a 5 indonesia/jakarta 5 epi_isl_437189 a 6 indonesia/jakarta 6 epi_isl_435283 a 7 indonesia/jakarta 7 epi_isl_435282 a 8 indonesia/jakarta 8 epi_isl_435281 a 9 indonesia/surabaya 9 epi_isl_437188 g 10 indonesia/surabaya 10 epi_isl_437187 a 11 indonesia/manado 11 epi_isl_467375 a 12 indonesia/samarinda 12 epi_isl_467374 a 13 indonesia/pasuruan 13 epi_isl_458081 a 14 china 1 mt510727 a 15 china/guangzhou 2 mt568634 a 16 china/guangzhou 3 mt568638 a 17 china/guangzhou 4 mt568641 a 18 south korea 1 mt039890 a 19 south korea 2 mt304474 a 20 south korea 3 mt304475 a 21 south korea 4 mt304476 a 22 japan 1 lc556320 g 23 japan 2 lc549340 g 24 taiwan mt374104 a 25 hongkong mt114412 a 26 malaysia mt372481 a 27 australia/northern terrritory mt641648 a 28 australia/victoria mt451009 g 29 india mt415321 g 30 bangladesh mt762396 g 31 saudi arabia mt755885 g 32 italy 1 mt531537 g 33 italy/lazio 2 mt527178 g 34 italy/lazio 3 mt527184 g 35 spain mt359866 g 36 netherlands mt705206 g 37 germany mt358643 g 38 france mt470150 a 39 usa/virginia mt929083 g 40 usa/north america mt764170 g 41 brazil mt738101 g 42 colombia mt470219 g 43 south africa mt324062 g 44 egypt 1 mt627391 g 45 egypt 2 mt510690 g 46 marocco mt731292 g 47 guam mt459985 a 48 jamaica mt507793 a 49 serbia 1 mt569470 g 50 serbia 2 mt569471 g 51 china/wuhan-hu-1 nc_045512 a jurnal riset biologi dan aplikasinya, 3(2): 45-53, september 2021 | 48 total samples that had mutations were 23 of the 50 samples used. the result of the alignment of 13 samples from indonesia found 1 sample indonesia/jkt9 that had mutation. other samples that had mutations included 3 samples from italy, two samples from america, egypt, japan and serbia. one sample from spain, netherlands, south africa, morocco, germany, france, brazil, colombia, india, saudi arabia, bangladesh. the remaining 27 samples did not change base or were identical to the control sequence from china/wuhan-hu-1. most of the samples that had mutations came from countries in europe (eaaswarkhanth et al. 2020) and america (gudbjartsson et al., 2020). mutations in viral rna have a high rate and affect the process of spread and virulence (hu et al., 2020; becerra-flores & cardozo, 2020). in the case of the s-d614g mutation, the substitution of aspartate to glycine causes the s-g614g strain virus to be more pathogenic and have higher transmission rate than the s-d614g strain (becerra-flores & cardozo, 2020). this is due to the presence of single nucleotide deletion (delc) at a known variant site (rs35074065) in the cis-eqtl of tmprss2 which facilitates sars-cov-2 to be more easily inserting host cells (bhattacharyya et al., 2020). the spike gene in the s-g614 strain divides faster due to the presence of new serine protease (elastase-2) cleavage site located near the s1-s2 junction of the spike gene (bhattacharyya et al., 2020), this strain is also more stable than sd614 so it is strongly suspected to have a more efficient transmission (zhang et al., 2020). until november 19, 2020 indonesia was in the 19th position among countries with high cases of covid-19 in the world with a total of 478,720 cases (worldmeter, 2020; who, 2020; csis, 2020). east java province is the second highest number of covid-19 cases in indonesia after dki jakarta with total of 56,070 cases and highest fatality with a total of 4008 death (satgas penanganan covid-19, 2020) although a mutant sars-cov-2 was found from east java. it is suggested that there were some samples with mutation which were not yet uploaded to both ncbi genbank and gisaid within the research sampling period. the discovery of the sg614 variant virus from the city of surabaya could be one of the causes of covid-19 cases in indonesia increase due to the high transmission rate of this strain (bhattacharyya et al., 2020). in addition, countries in europe and america are in the row of countries with the most cases in the world (bhattacharyya et al., 2020; worldometer., 2020) accompanied by many samples that have mutations in the amino acid 614 spike gene on both continents. phylogenetic tree reconstruction based on the spike gene form two large cluster, there are cluster a and cluster g. most of the sars-cov-2 spike gene sequences from indonesia were in cluster a, but the indonesian/sby9 samples were in cluster g which was in one clade with italy/lz3 sample. the bootstrap value (54) revealed that the indonesian/sby9 sample has a close relationship to italy/lz3 sample. these results can be an indication that the indonesian/sby9 patient was in a close contact with a covid-19 patient from italy or the related patient was suspected of having a history of travel to italy. this can occur due to the spread of the sars-cov-2 virus through aerosols or nasopharyngeal droplets which are transmitted when people have direct contact with infected persons (safrizal et al., 2020; huang et al., 2020). the other samples from indonesia were in cluster a. the sample indonesia/jkt3 was in one branch with south korea3 with a bootsrap value of 79. however, the indonesia/jkt3 sample formed different branch along with asian countries in which several small clades were formed. the samples of indonesia/mnd were in one branch with samples from china/ghz2 and france with a bootsrap value of 85 and were in one clade with jamaica and taiwan. the sample of indonesia/jkt6 was in one branch with south korea2 with a bootsrap value of 80 and formed a small clade with the samples of indonesia/jkt1 and indonesia/sby10. the samples of indonesia/jkt7 and indonesia/psr13 were in one branch with a bootsrap value of 88 and formed a small clade with indonesia/smr12 and australia/nt. the sample indonesia/jkt5 was in one branch with china/ghz3 with a bootsrap value of 76 and formed a small clade with china1 and china/wuhan-hu-1. the indonesian/jkt2 sample was in one branch with the china/ghz4 sample with a bootsrap value of 74 and formed a small clade with indonesia/jkt4 and south korea4. the sample indonesia/jkt8 was in one branch with south korea1 with bootsrap value of 87 and s in the same clade as hongkong, malaysia and guam (figure 1). the results of the phylogenetic tree reconstruction also proved that the mutant samples formed separate clades from the non-mutant samples. generally, samples of the spike gene in 49 | anggraini & listyorini; s-d614g mutation reveals the euro-america and east-asia cluster g (type a2a) were suggested came from european and american countries with type a2a since this type was commonly found in europe and america which bear a non-synonymous s-d614g spike gene mutation which making it easier for the virus to enter the lung cells of the host (biswas et al., 2020; gudbjartsson, et al., 2020). this is the reason why type a2a has the advantage of infecting and surviving which results in faster spread across geographic areas (biswas et al., 2020). one of the causes of mutations in viruses is the adaptation of a virus to geographic environmental conditions and the condition of host cell antibodies (sanjuán & domingo-calap, 2016). although many samples of indonesia were found in cluster a, indonesian samples were not grouped in the same branch. this could be an indication that there are variations in the indonesian spike gene sequence. most of the samples of indonesian spike genes are closely related to the samples from east asia countries, especially china and south korea. it can be assumed that the patient has had contact with foreigners from or had a history of travel to those two countries. figure 1. phylogenetic tree reconstruction of spike gene sequences using the neighbour joining method g g a g (28) guam (32) malaysia (35) hongkong (9) indonesia/jkt 8 (22) s outh korea 1 (5) indonesia/jkt 4 (43) s outh korea 4 (3) indonesia/jkt 2 (48) china/ghz 4 (6) indonesia/jkt 5 (47) china/ghz 3 (21) china 1 (1) china/wuhan-hu-1 (8) indonesia/jkt 7 (17) indonesia/ps r 13 (16) indonesia/s mr 12 (27) australia/nt (2) indonesia/jkt 1 (14) indonesia/s by 10 (7) indonesia/jkt 6 (41) s outh korea 2 (36) jamaica (38) taiwan (15) indonesia/mnd 11 (25) france (46) china/ghz 2 (4) indonesia/jkt 3 (42) s outh korea 3 (10) s pain (11) netherlands (19) egypt 1 (20) morocco (23) germany (24) italy 1 (29) brazil (31) india (33) s audi arabia (34) japan 1 (39) egypt 2 (40) japan 2 (44) s erbia 1 (45) s erbia 2 (49) italy/lz 2 (12) us a/vrg (26) us a/na (18) s outh africa (30) colombia (13) indonesia/s by 9 (50) italy/lz 3 (37) bangladesh (51) australia/vct (52) (53) (54) (55) (56) (57) (58) (59) (60) (61) (62) (63) (64) (65) (66) (67) (68) (69) (70) (71) (72) (73) (74) (75) (76) (77) (78) (79) (80) (81) (82) (83) (84) (85) (86) (87) (88) (89) (90) (91) (92) (93) (94) (95) (96) (97) (98) (99) (100) jurnal riset biologi dan aplikasinya, 3(2): 45-53, september 2021 | 50 (23) germany (45) s erbia 2 (49) italy/lz 2 (33) s audi arabia (24) italy 1 (10) s pain (19) egypt 1 (30) colombia (13) indonesia/s by 9 (39) egypt 2 (18) s outh africa (40) japan 2 (31) india (20) morocco (11) netherlands (26) us a (34) japan 1 (44) s erbia 1 (51) australia/vct (12) us a/vrg (29) brazil (37) bangladesh (50) italy/lz 3 (1) china/wuhan-hu-1 (2) indonesia/jkt 1 (4) indonesia/jkt 3 (5) indonesia/jkt 4 (7) indonesia/jkt 6 (9) indonesia/jkt 8 (14) indonesia/s by 10 (15) indonesia/mnd 11 (16) indonesia/s mr 12 (17) indonesia/ps r 13 (27) australia/nt (35) hongkong (22) s outh korea 1 (38) taiwan (47) china/ghz 3 (6) indonesia/jkt 5 (3) indonesia/jkt 2 (8) indonesia/jkt 7 (46) china/ghz 2 (25) france (36) jamaica (41) s outh korea 2 (42) s outh korea 3 (43) s outh korea 4 (21) china 1 (48) china/ghz 4 (28) guam (32) malaysia (52) (53) (54) (55) (56) (57) (58) (59) (60) (61) (62) (63) (64) (65) (66) (67) (68) (69) (70) (71) (72) (73) (74) (75) (76) (77) (78) (79) (80) (81) (82) (83) (84) (85) (86) (87) (88) (89) (90) (91) (92) (93) (94) (95) (96) (97) (98) (99) (100) figure 2. phylogenetic tree reconstruction of rdrp gene sequences using the neighbour joining method the result of phylogenetic tree reconstruction using the rdrp gene showed that indonesian samples were in one large clade but separated in three different small clade (figure 2). the nonmutant indonesian samples on this phylogenetic tree are in the adjacent clade, namely clade a and clade b. in clade a the samples indonesia/jkt2, indonesia/jkt5 and indonesia/jkt7 are in one small clade with china/ghz3 with bootsrap value 61, and formed a larger clade a with south korea1 and taiwan with bootsrap value 66. samples of australia/nt, hongkong and china-wuhan-hu-1 form clade b together with indonesian samples including indonesia/mnd11, indonesia/psr13, indonesia/sby10, indonesia/jkt8, indonesia/jkt6, indonesia/jkt4, indonesia/jkt4, indonesia/jkt3 and indonesia/jkt1 with a bootsrap value of 68. in this clade, the indonesian sample appears to form new sub-branches with varied bootstrapping values, thus indicating that there are variations between the rdrp gene sequences in the indonesian sample. as well as having close similarities to hongkong, australia/nt and china-wuhan-hu-1 (figure 2, clade b). clade a clade b clade g 51 | anggraini & listyorini; s-d614g mutation reveals the euro-america and east-asia in clade g, the sample indonesia/sby9 is in the same branch with egypt2 with a value of 84 and is in a small clade with colombia and egypt1. the small clade was in one clade g together with samples from spain, italy/lz2, serbia and germany with a value of 99. samples in clade g were samples that had the s-d614g mutation or mutant strains. the results of phylogenetic tree reconstruction using spike and rdrp genes were found to be similar (figure 1 & 2) where 12 samples of indonesia are closely related to east asian countries, while one sample indonesia/sby9, is closely related to countries from the continents of europe, africa and america. this indicates that the origins of the sars-cov-2 virus in indonesia came from east asia, the continent of europe, america and africa either through direct patient contact with foreigners from these countries or a history of travel to these countries. the spike gene and the rdrp gene are two crucial genes in the process of viral infection into host cells. the spike gene acts as an intermediary for fusion between the virus and the cellular membrane of the host cell through endocytosis (zhang et al., 2020; tay et al., 2020), and the rdrp gene activates the rna polymerase enzyme for the virus replication process in the host cell (lung et al., 2020). high variations through this research can cause obstacles for scientists to determine drugs based on the anti-sense silencing rna (sirna) method (parikesit & nurdiansyah, 2020). transmission of the sars-cov-2 virus through aerosols or nasopharyngeal droplets which is transmitted when people make direct contact with patient (safrizal et al., 2020; huang et al., 2020) accompanied by high mobilization and interaction between humans in their daily lives will also be an obstacle as well in reducing cases of covid-19. therefore, vaccines, physical distancing (aminnejad & alikhani, 2020), wearing masks (howard et al., 2021) and diligently washing hands are still the most appropriate steps to take for prevention of each individual in preventing the spread and transmission of covid-19 (bloomfield et al., 2020). conclusion this study found a mutation of the spike gene at amino acid14 in indonesian/sby9 sample originating from the city of surabaya. the spike gene sequences and the rdrp gene from 12 samples from indonesia are closely related to countries from east asia. one sample from indonesia is closely related to countries from the european-american continent, italy, more specifically. acknowledgment the author extends our gratitude to lp2m universitas negeri malang for financial support under um pnbp bachelor thesis grant scheme granted to d.l and n.b.a references aminnejad, r., alikhani, r. (2020). physical distancing or social distancing: that is the question physical distancing or social distancing : that is the question. canadian journal of anesthesia/journal canadien d’anesthésie. 67, 1457–1458. https://doi.org/10.1007/s12630-020-01697-2 baud, d., x. qi, x., nielsen-saines, k., musso, d., pomar, l., favre, g. (2020). real estimates of mortality following covid-19 infection. the lancet infectious diseases. 773. https://doi: 10.1016/s14733099(20)30195-x. becerra-flores, m., cardozo, t. (2020). sars-cov-2 viral spike g614 mutation exhibits higher case fatality rate. international journal of clinical practice, 74(8), 4–7. https://doi: 10.1111/ijcp.13525. bhattacharyya, c., das, c., ghosh, a., singh a,k., mukherjee, s., majumder, p, p., basu, a., biswas, n,k. (2020). global spread of sars-cov-2 subtype with spike protein mutation d614g is shaped by human genomic variations that regulate expression of tmprss2 and mx1 genes. biorxiv. https://www.biorxiv.org/content/10.1101/2020.05 .04.075911v1.full biswas, n.k., majumder, p.p. (2020). analysis of rna sequences of 3636 sars-cov-2 collected from 55 countries reveals selective sweep of one virus type. indian j med res. 151(5), 450-458. https:// doi: 10.4103/ijmr.ijmr_1125_20. bloomfield, s. f. pharm, b., boyle, c., larson, e.l. (2007). the effectiveness of hand hygiene procedures in reducing the risks of infections in home and community settings including handwashing and alcohol-based hand sanitizers. american journal of infection control amer j infect control.35. https://doi: 10.1016/j.ajic.2007.07.001. csis indonesia. (2020). indeks intensitas covid-19. https://covid19.csis.or.id (accesed 6th of september 2020). decaro, n., lorusso, a. (2020). novel human coronavirus (sars-cov-2): a lesson from animal coronaviruses. veterinary microbiology. 244.https://doi.org/10.1016/j.vetmic.2020.108693 eaaswarkhanth, m., al-madhoun, a., al-mulla, f. (2020). jurnal riset biologi dan aplikasinya, 3(2): 45-53, september 2021 | 52 could the d614g substitution in the sars-cov-2 spike (s) protein be associated with higher covid19 mortality?. international journal of infectious diseases. 96, 459–460. https://doi: 10.1016/j.ijid.2020.05.071. gorbalenya, a.e., baker, s.c., baric, r,s., groot, r.j., dosten, c., gulyaeva, a.a., haagmans, b.l., lauber, c., leontovich, a.m., neuman, b.w., penzar, d., perlman, s., poon, l.l., samborskiy, d.v., sidorov, i.a., sola, i., ziebuhr, j. (2020). the species severe acute respiratory syndrome-related coronavirus: classifying 2019-ncov and naming it sars-cov-2. nature microbiology. 5(4), 536–544. https://doi.org/10.1038/s41564-020-0695-z gralinski, l.e., menachery, v.d. (2020). return of the coronavirus: 2019-ncov. viruses mdpi. 12(2), 135. https://doi.org/10.3390/v12020135 gudbjartsson, d.f., helgason, a., jonsson, h., magnusson, o.t. (2020). spread of sars-cov-2 in the icelandic population. the new england journal of medicine. 382, (2302-2315). http://doi: 10.1056/nejmoa2006100 hu, j. he, c.l., gao, q.z., cao, x., long, q., deng, h., huang, l., chen, j., wang, k., tang, n., huang, a. (2020). the d614g mutation of sars-cov-2 spike protein enhances viral infectivity and decreases neutralization sensitivity to individual convalescent sera. biorxiv. https://doi.org/10.1101/2020.06.20.161323. huang, c., wang, y., li, x., ren, l., zhao, j., hu, y. (2020). clinical features of patients infected with 2019 novel coronavirus in wuhan, china. lancet. 395(10223). https://doi.org/10.1016/s0140-6736(20)30183-5 indonesian ministry of health. 2020. pedoman pencegahan dan pengendalian coronavirus disesase (covid-19). revisi ke-5. pp. 21. jin, x., lian, j.s., hu, j.h., gao, j., zheng, l., zhang, y.m., hao, s.r., jia, h.y., cai, h., zhang, x.l., yu, g.d., xu, k,j., wang, x.y., gu, j.q., zhang, s.y., ye, c.y., jin, c.l., lu, y.f., yu, x., yu, x.p., huang, j.r., xu, k.l., ni, q., yu, c.b., zhu, b., li, y.t., liu, j., zhao, h., zhang, x., yu, l., guo, y.z., su, j.w., tao, j.j., lang, g.j., wu, x.x., wu, w.r., qv, t.t., xiang, d.r., yi, p., shi, d., chen, y., ren, y., qiu, y.q., li, l.j., sheng, j., yang, y. (2020). epidemiological, clinical and virological characteristics of 74 cases of coronavirus-infected disease 2019 (covid-19) with gastrointestinal symptoms. gut. 69, 1002-1009. http://dx.doi.org/10.1136/gutjnl-2020-320926 khot, w.y., nadkar, m.y. (2020). the novel coronavirus outbreak-a global threat. journal of association of physicians of india. 68(3), 67-71. korber, b. fischer, w.m., gnanakaran, s., yoon, h., abfalterer, j.t.w., giorgi, b.f.ee., bhattacharya, t., parker, m.d., partridge, d.g., evans, c.m., freeman, t.m., de silva, t.i., labranche, c.c., monteifiori, d.c. (2020). spike mutation pipeline reveals the emergence of a more transmissible form of sars-cov-2. biorxiv. https://doi.org/10.1101/2020.04.29.069054 laha, s. chakraborty, j., das, s., manna, s.k., biswas, s., chatterjee, r. (2020). characterizations of sarscov-2 mutational profile, spike protein stability and viral transmission. biorxiv. . https://doi.org/10.1101/2020.05.03.066266 lung, j. lin, y., yang, y., chou, y., shu, l., cheng, y., liu, h., wu, c. (2020). the potential chemical structure of anti-sars-cov-2 rna-dependent rna polymerase. journal of medical virology. 92(6), 693– 697. https://doi: 10.1002/jmv.25761. mahase, e. (2020). coronavirus covid-19 has killed more people than sars and mers combined, despite lower case fatality rate. bmj. 368. https://doi: 10.1136/bmj.m641. mahase, e. (2020). coronavirus: wales tests 90% of suspected patients in their own home,” bmj. 368, 698. https://doi: 10.1136/bmj.m698. mao, l., jin, h., wang, m. (2020). neurologic manifestations of hospitalized patients with coronavirus disease 2019 in wuhan, china. jama neurol. 2020;77(6), 683–690. https://doi:10.1001/jamaneurol.2020.1127 parikesit, a.a., nurdiansyah, r. (2020). the predicted structure for the anti-sense sirna of the rna polymerase enzyme (rdrp) gene of the sars-cov2. jurnal ilmu-ilmu hayati.19 (1), 97-108. rothan, h.a., byrareddy, s.n. (2020). the epidemology and phatogenesis of coronavirus diseases (covid-19) outbreak. journal of autoimunity. 109, 1-4. https://doi: 10.1016/j.jaut.2020.102433. safrizal, z.a., putra, d.i., sofyan, s., bimo. (2020). pedoman umum menghadapi pandemi covid-19 bagi pemerintah daerah. kementrian dalam negeri: jakarta sanjuán, r., domingo-calap, p. (2016). mechanisms of viral mutation. cell. mol. life sciences. 73(23), 4433–4448. https://doi: 10.1007/s00018-016-2299-6 satgas penanganan covid-19. (2020). peta sebaran kasus per provinsi. https://covid19.go.id/peta-sebaran. (accesed 6th of september 2020). schleicher, a. (2020). the impact of covid-19 on education insights from education at a glance 2020. pp. 1–31. shang, j. wan, y., luo, c., ye, g., geng, q., auerbach, a., li, f. (2020) “cell entry mechanisms of sars-cov2. proceedings of the national academy of sciences may https://doi.org/10.1016/s0140-6736(20)30183-5 53 | anggraini & listyorini; s-d614g mutation reveals the euro-america and east-asia 2020. 117 (21), 11727-11734. https://doi: 10.1073/pnas.2003138117 susilo, a., rumende, c.m., pitoyo, c.w., santoso, w.d., yulianti, m., herikurniawan., sinto, r., singh, g., nainggolan, l., nelwan, e.j., chen, l.k., widhani, a., wijaya, e., wicaksana, b., maksum, m., annisa, f., jasirwan, c.o., yunihastuti, e. (2020). coronavirus disease 2019: tinjauan literatur terkini. jurnal penyakit dalam indonesia. 7(1), 45-69. http://dx.doi.org/10.7454/jpdi.v7i1.415 tay, m. z. poh, c.m., renia, l., macary, p.a., lisa, f.p. (2020). the trinity of covid-19: immunity, inflammation and intervention. nature reviews immunology. 20(6), 363–374. https://doi: 10.1038/s41577-020-0311-8. turista, d. d. r., islamy, a., kharisma, v.d., ansori, a.n.m. (2020). distribution of covid-19 and phylogenetic tree construction of sars-cov-2 in indonesia. journal of pure and applied microbiology. 14, 1035–1042. https://doi: 10.22207/jpam.14.spl1.42. world health organization. situation report – 42 [internet]. 2020 [updated 2020 march 02; cited 2020 march 15]. available from: https://www.who.int/docs/default-source/ coronavirus/situation-reports/20200302-sitrep-42covid-19. pdf?sfvrsn=224c1add_2. worldometers. (2020) worldometer: real time world statistics. current world population. worldo meter. https://www.worldometers.info/coronavirus/. (accessed 6th of september 2020). wren-lewis, s. (2020) the economic effects of a pandemic, economics in the time of covid-19. https://www.socialeurope.eu/the-economic-effectsof-a-pandemic zhang, l, jackson, c.b, mou h., ojha, a., peng, h., quinlan, b.d., rangarajan, e.s., pan a., vanderheiden, a., suthar, m.s., li, w., izard, t., rader, c., farzan, m., choe, h. (2020) sars-cov-2 spike-protein d614g mutation increases virion spike density and infectivity. nature communication. 11:6013 https://doi.org/10.1038/s41467-020-19808-4 zheng, y.y., ma, y.t., zhang, j.j., xie, x. (2020). covid19 and the cardiovascular system. nature reviews cardiology. 17(5), 259–260. https://doi.org/10.1038/s41569-020-0360-5 zhu, n., zhang, d., wang, w., li, x., yang, b., song, j., zhao, x., huang, b., shi, w., lu, r., niu, p., zhan, f., ma, x., wang, d., xu, w., wu, g., gao, g.f., tan, w. (2020) a novel coronavirus from patients with pneumonia in china, 2019. new england journal of medicine 382(8), 727–733. https://doi: 10.1056/nejmoa2001017 zhu, w., chen, c.z., gorshkov, k., xu, m., lo, d.c., zheng, w. (2020). rna-dependent rna polymerase as a target for covid-19 drug discovery. sage journals. 25(10), 1141-1151. https://doi: 10.1177/2472555220942123. jurnal riset biologi dan aplikasinya, volume 5, issue 1, march 2023 genetic identification of superbugs from river streams in state university of malang reeno al hikmatus sholekah, dwi listyorini* department of biology, faculty of mathematics and natural sciences, state university of malang, jl. semarang no. 5 malang, east java, indonesia *corresponding author e-mail: listyorini.aljabari@um.ac.id article history abstract received : 9 november 2022 superbugs revert to bacterial strains, which exhibit resistance to antibiotics. these bacteria could cause some problems in disease treatment and the environment. this research aimed to identify the presence of superbugs in the river stream that flows through state university of malang campus area. amoxicillin, tetracycline, and chloramphenicol were selected to test the possibly found resistant bacteria. water samples taken from a decided spot was spread over luria bertani’s agar on both antibiotic supplemented and antibiotics-free lb agar media with no delay. molecular identification was carried out using 16s rrna gene in dna barcoding approach, completed with morphological and gram staining analyses. a total of 16 isolates of gram-negative colonies were found in the form of bacilli, diplobacilli, cocci, and diplococci. the genetic identification of eight resistant colonies led us to suggest that the isolates may belong to aeromonas, shigella, and bacillus. further studies are still required to get a clearer view of the correct taxonomical position of those resistant isolates. revised : 4 february 2023 approved : 18 march 2023 published : 31 march 2023 keywords superbugs; antibiotic; 16s rrna; phylogenetic how to cite: sholekah, r.a.h & listyorini, d. (2023). genetic identification of superbugs from river streams in state university of malang. jurnal riset biologi dan aplikasinya, 5(1):27-36. doi: 10.26740/jrba. v5n1.p.27-36. introduction superbug is a term used to describe strains of microorganisms, which are resistant to one or more antibiotics (rajendran, 2018). antibiotic resistance is a phenomenon that occurs when bacteria cannot be killed or their growth is not inhibited by the administration of antibiotics (world health organization, 2014). there are more than 1.5 million deaths worldwide yearly caused by superbug infection (hall et al., 2018). various pathogenic bacteria, including escherichia coli, mycobacterium tuberculosis, clostridium perfringens, legionella pneumophila, pseudomonas aeruginosa, shigella flexneri, vibrio cholera, and salmonella enterica have been detected in wastewater (cai & zhang, 2013). among those pathogenic bacteria, several strains of p. aeruginosa, e. coli, acinetobacter sp., and enterobacteriaceae has been known to be resistant to antibiotics (jia & zhang, 2019). reports on resistant bacteria are still very limited in indonesia. verawaty et al. (2020) reported the presence of e. coli that is resistant to ampicillin, tobramycin, and tetracycline in the waters of palembang, meanwhile suhartono et al. (2021) reported the presence of salmonella spp. that are resistant to azithromycin, tetracycline, and streptomycin in the lamnyong and krueng waters, aceh. research on resistant bacteria in indonesian waters is still limited, providing the basis for carrying out this research. the main cause of antibiotic resistance is the misuse of antibiotics, especially in humans and livestock (parathon et al., 2017), due to the easy access of the public to antibiotics without a prescription either in drugstores or food stalls (yarza et al., 2015). amoxicillin was the most widely jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi mailto:listyorini.aljabari@um.ac.id https://doi.org/10.26740/jrba.v5n1.p27-36 jurnal riset biologi dan aplikasinya, 5(1): 27-36, march 2023 | 28 consumed antibiotic in indonesia during 2008-2010, while tetracycline and chloramphenicol were ranked fifth and tenth, respectively (pradipta et al., 2015). amoxicillin is commonly used to treat respiratory infections (akhavan et al., 2021) as well as tetracycline (bidell et al., 2020), while chloramphenicol is used to treat typhoid fever (hanekamp & bast, 2015). amoxicillin is a ß-lactam antibiotic of the penicillin class (amino-penicillin), which acts as a bactericide (bernatová et al., 2013). tetracycline is a tetracycline-class antibiotic that works as a bacteriostatic to inhibit bacteria replication (shutter, 2022). meanwhile, chloramphenicol works through both bacteriostatic and bactericidal mechanisms at high concentrations (oong & tadi, 2021). superbug have also reported to be found in the air environment of hospitals, livestock sector, and sewage treatment plants (zhou et al., 2020). in the aquatic environment, superbugs can also be found due to the fact that in many areas, water bodies become the estuaries of domestic waste (puspita et al., 2016), hospital waste (sarkar et al., 2019), agricultural waste (habibi et al., 2014), mining waste (mulyadi et al., 2020), and industrial wastewater (rahardjo & prasetyaningsih, 2021). this causes adverse ecotoxicological effects (smith et al., 2020). in many cases, the disposal of wastewater treatment plants located upstream is a major source of antibiotic-resistant bacteria in waters (ren & hongqiang, 2019). surface and groundwater have been reported in several studies to have a role in causing the emergence of antibiotic-resistant organisms (li et al., 2014; hughes et al., 2013; bradford et al., 2017). the river stream within state university of malang campus is an estuary of domestic waste disposal originating from densely populated residential areas upstream. wastewater has been reported to be one of the reservoirs for superbugs and an important source for the spread of antibiotic resistance (jia & zhang, 2019). taking into consideration the negative impact of resistant bacteria on the treatment of diseases and environment, we studied the possible existence of superbugs in the river flow within the campus. molecular identification of superbugs was done using 16s rrna gene sequence based on the report that 16s rrna gene is highly conserved which only undergoes slight nucleotide changes in the evolutionary process (lan et al., 2016). this research aimed to identify the presence of superbugs in the river stream that flows through malang state university campus area. materials and methods location and time of observation this explorative descriptive research was carried out from september 2021 through august 2022 at biology laboratory of the state university of malang. sampling was taken at river flow of the state university of malang, jl. semarang no.5, malang, indonesia. the location of sampling coordinates is located at 7°57'41.0"s, 112°37'06.9"e. culture medium luria bertani (lb) agar and luria bertani broth were used as a bacterial culture medium. all media and tools were sterilized in an autoclave at 121⁰c, 15 lbs. for 15 minutes. as much as 32 mg/l of amoxicillin, 16 mg/l of tetracycline, or 32 mg/l of chloramphenicol were added to lb agar media (huang et al., 2012; tahrani et al., 2015) to detect the possible existence of antibiotic resistant bacteria. the media were then stored in the refrigerator until being used. bacteria sample bacterial samples were isolated from water taken at 7 a.m. from the river behind the green house area of state university of malang. a total of 15 ml of river water in a sterile centrifuge tube was brought to the laboratory in a cooler box. water quality parameters were measured, including water ph using the hanna instrument ph 211 and water turbidity using a digital turbidity meter, sgz200bs. water sample was diluted gradually (10-1, 102, 10-3, 10-4, 10-5, and 10-6) and homogenized in 0.1% peptone media. a total of 0.1 ml of water from each sample was inoculated on both lb agar and antibiotic added lb agar media in three repetitions. incubation was carried out for 1 x 24 hours at 37⁰c (bergeron et al., 2015). colony morphological analysis and bacterial gram staining each colony was purified using the quadrant streak plate method to obtain a single colony. each isolated colony was observed for colony morphology, which included: colony shape, colony edge, colony elevation, and colony color. the isolated colonies were also inoculated on slanted agar media for shortterm stock and preserved in glycerin solution for extended time storage. bacterial gram and cell shape were microscopically observed. gram staining was performed using ammonium oxalate crystal violet reagent, iodine, 96% alcohol, and safranin. 29| sholekah & listyorini., genetic identification of superbugs genetic identification (dna barcoding) for genetic identification purposes, each of antibiotic resistant isolates was cultured in 2 ml of liquid lb medium with respective antibiotic added in duplicate. incubation was carried out for 2x24 hours. total bacterial dna isolation was carried out following the protocol provided by the manufacturer (geneaid prestotm mini gdna bacteria kit). the quality and concentration of total dna obtained were measured using a spectrophotometer nanodrop nd-2000. target gene amplification was carried out by pcr technique using universal primers for 16s rrna gene. the forward primer used was 27f, 5’agagtttgatcmtggctcag-3’, and reverse primer used was r1492, 5’tacggytaccttgttacgact-3’ (pertiwi et al., 2018). pre-denaturation was carried out at 95°c for 3 minutes, followed by 40 amplification cycles consisting of denaturation at 95°c for 1 minute, annealing at 50°c for 1 minute, extension at 72°c for 1 minute, and the final extension was carried out at 72°c for 10 minutes. electrophoresis was performed to visualize the pcr product on 1% agarose gel running in 50 volts electrical current for 60 minutes (pertiwi et al., 2018). the results of electrophoresis are visualized using a uv trans illuminator. the sequence data was taken for eight isolates demonstrating antibiotic resistance. sequencing process was carried out by first base laboratories, malaysia. data analysis colony morphology, bacterial gram, and sequence data were analyzed descriptively. the target gene sequences were read using finch tv. consensus sequences from forward and backward sequencing of each sample were constructed using clustalx, then compared to the respective sequence databases available in the gene bank ncbi using online basic local alignment search tool (blast). phylogenetic tree reconstruction in order to analyze the taxonomic position of each bacterial isolate was carried out using mega-11 software for neighbor joining (nj) model with the kimura-2-parameter in a 1000 bootstrap value (prasetio et al., 2021). results and discussion water parameter water sample taken from a decided spot within state university of malang was neutral (ph 7,33) and clear (0,1 ntu turbidity). colony morphology and gram staining bacterial colonies were growing on both lb and antibiotic added lb media (figure1 & 2). from the original inoculation plates, we subcultured in order to purify the distinct colonies. in lb media we found eight different colonies. meanwhile, three different colonies were growing on both amoxicillin and chloramphenicol media, and only two different colonies were growing on tetracycline media. the observed colonies were dominated by circular opaques with entire margin, and only a few showing other shapes of their edges and being translucent in color (table 1). the observation through gram staining showed that all colonies growing on lb media were bacilli, while those growing on antibiotic added media were bacilli, diplobacilli, cocci, or diplococci (table 1, figure 2). figure 1. initial inoculation on lb agar media and antibiotic added lb agar media. scale bar = 2 cm jurnal riset biologi dan aplikasinya, 5(1): 27-36, march 2023 | 30 table 1. morphologies and gram-staining of 16 distinct purified colonies no control (lb) gram lb + antibiotic gram 1 2.1 circular; entire; raised; opaque; milky white negative bacilli amoxicillin 2.1 circular; entire; raised; opaque; milky white negative bacilli 2 2.2 circular; entire; flat translucent; clear white negative bacilli amoxicillin 2.2 circular; entire; flat; translucent; clear white negative bacilli 3 2.3 circular; wooly; flat; opaque; murky white negative bacilli amoxicillin 2.3 circular; irregular; flat; opaque; murky white negative diplo bacilli 4 2.4 circular; entire; flat; opaque edge; milky white negative bacilli chloramphenicol 2.1 circular; entire; raised; opaque; milky white negative cocci 5 2.5 circular; irregular; flat; opaque; milky white negative bacilli chloramphenicol 2.2 circular; entire; flat; translucent; clear white negative bacilli 6 2.6 circular; undulate; flat; opaque; milky white negative bacilli chloramphenicol 2.3 circular; entire; raised; opaque; murky white negative bacilli 7 2.7 circular; wooly; flat; opaque; milky white negative bacilli tetracycline 2.1 circular; entire; raised; opaque; milky white negative bacilli 8 2.8 circular; ciliate; flat; opaque; murky white negative bacilli tetracycline 2.2 circular; entire; flat; translucent; clear white negative diplococci among all subcultured colonies, we identified that there were colonies growing on two different antibiotic media, i.e: those which were growing on both amoxicillin (amx 2.1; figure 2i) and tetracycline (tet 2.1; figure 2o) and those which were growing on both amoxicillin (amx 2.2; fig. 2j) and chloramphenicol (cap 2.2; figure 2m). a total of 16 bacterial isolates were found. on control media grew, eight isolates, on amoxicillin and chloramphenicol media, three isolates were grown, and on tetracycline media grew only two isolates. it can be understood that those number are less than the number of bacterial isolates that grew in lb media. the presence of antibiotic eliminates the nonresistant ones that grow naturally on the control media due to the absence of any agents that inhibit bacterial growth. the inhibition of bacterial growth in antibiotic supplemented media may be caused by the bacteriostatic effect, which caused disruption of bacterial replication (bernatová et al., 2013; nemeth et al., 2015) and/or bactericidal effect of given antibiotics that cause bacterial death (baquero & levin, 2021). the number of isolates grown on amoxicillin and chloramphenicol media was greater than that grown-on tetracycline media (table 1; figure 2). we suggest that this finding resulted from the high usage of amoxicillin and chloramphenicol in society in the area upstream to the river. amoxicillin is widely used to treat various bacterial infections, such as pneumonia, tonsillitis, ear infections (akhavan et al., 2021), sinusitis dermatitis (sartelli et al., 2018), and urinary tract infections (tan & chlebicki, 2016). chloramphenicol is used to be applied to treat typhoid fever (hanekamp & bast, 2015), bacterial conjunctivitis (eye infection) and otitis externa (oong, 2021). tetracyclines are common to be used to treat respiratory tract infections (bidell et al., 2020) and certain skin inflammations (orylska et al., 2022). as it has been well understood that the excessive metabolites will be removed from body through excretory system, either through feces, urine, or sweat. (garza et al., 2020). then, in turn, the disposal of house or hospital sewage, which may contain excess antibiotics, directly into any type of water body will not only pollute the water, but also induce the living organism including bacteria, to develop their resistance. 31| sholekah & listyorini., genetic identification of superbugs figure 2. colony morphology and gram type. blue scale bar = 10 μm amoxicillin works by binding to penicillinbinding protein, activating autolytic enzymes, and thereby causing cell wall lysis (akhavan et al., 2021). certain antibiotic resistant bacteria, such as e. coli, produce ß-lactamase enzymes. this enzyme degrades ß-lactam ring of the antibiotic which resulting in the deactivation of its function (wu et al., 2021). chloramphenicol works by interfering the protein synthesis on the 50s ribosomal subunit and inhibiting aminoacyl-trna binding at the ribosomal site (blanco & antonio, 2017). thus, the mechanism of bacterial resistance against chloramphenicol is different from the mechanism of resistance to amoxicillin. it can be through drug inactivation, inhibiting protein synthesis (kapoor et al., 2017), or the existence of an efflux system mechanism (reygaert, 2018). tetracyclines work by binding to 16s rrna and inhibiting trna from binding to the ribosome site (chukwudi, 2016). it had been reported that tetracycline resistance in gram-negative bacteria can occur through the efflux system mechanism. the efflux pump gene codes for a membrane protein that pumps tetracycline out of cells, rendering the drug ineffective (amaral et al., 2014). the presence of superbugs in amoxicillin, chloramphenicol, and tetracycline media suggested jurnal riset biologi dan aplikasinya, 5(1): 27-36, march 2023 | 32 that the isolated bacteria in this study may develop resistance mechanisms. further studies are required to fully understand this finding. identification of bacteria based on the 16s rrna gene from all antibiotic resistant isolates, we got 955 to 1460 bp length fragments. reconstructed phylogenetic tree analysis revealed that two isolates of amoxicillin resistant bacteria (amx 2.1 and amx 2.2) were sitting among aeromonas species with low bootstrap value. a similar situation was shown by one chloramphenicol-resistant isolate (cap 2.2), which was sitting among shigella species with relatively low bootstrap value. it means that position is not confidently accepted and needs more genetic analysis to clarify this result. on the other hand, tet 2.1, cap 2.3, amx 2.3, and cap 2.1 were forming a distinct clade splited from bacillus spesies with high bootstrap value (figure 3). the results of the phylogenetic tree reconstruction showed that amx 2.1 and amx 2.2 isolates were suspected to be aeromonas caviae or aeromonas dhakensis. a. dhakensis causes soft tissue infections, bloodstream infections in immunocompromised individuals with malignancy and cirrhosis. a higher mortality rate was observed in cases of bacteremia (puah et al., 2022). it has been reported that a. veronii isolated from lake erie showed resistance to tetracycline (skwor et al., 2014). aeromonas spp. isolates were susceptible to chloramphenicol found in freshwater fish (fauzi et al., 2021). resistance of a. dhakensis to erythromycin, amoxicillin, and ampicillin has also been reported (soto-rodriguez et al., 2018). this study also revealed that amx 2.3 isolate, cap 2.1 isolate, cap 2.3 isolate, and tet 2.1 isolate were suspected to be species of the genus bacillus. some species of bacillus are involved in food poisoning, except for b. anthracis which causes anthrax (tarek et al., 2021). furthermore, some bacillus sp. was found to have high resistance to βlactams, fluoroquinolones, and tetracyclines (mbhele et al., 2021). analyzing the position of cap 2.2 isolate in the phylogenetic tree, we suggest that the isolate belongs to shigella sp. contamination of shigella spp. to the water can be occurred through human and pet waste (garcia et al., 2017). shigella spp. is the most common bacterium that causes bacillary dysentery (shigellosis), a disease characterized by damage to the colonic mucosa caused by bacterial invasion (garcia et al., 2017). this member of shigella has also been reported to be resistant to several antibiotics, such as ampicillin, chloramphenicol, tetracycline, and trimethoprim-sulfamethoxazole (meiyanti et al., 2016). again, a thorough investigation is required to prove it. the tet 2.2 isolate was suspected to be aeromonas veronii since this isolate stayed in the same clade with a convincing bootstrap value. a. veronii is a facultative anaerobic, gram-negative, and bacillusshaped bacterium (li et al., 2020). this species had been known to cause diarrhea and sepsis in humans (fernández-bravo et al., 2020). in particular, a. veronii is a common pathogen in aquaculture, which infects freshwater fish. drug sensitivity tests showed that the a. veronii isolate strain 18bj181 was resistant to against four antibacterial drugs, including amoxicillin, madinomycin, penicillin, and sulfamethoxazole, while quite sensitive to erythromycin and rifampin (wang et al., 2021). resistance to tetracyclines has also been reported in isolates of a. veronii which have been confirmed to have teta and tete genes (kim et al., 2020). the amx 2.3, cap 2.1, cap 2.3, and tet 2.1 isolates, which were found to be gram negative, phylogenetically formed an exclusive clade inside bacillus genus big cluster which well known as gram positive bacteria. considering carefully the finding that these isolates were multi-antibiotic resistant, thus we suggest that both morphological and physiological changes have been occurred. those changes might be caused by certain significant mutations. on the other hand, changes in bacterial colony morphology and cell shape found in this study, might be possible as a result of antibiotic treatment and the concentration given in this experiment as of reported by peach et al. (2013) and the length of exposure (cushnie et al., 2016). the morphology of e. coli bacterial cells exposed to the antibiotics after three hours showed a change in cell shape to resemble to the diplobacilli-like, diplococci, or forming a typical intracellular inclusion body (dufour et al., 2017). overall, our findings in this study are still far from clear. more genetic studies including dna barcoding approaches using stronger markers, genetic analysis on responsible genes that may induce antibiotic resistance, and enzymatic bioassays are urgently required. enzymatic analysis would confirm whether the isolates produce β-lactamase that makes it resistant. meanwhile, genetic analysis which focusing on certain genes mutation may reveal how those isolates developed their resistance, especially those that became multi-antibiotic resistant while phylogenetically coexisting gram 33| sholekah & listyorini., genetic identification of superbugs references figure 3. isolates taxonomical position based on 16s rrna in neighbor joining method positive bacteria, may help to determine the possible mutations which lead to the resistance to the given antibiotic. conclusion this study found eight isolates grew on lb media, three isolates grew on amoxicillin media, three isolates grew on chloramphenicol media, and two isolates grew on tetracycline media. based on colony morphology and gram staining, we found that one isolate was multi-resistant to amoxicillin and tetracycline, and the other was multi-resistant against amoxicillin and chloramphenicol. genetically, the isolates found were suggested to be members of aeromonas, shigella, and bacillus. further research is needed to ensure the accuracy of isolated species found. acknowledgments the author would like to thanks to lp2m of state university of malang for partial financial support through the pnbp thesis grant 2022 scheme to d.l and r.a.s under contract no. 19.5.857/un32.20.1/lt/202. references akhavan bj, khanna nr, & v. p. (2022). amoxicillin. in: statpearls [internet]. treasure island (fl): statpearls publishing. https://www.ncbi.nlm.nih.gov/books/nbk48225 0/ amaral, l., martins, a., spengler, g., & molnar, j. (2014). efflux pumps of gram-negative bacteria: what they do, how they do it, with what and how to deal https://www.ncbi.nlm.nih.gov/books/nbk482250/ https://www.ncbi.nlm.nih.gov/books/nbk482250/ jurnal riset biologi dan aplikasinya, 5(1): 27-36, march 2023 | 34 with them. frontiers in pharmacology, 4 jan(january), 1–11. https://doi.org/10.3389/fphar.2013.00168 bergeron, s., boopathy, r., nathaniel, r., corbin, a., & lafleur, g. (2015). presence of antibiotic resistant bacteria and antibiotic resistance genes in raw source water and treated drinking water. international biodeterioration & biodegradation, 102, 370-374. https://doi.org/10.1016/j.ibiod.2015.04.017 baquero, f., & levin, b. r. (2021). proximate and ultimate causes of the bactericidal action of antibiotics. nature reviews microbiology, 19(2), 123–132. https://doi.org/10.1038/s41579-020-00443-1 bernatová, s., samek, o., pilát, z., šerý, m., ježek, j., jákl, p., šiler, m., krzyžánek, v., zemánek, p., holá, v., dvorácková, m., & ružicka, f. (2013). following the mechanisms of bacteriostatic versus bactericidal action using raman spectroscopy. molecules, 18(11), 13188–13199. https://doi.org/10.3390/molecules181113188 bidell, m. r., pai, m. a. p., & lodise, t. p. (2020). use of oral tetracyclines in the treatment of adult patients with community-acquired bacterial pneumonia: a literature review on the often-overlooked antibiotic class. antibiotics, 9(12), 1–22. https://doi.org/10.3390/antibiotics9120905 blanco antonio, g. b. (2017). medical biochemistry. academic press. bradford, s. a., & harvey, r. w. (2017). future research needs involving pathogens in groundwater. hydrogeology journal, 25(4), 931. https://doi.org/10.1007/s10040-016-1501-0 cai, l., & zhang, t. (2013). detecting human bacterial pathogens in wastewater treatment plants by a high-throughput shotgun sequencing technique. environmental science and technology, 47(10), 5433– 5441. https://doi.org/10.1021/es400275r chukwudi, c. u. (2016). rrna binding sites and the molecular mechanism of action of the tetracyclines. in antimicrobial agents and chemotherapy, 60(8). https://doi.org/10.1128/aac.00594-16 cushnie, t. p. t., o’driscoll, n. h., & lamb, a. j. (2016). morphological and ultrastructural changes in bacterial cells as an indicator of antibacterial mechanism of action. cellular and molecular life sciences, 73(23), 4471–4492. https://doi.org/10.1007/s00018-016-2302-2 doi, y., & chambers, h. f. (2014). penicillins and βlactamase inhibitors. in mandell, douglas, and bennett’s principles and practice of infectious diseases (eighth edi, vol. 1, issue 1). elsevier inc. https://doi.org/10.1016/b978-1-4557-48013.00020-5 dufour, n., delattre, r., ricard, j. d., & debarbieux, l. (2017). the lysis of pathogenic escherichia coli by bacteriophages releases less endotoxin than by βlactams. clinical infectious diseases, 64(11), 1582– 1588. https://doi.org/10.1093/cid/cix184 fauzi, n. n. f. n. m., hamdan, r. h., mohamed, m., ismail, a., zin, a. a. m., & mohamad, n. f. a. (2021). prevalence, antibiotic susceptibility, and presence of drug resistance genes in aeromonas spp. isolated from freshwater fish in kelantan and terengganu states, malaysia. veterinary world, 14(8), 2064. https://doi.org/10.14202/vetworld.2021.20642072 fernández-bravo, a., fort-gallifa, i., ballester, f., pujol, i., gomez-bertomeu, f., domínguez, m., micó, m., alcoceba, e., simó-sisó, j. m., & figueras, m. j. (2020). a case of aeromonas trota in an immunocompromised patient with diarrhea. microorganisms, 8(3), 1–6. https://doi.org/10.3390/microorganisms8030399 garcia-aljaro, c., momba, m. and muniesa, m. (2017). pathogenic members of escherichia coli & shigella spp. shigellosis. michigan state university. garza az, park sb, k. r. (2020). drug elimination. in: statpearls [internet]. treasure island (fl): statpearls. https://pubmed.ncbi.nlm.nih.gov/31613442/ google maps. (2022). [sampling location point]. retrieved august 8, 2022, from https://www.google.com/maps/place/7%c2%b05 7'41.0%22s+112%c2%b037'06.9%22e/@7.96139 37,112.6175212,19z/data=!3m1!4b1!4m9!1m2!2m1 !1sfaculty+enginering!3m5!1s0x0:0x1ce987ef2337 243c!7e2!8m2!3d-7.961395!4d112.6185776 hall, w., mcdonnell, a., o’neill, j. (2018). superbugs: an arms race against bacteria. harvard university press. hanekamp, j. c., & bast, a. (2015). antibiotics exposure and health risks: chloramphenicol. environmental toxicology and pharmacology, 39(1), 213–220. https://doi.org/10.1016/j.etap.2014.11.016 huang, j. j., hu, h. y., lu, s. q., li, y., tang, f., lu, y., & wei, b. (2012). monitoring and evaluation of antibiotic-resistant bacteria at a municipal wastewater treatment plant in china. environment international, 42(1), 31–36. https://doi.org/10.1016/j.envint.2011.03.001 hughes, s. r., kay, p., & brown, l. e. (2013). global synthesis and critical evaluation of pharmaceutical data sets collected from river systems. environmental science and technology, 47(2), 661– 677. https://doi.org/10.1021/es3030148 jia, s., & zhang, x. (2019). biological hrps in wastewater. in high-risk pollutants in wastewater. elsevier inc. https://doi.org/10.1016/b978-0-12-8164488.00003-4 kapoor, g., saigal, s., & elongavan, a. (2017). action and resistance mechanisms of antibiotics: a guide for clinicians. journal of anaesthesiology, clinical pharmacology, 33(3), 300-305. https://doi.org/300. 10.4103/joacp.joacp_349_15 kim, h. y., jun, j. w., lim, s. r., park, s. y., han, j. e., park, s. c., & kim, j. h. (2020). first report of tetracycline-resistant aeromonas veronii infection in amur catfish (silurus asotus) cultured in korea. korean journal of veterinary research, 59(4), 207– 211. https://doi.org/10.14405/kjvr.2019.59.4.207 lan, y., rosen, g., & hershberg, r. (2016). marker genes that are less conserved in their sequences are useful for predicting genome-wide similarity levels between closely related prokaryotic strains. microbiome, 4, 1– 13. https://doi.org/10.1186/s40168-016-0162-5 li, t., raza, s. h. a., yang, b., sun, y., wang, g., sun, w., qian, a., wang, c., kang, y., & shan, x. (2020). aeromonas veronii infection in commercial freshwater fish: a potential threat to public health. animals, 10(4), 1–11. https://doi.org/10.3390/ani10040608 li, x., watanabe, n., xiao, c., harter, t., mccowan, b., liu, y., & atwill, e. r. (2014). antibiotic-resistant e. coli in surface water and groundwater in dairy operations in northern california. environmental monitoring and assessment, 186, 1253-1260. https://doi.org/10.1007/s10661-013-3454-2 mbhele, zamile n., christiana o. shobo, daniel g. amoako, https://doi.org/10.3389/fphar.2013.00168 https://doi.org/10.1016/j.ibiod.2015.04.017 https://doi.org/10.1038/s41579-020-00443-1 https://doi.org/10.3390/molecules181113188 https://doi.org/10.3390/antibiotics9120905 https://doi.org/10.1007/s10040-016-1501-0 https://doi.org/10.1021/es400275r https://doi.org/10.1128/aac.00594-16 https://doi.org/10.1007/s00018-016-2302-2 https://doi.org/10.1016/b978-1-4557-4801-3.00020-5 https://doi.org/10.1016/b978-1-4557-4801-3.00020-5 https://doi.org/10.1093/cid/cix184 https://doi.org/10.14202/vetworld.2021.2064-2072 https://doi.org/10.14202/vetworld.2021.2064-2072 https://doi.org/10.3390/microorganisms8030399 https://pubmed.ncbi.nlm.nih.gov/31613442/ https://www.google.com/maps/place/7%c2%b057'41.0%22s+112%c2%b037'06.9%22e/@7.9613937,112.6175212,19z/data=!3m1!4b1!4m9!1m2!2m1!1sfaculty+enginering!3m5!1s0x0:0x1ce987ef2337243c!7e2!8m2!3d-7.961395!4d112.6185776 https://www.google.com/maps/place/7%c2%b057'41.0%22s+112%c2%b037'06.9%22e/@7.9613937,112.6175212,19z/data=!3m1!4b1!4m9!1m2!2m1!1sfaculty+enginering!3m5!1s0x0:0x1ce987ef2337243c!7e2!8m2!3d-7.961395!4d112.6185776 https://www.google.com/maps/place/7%c2%b057'41.0%22s+112%c2%b037'06.9%22e/@7.9613937,112.6175212,19z/data=!3m1!4b1!4m9!1m2!2m1!1sfaculty+enginering!3m5!1s0x0:0x1ce987ef2337243c!7e2!8m2!3d-7.961395!4d112.6185776 https://www.google.com/maps/place/7%c2%b057'41.0%22s+112%c2%b037'06.9%22e/@7.9613937,112.6175212,19z/data=!3m1!4b1!4m9!1m2!2m1!1sfaculty+enginering!3m5!1s0x0:0x1ce987ef2337243c!7e2!8m2!3d-7.961395!4d112.6185776 https://www.google.com/maps/place/7%c2%b057'41.0%22s+112%c2%b037'06.9%22e/@7.9613937,112.6175212,19z/data=!3m1!4b1!4m9!1m2!2m1!1sfaculty+enginering!3m5!1s0x0:0x1ce987ef2337243c!7e2!8m2!3d-7.961395!4d112.6185776 https://doi.org/10.1016/j.etap.2014.11.016 https://doi.org/10.1016/j.envint.2011.03.001 https://doi.org/10.1021/es3030148 https://doi.org/10.1016/b978-0-12-816448-8.00003-4 https://doi.org/10.1016/b978-0-12-816448-8.00003-4 https://doi.org/300.%2010.4103/joacp.joacp_349_15 https://doi.org/300.%2010.4103/joacp.joacp_349_15 https://doi.org/10.14405/kjvr.2019.59.4.207 https://doi.org/10.1186/s40168-016-0162-5 https://doi.org/10.3390/ani10040608 https://doi.org/10.1007/s10661-013-3454-2 35| sholekah & listyorini., genetic identification of superbugs oliver t. zishiri, & l. a. b. (2021). occurrence, antibiotic resistance, virulence factors, and genetic diversity of bacillus spp. from public hospital environments in south africa. microbial drug resistance, 27(12), 1692–1704. meiyanti, m., salim, o. c., herwana, e., kalumpiu, j. v, & lesmana, m. (2016). antibiotic susceptibility of salmonella, shigella and vibrio isolated from diarrhea patients in jakarta, indonesia. jurnal kedokteran dan kesehatan indonesia, 7(3), 95–101. https://doi.org/10.20885/jkki.vol7.iss3.art4 mohammad alimudin habibi, l. m. dan s. y. w. (2014). studi konsentrasi fospat bioavailable dan karbon organik total (kot) dalam sedimen di perairan benteng portugis, jepara. journal of oceanography, 3(4), 690–697. mulyadi, i., zaman, b., & sumiyati, s. (2020). mercury concentrations of river water and sediment in tambang sawah village due to unlicensed gold mining. jurnal ilmiah teknik kimia, 4(2), 2–6. nemeth, j., oesch, g., & kuster, s. p. (2015). bacteriostatic versus bactericidal antibiotics for patients with serious bacterial infections: systematic review and meta-analysis. journal of antimicrobial chemotherapy, 70(2), 382–395. https://doi.org/10.1093/jac/dku379 oong gc, t. p. (2021). chloramphenicol. statpearls. [internet]. treasure island (fl): statpearls publishing. https://www.ncbi.nlm.nih.gov/books/nbk55596 6/. organization, w. h. (2014). antimicrobial resistance global report on surveillance: 2014 summary (no.who/hse/ped/aip/2014.2). world health organization. orylska r, m., placek, w., & owczarczyk-saczonek, a. (2022). tetracyclines—an important therapeutic tool for dermatologists. international journal of environmental research and public health, 19(12), 7246. https://doi.org/10.3390/ijerph19127246 pakbin, b., amani, z., allahyari, s., mousavi, s., mahmoudi, r., brück, w. m., & peymani, a. (2021). genetic diversity and antibiotic resistance of shigella spp. isolates from food products. food science and nutrition, 9(11), 6362–6371. https://doi.org/10.1002/fsn3.2603 parathon, h., kuntaman, k., widiastoety, t. h., muliawan, b. t., karuniawati, a., qibtiyah, m., djanun, z., tawilah, j. f., aditama, t., thamlikitkul, v., & vong, s. (2017). progress towards antimicrobial resistance containment and control in indonesia. bmj (online), 358, 31–35. https://doi.org/10.1136/bmj.j3808 peach, k. c., bray, w. m., winslow, d., linington, p. f., & linington, r. g. (2013). mechanism of action-based classification of antibiotics using high-content bacterial image analysis. molecular biosystems, 9(7), 1837–1848. https://doi.org/10.1039/c3mb70027e pertiwi, m. p., praseptin, p. k. h., werdani, i. d., listyorini, d., & prabaningtyas, s. (2018). identification and phylogenetic study of bioluminescent bacteria from squid (loligo duvaucelii) based on 16s rrna gene. aip conference proceedings, 2002(august). https://doi.org/10.1063/1.5050134 pradipta, i., kartikawati, a., hartanto, h., febrina, e., ronasih, e., abdulah, r., & amelia, r. (2015). three years of antibacterial consumption in indonesian community health centers: the application of anatomical therapeutic chemical/defined daily doses and drug utilization 90% method to monitor antibacterial use. journal of family and community medicine, 22(2), 101. https://doi.org/10.4103/2230-8229.155385 prasetio, r. a., isnawati, i., & rahayu, d. a. (2021). molecular identification of pathogenic bacteria in kantong semar plants (nepenthes gracillis) based on mitochondrial 16s rrna gene. in e3s web of conferences, 328, 1-7. https://doi.org/10.1051/e3sconf/202132808005 puah, s. m., khor, w. c., aung, k. t., lau, t. t. v., puthucheary, s. d., & chua, k. h. (2022). aeromonas dhakensis: clinical isolates with high carbapenem resistance. pathogens, 11(8), 1–10. https://doi.org/10.3390/pathogens11080833 puspita, i., ibrahim, l., & hartono, d. (2016). influence of the behavior of citizens residing in riverbanks to the decrease of water quality in the river of karang. jurnal manusia dan lingkungan, 23(2), 249. https://doi.org/10.22146/jml.18797 rahardjo, d., & prasetyaningsih, a. (2021). pengaruh aktivitas pembuangan limbah cair industri kulit terhadap profil pencemar kromium di lingkungan serta moluska, ikan dan padi di sepanjang aliran sungai opak bagian hilir. prosiding seminar nasional unimus, 4, 1830– 1841. rajendran, r. (2018). superbug infection. journal of drug metabolism & toxicology, 09(02), 9–11. https://doi.org/10.4172/2157-7609.1000238 ren, hongqiang, & x. z. (2019). high-risk pollutants in wastewater. elsevier inc. reygaert, w. c. (2018). an overview of the antimicrobial resistance mechanisms of bacteria. aims microbiology, 4(3), 482-501. https://doi.org/10.3934/microbiol.2018.3.482 sarkar, m., chakraborty, s., kundu, d., ghosh, s., khan, a., karmakar, d., ali, s., & mandal, s. (2019). isolation and characterization of bacteria from sewage and pond water, malda, india. acta scientific microbiology, 2(9), 28–34. https://doi.org/10.31080/asmi.2019.02.0394 sartelli, m., guirao, x., hardcastle, t. c., kluger, y., boermeester, m. a., raşa, k., ansaloni, l., coccolini, f., montravers, p., abu-zidan, f. m., bartoletti, m., bassetti, m., ben-ishay, o., biffl, w. l., chiara, o., chiarugi, m., coimbra, r., de rosa, f. g., de simone, b., catena, f. (2018). 2018 wses/sis-e consensus conference: recommendations for the management of skin and soft-tissue infections. world journal of emergency surgery, 13(1), 1–24. https://doi.org/10.1186/s13017-018-0219-9 shutter mc, a. h. (2022). tetracycline. in: statpearls [internet]. treasure island (fl): statpearls publishing. https://www.ncbi.nlm.nih.gov/books/nbk54990 5/ skwor, t., shinko, j., augustyniak, a., gee, c., & andraso, g. (2014). aeromonas hydrophila and aeromonas veronii predominate among potentially pathogenic ciprofloxacin-and tetracycline-resistant aeromonas isolates from lake erie. applied and environmental microbiology, 80(3), 841-848. https://doi.org/10.1128/aem.03645-13 smith, c. a., skibinski, k., & livingston, m. (2020). response: update on pharmaceutical waste disposal regulations-strategies for success. american journal of health-system pharmacy, 77(21), 1720–1721. https://doi.org/10.20885/jkki.vol7.iss3.art4 https://doi.org/10.1093/jac/dku379 https://www.ncbi.nlm.nih.gov/books/nbk555966/ https://www.ncbi.nlm.nih.gov/books/nbk555966/ https://doi.org/10.3390/ijerph19127246 https://doi.org/10.1002/fsn3.2603 https://doi.org/10.1136/bmj.j3808 https://doi.org/10.1039/c3mb70027e https://doi.org/10.1063/1.5050134 https://doi.org/10.4103/2230-8229.155385 https://doi.org/10.1051/e3sconf/202132808005 https://doi.org/10.3390/pathogens11080833 https://doi.org/10.22146/jml.18797 https://doi.org/10.4172/2157-7609.1000238 https://doi.org/10.3934/microbiol.2018.3.482 https://doi.org/10.31080/asmi.2019.02.0394 https://doi.org/10.1186/s13017-018-0219-9 https://www.ncbi.nlm.nih.gov/books/nbk549905/ https://www.ncbi.nlm.nih.gov/books/nbk549905/ https://doi.org/10.1128/aem.03645-13 jurnal riset biologi dan aplikasinya, 5(1): 27-36, march 2023 | 36 https://doi.org/10.1093/ajhp/zxaa227 soto-rodriguez, s. a., lozano-olvera, r., garcia-gasca, m. t., abad-rosales, s. m., gomez-gil, b., & ayalaarellano, j. (2018). virulence of the fish pathogen aeromonas dhakensis: genes involved, characterization and histopathology of experimentally infected hybrid tilapia. diseases of aquatic organisms, 129(2), 107–116. https://doi.org/10.3354/dao03247 suhartono, s., ismail, y. s., & aini, z. (2021). distribution of multidrug-resistant salmonella spp. recovered from aquatic environment of banda aceh, indonesia. biodiversitas, 22(2), 881–886. https://doi.org/10.13057/biodiv/d220243 tahrani, l., soufi, l., mehri, i., najjari, a., hassan, a., van loco, j., reyns, t., cherif, a., & mansour, h. ben. (2015). isolation and characterization of antibioticresistant bacteria from pharmaceutical industrial wastewaters. microbial pathogenesis, 89, 54–61. https://doi.org/10.1016/j.micpath.2015.09.001 tan, c. w., & chlebicki, m. p. (2016). urinary tract infections in adults. singapore medical journal, 57(9), 485–490. https://doi.org/10.11622/smedj.2016153 tarek f. el-arabi, m. w. g. (2021). foodborne infections and intoxications (fifth edition). academic press. verawaty, m., apriani, n., tarigan, l. r., aprian, e. t., laurenta, w. c., & muharni. (2020). antibiotics resistant escherichia coli isolated from aquatic ecosystems in palembang, south sumatra, indonesia. biodiversitas, 21(1), 86–97. https://doi.org/10.13057/biodiv/d210113 wang, b., mao, c., feng, j., li, y., hu, j., jiang, b., gu, q., & su, y. (2021). a first report of aeromonas veronii infection of the sea bass, lateolabrax maculatus in china. frontiers in veterinary science, 7(january), 1– 12. https://doi.org/10.3389/fvets.2020.600587 wu, d., ding, y., yao, k., gao, w., & wang, y. (2021). antimicrobial resistance analysis of clinical escherichia coli isolates in neonatal ward. frontiers in pediatrics, 9(may), 1–7. https://doi.org/10.3389/fped.2021.670470 yarza, h. l., yanwirasti, y., & irawati, l. (2015). hubungan tingkat pengetahuan dan sikap dengan penggunaan antibiotik tanpa resep dokter. jurnal kesehatan andalas, 4(1), 151–156. https://doi.org/10.25077/jka.v4i1.214 zhou, z.-c., liu, y., lin, z.-j., shuai, x.-y., zhu, l., xu, l., meng, l.-x., sun, y.-j., & chen, h. (2020). antibiotic resistance associated with air quality and transferred by airborne particulate matter. microbiome. 1-20. https://doi.org/10.21203/rs.2.23315/v1 https://doi.org/10.1093/ajhp/zxaa227 https://doi.org/10.3354/dao03247 https://doi.org/10.13057/biodiv/d220243 https://doi.org/10.1016/j.micpath.2015.09.001 https://doi.org/10.11622/smedj.2016153 https://doi.org/10.13057/biodiv/d210113 https://doi.org/10.3389/fvets.2020.600587 https://doi.org/10.3389/fped.2021.670470 https://doi.org/10.25077/jka.v4i1.214 https://doi.org/10.21203/rs.2.23315/v1 jurnal riset biologi dan aplikasinya, volume 4, issue 1, march 2022 araceae floristic and potential study in bogor botanical gardens, west java, indonesia rizal koen asharo1*, ayu novitasari1, sri devi nur azizah1, rahadian ajeng saraswati1, fani setyaningsih1, puput apriliani1, rizky priambodo1, pinta omas pasaribu1, vina rizkawati1, usman2 1department of biology,faculty of mathematics and natural science, universitas negeri jakarta jln. rawamangun muka raya no.11, rw.14, rawamangun, kec. pulo gadung, east jakarta, jakarta 2 research center for plant conservation and botanical gardens lipi jln. ir. h. juanda no.13, paledang, kecamatan bogor tengah, kota bogor, jawa barat *corresponding author: e-mail: koenindo@gmail.com article history abstract received : 28 february 2022 bogor botanical gardens is a conservation area that assists the preservation of flora in indonesia, including the araceae. araceae is often used by the public as medicine, food sources, and ornamental plants. therefore, the araceae is often used as an interesting research object and conservation efforts have commenced maintaining its sustainability. the purpose of this research was to determine the species of living araceae and the potential possessed by each living araceae species in the conservation area of the bogor botanical gardens. this research was conducted on 8-9 june 2021 to determine the diversity and potential of the araceae in bogor botanical gardens. the method used in this research is the exploring method and data analysis using descriptive method. the result of this research revealed there were 60 species of araceae consisting of 25 genera. the genera with the highest number of species are philodendron. two species of them are araceae which has a habitat in the waters. a total of 33 species are terrestrial and 25 are epiphytic plants. araceae have many potentials, such as food, aromatic, medicine, flavoring, animal feed, and ornamental plants. more than 50% of the araceae species were used as ornamental plants. revised : 15 march 2022 approved : 29 march 2022 published : 31 march 2022 keywords araceae, diversity, potential, bogor botanical garden how to cite: asharo, r.k., novitasari, a., azizah, s.d.n., saraswati, r.a., setyaningsih, f., apriliani, p., priambodo, r., pasaribu, p.o., rizkawati, v & usman (2022). araceae floristic and potential study in bogor botanical gardens, west java, indonesia. jurnal riset biologi dan aplikasinya. 4(1): 9-18. doi:10.26740/jrba.v4n1.p 9-18. introduction indonesia is a country that has a high level of flora and fauna diversity. this high biodiversity is partly due to the geographical location of indonesia, which is traversed by the equator and is located in a tropical climate. of the approximately 1.7 million species of plants that exist in the world, around 101,000 species have been identified in indonesia and 40-50% are endemic plants (lipi, 2014; bappenas, 2016; aryani, 2016). this diversity includes various kinds of plants, one of which is the araceae. araceae is one of the largest monocotyledonous families with key characteristics, namely herbs and inflorescences arranged in the form of a cob (spadix) surrounded by a spathe (boyce et al., 2010). this family can grow well in tropical areas that have high humidity and will be difficult to grow in dry conditions (kurniawan et al., 2013). according to suhono et al. (2010), araceae plants can live in lowland and highland areas with moderate to cold climates, so araceae plants are often found in indonesian forest areas. the araceae has become one of the most important plants in indonesia. this is because many jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi mailto:koenindo@gmail.com jurnal riset biologi dan aplikasinya, 4(1): 9-18, march 2022 | 10 species of araceae have their potential, so araceae plants are widely used to meet the needs of the indonesian people, such as food, medicine, ornamental, and others. generally, the species of araceae genera aglaonema and anthurium have the potential as ornamental plants. several species of araceae also have potential as alternative food ingredients, such as taro (colocasia esculenta (l.) schott) and suweg (amorphophallus paeoniifolius (dennst.) nicolson); as medicine, namely rat taro (typhonium flagelliform blume) and epipremnum pinnatum (l.) engl.; as well as animal feed ingredients such as montrichardia arborescens (l.) schott. the high potential and diversity of araceae in indonesia encourage experts to conduct research on araceae in various regions in indonesia. one area that has the potential for habitat for araceae growth is the bogor botanical gardens. bogor botanical gardens is an ex-situ plant conservation area in indonesia. the existence of araceae species in the bogor botanical gardens has been previously reported by several researchers. yuzammi (2018) reported that there were 36 genera and 130 species with 21 genera native to indonesia, bogor botanical gardens. hariri et al. (2019) report that two species of typhonium grow and spread in the bogor botanical gardens. in this study, data were collected on all live araceae species found in the collection and non-collection areas that we explored. this study aims to determine the species of living araceae and the potential possessed by each living araceae species in the conservation area of the bogor botanical gardens. materials and methods the research was conducted at the bogor botanical gardens, central bogor district, bogor city, west java. this research was conducted during june 8-9, 2021. this study was a descriptive method using exploring method of data collection. determination of the location is done by purposive sampling. the tools used in this research are meter, stationery, gps (global positioning system), identification book “the genera of araceae” and camera. the materials or objects in this study are plant species of the araceae. the research location was determined by exploring the bogor botanical gardens area which was divided into 7 locations (figure 1). the araceae plants found were observed by recording their characters in detail and documenting. identification of araceae was carried out using the identification literatures: the genera of araceae (mayo et al., 1997), descriptor taro (ipgri, 1999), and the araceae of borneo–the genera (boyce et al., 2010). in addition, a literature study was also conducted on several potentials possessed by each type of araceae that live in the bogor botanical gardens area. data on araceae species are presented qualitatively in the form of a description of the character, habitat, and distribution of araceae plants accompanied by photos of dominant species. furthermore, the use of araceae plants found in the conservation area of the bogor botanical gardens is presented. figure 1. map of research locations. (1) araceae garden, (2) araceae collection garden, (3) kenari i street, (4) kenari ii street, (5) orchid nursery, (6) giant lotus pond, (7) astrid avenue. results and discussion based on observations that have been made, obtained 60 species from 25 genera araceae in the bogor botanical gardens (table 1). location 2 has the most abundant araceae species diversity because this location was a collection location for araceae. the most commonly found genus of araceae is philodendron. the araceae were observed to grow in three species of habitats, namely terrestrial as many as 33 species, epiphyte as many as 25 species, and aquatic as many as 2 species. locations 1 and 2 had the highest number of collection plant species, while at location 7 there were only non-collected plants. furthermore, the distribution of collected and non-collected plant species in the bogor botanical gardens based on each location can be seen in figure 2. collection plants are plants that have recorded species names, important information, the process of entering the botanical gardens until the plants die. 11 | asharo et al.; araceae floristic and potential study in bogor botanical gardens table 1. distribution of araceae species in bogor botanical gardens and their habitats. genus species habitat location 1 2 3 4 5 6 7 aglaonema a. marantifolium blume terrestrial  a. nitidum (jack) kunth  a. simplex blume  alocasia a. alba schott terrestrial    a. macrorrhizos (l.) g.don     a. suhirmaniana yuzammi & a.hay  amorphophallus a. muelleri blume terrestrial  a. paeoniifolius (dennst.) nicolson  a. titanum (becc.) becc.  amorphophallus sp.  amydrium a. zippelianum (schott) nicolson epiphyte  amydrium sp.  anthurium a. cordatum (l.) schott terrestrial  a. crassinervium (jacq.) schott  a. pedatoradiatum schott  anthurium sp.   apoballis a. acuminatissima (schott) s.y.wong & p.c.boyce terrestrial  a. rupestris (zoll. & moritzi) s.y.wong & p.c.boyce  colocasia c. esculenta (l.) schott terrestrial       culcasia c. mannii (hook.f.) engl. terrestrial  cyrtosperma cyrtosperma sp. aquatic  dieffenbachia d. bowmannii h.j.veitch terrestrial  d. fournieri n.e.br.  d. seguine (jacq.) schott   d. x splendens w.bull   dieffenbachia sp.   epipremnum e. falcifolium engl. epiphyte   e. nobile (schott) engl.   e. pinnatum (l.) engl.     homalomena h. cordata schott terrestrial   h. pendula (blume) bakh.f.   leucocasia l. gigantea (blume) schott terrestrial      monstera m. oblique miq. epiphyte  montrichardia m. arborescens (l.) schott aquatic  philodendron p. bipinnatifidum (schott ex endl.) sakur. epiphyte   p. crassinervium lindl.  p. erubescens k.koch & augustin  p. imbe schott ex kunth  p. melanochrysum linden & andré  p. panduriforme (kunth) kunth   p. sagittifolium liebm.  p. squamiferum poepp.  p. tripartitum (jacq.) schott  philodendron sp.    pothos pothos sp. epiphyte  rhaphidophora r. foraminifera (engl.) engl. epiphyte    r. korthalsii schott  r. montana (blume) schott  r. sylvestris (blume) engl.  rhodospata rhodospata sp. epiphyte  schismatoglottis s. calyptrata (roxb.) zoll. & moritzi terrestrial  scindapsus s. pictus hassk. epiphyte  spathiphyllum s. cannifolium (dryand. ex sims) schott terrestrial   jurnal riset biologi dan aplikasinya, 4(1): 9-18, march 2022 | 12 genus species habitat location 1 2 3 4 5 6 7 s. commutatum schott   spathiphyllum sp.    syngonium s. auritum (l.) schott epiphyte   s. podophyllum schott      xanthosoma x. robustum schott terrestrial  x. sagittifolium (l.) schott  zamioculcas z. zamiifolia (g.lodd.) engl. terrestrial  note: : collectible plant, : non-collected plant, : collectible and non-collected plant figure 2. number of collection and non-collection plant species in the bogor botanical gardens usually, collection plants have a registration number to make it easier for the botanical gardens to manage the collection. meanwhile, non-collected plants are plants that live in the botanical gardens area but do not have a registration number like collection plants. in addition, non-collected plants usually grow in poorly managed areas. figure 1 shows the number of collected plant species is greater than that of non-collected plants. this is influenced by the role of the botanical gardens themselves, according to presidential decree no. 93 of 2011 is an ex-situ plant conservation area that has a documented and organized plant collection based on a taxonomic, bioregional, thematic classification pattern or a combination of these patterns for conservation, research, education, tourism, and environmental services. of course, there will be more collection plants than noncollections. non-collected plants also live in the bogor botanical gardens area, especially in areas that are not managed by the botanical gardens. non-collected araceae can grow wild because the seeds disperse outside the araceae collection gardens. barrancos et al. (2019) and renner (2004) reported araceae could disperse via wind, water current, and animals, such as a bird. furthermore, araceae grow in a wide range of environments, so they are easy to find anywhere (croat, 2019). locations 1 and 2 have the highest number of collection plant species because these locations are araceae collection gardens. likewise, location 7 only has non-collected araceae plants because location 7 is a quite lush and only has a path that is covered by other plants. the results of environmental observation show that soil humidity in 7 locations was 40-90%. harahap (2020) and mansur (2021) reported araceae can grow in 1590% humidity. soil temperature on 7 locations was 27-33oc and water temperature on location 6 was 32oc. ivanvic et al. (2008) and zotz et al. (2019) reported araceae was able to grow in 20-40oc temperature. soil acidity levels (ph) on 7 locations were 7-8 and water ph was 5. sumarwoto (2004) reported araceae can grow on 5.6-7.5 in ph. based on these results, all the locations are good habitats for the growth of araceae. the differences in the number of araceae in each location could be due to competition between plants, especially in the poorly managed area. competition with other plants, especially poaceae, will harm araceae because poaceae has great competitiveness and is one of the aggressive pioneer species (susanti et al., 2013). 13 | asharo et al.; araceae floristic and potential study in bogor botanical gardens figure 3 . a. alocasia macrorrhizos (l.) g.don (1), adaxial leaf (2); b. colocasia esculenta (l.) schott (1), adaxial leaf (2); c. epipremnum pinnatum (l.) engl.: creeping on the tree (1), adaxial leaf (2), stem (3); d. leucocasia gigantea (blume) schott (1), inflorescence (2); and e. rhaphidophora foraminifera (engl.) engl. (1), inflorescence (2), young leaves that have perforations (3). table 3. potential species of araceae that grow and are cultivated in the bogor botanical gardens as plants, food, ornamental, medicines, aromatics, and others genus species usefulness references f o o d o rn a m e n ta l m e d ic in e s a ro m a ti c s o th e rs aglaonema a. marantifolium blume ● nicolson, 1969 a. nitidum (jack) kunth ● ilhamullah et al., 2015 a. simplex blume ● ● ilhamullah et al., 2015; ismail et al., 2017 a1 a2 b1 b2 c1 c2 c3 d1 d2 e1 e2 e3 jurnal riset biologi dan aplikasinya, 4(1): 9-18, march 2022 | 14 genus species usefulness references f o o d o rn a m e n ta l m e d ic in e s a ro m a ti c s o th e rs alocasia a. alba schott ● asih and kurniawan, 2019 a. macrorrhizos (l.) g.don ● ● ● koller, 2008; erlinawati, 2010; yuzammi, 2018; eldeen et al., 2008 a. suhirmaniana yuzammi & a.hay ● erlinawati, 2010 amorphophallus a. muelleri blume ● ● asih and kurniawan, 2019; wahidah et al., 2021 a. paeoniifolius (dennst.) nicolson ● ● animal feed erlinawati, 2010; mutaqin et al., 2018 a. titanum (becc.) becc. ● yudaputra et al., 2021 amorphophallus sp. ● ● asih and kurniawan, 2019; mutaqin et al., 2018; wang and li, 2021 amydrium a. zippelianum (schott) nicolson ● lemmens et al., 1995 amydrium sp. ● lemmens et al., 1995 anthurium a. cordatum (l.) schott ● yuzammi, 2018 a. crassinervium (jacq.) schott ● yuzammi, 2018 a. pedatoradiatum schott ● yuzammi, 2018 anthurium sp. ● ● vardhana, 2008; yuzammi, 2018 apoballis a. acuminatissima (schott) s.y.wong & p.c.boyce ● yuzammi, 2018 a. rupestris (zoll. & moritzi) s.y.wong & p.c.boyce ● widodo and wibowo, 2012 colocasia c. esculenta (l.) schott ● ● animal feed asih and kurniawan, 2019; erlinawati, 2010; murthy, 2021 culcasia c. mannii (hook.f.) engl. ● yuzammi, 2018 cyrtosperma cyrtosperma sp. ● yuzammi, 2018 dieffenbachia d. bowmannii h.j.veitch ● ● syamjith et al., 2018 d. fournieri n.e.br. ● yuzammi, 2018 d. seguine (jacq.) schott ● mutaqin et al., 2018 d. x splendens w.bull ● yuzammi, 2018 dieffenbachia sp. ● ● oloyede et al., 2012 epipremnum e. falcifolium engl. ● yuzammi, 2018 e. nobile (schott) engl. ● yuzammi, 2018 e. pinnatum (l.) engl. ● ● asih and kurniawan, 2019; yuzammi, 2008 homalomena h. cordata schott ● yuzammi, 2018 h. pendula (blume) bakh.f. ● ● ● yuzammi, 2018 leucocasia l. gigantea (blume) schott ● flavoring sin yeng, 2016; sulaiman and mansoor, 2002 monstera m. oblique miq. ● yuzammi, 2018 montrichardia m. arborescens (l.) ● ● ● food for andel tr, 2000; portal et 15 | asharo et al.; araceae floristic and potential study in bogor botanical gardens genus species usefulness references f o o d o rn a m e n ta l m e d ic in e s a ro m a ti c s o th e rs schott manatee and turtle al., 2002 philodendron p. bipinnatifidum (schott ex endl.) sakur. ● ● kujawska et al., 2017 p. crassinervium lindl. ● yuzammi, 2018 p. erubescens k.koch & augustin ● rameshkumar, 2018 p. imbe schott ex kunth ● ● yuzammi, 2018 p. melanochrysum linden & andré ● yuzammi, 2018 p. panduriforme (kunth) kunth ● yuzammi, 2018 p. sagittifolium liebm. ● yuzammi, 2018 p. squamiferum poepp. ● ● otero et al., 2020; yuzammi, 2018 p. tripartitum (jacq.) schott ● yuzammi, 2018 philodendron sp. ● ● ● kujawska et al., 2017; rameshkumar, 2018; yuzammi, 2018 pothos pothos sp. ● yuzammi, 2018 rhaphidophora r. foraminifera (engl.) engl. ● yuzammi, 2018 r. korthalsii schott ● yeap et al., 2012 r. montana (blume) schott ● yuzammi, 2018 r. sylvestris (blume) engl. ● yuzammi, 2018 rhodospata rhodospata sp. ● yuzammi, 2018 schismatoglottis s. calyptrata (roxb.) zoll. & moritzi ● ● erlinawati et al., 2019; sulaiman and mansoor, 2002 scindapsus s. pictus hassk. ● munawaroh and yuzammi, 2016 spathiphyllum s. cannifolium (dryand. ex sims) schott ● ● abdullah et al., 2012 s. commutatum schott mutaqin et al., 2018 spathiphyllum sp. ● ● abdullah et al., 2012 syngonium s. auritum (l.) schott ● yuzammi, 2018 s. podophyllum schott ● benedetto et al., 2006 xanthosoma x. robustum schott ● ● nzietchueng, 1988; yuzammi, 2018 x. sagittifolium (l.) schott ● ● caxito et al., 2015; erlinawati, 2010 zamioculcas z. zamiifolia ● ● muharini et al., 2018 research on araceae diversity in the bogor botanical gardens has been carried out by yuzammi (2018). in this study, obtained a total of 130 species with 36 genera, while in this study obtained 60 species with 25 genera araceae. there is a considerable difference in the results between the results of this study and that of yuzammi (2018). this is because in yuzammi's research jurnal riset biologi dan aplikasinya, 4(1): 9-18, march 2022 | 16 (2018), data were collected on living araceae plants and araceae herbarium, while in this study data was collected only on living araceae plants. this difference in results can also be caused by the different araceae growing in 2018 and 2021. we did not find aglaodorum, anadendrum, anchomanes, anubias, cercestis, dracontium, gonatopus, holochlamys, lasia, and pistia. the reason for this difference is that araceae plants are not well cared for, unable to compete with other epiphytic plants, and the research time is short. the araceae has various potentials that can be utilized, such as food, medicine, and ornamental plants. several species of araceae which are used as food ingredients are colocasia esculenta (taro) (figure 3), xanthosoma sagittifolium (keladi), and amorphophallus paeoniifolius (suweg). araceae plants are also known to be antimalarial, cytotoxic (frausin et al., 2015), antibacterial, antifungal, antiinflammatory, and anti-cancer (chen et al., 2007). koller (2008) stated that both the rhizome and the leaf of alocasia macrorrhizos can be used to treat cancer, tumors and snake bites. dieffenbachia, which inhibits the activity of salmonella typhi and pseudomonas aeruginosa, and colocasia esculenta, which inhibits the activity of vibrio cholerae and v. harveyi. in addition, araceae can also be used as ornamental plants such as alocasia suhirmaniana and anthurium sp. the potential for araceae species found in the bogor botanical gardens area is listed in table 3. conclusion observation results obtained 60 species of araceae from 25 genera that can be identified in the bogor botanical gardens. two species of them are araceae which has a habitat in the waters. a total of 33 species are terrestrial and 25 are epiphytic plants. the location with the most araceae species found was at location 2 where 34 species of araceae were found, while location 6 was the location with the least number of araceae species, which only found 4 species of araceae. various potential uses of the araceae were observed, including food, aromatics, medicine, flavoring, animal feed, and ornamental plants. the greatest potential utilization is as an ornamental plant with a total of 48 species of all species observed. references abdullah, e., raus, r. a., & jamal, p. (2012). extraction and evaluation of antibacterial activity from selected flowering plants. american medical journal, 3(1), 2732 arga, p. h., suminarti, n. e., & ariffin, a. (2018). studi tingkat ketebalan mulsa jerami padi pada pertumbuhan dan hasil tanaman talas (colocasia esculenta (l.) schoot var. antiquorum) di lahan kering pada musim kemarau. jurnal produksi tanaman, 5(4), 1-10. aryani, i. (2017). studi keanekaragaman spermatophyta di perbukitan daerah tlogodlingo kecamatan tawangmangu kabupaten karanganyar. proceeding biology education conference: biology, science, enviromental, and learning, 14(1), 109-113. asih, n. p. s., & kurniawan, a. (2019). studi araceae bali: keragaman dan potensinya. jurnal widya biologi, 10(02), 135-147. asih, n. p. s., warseno, t., & kurniawan, a. g. u. n. g. (2015). studi inventarisasi araceae di gunung seraya (lempuyung), karangasem, bali. prosiding seminar nasional masyarakat biodiversitas indonesia, 1(3), 521-527. bago, a. s. (2020). identifikasi keragaman famili araceae sebagai bahan pangan, obat, dan tanaman hias di desa hilionaha kecamatan onolalu kabupaten nisa selatan. jurnal education and development, 8(4), 695695. bappenas, klh dan lipi. (2016). indonesia biodiversity strategy and action plan (ibsap) 2015-2020. kementerian perencanaan pembangunan nasional. barrancos, e. p. f., reid j. l., hall j. s. (2019). lack of araceae in young forest highlights the importance of mature forest conversation. tropical conservation science, 12 (1):1-9. benedetto, a. d., molinari, j., boschi, c., benedicto, d., cerrotta, m., & cerrotta, g. (2010). estimating crop productivity for five ornamental foliage plants. international journal of agricultural research, 5(11), 997-1008. boyce, p. c., & wong, s. y. (2012). studies on homalomena (araceae) of sumatera i: homalomena hypsiantha, a distinctive new species of the chamaecladon supergroup. webbia, 67(2), 147-150. boyce, p. c. (1999). the genus rhaphidophora hassk. (araceae-monsteroideae-monstereae) in peninsular malaysia and singapore. gardens’ bulletin singapore, 51(1), 183-256. boyce, p. c., wong, s. y., ting, a. p. j., low, s. e., ng, k.k., & ooi, i.h. (2010). the araceae of borneo the genera. journal of aroideana, 33(6), 126-129. caxito, m. l., correia, r. r., gomes, a. c. c., justo, g., coelho, m. g., sakuragui, c. m., kuster, r. m., & sabino, k. c. (2015). in vitro antileukemic activity of xanthosoma sagittifolium (taioba) leaf extract. evidence-based complementary and alternative medicine. chen, j., henny, r. j., liao, f. (2007). aroids are important medicinal plants. acta horticulturae, 756, 346-354. croat, t. b. (2019). araceae, a family with great potential. annals of the missouri botanical garden, 104(1), 3-9. croat, t. b., & ortiz, o. o. (2020). distribution of araceae and the diversity of life forms. acta societatis botanicorum poloniae, 89(3). darmayanti, a. s., & wuryanti, s. (2010). inventarisasi tumbuhan berkhasiat obat di wilayah desa egon, kecamatan waegete, kabupaten sikka nusa tenggara timur. berk. penel. hayati edisi khusus, 4, 5-11. drastistiyana, r. (2017). keanekaragaman dan kelimpahan vegetasi riparian di hulu dan tengah sungai. [skripsi]. yogyakarta: fakultas sains dan teknologi, uin sunan kalijaga 17 | asharo et al.; araceae floristic and potential study in bogor botanical gardens efendi, m., hapitasari, i. g., rustandi, s. a., & supriyatna, a. (2016). inventarisasi tumbuhan penghasil pewarna alami di kebun raya cibodas. bumi lestari journal of environment. 16 (1), 50-58. el-deen helal, e. g., el-wahab, a., samia, m., metwally, a. s. m., asran, a. m., zedan, h. a., & ali, m. a. h. (2008). effect of alocasia macrorrhiza extract on hepatorenal functions in mice. egyptian journal of hospital medicine, 33,9-18. erlinawati, i. (2010). the diversity of terestrial araceae in mt watuwila complex, south east of sulawesi, berk. penel. hayati, 15: 131137. erlinawati, i., asih, n. p. s., kuniawan, a., & yuzammi, y. (2019). studies on the araceae of the lesser sunda islands ii: new record for scindapsus hederaceus miq. in bali. reinwardtia, 18(2), 51-64. frausin, g., lima, r. b. s., hidalgo, a. f., ming, l. c., pohlit, a.m. (2015). plants of the araceae family for malaria and related diseases: a review. revista brasileira de plantas medicinais, 17(4), 657-666. gibernau, m., & barabé, d. (2002). pollination ecology of philodendron squamiferum (araceae). canadian journal of botany, 80(3), 316-320. harahap, s. a. (2020). inventarisasi jenis-jenis araceae di kawasan hutan batang toru blok barat kabupaten tapanuli utara, provinsi sumatera utara. [skripsi]. medan: fakultas matematika dan pengetahuan alam, universitas sumatera utara. hariri, m. r., robiansyah, i., & witono, j. r. (2019). dinamika marga typhonium schott (araceae: areae) di kebun raya bogor, jawa barat. prosiding seminar nasional masyarakat biodiversitas indonesia, 5(2), 369373. hartanti, r. e. d. p., gumiri, s., & sunariyati, s. (2020). keanekaragaman dan karakteristik habitat tumbuhan famili araceae di wilayah kecamatan jekan raya kota palangka raya. journal of environment and management, 1(3), 221-231. hutasuhut, m. a. (2020). inventarisasi araceae di hutan sibayak 1 kecamatan sibolangit kabupaten deli serdang sumatera utara. jurnal biolokus: jurnal penelitian pendidikan biologi dan biologi, 3(1), 288292. ilhamullah, b., ekyastuti, w., husni, h. (2015). studi potensi jenis tumbuhan bawah dan epifit sebagai tanaman hias pada kawasan pptat yayasan dian tama kalimantan barat, jurnal hutan lestari, 3(3). ipgri. (1999). descriptors for taro. rome: international plant genetic resources institute. islam, a., kamal, t., hosen, m., sharmin, n., hossain, s., & islam, n. (2019). lethal efficacy of indoor ornamental plant aglaonema marantifolium (schott.) against three economically important stored product pests callosobruchuschinensis (l.), sitophilus oryzae (l.) and triboliumcastaneum (hbst). journal of pharmacognosy and phytochemistry, 8(1), 2198-2201. ismail, z., ahmad, a., & muhammad, t. s. t. (2017). phytochemical screening of in vitro aglaonema simplex plantlet extracts as inducers of sr-b1 ligand expression. journal of sustainability science and management, 12(2), 34-44. ivanvic, a., roupsard, o., garcia, j. q., melteras, m., molisale, t., tara, s., lebot, v. (2008). thermogenesis and flowering biology of colocasia gigantea, araceae. j plant res, 121(1), 73-82. jansen, p. c. m., van der wilk c., hetterscheid w. l. a. amorphophallus blume ex decaisne. in flach m., rumawas f. (eds.). (1996). prosea: plant resources of south-east asia, plant yielding non-seed carbohydrates. leiden: backhuys publishers. kahayu. (2017). jenis tumbuhan family araceae berpotensi obat untuk menunjang kesehatan masyarakat dan pemanfaatannya di kawasan air terjun ironggolo. simki-techsain. 1(2), 2-7. kujawska, m., jiménez-escobar, n. d., nolan, j. m., & arias-mutis, d. (2017). cognition, culture and utility: plant classification by paraguayan immigrant farmers in misiones, argentina. journal of ethnobiology and ethnomedicine, 13(1), 1-13. koller, e. (2008). javanese medicinal plants used in rural communities. [thesis]. durchgefuhrt am department fur pharmakognosie. universitat wien. kurniawan, a., warseno, t., & asih, n. p. s. (2013). keanekaragaman jenis araceae di kawasan hutan bukit tapak, cagar alam batukahu, bali. prosiding seminar nasional pendidikan biologi dan biologi, jurdik biologi. kurniawan, a., wibawa, i. p. a. h., & adjie, b. (2011). species diversity of amorphophallus (araceae) in bali and lombok with attention genetic study in a. paeoniifolius (dennst.) nicolson. biodiversitas journal of biological diversity, 12(1). lembaga ilmu pengetahuan indonesia. (2014). kekinian keanekaragaman hayati indonesia. kerja sama kementerian ppn/bappenas, klh dan lipi. bogor: lipi press lemmens, r. h. m. j., soerianegara, i., & wong, w. c. (1995). plant resources of south-east asia. 5(2). backhuys publ. lestiani, a., lestari, r. s. d., rizkia, r. a., pratiwi, a. m., azrai, e. p., & rini, d. s. (2021). survei keberagaman lumut dan pohon inang di kawasan kebun raya bogor. proceeding of biology education, 4(1), 51-62. lolok, r. (2020). alat sensor soil tester. [skripsi]. fakultas sains dan teknologi, universitas sanata dharma mansur, m. (2017). potensi serapan karbondioksida (co2) pada beberapa jenis tumbuhan lantai hutan dari suku araceae di taman nasional gunung halimunsalak, jawa barat. jurnal biologi indonesia, 8(2). maretni, s., & mukarlina, m. t. (2017). jenis-jenis tumbuhan talas (araceae) di kecamatan rasau jaya kabupaten kubu raya, protobiont, 6(1). mayo, j.s., bogner, j., & boyce, p.c. (1997). the genera of araceae. belgium: continental printing. mohan, s., abdul, a.b., wahab, s.i.a., al-zubairi, a.s., elhassan, m.m., yousif, m. (2008). antibacterial and antioxidant activities of typhonium flagelliforme (lodd.) blume tuber. american journal of biochemistry and biotechnology, 4(4), 402-407. muharini, r., masriani, m., & rudiyansyah, r. (2018). phytochemical screening, antioxidant, and cytotoxicity of zamioculcas zamiifolia root extract. indonesian journal of pure and applied chemistry, 1(2), 62-67. murthy, k. m. s. (2021). effect of ethanolic extract of colocasia esculenta leaves and their cytotoxicity and apoptosis potential on ovarian cancer cell lines pa-1. journal of advanced scientific research, 12(1). mutaqin, a. z., fatharani, m., iskandar, j., partasasmita, r. (2018). utilization of araceae by local community in cisoka village, cikijing sub-district, majalengka district, west java, indonesia. biodiversitas journal of biological diversity. 19(2): 560-571 nguyen, v. d., tien, t. v., loan, l. t., bouamanivon, s., hetterscheid, w. l. a. (2018). amorphophallus jurnal riset biologi dan aplikasinya, 4(1): 9-18, march 2022 | 18 ravenii, a new species of amorphophallus (araceae) from laos. novon, 26(1), 53-55. nicholson, b. j., & halkin, s. l. (2007). temperature relationships in eastern skunk cabbage. bioscene: journal of college biology teaching, 33(2), 6-14. nicolson, d. h. (1969). a revision of the genus aglaonema (araceae). smithsonian contributions to botany. 1, 1-69. nzietchueng, s. (1988). some physiological characteristics of pythium myriotylum, causal agent of cocoyam (xanthosoma sagittifolium) root rot disease in camerum. 7. symposium of the international society for tropical root crops, gosier (guadalupe). ortiz, o. o., de stapf, m. s., & croat, t. b. (2019). diversity and distributional patterns of aroids (alismatales: araceae) along an elevational gradient in darién, panama. webbia, 74(2), 339-352. oloyede, g. k., onocha, p. a., & abimbade, s. f. (2012). phytochemical, toxicity, antimicrobial and antioxidant screening of extracts obtained from dieffenbachia picta (araceae) leaves and stem. journal of science research, 11(1), 31-43. phuong, v. t. t. (2019). morphological and anatomical property, phytochemical screening and antibacterial activity of colocasia gigantea (blume) hook.f. international journal of research in pharmacy and pharmaceutical sciences. 4(5), 51-57. portal, r. r., lima, m. a. s., luz, v. l. f., & bataus, y. s. l. (2002). vegetables species used as food by podocnemis unifilis, troschel 1948 (reptilia: testudinae, pelomedusidae) in the pracuúba region, state of amapá/brazil. ciência animal brasileira. 3, 11-19. powo. (2021). "plants of the world online. facilitated by the royal botanic gardens, kew.” published on the internet; http://www.plantsoftheworldonline.org/taxon/urn:l sid:ipni.org:names:87046-1diakses pada 18 juni 2021 pratama, m. y. a. (2017). inventarisasi jenis dan pola sebaran tumbuhan famili araceae di kawasan air terjun ironggolo kediri sebagai media konservasi in-situ. simki-techsain. 1(2). rameshkumar, s. (2018). standardization of plant species and growing medium for vertical garden system: a new urban horticulture concept. j. hortl. sci. 13, 1. renner, s. (2004). plant dispersal across the tropical atlantic by wind and sea currents. int. j. plant sci, 165, s23-s33. simpson, m. g. (2010). plant systematics. academic press elsevier. sin yeng, w. (2016). keladi hutan borneo. kuala lumpur: dewan bahasa dan pustaka. sugiyono. (2008). metode penelitian kuantitatif, kualitatif dan r&d. bandung: alfabeta. suhono, b., yuzammi, witono, j. k., hidayat, s., handayani, t., suciati., mursidawati, s., puji, i., sudarmono., wawangningrum, h. (2010). ensiklopedia flora. jilid 1. bandung: kharisma ilmu. sulaiman, b., & mansor, m. (2002). medicinal aroids conservation: a case study of floral garden, school of biological sciences. malaysia: universiti sains malaysia. sumaworto. (2004). pengaruh pemberian kapur dan ukuran bulbil terhadap pertumbuhan iles-iles (amorphophallus muelleri blume) pada tanah ber-al tinggi. ilmu pertanian. 11(2), 45-53. suminarti, n. e. (2015). pengaruh tingkat ketebalan mulsa jerami pada pertumbuhan dan hasil tanaman talas (colocasia esculenta (l.) schott var. antiquorum). jurnal agro, 2(2), 1-13. sungkajanttranon, o., marod, d., thanompun, k. (2018). diversity and distribution of family araceae in doi inthanon national park, chiang mai province. agriculture and natural resources. 52, 125-131. susanti, t., suraida, s., febriana, h. (2013). keanekaragaman tumbuhan invasif di kawasan taman hutan kenali kota jambi. prosiding semirata, 1(1). syamjith, p., vinod, k. r., vipuldas, m. k., venkatesh, r., sindhu, t. j., & johncy, n. j. (2018). dieffenbachia: benefits vs risks of a household ornamental planta review. word journal of pharmaceutical research, 7(17), 598-604. takeda, s., onishi, y., fukui, y., ohsako, t., & kubo, n. (2018). life cycle and genetic diversity of symplocarpus nipponicus (araceae), an endangered species in japan. plants. 7(3), 73. van andel, t.r. (2000). non-timber forest products of the northwest district of guyana, part i and ii. tropenbos-guyana series 8a and 8b. [dissertation]. wageningen: utrecht university,. vardhana, r. (2008). direct uses of medicinal plants and their identification. sarup & sons. wahidah, b. f., afiati, n., & jumari, j. (2021). community knowledge of amorphophallus muelleri blume: cultivation and utilization in central java, indonesia. biodiversitas journal of biological diversity, 22(7). wang, h., & li, k. (2021). research status and prospect in molecular biology of amorphophallus. medicinal plant research, 11. widodo, p., & wibowo, d. n. (2012). araceae di lereng selatan gunung slamet. ekologi gunung slamet, 89. wong, s. y., & boyce, p. c. (2010). studies on schismatoglottideae (araceae) of borneo ix: a new genus, hestia, and resurrection of apoballis. botanical studies (taipei), 51, 249-255. yeap, s. k., omar, a. r., ali, a. m., ho, w. y., beh, b. k., & alitheen, n. b. (2012). immunomodulatory effect of rhaphidophora korthalsii on natural killer cell cytotoxicity. evidence-based complementary and alternative medicine, 2012. yudaputra, a., fijridiyanto, i. a., witono, j. r., & astuti, i. p. (2021). the plant expedition of an endangered giant flower amorphophallus titanum in sumatra. warta kebun raya, 19(1), 23-29. yudhoyono, a & sukarya, d. g. (2013). 3500 plant species of the botanic gardens of indonesia. jakarta: pt. sukarya dan sukarya pendetama. yuzammi. (2018). the diversity of aroids (araceae) in bogor botanic gardens, indonesia: collection, conservation and utilization. biodiversitas, 19(1), 140-152. yuzzami. (2008). kr bogor, eladi cancer (epipremnum pinnatum (l.) engl.): alternative to treat a different kinds of diseases. warta kebun raya, 8(2), 84-88 zotz, g., kappert, n., muller l.-l.b., wagner, k. (2019). temperature dependence of germination and growth in anthurium (araceae). plant biology, 22(2), 184-190. http://www.plantsoftheworldonline.org/taxon/urn:lsid:ipni.org:names:87046-1 http://www.plantsoftheworldonline.org/taxon/urn:lsid:ipni.org:names:87046-1 13 | setiarini et al.; design of the env-su gene coding for surface unit protein as a vaccine candidate jurnal riset biologi dan aplikasinya, volume 3, issue 1, march 2021 design of the env-su gene coding for surface unit protein as a vaccine candidate for jembrana disease virus in in silico nur asih setiarini1*, indriawati2, r susanti3, endang tri margawati4 1,3department of biology, faculty of mathematics and natural sciences, state university of semarang d6 building, 1st floor campus sekaran gunungpati, semarang, central java 50229, indonesia 2),4) biotechnology research center, indonesian institute of sciences jln. raya jakarta-bogor no. km 46, cibinong, bogor, west java 16911, indonesia *corresponding author: e-mail: nurasihsetiarini02@gmail.com article history abstract received : 19 february 2021 bali cattle are superior meat producers, but they are susceptible to jembrana disease. the injection of the crude vaccine was considered ineffective, so the env-su gene was selected to express the jembrana surface unit (jsu) protein as a candidate for the jembrana vaccine. this study aimed to analyze the potential of the jsu protein as a candidate for the jembrana vaccine and analyze the increase in the env-su gene expression which codon has been optimized in silico. vaccine design was carried out through in silico including the selection of the su protein sequences of the genus lentivirus and sequence alignment of uniprot. the construction phylogeny tree of su protein using mega-x program, optimization of env-su gene codon with preference codon esherichia coli str. k-12 substr. mg1655 using optimizer. the optimized env-su gene was inserted into the plasmid pet-21a (+) using genscript. the result of sequence alignment showed that there is no su protein that has a percent identity value of more than 30% with jsu protein. the su jdv and biv proteins are monophyletic groups and have a percent identity of 20.57%. codon optimization showed an increase in cai by 1,000 and gc 54.5%, and a decrease in enc to 22 and at 45.5%. ecor1 and hindiii can recognize the gene target and mcs cut regions on the plasmid so that the env-su gene can be inserted into the pet-21a (+) plasmid. the jsu protein has the potential to be a candidate for the jembrana vaccine, but it needs further research in vitro and in vivo. revised : 3 march 2021 approved : 22 march 2021 published : 31 march 2021 keywords vaccine candidate; env-su gene;sequence alignment; codon optimization; in silico how to cite: setiarini, n.a., indriawati., susanti, r., & margawati, e.t. (2021). design of the env-su gene coding for surface unit protein as a vaccine candidate for jembrana disease virus in in silico. jurnal riset biologi dan aplikasinya, 3(1):13-22. doi: https://doi.org/10.26740/jrba.v3n1.p13-22. introduction bali cattle are one of the original indonesian cattle breeds with great potential as a meat producer because they have many advantages, including adaptability to critical environments, good reproduction, and growth rates (astiti, 2018). however, the weakness of bali cattle is that they are susceptible to blood sweat disease called jembrana disease (aryadrie et al., 2015). jembrana disease is an endemic disease that first appeared and became epidemic in sangkaragung village, jembrana district, jembrana regency, bali province in 1964 (mardiatmi, 2015). along with technological advances in the field of genetic engineering, and the availability of genome sequence information for various types of viruses, recombinant dna technology can be applied to produce functional proteins as vaccine ingredients (ali, 2015). the jembrana disease virus (jdv) genome in the genbank can be used as a reference for jembrana disease vaccine material, which is inserted in the expression plasmid and produced in e. coli host cells. the jembrana surface unit (jsu) protein plays a role at the beginning of the replication process by interacting in the binding process between the jembrana disease virus particles and the surface of jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi mailto:nurasihsetiarini02@gmail.com https://doi.org/10.26740/jrba.v3n1.p13-22 jurnal riset biologi dan aplikasinya, 3(1): 13-22, march 2021 |14 the host cell so that it can trigger an antibody response that can block the recognition of receptors and prevent the process of entering the virus into the target cell, therefore genes env-su was selected as a candidate for the jembrana vaccine to express the jsu recombinant protein (indriawati et al., 2013; kusumawati et al 2015). the test for the potential of the jsu protein as a candidate for the jembrana vaccine needs to be carried out with sequence alignment using uniprot to find out how much acidity is in the jsu protein with other su proteins of the lentivirus genus, the test results are determined in the percent identity calculation (pearson, 2013). the use of e. coli as a host cell in the production of recombinant protein because e. coli is easy to manipulate and has a short life cycle to minimize production costs and the resulting high and fast rate of target protein expression. however, the production of recombinant protein using e. coli host cells also have drawbacks, namely the occurrence of codon bias that affects the results of target protein expression by forming inactive protein aggregates (inclusion bodies) ( maksum et al., 2017; silaban et al., 2017). the strategy to overcome this is the use of synthetic gene technology from target genes to match the host cell preference codons (silaban et al., 2017). the codon optimization method is a process that can adjust the env-su jdv gene codon coding for the jsu protein with preference codons in e. coli as the host (lanza et al., 2014; rosano & ceccarelli, 2014). the discovery and development of the jsu recombinant protein vaccine design were carried out using the in silico test beforehand to reduce the risk of possible failure and loss and to save time and money (ullah et al., 2020). therefore, it is necessary to research to determine the jsu protein encoded in the jdv env-su gene as a candidate for the jembrana disease vaccine based on the percent identity value of the sequence alignment with the su protein of the lentivirus genus and knowing the optimization results of the env-su jdv gene codon in silico will increase expression jsu recombinant protein. materials and methods the research was conducted from august to december 2020, at the biology laboratory, faculty of mathematics and natural sciences, semarang state university. the research was conducted using the asus e202s series computer with windows 7 system specifications and a dual-core intel celeron n3050 processor. the bioinformatics and biocomputing tools used include ncbi, uniprot, genscript, mega-x, optimizer. the materials used are various amino acid sequences of su protein which are incorporated into the genus lentivirus, such as feline immunodeficiency virus (fiv), simian immunodeficiency virus (siv-mac), bovine immunodeficiency virus (biv), caprine arthritis encephalitis virus (caev-63), jembrana disease virus (jdv), equine infections anemia virus (eiav), dan ovine maedi visna related virus (saomvv). selection of sequences and protein sequence alignment processes su uniprot is used for the collection of various su proteins of the genus lentivirus and sequence alignment processes. the search was carried out with the keyword "envelope virus species name", selected entities that had the access code "env" and selected entries that had been reviewed by the swissprot curator. select entries that have the number of env amino acid sequences that correspond to the total env nucleotide sequences in ncbi. each su protein from various species is added to the "add basket" option available in the uniprot tool. the jsu protein sequence alignment process is carried out alternately with each other organism's su protein sequence. finally, a table of the results of the alignment of the jsu protein with each other su protein gene includes the value of percent identity, identical positions, and similar positions. construction of the lentivirus genus su protein phylogenetic tree each su protein from various species is added to the "add basket" option available on the uniprot tool and downloaded in one file with the fasta format. mega-x software was used for the production of phylogenetic tree dendrogram for the su protein genus lentivirus. a file containing a set of genes encoding the env-su genus lentivirus is opened in the mega software. select the option "alignment by the cluster algorithm" to perform multiple sequence alignment processes. select the "phylogenetic" menu and select the type of phylogenetic tree "construct/test neighbor-joining tree" with the "bootstrap method" 1000x. click the "view" menu then select the option "branch lengths" and "starts/frequency". finally, save the file as png. 15 | setiarini et al.; design of the env-su gene coding for surface unit protein as a vaccine candidate jdv env-su gene optimization the optimizer website is used for the codon optimization process. the nucleotide sequence of the env-su gene was searched for in the complete jdv genome and nucleotides were selected in sequences─5197 to 6463 that encode the env-su jdv gene. env-su gene nucleotides were inserted into the column, the host cell reference codon was selected from the heg-db data and selected “escherichia coli str. k-12 substr. mg1655”. select the host cell genetic code, namely eubacteria, then the method used is "one aa-one codon". the resulting codon is optimized by the optimizer device and then the gc and enc values are analyzed as well as the gc and at content. to analyze the genome regions identified by the restriction enzymes using the genscript website, ecori and hindiii enzymes were selected. insertion of the env-su jdv gene into the plasmid pet-21a (+) the optimized env-su codon is inserted into the pet-21a (+) expression plasmid using the genscript website. the first step, select the option "create construct", then given the name plasmid to be designed. click the "the commons" option, then select "popular commercial vector". select "bacterium" and look for the pet-21a (+) vector (plasmid), then click the "create construct" option under the column. the env-su gene is inserted through the mcs site on the plasmid by selecting the "sequence" option then "insert", then the "add" option is selected in the "annotation" menu and given the name env-su. the optimization process is carried out using the "gene optimization" option which is in the "sequence" menu by selecting the e. coli host cell as well as the ecori and hindiii restriction enzymes. to find out the plasmid design errors made, you can select the "project" menu and select the "check design" option. results and discussion a total of seven lentivirus genus su protein sequences were taken from the uniprot website (table 1). from the sequence alignment between these proteins, the evolutionary lines that culminate in a common ancestor can be studied (bu’ulolo et al., 2010). the results of the alignment of the jsu protein with su proteins of other species belonging to the genus lentivirus are presented in table 2. based on the determination of the percent identity value limit used to compare between protein sequences, there is no su protein encoded by other env-su genes in the genus lentivirus that have percent identity more than 30% with jembrana surface unit jdv protein. the results obtained in table 2. are reinforced by the statement of bu’ulolo et al (2010), that the farther the sequence equation is aligned, the more specific the type of material (sequence) is compared, on the contrary, the closer the equation between the sequences means the material is compared. the more common types. this shows that the jsu protein has the potential to be used as a vaccine candidate for jembrana disease based on the percent identity value of the in-silico sequence alignment. specific proteins are chosen as vaccine raw materials because they do not induce side effects, induce the formation of specific antibodies, and do not trigger an immune response against unwanted host cells (gustiananda, 2011; susmiarsih, 2018). percent identity on the alignment of sequences of amino acid and nucleotide sequences from two or more different species can be calculated by the number of identical positions divided by the total number of characters then multiplied by 100% table 1. a trace list of various proteins of the env genus lentivirus using the uniprot website access number access name virus species aa length q82857 env_jembr jembrana disease virus (jdv) 781 p19557 env_biv29 bovine immunodeficiency virus (strain r29) (biv) 904 p16090 env_fivpe feline immunodeficiency virus (isolate petaluma) (fiv) 856 p32541 env_eiavc equine infectious anemia virus (isolate cl22) (eiav) 859 p31627 env_caevg caprine arthritis encephalitis virus (strain 63) (caev63) 942 p16899 env_omvvs ovine maedi visna related virus (strain south africa) (sa-omvv) (ovine lentivirus) 990 p08810 env_sivm2 simian immunodeficiency virus (isolate mm251) (sivmac) 881 note: aa = the total amino acid protein env https://www.uniprot.org/uniprot/q82857 https://www.uniprot.org/taxonomy/36370 https://www.uniprot.org/taxonomy/417296 https://www.uniprot.org/taxonomy/11674 https://www.uniprot.org/taxonomy/31675 https://www.uniprot.org/taxonomy/11662 https://www.uniprot.org/taxonomy/11662 https://www.uniprot.org/taxonomy/11664 https://www.uniprot.org/taxonomy/11664 https://www.uniprot.org/taxonomy/11734 https://www.uniprot.org/taxonomy/11734 jurnal riset biologi dan aplikasinya, 3(1): 13-22, march 2021 |16 (ernawati et al., 2014). however, the percent identity calculation formed in each program has a different value even though the object of research is the same. this is influenced by the programming techniques for the tools used (sunarto, 2015). the sequence alignment process of various su proteins of the lentivirus genus using the uniprot website can only measure the similarity of the jsu protein sequences with other su proteins without knowing the relationships between species in the lentivirus genus. therefore, it is necessary to use a multiple sequence alignment method with clustalw to construct a phylogeny tree that describes the kinship relationship based on genetic distances between sequences in the su protein of the genus lentivirus (daugelaite et al., 2013). su protein belonging to the genus lentivirus was reconstructed into a phylogenetic tree formed from neighbor-joining (nj) analysis and tested by statistical tree evaluation using bootstrap 1000 times. a dendrogram-shaped phylogeny tree is presented in figure 1 based on the value of the branch length and bootstrap test. lentivirus genus su protein phylogeny tree constructs shown in figure 1 form two clades with similar evolutionary distance values and a bootstrapping value of 70%. clade 1 members consist of two distinct internal nodes, internal node 1 consists of su eiav and siv-mac proteins while internal node 2 is composed of su caev-63 and sa-omvv proteins. meanwhile, the members of clade 2 are also composed of two internal nodes, namely internal node 1 is occupied by su fiv protein and internal node 2 contains su jdv and biv proteins. the caev-63 species with sa-omvv can be said to be closely related because they have almost the same branch length value, namely 0.23 for saomvv and 0.22 for caev-63 calculated from the same node, which means that the two species are derived from one node ancestral unit. besides, the bootstrap test results showed that both species were monophyletic. monophyletic groups are shown in branches with a bootstrap value of 100% which are assumed to carry genetic and biochemical traits or patterns from one common ancestor (akhsani et al., 2017; retnaningati, 2017). a branch is monophyletic if all grouped otus have adjacent branches because the group shares the same ancestor compared to other groups with different lineages (pangestika et al., 2015). caprine arthritis encephalitis virus (caev-63) and visna related virus (sa-omvv) have many genetic similarities in the env structural genes because they belong to the srlv (small-ruminant lentiviruses) genome (bartak et al., 2018). from the sequence alignment process using uniprot, the two proteins have a percent identity value of 67.864%. in figure 1, it can be seen that the su jdv and biv proteins are also monophyletic groups. the su jdv and biv proteins entered the same node with the branch length values between these species which were quite close, namely 2.47 in jdv and 1.19 in biv. this branch length value strengthens the sequence alignment results that the two proteins have similarities in the env gene, which is thought to be inherited from one ancestral unit (kusumawati et al., 2014). su siv-mac and eiav proteins are in one internal node but have far enough branch length values, namely 5.45 for siv-mac and 1.96 for eiav. this explains that the two species have different evolutionary distances even though they are formed at the same node, this statement is supported by the results of the bootstrap test on the su siv-mac and eiav protein branches forming a value of 54% which is classified in the weak category, so there is still a possibility of changes in clade arrangement. the farthest genetic distance occurs in su biv and siv-mac proteins, because the two proteins are separated by different clades. the env-su jdv gene has a fragment length of 1266 nucleotide bases encoding the jsu protein with a molecular weight of 47 kda and a length of 422 amino acids (kusumawati et al., 2014). the nucleotide sequence of the env-su gene was then performed codon optimization with the optimizer device to ensure and increase the likelihood that the protein could be expressed in e. coli (strain k12) host cells (mauro & chappell, 2014). the results before and after codon optimization can be seen in table 4 which includes changes in the values of cai, enc, and the content of gc and at. in table 4, it can be seen that the cai value of the env-su codon before the optimization is 0.217. this value is classified as low because the ideal cai value range is 0.8─1.0, so codon optimization needs to be done (genscript, 2019). the results of the envsu codon optimization show that the cai value increases to 1, this value is categorized as the highest value level. the greater the cai value, the stronger the use of host cell codons to increase the expression of target genes. if the cai index in the codon optimization results is 1, it shows that the codon is always used for the synthesis of each coded 17 | setiarini et al.; design of the env-su gene coding for surface unit protein as a vaccine candidate amino acid (gun et al., 2018). the alignment results show that out of 1266 env-su nucleotide bases, 937 nucleotide bases match the e. coli str k-12 substr mg1655 genome, 155 nucleotide bases are changed with their nitrogenous bases (transition), and 174 nucleotide bases are changed differently type of nitrogenous base (transversion). the enc value listed in table 4 before the optimization is 51, after optimization it drops to 22. the index value of enc ≤ 35 means that the preference for the host codon used is high, while the enc value ≥ 50 indicates that there is still use of random codons so that gene expression is low. similar to the results of research by behura & severson (2012), if the enc value approaches 20, it indicates that there is an increase in the use of host codons in a target gene codon. table 2. results of the alignment of the jsu protein with other su proteins of the genus lentivirus a n note: a= the total amino acid protein su figure 1. su protein dendrogram based on branch length and bootstrap test (numbers in the column represent the bootstrap value) the relative degree of adjustment for the use of the host codon in the target gene was determined by looking at the enc value. this is by the statement of uddin (2017), the smaller the enc value, the higher the host cell codon used. the results of adjustment for the host cell codon e. coli on the env-su gene codon are shown in table 3. based on table 3 it can be seen that each amino acid making up the su protein can be encoded by one or several different codons (synonym codons). after the codon optimization process was carried out, it was seen that several amino acids that were initially coded by more than 1 codon became only 1 codon. the amino acid alanine (a) in the env-su gene before optimization was coded by 4 codons, namely gca, gcc, gcg, and gct, after optimization, only the gcg codon was selected. cysteine (c) amino acids were originally encoded by two codons namely tgc and tgt, after codon optimization, cystein's amino acids were encoded only by the tgc codon. modification of the env-su gene nucleotide base sequence is carried out by replacing the adenine (a) species percent identity (%) similar positions (aa) identical positions (aa) 1st species aa lengh 2nd species aa length jdv 422 fiv 611 12.78 135 81 jdv 422 eiav 438 14.72 127 72 jdv 422 caev-63 550 10.15 113 66 jdv 422 sa-omvv 555 11.47 105 75 jdv 422 siv-mac 508 12.35 114 73 jdv 422 biv 555 20.57 141 122 jurnal riset biologi dan aplikasinya, 3(1): 13-22, march 2021 |18 and thymine (t) nucleotide bases with guanine (g) and cytosine (c) in a codon without changing the amino acid sequence coding for the translated jsu protein, and equalization is obtained. the content of gc to all parts of the gene (yulita et al., 2020). the env-su codon that had not been optimized had a gc content of 45.9%, and after optimization, the gc content increased to 54.5%. this is by research by milo (2017), that the gc content in e. coli str. k-12 ranges above 50.8%, while the ideal percentage of gc content is 30-70% (mega et al., 2019). low gc content can affect the stability of the mrna structure of the target protein by increasing the heterochromatin conditions in the dna strand. heterochromatin is a type of chromatin that makes up dna that is solid (compact), because the structure of rna polymerase cannot initiate the transcription and translation process so that the target gene is not expressed (barahimipor et al., 2015; ramadhani & suvifan, 2012), while the gc content which is too high can reduce the level of expression, because it is thought to terminate the transcription process (silaban et al., 2016). protein coding genes with ideal gc content in an organism will be translated optimally to increase the expression of the target gene. the at content before optimization was 54.1%, after optimization it fell to 45.5%. at-rich codons will be translated inefficiently and can decrease the expression of target genes (courel et al., 2019; zhou et al., 2014). gene expression that was carried out with codon optimization with un-optimized genes, there was a significant difference in the level of expression of the recombinant protein formed. codon-optimized genes produced higher recombinant protein than un-optimized genes and with western blotting analysis, protein expression in genes that were not codon-optimized could hardly be detected due to inclusion bodies (liu et al., 2018). inclusion bodies are formed when the expression rate of recombinant protein is high, but not followed by folding of the appropriate protein into active protein and there is a reduction in disulfide bonds between amino acids (glick et al., 2010). proteins that are not completely folded will interact with each other, causing insoluble protein aggregates so that they cannot be detected (maksum et al., 2019). the formation of the inclusion bodies in the form of target protein aggregates shows the inability of the host cell to produce recombinant proteins in their original form (thenawidjaja et al., 2017). the results of cutting the restriction endonuclease enzyme via the genscript website shown in figure 2 show that the two enzymes can recognize the cut regions at the mcs (multiple cloning site) site in the pet-21a (+) plasmid. the ecori restriction enzyme will cut dna fragments in the sequence 5'-g'aatcc-3 'and its complement 3'-cctaa'g-5' with a length of 159─164bp on the plasmid, while the hindiii enzyme cuts through the 5'-a'agctt dna sequence -3 'and its complement 3'-ttcga'a-5' with a length of 1431─1436bp on the plasmid. cutting with two types of restriction enzymes at separate cutting points on different dna was carried out simultaneously to produce 2 bands, namely a ribbon measuring 5443 bp (plasmid size pet-21a (+) and a ribbon measuring 1266 pb (size of the env-su gene). optimization of dna cutting was carried out using the double-digest endonuclease inhibition enzyme method, namely ecori and hindiii. the double-digest method is used to cut dna at separate cutting points using two different types of endonuclease inhibition enzymes. this method is often used in directed cloning which will produce two dna fragments, namely, vector dna fragments, and target dna fragments, which can reduce cloning costs and times, and facilitate ligation of different dna (shirasawa et al., 2016; wang et al., 2017). the selection of the restriction enzyme cutting site was based on the presence or absence of the enzyme cutting site to be used on the nucleotide sequence of the env-su and plasmid pet21a(+) genes (priyatno et al., 2019). the two enzymes are used to cut dna encoding the target protein and plasmid dna so that the results of the cutting of the two molecules are complementary so that the target protein dna can be constructed into the plasmid by forming relatively stable hydrogen bonds and can be linked to the ligase enzyme through phosphodiester bonds (choiriyah et al., 2013; mega et al., 2019). the transcription process of pet-21a (+) plasmid is controlled by the t7 promoter which will only start transcription after it is initiated by rna polymerase t7. the t7 promoter is commonly used in expression vectors because it has a high transcription power of target genes and can control gene expression so that it can suppress the toxic effect of proteins that are also expressed by e. coli host cells for their survival (kusumaningsih, 2018). the plasmid pet-21a (+) has been equipped with a lac operon to control the transport and metabolism of lactose in e. coli cells. the process of 19 | setiarini et al.; design of the env-su gene coding for surface unit protein as a vaccine candidate target gene expression begins with the bonding between the inducer and the lac repressor protein. the bonding complex causes the lac repressor protein to be inactivated and not bind to the lac operon so that it will be able to activate the rna polymerase enzyme in e. coli into t7polymerization protein which can initiate the transcription and translation process. after the t7 polymerization protein is formed, the protein will bind to the t7 promoter contained in the pet21a(+) plasmid so that the jsu protein encoded by the env-su gene will be expressed (nurjayadi et al., 2019; yang et al., 2015). validation of the results of cutting the endonuclease inhibition enzyme and the next step in producing the jsu recombinant protein from the env-su gene in silico requires further research in vitro and in vivo to ensure the safety and potential of the predicted vaccine candidates (ullah et al., 2020). table 3. adjustment for the use of e. coli cell codons in the env-su gene codon codons query optimized codons query optimized codons query optimized codons query optimized gca(a) 5 0 gcc(a) 1 0 gcg(a) 2 17 gct(a) 9 0 tgc(c) 7 13 tgt(c) 6 0 gac(d) 10 21 gat(d) 11 0 gaa(e) 18 26 gag(e) 8 0 ttc(f) 7 17 ttt(f) 10 0 gga(g) 18 0 ggc(g) 3 0 ggg(g) 15 0 ggt(g) 1 37 cac(h) 6 11 cat(h) 5 0 ata(i) 16 0 atc(i) 4 30 att(i) 10 0 aaa(k) 8 17 aag(k) 9 0 tta(l) 8 0 ttg(l) 7 0 cta(l) 10 0 ctc(l) 2 0 ctg(l) 7 36 ctt(l) 2 0 atg(m) 8 8 aac(n) 10 21 aat(n) 11 0 cca(p) 13 0 ccc(p) 5 0 ccg(p) 2 26 cct(p) 6 0 caa(q) 6 0 cag(q) 14 20 aga(r) 12 0 agg(r) 6 0 cga(r) 1 0 cag(q) 1 0 cgg(r) 2 0 cgt(r) 3 25 agc(s) 6 0 cgc(r) 5 0 tca(s) 4 0 tcc(s) 3 0 tcg(s) 0 0 agt(s) 0 18 aca(t) 7 0 acc(t) 5 22 acg(t) 2 0 act(t) 8 0 gta(v) 13 0 gtc(v) 4 0 gtg(v) 13 0 gtt(v) 4 34 tgg(w) 14 14 tac(y) 6 9 tat(y) 3 0 taa(.) 0 0 tga(.) 0 0 tag(.) 0 0 table 4. optimization results of the env-su jdv gene codon with the optimizer type cai enc %gc %at before optimization 0.217 51 45.9 54.1 after optimization 1.000 22 54.5 45.5 figure 2. construction of the env-su gene into the plasmid pet-21a (+) jurnal riset biologi dan aplikasinya, 3(1): 13-22, march 2021| 20 even though the in-silico test results in good predictions, it is not certain that when carried out in vitro and in vivo tests are directly proportional to the in-silico results, because various factors can affect the expected final results of the study. conclusion the jsu protein encoded by the jdv env-su gene has the potential as a candidate for the jembrana disease vaccine based on the results of the percent identity sequence alignment value with the su protein of other species in the genus lentivirus less than 30%. codon optimization results showed an increase in the cai value and gc content and decreased the enc value and at content in the jdv env-su gene codon, thereby reducing codon bias and increasing the yield of jsu recombinant protein expression in silico. acknowledgement thank you to the center for biotechnology research, the indonesian institute of sciences for allowing and helping to carry out thesis research references akhsani, f., hamidy, a., farajallah, a., & smith, e. n. (2017). hubungan filogenetik phrynella pulchra boulenger, 1887 berdasarkan gen 16s rrna. zoo indonesia, 26(2), 107–115. retrieved from https://ejournal.biologi.lipi.go.id/index.php/zoo_indon esia/article/view/3721. ali, m. (2015). upaya pengembangan teknologi cepat transkripsi dan translasi in vitro dalam sintesis vaksin di indonesia. wartazoa, 25(4), 181–188. retrieved from https://onesearch.id/record/ios5428.18465. aryadrie, d. fitria, santosa, p. e., & suharyanti, s. (2015). tingkat infestasi cacing hati pada sapi bali di kecamatan sukoharjo kabupaten pringsewu provinsi lampung. jurnal ilmiah peternakan terpadu, 3(3), 134–139. http://dx.doi.org/10.23960/jipt.v3i3.p%25p. astiti, n. m. a. g. r. (2018). sapi bali dan pemasarannya. warmadewa university press. barahimipor, r., strenkert, d., neupert, j., schroda, m., merchant, s. s., & bock, r. (2015). dissecting the contributions of gc content and codon usage to gene expression in the model alga chlamydomonas reinhardtii. plant journal, 84(4), 704–717. doi: 10.1111/tpj.13033. bartak, p., simek, b., vaclavek, p., curn, v., plodkova, h., tonka, t., farková, b., vernerová, k., & vejčík, a. (2018). genetic characterisation of small ruminant lentiviruses in sheep and goats from the czech republic. acta veterinaria brno, 87(1), 19–26. https://doi.org/10.2754/avb201887010019. behura, s. k., & severson, d. w. (2012). comparative analysis of codon usage bias and codon context patterns between dipteran and hymenopteran sequenced genomes. plos one, 7(8), 1–11. doi: 10.1371/journal.pone.0043111. bu’ulolo, i. c., simamora, n., tampubolon, s., & pinem, a. (2010). sequence alignment menggunakan algoritma smith waterman. seminar nasional politeknik batam, 2(2), 2–7. retrieved from https://jurnal.polibatam.ac.id/index.php/ji/article /view/256. choiriyah, u., nurjayadi, m., & dewi, f. k. (2013). subkloning dan ekspresi gen fim-c s. typhimurium. jurnal riset sains dan kimia terapan, 3(2), 280–291. https://doi.org/10.21009/jrskt.032.01. courel, m., clément, y., bossevain, c., foretek, d., cruchez, o. v., yi, z., bénard, m., benassy, m. n., kress, m., vindry, c., ernoult-lange, m., antoniewski, c., morillon, a., brest, p., hubstenberger, a., crollius, h. r., standart, n., & weil, d. (2019). gc content shapes mrna storage and decay in human cells. elife, 8, 1–32. retriefed from https://elifesciences.org/articles/49708. daugelaite, j., o’ driscoll, a., & sleator, r. d. (2013). an overview of multiple sequence alignments and cloud computing in bioinformatics. international scholarly research notices, 2013, 1–14. https://doi.org/10.1155/2013/615630. ernawati, e., puspitaningrum, d., & pravitasari, a. (2014). implementasi algoritma smith–waterman pada local alignment dalam pencarian kesamaan pensejajaran barisan dna (studi kasus: dna tumor wilms). jurnal pseudocode,1(2), 170–177). https://doi.org/10.33369/pseudocode.1.2.170-177. genscript. (2019). gene synthesis handbook (4th ed). genscript usa inc. glick, b. r., pasternak, j. ., & patten, c. (2010). molecular biotechnology: principles and applications of recombinant dna (4th ed). asm press. gun, l., yumiao, r., haixian, p., & liang, z. (2018). comprehensive analysis and comparison on the codon usage pattern of whole mycobacterium tuberculosis coding genome from different area. biomed research international, 2018(2), 1–8. https://doi.org/10.1155/2018/3574976. gustiananda, m. (2011). immunoinformatics analysis of h5n1 proteome for designing an epitope-derived vaccine and predicting the prevalence of preexisting cellular-mediated immunity toward bird flu virus in indonesian population. immunome research, 7(3), 1–11. retrieved from https://www.longdom.org/abstract/immunoinform atics-analysis-of-h5n1-proteome-for-designing-anepitopederived-vaccine-and-predicting-theprevalence-of-pre-8638.html. indriawati, i., margawati, e. t., & ridwan, m. (2013). identifikasi virus penyakit jembrana pada sapi bali menggunakan penanda molekuler gen env su. berita biologi, 12(2), 211–216. doi: 10.14203/beritabiologi.v12i2.534 kusumaningsih, p. (2018). evaluasi konstruksi dna da+lam vektor plasmid berkaitan dengan ekspresi protein rekombinan rophtry-1 (rop1) toxoplasma gondii pada eschericia coli. universitas dhyana pura bali. kusumawati, a., tampubolon, i. d., hendarta, n. y., salasia, s. i. o., wanahari, t. a., mappakaya, b. a., & hartati, s. (2015). use of reverse transcription loop-mediated isothermal amplification combined with lateral flow dipstick for an easy and rapid detection of jembrana disease virus. virus disease, http://dx.doi.org/10.14203/beritabiologi.v12i2.534 21 | setiarini et al.; design of the env-su gene coding for surface unit protein as a vaccine candidate 26(3), 189–195. doi: 10.1007/s13337-015-0277-5. kusumawati, a., wanahari, t. a., putri, r. f., mappakaya, b. a., & tampubolon, i. d. (2014). the structure and function of jembrana disease virus genome. journal of infection and molecular biology, 2(2), 26– 29. retrieved from https://www.ncbi.nlm.nih.gov/pmc/articles/pmc 103872/. lanza, a. m., curran, k. a., rey, l. g., & alper, h. s. (2014). a condition-specific codon optimization approach for improved heterologous gene expression in saccharomyces cerevisiae. bmc systems biology, 8(1), 1–10. liu, b., kong, q., zhang, d., & yan, l. (2018). codon optimization significantly enhanced the expression of human 37-kda ilrp in escherichia coli. 3 biotech, 8(4), 1–7. doi: 10.1007/s13205-0181234-y. maksum, i. p., utama, e., & subroto, t. (2017). extracellular secretion of recombinant human epidermal growth factor by using trimethylamine n-oxide reductase a (tora) signal peptide in escherichia coli bl21 (de3). jouranl of pharmaceutical sciences and research, 9(6), 1007–1016. retrieved from https://www.jpsr.pharmainfo.in/documents/volu mes/vol9issue06/jpsr09061746.pdf. maksum, i., sriwidodo, & yosua. (2019). strategi peningkatan ekspresi protein rekombinan secara intraselular pada inang escherichia coli. universitas padjajaran. mardiatmi, m. (2015). pedoman pengendalian dan penanggulangan penyakit jembrana. direktorat kesehatan hewan. mauro, v. p., & chappell, s. a. (2014). nih public access. trends in molecular medicine, 20(11), 604–613. mega, o., sumantri, c., arief, i. i., & budiman, c. (2019). ekspresi gen lon-like protease dari lactobacillus plantarum iia-1a5 pada escherichia coli bl21(de3). jurnal agripet, 19(2), 149–158. https://doi.org/10.17969/agripet.v19i2.14904. milo, r. (2017). bionumbers-gc content of e. coli k12 chromosome. nucleic acids research, id 100528. nurjayadi, m., afrizal, r., hardianto, d., & agustini, k. (2019). variations of binding, washing, and concentration of imidazole on purification of recombinant fim-c protein salmonella typhi with ni-nta resin. journal of physics: conference series, 1402(2019), 1–7. https://doi.org/10.1088/17426596/1402/5/055055. pangestika, y., budiharjo, a., & kusumaningrum, h. p. (2015). analisis filogenetik curcuma zedoaria (temu putih) berdasarkan gen internal transcribed spacer (its). jurnal biologi, 4(4), 8–13. retrieved from https://ejournal3.undip.ac.id/index.php/biologi/art icle/view/19424. pearson, w. r. (2013). an introduction to sequence similarity (“homology”) searching. current protocols bioinformatics, 42(1), 1–9. doi: 10.1002/0471250953.bi0301s42. priyatno, t. p., winangsih, f., manzila, i., & bintang, m. (2019). ekspresi dan karakterisasi β-1,3-glukanase rekombinan dari burkholderia cepacia (biogencc e76) yang diekspresikan dalam sistem ekspresi escherichia coli. jurnal agrobiogen, 15(1), 35–44. ramadhani, d., & suvifan, v. a. (2012). aplikasi teknik c-banding sebagai biodosimetri radiasi. buletin alara, 14(1), 17–22. retnaningati, d. (2017).hubungan filogenetik intraspesies cucumis melo l. berdasarkan dna barcode gen matk. biota, 2(2), 62–67. https://doi.org/10.24002/biota.v2i2.1658. rosano, g. l., & ceccarelli, e. a. (2014). recombinant protein expression in escherichia coli: advances and challenges. frontiers in microbiology, 5(172), 1– 17. https://doi.org/10.3389/fmicb.2014.00172. shirasawa, k., hirakawa, h., & isobe, s. (2016). analytical workflow of double-digest restriction siteassociated dna sequencing based on empirical and in silico optimization in tomato. dna research, 23(2), 145–153. doi: 10.1093/dnares/dsw004. silaban, s., maksum, i. p., enus, s., hasan, k., subroto, t., & soemitro, s. (2016). kajian ekspresi gen pretrombin-2 manusia sintetik pada escherichia coli secara in silico untuk produksi trombin sebagai komponen lem fibrin. jurnal pendidikan kimia, 8(1), 58–64. https://doi.org/10.24114/jpkim.v8i1.4425. silaban, s., maksum, i. p., gaffar, s., enus, s., hasan, k., subroto, t., & soemitro, s. (2017). desain, optimasi, dan kloning gen pretrombin-2 sintetik untuk produksi trombin sebagai komponen lem fibrin. jurnal ilmiah ilmu dan teknologi kimia, 1(1), 69–81. retrieved from http://stakc.ac.id/2017/08/12/desain-optimasidan-kloning-gen-pretrombin-2-sintetik-untukproduksi-trombin-sebagai-komponen-lem-fibrin/. sunarto, a. a. (2015). perbandingan program sequence alignment. jurnal rekayasa nusaputra, 1(1), 1–5. retrieved from https://jurnal.nusaputra.ac.id/rekayasa/uploads/pa per/55ed4-asril-adi-sunarto.pdf. susmiarsih, t. p. (2018). kajian dna rekombinan pada vaksin dna dan vaksin subunit protein. majalah kesehatan pharma medika, 10(2), 108–128. thenawidjaja, m., ismaya, w. t., & retnoningrum, d. s. (2017). protein; serial biokimia mudah dan menggugah. grasindo. uddin, a. (2017). indices of codon usage bias. journal of proteomics & bioinformatics, 10(6), 4172. retrieved from https://www.longdom.org/openaccess/indices-of-codon-usage-bias-jpb1000e34.pdf. ullah, m. a., sarkar, b., & islam, s. s. (2020). exploiting the reverse vaccinology approach to design novel subunit vaccines against ebola virus. immunobiology, 225(3), 1–80. https://doi.org/10.1016/j.imbio.2020.151949. wang, y., cao, x., zhao, y., fei, j., hu, x., & li, n. (2017). optimized double-digest genotyping by sequencing (ddgbs) method with highdensity snp markers and high genotyping accuracy for chickens. plos one, 12(6), 1–19. https://doi.org/10.1371/journal.pone.0179073. yang, x., chen, b., cai, y., & tseng, c. (2015). understanding the lac operon with geneact. international journal of computational biology and drug design, 8(2), 168–188. doi: 10.1504/ijcbdd.2015.071127. yulita, d. s., polosoro, a., sisharmini, a., apriana, a., nurilmala, f., & trijatmiko, r. (2020). konstruksi vektor biner dan transformasi gen lccsp sintetis ke dalam genom padi nipponbare dengan bantuan agrobacterium tumefaciens. jurnal agrobiogen, 16(1), 25–34. retrieved from http://ejurnal.litbang.pertanian.go.id jurnal riset biologi dan aplikasinya, 3(1): 13-22, march 2021| 22 zhou, h., ning, l., zhang, h., & guo, f. (2014). analysis of the relationship between genomic gc content and patterns of base usage , codon usage and amino acid usage in prokaryotes : similar gc content adopts similar compositional frequencies regardless of the phylogenetic lineages. plos one, 9(9), 1–7. https://doi.org/10.1371/journal.pone.0107319. jurnal riset biologi dan aplikasinya, volume 4, issue 2, september 2022 filicinae taxonomic diversity in the tourism area of tretes waterfall wonosalam kabupaten jombang afifah mei nuraini, wisanti* departement of biology, faculty of mathematics and natural sciences, universitas negeri surabaya, jl. ketintang, gayungan, surabaya 60231, east java, indonesia. *corresponding author: e-mail: wisanti@unesa.ac.id article history abstract received : 10 july 2022 filicinae is a fern with the most species members. the filicinae includes approximately 170 genera and 7000 species. filicinae grows in wet, humid, and shady environmental conditions, like waterfall areas with an altitude of 1100-1300 meters above sea level (m a s l). the study aimed to determine the taxonomic diversity of the filicinae in the tretes wonosalam waterfall tourism area. taxonomic diversity is very important in tourism areas because it prevents species extinction due to the destruction of the habitat, they live in. this was descriptive research with exploration and observation techniques used purposive sampling methods based on altitude. the results of the study were stated in the form of an inventory list of species and families of each station. data gained of species diversity were analyzed using taxonomic diversity with the formula (∆) and dominance diversity with the formula (∆*). exploration results found 37 species from 12 families composed of 10 species from 7 families at station 1; 12 species from 6 families at station 2; 14 species from 7 families at station 3; and 22 species from 12 families at station 4. the highest taxonomic diversity (∆) was station 4 with 106.8 while the lowest for station 1 was 25.63. dominance diversity (∆*) at all stations in this study was in the medium category. the highest family found in the study was tectariaceae with six species. revised : 4 august 2022 approved : 12 september 2022 published : 30 september 2022 keywords dominan diversity, filicinae, taxonomy diversity, tretes waterfall how to cite: nuraini, a.m & wisanti. filicinae taxonomic diversity in the tourism area of tretes waterfall wonosalam kabupaten jombang. jurnal riset biologi dan aplikasinya, 4(2):57-68. doi: 10.26740/jrba. v4n2.p.57-68. introduction filicinae (pteridophyta) is one of the plants with high diversity and distribute widely in indonesia. ferns are distributed in tropical and subtropical regions, live terrestrial, epiphytes on tree surfaces, and at different altitudes (sandy et al. 2016). there are approximately 10.000 known species of ferns in the world and approximately 1.300 species are found in indonesia (sandy et al. 2016). among those numbers 515 fern species were found in java island (darajati et al., 2016). filicinae is a class of pteridophyta with the highest diversity. filicinae is also known as true ferns. filicinae has include approximately 170 genera and 7000 species (nurchayati, 2016). the characteristics of the filicinae are as follows macrophiles leaves with double pinnate compound types (pranita et al. 2016); young leaves are coiled and sorus on the lower surface of the leaves (sulasmi, 2017); some leaves, petioles and leaf branches are sometimes covered with a layer of scale-like hairs called palea (sianturi et al., 2020). the diversity of fern species is strongly influenced by indirect environmental factors, such as temperature, humidity, soil acidity (ph), altitude, and light intensity. the ideal temperature for the growth of ferns in tropical region is usually around 21–27 oc (imaniar et al., 2017). ferns prefer shady areas with a high humidity level. the percentage of humidity 30% is the lowest moisture value that fern can tolerate (situmorang & hasibuan, 2021). the range of 50-80% is the ideal humidity range for the growth of ferns (lestari et al, 2020) besides to temperature and humidity, ph also influences the growth of ferns. usually, the range of 5.5–6.5 is the ideal ph for ferns that live jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi mailto:wisanti@unesa.ac.id jurnal riset biologi dan aplikasinya, 4(2): 57-68, september 2022 | 58 terrestrially in the forest (sianturi et al. 2021). ferns live well in shaded environment. light intensity for good growth of ferns ranges from 117– 1603 lux (sandy et al. 2016). the ideal altitude for the growth of ferns is 1.100-1.300 m a s l (lubis, 2009). ferns are part of biodiversity belonging to plant communities that have quite important ecological functions in forest ecosystems, such as ground cover vegetation, waste mixers for soil nutrient formation, and producers in the food chain (anderson, 2021). ferns also have a role as a direct blocker and suppressor of rainwater flow in steep and runoff area (brock et al. 2016). in addition, ferns have potential as food and medicine also role as a source of germplasm (suneetha et al. 2021). one of the places where filicinae can grow well is in the waterfall area. this is a green open area that has an ideal natural bioecology so that it can support various plant life, including filicinae (hussen et al. 2019). fern’s diversity in a green open space of the waterfall area includes coban rondo waterfall tourism area, malang regency. there are 19 species of ferns that have high diversity (efendi et al. 2013). for the amount of 24 species of ferns have moderate diversity in the jurang nganten waterfall tourism area, jepara regency (windari et al. 2021). the huai yang waterfall national park tourism area in thailand has high diversity of ferns composed of 125 species (yuyen & boonkerd, 2002). species diversity is the diversity of organisms that live in the ecosystem area, such as land or water. each species has different characteristics from other species. species diversity is not only measured by the number of species in an area but also by taxon diversity (taxonomic groups, namely classes, orders, families, and genera) (darajati et al. 2016). diversity needs special attention to solve the basic problem of decreasing of biodiversity. this is because biodiversity is one of the basic conservation effort to prevent extinction so that species are maintained at this time until the future (anderson, 2021). the number of individuals of each species of biodiversity always changes from year to year or from one place to another. taxonomic diversity is the overall variation of living things related to naming, characterizing, and classifying taxonomic diversity which is used as a conservation effort because diversity cannot be done if it has nothing to do with taxonomy (new, 1995). taxonomy is not only used for naming and for grouping. it can also provide information about the basic characteristics of living things. an area that does not know what to protect, will not be able to become a conservation area because the character of organisme has not been identified yet (anderson, 2021). the role of taxonomy today is essential. many studies on biodiversity emphasize the need to document natural assemblages as a basis for conservation (new, 1995). the role of taxonomy as a basis of functional ecology is not only in naming species but also focuses on the importance of taxonomic structures that create ecosystem functions (cousins, 1994). differences among organisms are the main of interactions that occur in ecosystems. as the correlation the task of taxonomy is to describe and relate those differences. the lack of taxonomists leads to bias and underrepresentation of the species lists compiled. taxonomy in translating biodiversity in terms of conservation by trying to explain how species between taxon are interrelated (giangrande, 2003). the taxonomic diversity approach is used to manage and monitor species diversity from phylogenetic to functional diversity. such approaches have been carried out on the use of taxonomic and phylogenetic diversity in conservation efforts (bisby et al. 1995). tretes waterfall is a waterfall tourist area located in galengdewo village, wonosalam district, jombang regency, east java. the tretes waterfall tourism area has a height of 170 meters and is located at an altitude of 1.250 m a s l (dian, 2014). the altitude of the tretes waterfall area is an ideal place for various species of ferns, especially the filicinae class to live and settle. tretes waterfall comes from the upstream of the sumber watu bonakah river and has a beautiful natural panorama located on mount jurung guah. waterfalls that are used as tourist areas can lead to species extinction due to the destruction of the habitat they live in so biodiversity has decreased (imaniar et al. 2017) based on this explanation, the tretes waterfall area has the potential as a habitat for filicinae species to live and settle. however, until now there is no information about the diversity of filicinae in the tretes wonosalam waterfall tourism area. to correctly identify the presence of filicinae in an area, it is necessary to carry out observation, exploration, collection, and identification activities regarding the taxonomic diversity of the filicinae in the tretes waterfall tourism area. the need for this research is done see it relates to biodiversity. 59|nuraini & wisanti; filicinae taxonomic diversity in the tourism area of tretes waterfall research on biodiversity is very important because its utilization and conservation cannot be done without scientific research (suhartini, 2009). thus, research on diversity, especially the diversity of filicinae’s taxonomy in the waterfall area, needs to be continuously developed so that the biological resources used can be used sustainably and can continue to coexist and be in line with nature. materials and methods this research was a descriptive research with an exploration and observation technique. the main stages in this research included exploration, observation, collection, identification, and analysis of the diversity. sampling was carried out in the tretes wonosalam waterfall tourism area, located in jombang regency. geographically, tretes wonosalam waterfall was located at coordinates 7o46'20,867o to 7o46'41,543 south latitude and 112o23'3,485" to 112o24'23,804" east longitude (figure 1). the object in this study was the filicinae species in tourism area of waterfall tretes, wonosalam, kabupaten jombang. observations were made to obtain data related to growth type, morphological characteristics, and environmental factors of the filicinae. morphological characteristics composed of stature, leaves (includes type and shape); and sorus (includes arrangement, shape, and color) (suryadi et al. 2020). environmental factors carried out were measuring soil moisture and ph using a soil tester, light intensity using a lux meter, and temperature using a thermometer. determination of stations in this study were carried out by a certain method of consideration (purposive sampling), namely based on the presence of filicinae. determination of stations based on height or topography along the path to the waterfall (coviello et al. 2015). the stations that had been determined are station 1 (960 m a s l), station 2 (1000 m a s l), station 3 (1100 m a s l), and station 4 (1200 m a s l) using elevation records (pambudi & roziaty, 2020). each station used a rectangular plot with a size of 50 m x 5 m (wardiah et al. 2019). sampling in the area around tretes waterfall starteds from the parking lot to the waterfall based on station placement (figure 2). specimen collection was carried out along the transect line with a specimen collection limit of 2 meters to the right and left and 1.5 meters if epiphytic spikes were found (imaniar et al. 2017). the filicinae species found in location were labeled the habitat was counted in the number of individuals (2 clump of ferns was counted as an individual) for each species. filicinae specimens were collected for identification at the species level using the flora of malaya reference book (holtum, 1968), fern diversity in east java (efendi & iswahyudi, 2019), and the fern guide book (sianturi et al. 2020). results and discussion the results of exploration in the tretes wonosalam waterfall tourism area at different altitudes had been identified and presented in the form of species and family’s inventory (table 1). total identified filicinae species were 37 species from 12 families. station 1 covered 10 species belonging to 7 families, station 2 covered 12 species belonging to 6 families. station 3 covered 14 species from 7 families, and station 4 covered 22 species from 12 families. total families found including 12 families from two orders, namely cyatheales and polypodiales. cyatheales consisted of cycatheaceae family while the order polypodiales consisted of families, such as pteridaceae, aspleniaceae, athyriaceae, dryopteridaceae, thelypteridaceae, lamariopsidaceae, davalliaceae, polypodiales, tectariaceae, dennstaeditiaceae, and neprolepidaceae. based on table 1, the results of the study found various filicinae from four station. family with the highest species diversity was tectariaceae with six species, while the highest diversity of genus was tectaria with five species. the highest diversity of filicinae species was found at station 4 (1200 m a s l) with 22 species, while the lowest diversity was at station 1 (960 m a s l) with 10 species. two other stations, namely station 2 (1000 m a s l) and station 3 (1200 m a s l) had 12-14 species of filicinae diversity. each station showed different and unique families and species characteristics. two stations had distinctive families, namely cyathaeceae family at station 1 and lomariopsidaceae, neprolephidaceae, and dennstaeditiaceae families at jurnal riset biologi dan aplikasinya, 4(2): 57-68, september 2022 | 60 figure 1. research area map (source: upt tahura) figure 2. research station placement map, : pick-up point with an altitude of 960 m above sea level; : pick-up point at an altitude of 1000 m above sea level; : the pick-up point is at an altitude of 1100 m above sea level; : point of elevation 1200 m above sea level; : parking area; : river; : waterfall; : footpath filicinae species diversity was analyzed using taxonomic diversity which is obtained from the formula ∆ (1) and dominance diversity from the formula ∆* (2) (warwick & clarke, 1995) (braun, 2015). taxonomic diversity formula (∆) : [ ijxixj ]/[n (n 1)/2)] …….. (1) information: ∆ = taxonomic diversity ij = representation of the link between the two species in a hierarchical classification 1: genera with different species 2: families with different genera 4: class and order n = total number of individuals in the sample xixj = species abundance indicator the criteria for taxonomic diversity are divided into three categories, namely the low category (∆ < 26.06); the medium category (26.06 – 69.07); and the high category (∆ > 69.07) (sirait et al. 2018). 61|nuraini & wisanti; filicinae taxonomic diversity in the tourism area of tretes waterfall dominant diversity formula (∆*) * =[ ijxixj ]/ [ ∑ j = 1, … n ∑i<j xixj ] …….. (2) note: ∆* = dominance of diversity ij = representation of the link between the two species in a hierarchical classification 1: genera with different species 2: families with different genera 4: class and order n = total number of individuals in the sample xixj = species abundance indicator the criteria for dominance diversity are divided into three categories, namely low (∆* < 3.0); medium (3.1 – 6.0); and height (∆* > 6.1) (wahyuningsih et al. 2019) table 1. inventory of filicinae in tretes waterfall tourism area no. species name families orders station 1 2 3 4 1 adiantum capillus-veneris l. pteridaceae polypodiales √ 2 asplenium adiantum-nigrum l. aspleniaceae √ 3 asplenium excisum c. presl. √ 4 athyrium accendens (biume) milde. athyriaceae √ 5 athyrium asperum (blume) milde. √ 6 athyrium esculentum (retz.) copel. √ √ 7 athyrium filix-femina (l.) roth. dryopteridaceae √ 8 athyrium procumbens (holttum) athyriaceae √ √ 9 bolbitis heteroclita (c. presl) ching. dryopteridaceae √ √ √ 10 chingia clavipilosa holttum thelypteridaceae √ 11 christella dentata (forsk.) brownsey & jeremy cyatheaceae √ 12 cyathea contaminans copel cyatheales √ 13 cyathea squamulata (biume) copel. √ 14 cyclopeltis crenata (fee) c. chr. lomariopsidaceae davalliaceae polypodiales √ 15 davallia canariensis (l.) sm. √ 16 davallia denticulata (burm.f.) mett. ex kuhn. √ 17 davallia trichomanoides biume √ 18 dryopteris carthusiana (vill.) h. p. fuchs dryopteridaceae √ 19 dryopteris concolor (langsd. & fisch.) kuhn pteridaceae √ 20 dryopteris cycadina (franch. & sav.) c. chr. dryopteridaceae √ 21 goniophlebium sobauriculatm (biume) c. presl. polypodiaceae √ √ 22 heterogonium sagenoides (mett.) holt. tectariaceae √ √ 23 loxogramme involuta (d. don.) c. presl. polypodiaceae √ 24 macrothelypteris torresiana (gaudich.) ching thelypteridaceae √ √ √ √ 25 microlepia speluncae (l.) t. moore. dennstaeditiaceae √ 26 nephrolepis biserrata (sw.) schott nephrolepidaceae √ 27 phegopteris connectilis (michx.) watt thelypteridaceae √ 28 pteridium aquilinum (l.) kuhn dennstaeditiaceae pteridaceae √ 29 pteris biaurita l. √ √ √ 30 pteris fauriei hieron. √ 31 pyrrosia adnascenes (sw.) ching. polypodiaceae √ 32 sphaerostephanos heterocarpus (blume) holt. thelypteridaceae √ 33 stenosemia aurita (sw.) c. presl tectariaceae √ √ √ √ 34 tectaria inges (atk.) holt. √ √ 35 tectaria melanocaula (blume) copel. √ 36 tectaria multicaudata (wall.) ching. √ √ √ √ 37 tectaria vasta (blume) copel. √ √ √ jurnal riset biologi dan aplikasinya, 4(2): 57-68, september 2022 | 62 station 4. each station also had a special species. station 1 contained six typical species including a. capillus-veneris; a. adiantum-nigrum; c. contaminants; c. squamulata; p. adnascenes and d. trichomanoides (fig. 3). there were to distinct species at station 2, namely d. denticulata and d. carthusiana (figure 4). station 3 contained six typical species including a. accendens; c. clavipilosa; d canariensis; d. cycadina; l. involuta and p. fauriei (figure 5). station 4 contained 12 species with distinctive characters figure 3. characteristics of species at station 1 consisting of a. adiantum-nigrum species; c. contaminants; p. adnascenes; and d. trichomanoides. a. adiantum-nigrum has an elongated brown sorus arranged parallel to it. c. contaminans contained round brown sorus arranged in regular rows adjacent to the mother leaf bone. p. adnascenes has an epiphytic habitat, the sterile leaves are short, oblonand g while the fertile leaves are long like ribbons. d. trichomanoides is an epiphytic fern with double pinnate compound leaves. figure 4. characteristics of station 2 species which consist of two species. the first species d. denticulata epiphytes habitat, double-pinnate compound leaves. sorus goblet-shaped yellowish that was located at the edge of the leaf and appears at the tip of the leaf veins. the second species, d. carthusiana, was a terrestrial and compound-leaved. sorus round yellowish arranged scattered in the middle of the veins on the lower surface of the leaf. figure 5. characteristics of station 3 species consisting of two species, namely a. accendes and d. canariensis. a. accendens has a terrestrial habitat and has compound leaves. the sorus are yellowish stripes, inditium and arranged along the entire length of the leaf veins. d. canariensis has an epiphytic habitat, double pinnate compound leaves. sorus goblet-shaped (convex) yellowish which was located at the edge of the leaf and appears at the tip of the leaf veins. figure 6. characteristics of station 4 species which consist of three species. the first species is s. heterocarpus which has a terrestrial habitat with pinnate compound leaves. the sorus are round or almost round brown, arranged in parallel in two rows located on each leaf vein, approaching the midrib of the leaf. the second species, m. speluncae, has a terrestrial habitat and has compound leaves. sorus are round brown in shape arranged in parallel which is located under the leaf surface near the notch or leaf lobe. and the third species is a. asperium which has a terrestrial habitat and has compound leaves with alternating leaflets. sorus is a brown line that is located almost throughout the leaf veins, from the base to the middle or near the leaf edge and has a thin indusium. table 2. taxonomic diversity and dominance diversity of filicinae in tretes waterfall tourism area note: station 1: 1= 1, 4= 4; station 2: 1= 1, 2= 2, 4=4; station 3: 1= 1, 2= 2, 4=4; and stasion 4: 1= 1, 2= 2, 4=4 table 3. abiotic factors of each research station stations taxonomic diversity category dominance diversity category station 1 (960 m a s l) 25.63 low 3.80 medium station 2 (1000 m a s l) 28.23 medium 3.58 medium station 3 (1100 m a s l) 63.04 medium 3.68 medium station 4 (1200 m a s l) 106.8 high 3.84 medium abiotic factors ph temperature humidity light intensity station 1 (960 m a s l) 5.6 22 oc 40% 3320 lux station 2 (1000 m a s l) 6.1 21.7 oc 45% 2500 lux station 3 (1100 m a s l) 6.4 21oc 49% 1742 lux station 4 (1200 m a s l ) 6.5 21oc 65% 397 lux 63|nuraini & wisanti; filicinae taxonomic diversity in the tourism area of tretes waterfall the results of data analysis showed that the calculation at station 1 only used two types of omega, namely ω1 = 1 and ω4 = 4 so the diversity was lowest. this is because station 1 there were no species belonging to the same family with different genera. however, for the rest stations the calculation used all types of omega, because each station contained species belonging to one family with different genera so the diversity was various from medium to high. based on table 2, the highest diversity value was shown at station 4 by the amount of 106.8 with 22 species, while the lowest was at the station 1 by the amount of 25.63 with 10 species. the dominance diversity value obtained at all stations was included in the medium category (between 3.1 – 6.0). the highest score was obtained at the station 4 by the amount of 3.84, while the lowest value was obtained at the station by the amount 2 of 3.58. the determination of high and low diversity was based on the use of ω value. the greater ω value, the higher the diversity, and vice versa. table 3, it could be seen that the highest soil ph was station 4, which is 6.5 and the lowest was at station 1, with the score of 5.6. the highest ambient temperature was the station 1 at 22oc and the lowest temperature was the station 3 and station 4 at 21oc. the highest humidity was at station 4 was at the station 4 reaching the amount of 65% while the lowest humidity was at the station 1 by the amount of 40%. the highest light intensity was at station 1 of 3320 lux and the lowest light intensity was at station 4 of 397 lux. based on the results of observations, explorations, collections, and identifications, 37 species of filicinae from 12 families were found. the family consists of families cycatheaceae, pteridaceae, aspleniaceae, athyriaceae, dryopteridaceae, thelypteridaceae, lamariopsidaceae, davalliaceae, polypodiales, tectariaceae, dennstaeditiaceae and neprolepidaceae. this proved that tretes waterfall tourism area was ideal for the growth and development of filicinae since abiotic conditions (ph, temperature, humidity, and light intensity). the filicinae species in the tretes wonosalam waterfall tourism area were mostly ferns lived in terrestrial habitat. in line with the results of research by pranita et al. (2016), the filicinae species in the watu ondo waterfall area most commonly found were terrestrial ferns with nine species when compared to four species of epiphytic ferns. the results of asri's research (2020), showed that the fern species that grow in the joben montong gading tourism area, east lombok regency, mostly had a terrestrial habitat compared to epiphytes. the lack of habitat for epiphytic plants was found because there were few trees that could be used as host trees for the attachment of ferns. most of the trees found in this area had a dry texture, such as brugmansia sauveolens, while ferns prefered trees with a rough texture and thick skin. confirming to harrington & watts (2021), that usually the host plants favored by ferns are tree plants that have a thick, grooved and, stringy texture, and have hard skin which is thought to come from the influence of the association between the host plant and its epiphytes. species diversity was a community-level characteristic that corresponds to its biological organization. the high diversity of species proved that the community in an area has high complexity. this is because of very high reciprocal relationship between species in the community. according to schweiger et al. (2018), diversity was used to express the level of species diversity in a particular area. the more the number of species, the higher the diversity. conversely, the fewer the number of species, the community was only dominated by one or a few species (odum, 1996). species diversity was also influenced by the distribution of individuals within each species because even though a community had many species, the distribution of individuals was not evenly distributed, so the diversity was low (efendi et al. 2013). the highest taxonomic diversity was at station 4, which was 106.8 including 22 species belonging to 12 families. the high diversity was due to the environmental conditions (table 3) in the tretes wonosalam waterfall tourism area which were very supportive for the growth and development of the filicinae. the altitude at station 4 (1200 m a s l) also affected the diversity of ferns. this was in line with the research of nugroho & roziaty (2020), in the girimanik forest area of central java that station 1 with an altitude of 1200-1300 m dpl found the most species compared to station 2 with an altitude of 1350-1500 m a s l. station 1 (1200 – 1300 m a s l) found 15 species while station 2 (1350 – 1500 masl) had 13 species of ferns. as explained by lubis (2009), the highest diversity was at altitude of 1100-1300 m a s l when compared to an altitude of 1300-1500 m a s l and 1500-1750 m a s l. however, research conducted by sandy et al. (2016) in the lawean sendang waterfall area, tulungagung regency showed different results, at the initial jurnal riset biologi dan aplikasinya, 4(2): 57-68, september 2022 | 64 location of the study (1109 m a s l) more fern species were found than at the final location of the study (1225 m a s l). the initial location of the study (1109 m a s l) found 16 species of filicinae and 1 species of lycopodiinae while at the last location of the study (1225 m a s l) found 4 species of filicinae and 1 species of lycopodiinae. sandy et al. (2016), stated that the higher the research location, the more homogeneous and less numerous fern species were found. the lowest taxonomic diversity was at station 1, which was 25.63 with 10 species from 7 families. station 1 (960 m a s l) was an area that mostly used as a parking area. it caused filicinae difficult to grow in this area. in line with the research of imaniar et al. (2017), in kapas biru waterfall area, lumajang regency that station 1 (630 m a s l) which functioned as parking area had the least number of species compared to station 2 (593 m a s l) and station 3 (521 m a s l). there were 9 filicinae species out of 30 species. in line with the research of mila et al. (2021), that the low diversity of ferns in the matalawa national park area on the island of sumba was strongly influenced by human activities and environmental factors. nugroho & roziaty, (2020), said that the felling of trees due to the change of functioning in a tourist area caused the reduction of ferns existence. the diversity of filicinae dominance species in all research stations had been classified to moderate, which was in the range (∆*) = 3.58–4.84. in line with sari & bayu research (2019), the diversity of dominance in the benua forest area of hulu sungai tengah regency had a medium dominance diversity of 39.90. astuti et al. (2018), argued that the few species or at least the dominant species in a community, the dominance diversity could be said as low. conversely, the abundance of species with the same or nearly the same number in a community could be started as high dominance diversity. efendi et al. (2013), added that the more extreme environmental conditions, such as the increasing climate, soil, or altitude, the less diversity of species composition in vegetation, and one or two species would be more dominant. the family that had the highest number of species was tectariaceae with six species. in line with the research of mila et al. (2021), the high number of tectariaceae species in the matalawa national park area was ninety-two individuals because this family had good adaptation to various environmental conditions. the tectariaceae included 20 genera and 400 species distributed throughout tropical region (wang & wu, 1999), and some species extended north and south of temperate regions (brownsey & perrie, 2014). the tectariaceae family was a terrestrial fern, with single to compound leaves, and a round sorus located on the underside of the leaves with different indusium (fuwu et al. 2013). the cyatheacae family was a characteristic of the family at station 1 that was not found in other stations. station 1 (960 m a s l) has a high light intensity of 3320 lux. in line with the research of hanum et al. (2014), the cyathea genera in bali was found at an altitude of 200-1600 masl. according to dong (2009), most of the cyatheaceae family grows under all kinds of conditions, especially light intensity and wind speed. other family characteristics, lomariopsidaceae, neprolephidaceae, and dennstaeditiaceae families, were found at station 4. the three families were only found at station 4 because most of the species were only able to live in certain environmental different conditions at each station cause each station to had species characteristics. one of the specific characteristics of each station was a species of c. contaminans with tree stature, and double pinnate compound leaves at the station 1. round brown sorus was arranged in regular rows adjacent to the mother leaf bone (hanum et al. 2014). station 2 containeds species of d. carthusiana with herbaceous stature and compound leaves. yellowish round sorus arranged scattered in the middle of the veins on the lower surface of the leaf (efendi & iswahyudi, 2019). station 3 containeds the species of a. accendens, which is herbaceous and had compound leaves, the sorus was in the form of a yellowish line, had an indusium, and arranged along the entire length of the leaf veins (efendi & iswahyudi, 2019). station 4 containeds a species of m. speluncae with herbaceous stature and compound leaves. sorus was brown with indusium and located in each leaf groove (hidayah et al. 2021). the existence of the filicinae species in tretes wonosalam waterfall tourism area needed to be protected. one of the efforts to protect its sustainability was to find out the conservation status of the filicinae species. based on the search results through the iucn red list (2022), all filicinae species obtained in the tretes wonosalam waterfall tourism area had a conservation status that was still safe or not at risk of being threatened with extinction. the number of filicinae species obtained based on exploration is 37 species with 65|nuraini & wisanti; filicinae taxonomic diversity in the tourism area of tretes waterfall figure 3. species characteristics at station 1, a. sorus a. adiantum-nigrum; b. sorus c. contaminans; c. p. adnascenes; and d. d. trichomanoides figure 4. characteristics of species at station 2, a. sorus d. denticulata and b. sorus d. carthusiana figure 5. characteristics of station 3 species, a. sorus a. accendens and b. sorus d. canariensis figure 6. characteristics of station 4 species, a. sorus s. heterocarpus; b. sorus m. speluncae; and c. sorus a. asperus a b c d a b a b a b c jurnal riset biologi dan aplikasinya, 4(2): 57-68, september 2022 | 66 high diversity category. however, the filicinae species that existed in the area must be preserved order to prevent increasing of the red list status in the future. the biodiversity of plants in an area has a strategic role in controlling environmental crises. this was because the abilities possessed could be used as staples and treatment for the community and also the role of the environment was used to balance the ecological system (robinson et al. 2013).ecosystems and biological natural resources had functions and benefits as elements of the formation of environment formation and their existence was the most important part of natural resources. therefore, efforts to conserve living natural resources and their ecosystems needed to be maintained for the present and the future because their nature and role were significant and cannot be replaced for life (suhartini, 2009). conclusion based on the results of research in tretes wonosalam waterfall tourism area, it could be concluded that there was a total of 37 filicinae species belonging to 12 families with the acquisition of species per station as follows: ten species with seven families at station 1; twelve species with six families at station 2; fourteen species with seven families at station 3; and twenty-two species with twelve families at station 4. the highest taxonomic diversity (∆) was obtained at station 4 of 106.8 while the lowest was obtained at station 1 of 25.63. the dominance diversity (∆*) obtained in all research stations was categorized as moderate, ranging from 3.58 to 4.84. the highest family found in the study was tectariaceae with six species. the tretes wonosalam waterfall tourism area has potential as a filicinae habitat as evidenced by the level of taxonomic diversity of filicinae which is included in the high to low category with dominance diversity in the medium category. nevertheless, the diversity of filicinae in the tretes wonosalam waterfall tourism area needs to be preserved so that it does not extinct in the future. efforts to preserve the diversity of the filicinae are crucial because it has a big and irreplaceable role for life. acknowledgment the authors would like to thank the upt taman hutan raya raden soerjo and the department of biology, faculty of mathematics and science, state university of surabaya. references anderson, o. r. (2021). physiological ecology of ferns: biodiversity and conservation perspectives. international journal of biodiversity and conservation, 13(2), 49–63. https://doi.org/10.5897/ijbc2021.1482 asri, i. h. (2020). keanekaragaman tumbuhan paku (pteridophyta) di kawasan wisata joben desa pesangerahan kecamatan montong gading kabupaten lombok timur. cocosbio, 5(2), 36–40. https://ejournal.hamzanwadi.ac.id/index.php/cob/article/view /3221. astuti, f. k., murningsih, m., & jumari, j. (2018). keanekaragaman jenis tumbuhan paku (pteridophyta) di jalur pendakian selo kawasan taman nasional gunung merbabu, jawa tengah. bioma : berkala ilmiah biologi, 20(1), 25–30. https://doi.org/10.14710/bioma.20.1.25-30. bisby, f. a, coddington, j., thorpe, j. p., smartt, j., hengeveld, r., edwards, p. j., & duffield, s. j. (1995). characterization of biodiversity. global biodiversity assessment, 1–104. braun, a. c. (2015). taxonomic diversity and taxonomic dominance: the example of forest plantations in south-central chile. open journal of ecology, 05(05), 199–212. http://dx.doi.org/10.4236/oje.2015.55017 brock, j. m. r., perry, g. l. w., lee, w. g., & burns, b. r. (2016). tree fern ecology in new zealand: a model for southern temperate rainforests. forest ecology and management, 375, 112–126. https://doi.org/10.1016/j.foreco.2016.05.030. brownsey, p. j., & perrie, l. r. (2014). flora of new zealand ferns and lycophytes (issue december). new zaeland: manaaki whenua press. cousins, s.h. 1994. taxonomy and functional biotic measurement, or, will the ark work? in systematics and conservation evaluation, forey pl, humphries cj, vane-wright ri. (eds). oxford: claderon press. coviello, v., arattano, m., & turconi, l. (2015). detecting torrential processes from a distance with a seismic monitoring network. natural hazards, 78(3), 2055– 2080. https://doi.org/10.1007/s11069-015-1819-2. darajati, w., pratiwi, s., herwinda, e., radiansyah, a. d., nalang, v. s., nooryanto, b., rahajoe, j. s., ubaidillah, r., maryanto, i., kurniawan, r., prasetyo, t. a., rahim, a., jefferson, j., & hakim, f. (2016). indonesia biodiversity startegy and action plan (ibsap) 2012-2020. kemetrian pembangnan nasional/bappenas. dian, n. (2014). analisis kebijakan terhadap pengembangan pariwisata di kecamatan wonosalam kabupaten jombang. kebijakan dan manajemen publik, 1(1), 1–8. dong, s. y. (2009). hainan tree ferns (cyatheaceae): morphological, ecological and phyto geographical observations. annales botanici fennici, 46(5), 381–388. 10.5735/085.046.0502. efendi, w.w., & iswahyudi, s. (2019). keanekaragaman tumbuhan paku di jawa timur. surabaya: graha ilmu. efendi, w.w., hapsari, f.n.p., dan nuraini, z. (2013). studi inventarisasi keanekaragaman tumbuhan paku di kawasan wisata coban rondo kabupaten malang. cogito ergo sum, 2(3), 173. http://eprints.umm.ac.id/26645/1/jiptummpp-gdlwawanwahyu-31552-1-pendahul-n.pdf. fuwu, x., yuehong, y., shiyong, d., chriztenhusz, m., faguo, w., & hovenkamp, p. (2013). tectariaceae. flora of china, 2(3), 730–746. 10.11646/phytotaxa.10.1.9. https://doi.org/10.5897/ijbc2021.1482 https://doi.org/10.14710/bioma.20.1.25-30 https://doi.org/10.1016/j.foreco.2016.05.030 http://dx.doi.org/10.5735/085.046.0502 http://dx.doi.org/10.11646/phytotaxa.10.1.9 67|nuraini & wisanti; filicinae taxonomic diversity in the tourism area of tretes waterfall giangrande, a. (2003). biodiversity, conservation, and the “taxonomic impediment.” aquatic conservation: marine and freshwater ecosystems, 13(5), 451–459. https://doi.org/10.1002/aqc.584. hanum, s. f., hendriyani, e., & kurniawan, a. (2014). daerah penyebaran, populasi dan habitat paku pohon (cyathea spp. dan dicksonia spp.) di bali. indonesian forest rehabilitation journal, 2(2), 111–122. https://www.journals.uchicago.edu/doi/abs/10.1086 /713443. harrington, a. d., & watts, j. l. (2021). low-trunk epiphytic fern gametophyte and sporophyte occurrence is influenced by moss height and density in a costa rican lowland tropical rain forest. international journal of plant sciences, 182(4), 286–294. https://www.journals.uchicago.edu/doi/abs/10.1086 /713443. hidayah, n., julita, t., melvinasari, m.w., dwiyanoto, g., hendi, r., dan sigit, d.v. 2021. identification of pteridophyte in jakarta urban forest, indonesia. proceeding of biologi education, 4(1), 1–11. http://dx.doi.org/10.21009/pbe.4-1.1. hussen, a. m. e. a., retnaningdyah, c., hakim, l., & soemarno, s. (2019). the variations of physical and chemical water quality in coban rondo waterfall, malang indonesia. aip conference proceedings, 1–12. holtum, (1968). ferns of malaya. toronto: mc grawhill. imaniar, r., pujiastuti, & murdiyah, s. (2017). identifikasi keanekaragaman tumbuhan paku di kawasan air terjun kapas biru kecamatan pronojiwo kabupaten lumajang serta pemanfaatan sebagai booklet. jurnal pendidikan biologi, 6(3), 337–345. https://doi.org/10.24114/jpb.v6i3.7901. lestari, i., murningsih, & utami, s. (2020). the diversity of fern in petungkriyono mixed forest pekalongan, central java. journal of physics: conference series, 1524(1), 1–4. 10.1088/1742-6596/1524/1/012141. lubis, s. r. (2009). keanekaragaman dan pola distribusi tumbuhan paku di hutan wisata alam taman eden kabupaten toba samosir provinsi sumatera utara. tesis. medan: sekolah pascasarjana universitas sumatra utara. mila, y. s., lalupanda, e. m., & ina, a. t. (2021). keanekaragaman pteridophyta di kawasan taman nasional matalawa di pulau sumba. jurnal penelitian kehutanan bonita, 3(1), 18–27. http://dx.doi.org/10.55285/bonita.v3i1.718. new, t. (1995). an introduction to invertebrate conservation biology. new york: oxford university press. nugroho, r. a., & roziaty, e. (2020). inventarisasi tumbuhan paku terestrial (pteridophyta) di kawasan hutan girimanik kecamatan slogohimo kabupaten wonogiri jawa tengah. seminar nasional pendidikan biologi dan saintek (snpbs) ke-v, 3(2), 1– 4. nurchayati, n. (2016). identifikasi profil karakteristik morfologi spora dan prothalium tumbuhan paku familia polypodiaceae. jurnal bioedukasi, 14(2), 25–30. https://jurnal.unej.ac.id/index.php/bioed/article/v iew/4538. odum, p.e. (1996). dasar – dasar ekologi. yogyakarta: gadjah mada university press. pambudi, e. f., & roziaty, e. (2020). inventarisasi tumbuhan obat di kawasan air terjun grojogan sewu tawangmangu karanganyar jawa tengah. prosiding seminar nasional pendidikan biologi dan saintek (snpbsi) v, 66–70. pranita, h. s., mahanal, s., & sari, m. s. (2016). inventarisasi tumbuhan paku kelas filicinae di kawasan wati ondo sebagai media belajar mahasiswa. seminar nasional pendidikan dan saintek 2016 ke-1, 2016, 733–740. robinson, d., hockley, n., cooper, d., emmett, b., keith, a., lebron, i., reynolds, b., tiping, e., tye, a., watts, c., whalley, w., black, h., & warren, g. (2013). natural capital and ecosystem services, developing an appropriate soils framework as a basis for valuation. soil biology and biochemistry, 57, 1023– 1033. https://doi.org/10.1016/j.soilbio.2012.09.008. sandy, s. f., pantiwati, y., hudha, a. m., & latifa, r. (2016). keanekaragaman jenis tumbuhan paku (pteridophyta) di kawasan air terjun lawean sendang kabupaten tulungagung. prosiding seminar nasional ii tahun 2016, kerjasama prodi pendidikan biologi fkip dengan pusat studi lingkungan dan kependudukan (pslk) universitas muhammadiyah malang, 828–836. sari, h., & bayu, h. m. (2019). keanekaragaman tumbuhan paku (pteridophyta) di kawasan hutan desa banua rantau kecamatan batang alai selatan kabupaten hulu sungai tengah. jurnal pendidikan hayati, 5(3), 107–114. https://www.stkipbjm.ac.id/mathdidactic/index.php/ jph/article/view/869/367. schweiger, a. k., cavender-bares, j., townsend, p. a., hobbie, s. e., madritch, m. d., wang, r., tilman, d., & gamon, j. a. (2018). plant spectral diversity integrates functional and phylogenetic components of biodiversity and predicts ecosystem function. nature ecology and evolution, 2(6), 976–982. https://www.nature.com/natecolevol. sianturi, a., ridlo, s., & retnoningsih, a. (2021). diversity and distribution of ferns at different altitudes in central java. journal of physics: conference series, 1918(5), 1–4. https://iopscience.iop.org/article/10.1088/17426596/1918/5/052016/pdf. sianturi, a. s. r., retnoningsih, a., & ridlo, s. (2020). eksplorasi tumbuhan paku pteridophyta. ristekditi unnes, 1–156. https://doi.org/10.24042/biosfer.v10i1.4277. sirait, m., rahmatia, f., & pattulloh. (2018). comparison of diversity index and dominant index of phytoplankton at ciliwung river jakarta). jurnal kelautan: indonesian journal of marine science and technology, 11(1), 75–79. 10.21107/jk.v11i1.3338. situmorang, j. t., & hasibuan, r. (2021). an inventory of ferns (pteridophyta) in plantation ptpn nusantara 3 rantau prapat district labuhanbatu. budapest international research and critics institute (bircijournal): humanities and social sciences, 4(2), 3122– 3128. 10.33258/birci.v4i2.2030. suhartini. (2009). peran konservasi keanekaragaman hayati dalam menunjang pembangunan yang berkelanjutan. prosiding seminar nasional penelitian, pendidikan dan penerapan mipa 2., 199–205. sulasmi, e. s. (2017). analisis kekerabatan spora tumbuhan paku koleksi herbarium malangensis. prosiding seminar nasional hayati v, 162–169. suneetha, c., nagesha, n., nataraja, a., kavita, k., vinayaka, m., & smitha, h. (2021). ethnobotanical importance of pteridophytes of agumbe ghats. indian fern j, 38, 115–124. suryadi, muhibuddin, hasanuddin, samingan, & nurmaliah, c. (2020). phenetic kinship of eight ferns from filicinae class based on morphological and anatomical characteristic. journal of physics: conference series, 1460(1), 1–6. https://doi.org/10.1002/aqc.584 https://doi.org/10.24114/jpb.v6i3.7901 http://dx.doi.org/10.1088/1742-6596/1524/1/012141 http://dx.doi.org/10.55285/bonita.v3i1.718 https://doi.org/10.1016/j.soilbio.2012.09.008 https://doi.org/10.24042/biosfer.v10i1.4277 http://dx.doi.org/10.21107/jk.v11i1.3338 http://dx.doi.org/10.33258/birci.v4i2.2030 jurnal riset biologi dan aplikasinya, 4(2): 57-68, september 2022 | 68 https://iopscience.iop.org/article/10.1088/17426596/1460/1/012077/pdf. wahyuningsih, e., faridah, e., budiadi, & syahbudin, a. (2019). komposisi dan keanekaragaman tumbuhan pada habitat ketak (lygodium circanatum (burm.(sw.) di pulau lombok, nusa tenggara barat. jurnal hutan tropis, 7(1), 92–105. http://dx.doi.org/10.20527/jht.v7i1.7285. wang, c.h., dan wu, s.h. 1999. for a reipublicae popularis sinicae (in chinese). beijing: science press. wardiah, w., sarina, i., hasanuddin, nurmaliah, c., & andayani, d. (2019). pteridophyta di kawasan air terjun suhom kecamatan lhoong kabupaten aceh besar. biotik: jurnal ilmiah biologi teknologi dan kependidikan, 7(2), 89–95. http://dx.doi.org/10.22373/biotik.v7i2.5650. warwick, r. m., & clarke, k. r. (1995). new “biodiversity’’ measures reveal a decrease in taxonomic distinctness with increasing stress. marine ecology progress series, 129(1–3), 301–305. https://www.jstor.org/stable/24855596. windari, khotimperwati, l., & murningsih. (2021). keanekaragaman jenis tumbuhan paku ( pteridophyta ) di kawasan wisata air terjun jurang nganten kabupaten jepara. bioma: jurnal berkala ilmiah biologi, 23(2), 107–111. https://doi.org/10.14710/bioma.23.2.107-111. yuyen, y., & boonkerd, t. (2002). pteridophyte flora of huai yang waterfall national park, prachuap khiri khan province, thailand. the natural history journal of chulalongkorn university, 2(1), 39–49. https://li01.tcithaijo.org/index.php/tnh/article/view/102864/8240 8. http://dx.doi.org/10.20527/jht.v7i1.7285 http://dx.doi.org/10.22373/biotik.v7i2.5650 https://doi.org/10.14710/bioma.23.2.107-111 jurnal riset biologi dan aplikasinya, volume 5, issue 1, march 2023 leaf and stomata morphometrics of gayam inocarpus fagifer (fabaceae) at different altitudes alwi smith, kristin sangur*, dessy fitri molle, ludia haurissa, grisendy maulany, belsefren renyaan biology education study program, faculty of teacher training and education, universitas pattimura, jln. ir. m. putuhena, poka campus, ambon city, maluku, indonesia *corresponding author: e-mail: sangur_kristin@yahoo.com article history abstract received : 5 desember 2022 gayam (inocarpus fagifer) is one of the members of the angiosperm flora in ambon city, indonesia, that grows and develops at various altitudes. this research aimed to analyze the leaf and stomata morphometrics of these plants in the aer louw and ema village areas. leaf samples were taken from the upper, middle, and lower strata and considered as replicates. the morphometric characteristics were measured manually using millimeter block paper and the formula for calculating leaf ratio. furthermore, the stomata were stained using the direct incision method and safranin. the incision results were analyzed using an olympus cx23 microscope at 400x magnification. the measurement and observation were analyzed descriptively and correlatively. the results showed that the average leaf width and length, also the midrib length were greater in aer louw village than in ema village; while the leaf tip and stalk length were greater in ema village than in aer louw village. the characteristics of stomata length and width in ema village were greater than in aer louw village; otherwise, the number, index, and density of stomata in aer louw village were greater than in ema village. meanwhile, the correlational analysis showed that the environment influenced the variations of leaves and stomata. therefore, the variations of leaves and stomata in the areas could predict plant adaptations to different environments. revised : 12 february 2023 approved : 22 march 2023 published : 31 march 2023 keywords altitudinal gradient; ecology; functional morphology; stomata density how to cite: smith, a., sangur, k., molle, d.f., haurissa, l., maulany, g., & renyaan, b. (2023). leaf and stomata morphometrics of gayam inocarpus fagifer (fabaceae) at different altitudes. jurnal riset biologi dan aplikasinya, 5(1): 16-26. doi: 10.26740/jrba. v5n1.p.16-26. introduction inocarpus fagifer (parkinson ex zollinger) fosberg is a woody, leguminous plant with a tree habitus distributed in tropical and subtropical areas. it has a shallow taproot, while the lateral roots appear on the soil surface. the tree bark is rough and brown or gray, while the leaves are oval, arranged alternately, dark green, and has a rough surface. the flowers are arranged in clusters on branches, stems, and twigs with five petals and showing white or yellowish color variations. the fruit is oval, irregular, and slightly flattened, while the young fruit is green and turns orange-brown when ripe. moreover, the seeds are white, fibrous, and thin (setyowati & wawo, 2015; wawo et al., 2011). i. fagifer is known in different countries under its local names, thus aila in papua new guinea, chataignier de tahiti in french polynesia, ivi in fiji, and tahitian chestnut or polynesian chestnut in england (pauku, 2006). pauku et al. (2010) also stated that most farmers use i. fagifer as an agricultural crop. meanwhile, i. fagifer in ambon city is grown by the community but not cultivated as a crop, such that the seeds that fall on the ground will grow naturally. the city is one of the areas with a large distribution of these plants, namely in ema and air louw villages. the distribution in the two villages represents the highlands and lowlands. jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi mailto:sangur_kristin@yahoo.com https://doi.org/10.26740/jrba.v5n1.p16-26 17| smith et al., leaf and stomata morphometrics of gayam according to hamidah & fitriani (2018), some plants can grow well in the lowlands to the highlands hence, they have a wide distribution. this explanation shows that i. fagifer is a plant with a wide distribution in these two villages. the topography and slope of the place and environmental factors such as light intensity, wind speed, temperature, and co2 pressure vary greatly in high and low areas (gao et al., 2019; kofidis & bosabalidis, 2008). the varying conditions of environmental factors certainly affect the modification and adaptation of plants in the two villages. one of the characteristics that is easy to observe is the morphology of plant organs such as roots, stems, leaves, flowers, fruits, and seeds. however, the tree has a large trunk diameter and a height of up to 3 m. this makes it difficult to observe and measure some morphological characteristics. meanwhile, flowers, fruits, and seeds are classified as seasonal organs, making morphological observation difficult. leaves are one of the vegetative organs obtained to observe and measure morphological characteristics. leaf morphometric measurement is conducted to determine leaf area, length, and ratio, which are also very useful for determining physiological processes. observation of stomata characteristics can easily be performed through the leaf organ. liu et al. (2020) also stated that plant adaptation to changes in environmental factors is carried out by reducing leaf area and increasing the thickness, mesophyll tissue thickness, and stomata density. according to ruszala et al. (2011) and he & liang (2018), stomata are tissues that are very sensitive to the environment. therefore, it is very important to observe and measure the stomata of the i. fagifer leaves to determine their shape, length, width, aperture, density, and index. paembonan et al. (2021) stated that highlands affect the number of stomata but reduce the size and index of the makassar ebony (diospyros celebica bakh.). tumpa et al. (2022) also noted that geographical location affects the leaf size of salix triandra l., a process of morphological adaptation to environmental changes. according to muradoglu & gundogdu (2011), leaf surface area relates to the stomata frequency in walnut plants. based on these results, the leaf and stomata morphometric measurement of i. fagifer plants was conducted based on the difference in altitude in two areas, namely ema and aer louw villages. morphometric analysis of leaf and stomata at different altitudes can be a prediction for i. fagifer plants to cope to climate change in the future. therefore, this research analyzed leaf and stomata morphometrics based on different altitudes. materials and methods sampling location this research was conducted in aer louw village with an altitude 200 m above sea level (asl) and ema village with an altitude of 600 m above sea level (asl) (figure 1). figure 1. a. map of ambon island; b. research locations in aer louw village; c. research locations in ema village. source: https://earth.google.com/web/search/ a b c https://earth.google.com/web/search/ jurnal riset biologi dan aplikasinya, 5(1): 16-26, march 2023 |18 sampling leaf samples for stomata observation and morphometric measurement were taken separately. the samples for observing stomata were taken from one of the largest and tallest i. fagifer trees at the two sampling locations. meanwhile, morphometric measurements were taken from 10 trees in the two locations by considering the upper, middle, and lower strata. sampling for stomata measurement was carried out on the left and right branches and focused only on green leaves. leaf samplings were repeated 5 times with a total was 30 dark green leaves. research procedure environmental factors such as temperature, light, and altitude were measured. the morphometric measurement of i. fagifer leaves was conducted in the following stages: (1) leaf samples were cleaned of dirt and dust using a tissue, (2) the samples were placed on millimeter block paper and marked using a pen, (3) the results of the markers were measured using a ruler as shown in figure 2. after obtaining the values for the length, width, tip, stalk, and leaf midrib length, the next step was to calculate the formula for the ratio of leaf length and width (shi et al., 2020). the i. fagifer leaf stomata morphometric measurement was conducted in the following stages: (1) the leaf samples taken were cleaned of dirt and dust; (2) the samples were sliced crosswise at the bottom using a razor blade; (3) the leaf slices were soaked in commercial bleach (bayclin) for ± 5 min until they turn white; (4) the leaf slices were washed using distilled water and soaked in 1% safranin for 1 min; (5) the slices were washed again using distilled water; (6) the slices were observed using an olympus cx23 microscope with 400x magnification; (7) the observation results were photographed using an digital camera connected to a computer; (8) the observed photos were inserted into the image master to measure length, width and opening size of stomata, count the number, and observe the location and type of stomata. figure 2. morphometric characteristics of i. fagifer leaf measurement. (a) leaf length; (b) leaf width; (c) leaf midrib length; (d) leaf tip length; (e) leaf stalk length ratio of leaf length and width = leaf length leaf width ratio of leaf length and leaf midrib length = leaf length leaf midrib length ratio of leaf length and leaf stalk length = leaf length leaf stalk length ratio of leaf length and leaf tip length = leaf length leaf tip length 19| smith et al., leaf and stomata morphometrics of gayam figure 3. morphometric characteristics of i. fagifer leaf stomata measurement. (a) stomata length; (b) stomata width; (c) stomata opening size data analysis data from i. fagifer leaf and stomata morphometric calculation were collected and analyzed descriptively to determine the average value and standard deviation. furthermore, the data were analyzed to determine correlation value of environmental factors and effective contribution using multiple linear regression inferential statistics (wang et al., 2019; sun et al., 2021). an analysis of correlation value and effective contribution is used based on the following formula: formula of product moment correlation 𝑟𝑥𝑦 = 𝑛 ∑ 𝑋𝑌−(∑ 𝑋) (∑ 𝑌) √{𝑛 ∑ 𝑋2− (∑ 𝑋)2} (chawla et al., 2016; kumari & yadav, 2018). then analyze the effective contribution (ec): 𝐸𝐶%𝑋𝑛 = 𝐵𝑋𝑛 𝑥 𝑟𝑥𝑦 𝑥 100% (turkheimer & waldron 2000). note: ec: effective contribution; bxn: b coefficient of the predictor; xn: predictors such as temperature, light, and altitude, rxy: correlation coefficient. the calculation for the stomata index and density was conducted based on the fetter et al. (2019) formula as follows: stomata density = number of stomata field of view unit index stomata = number of stomata number of stomata + epidermal cells the data was analyzed using excel and spss for windows 18. results and discussion inocarpus fagifer leaf and stomata morphology morphologically, the color of i. fagifer leaves in ema and aer louw villages was the same, dark green on the upper surface and light green on the lower surface. the upper surface of the leaves is smooth and greasy, while the lower surface was rough (figure 4). meanwhile, the stomata morphology between the two areas has the same shape but differed in size and number of stomata in one field of view (figure 4). stomata are a type of differentiation from leaf epidermal tissue (peterson et al., 2013; torii, 2021; zuch et al., 2022). i. fagifer stomata are found on the lower surface of the leaves. the stomata in these two areas have an actinostic type, with guard cells surrounded by neighboring cells in a radius. the number of neighboring cells is 4 or more, while the stomata’s guard cells are kidney-shaped with thin side walls and thicker top and bottom walls (prabhakar, 2004; ahmad et al., 2009; song et al., 2020). jurnal riset biologi dan aplikasinya, 5(1): 16-26, march 2023 |20 figure 4. i. fagifer leaf morphology. (top row) samples from ema village (altitude of 600 m asl). (bottom row) samples from aer louw village (altitude of 200 m asl). leaf and stomata morphometrics of inocarpus fagifer the morphometric measurement in the two areas with different altitudes varies greatly, as summarized in table 1. the same result was reported by paridari et al. (2013) wherein carpinus betulus l. growing at high altitudes had a small leaf lamina compared to those growing at low altitudes. according to liu et al. (2020), adapting plants in the highlands reduces leaf area. this shows that i. fagifer plants that grow at different altitudes have adapted to have an average leaf width and length at high altitudes (ema village) of 119.35 mm and 259.77 mm, while those growing at low altitudes (aer louw village) have an average leaf width and length of 135.43 mm and 312.52 mm. the long and wide leaves of the i. fagifer plants in aer louw village also have a midrib average length of 268.47 mm, while in ema village the midrib average length is 245.8 mm. this result agrees with that of madeline et al. (2014), where broad leaves have high vein density accompanied by stomata density. meanwhile, the broad leaves of i. fagifer in aer louw village had shorter tips and petioles on average 3.69 mm and 5.45 mm, while the average tips and petioles in ema village were 6.07 and 8.7. according to serdar & kurt (2011), leaf parameters can be used as a variable to detect the level of phenotypic variability among plant species in a population. the stomata morphometric measurement of i. fagifer leaves in the two areas with different altitudes varied greatly, as recapitulated in table 2. the high altitude in ema village (600 m asl) resulted a lower stomata density than aer louw in the lower area (200 m asl). fustier et al. (2019) reported that stomata density decreased with increasing altitude. according to li et al. (2021), plants with large stomata have low densities, but large size affects plant adaptation. furthermore, idris et al. (2019) stated that high intensity affects stomata density to support high assimilation processes in plants. 21| smith et al., leaf and stomata morphometrics of gayam table 1. morphometric characteristics of i. fagifer leaves at two places with different altitudes morphometric characteristics of i. fagifer leaves location upper strata (mm) middle strata (mm) lower strata (mm) leaf length ema 265.7±3.37 258.2±4.03 255.4±4.17 aer louw 302.26±2.12 293.22±1.03 342.08±18.4 leaf width ema 116±2.93 111.8±2.63 111.7±2.83 aer louw 140.14±2.12 135.88±1.03 130.26±0.82 leaf midrib length ema 251 ±3.22 244.7±3.83 241.7±3.92 aer louw 278.26±4.23 269.22±2.89 257.94±2.37 leaf tip length ema 9.7±0.17 4.1±0.12 4.4±0.14 aer louw 3.66±0.66 3.76±0.04 3.66±0.05 leaf stalk length ema 8.8±0.26 8.7±0.26 8.6±0.3 aer louw 5.40±0.1 5.56±0.07 5.40±0.1 ratio of leaf length and width ema 23.2±0.37 23.09±21.56 22.8±0.29 aer louw 21.64±0.19 21.56±0.14 25.56±1.16 ratio of leaf length and leaf midrib length ema 10±0 10±0 10±0 aer louw 10.99±0.12 10.89±0.05 13.09±0.64 ratio of leaf and leaf stalk length ema 303±7.93 294.5±6.83 314.4±6.28 aer louw 487.9±27.9 500.12±18 535.68±54.2 ratio of leaf length and leaf tip length ema 535.1±32.3 59.04±12.3 531.7±15.6 aer louw 856.5±24.3 785.01±9.19 966.59±68 table 2. stomata morphometric characteristics of i. fagifer leaves at two areas with different altitudes stomata morphometric characteristics loc. upper strata (μm) middle strata (μm) lower strata (μm) desc riptio n right branch left branch right branch left branch right branch left branch stomata length (mean±sd) ema 47.54± 0.40 47.50± 0.33 44.07± 0.26 44.21± 0.45 41.88± 0.39 42.39± 0.46 very long aer louw 16.68± 0.14 16.63± 0.12 14.89± 0.22 14.96± 0.21 12.75± 0.995 12.79± 0.75 less long stomata width (mean±sd) ema 46.86± 0.56 47.09± 0.39 44.4± 0.26 44.02± 0.37 42± 0.46 41.99± 0.63 very wide aer louw 16.93± 0.30 17.09± 0.29 14.96± 1.06 15.26± 0.54 14± 1.07 14.3± 1.64 less wide stomata opening size (mean±sd) ema 16.03± 0.27 16± 0.32 14.11± 0.34 14.06± 0.25 12± 0.24 12.02± 0.24 wide aer louw 6.058± 0.11 6.2± 0.13 5.01± 0.1 5.16± 0.24 4.8± 0.39 4.92± 0.46 less wide number of stomata (mean±sd) ema 13± 1.52 14.4± 2.30 10± 0.71 9.8± 0.84 7.2± 0.84 6.4± 1.14 few aer low 43± 7.01 40.2± 9.15 24.4± 4.62 27.4± 8.05 24± 3.27 21.4± 1.52 many stomata index (mean±sd) ema 0.18± 0.01 0.18± 0.01 0.15± 0.01 0.15± 0.01 0.1± 0.02 0.1± 0.01 low aer louw 0.58± 0.02 0.57± 0.03 0.43± 0.02 0.44± 0.01 0.37± 0.01 0.36± 0.01 high stomata density (mean±sd) ema 152.3± 17.24 163.6± 26.16 113.6± 8.04 111.4± 9.51 81.81± 9.51 72.72± 12.96 low aer louw 670.8± 108.9 624.2± 142.1 379.9± 70.23 425.5± 124.9 370.6± 48.9 333.3± 21.61 high description: loc: location jurnal riset biologi dan aplikasinya, 5(1): 16-26, march 2023 |22 the difference in altitude is an environmental factor affecting the plant microclimate. according to lamprecht et al. (2018), ecosystems at high altitudes have low temperatures. meanwhile, idris et al. (2019) reported that the stomata density increased when exposed to high sunlight. environmental characteristics at different altitudes also affect the stomata morphometric features. tiwari et al. (2013), also stated that altitude was positively correlated with stomata density, index, and guard cell length. according to akbarinia et al. (2011), variations in shape, size, index, area, and stomata can vary within one species. the stomata length characteristic of i. fagifer leaves is directly proportional to its width. muradoglu & gundogdu (2011) also stated a positive relationship between stomata length and width. according to li et al. (2011), the stomata index of quercus aquifolioides rehder & e.h. wilson decreased at high altitudes and increased at low altitudes. meanwhile, the morphological characteristics of stomata related to its density are inversely proportional to the length and width of it, as well as to the size of the stomatal opening, which is inversely proportional to stomata density (hong et al., 2018; haworth et al., 2023). some of these findings have supported this research that the length of the i. fagifer stomata leaves are also directly proportional to the width of the stomata and the size of the opening of the stomata is directly proportional to the number, index, and density of stomata. the variation of stomata in the two areas with different altitudes shows that altitude plays a role in morphometric characteristics. according to alonsoamelot (2008), highland plants have high adaptability to extreme environments. it was stated by ahmad et al. (2020) that the ability of plants to adapt in the highlands is by adjusting their morphological and physiological characteristics. halbritter et al. (2018) and montesinos‐navarro et al. (2011) also confirmed that the elevation gradient greatly affects abiotic factors, such as humidity, temperature, and light intensity in an area. variations in leaf and stomata morphometrics of i. fagifer as affected by environmental parameters environmental characteristics in the two areas with different altitudes are shown in table 3. the condition of the two areas showed that light intensity influences temperature, while altitude is related to light intensity as indicated in table 3. the condition of the two areas showed that light intensity influences temperature, while altitude is related to light intensity as indicated in table 3. altitude is an environmental factor that greatly determines the relationship between leaf and stomata morphometrics in i. fagifer plants. the relationship of environmental factors to the leaf morphometric characteristics of i. fagifer plants is shown in table 4. table 3. environmental characteristics environmental characteristics ema village air louw village light intensity 17,000 lux 20,000 lux temperature (ᵒc) 25ºc 28ºc altitude 600 m asl 200 m asl table 4. correlation of environmental factors with leaf morphometric characteristics leaf characteristics r r 2 sum of square mean square f f sig (p) reg. res. reg. res. leaf length 0.31 0.099 417.4371 3798.868 417.43713 65.5 6.3733 08 0.014(*) leaf width 0.46 0.2136 74.32614 273.564 74.32614 4.717 15.758 35 0.00(*) leaf midrib length 0.32 0.1025 77.11201 675.319 77.112007 11.64 6.6227 93 0.012(*) leaf tip length 0.32 0.1003 0.074907 0.671787 0.074907 0.012 6.4672 12 0.014(*) leaf stalk length 0.65 0.418 1.581127 2.201347 1.581127 0.038 41.658 75 0.00(*) ratio of leaf length and width 0.01 0.0001 0.001815 16.26631 0.001815 0.28 0.0064 72 0.936 23| smith et al., leaf and stomata morphometrics of gayam leaf characteristics r r 2 sum of square mean square f f sig (p) reg. res. reg. res. ratio of leaf length and leaf midrib length 0.3 0.09 0.411682 4.163537 0.411682 0.072 5.7349 17 0.019(*) ratio of leaf length and leaf stalk length 0.42 0.1727 7390.602 35402.1997 6 7390.6021 610.4 12.108 14 0.001(*) ratio of leaf length and leaf tip length 0.47 0.2163 16625.69 60222.5031 4 16625.692 1038 16.012 12 0.00(*) description: reg: regression; res: residual; (*): significant table 5. effective contribution of environmental factors to leaf morphometric characteristics leaf characteristics effective contribution of environmental factors total (%) temperature light altitude leaf length 0.00 0.00 9.901 9.901 leaf width 0.00 0.00 21.36 21.36 leaf midrib length 0.00 0.00 10.25 10.25 leaf tip length 0.00 0.00 10.03 10.03 leaf stalk length 0.00 0.00 41.8 41.8 ratio of leaf length and width 0.00 0.00 ratio of leaf length and leaf midrib length 0.00 0.00 8.998 8.998 ratio of leaf length and leaf stalk length 0.00 0.00 17.27 17.27 ratio of leaf length and leaf tip length 0.00 0.00 21.63 21.63 table 6. correlation of environmental factors with stomata morphometric characteristics stomata characteristics r r2 sum of square mean square f f sig (p) reg. res. reg. res. stomata length 0.992 0.983 2667.697 44.952 2667.697 4.495 593.452 0.00(*) stomata width 0.992 0.985 2493.795 39.027 2493.795 3.903 638.997 0.00(*) stomata opening size 0.964 0.93 229.338 17.248 229.338 1.725 132.961 0.00(*) number of stomata 0.843 0.711 1180.083 480.833 1180.083 48.08 24.542 0.00(*) stomata index 0.915 0.838 0.288 0.056 0.288 0.006 51.575 0.00(*) stomata density 0.879 0.772 370572.395 109402.096 370572.4 10940 33.873 0.00(*) description: reg: regression; res: residual; (*): significant table 7. effective contribution of environmental factors to stomata morphometric characteristics stomata characteristics effective contribution of environmental factors total (%) temperature light altitude stomata length 0.00 0.00 98.3 98.3 stomata width 0.00 0.00 98.5 98.5 stomata opening size 0.00 0.00 93 93 number of stomata 0.00 0.00 71.1 71.1 stomata index 0.00 0.00 83.8 83.8 stomata density 0.00 0.00 77.2 77.2 jurnal riset biologi dan aplikasinya, 5(1): 16-26, march 2023 |24 the relationship of environmental factors to the stomata morphometric characteristics of i. fagifer leaves is shown in table 6. environmental factors of light, temperature, and altitude have a significant relationship with all morphometric characteristics of i. fagifer leaves (p=<0.05). previous research confirmed that environmental factors greatly affect stomata opening size (casson & gray, 2008). qi & torii (2018), reported that environmental factors stimulate stomata density. harrison et al. (2020) also stated that environmental factors correlated with stomata size and density. the effective contribution of environmental factors was calculated to determine which stomatal morphometric characteristics were more dominant. the altitude effectively contributed to these stomatal morphometric characteristics, as indicated in table 7. aslantaş & karakurt (2009) stated that high areas have high rainfall while temperature, o2 and co2 levels decreased. this shows that the environmental factors of temperature, light, o2, co2, and humidity depend on altitude. the low and high altitudes are related to temperature, light, and humidity. these environmental factors affect stomata length, width, opening size, number, index, and density simultaneously. specifically, stomata opening is influenced by light (elhaddad et al., 2014) and high temperature (lawson & blatt, 2014). driesen et al. (2020) stated that stomata opening is influenced simultaneously by light, co2, temperature, and humidity. altitude greatly influences plant physiology, such as stomata density (qiang et al., 2003). richardson et al. (2017) confirmed that stomata are adaptive tissues that modify their stomatal density, size, and form in response to environmental changes. conclusion the results showed that different environmental conditions can provide variations in the morphology of the leaves and stomata of i. fagifer plants. altitude is related to other environmental factors, such as temperature and light intensity, which can directly influence variations of leaves and stomata. this research can predict i. fagifer plants’ survival and adaptation to environment changes. acknowledgement the authors are grateful to the leadership of the faculty of teacher training and education at pattimura university, which has provided funds for this research. the funding is stated in the certificate number 1087/un13/sk/2021. references ahmad, k., khan, m. a., ahmad, m., zafar, m., arshad, m., & ahmad, f. (2009). taxonomic diversity of stomata in dicot flora of a district tank (n.w.f.p) in pakistan. african journal of biotechnology, 8(6), 1052–1055. ahmad, k. s., wazarat, a., mehmood, a., ahmad, m. s. a., tahir, m. m., nawaz, f., ahmed, h., zafar, m., ulfat, a., ahmad, k. s., wazarat, a., mehmood, a., ahmad, m. s. a., tahir, m. m., nawaz, f., ahmed, h., zafar, m., & ulfat, a. (2020). adaptations in imperata cylindrica (l.) raeusch. and cenchrus ciliaris l. for altitude tolerance. biologia, 75(2), 183–198. https://doi.org/10.2478/s11756-019-00380-2 akbarinia, m., zarafshar, m., sattarian, a., fariba, b. s., ehsan, g., & iman, c. p. (2011). morphological variations in stomata epidermal cells and trichome of sweet chestnut (castanea sativa mill.) in caspian ecosystem. taxonomy and biosystematics, 3(7), 23– 32.https://dorl.net/dor/20.1001.1.20088906.1390. 3.7.4.0. alonso-amelot, m. e. (2008). high altitude plants chemistry of acclimation and adaptation. studies in natural products chemistry, 34, 883–982. https://doi.org/10.1016/s1572-5995(08)80036-1. aslantaş, r., & karakurt, h. (2009). the effects of altitude on stomata number and some vegetative growth parameters of some apple cultivars. research journal of agriculture and biological sciences, 5(5), 853–857. casson, s., & gray, j. e. (2008). influence of environmental factors on stomatal development. new phytologist, 178(1), 9–23. https://doi.org/10.1111/j.14698137.2007.02351.x chawla, s., sachdeva, m., & behal, s. (2016). discrimination of ddos attacks and flash events using pearson’s product moment correlation method. international journal of computer science and information security, 14(10), 382. driesen, e., van den ende, w., de proft, m., & saeys, w. (2020). influence of environmental factors light, co2, temperature, and relative humidity on stomatal opening and development: a review. agronomy, 10(12), 1975–1988. https://doi.org/10.3390/agronomy10121975. elhaddad, n. s., hunt, l., sloan, j., & gray, j. e. (2014). light-induced stomatal opening is affected by the guard cell protein kinase apk1b. plos one, 9(5), e97161.https://doi.org/10.1371/journal.pone.009 7161 fetter, k. c., eberhardt, s., barclay, r. s., wing, s., & keller, s. r. (2019). stomata counter: a neural network for automatic stomata identification and counting. new phytologist, 223(3), 1671–1681. https://doi.org/10.1111/nph.15892. fritz, m. a., rosa, s., & sicard, a. (2018). mechanisms underlying the environmentally induced plasticity of leaf morphology. frontiers in genetics, 9, 478. https://doi.org/10.3389/fgene.2018.00478. fustier, m. a., martínez-ainsworth, n. e aguirre-liguori, j. a., venon, a., corti, h., rousselet, a., dumas, f., dittberner, h., camarena, m. g., grimaneli, d., ovaskainen, o., falque, m., moreau, l., de meaux, j., montes-hernández, s., eguiarte, l. e., vigouroux, y., manicacci, d., & tenaillon, m. i. (2019). common gardens in teosintes reveal the https://doi.org/10.2478/s11756-019-00380-2 https://dorl.net/dor/20.1001.1.20088906.1390.3.7.4.0 https://dorl.net/dor/20.1001.1.20088906.1390.3.7.4.0 https://doi.org/10.1016/s1572-5995(08)80036-1 https://doi.org/10.1111/j.1469-8137.2007.02351.x https://doi.org/10.1111/j.1469-8137.2007.02351.x https://doi.org/10.3390/agronomy10121975 https://doi.org/10.1371/journal.pone.0097161 https://doi.org/10.1371/journal.pone.0097161 https://doi.org/10.1111/nph.15892 https://doi.org/10.3389/fgene.2018.00478 25| smith et al., leaf and stomata morphometrics of gayam establishment of a syndrome of adaptation to altitude. plos genetics, 15(12), e1008512. https://doi.org/10.1371/journal.pgen.1008512 gao, j., song, z., & liu, y. (2019). response mechanisms of leaf nutrients of endangered plant (acer catalpifolium) to environmental factors varied at different growth stages. global ecology and conservation, 17, e00521. https://doi.org/10.1016/j.gecco.2019.e00521 halbritter, a. h., fior, s., keller, i., billeter, r., edwards, p. j holderegger, r karrenberh, s., pluess, a. r., alexander, j. m., halbritter, a. h., fior, s., keller, i., billeter, r., edwards, p. j holderegger, r karrenberh, s., pluess, a. r., & m, a. j. (2018). trait differentiation and adaptation of plants along elevation gradients. journal of evolutionary biology, 31(6), 784–800. https://doi.org/10.17605/osf.io/yfj9m. hamidah, s., y, a. f., & fitriani a. (2018). micro climate assessment of medicinal plant habitat for the first step of domestication. academic research international, 9(3), 145–150. harrison, e. l., cubas, l. a., gray, j. e., & hepworth, c. (2020). the influence of stomatal morphology and distribution on photosynthetic gas exchange. the plant journal, 101(4), 768–779. https://doi.org/10.1111/tpj.14560 haworth, m., marino, g., materassi, a., raschi, a., scutt, c. p., & centritto, m. (2022). the functional significance of the stomatal size to density relationship: interaction with atmospheric [co2] and role in plant physiological behaviour. science of the total environment, 863, 160908. http://dx.doi.org/10.1016/j.scitotenv.2022.16090 8. he, j., & liang, y-k. (2018). stomata. plant science. https://doi.org/10.1002/9780470015902.a002652 6. hong, t., lin, h., & he, d. (2018). characteristics and correlations of leaf stomata in different aleurites montana provenances. plos one, 13(12), e0208899. https://doi.org/10.1371/journal.pone.0208899 hovenden, m. j., & schoor, j. k. v. (2006). the response of leaf morphology to irradiance depends on altitude of origin in nothofagus cunninghamii. new phytologist, 169(2), 291–297. https://doi.org/10.1111/j.14698137.2005.01585.x idris, a., linatoc, a. c., & bakar, m. f. b. a. (2019). effect of light intensity on the photosynthesis and stomatal density of selected plant species of gunung ledang johor. malaysian applied biology, 48(3), 133–140. kofidis, g., & bosabalidis, a. m. (2008). effects of altitude and season on glandular hairs and leaf structural traits of nepeta nuda l. botanical studies, 49(4), 363–372. kumari, k., & yadav, s. (2018). linear regression analysis study. journal of the practice of cardiovascular sciences, 4(1), 33. lamprecht, a., semenchuk, p. r., steinbauer, k., winkler, m., & pauli, h. (2018). climate change leads to accelerated transformation of high‐elevation vegetation in the central alps. new phytologist, 220(2), 447–459. https://doi.org/10.1111/nph.15290 lawson, t., & blatt, m. r. (2014). stomatal size, speed, and responsiveness impact on photosynthesis and water use efficiency. plant physiology, 164(4), 1556–1570. https://doi.org/10.1104/pp.114.237107 li, c., zhang, x., liu, x., luukkanen, o., & berninger, f. (2006). leaf morphological and physiological responses of quercus aquifolioides along an altitudinal gradient. silva fennica, 40(1), 5–9. https://doi.org/10.14214/sf.348. li, q., hou, j., he, n., xu, l., & zhang, z. (2021). changes in leaf stomatal traits of different aged temperate forest stands. journal of forestry research, 32(3), 927–936. https://doi.org/10.1007/s11676-02001135-5 li, x., li, y., zhang, z., & li, x. (2015). influences of environmental factors on leaf morphology of chinese jujubes. plos one, 10(5), e0127825. https://doi.org/10.1371/journal.pone.0127825 liu, w., zheng, l., & qi, d. (2020). variation in leaf traits at different altitudes reflects the adaptive strategy of plants to environmental changes. ecology and evolution, 10(15), 8166–8175. https://doi.org/10.1002/ece3.6519. madeline, r. c. m., jordan, g. j., & brodribb, t. j. (2014). acclimation to humidity modifies the link between leaf size and the density of veins and stomata. plant, cell & environment, 37(1), 124–131. https://doi.org/10.1111/pce.12136 montesinos‐navarro, a., wig, j., pico, f. x., & tonsor, s. j. (2011). arabidopsis thaliana populations show clinal variation in a climatic gradient associated with altitude. new phytologist, 189(1), 282–294. https://doi.org/10.1111/j.14698137.2010.03479.x. muradoglu, f., & gundogdu, m. (2011). stomata size and frequency in some walnut (juglans regia) cultivars. international journal of agriculture and biology, 13(6), 1011–1015. paembonan, s. a., larekeng, s. h., & millang, s. (2021). the dynamics of physiological properties of ebony (diospyros celebica bakh.) based on crown position and altitude. earth and environmental science, 807. https://doi.org/10.1088/17551315/807/3/032016 paridari, i. c., jalali, s. g., sonboli, a., zarafshar, m., & bruschi, p. (2013). leaf macro-and micromorphological altitudinal variability of carpinus betulus in the hyrcanian forest (iran). journal of forestry research, 24(2), 301–307. https://doi.org/10.1007/s11676-013-0353-x. pauku. r. l. (2006). inocarpus fagifer (tahitian chestnut). growth, 5(14), 1–9. pauku, r. l., lowe, a. j., & leakey, r. r. (2010). domestication of indigenous fruit and nut trees for agroforestry in the solomon islands. forests, trees and livelihoods, 19(3), 269–287. https://doi.org/10.1080/14728028.2010.9752671 peterson, k. m., shyu, c., burr, c. a., horst, r. j., kanaoka, m. m., omae, m., sato, y., & tori, k. u. (2013). arabidopsis homeodomain-leucine zipper iv proteins promote stomatal development and ectopically induce stomata beyond the epidermis. development, 140(9), 1924–1935. https://doi.org/10.1242/dev.090209. prabhakar, m. (2004). structure, delimitation, nomenclature and classification of stomata. acta botanica sinica, 46(2), 242–252. qi, x., & torii, k. u. (2018). hormonal and environmental signals guiding stomatal development. bmc biology, 16(1), 1–11. https://doi.org/10.1186/s12915-018-0488-5. qiang, w. y., wang, x. l., chen, t., feng, h. y., an, l. z., he, y. q., & wang, g. (2003). variations of stomatal density and carbon isotope values of picea https://doi.org/10.1371/journal.pgen.1008512 https://doi.org/10.1016/j.gecco.2019.e00521 https://doi.org/10.17605/osf.io/yfj9m https://doi.org/10.1111/tpj.14560 http://dx.doi.org/10.1016/j.scitotenv.2022.160908 http://dx.doi.org/10.1016/j.scitotenv.2022.160908 https://doi.org/10.1002/9780470015902.a0026526. https://doi.org/10.1002/9780470015902.a0026526. https://doi.org/10.1371/journal.pone.0208899 https://doi.org/10.1111/j.1469-8137.2005.01585.x https://doi.org/10.1111/j.1469-8137.2005.01585.x https://doi.org/10.1111/nph.15290 https://doi.org/10.1104/pp.114.237107 https://doi.org/10.14214/sf.348 https://doi.org/10.1007/s11676-020-01135-5 https://doi.org/10.1007/s11676-020-01135-5 https://doi.org/10.1371/journal.pone.0127825 https://doi.org/10.1002/ece3.6519 https://doi.org/10.1111/pce.12136 https://doi.org/10.1111/j.1469-8137.2010.03479.x https://doi.org/10.1111/j.1469-8137.2010.03479.x https://doi.org/10.1088/1755-1315/807/3/032016 https://doi.org/10.1088/1755-1315/807/3/032016 https://doi.org/10.1007/s11676-013-0353-x https://doi.org/10.1080/14728028.2010.9752671 https://doi.org/10.1242/dev.090209 https://doi.org/10.1186/s12915-018-0488-5 jurnal riset biologi dan aplikasinya, 5(1): 16-26, march 2023 |26 crassifolia at different altitudes in the qilian mountains. trees, 17(3), 258–262. https://doi.org/10.1007/s00468-002-0235-x. richardson, f., brodribb, t. j., & jordan, g. j. (2017). amphistomatic leaf surfaces independently regulate gas exchange in response to variations in evaporative demand. tree physiology, 37, 869–878. https://doi.org/10.1093/treephys/tpx073 ruszala, e. m., beerling, d. j., franks, p. j., chater, c., casson, s. a., gray, j. e., & hetherington, a. m. (2011). land plants acquired active stomatal control early in their evolutionary history. current biology, 21, 1030–1035. https://doi.org/10.1016/j.cub.2011.04.044 serdar, u., & kurt, n. (2011). some leaf characteristics are better morphometric discriminators for chestnut genotypes. journal of agricultural science and technology, 13, 885–894. setyowati, n., & wawo, a. h. (2015). mengungkap keberadaan dan potensi gayam (inocarpus fagifer) sebagai sumber pangan alternatif di sukabumi, jawa barat [to reveal the existence and potential of gayam (inocarpus fagifer) as an alternative food source in sukabumi, west java]. proceedings of the national seminar on the indonesian biodiversity society., 1(1), 71–77. https://doi.org/10.13057/psnmbi/m010111 shi, p., yu, k., niinemets, ü., & gielis, j. (2020). can leaf shape be represented by the ratio of leaf width to length? evidence from nine species of magnolia and michelia (magnoliaceae). forests, 12(1), 41–50. https://doi.org/10.3390/f12010041 song, j. h., yang, s., & choi, g. (2020). taxonomic implications of leaf micromorphology using microscopic analysis: a tool for identification and authentication of korean piperales. plants, 9(5), 1– 15. https://doi.org/10.3390/plants9050566 sun, j., liu, c., hou, j., & he, n. (2021). spatial variation of stomatal morphological traits in grassland plants of the loess plateau. ecological indicators, 128, 107857. https://doi.org/10.1016/j.ecolind.2021.107857 tiwari, s. p., kumar, p., yadav, d., & chauhan, d. k. (2013). comparative morphological, epidermal, and anatomical studies of pinus roxburghii needles at different altitudes in the north-west indian himalayas. turkish journal of botany, 37(1), 65–73. https://doi.org/10.3906/bot-1110-1 torii, k. u. (2021). stomatal development in the context of epidermal tissues. annals of botany, 128(2), 137–148. https://doi.org/10.1093/aob/mcab052 tumpa, k., šatović, z., vidaković, a., idžojtić, m., stipetić, r., & poljak, i. (2022). population variability of almond-leaved willow (salix triandra l.) based on the leaf morphometry: isolation by distance and environment explain phenotypic diversity. forests, 13(3), 420–429. https://doi.org/10.3390/f13030420 turkheimer, e., & waldron, m. (2000). nonshared environment: a theoretical, methodological, and quantitative review. psychological bulletin, 126(1), 78. https://doi.org/10.1037/0033-2909.126.1.78 wawo, a. h., studi persebaran dan pemanfaatan gayam [inocarpus fagifer (parkinson ex zollinger) fosberg] di daerah istimewa yogyakarta [study of the distribution and utilization of gayam [inocarpus fagifer (parkinson ex zollinger) fosberg] in the special region of yogyakarta. biosfera, 28(3), 140– 151. https://doi.org/10.20884/1.mib.2011.28.3.271 ye, m., zhu, x., gao, p., jiang, l., & wu, r. (2020). identification of quantitative trait loci for altitude adaptation of tree leaf shape with populus szechuanica in the qinghai-tibetan plateau. frontiers in plant science, 11(632), 1–13. https://doi.org/10.3389/fpls.2020.00632 wang, c., lu, h., zhang, j., mao, l., & ge, y. (2019). bulliform phytolith size of rice and its correlation with hydrothermal environment: a preliminary morphological study on species in southern china. frontiers in plant science, 10, 1037. https://doi.org/10.3389/fpls.2019.01037 zuch, d. t., doyle, s. m., majda, m., smith, r. s., robert, s., & torii, k. u. (2022). cell biology of the leaf epidermis: fate specification. morphogenesis and coordination. the plant cell, 34(1), 209–227. https://doi.org/10.1093/plcell/koab250. https://doi.org/10.1007/s00468-002-0235-x https://doi.org/10.1093/treephys/tpx073 https://doi.org/10.1093/treephys/tpx073 https://doi.org/10.1016/j.cub.2011.04.044 https://doi.org/10.13057/psnmbi/m010111 https://doi.org/10.3390/f12010041 https://doi.org/10.3390/plants9050566 https://doi.org/10.1016/j.ecolind.2021.107857 https://doi.org/10.3906/bot-1110-1 https://doi.org/10.1093/aob/mcab052 https://doi.org/10.3390/f13030420 https://doi.org/10.1037/0033-2909.126.1.78 https://doi.org/10.20884/1.mib.2011.28.3.271 https://doi.org/10.3389/fpls.2020.00632 https://doi.org/10.3389/fpls.2019.01037 https://doi.org/10.1093/plcell/koab250 jurnal riset biologi dan aplikasinya, volume 2, nomor 1, maret 2020 prevalensi kejadian aglutinasi spermatozoa rattus norvegicus strain wistar albino yang diberi paparan antibiotik kanamycin spermatozoid agglutination prevalence in rattus norvegicus by kanamycin administration muhammad saka abeiasa* jurusan keperawatan, sekolah tinggi kesehatan piala sakti pariaman abstrak kelompok antibiotik dari golongan aminoglikosida seperti kanamycin dan gentamycin menyebabkan kesalahan penerjemahan dan efek inhibisi pada proses translokasi t-rna dan m-rna bakteri. telah dilaporkan bahwa toksisitas kanamycin dapat meningkat seiring dengan peningkatan dosis yang diterima. hal ini dapat berakibat penurunan jumlah dan kecacatan spermatozoa. penelitian ini bertujuan untuk menguji pengaruh antibiotik kanamycin terhadap prevalensi kejadian aglutinasi spermatozoa. jumlah aglutinasi spermatozoa dihitung menggunakan agglutination grade who. penelitian ini merupakan penelitian eksperimental dengan model post-test-only control group design dengan variabel independen yaitu kanamycin dosis bertingkat dan variabel dependen yaitu jumlah aglutinasi spermatozoa. data dianalisis menggunakan anava dan dilanjutkan dengan uji lanjut bonferroni. hasil penelitian menunjukkan bahwa pemberian kanamycin dosis bertingkat berpengaruh terhadap prevalensi kejadian aglutinasi spermatozoa. peningkatan jumlah aglutinasi seiring dengan peningkatan dosis yang diterima. abstract aminoglycocide-group-antibiotics such kanamycin and gentamycin caused mistranslation and inhibition effect for t-rna and m-rna translocation of bacteria. kanamycin toxicity can increase along with increasing in dose received. this can cause the disability and decreasing amount of spermatozoa. this study aimed to examine the effect of kanamycin for spermatozoid agglutination prevalence. the amount of spermatozoid agglutination was counted by using agglutination grade who. this study was an experimental research with post-test-only control group design. the data was analyzed using anava and followed by post-hoc bonferroni test. the result showed that kanamycin multilevel dosing taken effect for spermatozoid agglutination prevalence. increasing the amount of agglutination along with the increase in the dose received. how to cite: abeiasa, m. s. (2020). prevalensi kejadian aglutinasi spermatozoa rattus norvegicus strain wistar albino yang diberi paparan antibiotik kanamycin. jurnal riset biologi dan aplikasinya, 2(1), 1-5. *corresponding author: e-issn 2655-9927 jln. diponegoro no 05 kp. pondok pariaman 25512 sumatera barat, indonesia sumatera barat, indonesia e-mail: 13abeiasa@gmail.com jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi article history received : 16 desember 2019 approved : 8 maret 2020 published : 31 maret 2020 kata kunci: aglutinasi, spermatozoa, antibiotik, kanamiycn keywords: agglutination, spermatozoa, antibiotik, kanamycin 2 | abeiasa; prevalensi kejadian aglutinasi spermatozoa rattus norvegicus strain wistar albino pendahuluan pembuktian tentang efek samping penggunaan antibiotik terhadap spermatogenesis telah banyak dilakukan pada hewan coba. pada manusia masalah infertilitas merupakan kasus dengan banyak faktor etiologi sehingga dalam penetapan diagnosis perlu analisis yang tepat. penggunaan jangka panjang antibiotik pada manusia diketahui memberi efek samping yang merugikan, hal ini dikarenakan oleh terjadinya peningkatan radikal bebas akibat metabolisme antibiotik tersebut. antibiotik dari golongan aminoglikosida, macrolida, tetraxyclin, dan obat golongan sulfat diketahui memiliki efek samping terhadap kejadian infertilitas pria. kelompok antibiotik dari golongan aminoglikosida, misalnya kanamycin dan gentamycin, menyebabkan kesalahan penerjemahan dan efek inhibisi pada proses translokasi t-rna dan m-rna pada bakteri. kanamycin juga mengintervensi perkembangan ribosom sehingga mengakibatkan ribosom mensintesis polipeptida yang tidak lengkap, hal ini diketahui dapat bekerja baik terhadap bakteri, namun memberikan efek samping berupa peningkatan translokasi pada membran sel yang dapat berakibat pada stres seluler (liu & imlay, 2013). inti niamin pada antibiotik golongan aminoglikosida memediasi sequence spesific binding pada situs-a ribosom (salian et al., 2012). kanamycin dipergunakan secara injeksi intramuskular pada area gluteal dengan dosis yang disesuaikan berdasarkan berat badan resipien. pada kasus infeksi gonorrhea, kanamycin umum dipergunakan sebagai alternatif yang dipilih ketika terjadi resistensi terhadap antibiotik lain (who, 2016). toksisitas kanamycin dapat meningkat seiring dengan peningkatan dosis yang digunakan (zhao et al., 2014) dan diketahui dapat meningkatkan reactive oxygen species (ros) (ye et al., 2018). beberapa laporan tentang peningkatan kadar ros yang berujung pada kematian sel akibat pengunaan antibiotik golongan aminoglikosida (kanamycin dan gentamycin) masih diperdebatkan (ye et al., 2018). beberapa agen antimikrobial tertentu menekan proses infeksi tanpa menginduksi ros, namun beberapa antimicrobial yang lain, misalnya ofloxacin, bekerja di bawah pengaruh kadar oksigen tubuh terutama keadaan anoksia dan secara luas menekan bakteri melalui jalur ros bebas (keren et al., 2013). aktivitas antibiotik dapat mengakibatkan dampak primer pada sel. kerusakan pada sel ini dapat ditanggulangi oleh antioksidan dan ion besi. aktivitas antibiotik lebih lanjut mengakibatkan akumulasi radikal bebas yang menyebabkan dampak sekunder yang berakhir pada kematian sel (zhao et al., 2014). radikal bebas berperan aktif dalam memicu terjadinya penurunan populasi sel didalam tubuh. kematian sel melalui jalur apoptosis dan nekrosis merupakan dampak terburuk. hal ini juga dikaitkan sebagai faktor utama dalam kejadian oligozoospermia dan aglutinasi spermatozoa (agarwal et al., 2008). peningkatan ros sebagai radikal bebas di dalam tubulus seminiferus mengakibatkan sel-sel germinal mengalami stres oksidatif yang dapat mengakibatkan kerusakan dna. perubahan pada gen yang dibawa spermatozoa dapat berakibat pada kesalahan pengkodean yang berujung pada penurunan populasi dan kecacatan spermatozoa. pada proses spermiogenesis dapat menimbulkan dampak tersendiri berupa perlekatan spermatozoa yang dikenal dengan aglutinasi sel sperma (adewoyin et al., 2017). peningkatan ros pada sel spermatogenik juga diketahui dapat memicu agregasi leukosit yang selanjutnya mengintervensi fungsi spermatozoa dengan mengaktivasi jalur peroksidasi lipid membrane. akibatnya kapasitasi akrosomal akan terjadi di dalam tubulus seminiferus. namun, secara garis besar hubungan langsung reactive oxigen species (ros) terhadap kejadian aglutinasi spermatozoa masih sangat sedikit dan perlu dilakukan uji lanjut (american urological association, 2010). penelitian ini bertujuan untuk menguji pengaruh antibiotik kanamycin terhadap prevalensi kejadian aglutinasi spermatozoa. bahan dan metode penelitian ini merupakan penelitian eksperimen dengan desain penelitian post-test only control group design. populasi penelitian adalah tikus jantan wistar yang berumur 2-3 bulan, dengan berat badan kira-kira 300–350 g dengan jumlah sampel sebanyak 24 ekor. perlakuan hewan coba dan pemeriksaan aglutinasi spematozoa dilakukan di laboratorium anatomi fisiologi stikes piala sakti pariaman. variabel independen adalah kanamycin dosis bertingkat dan variabel dependen adalah aglutinasi spermatozoa. sampel dibagi ke dalam empat kelompok yang berisi enam ekor tikus: 1 kelompok kontrol dan 3 kelompok eksperimen yang masing-masing diberi perlakuan kanamycin sulfat dengan dosis 10, 15, dan 20 mg/bb/hari (susetijawati, 1996). ruang uji dikontrol dengan siklus terang gelap. pada akhir jurnal riset biologi dan aplikasinya, 2(1), 1-5, maret 2020 | 3 masa penelitian tikus dikorbankan untuk diambil cauda epididimisnya, epididimis yang telah diambil diletakkan ke dalam botol vial 10 ml berisi garam fisiologis (nacl 0,9%) sebanyak 5 ml. cauda epididimis didiamkan selama 15 menit agar spermatozoa keluar selanjutnya cairan yang telah berisi spermatozoa diambil 0,5 ml dan ditambah dengan larutan gorge sebanyak o,5 ml dan diaduk agar homogen. sebanyak 10 µl cairan diambil menggunakan pipet tetes dan diletakkan pada hemositometer improved neubauer kemudian dihitung jumlah aglutinasi per lapang pandang dengan menggunakan derajat aglutinasi yang ditetapkan oleh who (2016). data yang diperoleh dianalisis menggunakan uji statistik parametrik one way anova dan dilanjutkan dengan uji multiple comparisons (post hoc test) bonferroni. hasil dan pembahasan pengamatan terhadap kondisi spermatozoa yang diisolasi dari semua sampel menunjukkan kejadian aglutinasi spermatozoa pada kelompok perlakuan (gambar 1). aglutinasi merupakan kelainan umum yang terjadi karena proses reaksi inflamasi yang terjadi di tubulus seminiferus (agarwal et al., 2008). perlekatan spermatozoa dapat diakibatkan kesalahan informasi yang terjadi pada proses spermatogenesis maupun spermiogenesis (berger et al., 2019). perubahan morfologis pada spermatozoa tidak hanya karena kerusakan struktural membran, namun juga diikuti oleh kerusakan dna dan subunit ribosom yang mengakibatkan kesalahan translasi (hallaj salahipour et al., 2019). peningkatan kerusakan dna memiliki korelasi yang kuat terhadap kerusakan struktur dan jumlah kejadian apoptosis pada spermatozoa (khodair & omran, 2013). berdasarkan hasil analisis data jumlah kejadian aglutinasi spermatozoa diketahui bahwa terdapat perbedaan yang signifikan antara semua kelompok eksperimen dan antara kelompok eksperimen dengan kontrol (pvalue 0,00) (tabel 1). kanamycin diketahui memiliki efek merusak pada sebagian besar spermatozoa mamalia (hasan et al., 2001). kerusakan yang terjadi pada spermatozoa dimungkinkan adanya mutasi pada dna sel dan mitokondria yang terjadi akibat adanya induksi radikal bebas dan kerusakan pada membran sel (gao et al., 2017). ros merupakan hasil sampingan dari proses kerja aminoglikosida di dalam tubuh. ros potensial mengurangi kemampuan sel mengatur homeostasis yang berujung pada ketidakseimbangan secara fisiologis (acharya et al., 2012). antibiotik kelompok aminoglikosida juga menginduksi peningkatan radikal bebas pada kelompok yang diberikan antibiotik (sha & schacht, 1999). di dalam tubuh radikal bebas dapat menyebabkan perubahan struktural membran sel sehingga permeabilitas membran meningkat. hal ini dapat mengakibatkan sel lisis sehingga berujung pada kerusakan sel dalam skala yang besar (ye et al., 2018). gambar 1. perbandingan aglutinasi spermatozoa hewan coba (a) kondisi spermatozoa kelompok kontrol; (b) aglutinasi spermatozoa yang terjadi pada kelompok perlakuan a a b b 4 | abeiasa; prevalensi kejadian aglutinasi spermatozoa rattus norvegicus strain wistar albino tabel 1. rata-rata jumlah aglutinasi spermatozoa hewan coba yang diberi kanamycin dosis bertingkat (n=24) kelompok rata-rata ± sd p kontrol 6,50 ± 0,547a 0,000 p1 17,00 ± 3,687b p2 29,33 ± 4,273c p3 38,17 ± 1,834d gambar 2. jumlah aglutinasi spermatozoa antarkelompok hewan coba yang diberi kanamycin dosis bertingkat (n=24) kontrol: tanpa injeksi kanamycin; p1: 10; p2: 15; p3: 20 (mg/bb/hari) berdasarkan hasil analisis data jumlah kejadian aglutinasi spermatozoa diketahui bahwa terdapat perbedaan yang signifikan antara semua kelompok eksperimen dan antara kelompok eksperimen dengan kontrol (pvalue 0,00) (tabel 1). kanamycin diketahui memiliki efek merusak pada sebagian besar spermatozoa mamalia (hasan et al., 2001). kerusakan yang terjadi pada spermatozoa dimungkinkan adanya mutasi pada dna sel dan mitokondria yang terjadi akibat adanya induksi radikal bebas dan kerusakan pada membran sel (gao et al., 2017). penelitian ini juga membuktikan bahwa pemberian antibiotik kanamycin dengan dosis meningkat mengakibatkan aglutinasi spermatozoa yang lebih parah (gambar 2). hasil uji beda nyata menunjukkan bahwa semua kelompok, baik kelompok kontrol maupun kelompok eksperimen memiliki tingkat aglutinasi spermatozoa yang berbeda secara signifikan (tabel 1). seperti telah disampaikan di atas bahwa kanamycin memiliki efek yang merusak (hasan et al., 2001), karena di dalam tubuh metabolisme antibiotik menghasilkan ros yang menyebabkan peningkatan permeabilitas membran (sha & schacht, 1999; acharya et al., 2012) dan pada akhirnya memicu kematian sel (gao et al, 2017). toksisitas kanamycin dan peningkatan ros dapat meningkat seiring dengan peningkatan dosis yang diterima (ye et al., 2018). hal ini menjelaskan bagaimana dosis kanamycin yang lebih tinggi pada penelitian ini menyebabkan aglutinasi yang lebih parah. simpulan berdasarkan hasil penelitian ini dapat disimpulkan bahwa kanamycin secara nyata menyebabkan aglutinasi spermatozoa. dosis kanamycin secara nyata menyebabkan aglutinasi yang lebih parah. daftar pustaka acharya, c., thakar, h., vajpeyee, s. k. (2012). a study of oxidative stress in gentamicin induced nephrotoxicity and effect of antioxidant vitamin c in wistar rats. national journal of physiology, pharmacy & pharmacology, 3(1), 14-20. doi: 10.5455/njppp.2013.3.14-20. adewoyin, m., ibrahim, m., roszaman, r., isa, m. l. m., alewi, n. a. m, rafa, a. a. a., & anuar, jurnal riset biologi dan aplikasinya, 2(1), 1-5 , maret 2020 | 5 m. n. n. (2017). male infertility: the effect of natural antioxidants and phytocompounds on seminal oxidative stress. diseases, 5(9), 1-26. doi: 10.3390/diseases5010009. agarwal, a., bragais, f. m., & sabanegh, e. (2008). assessing sperm function. urologic clinics of north america, 35(2), 157-171. https://doi.org/10.1016/j.ucl.2008.01.012. american urological association. (2010). the optimal evaluation of the infertile male: aua best practice statement. usa: aua publisher. diakses dari https://www.researchgate.net/publication/24 2579257_the_optimal_evaluation_of_the_inf ertile_male_aua_best_practice_statement. berger, g. k., smith-harrison, l. i., & sandlow, j. i. (2019). sperm agglutination: prevalence and contributory factors. andrologia, 51(5). doi:10.1111/and.13254 gao, z., chen, y., & guan, m. (2017). mitochondrial dna mutations associated with aminoglycoside induced ototoxicity. journal of otology, 12(1), 1-8. doi: 10.1016/j.joto.2017.02.001. hallaj salahipour, m., hasanzadeh, s., malekinejad, h., razi, m., & farrokhi-ardebili, f. (2019). deoxynivalenol reduces quality parameters and increases dna damage in mice spermatozoa. andrologia, 51(5). doi:10.1111/and.13238. hasan, s., andrabi, s. m. h., muneer, r., anzar, m., & ahmad, n. (2001). effects of a new antibiotic combination on post-thaw motion characteristics and membrane integrity of buffalo and sahiwal bull spermatozoa and on the bacteriological quality of their semen. pakistan vet journal, 21(1), 6-11. diakses dari http://agris.fao.org/agrissearch/search.do?recordid=pk2002000156. keren, i., wu, y., inocencio, j., mulcahy, l. r., & lewis, k. (2013). killing by bactericidal antibiotics does not depend on reactive oxygen species. science, 339(6124):1213-1216. doi: 10.1126/science.1232688. khodair, h. a., & omran, t. (2013). evaluation of reactive oxygen species (ros) and dna integrity assessment in cases of idiopathic male infertility. egyptian journal of dermatology and venereology, 33(2), 51-55. doi: 10.1126/science.1232688. liu, y., & imlay, ja. (2013). cell death from antibiotics without the involvement of reactive oxygen species. science, 339 (6124), 1210-1213. doi: 10.1126/science.1232751. salian, s., matt, t., akbergenov, r., harish, s., meyer, m., duscha, s., shcherbakov, d., bernet, b. b., vasella, a., westhof, e., & bottger, e. c. (2012). structure-activity relationships among the kanamycin aminoglycosides: role of ring i hydroxyl and amino groups. antimicrobial agents and chemotherapy, 56 (12), 6104-6108. doi: 10.1128/aac.01326-12. sha, s., & schacht, j. (1999). stimulation of free radical formation by aminoglycoside antibiotics. hearing research, 128(1-2), 112118. https://doi.org/10.1016/s03785955(98)00200-7. susetijawati, e. (1996). pengaruh pemberian kanamycin sulfat terhadap perubahan histopatologi ginjal tikus putih (rattus norvegicus). (skripsi, fakultas kedokteran hewan, universitas airlangga surabaya). diakses dari : http://repository.unair.ac.id/id/eprint/57254. world health organization. (2016). who guidelines for the treatment of neisseria gonorrhoeae. switzerland: who publication ye, j., su, y., lin, x., lai, s., li, w., ali, f., zheng, j., & peng, b. (2018). alanine enhances aminoglycosides-induced ros production as revealed by proteomic analysis. frontiers in microbiology, 9 (29): 1-14, doi: 10.3389/fmicb.2018.00029. zhao, h., li, j., han, b., li, x., & chen, j. (2014). improvement of oxidative stress tolerance in saccharomyces cerevisiae through global transcription machinery engineering. journal of industrial microbiology & biotechnology, 41(5), 869–878. doi:10.1007/s10295-014-1421-8. https://doi.org/10.1016/s0378-5955(98)00200-7 https://doi.org/10.1016/s0378-5955(98)00200-7 1 | isnawati; aktivitas selulolitik fungi indigenos pada fermetoge jurnal riset biologi dan aplikasinya, volume 1, nomer 1, maret 2019 aktivitas selulolitik fungi indigenos pada fermetoge: pakan fermentasi hewan ruminansia terbuat dari eceng gondok (eichhornia crassipes) dan tongkol jagung (zea mays) cellulolytic activity of indigenous fungi of fermetoge: fermented feed of ruminants made of water hyacinth (eichhornia crassipes) and corn (zea mays) cob isnawati* jurusan biologi, fakultas matematika dan ilmu pengetahuan alam, universitas negeri surabaya abstrak eceng gondok dan tongkol jagung tergolong bahan berselulosa. campuran kedua bahan itu terdapat mikrobindigenos. tujuan penelitian ini untuk mendeskripsikan aktivitas selulolitik fungi indigenos yang terdapat pada fermetoge, pakan fermentasi dari campuran eceng gondok dan tongkol jagung dan memaparkan antagonism/sinergisme kerja fungi yang terpilih sebagai konsorsium starter. mikroorganisme diisolasi dari pakan setiap hari selama 15 hari selama fermentasi berlangsung. isolate yang diperoleh dimurnikan, dikarakterisasi, dan diidentifikasi. terdapat 10 fungi indigenos dalam pakan. berdasarkan observasi karakteristik mikroskopik dan makroskopis fungifungi tersebut meliputi: aspergillus sp1, rhizopus sp1, aspergillus terreus, mucor sp1, aspergillus sp2, aspergillus niger, trichoderma sp1, aspergillus flavus, aspergillus sp3, dan penicillium sp1. uji aktivitas sellulolitik pada medium spesifik carboxymethyl cellulose (cmc) memaparkan bahwa mucor sp1, rhizopus sp1 dan trichoderma sp1 adalah tiga fungi memiliki aktivitas selulolitik tinggi, karena terbentuk zona halo dengan jari-jari (mm) secara berturut-turut, 4008; 23,75; dan 15,15. abstract water hyacinth and corncob are classified as cellulosic materials. there are indigenos microbes in mixture two these materials. this research was aimed to describe cellulolytic activity of indigenous fungi in fermetoge, fermented feed made of water hyacinth and corn cob, and display antagonism/synergism work selected fungi for starter consortium. the microorganisms were isolated from the feed every day for 15 days during fermentation. the isolates obtained was purified, characterized, and identified. there were ten kinds of indigenous fungi isolates in the feed. based on macroscopic and microscopic characteristics observation these fungi consisted of aspergillus sp1, rhizopus sp1, aspergillus terreus, mucor sp1, aspergillus sp2, aspergillus niger, trichoderma sp1, aspergillus flavus, aspergillus sp3, and penicillium sp1. cellulolytic activity test on specific media carboxymethyl cellulose (cmc) revealed that mucor sp1, rhizopus sp1 and trichoderma sp1 had fungi with high cellulolytic activities because of their radius halo zone were 40,08; 23,75; and 15,15, respectively. how to cite: isnawati. (2019). aktivitas selulolitik fungi indigenos pada fermetoge: pakan fermentasi hewan ruminansia terbuat dari eceng gondok (eichhornia crassipes) dan tongkol jagung (zea mays). jurnal riset biologi dan aplikasinya. 1 (1): 26-31. *correspondence author: jalan ketintang gedung c3 lt. 2 surabaya 60231, indonesia e-issn: 2655-9927 e-mail: isnawati@unesa.ac.id jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi history article received: 3 desember 2018 approved: 11 januari 2019 published: maret 2019 kata kunci: eceng gondok, tongkol jagung, selulolitik, fungi, indigenos key words: water hyacinth, corn (zea mays) cob, cellulolytic, fungi, indigenos 27 | isnawati; aktivitas selulolitik fungi indigenos pada fermetoge pendahuluan fermetoge adalah pakan fermentasi untuk hewan ruminansia yang baru dikembangkan oleh peneliti. fermetoge terbuat dari campuran eceng gondok dan tongkol jagung yang difermentasi. eceng gondok tumbuh sangat cepat di air yang terpolusi bahan organik (ndimele and jimoh, 2011). sampai saat ini, eceng gondok dianggap sebagai gulma air yang tidak menguntungkan. pertumbuhannya yang cepat di dalam badan air dapat mengubah keragaman organisme air dan membahayakan kehidupan organismelainnya (gichuki dkk., 2012). berbagai macam usaha telah dilakukan untuk menghambat pertumbuhan eceng gondok ini. usaha-usaha tersebut meliputi pengurangan nutrien dalam badan air (gichuki dkk., 2012), pengambilan tanaman secara manual, pemberian 2,4-d atau glyphosate (labrada dkk.,1994) dan paraquate (jian-jun dkk., 2006). usaha lain untuk mengurangi eceng gondok pada wilayah perairan adalah dengan memfungsikan tanaman tersebut sebagai pakan ternak, karena kandungan proteinnya yang tinggi sekitar 11,87% sampai 14,28% (mako dkk., 2011), kalsium dan fosfornya tinggi dan dapat merangsang produksi susu jika dikombinasikan dengan pakan dengan konsentrasi yang tepat (kumar dkk., 2011). analisis yang lain menyatakan bahwa eceng gondok mengandung bahan kering (8,7 sampai 9,3 g/100g), protein kasar (10,1 sampai 11,2 g/100g), serat kasar (26,1 sampai 27,4 g/100g), ekstrak bebas nitrogen (47,2 sampai 50,2 g/100g), ekstrak eter (1,1 sampai 1,8 g/100g), dan total abu 12,3 sampai 12,4 g/100g, dengan energy metabolisme tersedia 1999,7 sampai 2054,1 kcal/kg (hossain dkk., 2015). beberapa peneliti telah menggunakan eceng gondok sebagai pakan ternak seperti itik (lu dkk., 2008, dan pakan ikan mas (mohapatradkk., 2015). selain itu, terdapat bahan limbah lain yang jarang digunakan, tetapi berpotensi sebagai pakan ternak yaitu tongkol jagung. kadar lignoselulosa pada tongkol jagung adalah 45% sampai 55% selulosa, 25% sampai 35% hemicelluloses dan 20% sampai 30% lignin, yang sulit didedagrasi oleh sistem pencernaan babi (kanengoni dkk., 2015). tongkol jagung juga mengandung 5,6% protein, yang lebih tinggi daripada jerami (4,9%).tongkol jagung telah digunakan untuk makanan babi, ayam dan kambing (sarian, 2016), pakan kerbau (wanapat dkk., 2012; wachirapakorn dkk., 2016) dan pakan ikan (rostika &safitri, 2012), juga pakan berbagai jenis hewan memamahbiak (lardy & anderson, 2009). kelemahan eceng gondok dan tongkol jagung sebagai pakan ternak adalah kedua bahan ini sulit dicerna dan tingkat kesukaan ternak rendah terhadap kedua bahan ini. hal ini disebabkan kandungan selulosanya yang tinggi dan baunya yang kurang enak. kelemahan ini dapat diatasi dengan memfermentasi kedua bahan ini terlebih dahulu sebelum dijadikan pakan ternak. pakan fermentasi mempunyai beberapa keunggulan seperti tingkat ketercernaannya meningkat, keterserapan nutriennya oleh ternak tinggi, menyeimbangkan mikroflora rumen dan menurunkan populasi mikroflora pathogen (missotten, etal. 2015). keunggulan lain pakan fermentasi adalah dapat menekan pertumbuhan mikrob patogen dalam saluran pencernaan, membantu lambung mencapai ph rendah sehingga organisme pathogen yang terbawa makanan terbunuh (missotten dkk., 2015). penggunaan pakan fermentasi telah meningkatkan berat badan pada ayam, meningkatkan agresivitas, meningkatkan kekuatan cangkang telur, tanpa mempengaruhi produksi telur (engberg dkk., 2009). proses fermentasi bahan berselulosa meliputi beberapa tahap seperti mesofilik, termofilik, pendinginan dan pemasakan (ishii dkk., 2000; yu dkk., 2007). sedangkan studi yang dilakukan oleh bhatia dkk. (2015) dalam proses pengomposan sebelum fase mesofilik, terdapat fase laten, yang pada fase itu mikroorganisme beradaptasi dengan lingkungannya, yang ditandai dengan adanya suhu yang konstan. pada proses fermentasi maupun pengomposan selalu terlibat mikroorganisme utamanya bakteri dan fungi indigenos, atau penghuni asli pada lingkungan/bahan yang mengalami fermentasi. pada campuran eceng gondok dan tongkol jagung juga terdapat bakteri dan fungi indigenos yang berperan penting pada proses fermentasi. kedua bahan tersebut adalah bahan berselulosa tinggi, tentunya mikroorganisme indigenosnya juga mampu mendegradasi selulosa. pada penelitian ini ingin diketahui aktivitas selulolitik fungi indigenos pada campuran eceng gondok dan tongkol jagung. bahan dan metode eceng gondok sebagai sumber mikrob diambil dari sungai atau badan air yang kondisinya bebas dari polutan berbahaya. tongkol jagung diambil dari tempat penggilingan yang dipastikan aman dari bahan berbahaya untuk kategori pakan. fermetoge dibuat berbahan baku eceng gondok dan tongkol jagung dengan perbandingan 1:1. bahan-bahan tersebut sebelumnya diperkecil ukurannya dengan jurnal riset biologi dan aplikasinya, 1 (1): 26 – 31, maret 2019 | 28 dipotong dan digerus. selanjutnya bahan tersebut dikukus dan diinkubasi supaya terjadi proses fermentasi secara alamiah (fitrihidajati dkk., 2015). setiap hari selama 15 hari proses fermentasi diambil sampel pakan untuk diisolasi funginya. massa pakan sebanyak 30 g disuspensikan dalam akuades steril, disaring dan dikultur dengan metode lempeng tuang (pour plate method). media kultur yang digunakan adalah pda (potato dextrose agar). selanjutnya kultur diinkubasi pada suhu 37oc selama 1-3 hari. setelah masa inkubasi akan diperoleh kultur campuran. kultur campuran yang diperoleh selanjutnya dimurnikan dengan cara melakukan isolasi dan subkultur setiap koloni menjadi kultur tunggal dengan metode cawan gores (streak plate method). karakterisasi dan identifikasi fungi yang diperoleh didasarkan pada hasil pengamatan makroskopis karakter koloni dan mikroskopik karakter hifa dan struktur reproduksi yang dilakukan dengan metode slide culture. uji aktivitas selulolitik fungi indigenos dilakukan dengan pengamatan terbentuknya zona halo pada permukaan media spesifik cmc (carboxymetil cellulosa) setelah diwarnai dengan congo red 2%. komposisi media spesifik yang digunakan adalah 1000ml air destilasi, 1g nh4h2po4, 0,2g kcl, 1g mgso4.7h2o, 1g yeast extract, 26g carboxymethyl cellulose (cmc) and 3g agar. tampaknya zona halo yang besar sekitar koloni fungi yang tumbuh menunjukkan adanya aktivitas selulolitik yang juga besar. selanjutnya dilakukan uji antagonism/synergism kerja antar fungi. fungi yang bekerja sinergis akan dikonsorsiumkan sebagai formula starter. uji sinergisme/antagonisme kerja fungi dilakukan dengan cara menumbuhkan dua fungi yang diuji pada satu media padat dan diamati pertumbuhannya. apabila terdapat zona hambat (daerah disekitar koloni yang tidak ditumbuhi miselium) maka fungi tersebut saling antagonis. jika zona hambat tidak ditemukan, maka fungi bekerja sinergis. data berupa diameter zona halo dianalisis secara deskriptif kuantitatif. hasil dan pembahasan isolat fungi yang diperoleh diuji aktivitas selulolitiknya pada media cmc dan diwarnai dengan congo red, cmc yang terdapat pada media yang didegradasi oleh bakteri menampakkan zona halo (daerah yang intensitas warna merahnya berkurang). koloni fungi yang terlebih dahulu ditumbuhkan pada media potato dextrose agar (pda) dipotong bentuk lingkaran dan diinokulasikan pada bagian tengah medium cmc. koloni tersebut harus dapat menggunakan cmc sebagai sumber karbon sekaligus sumber energy. bagi fungi yang mempunyai aktivitas sellulolitik, cmc akan terdegradasi dan apabila diwarnai dengan congo red, akan tampak zona halo.dengan demikian adanya zona halo di sekitar koloni fungi yang tumbuh menunjukkan bahwa koloni tersebut dapat mendegradasi selulosa atau mempunyai aktivitas selulolitik. selanjutnya zona halo di sekitar koloni diukur radiusnya dan dipaparkan hasilnya pada gambar 1, sedangkan tampilan zona halo seperti pada gambar 2. fungi yang bekerja antagonis dan sinergis dipaparkan pada gambar 3. gambar 1. jari-jari zona halo (mm) pada uji aktivitas selulolitik fungi indigenos 29 | isnawati; aktivitas selulolitik fungi indigenos pada fermetoge gambar 2. zona halo sebagai bukti adanya aktivitas selulolitik koloni fungi gambar 3. (a) fungi yang saling antagonis dan (b) fungi yang saling sinergis kesepuluh spesies fungi indigenos yang terdapat dalam campuran eceng gondok dan tongkol jagung mempunyai aktivitas selulolitik, tetapi terdapat tiga spesies fungi yang aktivitas sellulolitiknya besar yaitu rhizopus sp1, mucor sp1 dan trichoderma sp1. ketiga spesies fungi ini sangat berpotensi untuk dikonsorsiumkan sebagai starter dalam proses fermentasi bahan-bahan selulosik, karena ketiga fungi ini terbukti dapat mendegradasi cmc pada media uji. degradasi selulosa merupakan hasil kerja tiga komponen enzim secara sinergis, yaitu endoglukanase, eksoglukanase, dan β-glukosidase (lymar dkk., 1995). beberapa mikroba yang berperan dalam proses dekomposisi seperti achromo bacteria, bacillus, cellulomonas, clostridium, cytophaga, vibrio pseudomonas, dan sporocytophaga merupakan kelompok bakteri selulolitik, dan aspergillus, chaetomium, fusarium, pencillium, rhizoctonia, rhizopus dan trichoderma merupakan kelompok fungi selulolitik.rhizopus dan trichoderma telah banyak dimanfaatkan sebagai produsen enzim selulase yang banyak diaplikasikan dalam skala industri. eceng gondok dan tongkol jagung tergolong bahan selulotik atau mengandung selulosa tinggi, sehingga mengandung banyak mikroorganisme yang mempunyai aktivitas selulolitik. fungi indigenos yang terdapat dalam campuran kedua bahan ini mendegradasi sellulosa untuk dimanfaatkan sebagai sumber karbon dan sumber energi, yang selanjutnya digunakan untuk tumbuh dan berkembang. selulosa merupakan polimer glukosa rantai lurus dengan ikatan β-1.4 glukosida dari suatu selobiosa yaitu dimer dari glukosa (shuangqi et al., a b jurnal riset biologi dan aplikasinya, 1 (1): 26 – 31, maret 2019 | 30 2011). rantai lurus tersebut berhubungan melalui ikatan hidrogen dan gaya van der waals (perez et al., 2002). selulosa mengandung sekitar 50-90% bagian berkristal dan sisanya bagian amorf. ikatan β-1.4 glukosida pada serat selulosa dapat dipecah menjadi monomer glukosa dengan cara hidrolisis asam atau enzimatis. proses terbentuknya zona halo pada media cmc dapat dijelaskan sebagai berikut. cmc adalah jenis selulosa murni yang berbentuk amorphous dan hanya dapat dihidrolisis menggunakan enzim selulase --glukanase. enzim endo-1,4-jenis endo1,4glukanase bekerja pada rantai dalam cmc menghasilkan rantai oligosakarida atau rantai selulosa yang lebih pendek (meryandini et al., 2009). rantai oligosakarida yang relative lebih sederhana dibandingkan cmc tidak terlalu menyerap warna congo red, sehingga menampilkan zona halo pada permukaan media di sekitar koloni fungi. rhizopus sp,mucor sp, dan trichoderma sp. selain mempunyai aktivitas sellulolitik yang tinggi, ketiganya juga bekerja saling sinergis, sehingga saling mendukung untuk mempercepat proses fermentasi bahan pakan. simpulan pada penelitian ini ditemukan sepuluh spesies fungi indigenos pada pakan fermetoge yang terbuat dari campuran eceng gondok dan tongkol jagung. sepuluh spesies itu meliputi aspergillus sp1, rhizopus sp1, aspergillus terreus, mucor sp1, aspergillus sp2, aspergillus niger, trichoderma sp1, aspergillus flavus, aspergillus sp3, dan penicillium sp1. aktivitas sellulolitik yang tinggi dan kerja saling sinergis ditemukan pada tiga spesies fungi yaitu rhizopus sp, mucor sp, dan trichoderma sp. ketiga spesies ini merupakan fungi yang sangat potensial sebagai anggota konsorsium suatu starter yang dapat dimanfaatkan dalam degradasi bahan-bahan selulotik untuk produksi pakan ternak, pembuatan kompos atau produksi enzim selulase untuk keperluan industri. ucapan terimakasih ucapan terima kasih disampaikan pada para mahasiswa yang telah membantu pelaksanaan penelitian ini. juga kepada jurusan biologi yang telah memfasilitasi dengan menyediakan prasarana dan sarana yang diperlukan. daftar pustaka bhatia, a., rajpal, a., madan, s., & kazmi, a. a. (2015). techniques to analyze diversity during composting a mini review. indian journal of biotechnology. 14 :1925. fitrihidajati, h., ratnasari, e., isnawati, & soeparno g. (2015). quality of fermentation result of ruminant feed production made of water hyacinth (eichornia crassipes), journal of biosantifika. 7 (1): 62-67. gichuki, j., omondi, r., boera, p., okorut, t, matano, a. s., jembe, t& ofulla, a. (2012). water hyacinth eichhornia crassipes (mart.) solms-laubach dynamics and succession in the nyanza gulf of lake victoria (east africa): implications for water quality and biodiversity conservation. the scientific world journal. 10: 11-20. hossain, m.d.e., sikder, h, kabir, m.d. h & sarma s.m. (2015). nutritive value of water hyacinth (eichhornia crassipes). journal of animal and feed research. 5 (2): 40-44. ishii, k., fukui, m &takii, s. (2000). microbial succession during a composting process as evaluated by denaturing gradient gel electrophoresis analysis. journal of applied microbiology. 89: 768-777. jian-jun, c., yi d & qi-jia, z. (2006). invasion and control of water hyacinth (eichhornia crassipes) in china. j zhejiang univ science. 7 (8): 623-626. kanengoni, a. t, chimonyo, m, ndimba, b. k & dzama k. (2015). potential of using maize cobs in pig diets a review. asian australia journal animal science. 28 (12): 1669-1679. labrada, r., caseley, j. c &parker, c. (1994). weed management for developing countries. fao. new york. usa. lardy, g& vern anderson. (2009). alternative feeds for ruminant. ndsu. dakota. lu, j., fu, z &yin, z. (2008). performance of water hyacinth (eichhornia crassipes) system in the treatment of wastewater from a duck farm and the effects of using water hyacinth as duck feed. journal of environmental sciences. 20 (5) : 513-519. lymar, e. s, li, b&renganathan, v. (1995). purification and characterization of a cellulosebinding β glucosidase from cellulose degrading culture of phanerochaete chrysosporium. applied environment microbiology. 61: 2976-2980. mako, a. a., babayemi, o. j &akinsoyinu, a. o. (2011). an evaluation of nutritive value of water hyacinth (eichhornia crassipes mart. solms-laubach) harvested from different water sources as animal feed. livestock research for rural development. 23: 106-110. mangisah, i, sukamto, b & nasution, m. h. (2009). implementation of fermented eceng gondok in duck ration. journal of the indonesian tropical animal agriculture. 34 (2) :127-133. https://www.researchgate.net/journal/1001-0742_journal_of_environmental_sciences https://www.researchgate.net/journal/1001-0742_journal_of_environmental_sciences https://www.researchgate.net/journal/1001-0742_journal_of_environmental_sciences https://www.researchgate.net/journal/1001-0742_journal_of_environmental_sciences 31 | isnawati; aktivitas selulolitik fungi indigenos pada fermetoge meryandini, a., widosari, w., maranatha, b., sunarti, t.c., rachmania, n., & satria, h. (2009). isolasi bakteri selulolitik dan karakterisasi enzimnya. jurnal makara sains, 13 (1): 33–38. missotten, a. m, michiels, j., degroote, j & de, sme s. (2015). fermented liquid feed for pigs: an ancient technique for the future. journal of animal science and biotechnology. 6: 4-13. mohapatra, s. b. (2015). utilization of water hyacinth (eichhornia crassipes) meal as partial fish protein replacement in the diet of cyprinus carpio fry. european journal of experimental biology. 5 (5): 31-36. ndimele, p & jimoh, a. (2011). water hyacinth (eichhornia crassipes [mart.] solms.) in phytoremediation of heavy metal polluted water of ologe lagoon, lagos, nigeria. research journal of environmental sciences. 5 (5): 424-433. perez, j. j., munoz-dorado, t., de la rubia &martinez, j. (2002). biodegradation and biological treatments of cellulose, hemicellulose and lignin: an overview. international microbiology. 5: 53-63. shuangqi, t. w., zhenyu, f., ziluan, z., lili & w. jichang. (2011). determination methods of cellulase activity. african journal biotechnology. 10: 7122-7125. jurnal riset biologi dan aplikasinya, 1 (1): 26 – 31, maret 2019 | 32 jurnal riset biologi dan aplikasinya, 1 (1) : 9-17, maret 2019 | 1 jurnal riset biologi dan aplikasinya, volume 1, nomer 1, maret 2019 pengembangan lkpd berbasis search, solve, create and share (sscs) untuk melatih keterampilan proses sains pada materi arthropoda kelas x sma the development lkpd based on search, solve, create and share (sscs) to train process skills in arthropoda materials of x-grade senior high school amanda ivana sanchia, ulfi faizah* jurusan biologi, fakultas matematika dan ilmu pengetahuan alam, universitas negeri surabaya abstrak keterampilan proses sains dapat dilatihkan dengan menerapkan konsep biologi yang berorientasi pada pendekatan saintifik untuk mengembangkan kompetensi ilmiah. pada proses pembelajaran lembar kegiatan peserta didik (lkpd) sangat penting guna menunjang aktivitas pembelajaran peserta didik. arthropoda merupakan kelompok hewan invertebrata yang sering dijumpai di sekitar kita dan merupakan salah satu materi yang dipelajari di biologi kelas x. tujuan penelitian ini untuk menghasilkan lkpd berbasis search, solve, create and share (sscs) pada materi arthropoda yang layak secara teoretis yang ditinjau dari hasil validitas dan layak secara empiris yang ditinjau dari aktivitas peserta didik, hasil belajar peserta didik, dan respons peserta didik. penelitian ini merupakan penelitian pengembangan yang mengacu pada model 4d (define, design, develop, disseminate). tahap pengembangan dilaksanakan di jurusan biologi selanjutnya diujicobakan kepada 20 peserta didik man sidoarjo dengan rancangan one group pre-test-post-test. hasil penelitian menunjukkan bahwa lkpd berbasis sscs yang dikembangkan termasuk kategori sangat valid. penilaian berdasarkan aktivitas peserta didik memperoleh nilai 96.66% dengan kategori praktis artinya hampir semua peserta didik melakukan kegiatan pada lkpd berbasis sscs dan respons peserta didik memperoleh nilai 96.95% dengan kategori sangat praktis. simpulan penelitian ini menunjukkan bahwa lkpd berbasis sscs materi arthropoda untuk melatihkan keterampilan proses layak secara teoretis dan empiris. abstract scientific process skills can be trained by applying biological concepts oriented on the scientific approach to developing scientific competence. in the learning process student worksheet is important in order to support the learning activities of learners. arthropoda is a group of invertebrate animals that can be found around us. this topic is learned in class x biology. this research aimed to produce a search-based, solve, create and share (sscs) lkpd on the theoretically feasible arthropoda material reviewed from results of validity and empirical worth in terms of the activities of students, learning outcomes of students, and the response of students. this research was developmental research that refers to the 4d model (define, design, develop, disseminate). the development phase was implemented in biology department then was tested to 20 students of man sidoarjo with one group pre-test-post-test. student learning outcomes were analyzed using the gain score. the results showed that the student worksheet developed in this research was valid. assessment based on student’s activity score 96.66% with categories of very practical means that almost students did the activity on sscs-based lkpd and student's response got value 96.95% with a very practical category. based on this data it can be concluded that lkpd of sscs arthropoda material to train the process of skill theoretically and empirical. how to cite: sanchia, a. a & faizah, u. (2019). pengembangan lkpd berbasis search, solve, create and share (sscs) untuk melatih keterampilan proses sains pada materi arthropoda kelas x sma. jurnal riset biologi dan aplikasinya. 1 (1): 9-17. * *correspondence author: jalan ketintang gedung c3 lt. 2 surabaya 60231, indonesia e-issn: 2655-9927 e-mail: ulfifaizah@unesa.ac.id jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi history article received: 13 juli 2018 approved: 9 januari 2019 published: maret 2019 kata kunci: lkpd, (seacrh, solve, create and share), arthropoda, keterampilan proses skill keywords: student worksheet, (seacrh, solve, create and share) sscs, arthropod, scientific process skill 10 | sanchia dkk; pengembangan lkpd berbasis search, solve, create and share (sscs) pendahuluan pendidikan tidak hanya semata-mata berkaitan dengan aspek kognitif saja melainkan metode yang digunakan dalam proses pembelajaran juga harus sesuai dengan tujuan pembelajaran yang ingin dicapai. pada proses pembelajaran dengan kurikulum 2013 berorientasi pada pendekatan saintifik yang menekankan pada pemberian pengalaman dan praktik, karena pembelajaran yang menekankan pada pemberian pengalaman secara langsung dengan melakukan pengamatan objek akan mempermudah peserta didik dalam mengklasifikasikan makhluk hidup serta data yang diperoleh akan lebih valid (lepiyanto, 2016). keberhasilan dalam ketercapaian tujuan pembelajaran juga tidak dapat dipisahkan dari sumber belajar. penggunaan sumber belajar mampu menunjang kegiatan proses belajar mengajar yang penting bagi peserta didik untuk membangun pengetahuannya sendiri dengan penggunaan lembar kegiatan peserta didik (lkpd) (trianto, 2011). salah satu inovasi model pembelajaran yang dapat digunakan oleh guru dalam proses pembelajaran pada materi mengklasifikasikan makhluk hidup yaitu dengan model search, solve, create and share (sscs) yang berbasis problem solving (febriyanti, 2014). model sscs merupakan model pembelajaran yang berpendekatan pemecahan masalah yang memiliki empat tahapan yaitu search, solve, create and share (lartson, 2013). materi arthropoda merupakan salah satu materi yang dipelajari di biologi kelas x sma dan merupakan filum terbesar yang anggotanya tersebar luas. arthropoda dapat dijumpai dengan mudah di lingkungan sekolah, sehingga kegiatan pengamatan dapat dilakukan dengan memanfaatkan lingkungan sekolah sebagai sumber belajar (nursa’diyah, 2014). dengan demikian pembelajaran pada materi arthropoda dirancang untuk mengajak peserta didik melakukan kegiatan pengamatan anggota filum arthropoda dan mendeskripsikan ciri morfologi pada tiap kelas yang tergabung dalam filum arthropoda. oleh karena itu, materi ini merupakan salah satu materi yang membutuhkan keterampilan proses. berdasarkan hasil dari angket yang telah diberikan kepada 3 guru dan 35 peserta didik di man sidoarjo menyebutkan bahwa pembelajaran pada materi filum arthropoda belum dilatihkan keterampilan proses sains karena pada kegiatan pembelajaran belum menerapkan keterampilan proses sains. selain itu, media dan sumber belajar yang digunakan menjadi kendala untuk guru dalam penyampaian materi. kendala tersebut disebabkan karena kurangnya media dan sumber belajar yang mengarah pada kegiatan pengamatan hewan secara langsung. akibatnya peserta didik kurang aktif dan tidak termotivasi pada proses pembelajaran. berdasarkan hal tersebut, pembelajaran melalui observasi atau pengamatan langsung dapat melatihkan keterampilan proses peserta didik. salah satu model pembelajaran yang dapat melatihkan keterampilan proses yaitu model pembelajaran sscs. model pembelajaran sscs ini, berorientasi pada pemecahan masalah yang terdiri dari empat tahap yaitu mengidentifikasi masalah, membuat rumusan masalah, melakukan pengamatan, dan mengkomunikasikan. keunggulan model sscs yakni dapat mengajak peserta didik aktif dalam kegiatan pembelajaran dengan melakukan pengamatan langsung untuk mencapai kecakapan kognitif, afektif, dan psikomotornya kreativitasnya (febriyanti, 2014). bertolak dari uraian di atas, maka diperlukan adanya pengembangan lkpd berbasis search, solve, create and share (sscs) untuk melatih keterampilan proses sains pada materi arthropoda kelas x sma layak secara teoretis yang ditinjau dari hasil validitas dan layak secara empiris yang ditinjau dari aktivitas peserta didik, hasil belajar peserta didik, dan respons peserta didik. metode penelitian ini merupakan penelitian pengembangan untuk menghasilkan lkpd berbasis sscs yang layak secara teoretis yang ditinjau dari hasil validasi dan layak secara empiris yang ditinjau dari aktivitas peserta didik, hasil belajar peserta didik, dan respons peserta didik pada materi arthropoda. penelitian ini menggunakan model pengembangan four-d models (4d) yang terdiri dari empat tahapan yakni define (pendefinisian), design (perancangan), develop (pengembangan), dan disseminate (penyebaran). sasaran penelitian ini adalah lembar kegiatan peserta didik (lkpd) berbasis search, solve, create and share (sscs) untuk melatihkan keterampilan proses pada materi arthropoda yang diujicobakan pada 20 peserta didik kelas x mia 1 di man sidoarjo. penelitian ini menggunakan metode validasi, observasi dan respons, serta tes dalam pengumpulan data. instrumen yang digunakan berupa lembar validasi lkpd, lembar observasi keterlaksanaan aktivitas peserta didik meliputi jurnal riset biologi dan aplikasinya, 1 (1) : 9-17, maret 2019 | 11 aktivitas peserta didik menggunakan lkpd berbasis sscs dan keterampilan proses sains peserta didik, lembar pre-test dan post-test dan lembar angket peserta didik. lkpd dinyatakan layak apabila nilai validasi ≥70%, aktivitas peserta didik akan dinyatakan layak jika mendapat persentase ≥70%, peserta didik dinyatakan tuntas apabila dapat mencapai kkm 75, respons peserta didik dinyatakan tuntas apabila mendapat persentase ≥70%. peningkatan skor pre-test dan post-test dianalisis menggunakan gain score. hasil dan pembahasan peneliti mengembangkan lkpd berbasis sscs pada materi arthropoda untuk melatihkan keterampilan proses yang terdiri atas tiga bagian yaitu lkpd 1 yakni dengan topik filum arthropoda, lkpd 2 yakni dengan topik insekta dan lkpd 3 dengan topik arachnida. karakteristik lkpd yang dihasilkan adalah penggunaan sscs untuk materi arthropoda (gambar 1. a-d). pada lembar kegiatan peserta didik berbasis sscs yang dikembangkan dilengkapi dengan beberapa fitur-fitur yang memudahkan peserta didik dalam penggunaan lkpd berbasis sscs serta memudahkan peserta didik untuk memahami konsep dalam pembelajaran filum arthropoda (tabel 1). gambar 1. profil lkpd. a. cover lkpd, b. peta konsep lkpd, c. tahapan sscs pada lkpd, d. kunci identifikasi pada lkpd a b c d 12 | sanchia dkk; pengembangan lkpd berbasis search, solve, create and share (sscs) hasil pengembangan berupa lkpd berbasis sscs pada materi arthropoda. berdasarkan hasil analisis data validasi lkpd berbasis sscs termasuk kedalam kategori sangat valid dengan modus 4 (tabel 2). aktivitas yang diamati, yaitu meliputi 15 aktivitas pembelajaran menggunakan lkpd berbasis sscs terhadap 20 peserta didik. berdasarkan hasil analisis data aktivitas peserta didik, diperoleh hasil rekapitulasi rata-rata aktivitas peserta didik dengan menggunakan lkpd berbasis sscs praktis sebesar 96,66%. hasil aktivitas peserta didik merupakan jumlah peserta didik yang melakukan aktivitas menggunakan lkpd berbasis sscs disajikan pada tabel berikut (tabel 3). berdasarkan tabel 3 diketahui bahwa keempat aspek keterampilan proses yang dituntut dalam lkpd telah mendapatkan kategori yang baik yaitu diperoleh persentase sebesar 91,25% yang tergolong dalam kategori aktif. berdasarkan tabel 5 diketahui bahwa keempat aspek indikator untuk keterampilan proses yang dituntut dalam lkpd mendapatkan kategori yang baik yaitu diperoleh persentase sebesar 91,25% yang tergolong dalam kategori aktif. hasil dari rekapitulasi respons peserta didik dapat diketahui dari lembar angket yang dibagikan kepada peserta didik. berdasarkan hasil analisis respons peserta didik terhadap 20 peserta didik, diperoleh hasil rata-rata penilaian sebesar 96,95% termasuk dalam kategori sangat praktis. hasil sikap direkapitulasi dalam bentuk tabel berikut ini (tabel 5). ketercapaian indikator dan ketuntasan hasil belajar peserta didik mengacu pada kd 3.9 dan kd 4.9. untuk mengetahui ketercapaian indikator dan ketuntasan hasil belajar peserta didik maka dilakukan pre-test dan post-test sehingga peningkatan hasil belajar peserta didik sesudah menggunakan lkpd dapat terukur. ketercapaian indikator keseluruhan dikatakan tuntas apabila memperoleh hasil ≥ 71%. rekapitulasi hasil ketercapaian indikator pada kd 3.9 dan 4.9 setelah menggunakan lkpd berbasis sscs pada materi arthropoda disajikan dalam gambar 2. hasil belajar siswa diukur dengan lembar pretest dan post-test. hasil belajar pre-test menunjukkan bahwa seluruh peserta didik tidak tuntas, sedangkan hasil belajar post-test didapatkan 20 peserta didik tuntas. hasil bealajar pre-test dan post-test dihitung menggunakan perhitungan gain score untuk mengetahui peningkatan hasil belajar peserta didik. gain score didapatkan rata-rata (g) sebesar 0,81 dan tergolong dalam kategori tinggi. tabel 1. fitur-fitur lkpd berbasis sscs materi arthropoda no. fitur keterangan 1 tahap search disajikan ilustrasi dan awetan anggota filum arthropoda, peserta didik dapat menganalisis permasalahan yang muncul pada ilustrasi dan membuat rumusan masalah terkait ilustrasi yang telah dibacanya. 2 tahap solve bagian ini peserta didik memilih metode pemecahan masalah yakni dengan melakukan pengamatan secara langsung dengan menggunakan awetan anggota filum arthropoda 3 tahap create bagian ini peserta didik menyusun data hasil pengamatan dan melakukan pengklasifikasian anggota hewan filum arthropoda yang telah diamati 4 tahap share bagian ini peserta didik mengkomunikasikan hasil pengamata tabel 2. rekapitulasi validasi lkpd berbasis sscs no. aspek yang dinilai rata-rata kelayakan aspek (%) kategori 1 penyajian 4 sangat valid 2. isi 3,5 sangat valid 3. mendorong peserta didik untuk melatih keterampilan proses sains 4 sangat valid 4. karakteristik pembelajaran dengan model search, solve, create and share (sscs) 3,5 sangat valid 5 keterbahasaan 4 sangat valid modus 4 sangat valid jurnal riset biologi dan aplikasinya, 1 (1) : 9-17, maret 2019 | 13 tabel 3. rekapitulasi aktivitas peserta didik menggunakan lkpd berbasis sscs no aktivitas siswa ∑ siswa yang beraktivitas (%) 1. peserta didik membaca petunjuk penggunaan yang tercantum dalam lkpd 100 2. peserta didik membaca tujuan pembelajaran yang tercantum pada lkpd 95 3. peserta didik membaca materi pendahuluan tentang arthropoda dalam lkpd 100 tahap search 4. peserta didik membaca ilustrasi mengenai hewan anggota filum arthropoda 100 5. peserta didik melakukan pengamatan pada gambar 100 6. peserta didik menganalisis masalah yang muncul dari ilustrasi dan gambar tersebut 90 tahap solve 7. peserta didik berlatih memecahkan masalah 100 8. peserta didik memecahkan masalah dengan metode pengamatan secara langsung 100 9. peserta didik melakukan pengamatan secara langsung berbagai awetan hewan anggota filum arthropoda 95 tahap create 10. peserta didik mengklasifikasi hewan amatan ke dalam tingkat kelas hingga ordo setelah melakukan pengamatan 80 11. peserta didik menuliskan ciri khas yang dimiliki tiap kelas dan ordo 100 12. peserta didik menentukan kelas hewan dan ordo arthropoda menggunakan kunci determinasi dan bantuan gambar 90 tahap share 13. peserta didik dapat menuliskan laporan hasil pengamatan berupa deskripsi. 100 14. peserta didik dapat mengkomunikasikan hasil pengamatan di depan kelas 100 15. peserta didik dapat mengevaluasi hasil data yang diperoleh melalui umpan balik dari guru 100 rata-rata persentase aktifitas peserta didik menggunakan lkpd berbasis sscs materi arthropoda 96,66 tabel 4. hasil pengamatan keterampilan proses sains peserta didik no. aktivitas peserta didik persentase keaktifan (%) 1. peserta didik menganalisis masalah yang muncul dari ilustrasi dan gambar yang diberikan 90 2. peserta didik melakukan pengamatan secara langsung berbagai awetan hewan anggota filum arthropoda 95 3. peserta didik mengklasifikasi hewan amatan ke dalam tingkat kelas hingga ordo setelah melakukan pengamatan 80 4. peserta didik dapat mengkomunikasikan hasil pengamatan di depan kelas 100 rata-rata persentase respons peserta didik menggunakan lkpd berbasis sscs materi arthropoda 91,25 tabel 5. rekapitulasi hasil respons peserta didik terhadap lkpd berbasis sscs materi arthropoda no. sikap peserta didik ∑ peserta didik (%) 1. isi 98.57 2. bahasa 93.75 3. penyajian 98.75 14 | sanchia dkk; pengembangan lkpd berbasis search, solve, create and share (sscs) no. sikap peserta didik ∑ peserta didik (%) 4. aspek ketertarikan peserta didik 95 5. kesesuaian dengan sscs 100 rata-rata persentase respons peserta didik menggunakan lkpd berbasis sscs materi arthropoda 96.95 gambar 2. rekapitulasi data ketercapaian indikator pembelajaran setelah proses pembelajaran menggunakan lkpd berbasis sscs pada materi arthropoda keterangan: 1. mengidentifikasi ciri-ciri umum yang teramati dari hewan filum arthropoda berdasarkan lapisan tubuh, rongga tubuh, simetri tubuh dan reproduksi. 2. mengklasifikasikan hewan filum arthropoda ke dalam tingkat kelas 3. memberi contoh hewan dari tiap kelas hasil belajar siswa diukur dengan lembar pre-test dan post-test. hasil belajar pre-test menunjukkan bahwa seluruh peserta didik tidak tuntas, sedangkan hasil belajar post-test didapatkan 20 peserta didik tuntas. secara keseluruhan hasil belajar post-test lebih tinggi dibandingkan dengan hasil belajar pre-test. hasil bealajar pre-test dan post-test dihitung menggunakan perhtungan gain score untuk mengetahui peningkatan hasil belajar peserta didik. gain score didapatkan rata-rata (g) sebesar 0,81 dan tergolong dalam kategori tinggi. kelayakan lkpd berbasis sscs materi arthropoda berdasarkan validitas, kefektifan dan kepraktisan. validitas ditinjau dari hasil validasi oleh ahli materi dan ahli pendidikan. keefektifan media dan lkpd berbasis sscs materi arthropoda ditinjau dari hasil belajar dan angket respons peserta didik. kepraktisan lkpd berbasis sscs materi arthropoda ditinjau dari aktivitas peserta didik. berdasarkan hasil validasi (tabel 2) diketahui bahwa lkpd yang dikembangkan memiliki modus 4 dan termasuk dalam kategori sangat valid. oleh karena itu lkpd berbasis sscs dapat diujicobakan di sekolah. kelayakan tersebut didapatkan berdasarkan 5 aspek penilaian terhadap lkpd berbasis sscs yaitu terdiri dari aspek penyajian, aspek kelayakan isi, aspek keterampilan proses peserta didik, aspek karakteristik dengan model pembelajaran sscs, dan aspek kebahasaan. kepraktisan lkpd berbasis sscs materi arthropoda untuk melatihkan keterampilan proses ditinjau berdasarkan aktivitas peserta didik dan hambatan yang dihadapi peserta didik saat proses pembelajaran menggunakan lkpd. aktivitas peserta didik diamati pada saat peserta didik menggunakan lkpd berbasis sscs materi arthropoda. aktivitas yang diamati terdiri dari lima belas aspek dengan rata-rata nilai keaktifan peserta didik sebesar 96,66% (tabel 3) dengan kategori praktis. 0% 10% 20% 30% 40% 50% 60% 70% 80% 90% 100% 1 2 3 65% 53% 60% 100% 85% 90% pre-test post test jurnal riset biologi dan aplikasinya, 1 (1) : 9-17, maret 2019 | 15 aktivitas yang dinilai merupakan gabungan dari sintaks model pembelajaran sscs dan sintaks dari keterampilan proses. pada tahap pertama, yaitu tahap search, kegiatan yang dilakukan peserta didik yaitu membaca ilustrasi mengenai anggota filum arthropoda dengan topik insekta dan arachnida, peserta didik dapat menemukan permasalahan yang muncul dari ilustrasi tersebut. tahap tersebut memperoleh rata-rata sebesar 96,66% yang termasuk dalam kategori praktis. hal ini sesuai dengan hasil penelitian iswantini & purnomo (2017) membaca artikel dapat membantu peserta didik untuk berpikir secara sistematis dan melatih keterampilan penyelidikan. peserta didik dapat belajar melalui penemuan sehingga mereka mampu menemukan sendiri dan berusaha untuk mencari pemecahan masalah yang didukung oleh pengetahuan yang telah dimilikinya. tahap sscs selanjutnya yaitu tahap solve yang memperoleh rata-rata sebesar 98,33% yang termasuk dalam kategori praktis. pada tahap ini kegiatan yang dilakukan yakni memilih metode untuk memecahkan masalah dengan melakukan metode pengamatan secara langsung. hal ini sejalan dengan teori belajar vygotsky yang menyatakan bahwa perkembangan intelektual peserta didik mampu terjadi apabila dalam proses pembelajaran peserta didik berhadapan dengan suatu masalah dan mereka akan berusaha untuk memecahkan masalah tersebut (vygotsky, 1978). kegiatan mengamati atau kegiatan investigasi juga dapat membantu melatih keterampilan proses yang dimiliki peserta didik karena kegiatan mengamati merupakan keterampilan dasar yang dibutuhkan dalam proses memperoleh ilmu pengetahuan (atmojo, 2012). tahap sscs selanjutnya yaitu tahap create yang memperoleh rata-rata sebesar 90% yang termasuk dalam kategori praktis. pada tahap ini kegiatan yang dilakukan yakni melakukan penyusunan data hasil pengamatan awetan hewan anggota filum arthropoda dan pengklasifikasian hewan anggota filum arthropoda. klasifikasi merupakan hal yang penting untuk dapat mengetahui bahwa satu ciri yang dimiliki suatu objek juga dimiliki oleh objek yang lain (duruk, dkk., 2017). kegiatan pada tahap ini sejalan dengan pendapat ausubel mengenai pembelajaran bermakna yakni dalam proses pembelajaran informasi baru yang didapatkan peserta didik dihubungkan dengan struktur kognitif yang telah dimiliki peserta didik (ausubel, 1999). tahap yang terakhir yaitu share yakni mengkomunikasikan hasil yang diperoleh dari pengamatan guna sebagai jawaban dari masalah, tahap tersebut memperoleh rata-rata sebesar 100%. menurut ibrahim (2010), menyatakan bahwa proses mengkomunikasi dapat berupa pendeskripsian hasil pengamatan, merangkum informasi dalam bacaan dan menyajikan data dalam bentuk grafik atau tabel. hal tersebut sejalan dengan pendapat fraser dkk. (2011) bahwa keterampilan mengkomunikasikan merupakan proses penyampaian infomasi secara lisan maupun tulisan yang berupa deskripsi, grafik, gambar, serta hasil pengamatan yang lain. berdasarkan (tabel 3) dapat diketahui bahwa keterampilan proses peserta didik terhadap lkpd berbasis sscs pada materi arthropoda yang dikembangkan termasuk dalam kategori aktif yaitu sebesar 91,25% atau dengan kata lain peserta didik telah terlatih dalam keterampilan proses yang diajarkan pada lkpd berbasis sscs. hal ini sesuai dengan hasil validasi yang memperoleh modus sebesar 4 yang termasuk ke dalam kategori sangat valid dan sesuai dengan pengamatan keterampilan proses peserta didik yang termasuk dalam kategori aktif. berdasarkan tabel 4 dapat diketahui bahwa keterampilan proses sains peserta didik terhadap lkpd berbasis sscs pada materi arthropoda yang dikembangkan termasuk dalam kategori aktif yaitu sebesar 91,25% artinya peserta didik dapat dilatih keterampilan prosesnya melalui penggunaan lkpd berbasis sscs. hal ini didukung dengan hasil validasi yang memperoleh modus sebesar 4 yang termasuk ke dalam kategori sangat valid dan sesuai dengan pengamatan aktivitas peserta didik yang aktif dalam menggunakan lkpd. respons peserta didik didapatkan melalui angket respons peserta didik yang diberikan kepada peserta didik setelah kegiatan pembelajaran dengan menggunakan lkpd berbasis search, solve, create and share (sscs) pada materi arthropoda untuk melatihkan keterampilan proses. pada angket respons peserta didik terdapat beberapa kriteria yang ditanyakan yaitu kriteria isi, bahasa, penyajian, dan kesesuaian dengan sscs pada lkpd yang dikembangkan. berdasarkan hasil yang diperoleh pada (tabel 5) dapat diketahui bahwa respons peserta didik terhadap lkpd berbasis sscs pada materi arthropoda untuk melatihkan keterampilan proses yang dikembangkan termasuk dalam kategori sangat praktis yaitu sebesar 96.95% atau dengan kata lain peserta didik memberikan respons positif. hal ini sesuai dengan pendapat pinasthika dkk. (2013) 16 | sanchia dkk; pengembangan lkpd berbasis search, solve, create and share (sscs) yang menyatakan bahwa penggunaan lks pada kegiatan pembelajaran dapat mempermudah peserta didik dalam memahami materi, di mana peserta didik dapat menemukan konsep-konsep sesuai panduan dalam lkpd. keefektifan lkpd yang dikembangkan ditinjau dari ketercapaian indikator dan hasil belajar peserta didik. indikator yang dinilai dalam penelitian ini yaitu indikator pengetahuan dan keterampilan yang mengacu pada kd 3.9 dan kd 4.9. ketercapaian indikator peserta didik diketahui melalui hasil pre-test dan post-test. dengan pre-test dan post-test maka diketahui adanya peningkatan hasil belajar peserta didik sesudah menggunakan lkpd berbasis sscs pada materi arthropoda untuk melatihkan keterampilan proses. peserta didik dikatakan tuntas karena mendapat nilai lebih besar dari menurut kkm mata pelajaran biologi kelas x man sidoarjo yaitu sebesar 75. berdasarkan (tabel 6) dapat diketahui bahwa ketuntasan indikator pembelajaran berdasar nilai pre-test pada kd 3.9 terdapat tiga indikator yaitu indikator 3.9.1 mengidentifikasi ciri-ciri umum yang teramati dari hewan filum arthropoda dengan ketuntasan sebesar 65%, indikator 3.9.2 mengklasifikasikan hewan filum arthropoda ke dalam tingkat kelas dengan ketuntasan sebesar 53% dan indikator 3.9.3 memberi contoh hewan dari tiap kelas dengan ketuntasan sebesar 60%. secara keseluruhan peserta didik belum tuntas dalam pre-test karena nilai yang didapatkan peserta didik kurang dari kkm yang telah di tentukan. sedangkan nilai post-test peserta didik secara keseluruhan telah melebihi kkm (≥ 75). hal ini menunjukkan bahwa seluruh peserta didik telah tuntas sehingga ketuntasannya sebesar 100%. peningkatan nilai peserta didik membuktikan bahwa penggunaan lkpd berbasis sscs pada materi arthropoda untuk melatihkan keterampilan proses selama kegiatan pembelajaran dapat dikatakan efektif. hal ini disebabkan selama proses pembelajaran peserta didik dituntut untuk aktif dan memberikan kebebasan kepada siswa untuk mengembangkan kreativitas dan keterampilan berpikir dalam rangka memperoleh pemahaman ilmu dengan melakukan penyelidikan dan mencari solusi dari permasalahan yang ada (utami, 2011). selain itu, menurut febriyanti (2014) menyatakan bahwa model pembelajaran sscs yang diterapkan dalam pembelajaran mampu dengan mudah meningkatkan keterampilan proses sains karena dengan belajar dari permasalahan akan membuat peserta didik termotivasi untuk memecahkan masalah dan berlatih untuk menemukan solusi dari masalah. peningkatan nilai peserta didik kemudian dihitung menggunakan gain score untuk mengetahui peningkatan nilai pre-test dan post-test. hasil perhitungan n-gain menunjukkan hasil bahwa 18 peserta didik (90%) memperoleh skor ngain dengan kategori tinggi dan dua peserta didik (12,5%) memperoleh skor n-gain dengan kategori sedang. hal tersebut menunjukkan bahwa semua peserta didik mengalami peningkatan nilai setelah menggunakan lkpd berbasis sscs pada materi arthropoda. peningkatan nilai yang didapatkan peserta didik membuktikan bahwa lkpd yang dikembangkan terbukti dapat melatihkan keterampilan proses peserta didik. simpulan berdasarkan penelitian yang telah dilakukan, simpulan dari penelitian ini adalah telah dikembangkan lembar kerja peserta didik (lkpd) berbasis search, solve, create and share (sscs) pada materi arthropoda untuk melatihkan keterampilan proses yang layak secara teoritis ditinjau berdasarkan tingkat validitas dan kelayakan empiris ditinjau berdasarkan tingkat kepraktisan dan keefektifannya. validitas lkpd ini memperoleh modus dengan kategori sangat layak; kepraktisan memperoleh tingkat kepraktisan aktivitas keterampilan proses dan respons peserta didik masing-masing sebesar 96,66% dan 96,95%; keefektifan memperoleh hasil sangat efektif dengan ketercapaian indikator dan ketuntasan hasil belajar peserta didik sebesar 100%. ucapan terimakasih terima kasih kepada prof. dr. muslimin ibrahim, m.pd. selaku dosen penguji yang telah memberikan kritik serta saran untuk perbaikan penyusunan skripsi pengembangan lkpd berbasis sscs, prof. dr. endang susantini, m.pd. selaku validator ahli materi yang juga memberikan kritik serta saran untuk perbaikan penyusunan skripsi pengembangan lkpd berbasis sscs serta pihak man sidoarjo. daftar pustaka atmojo, s.e. (2012). profil keterampilan proses sains dan apresiasi peserta didik terhadap profesi pengrajin tempe dalam pembelajaran ipa berpendekatan etnosains. juornal unnes. 1 (2) : 115-122. jurnal riset biologi dan aplikasinya, 1 (1) : 9-17, maret 2019 | 17 ausubel, david p. (1999). the use of advanced organizersmin the learning and retention of meaningful verbal material. journal of educational psychology. 51 : 267-272. duruk, u., abuzer, a., ceylan, d., & fatma, g. (2017). examining the learning outcomes included in the turkish science curriculum in terms of science process skills: a document analysis with standards-based assesment. international journal of enviromental & science education. 12 (2) : 117142. febriyanti, d., ilyas, s. nurmaliah, c. (2014). peningkatan keterampilan generik sains melalui penerapan model sscs (search, solve, create and share) pada materi mengklasifikasikan makhluk hidup di mtsn model banda aceh. jurnal biologi edukasi. 6 (2) : 43-47. fraser, p., & abder. (2010). teaching emerging scientist fostering scientific inquiry with diverse learner in grade k-2. boston: pearson education inc. ibrahim, m. 2010. dasar-dasar proses belajar mengajar. surabaya: university press. iswantini, w & purnomo, t. (2017). validitas lembar kegiatan peserta didik berbasis inkuiri pada materi pencemaran lingkungan untuk melatihkan literasi sains peserta didik kelas x sma. bioedu. 6 (3,) : 344-352 jerome, s. b. (1960). the process of education. harvard university press cambridge. lartson, c.a. (2013). effects of design-based science instruction on science problem-solving competency among different groups of high-school traditional chemistry students. thesis. university of colorado lepiyanto, a. p.s.a. (2016). pengembangan lembar kegiatan peserta didik (lkpd) berbasis scientific approach peserta didik sms kelas x pada materi fungi. jurnal pendidikan biologi universitas muhammadiyah metro. 7 (1). pinasthika, c. haryono, t. prastiwi, s. m. 2013. aktivitas belajar peserta didik sekolah menengah atas menggunakan lks berbasis web materi kingdom animalia. jurnal bioedu unesa. 2: 293298. utami, r.p. 2011. pengaruh model pembelajaran search solve create and share (sscs) dan problem based learning (pbi) terhadap prestasi belajar dan kreativitas peserta didik. jurnal bioedukasi. 4 (2): 57-71. jurnal riset biologi dan aplikasinya. 1(2): 47-53, september 2019 | 47 jurnal riset biologi dan aplikasinya, volume 1, nomor 2, september 2019 jenis-jenis gulma pada kebun tebu di kecamatan asembagus, situbondo, jawa timur: kelompok eudikotiledon weeds of sugar cane fields in asembagus sub-district, situbondo, east java: eudicots muhammad rifqi hariri1*, arifin surya dwipa irsyam2 1pusat penelitian konservasi tumbuhan dan kebun raya, lembaga ilmu pengetahuan indonesia 2herbarium bandungense (fipia), sekolah ilmu dan teknologi hayati (sith), institut teknologi bandung abstrak agroekosistem perkebunan tebu tidak akan pernah lepas dari kehadiran gulma sebagaimana telah dipaparkan oleh backer dalam atlas of 220 weeds of sugarcane fields in java pada tahun 1973. hingga saat ini, informasi mengenai gulma-gulma di perkebunan tebu belum terhimpun secara utuh sedangkan kehadiran gulmagulma terkini semakin banyak dilaporkan. penelitian ini bertujuan untuk inventarisasi jenis-jenis gulma perkebunan tebu di lima desa yang terletak di kecamatan asembagus dilakukan menggunakan metode jelajah. sebanyak 97 jenis gulma kebun tebu yang termasuk ke dalam 27 suku ditemukan di kecamatan asembagus. sepuluh jenis di antaranya belum dicatat oleh backer sebagai gulma pada kebun tebu. abstract sugar cane agro-ecosystems will never be separated from the presence of weeds as described by backer in his book atlas of 220 weeds of sugarcane fields in java on 1973. until now, the information about weeds in sugar cane plantations has not been fully collected meanwhile the presence of newly recorded weeds is increasingly being reported. this research aimed to inventory of weeds of sugar cane plantations was carried out at five villages located in asembagus subdistrict, using the exploratory method. a total of 97 species of weeds belonging to 27 families were found in asembagus sub-district. as many as ten species have not been recorded before as sugar cane plantation weeds. how to cite: hariri, m.r & irsyam, a.s.d. (2019). jenis-jenis gulma pada kebun tebu di kecamatan asembagus, situbondo, jawa timur: kelompok eudikotiledon. jurnal riset biologi dan aplikasinya. 1 (2): 47-53. *correspondence author: jl. ir. h. djuanda no. 13, bogor e-issn 2655-9927 e-mail: muhammad.rifqi.hariri@lipi.go.id jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi history article received : 15 juni 2019 approved : 10 juli 2019 published : 30 september 2019 keywords: eudicots, situbondo, sugar cane, weeds kata kunci: eudikotiledon, gulma, situbondo, tebu 48 | hariri & irsyam; jenis-jenis gulma pada kebun tebu di kecamatan asembagus pendahuluan tebu (saccharum officinarum l.) mulai dibudidayakan secara intensif di pesisir utara pulau jawa sekitar tahun 1830 hingga 1870-an (dell & olken, 2017). pada era kolonial, pemerintah hindia belanda memusatkan perkebunan tebu di kawasan jawa timur dan sampai saat ini tebu masih menjadi salah satu komoditas yang penting di provinsi tersebut (knight, 2014; harlianingtyas et al., 2018). berdasarkan catatan badan pusat statistik (bps) tahun 2017, propinsi jawa timur memiliki lahan perkebunan tebu seluas 217.923 hektar (bps, 2017). salah satu kawasan di pesisir utara jawa yang dijadikan lokasi penanaman tebu yaitu kecamatan asembagus di kabupaten situbondo (harlianingtyas et al., 2018). suatu agroekosistem seperti perkebunan tebu, tidak akan lepas dari kehadiran gulma. gulma dapat didefinisikan sebagai tumbuhan yang tumbuh di tempat yang tidak dikehendaki dan biasanya terdeteksi memiliki efek bagi lingkungan dan ekonomi (richardson et al., 2000; tjitrosoedirdjo et al., 2016a). informasi mengenai jenis gulma di kebun tebu di jawa telah terhimpun dalam buku onkruidflora der javasche suikerrietgronden yang ditulis oleh c.a. backer dan terbit dari tahun 1928 hingga 1934. seri buku ini terdiri atas satu jilid buku identifikasi dan 15 jilid atlas bergambar (backer, 1973). setelah atlas bergambar jilid kelimabelas terbit, sisa ilustrasi 220 jenis gulma belum sempat diterbitkan akibat krisis malaise dan perang dunia kedua. selanjutnya, pada tahun 1973, ilustrasi-ilustrasi tersebut diterbitkan oleh van steenis menjadi suatu kesatuan berjudul atlas of 220 weeds of sugarcane fields in java (backer, 1973). sejak seri onkruidflora der javasche suikerrietgronden terbit, informasi terkini jenis gulma pada kebun tebu di jawa belum tersedia. sementara itu, saat ini jenis-jenis gulma yang belum tercatat oleh backer sebelumnya dalam flora of java telah banyak dilaporkan, terutama dari kelompok eudikotiledon atau tumbuhan berkeping biji dua. beberapa di antaranya yaitu praxelis clematidea (griseb.) r.m.king & h.rob., plectranthus monostachyus (p.beauv.) b.j.pollard, dan solanum diphyllum l. (hariri & irsyam, 2018; irsyam & mountara, 2018; tjitrosoedirdjo & wahyuni, 2018). informasi jenis gulma kebun tebu di kecamatan asembagus juga belum terhimpun secara utuh. oleh sebab itu, penelitian ini bertujuan untuk menginventarisasi jenis tumbuhan eudikotiledon yang tumbuh menggulma pada perkebunan tebu di kecamatan asembagus, situbondo. bahan dan metode penelitian ini dilakukan di lima desa yang terletak di kecamatan asembagus, yaitu desa asembagus, awar-awar, gudang, trigonco, dan wringin anom pada bulan juni 2019. pengamatan lapangan dilakukan menggunakan metode jelajah mengikuti rugayah et al. (2004), yaitu dengan menjelajahi setiap sudut lokasi penelitian. spesimen yang diambil berupa individu atau ranting yang lengkap dengan bagian vegetatif dan generatif. data lapangan yang dicatat berupa nama kolektor, nomor koleksi, lokasi, tanggal, dan ciri-ciri morfologi yang dapat hilang selama proses pengawetan. sampel selanjutnya diproses dan diamati lebih lanjut di herbarium bandungense (fipia), sekolah ilmu dan teknologi hayati (sith), itb. identifikasi dilakukan berdasarkan ciri morfologi pada spesimen, terutama bagian bunga atau buah. spesimen dari lapangan selanjutnya diidentifikasi menggunakan 75 important invasive plant species in indonesia (tjitrosoedirdjo et al., 2016b), atlas of 220 weeds of sugarcane fields in java (backer, 1973), flora of java vol 1 & 2 (backer & bakhuizen van den brink, 1963; backer & bakhuizen van den brink, 1965), geïllustreerd handboek der javaansche theeonkruiden en hunne betekenis voor de cultuur (backer & van slooten, 1924), onkruidflora der javasche suikerrietgronden (backer, 1934), dan weeds of rice in indonesia (soerjani et al., 1987). hasil dan pembahasan berdasarkan hasil pengamatan di perkebunan tebu lima desa di kecamatan asembagus, tumbuhan eudikotiledon yang tumbuh menggulma terdiri dari 97 jenis dan termasuk ke dalam 27 suku. suku dengan jumlah jenis terbanyak antara lain fabaceae (16 jenis) dan asteraceae (11 jenis). jenis-jenis gulma pada kebun tebu di kecamatan asembagus disajikan dalam tabel 1. suku fabaceae atau polong-polongan merupakan kelompok tumbuhan dengan jumlah jenis terbanyak di lokasi penelitian, yaitu sebanyak 16 jenis. berdasarkan bentuk perawakannya, keenambelas jenis tersebut terbagi menjadi kelompok terna dan perdu. jenis yang termasuk terna yaitu, aeschynomene americana, centrosema pubescens, clitoria ternatea, dolichos lablab, mimosa invisa, dan pueraria phaseoloides. sementara jenis berperawakan perdu yakni clitoria laurifolia, crotalaria pallida, c. retusa, desmodium tortuosum, indigofera galegoides, i. tinctoria. jurnal riset biologi dan aplikasinya. 1(2): 47-53, september 2019 | 49 tabel 1. jenis-jenis gulma pada kebun tebu dari kelompok eudikotiledon di kecamatan asembagus no suku jenis lokasi as aw g t w 1 acanthaceae asystasia gangetica (l.) t.anderson √ 2 barleria cristata l. √ 3 ruellia tuberosa l. √ √ √ √ 4 amaranthaceae achyranthes bidentata blume √ √ √ 5 aerva lanata (l.) juss. √ √ √ 6 alternanthera brasiliana (l.) kuntze 7 alternanthera philoxeroides (mart.) griseb. √ √ 8 alternanthera pungens kunth √ 9 alternanthera sessilis (l.) r.br. ex dc. √ √ √ 10 amaranthus spinosus l. √ √ √ √ 11 amaranthus viridis l. √ √ 12 celosia argentea l. √ 13 gomphrena celosioides mart. √ √ 14 apiaceae centella asiatica (l.) urb. √ 15 apocynaceae calotropis gigantea (l.) dryand √ √ √ √ 16 catharanthus roseus (l.) g.don √ 17 asteraceae ageratum conyzoides (l.) l. √ √ √ 18 chromolaena odorata (l.) r.m.king & h.rob. √ √ √ √ √ 19 cyanthillium cinereum (l.) h.rob. √ √ √ √ √ 20 cyanthillium patulum (dryand. ex dryand.) h.rob. √ √ 21 emilia sonchifolia (l.) dc. ex dc. √ √ 22 mikania micrantha kunth √ √ √ √ √ 23 pluchea indica (l.) less. √ 24 sphagneticola trilobata (l.) pruski √ √ √ 25 synedrella nodiflora (l.) gaertn. √ √ √ √ √ 26 tridax procumbens (l.) l. √ √ √ √ √ 27 wollastonia biflora (l.) dc. √ √ √ 28 cannabaceae trema orientalis (l.) blume √ 29 cleomaceae cleome aspera j. könig ex dc. √ √ 30 cleome gynandra l. √ √ √ √ √ 31 cleome viscosa l. √ 33 convolvulaceae ipomoea fistulosa mart. ex choisy √ √ √ 34 ipomoea hederifolia l. √ 35 ipomoea obscura (l.) ker gawl. √ √ √ √ √ 36 ipomoea pes-tigridis l. √ 37 ipomoea triloba l. √ √ √ 38 merremia emarginata (burm. f.) hallier f. √ √ 39 cucurbitaceae coccinia grandis (l.) voigt √ √ √ √ √ 40 momordica charantia l. √ 41 euphorbiaceae acalypha indica l. √ √ √ √ √ 42 croton hirtus l'hér. √ 43 euphorbia heterophylla l. √ √ √ √ 44 euphorbia hirta l √ √ √ √ √ 45 jatropha gossypiifolia l. √ √ 46 ricinus communis l. √ √ √ 47 fabaceae aeschynomene americana l. √ √ 48 centrosema pubescens benth. √ √ √ √ √ 49 clitoria laurifolia poir. 50 clitoria ternatea l. √ 51 crotalaria pallida aiton √ √ √ √ 52 crotalaria retusa l. √ √ 53 desmodium tortuosum (sw.) dc. √ 54 dolichos lablab l. √ 55 indigofera galegoides dc. √ 56 indigofera tinctoria l. √ √ √ 57 leucaena leucocephala (lam.) de wit √ √ √ √ 58 mimosa invisa colla √ √ √ √ 59 mimosa pudica l. √ √ √ √ √ 50 | hariri & irsyam; jenis-jenis gulma pada kebun tebu di kecamatan asembagus no suku jenis lokasi as aw g t w 60 pueraria phaseoloides (roxb.) benth. √ 61 senna occidentalis (l.) link √ 62 tephrosia purpurea (l.) pers. √ √ √ 63 lamiaceae anisomeles indica (l.) kuntze √ 64 marsypianthes chamaedrys (vahl) kuntze √ √ √ 65 ocimum americanum l. √ √ 66 salvia misella kunth √ √ 67 linderniaceae lindernia crustacea (l.) f.muell. √ √ √ √ 68 malvaceae abutilon hirtum (lam.) sweet √ √ √ 69 hibiscus surattensis l. √ √ 70 malvastrum coromandelianum (l.) garcke √ √ √ 71 melochia corchorifolia l. √ √ 72 sida rhombifolia l √ √ √ √ √ 73 thespesia lampas (cav.) dalzell & a. gibson √ 74 triumfetta rhomboidea jacq. √ √ 75 urena lobata l. √ √ √ √ 76 waltheria indica l. √ 77 molluginaceae glinus oppositifolius (l.) aug.dc. √ √ 78 moraceae ficus callosa willd. √ 79 ficus septica burm.f. √ √ √ √ √ 80 nyctaginaceae boerhavia erecta l. √ √ √ √ √ 81 passifloraceae passiflora foetida l. √ 82 phyllanthaceae phyllanthus debilis klein ex willd. √ √ √ √ √ 83 phyllanthus reticulatus poir. √ 84 phyllanthus urinaria l. √ √ √ √ √ 85 plantaginaceae scoparia dulcis l. √ √ √ √ √ 86 plumbaginaceae plumbago zeylanica l. √ 87 rubiaceae oldenlandia corymbosa l. √ 88 richardia brasiliensis gomes √ 89 richardia scabra l. √ √ √ 90 sapindacaee cardiospermum halicacabum l. √ 91 solanaceae datura metel l. √ 92 solanum americanum mill. √ √ 93 solanum diphyllum l. √ 94 solanum torvum sw. √ 95 talinaceae talinum fruticosum (l.) juss. √ 96 vitaceae cayratia trifolia (l.) domin √ √ 97 zygophyllaceae tribulus terrestris l. √ √ √ √ √ keterangan: as= asembagus; aw= awar-awar; g= gudang; t= trigonco; w= wringin anom leucaena leucocephala, mimosa pudica, senna occidentalis, dan tephrosia purpurea. penemuan ini didukung oleh penelitian terdahulu bahwa jawa timur merupakan pusat keanekaragaman tumbuhan polong yang berperawakan terna dan perdu di kawasan malesia barat (raes et al., 2013). selain itu, lokasi pengamatan merupakan kawasan perkebunan tebu yang terbuka. raes et al. (2013) juga menyatakan bahwa daerah yang telah mengalami deforestasi dan alih guna lahan merupakan habitat yang ideal untuk tumbuhan terna dan perdu dari kelompok polong-polongan. suku dengan jumlah jenis terbanyak selanjutnya yaitu suku asteraceae yang terdiri atas 11 jenis. sebagian jenis asteraceae kebun tebu merupakan tumbuhan introduksi dari kawasan afrika (emilia sonchifolia, synedrella nodiflora), amerika tropis (ageratum conyzoides, chromolaena odorata, mikania micrantha, sphagneticola trilobata), dan meksiko (tridax procumbens) (soerjani et al., 1987; tjitrosoedirdjo, 2002; tjitrosoedirdjo et al., 2016b). penelitian terdahulu menunjukkan bahwa banyak jenis asteraceae yang telah diintroduksi ke pulau sumatera dan jawa, kemudian ternaturasisasi di habitat alami (soerjani et al., 1987; tjitrosoedirdjo, 2002). beberapa jenis yang ditemukan dari kecamatan asembagus juga telah ditetapkan menjadi tumbuhan asing invasif yang penting di indonesia, yaitu c. odorata, m. micrantha, s. trilobata, dan wollastonia biflora (tjitrosoedirdjo et al., 2016b). jurnal riset biologi dan aplikasinya. 1(2): 47-53, september 2019 | 51 gambar 1. gulma perkebunan tebu rekaman baru dari kecamatan asembagus. a=a. brasiliana, b=g. celosioides,c=f. callosa, d=m. chamaedrys, e=p. debilis, f=r. scabra, g=s. diphyllum, h=t. fruticosum, i=th. lampas, dan j=tr. terrestri. jenis tumbuhan dari suku asteraceae mampu menghasilkan biji dalam jumlah yang besar, karena memiliki perbungaan majemuk berupa bonggol yang terdiri atas banyak bunga. tjitrosoedirdjo et al. (2016a) menyatakan bahwa jumlah biji yang besar dapat memberikan kesempatan bagi suatu jenis asing untuk menghasilkan banyak keturunan, sehingga dapat membentuk populasi yang mapan pada lokasi yang belum terkolonisasi. selain itu, pemencaran biji juga terjadi secara efektif karena adanya struktur pappus yang berasal dari modifikasi daun kelopak (pyšek, 1997). marga-marga seperti ageratum, chromolaena, cyanthilium, emilia, mikania, pluchea, dan tridax memiliki pappus berupa bulu kejur yang akan membantu pemencaran biji secara anemokori. sementara struktur pappus pada synedrella berbentuk seperti duri sehingga memfasilitasi terjadinya pemencaran biji melalui mekanisme mamokori. pemencaran biji yang efektif akan membantu gulma asteraceae untuk menyebar secara luas ke tempat lain. beberapa jenis seperti mikania dan sphagneticola juga dapat melakukan perkembangbiakan secara vegetatif melalui fragmentasi sehingga mudah tumbuh (soerjani et al., 1987; thaman, 1999). faktor-faktor tersebut diduga menyebabkan banyak jenis asteraceae yang berhasil tumbuh menggulma di daerah sebaran baru. sebanyak 87 jenis gulma pada kebun tebu yang diamati dari kecamatan asembagus telah terdaftar dalam onkruidflora der javasche suikerrietgronden (backer, 1934). namun, 10 jenis sisanya belum pernah dilaporkan sebelumnya sebagai gulma kebun tebu, yaitu alternanthera brasiliana, gomphrena celosioides, ficus callosa, marsypianthes chamaedrys, phyllanthus debilis, richardia scabra, solanum diphyllum, talinum fruticosum, thespesia lampas, dan tribulus terrestris (gambar 1). dengan demikian, penemuan ini memberikan informasi baru mengenai keanekaragaman jenis gulma pada kebun tebu di jawa ficus callosa, p. debilis, dan s. diphyllum diduga belum tumbuh meliar di jawa saat backer menyusun daftar jenis gulma tebu, karena ketiga jenis tersebut juga tidak terekam dalam flora of java (backer & bakhuizen van den brink, 1963; backer & bakhuizen van den brink, 1965). ficus callosa merupakan jenis yang berasal dari asia selatan, tersebar mulai dari sri lanka, india, myanmar, indochina, thailand, hingga kepulauan andaman. keberadaannya di jawa baru terdaftar pada tahun 2005 dalam flora malesiana (berg & corner, 2005). phyllanthus debilis merupakan jenis yang berasal dari india dan sri lanka dan pertama kali dilaporkan sebagai gulma di jawa pada tahun 1987 (soerjani et al., 1987; chantaranothai, 2005). jenis tersebut sebelumnya tercatat sebagai gulma a b c d e f g h i j 52 | hariri & irsyam; jenis-jenis gulma pada kebun tebu di kecamatan asembagus padi, namun pada penelitian ini p. debilis tumbuh sebagai gulma di kebun tebu. sementara itu, s. diphyllum berasal dari amerika tengah dan telah ternaturalisasi di habitat alami karena lolos dari kultivasi. keberadaan populasi s. diphyllum yang ternaturalisasi di pulau jawa baru dilaporkan pada tahun 2018 (hariri & irsyam, 2018). jenis gulma seperti catharanthus roseus, datura metel, leucaena leucocephala, ocimum americanum, dan talinum fruticosum, diduga berasal dari tanaman yang sebelumnya sengaja ditanam oleh warga sekitar. leucaena leucocephala ditanam sebagai penyubur tanah dan pembatas kebun. sementara jenis yang ditanam untuk keperluan obat tradisional yakni d. metel dan t. fruticosum. ocimum americanum dan d. lablab dibudidayakan sebagai tanaman sayur, sedangkan c. roseus ditanam sebagai tanaman hias. semua jenis tersebut menghasilkan biji dalam jumlah yang besar dan berukuran kecil sehingga sulit untuk dikontrol. akibatnya, jenis-jenis ini lolos dari kultivasi dan tumbuh sebagai gulma di kawasan perkebunan tebu. simpulan tumbuhan gulma dari kelompok eudikotiledon yang tumbuh di kebun tebu di kecamatan asembagus terdiri atas 97 jenis dan tercakup ke dalam 27 suku. suku dengan jumlah jenis yang tinggi yaitu fabaceae dan asteraceae. sebanyak 10 jenis gulma yang ditemukan dari lokasi pengamatan belum tercatat sebelumnya pada buku onkruidflora der javasche suikerrietgronden. beberapa jenis tanaman budi daya seperti c. roseus, d. lablab, d. metel, l. leucocephala, o. americanum, dan t. fruticosum, telah ditemukan tumbuh menggulma di area perkebunan tebu. ucapan terima kasih ucapan terima kasih penulis tujukan kepada petani tebu di kecamatan asembagus yang telah memberikan izin untuk pengamatan gulma selama penelitian ini berlangsung. penulis juga mengucapkan terima kasih kepada indah wahyuni, s.si, m,si. yang telah membantu menyediakan referensi dari perpustakan seameo biotrop, tajur, bogor. daftar pustaka backer, c.a. & van slooten, d.f. (1924). geïllustreerd handboek der javaansche theeonkruiden en hunne betekenis voor de cultuur. batavia: ruygok. backer, c.a. (1934). onkruidflora der javasche suikerrietgronden. soerabaia: h. van ingen. backer, c.a. & bakhuizen van den brink, r.c. (1963). flora of java. vol. 1. groningen: n.v.p. noordhoff. backer, c.a. & bakhuizen van den brink, r.c. (1965). flora of java. vol. 2. groningen: n.v.p. noordhoff. backer, c.a. (1973). atlas of 220 weeds of sugarcane fields in java. deventer: the ysel press. berg, c.c. & corner, e.j.h. (2005). moraceae: ficeae. flora malesiana, ser. i. 17(2), 1-70. dikases dari https://borneoficus.info/wpcontent/uploads/2018/06/berg-corner2005-flora-malesiana-moraceae-ficus-.pdf. bps. (2017). statistik tebu indonesia. http://www.bps.go.id/publication. diakses tanggal 1 juni 2019. chantaranothai, p. (2005). taxonomic notes on the genus phyllanthus (euphorbiaceae) in thailand. thai forest bulletin (botany). 33, 1620. diakses dari: https://www.tcithaijo.org/index.php/thaiforestbulletin/arti cle/view/24223. dell, m. & olken, b.a. (2017). the development effects of the extractive colonial economy: the dutch cultivation system in java. the national bureau of economic research working paper series, 1-49. (doi): 10.3386/w24009. hariri, m.r. & irsyam, a.s.d. (2018). catatan tentang solanum diphyllum l. (solanaceae) ternaturalisasi di pulau jawa. al-kauniyah jurnal biologi, 11(1), 25-32. doi: http://dx.doi.org/10.15408/kauniyah.v11i1.5 448. harlianingtyas, hartati, d. & salim, a. (2018). modeling of rainfall and fertilization factor of sugarcane productivity in asembagus sugar factory situbondo. iop conf. ser.: earth environ. sci., 207, 012013. doi:10.1088/17551315/207/1/012013. irsyam, a.s.d. & mountara, a. (2018). plectranthus monostachyus (p beauv.) b. j. pollard (lamiaceae) di jawa. floribunda, 6(1), 32-33. doi: 10.32556/floribunda.v6i1.2018.223. knight, r. (2014). sugar, steam and steel: the industrial project in colonial java, 1830-1885. adelaide: the university of adelaide. pysek, p. (1997). compositae as invaders: better than the others?. preslia, 69(1), 9-22. diakses dari https://www.researchgate.net/publication/28 1663404. raes, n., saw, l.g., van welzen, p.c. & yahara, t. (2013). legume diversity as indicator for botanical diversity on sundaland, south east asia. south african journal of botany. 89: 265272. doi: https://doi.org/10.1016/j.sajb.2013.06.004. richardson, d.m., pyšek, p., rejmánek, m., barbour, m.g., panetta, f.d. & west, c.j. https://doi.org/10.1016/j.sajb.2013.06.004 jurnal riset biologi dan aplikasinya. 1(2): 47-53, september 2019 | 53 (2000). naturalization and invasion of alien plants: concepts and definitions. diversity and distributions, 6, 93-107. rugayah, retnowati, a., windadri, f.i. & hidayat, a. (2004). pengumpulan data taksonomi. dalam rugayah, e.a. widjaja & praptiwi (eds). pedoman pengumpulan data keanekaragaman flora (hlm. 5-42). bogor: puslit-lipi. doi: https://doi.org/10.1046/j.14724642.2000.00083.x soerjani, m., kostermans, a.j.g.h. & tjitrosoepomo, g. (1987). weeds of rice in indonesia. jakarta: balai pustaka. thaman, r.r. (1999). wedelia trilobata: daisy invader of the pacific islands (ias technical report no. 99/2). suva, fiji islands: university of the south pacific. tjitrosoedirdjo, s. (2002). notes on the asteraceae of sumatera. biotropia. 19: 65-84. diakses dari http://journal.biotrop.org/index.php/biotropi a/article/view/230/199. tjitrosoedirdjo, s., tjitrosoerdirdjo, s.s. & setyawati, t. (2016a). tumbuhan invasif dan pendekatan pengelolaannya. bogor: seameo biotrop. tjitrosoedirdjo, s.s., mawardi, i. & tjitrosoerdirdjo, s. (2016b). 75 important invasive plant species in indonesia. bogor: seameo biotrop. tjitrosoerdirdjo, s.s. & wahyuni, i. (2018). rekor baru keberadaan praxelis clematidea (asteraceae) di indonesia. dalam d. kurniadie, d. widayat & u. umiyati (eds). prosiding seminar nasional xx himpunan ilmu gulma indonesia: resistensi gulma terhadap herbisida dan dampaknya terhadap lingkungan dan produk pertanian (hlm. 212-217). bogor: higi. jurnal riset biologi dan aplikasinya, volume 5, issue 1, march 2023 genetic profile of local buffalo (bubalus bubalis) populations in pacitan and tuban, east java, indonesia measured by the molecular marker of inra032 locus laily isnaini rahmawati1, abdul basith2,4*, fitria lestari3 1smpn 27 kota malang, jl. lesanpuro no.24b, lesanpuro, kedungkandang district, malang city, east java, 65138, indonesia 2study program of biology education, university of kh. abdul wahab hasbulloh, jl. garuda no.9, tambak rejo, jombang district, jombang regency, east java, 61419, indonesia 3study program of biology education, university of pgri silampari, jln. mayor toha, air kuti, lubuk linggau timur i district, lubuklinggau city, south sumatera, 31625, indonesia 4indonesia genetic and biodiversity community, jln. ikan mujair 1, lowokwaru district, malang city, east java, indonesia *corresponding author: e-mail: golden_bee46@yahoo.com article history abstract received : 19 december 2022 the genetic profile of buffaloes is important information to support their breeding efforts, therefore the assessment of genetic profile needs to be carried out continuously. this study aimed to analyze the application of microsatellite marker at the inra032 locus for genetic profile assessment in buffalo (bubalus bubalis) populations in pacitan and tuban regencies, east java, indonesia. the total number of samples used was 16, with each population represented by 8 samples. genetic profile assessment parameters include allele frequency, the polymorphism information content (pic), and heterozygosity. the results showed that based on the inra032 locus, the tuban buffalo population had a higher allele frequency range (0.08 to 0.33) than the pacitan population (0.18 to 0.31). the average pic value in both populations was 0.39, so it can be concluded that the inra032 locus is informative enough to detect polymorphisms in both populations. the percentage heterozygosity of the pacitan buffalo population is 88%, which is higher than the tuban population at 50%, suggesting that the genetic diversity of the two populations is still quite high despite the decreasing trend in population numbers. the inra032 locus was shown to be moderately effective for assessing genetic profile in local buffaloes, but its application in future studies will require an increase in the number of samples representing the population and the addition of other microsatellite markers to obtain a more accurate conclusion. revised : 4 february 2023 approved : 12 march 2023 published : 31 march 2023 keywords genetic diversity; heterozygosity; microsatellites; polymorphism information content how to cite: rahmawati, r.i., basith, a., & lestari, f. (2023). genetic profile of local buffalo (bubalus bubalis) populations in pacitan and tuban, east java, indonesia measured by the molecular marker of inra032 locus. jurnal riset biologi dan aplikasinya, 5(1):37-42. doi: 10.26740/jrba. v5n1.p.37-42. introduction the need for animal protein consumption is increasing along with the human population size of indonesia, and one of the sources of animal protein is a large ruminant. one of the large ruminants that are the main source of animal protein in indonesia is buffalo (bubalus bubalis) (gunawan & romjali, 2009; komariah et al., 2018; nuraini et al., 2018). the number of buffaloes in east java province in 20172021 has gradually decreased, to 26.622, 24.364, 23994, 22.975, and 22.970, respectively. the number buffaloes in east java are very small compared to the number of buffaloes in west java and central java provinces (director general of livestock and animal health, 2021). in more detail, from 2014 to 2017, the average number of buffaloes in pacitan was only 117, while the average number of buffaloes in tuban was 1.695 (bps-statistics of east java, 2018). in general, buffaloes are kept by farmers in rural areas, with an average of 1 to 2 buffalo per farmer. the decline in buffalo population is due to various factors, such as limited stock of high-quality brooders, low quality feed, inbreeding, and despite jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi mailto:golden_bee46@yahoo.com https://doi.org/10.26740/jrba.v5n1.p37-42 jurnal riset biologi dan aplikasinya, 5(1): 27-36, march 2023 | 38 farmers have a lot of local wisdom on production and reproduction, they seem unable to handle large herds of buffalo. the relatively low reproduction rate may be due to more difficult detection of the estrous phase in buffaloes with a longer gestation period compared to cattle (gunawan & romjali, 2009). the decline in buffalo population is associated with an increased in the probability of negative impacts due to inbreeding. according to data from bps-statistics of east java (2018), the buffalo population in pacitan has a higher potential for inbreeding compared to the tuban population because of its smaller population. based on these problems, assessments of the buffalo genetic profile should be conducted regularly, for example by using the molecular markers of microsatellite. microsatellites or short tandem repeats (strs) are the most polymorphic dna molecular markers and have a high abundance in eukaryotic genomes. microsatellites are di-, tri-, or tetra nucleotide of dna tandem repeats presented in variable copy numbers at each locus and throughout the genome. microsatellites are one of the popular molecular markers used to estimate genetic diversity in livestock. the development of microsatellite markers in genetics and biotechnology increases opportunities for livestock selection, health improvement, and production (brenig & schütz, 2016; viryanski, 2019). one of the microsatellite markers that has been widely used in the assessment of genetic diversity in buffalo populations is the inra032 locus which is located on chromosome 11 (vaiman et al., 1994). not only in buffalo, the use of the inra032 locus in microsatellite-based genetic diversity assessments has also been applied to dairy cattle and horses (vanessa et al., 2018; sukri et al., 2022). several previous researches have used the inra032 locus in microsatellite-based genetic diversity assessment of buffaloes in indonesia, specifically in kudus (central java), east java, and west nusa tenggara populations (sukri, 2014; amin & lestari, 2014; lathifah, 2016). complementing previous studies, the investigation of the effectiveness of the inra032 locus for genetic profile assessment in this study focused on local buffalo populations in pacitan and tuban regencies, east java. materials and methods the total number of buffalo samples in this study was 16, obtained through purposive random sampling, with 8 representing the pacitan population and 8 representing the tuban population. samples were obtained from local farmers in pacitan and tuban regencies. blood samples were collected through the jugular vein on the neck of the buffalo using a venojack and preserved in edta solution and then stored in an ice box until dna isolation. furthermore, dna was isolated from blood using the standard protocols of sds/proteinase k and phenol/chloroform method (sambrook et al. 1989). the sequence of microsatellite primer pairs of inra032 locus, referring to vaiman et al. (1994) is presented in table 1. table 1. primer sequences of inra032 locus primer position primer sequences (5’-3’) annealing temperature forward aaactgtattctctaatagcac 57 °c reverse gcaagacatatctccattccttt the dna amplification process through polymerase chain reaction (pcr) was composed of a reaction mixture of 2.5 µl of dna template (10mg/µl), 12.5 µl of pcr mix (dntp, buffer, taqpolymerase, h2o), 2.5 µl of dh2o, 2.5 µl of forward primer, and 2.5 µl of reverse primer. the pcr process was done for 30 cycles with the following steps: predenaturation at 95 °c for 2 minutes, denaturation at 92 °c for 1 minute, annealing at 57°c for 1 minute, first elongation at 72 °c for 1minute, final elongation at 72 °c for 10 minutes, and the last step at a temperature ranging from 4°c. after pcr, dna separation was carried out using 10% of polyacrylamide gel electrophoresis (page), followed by silver staining and electrophoresis at 135 volts with duration of 60 minutes. electrophoresis results were documented in the form of images and analyzed manually with the help of gel analyzer software version 19.1 (www.gelanalyzer.com) by istvan lazar jr., phd, and istvan lazar sr., phd, csc, to increase the accuracy of allele observations. all alleles that appeared were recorded according to size, and then based on the allele size, allele frequency, heterozygosity, and polymorphic information content (pic), they were calculated using genpop software version 3.1 (liu et al., 2000). results and discussion the maintenance of genetic diversity is a vital and critical goal in livestock conservation programs so that livestock populations can adapt to future environmental challenges and respond to long-term selection, both natural and engineered, for certain 39| rahmawati et al., genetic profile of local buffalo (bubalus bubalis) traits of interest that are important to the economy and culture. according to putman & carbone (2014) the use of highly variable molecular genetic markers, such as microsatellite, is one of the most potential ways to assess the genetic diversity due to their high level of polymorphism, abundance, random distribution across the genome, codominant inheritance, and neutrality with respect to selection. the possibility of detecting polymorphisms is very important when choosing a molecular marker. if a molecular marker is unable to detect genetic differences that exist within a group of individuals, it is considered ineffective. a molecular marker is considered polymorphic if it has at least two alleles and the most frequent allele has a frequency of up to 99% (shete et al., 2000; serrote et al., 2020). the result of this study shows that the inra032 locus is moderately effective in detecting polymorphism between individuals in pacitan and tuban buffalo populations. allele frequency is the proportion or ratio of all gene copies that comprise a particular gene variant. in other words, allele frequency is the number of copies of a particular allele divided by the total number of copies of alleles at a locus in a population. allele frequency can be presented as a percentage (gillespie, 2004). according to the number of allele sizes at the inra032 locus in the two buffalo populations, the frequency of alleles at the inra032 locus in each population was calculated. the allele frequency of the inra032 locus in the pacitan buffalo population was between 0.18 and 0.31, while in the tuban buffalo population the allele frequency was between 0.08 and 0.33. thus, it was known that the allele frequency range of the inra032 locus in the tuban buffalo population is higher than that in the pacitan population. the results of the allele frequency analysis of the pacitan and tuban buffalo populations are presented in table 2. while allele frequencies at the inra032 locus in buffalo populations in kudus regency (central java) ranged from 0.08 to 0.591, south sumatra populations ranged from 0.06 to 0.75, tana toraja regency (south sulawesi) populations range from 0.36 to 0.64, and lombok (west nusa tenggara) populations range from 0.38 to 0.63 (lestari, 2013; afrida et al., 2014; lathifah, 2016). this indicates that the inra032 locus has variable allele frequencies, which will be important preliminary information for the detection of intrapopulation genetic diversity in buffalo. table 2. allele frequencies of inra032 locus in pacitan and tuban buffalo populations allele size (base pair) populations pacitan (%) tuban (%) 100 110 180 220 230 300 0.31 0.00 0.25 0.18 0.25 0.00 0.16 0.16 0.33 0.25 0.00 0.08 the pic value indicated that the molecular marker used was capable of detecting polymorphisms among individuals in a population, and the higher that capacity, the greater the value. pic values for co-dominant molecular markers ranged from 0 (monomorphic) to 1 (highly informative, with multiple alleles of equal frequency) (serrote et al., 2020). the pic values of the pacitan and tuban buffalo populations in this research are presented in table 3. following the criteria of botstein et al. (1980), the microsatellite marker inra032 locus observed in the study was highly informative in the tuban buffalo population (pic > 0.5) and less informative (pic < 0.25) in the pacitan population. the mean value of 0.39 for pic indicated that the inra032 locus was moderately informative (0.25 < pic < 0.5) for both populations. furthermore, higher pic values indicated the usefulness of this molecular marker in the assessment of genetic diversity in a population (machugh et al., 1997) as well as genome mapping studies (kayang et al., 2002). for comparison, the average pic value of the inra 032 locus in the buffalo population in kudus regency (central java) is 0.42, the south sumatra population is 0.41, in the tana toraja regency population (south sulawesi) is 0.35, in the lombok population (west nusa tenggara) is 0.34, and in the yogyakarta, population is 0.29 (afrida et al. 2014; limiansi, 2015; lathifah, 2016). this indicates that the inra032 locus is moderately informative for the detection of genetic diversity in buffalo populations in different regions of indonesia. nevertheless, based on the analysis, it is recommended to increase the number of samples and add other microsatellite markers to ensure the accuracy of the pic values. table 3. polymorphism information content (pic) values in pacitan and tuban buffalo populations populations average pacitan tuban 0.12 0.66 0.39 jurnal riset biologi dan aplikasinya, 5(1): 27-36, march 2023 | 40 heterozygosity is the probability of an individual being heterozygous at the location where the molecular marker is used and depends on the number of alleles and their frequency in the population. heterozygosity values range from 0 (no heterozygosity) to 1 (high number of alleles with equal frequency) (serrote et al., 2020). the calculated allele frequency values of the inra032 locus were used to calculate the expected heterozygosity values, while the observed heterozygosity values were also obtained from the observation of heterozygous individuals. the results of the calculation of heterozygosity values (observed heterozygosity and expected heterozygosity) at the inra032 locus for both populations are presented in table 4. table 4. heterozygosity of inra032 locus in pacitan and tuban buffalo populations pacitan (%) tuban (%) ho he ho he 88 15.7 50 23.4 notes: ho = observed heterozygosity, he = expected heterozygosity if observed heterozygosity (ho) is higher than expected heterozygosity (he), it indicates that there is no deviation from hardy-weinberg equilibrium and low probability of inbreeding (sharma et al. 2016). in both buffalo populations in this research, ho value was higher than he value, indicating no deviation from hardy-weinberg equilibrium and low probability of inbreeding. interestingly, the ho to he value for the pacitan buffalo population was higher than the tuban population, even though the pacitan population is much lower than tuban population. according to bps-statistics of east java (2018), from 2014 to 2017, the average number of buffaloes in pacitan was only 117, while the average number of buffaloes in tuban was 1695. based on this population size, pacitan buffalo population has higher potential for inbreeding compared to tuban population, and therefore the heterozygosity of pacitan population should be lower than tuban. in fact, tuban is geographically more accessible than pacitan, which should increase the potential for outbreeding in the tuban buffalo population, resulting in higher heterozygosity than pacitan. the results of this study are in line with the results of amin (2012), afrida et al. (2014), and lathifah (2016), which showed that the application of the inra032 locus in buffalo populations of kudus regency (central java), tana toraja regency (south sulawesi), and lombok (west nusa tenggara) also had higher ho values than he. heterozygosity results in population genetics research are an important and essential part. however, homozygosity is not expected. according to sharma et al. (2016) if homozygotes are present in a population, various factors can contribute to the occurrence of excess homozygotes. first, the observed locus is under selection. second, there may be "null alleles" that lead to incorrect observations of excess homozygotes. third, inbreeding may be common in the observed population. the likelihood of each of these explanations should be assessed from extra data, such as demographic information and population distribution. "null alleles" are unlikely to completely segregate the locus. another possibility of the high heterozygosity in the pacitan and tuban buffalo populations is the considerable knowledge of local farmers in the mating management of their buffalo herds. hale et al. (2012) suggest that to improve the accuracy of microsatellite-based genetic studies, a sample size of 25 to 30 samples per population is required. in line with this suggestion, we also recommend this sample size to improve the quality of our future studies. information on allelic variation in microsatellite dna indicating genetic diversity in buffalo is expected to be used as a reference for determining the genetic quality of buffalo through the provision of breeding stock for outbreeding programs or to reduce the effects of inbreeding, so that genetic quality can be maintained or improved (amin & lestari, 2014). the combination of the inra032 locus with other microsatellite loci will improve the quality of information on the genetic diversity of local buffalo, thereby increasing the accuracy of decision-making regarding conservation measures. in addition, based on previous studies, it was also explained that the inra032 locus is associated with reproductive characteristics (calving traits) and body conformation (hocks, rear leg set, rear view) in dairy cattle (harder et al. 2006; buitenhuis et al. 2007; vanessa et al. 2018). therefore, future research needs to investigate the relationship between the inra032 locus and other microsatellite markers to morphological characters associated with superior traits in local buffaloes in indonesia. conclusion in general, the inra032 locus is suitable for assessing the genetic profile of pacitan and tuban 41| rahmawati et al., genetic profile of local buffalo (bubalus bubalis) buffalo populations in east java. the number of alleles at the inra032 locus in the pacitan buffalo population is less than that in the tuban population. this was also the same result for the polymorphism information content (pic) value of the pacitan buffalo population, which was lower than that of the tuban population. however, the average pic value (0.39) indicated that the inra032 locus was moderately informative for the assessment of genetic diversity in both populations. the percentage heterozygosity of the pacitan population (88%) was higher than that of the tuban population (50%), even though the pacitan population is smaller than tuban population. various factors may influence the difference in heterozygosity between the two populations including artificial insemination program. future studies need to increase the number of samples and other microsatellite markers to improve the accuracy of local buffalo genetic profile information. references afrida, i. r., amin, m. & ghofur. (2014). pengembangan bahan ajar matakuliah genetika populasi berbasis penelitian keragaman genetik kerbau lokal tana toraja dan lombok. jurnal kependidikan, 13(4), 337–347. amin, a. & lestari, u. (2014). identifikasi keragaman genetik kerbau lokal populasi jawa timur dan nusa tenggara barat berbasis mikrosatelit sebagai model pengembangan konservasi kerbau secara ex situ. prosiding seminar nasional xi pendidikan biologi fkip uns, 11(1), 528–533. amin, m. (2012). genetic variation of local (bubalus bubalis) buffalo in west nusa tenggara based on microsatellite loci. proceeding of the 5th indonesian biotechnology conference: an international forum, 374–383. botstein, d., white, r. l., skolnick, m. & davis, r. w. (1980). construction of a genetic linkage map in man using restriction fragment length polymorphisms. american journal of human genetics, 32(3), 314–331. bps-statistics of east java. (2018). populasi kerbau menurut kabupaten/kota di jawa timur tahun 2009-2017, (https://jatim.bps.go.id/statictable/2018/10/18/1 298/populasi-kerbau-menurut-kabupaten-kota-dijawa-timur-2009-2017-ekor-.html, accessed on november 8, 2022. brenig, b. & schütz, e. (2016). recent development of allele frequencies and exclusion probabilities of microsatellites used for parentage control in the german holstein friesian cattle population. bmc genetics, 17(18), 1–9. https://doi.org/10.1186/s12863-016-0327-z. buitenhuis, a. j., lund, m. s., thomasen, j. r., thomsen, b., nielsen, v. h., bendixen, c. & guldbrandtsen, b. (2007). detection of quantitative trait loci affecting lameness and leg conformation traits in danish holstein cattle. journal of dairy science, 90(1), 472– 481. https://doi.org/10.3168/jds.s00220302(07)72649-8. director general of livestock and animal health. (2021). livestock and animal health statistics 2021. ministry of agricultural affairs of the republic of indonesia, jakarta. gillespie, j. h. (2004). population genetics: a concise guide (2 edition). baltimore, md.: the johns hopkins university press. gunawan & romjali, e. (2009). program pengembangan perbibitan kerbau. prosiding seminar dan lokakarya nasional kerbau, 3–10. hale, m. l., burg, t. m., & steeves, t. e. (2012). sampling for microsatellite-based population genetic studies: 25 to 30 individuals per population is enough to accurately estimate allele frequencies. plos one, 7(9), e45170. https://doi.org/10.1371/journal.pone.0045170. harder, b., bennewitz, j., reinsch, n., thaller, g., thomsen, h., kühn, c., schwerin, m., erhardt, g., förster, m., reinhardt, f. & kalm, e. (2006). mapping of quantitative trait loci for lactation persistency traits in german holstein dairy cattle. journal of animal breeding and genetics, 123(2), 89–96. https://doi.org/10.1111/j.14390388.2006.00577.x. kayang, b. b., inoue-murayama, m., hoshi, t., matsuo, k., takahashi, h., minezawa, m., mizutani, m. & ito, s. (2002). microsatellite loci in japanese quail and cross-species amplification in chicken and guinea fowl. genetics, selection, evolution, 34(2), 233–253. https://doi.org/10.1186/1297-9686-34-2-233. komariah, k., burhanuddin, b. & permatasari, n. (2019). analisis potensi dan pengembangan kerbau lumpur di kabupaten serang. jurnal ilmu produksi dan teknologi hasil peternakan, 6(3), 90–97. lathifah, a. s. (2016). identifikasi variasi genetik kerbau kudus berbasis mikrosatelit sebagai bahan ajar blended learning pada matakuliah tabm. prosiding snpbs (seminar nasional pendidikan biologi dan saintek) universitas muhammadiyah surakarta, 920–928. lestari, f. (2013). identifikasi variasi genetik kerbau (bubalus bubalis) lokal sumatera selatan berbasis mikrosatelit sebagai pengembangan media interaktif untuk pembelajaran teknik analisis biologi molekuler di universitas negeri malang. unpublished thesis. malang: state university of malang. limiansi, k. (2015). identifikasi variasi genetik kerbau (bubalus bubalis) endemik lokal sleman diy berbasis mikrosatelit untuk pengembangan modul teknik analisis biologi molekuler di universitas negeri yogyakarta. unpublished thesis. malang: state university of malang. liu, j-e, qiao, c-l & hou, x. (2000). a useful population genetics software package–genepop (version 3.1). biodiversity science, 08(2): 238–240. machugh, d. e., shriver, m. d., loftus, r. t., cunningham, p. & bradley, d. g. (1997). microsatellite dna variation and the evolution, domestication and phylogeography of taurine and zebu cattle (bos taurus and bos indicus). genetics, 146(3), 1071–1086. https://doi.org/10.1093/genetics/146.3.1071. nuraini, h., aditia, e. l. & brahmantiyo, b. (2018). meat quality of indonesian local cattle and buffalo. in s. s. o., & s. j. patil (eds.), bovine science–a key to sustainable development. intechopen. https://doi.org/10.5772/intechopen.79904. putman, a. i. & carbone, i. (2014). challenges in analysis and interpretation of microsatellite data for https://jatim.bps.go.id/statictable/2018/10/18/1298/populasi-kerbau-menurut-kabupaten-kota-di-jawa-timur-2009-2017-ekor-.html https://jatim.bps.go.id/statictable/2018/10/18/1298/populasi-kerbau-menurut-kabupaten-kota-di-jawa-timur-2009-2017-ekor-.html https://jatim.bps.go.id/statictable/2018/10/18/1298/populasi-kerbau-menurut-kabupaten-kota-di-jawa-timur-2009-2017-ekor-.html https://doi.org/10.1186/s12863-016-0327-z https://doi.org/10.3168/jds.s0022-0302(07)72649-8 https://doi.org/10.3168/jds.s0022-0302(07)72649-8 https://doi.org/10.1371/journal.pone.0045170 https://doi.org/10.1111/j.1439-0388.2006.00577.x https://doi.org/10.1111/j.1439-0388.2006.00577.x https://doi.org/10.1186/1297-9686-34-2-233 https://doi.org/10.1093/genetics/146.3.1071 https://doi.org/10.5772/intechopen.79904 jurnal riset biologi dan aplikasinya, 5(1): 27-36, march 2023 | 42 population genetic studies. ecology and evolution, 4(22), 4399–4428. https://doi.org/10.1002/ece3.1305. sambrook, j., e. f. fritsch & t. maniatis. (1989). molecular cloning: a laboratory manual. 2nd ed. plainview, n.y.: cold spring harbor laboratory press. serrote, c. m. l., reiniger, l. r. s., silva, k. b., rabaiolli, s. m. d. s. & stefanel, c. m. (2020). determining the polymorphism information content of a molecular marker. gene, 726(144175), 1–15. https://doi.org/10.1016/j.gene.2019.144175. sharma, r., kumar, b., arora, r., ahlawat, s., mishra, a. k. & tantia, m. s. (2016). genetic diversity estimates point to immediate efforts for conserving the endangered tibetan sheep of india. meta gene, 8, 14–20. http://dx.doi.org/10.1016/j.mgene.2016.01.002. shete, s., tiwari, h. & elston, r. c. (2000). on estimating the heterozygosity and polymorphism information content value. theoretical population biology, 57(3), 265–271. https://doi.org/10.1006/tpbi.2000.1452. sukri, a. (2014). analisis filogenetik kerbau lokal lombok tengah (bubalus bubalis) berdasarkan penanda dna mikrosatelit. jurnal florea, 1(2), 52–55. http://doi.org/10.25273/florea.v1i2.392. sukri, a., dewi, i. n., primawati, s. b., wangiyana, i. g. a. s, muttaqin, z. & winaya, a. (2022). revealing the genetic diversity of sumbawa endemic horse using microsatellite-based dna fingerprint. biodiversitas, 23(8), 4153–4159. https://doi.org/10.13057/biodiv/d230837. vaiman, d., mercier, d., moazami-goudarzi, k., eggen, a., ciampolini, r., lépingle, a., velmala, r., kaukinen, j., varvio, s. l. & martin, p. (1994). a set of 99 cattle microsatellites: characterization, synteny mapping, and polymorphism. mammalian genome, 5(5), 288–297. https://doi.org/10.1007/bf00389543. vanessa, r, prastowo, s, nugroho, t, widyas, n, susilowati, a. & sutarno. (2018). microsatellite selection candidate associated with reproduction trait in indonesian friesian holstein using published studies. aip conference proceedings 2014, 020055-1–02055-2. https://doi.org/10.1063/1.5054459. viryanski, d. (2019). microsatellite markers–a tool for molecular characterization of cattle genetic resources. bulgarian journal of agricultural science, 25(1), 158–165. https://doi.org/10.1002/ece3.1305 https://doi.org/10.1016/j.gene.2019.144175 http://dx.doi.org/10.1016/j.mgene.2016.01.002 https://doi.org/10.1006/tpbi.2000.1452 http://doi.org/10.25273/florea.v1i2.392 https://doi.org/10.13057/biodiv/d230837 https://doi.org/10.1007/bf00389543 https://doi.org/10.1063/1.5054459 jurnal riset biologi dan aplikasinya, 1 (1): 1-8, maret 2019 | 1 jurnal riset biologi dan aplikasinya, volume 1, nomer 1, maret 2019 pemberian pakan komersial dengan penambahan em4 (effective microorganisme 4) untuk meningkatkan laju pertumbuhan lele (clarias sp.) the administration of commercial feed with addition of em4 (effective microorganism 4) to increase catfish (clarias sp.) growth rate moh. yunus anis, dyah hariani* jurusan biologi, fakultas matematika dan ilmu pengetahuan alam, universitas negeri surabaya abstrak ikan lele (clarias sp.) merupakan salah satu komoditas perikanan air tawar yang banyak diminati di indonesia dan produksinya setiap tahun meningkat. oleh karena itu, produksi ikan lele perlu ditingkatkan. upaya yang dilakukan untuk meningkatkan produksi ikan lele yaitu melalui pemberian em4 (effective microorganism 4) pada pakan. em4 yang digunakan berisi lactobacillus casei dan saccharomyces cerevisiae. em4 dikultur dalam media yang dibuat dari molase, bekatul, susu sapi, buah nanas, kunyit putih, temulawak, jahe merah dan air kelapa. em4 hasil kultur dalam media disebut sebagai fermentor. penelitian ini bertujuan untuk menguji pengaruh pemberian em4 hasil kultur dalam media yang berbeda pada pakan terhadap laju pertumbuhan spesifik/spesific growth rate (sgr), rasio konversi pakan/feed conversion ratio (fcr) dan tingkat kelangsungan hidup/survival rate (sr) benih ikan lele. penelitian ini menggunakan rancangan acak lengkap (ral). perlakuan terdiri atas a (pakan komersial), b (pakan+10% em4), c (pakan+10% fermentor 1), d (pakan+10% fermentor 2) dan e (pakan+10% fermentor 3), setiap perlakuan diulang sebanyak empat kali. pakan difermentasi selama 1-3 hari sebelum pakan diberikan kepada benih ikan lele ukuran panjang 7-9 cm. data dianalisis menggunakan anava. hasil penelitian menunjukkan bahwa pemberian em4 hasil kultur dalam media yang berbeda pada pakan berpengaruh secara signifikan terhadap sgr, fcr dan sr benih ikan lele (p<0,05). perlakuan terbaik diperoleh pada perlakuan e (pakan+10% fermentor 3) dengan nilai sgr sebesar 5,91±0,04%, fcr sebesar 0,88±0,045 dan sr sebesar 73,50±1,91%. abstract catfish (clarias sp.) is one of the most popular freshwater fishery commodities in indonesia and the production increases in every year. therefore, the production of catfish needs to be improved. the efforts to increase the production of catfish was through the provision of em4 (effective microorganism 4) on the feed. the em4 used contains lactobacillus casei and saccharomyces cerevisiae. em4 was cultured in a medium made from molasses, rice bran, cow's milk, pineapple, white turmeric, temulawak, red ginger and coconut water. em4 culture resulted in a medium referred to as a fermentor. this research aimed to test the effect of em4 culture in different media on feed of specific growth rate (sgr), feed conversion ratio (fcr) and survival rate (sr) of catfish. this study used completely randomized design (ral). the treatments consisted of a (commercial feed), b (feed+10% em4), c (feed+10% fermentor 1), d (feed+10% fermentor 2) and e (feed+10% fermentor 3), each treatment repeated four times. the feed was fermented for 1-3 days, before given to catfish seed size length 7-9 cm. data were analyzed using anova. the results showed that em4 culture in different media on feed had significant effect on sgr, fcr and sr catfish seedlings (p <0.05). the best treatment was obtained at treatment e (feed+10% fermentor 3) with sgr value of 5.91 ± 0.04%, fcr of 0.88 ± 0.045 and sr at 73.50 ± 1.91%. how to cite: anis, m.h & hariani, d. (2019). pemberian pakan komersial dengan penambahan em4 (effective microorganisme 4) untuk meningkatkan laju pertumbuhan lele (clarias sp.). jurnal riset biologi dan aplikasinya. 1 (1): 1-8. * correspondence author: jalan ketintang gedung c3 lantai 2 surabaya 60231, indonesia e-issn: 2655-9927 e-mail: dyahhariani@unesa.ac.id jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi history article received: 26 juli 2018 approved: 2 januari 2019 published: maret 2019 kata kunci: ikan lele; em4; sgr; fcr; sr key words: catfish; em4; sgr; fcr; sr mailto:dyahhariani@unesa.ac.id mailto:dyahhariani@unesa.ac.id 2 | anis dkk; pemberian pakan komersial dengan penambahan em4 pendahuluan ikan lele (clarias sp.) merupakan salah satu komoditas perikanan air tawar yang unggul di pasaran selain mujair, patin, nila dan gurami (lingga dan kurniawan, 2013). ikan lele memiliki keunggulan dibandingkan dengan jenis ikan lain yaitu pertumbuhannya tergolong cepat, toleran terhadap kualitas air yang kurang baik, relatif tahan terhadap penyakit dan dapat dipelihara hampir di semua wadah budi daya (nasrudin, 2010). kebutuhan masyarakat terhadap konsumsi ikan lele setiap tahun semakin meningkat. agar dapat memenuhi kebutuhan ikan lele nasional, peningkatan produksi ikan lele selalu dilakukan setiap tahun. tahun 2014 peningkatan produksi ikan lele nasional yaitu sebesar 613.000 ton, tahun 2015 sebesar 1.058.400 ton dan tahun 2016 sebesar 1.217.100 ton (direktorat jenderal perikanan budi daya, 2016). salah satu faktor penting dalam upaya peningkatan produksi ikan lele adalah pakan. pakan memegang peranan penting dalam kegiatan budi daya ikan lele mulai dari pembenihan, pembesaran hingga ikan siap dipanen. kebutuhan biaya untuk pakan selama budi daya ikan sekitar 6070% dari total biaya operasional budi daya (hadadi dkk., 2009). umumnya, pembudi daya ikan lele mengandalkan pakan pabrik berupa pelet yang dijual di pasaran. pelet digunakan untuk pakan ikan dengan kandungan protein sebagai nutrien utama (harsono, 2009). protein merupakan nutrien yang sangat dibutuhkan oleh ikan untuk proses pertumbuhan terutama saat ikan pada usia benih (hariani dan purnomo, 2017). pakan dinilai berkualitas baik tidak hanya ditinjau dari jumlah nutrien sebagai penyusun pakan, juga perlu diperhatikan seberapa banyak nutrien terkandung dalam pakan yang dapat diserap dan dimanfaatkan oleh ikan untuk kebutuhannya (megawati dkk., 2012). pakan berkualitas baik dapat meningkatkan pertumbuhan dan kelangsungan hidup ikan selama budi daya sehingga produksi ikan juga menjadi lebih baik. salah satu alternatif yang dapat dilakukan untuk meningkatkan kualitas pakan yaitu dengan menggunakan probiotik (arief dkk., 2014). pemberian probiotik pada pakan dapat dilakukan dengan cara disemprotkan agar terjadi fermentasi pada pakan (kompiang, 2009). probiotik akan mensekresikan beberapa enzim eksogenous seperti protease, amilase, lipase, selulase untuk mendegradasi nutrien kompleks penyusun pakan berupa protein, karbohidrat dan lemak menjadi komponen yang lebih sederhana dalam bentuk asam amino, monosakarida, asam lemak dan gliserol. hal ini akan meningkatkan laju penyerapan nutrien pakan oleh ikan dalam saluran pencernaannya sehingga laju pertumbuhan ikan juga meningkat (putra, 2010). saat ini, banyak jenis probiotik komersial yang digunakan khusus untuk perikanan yang telah diperdagangkan, salah satunya yaitu em4 (effective microorganism 4). em4 mengandung kultur campuran dari mikroorganisme yang bersifat fermentasi yaitu bakteri asam laktat (lactobacillus casei) dan yeast (saccharomyces cerevisiae) (ardita dkk., 2015). kultur mikroorganisme em4 bekerja dalam tubuh ikan melalui aksi yang sinergis (rachmawati dkk., 2006). penggunaan em4 pada budi daya ikan lele dapat diperbanyak (kultur) secara mandiri menggunakan media kultur yang dibuat dari bahanbahan organik seperti molase, bekatul, susu sapi, buah nanas (hariani dan purnomo, 2017), dan air kelapa (yanuar dan sutrisno, 2015). bahan-bahan tersebut kaya akan nutrisi sumber karbon dan nitrogen yang dibutuhkan oleh mikroorganisme dalam em4 untuk mendukung pertumbuhannya (sartika, 2012). selain itu, ke dalam media kultur em4 dapat ditambahkan bahan-bahan hayati seperti rempah-rempah, antara lain: kunyit putih, temulawak dan jahe merah. penggunaan rempahrempah tersebut mengacu kepada unit pengelola budi daya air tawar (upbat) kepanjen. upbat kepanjen beroperasi di bawah naungan dirjen perikanan dan kelautan provinsi jawa timur dan telah menerapkan probiotik dengan penambahan rempah-rempah sejak tahun 2010 dan telah diujicobakan di berbagai tempat (hariani dan purnomo, 2017). rempah-rempah banyak mengandung senyawa bioaktif yang dapat meningkatkan imunitas dan nafsu makan ikan lele (destiawan dkk., 2015). alasan inilah yang menjadi latar belakang penelitian pemberian em4 hasil kultur dalam media yang berbeda pada pakan untuk budi daya ikan lele. penelitian ini merupakan penelitian pengembangan penggunaan em4 hasil kultur dalam media kultur yang dibuat menggunakan molase, bekatul, susu sapi, buah nanas dan rempah-rempah, juga pengembangannya dengan penambahan air kelapa. tujuan penelitian ini yaitu menguji pengaruh em4 hasil kultur dalam media yang berbeda pada pakan terhadap laju pertumbuhan spesifik/spesific growth rate (sgr), rasio konversi pakan/feed conversion ratio (fcr) dan tingkat kelangsungan hidup/survival rate (sr) ikan lele. jurnal riset biologi dan aplikasinya, 1 (1): 1-8, maret 2019 | 3 bahan dan metode jenis penelitian ini adalah eksperimental dengan menggunakan rancangan acak lengkap (ral) yang terdiri atas lima perlakuan dan empat ulangan. faktor yang dimanipulasi berupa em4 hasil kultur dalam media yang berbeda. kultur em4 ini disebut sebagai fermentor yang digunakan untuk memfermentasi pakan dan memelihara kualitas air pada kolam penelitian. perlakuan yang diberikan pada benih ikan lele antara lain a (pakan komersial), b (pakan komersial+10% em4), c (pakan komersial+10% fermentor 1), d (pakan komersial+10% fermentor 2) dan e (pakan komersial+10% fermentor 3). bahan-bahan yang digunakan dalam penelitian antara lain em4, molase, bekatul, susu sapi, buah nanas, air kelapa, kunyit putih, temulawak, jahe merah, air, kaporit, pelet ikan jenis hi-pro-vite ff 999 dengan kandungan protein sebesar 35% dan benih ikan lele ukuran panjang 7-9 cm sebanyak 1000 ekor. alat-alat yang digunakan antara lain pisau, blender, saringan, pengaduk, gelas ukur, kompor, panci, aerator, selang, termometer, do meter, ph meter, timbangan digital, jerigen plastik ukuran 20 liter dan 35 liter. prosedur penelitian ini meliputi pembuatan fermentor, persiapan pemeliharaan, pemeliharaan dan pengamatan benih ikan lele serta pengukuran kualitas air kolam penelitian. formula fermentor yang dibuat mengacu kepada formula probiotik yang dikembangkan oleh unit pengelola budi daya air tawar (upbat) kepanjen. pembuatan fermentor dilakukan berdasarkan formula media kultur em4 antara lain: fermentor 1, fermentor 2 dan fermentor 3. fermentor 1 dibuat dari 400 ml em4, 2 liter molase, 1 liter susu sapi, 600 gram buah nanas, 400 gram bekatul dan 1 liter air. buah nanas dicuci bersih, dipotong kecil-kecil kemudian diblender. buah nanas, susu sapi dan bekatul dituang ke dalam panci kemudian dipanaskan sampai suhu 60°c. molase ditambahkan air, dipanaskan sampai suhu mencapai 100°c. setelah itu, dalam keadaan panas bahan-bahan tersebut dimasukkan ke dalam jerigen ukuran 20 liter dan ditambah air mendidih sampai 5/6 jerigen, kemudian jerigen ditutup. didinginkan selama 24 jam, selanjutnya ditambah em4, ditutup kembali kemudian difermentasi selama 1 bulan. fermentor 2 dibuat menggunakan komposisi bahan dan cara pembuatan yang sama dengan fermentor 1 yang kemudian ditambahkan 1 liter air kelapa yang dipanaskan sampai suhu 60°c. fermentor 3 dibuat menggunaan komposisi bahan dan cara pembuatan yang sama dengan fermentor 2 yang kemudian ditambahkan rempah-rempah yaitu kunyit putih, temulawak dan jahe merah. rempah-rempah tersebut dicuci bersih dan timbang masing-masing sebanyak 1 kg, diiris tipis-tipis kemudian dihaluskan menggunakan blender, dituang ke dalam panci dan dipanaskan sampai suhu 100°c. persiapan kolam pemeliharaan, jerigen plastik ukuran 35 liter sebanyak 20 unit dimodifikasi dan dicuci bersih, kemudian diisi air sampai 30 liter dan diberi kaporit 10 ppm untuk disterilkan, kemudian didiamkan selama tujuh hari. setelah tujuh hari, ditambah fermentor 3 sebanyak 30 ml dan dilengkapi aerasi, didiamkan selama tujuh hari. benih ikan lele yang digunakan berukuran panjang 7-9 cm. benih ikan diaklimatisasi dalam kolam buatan selama tujuh hari, setiap kolam diisi 60 ekor dan diberi pakan tanpa probiotik. setelah aklimatisasi, benih ikan diseleksi untuk dipilih yang tidak cacat, sehat dan berukuran seragam. benih ikan lele dipelihara selama 42 hari. pemberian pakan perlakuan dilakukan sebanyak tiga kali sehari pada pukul 08.00, 16.00 dan 21.00 wib dengan feeding rate sebesar 5% dari berat tubuh benih ikan. pengukuran berat benih ikan dilakukan setelah benih ikan dipuasakan selama 24 jam, yaitu secara sampling mengambil sebanyak 20 ekor setiap 7 hari sekali. pengukuran berat sampel tersebut digunakan untuk mengetahui pertumbuhan dan kebutuhan pakan benih ikan lele. pergantian air dilakukan setiap tiga hari sekali dengan mengambil air sebanyak 50% dari total keseluruhan volume air dan menambahkan fermentor 3 sebanyak 30 ml. parameter yang diamati dalam penelitian ini antara lain laju pertumbuhan spesifik/spesific growth rate (sgr), rasio konversi pakan/feed conversion ratio (fcr) dan tingkat kelangsungan hidup/survival rate (sr). sgr dapat dilihat dari pertambahan berat benih ikan yang diukur setiap 7 hari sekali selama 42 hari. cara yang dilakukan yaitu dengan mengambil secara sampling 20 benih ikan dari setiap kolam perlakuan untuk dilakukan penimbangan berat menggunakan timbangan digital. menurut amisah dkk. (2009), untuk menghitung sgr benih ikan digunakan persamaan 1. sgr = ⌊√ wt wo − 1 t ⌋x 100% keterangan: sgr : laju pertumbuhan spesifik wt : bobot rata-rata ikan akhir (g) w0 : bobot rata-rata ikan awal (g) t : lama pemeliharaan (hari) (amisah dkk., 2009) (1) 4 | anis dkk; pemberian pakan komersial dengan penambahan em4 rasio konversi pakan diketahui dengan cara menimbang total biomassa benih ikan lele pada hari ke-0 dan total biomassa benih ikan lele pada akhir penelitian serta menimbang jumlah pakan setiap hari/perlakuan dan mengakumulasikan jumlah pakan yang diberikan selama penelitian. fcr dapat dihitung menggunakan persamaan 2. pengukuran kualitas air kolam penelitian meliputi suhu, ph dan do (dissolved oxygen) yang dilakukan setiap 7 hari sekali pada pukul 08.00, 13.00 dan 20.00 wib. data yang diperoleh dianalisis menggunakan anava dan dilanjutkan dengan uji duncan’s multiple rank test (kusriningrum, 2008). uji duncan dilakukan untuk mengetahui perbedaan pengaruh setiap perlakuan sehingga diketahui perlakuan yang terbaik. hasil dan pembahasan hasil penelitian pemberian em4 hasil kultur dalam media yang berbeda pada pakan untuk budi daya ikan lele selama 42 hari menunjukkan bahwa perlakuan e (pakan+10% fermentor 3) memperoleh nilai sgr dan sr tertinggi dengan fcr terendah yaitu berturut-turut sebesar 91±0,04%, 73,50±1,91%, 0,88±0,04%. nilai fcr rendah yang dihasilkan oleh pakan e memiliki efisiensi pakan yang tinggi, sedangkan nilai fcr yang tinggi menunjukkan efisiensi pakan yang rendah, dalam hal ini dihasilkan pada perlakuan pakan a (pakan komersial) yaitu sebesar 0,99±0,01%. pakan a juga menghasilkan sgr dan sr terendah, yaitu sgr sebesar 5,74±0,04%, sr sebesar 62,00±3,26% (tabel 1). berdasarkan hasil uji anava, pemberian em4 hasil kultur dalam media yang berbeda pada pakan berpengaruh secara signifikan terhadap sgr, fcr dan sr benih ikan lele (p<0,05). untuk mengetahui perlakuan yang menghasilkan pengaruh terbaik diuji menggunakan duncan. hasil uji duncan menunjukkan bahwa perlakuan e menghasilkan pengaruh terbaik terhadap sgr, fcr dan sr benih ikan lele dibandingkan perlakuan d, c, b dan a. laju pertumbuhan spesifik/spesific growth rate (sgr) benih ikan lele yang diamati setiap 7 hari sekali selama 42 hari penelitian menunjukkan bahwa perlakuan e (pakan komersial+10% fermentor 3) merupakan perlakuan terbaik dengan perolehan sgr tertinggi yaitu sebesar 5,91±0,04%, sedangkan sgr terendah diperoleh pada perlakuan a (pakan komersial) yaitu sebesar 5,74±0,04%. hasil uji anava menunjukkan bahwa pemberian fermentor pada pakan berpengaruh secara signifikan terhadap laju pertumbuhan spesifik benih ikan lele (p<0,05). berdasarkan uji duncan menunjukkan bahwa perlakuan e menghasilkan sgr terbaik dibandingkan perlakuan d, c, b dan a. penambahan fermentor ke dalam pakan memberikan respon pertumbuhan lebih baik dibandingkan pakan tanpa penambahan fermentor. fermentor mengandung kultur campuran dari mikroorganisme em4 yang bersifat fermentasi yaitu lactobacillus casei dan saccharomyces cerevisiae. fermentor dalam pakan akan mensekresikan enzim eksogenous seperti amilase, lipase, amilase dan selulase. enzim-enzim tersebut akan mendegradasi nutrien kompleks penyusun pakan menjadi lebih sederhana walaupun prosesnya belum sempurna. proses fermentasi pakan selanjutnya akan disempurnakan di dalam saluran pencernaan ikan dengan bantuan asam lambung, enzim endogenous dan enzim eksogenous dari fermentor yang masih tersisa di dalam pakan, sehingga pakan lebih mudah dicerna dan diabsorpsi oleh usus halus ikan. selanjutnya, nutrien pakan seperti asam amino akan disintesis menjadi protein tubuh ikan. akumulasi protein di dalam tubuh ini diekspresikan ke dalam bertambah beratnya tubuh ikan yang menandakan terjadinya pertumbuhan. hal ini didukung oleh arief dkk. (2014), yang mengemukakan bahwa mikroorganisme probiotik dapat membantu meningkatkan kualitas pakan melalui serangkaian mekanisme enzimatis dan mempercepat laju pertumbuhan yang ditandai dengan penambahan berat tubuh ikan lele. fermentor pada perlakuan e merupakan em4 yang dikultur dalam media yang terdiri atas molase, bekatul, susu sapi, buah nanas, air kelapa dan rempah-rempah seperti kunyit putih, temulawak dan jahe merah. ketersediaan nutrisi yang lengkap dalam media kultur akan meningkatkan pertumbuhan mikroorganisme probiotik dan memperbanyak enzim pencernaan yang dihasilkan sehingga proses degradasi nutrien pakan dapat menjadi lebih cepat. hal ini dibuktikan oleh benih ikan lele yang diberi pakan e menunjukkan sgr tertinggi dibandingkan perlakuan lainnya. rempah-rempah mengandung senyawa bioaktif yang berperan sebagai antioksidan yang dapat meningkatkan daya tahan tubuh dan fcr = f bt − bo keterangan: fcr : rasio konversi pakan f : total konsumsi pakan bt : biomassa ikan akhir (g) b0 : biomassa ikan awal (g) (amisah dkk., 2009) (2) jurnal riset biologi dan aplikasinya, 1 (1): 1-8, maret 2019 | 5 nafsu makan ikan lele. senyawa tersebut diantaranya kurkumin, oleoresin, flavonoid, terpenoid dan minyak atsiri. natsir dkk. (2016) mengemukakan bahwa rempah-rempah dapat menyebabkan peningkatan jumlah dan panjang mukosa vili usus halus sehingga dapat meningkatkan penyerapan nutien pakan. tabel 1. pengaruh pemberian em4 hasil kultur dalam media yang berbeda pada pakan terhadap sgr, fcr dan sr benih ikan lele selama penelitian pakan hasil/data yang diperoleh (%) sgr±sd fcr±sd sr±sd a 5,74±0,04 a 0,99±0,01 a 62,00±3,26 a b 5,79±0,03 ab 0,97±0,01 ab 66,50±1,91 b c 5,82±0,05 b 0,92±0,05 bc 67,50±1,91 b d 5,84±0,02 b 0,91±0,07 bc 69,50±2,51 b e 5,91±0,04 c 0,88±0,04 c 73,50±1,91 c keterangan: angka yang didampingi oleh huruf subskrip berbeda dalam kolom yang sama menunjukkan adanya perbedaan yang signifikan (p < 0,05). pemberian kode huruf diurutkan dari nilai yang paling tinggi (simbol “c”). sgr : spesific growth rate (laju pertumbuhan spesifik) fcr : feed conversion ratio (rasio konversi pakan) sr : survival rate (tingkat kelangsungan hidup) sd : standar deviasi perlakuan b menunjukkan respons sgr benih ikan lele lebih rendah dibandingkan perlakuan e, d dan c (perlakuan fermentor) yaitu sebesar 5,79±0,03%. perlakuan b merupakan perlakuan pakan dengan penambahan em4 yang tidak melalui proses kulturisasi dalam media. perbedaan respons sgr benih ikan lele pada perlakuan b dan perlakuan fermentor diduga berkaitan dengan jumlah mikroorganisme probiotik dan banyaknya enzim pencernaan yang dihasilkan. hariani dan purnomo (2017) mengemukakan bahwa semakin banyak mikroorganisme probiotik maka semakin banyak juga enzim pencernaan yang dihasilkan, sehingga proses degradasi pakan selama fermentasi dapat menjadi lebih cepat, dengan demikian meningkatkan nutrien yang siap digunakan oleh ikan untuk proses pertumbuhan. pakan yang dikonsumsi oleh ikan berupa protein, lemak dan karbohidrat akan dicerna di sepanjang saluran pencernaan ikan. enzim-enzim pencernaan akan mendegradasi nutrien kompleks penyusun pakan menjadi lebih sederhana. protease mendegradasi protein menjadi asam amino, lipase mendegradasi lemak menjadi asam lemak dan gliserol, amilase bersama selulase mendegradasi karbohidrat menjadi glukosa. selanjutnya nutrien yang sederhana ini akan diserap oleh vili-vili usus halus dan diedarkan ke dalam sel melalui sistem sirkulasi. saputra (2014) mengemukakan bahwa asam amino di dalam sel akan disintesis menjadi protein tubuh. akumulasi dari protein tubuh ini diekspresikan dalam bentuk bertambah beratnya tubuh ikan yang menunjukkan terjadinya pertumbuhan. rasio konversi pakan/feed conversion ratio (fcr) digunakan untuk mengetahui tingkat efisiensi pakan yang digunakan pada masing-masing perlakuan. pakan yang memiliki nilai fcr terendah adalah pakan terbaik yang menunjukkan efisiensi pakan tertinggi. hasil penelitian menunjukkan bahwa perlakuan e (pakan komersial+10% fermentor 3) merupakan perlakuan terbaik dengan perolehan fcr terendah (efisiensi pakan tertinggi) yaitu sebesar 0,88±0,04%, sedangkan fcr tertinggi (efisiensi pakan terendah) diperoleh pada perlakuan a (pakan komersial) yaitu sebesar 0,99±0,01%. hasil uji anava menunjukkan bahwa pemberian fermentor pada pakan berpengaruh secara signifikan terhadap rasio konversi pakan benih ikan lele (p<0,05). berdasarkan uji duncan menunjukkan bahwa perlakuan e menghasilkan fcr terbaik dibandingkan perlakuan d, c, b dan a. rasio konversi pakan merupakan perbandingan antara jumlah pakan yang diberikan dengan jumlah berat benih ikan yang dihasilkan. pemberian pakan dalam jumlah minimal namun mampu memberikan respon pertumbuhan benih ikan secara maksimal merupakan indikasi bahwa pakan tersebut memiliki kualitas yang baik. arief dkk. (2014) mengemukakan bahwa kualitas pakan yang baik dipengaruhi oleh beberapa faktor antara lain komposisi nutrien sebagai penyusun pakan, kemampuan ikan dalam mencerna dan menyerap nutrien pakan serta keberadaan mikroorganisme probiotik untuk 6 | anis dkk; pemberian pakan komersial dengan penambahan em4 membantu proses pencernaan nutrien pakan dalam saluran pencernaan benih ikan. pakan yang diberikan kepada ikan lele merupakan pakan yang difermentasi selama 1-3 hari. proses fermentasi bertujuan agar proses degradasi nutrien pakan sudah terjadi sebelum pakan dikonsumsi oleh ikan sehingga nutrien pakan tersebut akan mudah dicerna dan diserap di dalam saluran pencernaan ikan. ali dan jauncey (2004) mengemukakan bahwa fermentasi pakan akibat pemberian probiotik dapat menyebabkan perubahan yang menguntungkan seperti perbaikan bahan pakan dari segi mutu baik aspek gizi maupun daya cerna. fermentor 3 (perlakuan e) merupakan hasil kultur em4 dalam media yang dibuat dari molase, bekatul, susu sapi, buah nanas, air kelapa, kunyit putih, temulawak dan jahe merah. ketersediaan nutrisi yang lengkap dalam media kultur ini akan meningkatkan proses pertumbuhan mikroorganisme dalam em4 dan memperbanyak enzim untuk mendegradasi nutrien kompleks dalam pakan, sehingga pakan tersebut mengandung nutriennutrien sederhana yang siap diserap oleh benih ikan lele di dalam saluran pencernaannya. selain itu, adanya enzim bromealin yang berasal dari buah nanas dapat membantu mendegradasi protein pakan menjadi asam amino yang dibutuhkan benih ikan untuk pertumbuhan. dengan demikian, proses fermentasi pakan oleh fermentor ini dapat meningkatkan efisiensi pakan yang diberikan kepada benih ikan lele. data tingkat kelangsungan hidup/survival rate (sr) benih ikan lele yang diperoleh selama penelitian menunjukkan bahwa perlakuan e (pakan komersial+10% fermentor 3) merupakan perlakuan terbaik dengan perolehan sr tertinggi yaitu sebesar 73,50±1,91%, sedangkan sr terendah diperoleh pada perlakuan a (pakan komersial) yaitu sebesar 62,00±3,26%. hasil uji anava menunjukkan bahwa pemberian fermentor pada pakan berpengaruh secara signifikan terhadap tingkat kelangsungan hidup benih ikan lele (p<0,05). berdasarkan uji duncan menunjukkan bahwa perlakuan e menghasilkan sr terbaik dibandingkan perlakuan d, c, b dan a. penambahan fermentor ke dalam pakan terbukti dapat meningkatkan kelangsungan hidup ikan lele. hal ini diduga fermentor mampu mempertahankan kesehatan ikan sehingga perlakuan pakan dengan penambahan fermentor memberikan hasil lebih baik. fermentor diduga dapat mempertahankan kesehatan ikan lele dengan cara menghasilkan senyawa antimikrooganisme patogen seperti asam laktat, bakteriosin dan renterin yang dapat menghambat pertumbuhan mikroorganisme patogen dalam pakan, media pemeliharaan, juga di dalam saluran pencernaan ikan. selain itu, senyawa tersebut efeknya bersifat menstimulasi imunitas tubuh ikan melalui peningkan antibodi atau aktivitas makrofag. crab dkk. (2010) mengemukakan bahwa probiotik menghasilkan senyawa acyl homoserin lactonase yang dapat mencegah quorum sensing mikroorganisme patogen. quorum sensing merupakan kemampuan mikroganisme patogen untuk berkomunikasi antar sel yang memungkinkan mikrooganisme patogen tersebut untuk berbagi informasi tentang kepadatan sel dan menyesuaikan ekspresi gen. fermentor pada perlakuan e berasal dari media yang mengandung nutrisi kompleks, juga mengandung senyawa bioaktif yang berasal dari rempah-rempah. ketersediaan nutrisi yang kompleks ini menyebabkan pertumbuhan mikroorganisme dalam em4 meningkat dan diiringi dengan peningkatan jumlah asam laktat yang dihasilkan. asam laktat berguna untuk menghambat pertumbuhan mikroorganisme patogen. senyawa bioaktif dari rempah-rempah bermanfaat untuk meningkatkan imunitas tubuh ikan dari penyakit, sehingga ikan lele dapat bertahan hidup sampai penelitian ini berakhir. pemberian fermentor juga dilakukan ke dalam kolam pemeliharaan ikan lele. fermentor dalam kolam akan mendegradasi sisa pakan dan metabolisme ikan berupa amonia. proses degradasi amonia oleh fermentor ini menyebabkan senyawa racun dapat dinetralisasi. selain itu, adanya bioflok dalam kolam pemeliharaan diduga dapat memotong rantai penyakit sehingga penyakit tersebut tidak sampai menyerang ikan. degradasi limbah organik dalam kolam juga menyumbang nutrisi untuk pertumbuhan fitoplankton dan zooplankton. beauty dkk. (2012) mengemukakan bahwa fitoplankton dapat memproduksi oksigen dalam perairan sehingga kualitas perairan menjadi lebih baik untuk kelangsungan hidup benih ikan. faktor lain yang mempengaruhi tingkat kelangsungan hidup ikan lele adalah kualitas perairan di antaranya meliputi ph, suhu dan ketersediaan oksigen (do). perairan ideal untuk mendukung kelangsungan hidup ikan lele yaitu perairan dengan ph berkisar 6,5-8,5, suhu berkisar 25-32°c dan do > 3 mg/l (cahyo, 2009). berdasarkan hasil pengukuran kualitas air kolam penelitian menunjukkan bahwa kolam memiliki kualitas yang ideal untuk mendukung kelangsungan jurnal riset biologi dan aplikasinya, 1 (1): 1-8, maret 2019 | 7 hidup ikan lele yaitu suhu sebesar 27-32°c, do sebesar 3,2-7,9 mg/l. namun, hasil pengukuran ph kolam menunjukkan nilai ph yang fluktuatif dan cenderung bersifat basa di atas batas ideal untuk kelangsungan hidup ikan lele dengan rentang nilai ph 7,9-8,9. kondisi ph yang terlalu tinggi menyebabkan sebagian besar kematian benih ikan terjadi pada awal pemeliharaan akibat ikan mengalami stres lingkungan, yaitu pada minggu ke-1 dan minggu ke2 dengan persentase kematian ikan berkisar 11,515,5%, sedangkan pada minggu berikutnya persentase kematian ikan berkisar 2-2,5%. medinawati dkk. (2011) mengemukakan bahwa pada budi daya ikan lele ukuran panjang <10 cm, kematian ikan sering terjadi pada minggu pertama dan kedua pemeliharaan yang disebabkan ikan mengalami stres pada perubahan kondisi lingkungan. kematian benih ikan lele dalam penelitian diduga juga disebabkan proses pergantian air kolam pemeliharaan yaitu sebanyak 50% yang dilakukan setiap tiga hari sekali. pergantian air kolam menyebabkan penurunan komunitas mikroorganisme perairan yang menguntungan seperti mikroorganisme dalam em4, sehingga degradasi sisa metabolisme ikan dan sisa pakan yang tidak termakan pada hari ke-4 hingga hari ke-7 berlangsung kurang optimal. simpulan berdasarkan penelitian yang telah dilakukan, dapat diambil simpulan bahwa pemberian em4 (effective microorganism 4) hasil kultur dari media yang berbeda pada pakan berpengaruh secara signifikan terhadap laju pertumbuhan spesifik/spesific growth rate (sgr), rasio konversi pakan/feed conversion ratio (fcr) dan tingkat kelangsungan hidup/survival rate (sr) benih ikan lele. perlakuan e merupakan perlakuan pakan dengan penambahan fermentor 3 memberikan respon sgr, fcr dan sr terbaik dengan nilai yang diperoleh berturut-turut yaitu sebesar 5,91±0,04%, 0,88±0,04% dan 73,50+1,91%. daftar pustaka ali, m. z dan jauncey, k. (2004). effect of feeding regime and dietary protein on growth and body composition in clarias gariepinus (burchell, 1822). indian of fisheries. 51 (4) : 407-416. amisah, s., oteng, m. a., ofori j.k. (2009). growth performance of the african catfish, clarias gariepinus, fed varying inclusion levels of leucaena leucocephala leaf meal. applied science environment. 13 (1): 21-26. aquarista, iskandar, f, subhan, v. (2012). pemberian probiotik dengan carier zeolit pada pembesaran ikan lele dumbo (clarias gariepinus). perikanan dan kelautan. 3 (4) : 133-140. ardita, n., budiharjo, a., & sari s, l, a. (2015). pertumbuhan dan rasio konversi pakan ikan nila (oreochromis niloticus) dengan penambahan probiotik. bioteknologi. 12 (1): 16-21. arief, m., faradiba, d., & al-arief, m.a. (2015). pengaruh pemberian probiotik plus herbal pada pakan komersil terhadap retensi protein dan retensi lemak ikan nila merah (oreochromis niloticus). perikanan dan kelautan. 7 (2): 207-212. arief, m., fitriani, n., & subekti, s. (2014). pengaruh pemberian probiotik berbeda pada pakan komersial terhadap pertumbuhan dan efisiensi pakan ikan lele sangkuriang (clarias sp.). perikanan dan kelautan. 6 (1): 49-53. beauty, g., yustiati, a., & grandiosa, r. (2012). pengaruh dosis mikroorganisme probiotik pada media pemeliharaan terhadap kelangsungan hidup dan pertumbuhan benih ikan mas koki (carassius auratus) dengan padat penebaran berbeda). perikanan dan kelautan. 3 (3): 3-6. cahyo, b. (2009). budi daya lele dan betutu (ikan langka bernilai tinggi). jakarta: pustaka mina. crab, r., lambert, a., defoirdt, t., bossier, p. & verstraete. w. (2010). the application of bioflocs technology to protect brine shrimp (artemia franciscana) from pathogenic vibrio harveyi. microbiology. 109 (5):1643-1649. destiawan, g., eni, r., & arifin, d. (2015). pengaruh penambahan sari jahe (zingiber officinale rocs.) dan kunyit (curcumae domestical val.) pada air minum terhadap konsumsi pakan, konversi pakan dan konsumsi air minum pada ayam broiler. surya agritama. 4 (1) : 99-108. hadadi, a., herry, k.t, wibowo, e., pramono, a., surahman., & ridwan, e. (2009). aplikasi pemberian maggot sebagai sumber protein dalam pakan ikan lele sangkuriang (clarias sp.) dan gurame (osphronemus gouramy lac.). laporan tinjauan hasil tahun 2008. balai pusat budi daya air tawar sukabumi. hariani, d & purnomo, t. (2017). pemberian probiotik dalam pakan untuk budi daya lele. stigma journal of science. 10 (1) : 31-35. harsono p, 2009. pembenihan dan pembesaran lele dumbo hemat air. yogyakarta: kanisius. kompiang, i.p. (2009). pemanfaatan mikroorganisme sebagai probiotik untuk meningkatkan produksi 8 | anis dkk; pemberian pakan komersial dengan penambahan em4 ternak unggas di indonesia. pengembangan inovasi pertanian. 2 (3) : 177-191. kusriningrum, r. s. (2008). perancangan percobaan. surabaya: airlangga university press. lingga n dan kurniawan n. (2013). pengaruh pemberian variasi makanan terhadap pertumbuhan ikan lele (clarias gariepinus). jurnal biotropika. 1 (3) : 114-118. medinawati, n. s & yoel, 2011. pemberian pakan yang berbeda terhadap pertumbuhan dan kelangsungan hidup benih lele dumbo (clarias gariepinus). media litbang sulteng. 6 (2) : 83-87. megawati, r.a., arief, m & alamsyah, m.a, 2012. pemberian pakan dengan kadar serat kasar yang berbeda terhadap daya cerna pakan pada ikan berlambung dan ikan tidak berlambung. perikanan dan kelautan. 4 (2) :187-192. nasrudin. (2010). jurus suskses beternak lele sangkuariang. jakarta: pt agro media pustaka. natsir, m.h., widodo, e & muharlien. (2016). penggunaan kombinasi tepung kunyit (curcuma domestica) dan jahe (zingiber officinale) bentuk enkapsulasi dan tanpa enkapsulasi terhadap karakteristik usus dan mikroflora usus ayam pedaging. buletin peternakan. 40 (1) :1-10. putra, a.n. (2010). kajian probiotik, prebiotik dan sinbiotik untuk meningkatkan kinerja ikan nila (oreochromonas niloticus). tesis. bogor: program pasca sarjana. insititut pertanian bogor. rachmawati, f.n., susilo, u & hariyadi, b. (2006). penggunaan em4 dalam pakan buatan untuk meningkatkan keefisienan pakan dan pertumbuhan ikan nila gift (oreochromis sp.). agroland. 13 (3) : 270 – 274. saputra, d. (2014). penentuan daya cerna protein in vitro ikan bawal (colossoma macropomum) pada umur panen berbeda. comtech. 2 (5): 1127-1133. sartika, d., harpeni, e., & diantari, r. (2012). pemberian molase pada aplikasi probiotik terhadap kualitas air, pertumbuhan dan tingkat kelangsungan hidup benih ikan mas (cyprinus carpio). rekayasa dan teknologi budi daya perairan. 1 (1): 58-64. yanuar, s.e & sutrisno, a. (2015). minuman probiotik dari air kelapa muda dengan starter bakteri asam laktat lactobacillus casei. pangan dan agroindustri. 3 (3) : 909-917. 1 | rachmadiarti et al; training students’ attitudes in environmental science course through lesson study jurnal riset biologi dan aplikasinya, volume 1, nomer 1, maret 2019 training students’ attitudes in environmental science course through lesson study melatih sikap mahasiswa pada mata kuliah ilmu lingkungan melalui lesson study fida rachmadiarti*, sunu kuntjoro, widowati budijastuti department of biology, faculty mathemathics and natural sciences, universitas negeri surabaya abstract the core competences of environmental sciences are to communicate and to understand the concepts of natural resources and environment, to solve related problems, and to have an environmental awareness. an effective effort is needed to train the environmental awareness. the purposes of this research were to evaluate how to train the attitudes of biology education study program students in the second semester who were taking the environment knowledge lecture. this research was quantitative and qualitative interpretation research by observing the learning process of biology education students through lesson study. the research stages consisted of plan, do, and see in two cycles. the collected data included the results of observation on the learning process by the observer, the lecturers’ assessment related to the skills and attitudes during the learning process, and the students’ self-assessment on their attitudes. the data were analyzed descriptively. the research revealed that the students learned actively, they cooperated within groups, the class cleanliness was an indicator of attitude to environmental awareness because the lecturers always reminded the students related to the indicators of keeping the environment clean and treating garbage, the learning resources used challenged the students to work and discuss. the students’ attitudes towards environmental awareness are categorized as good-very good, the results of the lecturers’ assessment of the attitudes are categorized as good, and results of the students’ presentation skills are categorized as good-very good. abstrak kompetensi inti mata kuliah ilmu lingkungan adalah untuk berkomunikasi dan memahami konsep sumber daya alam dan lingkungan, untuk memecahkan masalah terkait, dan memiliki kesadaran lingkungan. diperlukan upaya yang efektif untuk melatih kesadaran lingkungan. tujuan penelitian ini adalah untuk mengevaluasi bagaimana cara melatihkan sikap kepada mahasiswa program studi pendidikan biologi pada semester ii yang mengambil kuliah ilmu lingkungan. penelitian ini adalah penelitian interpretasi kuantitatif dan kualitatif dengan mengamati proses pembelajaran siswa pendidikan biologi melalui lesson study. tahapan penelitian terdiri atas plan, do, see dalam dua siklus. data yang dikumpulkan meliputi hasil pengamatan proses pembelajaran oleh pengamat, penilaian dosen terkait dengan keterampilan dan sikap selama proses pembelajaran, dan penilaian diri mahasiswa pada sikap mereka. data dianalisis secara deskriptif. hasil penelitian ini menunjukkan bahwa siswa belajar secara aktif, mereka bekerja sama dalam kelompok, kebersihan kelas adalah indikator sikap terhadap kesadaran lingkungan karena dosen selalu mengingatkan mahasiswa terkait dengan indikator menjaga lingkungan bersih dan penanganan sampah, sumber belajar yang digunakan menantang para maha siswa untuk bekerja dan berdiskusi. sikap mahasiswa terhadap kesadaran lingkungan dikategorikan baiksangat baik, hasil penilaian dosen terhadap sikap dikategorikan baik, dan hasil keterampilan presentasi mahasiswa dikategorikan baik-sangat baik. how to cite: rahmadiarti, f., kuntjoro, s & budijastuti, w. (2019). training students’ attitudes in environment science lecture through lesson study. jurnal riset biologi dan aplikasinya. 1 (1): 40-46 *correspondence author: jalan ketintang gedung c3 lt. 2 surabaya 60231, indonesia e-issn: 2655-9927 e-mail: fidarachmadiarti@unesa.ac.id jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi history article received: 11 desember 2018 approved: 11 januari 2019 published: maret 2019 key words: lesson study, environmental science, environmental awareness kata kunci: lesson study, ilmu lingkungan, kesadaran lingkungan mailto:fidarachmadiarti@unesa.ac.id mailto:fidarachmadiarti@unesa.ac.id 41 | rachmadiarti et al; training students’ attitudes in environmental science course through lesson study introduction environmental science is a mandatory course in the second semester for the students majoring in biology, including biology study program. environmental science has three credit semesters. the learning process of environment science lecture was carried out in face to face theory, tutorial, and practicum. in this lecture, the core competence to be achieved is to communicate and to understand the concepts of natural resources and environment, to solve related problems, and to have an environmental awareness. so far, it is more focused on the learning which directs the students to develop concepts and to train skills, while the environment awareness has not been much trained. thus, environmental awareness has not become a culture. although the focus of this research was on how to train environmental awareness attitude, the students were also taught about the concept/knowledge and skills as capital in attitude. knowledge is the initial capital that an individual should have. the development of individual knowledge can be used to connect facts or information from various sources and draw conclusions (kerby & romine, 2009). by applying this knowledge and skills, an individual will be able to take actions to solve environmental problems and to have an attitude from that action, for example, the environmental awareness attitude. presentation skills that are part of communicating which are trained in this research as belief or action. it means that the students who are given the opportunity to do presentation will become confident and will have an important role in learning. therefore, in learning, the three aspects related to knowledge, concepts, and attitudes are the parts that need to be taught and trained comprehensively. the attitude which was trained in this research was the environmental awareness attitude, which means the attitude and actions that prevent environmental damages and the efforts to improve the environment quality (kemendiknas, 2010; kresnawati, 2013). the action to protect and manage the environment as an expression of love for the environment (aini, 2008). based on above mentioned the problem identification, it was known that the effective competence (attitude) has not been continuously trained, therefore, this lecture needs to train students’ attitudes to support their environmental awareness competence. the purpose of this research was to evaluate how to train the attitudes of biology education study program students in the second semester who were programming the environmental science course. these purposes were to explore the learning process of the environmental science course, to train the attitudes related to the environmental awareness in addition to training concepts and skills, as well as to describe the results of the attitude assessment during the learning. to achieve the objectives of the research, this research was conducted through lesson study with the aim of developing the students’ environmental awareness through learning community, especially the establishment of the interaction between students and environment, in addition to develop the interaction between students and students, and between students and teachers (rachmadiarti and fitrihidajati, 2017). while lewis et al. (2006) suggested that the cycle of a lesson study starts with the teachers (lecturers) work by establishing the main objectives during the implementation of the lesson plan. materials and methods this research was conducted to investigate the interaction between students and the environment, between students and students, and between students and lecturers. the implementation of the learning was carried out through lesson study, namely the lesson plan was made together with the ecology team, and the learning in the class involved another team as an observer. this research was conducted in the class of biology education 2014. the lecturers who participated in developing the lesson plan consisted of three lecturers of ecology subjects. while the lecturers who participated in the observation of learning and reflection of learning consisted of two lecturers from ecology team, three lecturers from other courses and one guest lecturer, along with two lecturers from other courses. the learning activity was carried out for two meetings with each meeting consisting of two learning period and two reflections. the findings of lesson study were divided into two stages, there were: stage 1 consisted of plan 1, do-see 1, reflection 1 and stage 2 consisted of plan 2, do-see 2 reflection 2. at the do-see stage, the learning process was carried out, during the learning process, an observation was carried out. the results of observations including the student activities and learning processes were recorded by the observers, including the students’ work and the students' ability to present the results of the discussion. after the learning process, the assessment was conducted. the assessment was conducted to assess the presentation skills and selfassessment for the environmental awareness attitude. jurnal riset biologi dan aplikasinya, 1 (1): 40-46, februari 2019 | 42 the data collected included: 1) the results of the observation on student activity and learning processes that occurred during the learning process, including problems and solutions to the problems; 2) the assessment of presentation after the learning process, and 3) self-assessment related to the environmental awareness attitude. observation to the learning students and reflection note during the lesson. observations were measured by looking at the number of observation results, comments and solutions during and after the learning process; the data were analyzed descriptively. this research began with the stage of the plan, where lectures and team developed lesson plans. they developed two lesson plans for two 100-minutes meetings. the feedbacks on the lesson plan from the lecturers from other teams were summarized as follows. (1) the lesson plans needed to be clarified in the lesson plan the connection between the environmental issues and the topics to be studied, namely the growth of population. (2) the word “audience” in the basic competencies needs to be eliminated, “audience” is written in the learning objectives. (3) the indicator of communicating in the lesson plan was clarified as presenting the results as one of the skills to be assessed. (4) the point of summarizing the lessons, which would be conducted by the students and the lecturers, should underline the focus materials. (5) the indicator of presentation should be made in order that the students can implement the presentation according to the expectation in basic competence. (6) a non-formal observation of environmental awareness attitude is needed on the eco-campus activities. a good plan is very useful in improving the lesson plan that will be implemented in the learning because there is some feedback to improve the learning, namely the delivery of presentation indicators on the students and make non-formal observations on students while doing environmental awareness activities. this presentation is important because, through a presentation, the students’ understanding of the learning material can be quickly identified. the next stage is the do and see. at this stage learning and observation of learning were conducted. the results of the learning observation are presented in table 1 and 2. table 1a illustrates that the completeness of the implementation of the lesson plan was 100%. all the stages in the learning activities designed on the lesson plan had been implemented. the learning condition was also supported by the results of the observation of the learning, which is reflected in the see activity (table 2). table 1. the completeness of the implementation of the lesson plans num. learning steps completeness meeting 1 meeting 2 a. opening phase 1: presenting the learning objectives and motivating students 1 reviewing the previous learning material on environmental issues (environmental issues, environmental pollution issues by questions and answers) 100% 100% 2 displaying the slides of environmental pollution, human population, and asking students to observe and give comments on the 100% 100% 3 stating the learning objectives (cognitive, psychomotor, affective), including environmental awareness attitude and cooperation. 100% 100% b. main (100 minutes) 1 phase 2: presenting information students pay attention to the lecturer presenting environmental pollution cases, human population growth and the affecting factors 100% 100% 2 phase 3: organizing students into study groups students are instructed to sit in groups and to read the student worksheet (environmental polution, changes in the survival rate of us pop) provided 100% 100% 3 phase 4: guiding group work and study students read the worksheet carefully and ask questions about the things they do not understand while reading the student worksheet 100% 100% 43 | rachmadiarti et al; training students’ attitudes in environmental science course through lesson study num. learning steps completeness meeting 1 meeting 2 a. opening 4 the lecturer asks the students to do the student worksheet by discussion 100% 100% 5 the lecturer guides the discussion in working on the student worksheet 100% 100% 6 phase 5: presenting the results of the discussion the students and their groups present the results of the discussions classically guided by the lecturer 100% 100% 7 the students and the lecturer summarize the learning material related to lab work 100% 100% 8 phase 6: giving reward lecturer gives reward the group with the best performance 100% 100% c. closing 1 the lecturer and the student summarize the learning materials on environmental pollution and population 100% 100% 2 the lecturer gives gives an assignment to study about the next material, which is environmental management 100% 100% table 2 shows that students studied actively. listened and paid attention to the lecturer, did the student worksheet. having discussions and doing presentations, although some students were not concentrated at the beginning of the class. students learned in groups with the worksheet written in english as the learning resources, the students were confident in doing presentations in english. in addition, the students could work with their friends in one group and show an environmental awareness attitude, which was indicated with the clean classroom. such a condition is supported by a model lecturer who frequently visited and guided each group, by asking the difficulties they experienced. in addition, the lecturer had good english-speaking competence. to monitor the students’ environmental awareness and cooperation, the students did selfassessment (table 3). an evaluation was carried out at the end of the learning by asking each group to do presentations, and the results of the assessment are presented in table 4. the students who had conducted selfassessment related to collaboration and presentation assessment by lecturers were also observed related to student activities during learning and the results were in line with the two things (table 5). table 5 shows that students were active in learning, group work, applying scientific attitudes, and direct involvement in presentations. table 2. summary of the observation results num. observer the results of observation 1 1 students discussed and corrected mistakes with presentations students listened to the topic and did the work students listens, and pay attention to pictures (phase 1) students listen and pay attention to power point presentation when summarizing, the students should not stand, but sit still in their seat. 2 2 group 1,2, 3 (still working on their own work when one of the other groups sstep forward). the lecturer should make sure the group work has finished. one student, when the lecturer explained the material, was not concentrated. lecturers needed to remind the students who were busy working on their own. 3 3 some of the students were not yet concentrated at the begining of the class. after given the student worksheet, the students became more active in discussions and did the student worksheet because there was not a clear time limitation for finishing the worksheet, the lecturer should have provided the allocation time for finishing the worksheet and discussion 4 4 always gave questions and slides jurnal riset biologi dan aplikasinya, 1 (1): 40-46, februari 2019 | 44 num. observer the results of observation group discussion motivated, guided and asked about the difficulties that the students experienced often visiting student groups and often having discussions with them, so that it encouraged the passive students to become more active visiting each group, and checking their progress on the task reminding about environmental awareness and cooperation spook english fluently and well. 5 5 motivated to learn in english. the availability of the worksheet eased the students and teachers in learning. working in groups, good language, confident. clean class. table 3. self assessment of attitude num. assessed aspects assessment percentage k c b sb 1 cooperation 22% 78% 2 environment awareness a. keep the environment cleanliness 22% 78% b. treat rubbish 28% 72% note: assessment rubric num. assessed aspect assessment k c b sb a. keep the environment cleanliness the surroundings of the students are not clean the surroundings of the students are not clean, still often reminded by teachers the surroundings of the students are always clean, still need to be reminded by the teacher the surroundings of the students are always neat and clean, done independently b. treat rubbish do not put rubbish on the rubbish bin rarely put rubbish in the rubbish bin always put the rubbish in the rubbish bin, but not in accordance with its type always put the rubbish in the rubbish bin according to its type table 4. presentation assessment num. assessed aspects group / score 1 2 3 4 5 6 1 mastery of the science concepts delivered 3 3 3 3 4 4 2 presenter performance 4 3 3 3 4 4 3 presentation display 4 4 3 3 4 4 average 3.66 3.33 3 3 4 4 note: assessment rubric num. assessed aspects score 1 2 3 4 1 mastery of the science concepts delivered not mastering the concept of population very well, the terms used are not correct lack of mastering the concept of population, the terms used are less precise mastering the concept of population well, the terms used are correct mastering the concept of population very well, the terms used are correct and precise 45 | rachmadiarti et al; training students’ attitudes in environmental science course through lesson study num. assessed aspects score 1 2 3 4 2 performance the delivery is not easy to understand, not communicative with the audience, not give the audience an opportunity to think the delivery is not easy to understand, less communicative with the audience, giving less opportunity for the audience to think delivery is easy to understand, communicative with the audience, giving less opportunity for the audience to think delivery is easy to understand, very communicative with the audience, giving the audience an opportunity to think 3 presentation display the displays are unattractive and not suitable with the material the displays are less attractive and less suitable with the material the display look attractive but less suitable with the material the displays are very attractive and suitable with the material table 5. results of student activity observation num. aspect of assessment assessment criteria group 1 2 3 4 5 6 1. activeness in learning 1. students are active, earnest and do not show any irrelevant behavior 2. students only show the two behaviors mentioned above 3. 1. students show less than the above two behaviors 3 3 3 3 3 3 2 group work 1. students are active, discussing with their group members, not dominating and respecting others’ opinions 2. students only show the two behaviors mentioned above 3. students show less than the above two behaviors 3 3 3 3 3 3 3 application of scientific attitude 1. students are thorough, honest and responsible during the observation activities 2. students only show the two behaviors mentioned above 3. students show less than the above two behaviors 3 3 3 3 3 3 4 involvement during presentation 1. students dare to express opinions, appreciate others’ opinions and pay attention to the presentation activities 2. students only show the two behaviors mentioned above 3. students show less than the above two behaviors 3 3 3 3 3 3 scores gained 3 3 3 3 3 3 the lesson plan, which was developed by the collaboration of teaching team and the lecturers were present plan can be implemented step by step in accordance with the syntax of cooperative learning (ibrahim et al., 2000). the most important thing from the implementation of this lesson plan was a good collaboration in the teaching team and among the lecturers who were present in the plan activities. this is in accordance with the stages of the lesson study cycle (hendayana et al., 2007; suratno and cock, 2009). at this lesson plan stage, the lecturers with their knowledge work together to construct lesson plans to determine the best learning for students, discuss student tasks, and the opportunity to discuss jurnal riset biologi dan aplikasinya, 1 (1): 40-46, februari 2019 | 46 in detail how students think and how best to further the understanding of student thinking (fernández, 2010). in this study, the student's academic ability was evaluated based on the communication skills, namely from the ability to present in groups. from the presentation, it can be seen, in addition to communication skills as well as mastery of concepts from the material presented, for example in population materials other than students are able to present material/concepts/implementations from presenter performance and presentation display indicators, namely describing the population and the influencing factors including impacts population in the environment, one of which causes environmental pollution, students also understand the concepts presented from the evidence of one of the presentation assessment scores, namely the mastery of the science concepts delivered. the success in terms of concepts and student communication is also inseparable from student interaction with students both in groups while working on and discussing the lesson provided in the worksheet, interactions between groups during presentations (rachmadiarti and fitrihidajati, 2017). the development and success of students have emerged in the learning of environmental knowledge courses, namely academic abilities and attitudes during learning, namely concern for the environment. this is because the development and success of lecturers and the team have acted as a good facilitator. this can occur because the knowledge of coconstruction in the lecturer team causes learning to be better for students (siu, 2007). in addition, with joint planning, lecturers also make it possible to expansive learning (engestrom, 2001), where students learn something that has not previously been studied and is involved in constructing and implementing (engestrom and sanino, 2010). this condition can encourage the students to succeed in learning and acting (environmental care attitude). conclusion based on the results, which showed that the students' attitudes towards environmental awareness were categorized as good-very good, the results of the lecturers' assessment of attitudes was good, and the results of students' presentations skills were categorized as good-very good. it can be concluded that learning through lesson study in the environmental science course can train the students’ attitude. references engeström, y. (2001) expansive learning at work: toward an activity theoretical reconceptualization, journal of education and work.14 (1) : 133-156, engeström, y. and sannino, a. (2010). studies of expansive learning: foundations, findings and future challenges. educational research review. (5): 1-24. fernández, m. l. (2010). investigating and how propective teachers learn through microteaching lesson study. teacher and teaching education. 26 (1): 351-262. hendayana, s. supriatna, a. imansya, h. (2007). indonesia’s issues and challenges on quality improvement of mathematics and science education. journal of international cooperation in education. 4 (2), 41-51 kemendikbud. (2016). peraturan menteri pendidikan dan kebudayaan republik indonesia nomor 23 tahun 2016 tentang standar penilaian pendidikan. kerby, d & romine, j. (2009). develop oral presentation skills through accounting curriculum design and course-embedded assesment. journal of education for bussiness. 85 (3): 172-179. kresnawati, n. (2013). korelasi kualitas pembelajaran geografi dan hasil belajar terhadap sikap peduli lingkungan siswa kelas xii ips sman 1 ponorogo. jurnal pendidikan biologi. 1 (3): 298-303. lewis, c., perry, r., murrata a. (2006). how should research contribute to instructional improvement? the case of lesson study. educational researcher. 35 (3): 36. ibrahim, m., rachmadiarti, f., ismono, nur, m. (2000). cooperatif learning. surabaya: unesa press. rachmadiarti, f. and fitrihidajati, h. (2017). training principal of lesson study at lecture of learnig materials development. proceeding icls 2017. lombok timur: universitas hamzanwahdi.isbn: 978-602-98097-8-7. suratno, t. & cock, k. j. (2009). a school-university partnership in indonesia. lessons learnt from lesson study. in: lim, c. p., cock, k., lock, g. & brook, c. (eds.). innovative practices in pre-service teacher education: an asia-pacific perspective. rotterdam: sense publisher. so, w.m.w. & kong, s.c. (2007). approaches of inquiry learning with multimedia resources in primary classrooms. journal of computers in mathematics and science teaching, 26(4), 329-354. waynesville, nc usa: association for the advancement of computing in education (aace). 1 | andarwati et al; the students worksheet development on fungi based on the plus kwl’s jurnal riset biologi dan aplikasinya, volume 1, nomer 1, maret 2019 the students’ activity sheet development on fungi based on the plus kwl’s the students worksheet development on fungi based on the plus kwl’s strategy to train the metacognitive skills pengembangan lembar kegiatan peserta didik materi fungi berdasarkan strategi kwl plus untuk melatihkan keterampilan metakognitif indrie dwi andarwati1, endang susantini1*, ahmad bashri1, and ruswanto2 1biology department, faculty of mathematics and sciences, universitas negeri surabaya 2sekolah indonesia singapura, singapura abstract the objective of this research was to produce worksheet of fungi material based on plus kwl’s strategy to train the metacognitive skills seen at the effectiveness. the type of this research was a development with a 3d research design that was shortened into define, design and development. the subjects of this study were students of class x mia 1. instruments used in this study was test. based on the effectiveness of worksheet based on plus kwl’s strategy was obtained from pre and posttest result which have been tested from the positive value sensitivity. this worksheet can be used to train the metacognitive skills by very good criteria that were determining the level of confidence and score. it can be concluded that the worksheet based plus kwl ‘s is very effective to train metacognitive skills abstrak tujuan penelitian ini adalah untuk menghasilkan lembar kerja mahasiswa materi jamur dengan menggunakan strategi kwl plus untuk melatihkan keterampilan metakognitif yang dilihat pada tingkat keefektifan. jenis penelitian ini adalah pengembangan dengan desain penelitian 3d yang disingkat menjadi define, design, dan development. subjek penelitian ini adalah siswa kelas x mia 1. instrumen yang digunakan dalam penelitian ini adalah tes. berdasarkan efektivitas lembar kerja menggunakan strategi kwl plus diperoleh hasil pre-test dan post-test yang telah diuji dari sensitivitas nilai positif. lembar kerja ini dapat digunakan untuk melatihkan keterampilan metakognitif dengan kriteria yang sangat baik yang menentukan tingkat kepercayaan dan skor. dapat disimpulkan bahwa lembar kerja berbasis kwl plus sangat efektif untuk melatihkan keterampilan metakognitif how to cite: andarwati, i.d., susantini, e., bashri, a & ruswanto. (2019). the students’ activity sheet development on fungi based on the plus kwl’s strategy to train the metacognitive skills. jurnal riset biologi dan aplikasinya. 1 (1): 32-39. * correspondence author: jalan ketintang gedung c3 lt. 2 surabaya 60231, indonesia e-issn: 2655-9927 e-mail: endangsusantini@unesa.ac.id jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi history article received 15 desember 2018 approved 2 januari 2019 published maret 2019 key words: effectivity, plus kwl’s, metacognitive kata kunci: efektivitas, kwl plus, metakognitif mailto:endangsusantini@unesa.ac.id mailto:endangsusantini@unesa.ac.id 33 | andarwati et al; the students worksheet development on fungi based on the plus kwl’s introduction metacognitive is the 21st-century skills which is needed to foster the students’ skills in indonesian education because indonesian education keeps improving its quality to achieve the goals of national education. the students' metacognitive skills are then chosen and included in the curriculum of 2013. susantini et al. (2018a; 2018b) found that students are able to learn independently and honestly to develop themselves with the metacognitive skills by setting and achieving the goals to improve the learning outcomes. the results of biology learning at sman 3 surabaya shows that 50% of students find the difficulties to learn biology because of the less interesting teaching style, i.e. the amount of memorization so that students understand less and are not so motivated in the subjects. the results were viewed from the results of the value obtained from the questionnaires given to students about biology learning on fungi materials. therefore, the lack of motivation relates to the lack of teacher strategy in teaching. the kwl plus learning strategy becomes one of the learning models that can explore all students' intelligence both psychomotor and cognitive. the strategy also improves the skills that involves all the components of learning because it is no longer centered on the teacher. kwl plus is the metacognitive learning strategies which consist of know, want, and learned. ruddel (2005) states that the kwl plus is clearly designed to help students learning completely (pre-reading, whilst reading and postreading). kwl plus also asks the students to build their prior knowledge by remembering what is known; determining what students want to learn, and identifying what is learned plus text mapping and summarizing information. furthermore, it is supported by other components that interact in it, i.e. the learning resources. the learning resource that a teacher applies to support the learning process is the student worksheet. student worksheet are the sheets containing tasks that must be done by the students. the worksheet is usually in the form of instructions and steps to complete the task according to achieve of the basic competencies. to realize the importance of the students’ learning, the students’ metacognitive ability is then necessarily concerned with developing the student worksheet based on the kwl plus learning strategy. the development of student worksheet based on kwl plus strategy expectedly train the students’ metacognitive skills on problem solving in learning, especially the fungi material. tok (2013) stated that students are able to diagnose their needs when students are aware of their own learning. the students also apply the metacognitive strategies to eliminate their shortcomings as well. accordingly, the kwl plus has several goals. the first is to help the students understand how to produce what is known and wanted to know. after, the students produce what they have learned to compare with their prior knowledge which the misconception may still occur. as the argument stated above, the researcher was interested to examine this issue in a study which is entitled “the students’ activity sheet development on fungi based on the plus kwl’s strategy to train the metacognitive skills. materials and methods this study has applied the research and development by using a 3-d model which is adapted from thiagarajan model. the development stages are define, design, and development. the steps of developing students’ worksheet based on the kwl plus strategy were applied in several stages that follow. the first was the defining stage which was done by analyzing the four aspects, namely of curriculum analysis, concept analysis, student analysis, and task analysis. the curriculum analysis was used in the fungi sub-subject based on the curriculum of 2013. the analysis proceeded in order to analyze the core competence, basic competence, indicators, and learning objectives. then the concept was examined by identifying the main concepts to be taught completely, arranging and detailing relevant concepts systematically, e.g. the concept of the fungi material. after that, student analysis was done at the beginning of the planning by paying attention to the characteristics, abilities, and experience of the students. those analysis were done to know both individual and group characteristics of students. accordingly, this study took the class x mia 1 sman 3 surabaya as the population of study. next, the task analysis was done to determine the contents of the unit lesson. task analysis was done by detailing the content of teaching materials in the form of an outline. based on the indicators designed, the task analysis was then prepared to undertake students with the worksheet. the tasks jurnal riset biologi dan aplikasinya. 1 (1): 32-39, maret 2019| 34 were presented in the form of student activities in order to draw the students' metacognitive abilities. the second was the design stage in order to prepare the students’ worksheet based on the kwl plus strategy. this preparation was adjusted from the material of class x. the third stage was the development stage which produced the revised students’ worksheet of the kwl plus strategy based on input from the experts. furthermore, the product testing is a product feasibility test that was designed in the biology learning of the fungus material. the testing was limited to the one group pre-test-pos-test design. the testing was conducted to determine the effectiveness of worksheet based on kwl plus strategy. the test was performed on the students of class x mia 1 sman 3 surabaya in the even semester of the academic year 2017/2018, dated on 17th and 24th april 2017. the research instrument was a description of the data needed to answer the questions or the problems in the study. the research instrument used in this research is the observation of students’ worksheet implementation, student response questionnaire, knowledge and metacognitive skills’ test. data collection method is a method used to collect data used. in this research data collection method used was observation, questionnaire and test. data analysis technique used in this research was the descriptive analysis. this analysis produced the result of worksheet’s practicality and its effectiveness. the practicality of worksheet based on kwl plus strategy was measured by using the guttman's scale. the interpretation of the score based on the likert scale, the implementation of a worksheet is stated to be practical if the average percentage is > 75%. when the students appraised "yes" in their responses reached > 71% then the worksheet was admittedly practical. the effectiveness of students’ worksheet was measured by using student learning analysis gained from pre and post-test with the type of three-tier test rule of scores (pesman, 2010) due to: 1. score 1. score 1 for a correct answer and score 0 for the wrong answer at level one (one tier). 2. score 2. scores 1 for the correct answer at the level of one and two (two-tier). if the answer is wrong on one level then a score of 0 is given. 3. score 3. scores 1 for the correct answer at level one and two is answered confidently (threetier), yet a score of 0 is given. 4. a confidence score’s level. score 1 for certain answers on the level three. if the answer is not certain then score of 0 is given. at this stage, the measurements of the students’ confidence level are performed by answering the questions. students are stated to have complete learning if the value of learning outcomes 75% or > 75. as to know the comprehensiveness of the learning outcomes on the pre-test and post-test. additionally, the sensitivity value of the item is calculated to know the item’s sensitivity to the effects of learning. the formula to calculate is: s = (ra – rb) : t information: s : sensitivity of item ra : number of students who answered correctly in the final test rb : number of students who answered correctly on the initial test q : number of students taking the test an effective grain index exists between 0.00 and 1.00 and a larger positive value indicates a larger item of the sensitivity to the learning effects (gronlund, 1982). metacognitive skills analysis 1. the first is to determine the score on the answer. the skill sets the score on the answer if the difference between the teacher's score and the student's score is 0-10, if greater than that the student is considerably incomplete (slavin, 2006). 2. the second is to draw the level of confidence in the correct answer. students are considered to have high levels of metacognitive skills if students know and believe the answer is right or wrong. otherwise, students are considered to have low levels of the metacognitive skills if the students do not know and are not sure that the answer is right or wrong. the students can be considered complete in the level of confidence on the correct answer if the fit between the answer and the belief level is ≥ 65% in all questions. the students are considered incomplete in the confidence in the correct answer if the fit between the answer and the confidence level is ≤ 65% in all questions. tabel 1. metacognitive scale score category 1 very poor 2 poor 3 good 4 very good 35 | andarwati et al; the students worksheet development on fungi based on the plus kwl’s results and disscusion the students’ metacognition is a cognition included in the curriculum of 2013. the students then are expected to be independent, i.e. knowing what is being learned and what has been learned. teaching metacognitive skills in the education system is important to help students develop the high order thinking processes and improve the academic achievement (flavell, 2004; larkin, 2009). the practicality of the worksheet was obtained through observation of worksheet implementation. it was also based on the learning using students’ worksheet based on the kwl plus strategy. moreover, the effectiveness was obtained based on the pre-test and post-test based on three-tier test. the development of students’ worksheet was adjusted to the 2013 curriculum by applying kwl plus learning strategy, in which the information required, was gathered from the activity. it obtained the information the knowledge that students know in column or stage know, the knowledge of what students want to know at the stage want. there were also activities described from the received information by answering questions from the stage want at the learning’s stage. the tests (pre-test and post-test) were developed according to the indicators consisting of 10 questions with 3 stages of answering the problems, the reason and the level of confidence. the practicality of students’ worksheet was obtained from observing the students’ worksheet implementation and the questionnaire from the students’ response, the table of an observation result of implementation that follows: table 2. the result of observing the worksheet at the first meeting, students use worksheet on topics of mushroom characteristics, fungus body structure and fungal reproduction. the second meeting discusses the clustering of mushroom classification and the role of fungi in everyday life. the third meeting is doing practicum by making tapai cassava. based on the results of observation analysis of worksheet implementation (table 2) by two observers shows that all students carry out learning activities by applying kwl plus strategy, that is students looking at the use of the worksheet guidelines and students write their knowledge in the know, want, and learn and make mapping because according to livingston (1997), metacognitive is the acquisition of new knowledge that builds knowledge of something. therefore, the implementation of kwl plus mapping helps to achieve these objectives so that students have implemented learning activities by using kwl strategy by following the procedures of kwl plus the students can develop metacognitive skills. in addition, a mapping is a cognitive or conceptual framework that involves prior knowledge to understand something. mapping readers can develop well by involving metacognitive use. the practicality of student activity sheet or worksheet is also seen from the questionnaire of student response after receiving learning using worksheet based on kwl plus strategy. the result of the student response questionnaire as follows (table 3). no activities observed yes no 1 2 3 1 2 3 1 students pay attention on worksheet’s instruction 2 2 2 0 0 0 2 students organize initial knowledge in the column know 2 2 2 0 0 0 3 students write down a list of questions in the column want 2 2 2 0 0 0 4 students review and discuss the fungi material text to answer some questions in the column want 2 2 2 0 0 0 5 students write down the answers in the column learned 2 2 2 0 0 0 6 students check their understanding in groups 2 2 2 0 0 0 7 students make the score from the answers obtained by the assessment rubric 2 2 2 0 0 0 8 students make a mapping of learning outcomes that have been obtained in the mapping column provided 2 2 2 0 0 0 total 16 16 16 0 0 0 % practicality 100 100 100 0 0 0 category practical jurnal riset biologi dan aplikasinya. 1 (1): 32-39, maret 2019| 36 table 3. the result of students’ responses no. aspect average score nb ya (%) no (%) 1 learning activity based on kwl plus strategy is new for me 100 0 p 2 learning activities based on kwl plus strategy are interesting and exciting 80 20 p 3 i am more motivated in the process of learning biology based on the kwl plus strategy 90 10 p 4 i am more active in the learning process based on kwl plus strategy 90 10 p 5 i am more able to express my opinions in group and class discussions in learning based on the kwl plus strategy 85 15 p 6 learning activities based on the kwl plus strategies to practice metacognitive thinking skills are systematic and clear. 100 0 p 7 the material taught in problem-based learning is clear and easy to understand 80 20 p 8 the instructions given by a teacher during our working on the worksheet are very clear and useful 100 0 p 9 after participating the learning activities based on the kwl plus strategy, i was able to work on the test easily 90 10 p 10 i am interested to follow the learning activities based on the next kwl plus strategy 80 20 p 11 i'm happy if the learning based on the kwl plus strategy is applied in high school 80 20 p 12 knowing phase on worksheet’s activities can explore my initial knowledge about the material 100 0 p 13 want phase on worksheet’s activities can grow my curiosity to learn more fungi material 100 0 p 14 learned phase on worksheet’s activities can help me know what i have learned 100 0 p ∑ students answer “yes” 255 maximum 280 % feasibility 91,07 p learning activity based on the kwl plus strategy is new for students. however, only 80% of students were happy and interested in the implementation of learning activities based on kwl plus strategy. yet there were only 85% of students who can express their opinions in group and class discussion. apparently, this strategy can be used in whole class activities, group activities or individual activities in order to help students remember what they read, what they revise in their concept and vocabulary. they were also able to activate the prior knowledge, assess what students have learned on the subject, and summarize the results learned in the form of mapping (camp 2000; dobbs 2003; martorella et al., 2005). accordingly, students believed that the material taught in the lesson was clear and easy to understand positively responded only by 80% students. on the other hand, 20% of students responded negatively. this was due to a large number of latin names and the fungi’s life cycle in the various divisions that the students memorize. the kwl plus strategy development was scored 255 from a maximum score of 280 with a feasibility percentage of 91.07 practical categories. it was identified after a recapitulation of positive responses from students. the integration of worksheet based on kwl plus strategy was proved to give a positive result on the student knowledge test. accordingly, the test method was used to know the effectiveness of students’ worksheet based on the kwl plus strategy. the problems of knowledge test were made basically from the basic competence and indicators on the fungi material. pre-test and post-test questions were adjusted on the cognitive levels of c3 and c4. the results of the completeness of indicators and sensitivity follow. 37 | andarwati et al; the students worksheet development on fungi based on the plus kwl’s table 4. the results of indicator satisfaction and sensitivity no. indicators pretest posttest sensitivity complete (%) complete (%) 1 categorize the characteristics of mushrooms in the images that have been provided 0 very poor 100 very good 1 2 determining the body structure of a fungus in one of the mushroom divisions 35 poor 75 good 0,4 3 categorize the division of the mushroom division based on the image provided 10 very poor 40 poor 0,3 4 selects grouping of mushroom divisions based on the main features of the division 5 very poor 75 good 0,7 5 determine the body structure of a fungus in one of the mushroom divisions by image 35 poor 75 good 0,4 6 linking the structure of the fungus and its function 15 very poor 50 good 0,35 7 sort the reproductive cycle of mushrooms based on random images 0 very poor 40 poor 0,4 8 determine the kind of reproduction that occurs in one of the mushroom divisions 40 poor 75 good 0,35 9 determining the role of fungi in everyday life 40 poor 75 good 0,35 10 determining the role of fungi in everyday life based on images 5 very poor 100 very good 0,95 in accordance with the data in table 5, it can be seen that, during the pre-test, the indicator was not completed to distinguish whether the category is poor or very poor. it showed the students had not mastered the whole material of fungi and an unusual problem where those can answer and reason to add the level of confidence (al-rubayea, 1996). yet, in fact, the fungi material was a material that was previously taught. additionally, the value of sensitivity is beneficially positive but there was also a negative, i.e. to determine the fungi body structure in its division based on the image. there were some factors that cause this existence. firstly, the learning process in the classroom tends to be more a teacher centered. thus students were less actively involved in the learning process. on the other hand, students were more active in learning by using students’ worksheet with kwl plus strategy. it created a good atmosphere that can help students understand the material. metacognitive learning occurs when some general strategies were obtained in order to facilitate the understanding of the knowledge. when students were aware of their own learning process, they can diagnose the needs and implement metacognitive strategies to eliminate their shortcomings (tok, 2013). kwl plus is a metacognitive strategy because it is a problem-solving process that focuses on thinking and developing language for thought processes on reading (pennington, 2009). the kwl method was designed to grow up the awareness of learning and develop the metacognitive (mok et al., 2006). the post-test knowledge test showed that the overall indicator was achieved although there were two unachieved indicators in categorizing the fungi division based on the provided image and determining the body structure fungi in its divisions. this was due to the lack of understanding of students in the latin name of fungi. besides, that was caused by the influence of the assessment in the test. although the answer in the first stage was correct, the students’ reason in the third stage was wrong which also affect the assessment. based on the results, it can be said that the students’ worksheet based on the kwl plus strategy was effective to develop the metacognitive ability. furthermore, it was also seen from the result of gan score score obtained equal to 0,6 with medium category. table 4 showed that the sensitivity was coefficient (s) ranges from -0.05 to 1. from. this sensitivity value indicated that there were still some items that are less sensitive to the effects of learning. based on table 5, the skill to determine the score on the answers was made by the students themselves on the first worksheet i, ii and iii. the skill component also determined the score best when it compared to the level of confidence in the correct answer. this was because students were told how to determine the score on each number according to the learning objectives. jurnal riset biologi dan aplikasinya. 1 (1): 32-39, maret 2019| 38 table 5. metacognitive skills based on the kwl plus student based worksheet on mushroom learning student score a b worksheet pre t/tt post t/tt i t/tt ii t/tt iii t/tt 1 80 t 85 t 80 t 20 tt 70 t 4 2 80 t 80 t 75 t 40 tt 80 t 4 3 80 t 80 t 75 t 20 tt 80 t 4 4 90 t 80 t 80 t 40 tt 90 t 4 5 80 t 80 t 75 t 30 tt 90 t 4 6 80 t 80 t 75 t 30 tt 60 tt 3 7 80 t 80 t 75 t 30 tt 70 t 4 8 80 t 80 t 75 t 40 tt 80 t 4 9 80 t 80 t 80 t 40 tt 90 t 4 10 80 t 80 t 75 t 40 tt 90 t 4 11 75 t 75 t 75 t 10 tt 70 t 4 12 85 t 80 t 75 t 40 tt 80 t 4 13 80 t 80 t 75 t 30 tt 80 t 4 14 80 t 80 t 75 t 20 tt 80 t 4 15 85 t 80 t 75 t 40 tt 90 t 4 16 85 t 85 t 75 t 40 tt 90 t 4 17 90 t 80 t 80 t 30 tt 70 t 4 18 90 t 80 t 75 t 40 tt 90 t 4 19 85 t 80 t 80 t 20 tt 80 t 4 20 80 t 85 t 75 t 10 tt 70 t 4 student(t) 0 19 20 20 20 average 3,95 student (tt) 20 1 0 0 0 % t 0 95 100 100 100 description: a = skill in determining score t = completed b = skills of determining beliefs tt = uncompleted the level of confidence in the correct answer in pre-test and post-test was increased drastically. in the pre-test, the students were not finished because most of the students answer the questions wrongly but they were confident with that. the indicator in the level of confidence was convinced with “correct” in the correct answer and “wrong” in the wrong answer. unfortunately, the student believed that the wrong answer was true. additionally, during the pre-test, the students were not properly prepared. yet the students studied the lesson at the second meeting. the post-test in the level of confidence to the correct answer was found only one student who was not finished because the student was not sure of answering the question through the selected answer was correct or incorrect. however, the students mainly completed the level of confidence. based on the two components shown in table 4.10, all students had “very good” metacognitive skills because students met all the components in the metacognitive skills. it was only one student who had "good" metacognitive skills. accordingly, metacognitive learning occurs when one obtains some general strategies that facilitate learning or understanding knowledge. when students are aware of their own learning process, they can diagnose their needs and implement metacognitive strategies to eliminate their shortcomings (tok, 2013). kwl plus is a metacognitive strategy because it is a problem-solving process that focuses on thinking and developing language for thought processes on reading (pennington, 2009). the kwl method is designed to raise the awareness of learners and develop their metacognitive (mok et al., 2006). kwl plus was purposeful to help students understand the lesson taught (szabo, 2006) conclusion this research was developmental research that produced worksheet based on the kwl plus strategy. based on the test of practicality by using questionnaire and observation of learning implementation, the worksheet was practically applied in biology learning on fungi’s subject. based on effectiveness test, it was the results of a sensitivity test were positive. during the teaching of metacognitive skills, it showed that all students were “very good” at metacognitive skills. therefore, it can 39 | andarwati et al; the students worksheet development on fungi based on the plus kwl’s be concluded that students’ worksheet based on the kwl strategy plus was very valid, practical, and effective in learning the biology of fungi’s subject. references al-rubayea, a. a. m. (1996). an analysis of saudia arabia high school students’ misconceptions about physics concepts. dissertation abstracts international. 57 (04): 1462. camp, d. (2000). “it takes two: teaching with twin text of fact and fiction”. the reading teacher. 53 (2): 400– 408. dobbs, o. (2003). using reading strategies to reduce the failure rate in the content area subject: social studies. grade level: 6-7-8. (eric document reproduction service ed 479 208). flavell, j. h. (2004). theory of the mind development: retrospect and prospect. merrill palmer quarterly. 50 (3): 274-290. gronlund, n.e. (1982). constructing achievement tests 3rd edition. englewed cliffs, new jersey: prentice hall. larkin, s. (2009). metacognition in young children. new york, ny: routledge. livingston, j. a. (1997). metacognition: an overview. received from http://www.gse.buffalo.edu/fas/shuell/cep564/metac og.htm at 21.11.2008. martorella, p. h., beal, c. m. a., & bolıck, c. m. (2005). teaching social studies i̇n middle and secondary schools. new jersey: merrill prentice hall. mok, m. m. c., lung, c. l., cheng, d. p. w., cheung, h. p. c., & ng, m. l. (2006). self-assessment in higher education: experience in using a metacognitive approach in five case studies. assessment & evaluation in higher education. 31: 415–433. pennington, m. (2009). the dark side of the kwl reading strategy, (online), (http://penningtonpublishing.com/about.php) pesman, haki. (2010). development of a three tier test to asses ninth grade student’s misconception about simple electric circuit. thesis for master of sciences. middle east technical university, turkey. ruddel, martha knapp. (2005). teaching content reading and writing. hoboken: john wiley and sons, inc. slavin, r.,e. (2006). educational psychology; theory and practice. pearcon (8th edition). boston; pearson education inc. susantini, e., sumitro, s.b., corebima, a.d., and susilo, h., (2018a). the development of biology material resources by metacognitive strategy. asia pacific education review.16 (2): 401-411. susantini, e., indana, s, and isnawati (2018b). using metacognitive strategy to teach learning strategies a study of indonesian pre-service biology teacher. the new educational review.52 : 258-268. szabo, susan. (2006). kwhhl: a student-driven evolution of the kwl. american secondary education. 34 (3). tok, şukran. (2013).” effects of the know-want-learn strategy on students’ mathematics achievement, anxiety and metacognitive skills”. metacognition learning. 8: 193–212. http://www.gse.buffalo.edu/fas/shuell/cep564/metacog.htm%20at%2021.11.2008 http://www.gse.buffalo.edu/fas/shuell/cep564/metacog.htm%20at%2021.11.2008 http://www.gse.buffalo.edu/fas/shuell/cep564/metacog.htm%20at%2021.11.2008 http://www.gse.buffalo.edu/fas/shuell/cep564/metacog.htm%20at%2021.11.2008 http://penningtonpublishing.com/about.php http://penningtonpublishing.com/about.php http://penningtonpublishing.com/about.php 1 | wulandari dkk; keanekaragaman dan kelimpahan burung di cagar alam besowo jurnal riset biologi dan aplikasinya, volume 1, nomer 1, maret 2019 keanekaragaman dan kelimpahan jenis burung di kawasan cagar alam besowo gadungan dan sekitarnya kabupaten kediri jawa timur diversity and abundance of birds in cagar alam besowo gadungan and its surrounding kediri regency, east java province eka yosida wulandari, sunu kuntjoro* jurusan biologi, fakultas matematika dan ilmu pengetahuan alam, universitas negeri surabaya abstrak cagar alam besowo gadungan yang terletak di kabupaten kediri merupakan salah satu dari delapan belas wilayah cagar alam yang ada di provinsi jawa timur. cagar alam ini termasuk dalam kawasan konservasi dengan tipe ekosistem hutan hujan tropis daratan rendah. tujuan penelitian ini adalah mengevaluasi tingkat keanekaragaman, menganalisis kelimpahan jenis burung dan mengevaluasi daya dukung lingkungan di kawasan cagar alam besowo gadungan dan sekitarnya. metode yang digunakan adalah jalur transek dengan menentukan lima stasiun pengamatan. pengambilan data dilakukan enam kali pada bulan maret 2018 serta dua kali pengamatan yaitu pagi dan sore pukul 07.00-10.00 wib dan 14.00-17.00 wib. burung yang dijumpai diidenitifikasi berdasarkan ciri morfologi dan jumlah. data dianalisis berdasarkan indeks keanekragaman shannon-wienner dan kelimpahan relatif. hasil penelitian menunjukkan kawasan cagar alam besowo gadungan terdapat 38 jenis burung dengan indeks keanekeragaman 2,64 kategori sedang. jenis yang paling melimpah adalah collocalia linchi (38,20%), pycnonotus aurigaster (10,11%) dan pericrocotus cinnamomeus (5,62%). vegetasi yang mendukung keberadaan burung pada kawasan ini adalah albizia chinensis, aleurites moluccanus, alstonia scholaris, altingia excelsa, coffea arabica, hopea odorata, ficus annulata, ficus benjamina dan pinus merkusii. faktor fisik yang mendukung kehadiran burung pada pagi hari hingga sore hari suhu rata-rata 25,9-28,9ºc; kecerahan sebesar 1833,77-2279,68 lux dan kelembaban udara 56,23-60,97%. abstract cagar alam besowo gadungan kediri regency is one of eighteen existing nature reserves in east java province. this nature reserve belongs to a conservation area with a lowland tropical rainforest ecosystem type. the purposes of this study were to evaluate the level of diversity, analyze the abundance of bird species, and evaluate the carrying capacity of the environment in cagar alam besowo gadungan and its surrounding areas. the method used in this research was the transect line at five observation stations. the data were collected six times during march 2018 and two observations were morning and afternoon at 07.00-10.00 wib and 14.00-17.00 wib. birds encountered were identified by morphological features and numbers. data were analyzed based on shannon-wienner’s diversity index and relative abundance. the result of research showed that cagar alam besowo gadungan area there are 38 species of birds with 2.64 index of moderate category. the most abundant species of birds were collocalia linchi, pycnonotus aurigaster and pericrocotus cinnamomeus; the relative abundace were 38.20%, 10.11%, 5.62% respectively. the vegetation that supports birds in this region are albizia chinensis, aleurites moluccanus, alstonia scholaris, altingia excelsa, coffea arabica, hopea odorata, ficus annulata, ficus benjamina and pinus merkusii. the physical factors that support the presence of birds in the morning to late afternoon temperatures average 25.9-28.9ºc; brightness of 1833.772279.68 lux and air humidity 56.23-60.97%. how to cite: wulandari, y.e & kuntjoro, s. (2019). keanekaragaman dan kelimpahan jenis burung di kawasan cagar alam besowo gadungan dan sekitarnya kabupaten kediri jawa timur. jurnal riset biologi dan aplikasinya. 1 (1): 18-25. * correspondence author: jalan ketintang gedung c3 lt. 2 surabaya 60231, indonesia e-issn: 2655-9927 e-mail: sunukuntjoro@unesa.ac.id jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi history article received: 26 juli 2018 approved: 2 januari 2019 published: maret 2019 kata kunci: keanekaragaman; kelimpahan; cagar alam besowo, burung key words: diversity, abundance, cagar alam besowo, birds 19 | wulandari dkk; keanekaragaman dan kelimpahan burung di cagar alam besowo pendahuluan kawasan cagar alam besowo gadungan merupakan kawasan konservasi yang dikelola oleh bksda jawa timur dengan tipe hutan hujan tropis dataran rendah. jenis flora yang ditemukan pada cagar alam ini antara lain cembirit (ervatamia divaricata), kemiri (aleurites moluccana), pule (alstonia scholaris) dan rau (dracontomelon puberulum). selain itu terdapat beberapa jenis fauna seperti babi hutan (sus scrofa), kelelawar (pteropus vampirus), musang (paguma larvata) dan tupai (sciuvus notakas). fauna lain yang sering ditemukan pada lokasi tersebut adalah burung (bbksda jatim, 2018). keanekaragaman dan kelimpahan jenis burung dapat menunjukkan sebagai salah satu indikator suatu kawasan. burung menjadi salah satu indikator keanekaragaman hayati karena burung memiliki beberapa perilaku atau kebiasaan yang mendukung yaitu burung mempunyai berbagai habitat yang terletak di seluruh dunia dan burung memiliki kepekaan terhadap perubahan yang terjadi pada lingkungannya (fitri dkk, 2015). keberadaan burung dapat menunjukkan bahwa ekosistem tersebut masih memiliki ekosistem yang baik. penurunan kualitas lingkungan dapat mengganggu kelangsungan hidup burung (safanah dkk, 2017). pengelolaan ekosistem cagar alam yang baik dapat menunjang stabilitas iklim (sutarno dan setyawan, 2015). keanekaragaman hayati yang ada di dalam cagar alam memiliki manfaat bagi manusia maupun lingkungan. keberadaan burung memiliki peran dalam menjaga lingkungan mulai dari rantai makanan, jaring-jaring makanan dan proses alami yang terjadi di lingkungannya. berdasarkan hal tersebut dilakukan upaya dalam melestarikan lingkungan dan melakukan konservasi burung sangat dibutuhkan untuk melestarikan keberagaman jenisnya di alam (nugroho dkk, 2015). keanekaragaman jenis burung di alam memiliki daya tarik khusus bagi peneliti maupun pengamat burung yaitu berasal dari keunikan dan keindahannya (ahmad dkk, 2015). keanakearagaman burung pada suatu kawasan dapat disebabkan oleh tipe habitat serta vegetasi tumbuhan yang ada pada kawasan tersebut. pada beberapa tipe habitat burung memiliki perbedaan yang terlihat jelas yaitu banyak sedikitnya vegetasi yang tumbuh pada suatu lokasi dan jenis vegetasi yang tumbuh pada suatu kawasan dengan luasan tertentu (susanto, 2012). tipe habitat pada beberapa wilayah konservasi berupa suaka alam, cagar alam atau taman wisata alam memiliki kondisi habitat yang tidak jauh berbeda misalnya pada cagar alam yang terletak di pangandaran jawa barat memiliki tipe habitat hutan daratan rendah dengan jenis vegetasi yang hampir sama pada seluruh kawasan cagar alam (safanah dkk., 2017). menurut chrystanto dkk. (2014) kawasan konservasi cagar alam keling memiliki tiga tipe habitat yaitu habitat lahan basah berupa mangrove, habitat dengan vegetasi tumbuhan padang rumput dan habitat hutan alam sekunder. perbedaan habitat pada kawasan cagar alam memiliki kekhasan pada flora maupun fauna yang hidup pada habitat tersebut. cagar alam besowo memiliki jenis vegetasi yang khas sehingga dapat mendukung kehidupan burung. vegetasi pada suatu kawasan dapat menyebabkan perbedaan jenis burung yang terdapat di suatu kawasan. penelitian ini bertujuan untuk mengevaluasi tingkat keanekaragaman dan menganalisis tingkat kelimpahan jenis burung, dan di kawasan cagar alam besowo gadungan kediri sekitarnya, serta mengevaluasi daya dukung lingkungan kawasan tersebut dalam mendukung keberadaan burung. bahan dan metode penelitian ini termasuk penelitian deskriptif dengan teknik observasi secara langsung. pengamatan dilakukan tanggal 10 dan 11 maret 2018, 17 dan 18 maret 2018, 24 dan 25 maret 2018, pada pagi dan sore hari pukul 07.00–10.00 wib dan 14.00–17.00 wib. pengamatan dilakukan pada lima stasiun yaitu area pintu masuk cagar alam (stasiun 1), area kebun kopi dan hutang lindung perhutani kediri (stasiun 2), area hutan pinus merkusii (stasiun 3), area hutan lindung perhutani kediri (stasiun 4) dan area terbuka dekat bukit kura-kura (stasiun 5) (gambar 1). teknik yang digunakan observasi lapangan dengan metode jalur transek. jalur transek setiap stasiun sepanjang ±200 meter dengan titik pemberhentian setiap 50 meter, setiap titik pemberhentian dilakukan pengamatan selama ± 5-7 menit sehingga total waktu pengamatan setiap stasiun ± 20-24 menit. sepanjang jalur transek diamati, dicatat dan difoto burung yang melintas, terbang, bertengger berdasarkan ciri morfologi dan jumlah yang dijumpai. tim sampling terdiri atas lima orang dengan dua tugas yaitu dua peneliti mencatat dan mengukur faktor fisik (suhu, kelembapan dan kecerahan) tiga orang melakukan pengamatan burung. pengamatan burung dilakukan menggunakan teropong bushnell perbesaran 10x25 lensa 60-70 mm, kamera canon 1200d dengan lensa tele 75-250 mm, kamera prosumer nikon p900 perbesaran 83x, termohigrometer, luxmeter, tali jurnal riset biologi dan aplikasinya. 1(1): 18-25, maret 2019 | 20 rafia, meteran gulung, alat tulis, lembar catatan dan buku panduan lapangan karangan mckinnon dkk. (2010). data burung yang diperoleh dianalisis dengan menggunakan indeks keanekaragaman shannonwiener (odum, 1993), dengan rumus sebagai berikut. ln ni ni h n n =  keterangan: h’= indeks keanekaragaman shannon; ni= jumlah suatu jenis; n=jumlah seluruh jenis. kategori nilai indeks dari kenaekaragaman shannon – wiener (h’) adalah sebagai berikut. h’<1,0 memiliki makna keanekaragamannya termasuk dalam kategori rendah, 1,0 < h’ ≤ 3,322 memiliki makna keanekaragamannya termasuk dalam kategori sedang, dan h’> 3,322 memiliki makna keanekaragamannya termasuk dalam kategori tinggi. kelimpahan merupakan indikator yang berfungsi untuk mengetahui kepadatan individu dalam suatu kawasan dengan menggunakan rumus kelimpahan relatif (sriyanto, 2013): 𝐷𝑖 = 𝑛𝑖 𝑁 𝑥100% keterangan: di adalah kelimpahan relatif (%), ni adalah jumlah individu setiap jenis, dan n adalah jumlah total individu. gambar 1. stasiun penelitian keterangan: lokasi cagar alam besowo gadungan, kabupaten kediri. daya dukung lingkungan yang dianalisis adalah jenis vegetasi yang ada pada setiap stasiun dan pengukuran faktor fisik berupa suhu lingkungan, kelembaban dan kecerahan lingkungan. vegetasi dianalisis mengenai hubungan keberadaan vegetasi (pengaruh) tersebut terhadap kehadiran burung. vegetasi diamati pada setiap stasiun dengan diidentifikasi kemudian dideskripsikan. faktor fisik yang diukur berupa suhu lingkungan, kelembaban dan kecerahan lingkungan dianalisis berdasarkan hasil pengukuran yang didapatkan. hasil pengukuran yang didapatkan dianalisis dengan menghubungkan nilai yang didapatkan kemudian dihubungkan dengan kehadiran burung. hasil dan pembahasan berdasarkan hasil pengamatan di kawasan cagar besowo gadungan dijumpai 38 jenis burung jenis burung terdiri atas sembilan ordo antara lain accipitriformes, apodiformes, columbiformes, coraciiformes, cuculiformes, galliformes, passeriformes, piciformes dan stigiformes. famili yang ditemukan sebanyak 21 famili. di antara 38 jenis burung, terdapat lima jenis burung dengan status dilindungi berdasarkan peraturan menlhk nomer 92 tahun 2018 (tabel 1). data hasil pengamatan burung yang didapatkan teradapat perbedaan nilai indeks keanekaragaman pada setiap stasiun pengamatan. stasiun satu hingga lima memiliki nilai keanekaragaman sebesar 2,47; 1,58; 2,23; 2,01 dan 1,71 (tabel 2). nilai indeks keanekearagaman di cagar alam besowo gadungan sebesar 2,64 termasuk kategori sedang. kelimpahan relatif yang didapatkan pada setiap stasiun memiliki persentase yang berbeda. jenis burung yang paling banyak kemelimpahannya pada setiap stasiun adalah spesies walet linci (collocalia linchi) dengan persentase kelimpahan sebesar 38,20% dan cucak kutilang (pycnonotus aurigaster) dengan persentase kelimpahan sebesar 10,11% (tabel 3). berdasarkan hasil pengukuran faktor fisik yang dilakukan selama enam kali pengamatan pada pagi dan sore hari didapatkan perbedaan suhu, kecerahan maupun kelembapan udara. nilai rata-rata suhu seluruh stasiun pada pagi hari sebesar 28,9ºc, nilai kecerahannya sebesar 2279,68 lux dan kelembapan udaranya memiliki nilai 56,23%. sedangkan rata-rata pengukuran fisik pada saat sore hari pada seluruh stasiun kisaran suhunya 25,9⁰c, nilai kecerahan sebesar 1833,77 lux dan kelembapan udara pada sore hari sebesar 60,97% (tabel 4). jenis tumbuhan yang tumbuh pada stasiun pengamatan antara lain pohon beringin (ficus benjamina), beringin penkecik (ficus annulata), cengal pasir (hopea odorata), kemiri (aleurites moluccanus), kopi (coffea arabica), pule (alstonia scholaris), pinus (pinus merkusii), rasamala (altigia excelsa) dan sengon (albizia chinensis). pohon 21 | wulandari dkk; keanekaragaman dan kelimpahan burung di cagar alam besowo beringin dan kemiri banyak dijumpai di stasiun satu, pohon pule dan kopi dijumpai tumbuh pada stasiun dua. pohon cengal pasir dan rasamala banyak tumbuh di sekitar stasiun empat dan lima. pohon yang tumbuh pada stasiun satu memiliki ciri kanopi yang lebar dan memiliki daun yang lebat. akar dan batang besar dan kokoh. stasiun satu dijumpai pohon beringin dan kemiri. pohon pule memiliki batang yang besar dan kokoh namun kanopinya hanya lebat pada ujung batang. pohon pule dijumpai tumbuh pada stasiun dua dengan tanaman kopi. stasiun dua termasuk terbuka karena memiliki sedikit tumbuhan jenis pohon. stasiun tiga dijumpai pohon pinus dengan beberapa pohon telah mati akibat letusan gunung kelud pada tahun 2014 lalu. tabel 1. daftar burung yang dijumpai di kawasan cagar alam besowo gadungan dan sekitarnya no ordo famili spesies nama indonesia nama inggris 1. accipitriformes accipitridae nisaetus bartelsi* elang jawa javan hawk-eagle spilornis cheela* elang-ular bido crested serpent eagle 2. apodiformes apodidae collocalia linchi walet linchi cave swiftlet aerodramus maximus walet-sarang hitam black-nest swiftlet hemiprocne longipennis tepekong jambul grey-rumped treeswift 3. columbiformes columbidae macropygia emiliana uncal buau ruddy cuckoo-dove ptilinopus melanospilus walik kembang black-naped fruitdove streptopelia chinensis tekukur biasa spotted dove treron griseicauda punai penganten grey-cheeked greenpigeon 4. coraciiformes alcedinidae todiramphus chloris cecakak sungai collared kingfisher meropidae merops leschenaulti kirik-kirik senja chestnut-headed beeeater 5. cuculiformes cuculidae centropus bengalensis bubut alangalang lesser coucal rhamphococcyx curvirostris kadalan birah chestnut-breasted malkoha 6. galliformes phasianidae gallus gallus ayam hutan merah red junglefowl coturnix chinensis puyuh batu blue-breasted quail 7. passeriformes aegithina aegithina tiphia cipoh kacat common iora campephagidae pericrocotus cinnamomeus sepah kecil small minivet coracina fimbriata kepudang-sungu kecil lesser cuckooshrike cisticolidae prinia inornata perenjak padi plain prinia orthotomus sepium cinenen jawa olive-backed tailorbird dicaediae dicaeum trochileum cabai jawa scarlet-headed flowerpecker dicrurus paradiseus srigunting batu greater racket-tailed monarchidae hypothymis azurea kehicap ranting black-naped monarch nectariniidae anthreptes malacensis madu kelapa plain-throated sunbird cinnyris jugularis madu sriganti olive-backed sunbird pycnonotidae pycnonotus aurigaster cucak kutilang sooty-headed bulbul pycnonotus goiavier merbah terukcuk yellow-vented bulbul pycnonotus plumosus merbah belukar olive-winged bulbul rhipiduridae rhipidura javanica* kipasan belang malaysian pied fantail sittidae sitta frontalis mungkuk beledu velvet-fronted jurnal riset biologi dan aplikasinya. 1(1): 18-25, maret 2019 | 22 no ordo famili spesies nama indonesia nama inggris vangidae hemipus hirundinaceus jingjing batu black-winged flycatcher-shrike 8. piciformes capitonidae psilopogon javensis* takur tulung tumpuk lineated barbet picidae dendrocopos analis caladi ulam freckle-breasted woodpecker picoides moluccensis caladi tilik sunda pygmy woodpecker rampastidae psilopogon armillaris* takur tohtor flame-fronted barbet psilopogon duvaucelii takur tenggeret blue-eared barbet psilopogon haemacephalus takur ungkutungkut coppersmith barbet 9. stigiformes strigidae strix leptogrammica kukuk beluk brown wood-owl keterangan: (*) = burung yang dilindungi berdasarkan uu no. p.92 menlhk 2018. tabel 2. indeks keanekaragaman dan kelimpahan jenis setiap stasiun pengamatan di cagar alam besowo dan sekitarnya no stasiun indeks keanekaragaman kategori jumlah spesies spesies paling melimpah spesies paling sedikit kelimpahannya 1 1 2,47 sedang 26 walet linci, punai penganten dan jingjing batu cipoh kacat, cinenen jawa, srigunting batu, 2 2 1,58 sedang 12 sepah kecil, walet linci dan takur tenggeret walet-sarang hitam, tekukur biasa, jingjing batu 3 3 2,23 sedang 18 walet linci, caladi ulam dan sepah kecil cekakak sungai, bubut alang-alang dan kepudang-sungu kecil 4 4 2,01 sedang 14 walet linci, walet-sarang hitam dan uncal buau puyuh batu, sepah kecil dan punai penganten 5 5 1,71 sedang 9 walet linci, cucak kutilang dan madu sriganti elang jawa tabel 3. keanekaragaman dan kelimpahan jenis burung di kawasan cagar alam besowo gadungan dan sekitarnya. no spesies jumlah spesies ni/n ln ni/n ni/n.ln ni/n di (%) 1 nisaetus bartelsi 2 0,0032 -5,744605 -0,018383 0,32% 2 spilornis cheela 4 0,064 -2,748872 -0,175928 6,40% 3 collocalia linchi 238 0,382 -0,962335 -0,367612 38,20% 4 aerodramus maximus 23 0,0369 -3,299544 -0,121753 3,69% 5 macropygia emiliana 26 0,0417 -3,177254 -0,132492 4,17% 6 ptilinopus melanospilus 3 0,0048 -5,339139 -0,025628 0,48% 7 streptopelia chinensis 3 0,0048 -5,339139 -0,025628 0,48% 8 treron griseicauda 15 0,0241 -3,725543 -0,089786 2,41% 9 todiramphus chloris 2 0,0032 -5,744605 -0,018383 0,32% 10 merops leschenaulti 11 0,0177 -4,034191 -0,071405 1,77% 11 centropus bengalensis 1 0,0016 -6,437752 -0,010300 0,16% 23 | wulandari dkk; keanekaragaman dan kelimpahan burung di cagar alam besowo no spesies jumlah spesies ni/n ln ni/n ni/n.ln ni/n di (%) 12 rhamphococcyx curvirostris 14 0,0225 -3,794239 -0,085370 2,25% 13 gallus gallus 1 0,0016 -6,437752 -0,010300 0,16% 14 coturnix chinensis 5 0,008 -4,828314 -0,038627 0,80% 15 aegithina tiphia 2 0,0032 -5,744605 -0,018383 0,32% 16 pericrocotus cinnamomeus 35 0,0562 -2,878839 -0,161791 5,62% 17 coracina fimbriata 1 0,0016 -6,437752 -0,010300 0,16% 18 prinia inornata 12 0,0193 -3,947650 -0,076190 1,93% 19 orthotomus sepium 2 0,0032 -5,744605 -0,018383 0,32% 20 dicaeum trochileum 7 0,0112 -4,491842 -0,050309 1,12% 21 dicrurus paradiseus 1 0,0016 -6,437752 -0,010300 0,16% 22 hemiprocne longipennis 1 0,0016 -6,437752 -0,010300 0,16% 23 hypothymis azurea 1 0,0016 -6,437752 -0,010300 0,16% 24 anthreptes malacensis 3 0,0048 -5,339139 -0,025628 0,48% 25 cinnyris jugularis 16 0,0257 -3,661264 -0,094095 2,57% 26 pycnonotus aurigaster 63 0,1011 -2,291645 -0,231685 10,11% 27 pycnonotus goiavier 1 0,0016 -6,437752 -0,010300 0,16% 28 pycnonotus plumosus 1 0,0016 -6,437752 -0,010300 0,16% 29 rhipidura javanica 2 0,0032 -5,744605 -0,018383 0,32% 30 sitta frontalis 4 0,0064 -5,051457 -0,032329 0,64% 31 hemipus hirundinaceus 10 0,016 -4,135167 -0,066163 1,60% 32 psilopogon javensis 1 0,0016 -6,437752 -0,010300 0,16% 33 dendrocopos analis 32 0,0514 -2,968117 -0,152561 5,14% 34 picoides moluccensis 12 0,0193 -3,947650 -0,076190 1,93% 35 psilopogon armillaris 8 0,0128 -4,358310 -0,055786 1,28% 36 psilopogon duvaucelii 28 0,0449 -3,103318 -0,139339 4,49% 37 psilopogon haemacephalus 31 0,0498 -2,999740 -0,149387 4,98% 38 strix leptogrammica 1 0,0016 -6,437752 -0,010300 0,16% keterangan : jenis burung yang paling banyak nilai kelimpahannya. tabel 4. hasil rata-rata pengukuran faktor fisik seluruh stasiun no waktu pengamatan suhu (⁰c) kecerahan (lux) kelembapan udara (%) 1 pagi 28,9 2279,68 56,23 2 sore 25,9 1833,77 60,97 berdasarkan hasil pengamatan yang telah dilakukan didapatkan 38 jenis burung yang terdiri atas sembilan ordo, famili yang ditemukan sebanyak 21 famili. burung yang ditemukan merupakan jenis burung hutan maupun burung arboreal namun ada dua jenis burung air yang ditemukan yaitu cekakak sungai dan kirik-kirik senja. nilai indeks keanekeragaman di kawasan cagar alam besowo dan sekitarnya menunjukkan bahwa jenis burung yang dijumpai tersebut beraktifitas, bertempat tinggal di kawasan tersebut. berdasarkan hasil perhitungan keanekaragaman jenis burung di kawasan cagar alam besowo dan sekitarnya nilai keanekaragaman yang didapatkan adalah 2,64 termasuk kategori sedang. nilai keanekaragaman sangat berkaitan dengan seberapa banyak jenis yang dijumpai pada stasiun pengamatan. semakin banyak jenis yang ditemukan maka semakin tinggi nilai keanekaragaman yang didapatkan. selain itu nilai keankeragaman yang tinggi dipengaruhi oleh faktor lingkungan bahwa ekosistem pada hutan tropis termasuk dalam ekosistem yang memliki kondisi stabil (karim dkk., 2016). setiap stasiun yang diamati memiliki nilai keanekaragaman yang berbeda hal ini disebabkan oleh tumbuhan yang hadir dalam suatu bentang lingkup habitat tersebut dan faktor lingkungan memiliki pengaruh besar untuk jurnal riset biologi dan aplikasinya. 1(1): 18-25, maret 2019 | 24 mendatangkan burung yang ada pada suatu lokasi (rumanasari dkk, 2017). stasiun 1 nilai indeks keanekaragaman yang didapatkan 2,47, nilai tersebut termasuk kategori sedang. jenis tanaman yang tumbuh di area ini adalah pohon kemiri (aleurites moluccanus), pohon beringin (ficus benjamina), pohon rasamala (altingia excelsa), beringin pencecik (ficus annulata). stasiun ini termasuk dalam kategori yang cukup rimbun, sepanjang jalan dikelilingi oleh vegetasi berupa pohon dengan ukuran yang besar. jenis burung yang dijumpai pada stasiun satu sebanyak 24 jenis dengan jenis terbanyak adalah jingjing batu, punai penganten dan wallet linci (tabel 2). stasiun 2 dijumpai 12 jenis burung dengan nilai ideks keanekaragaman terendah dari pada stasiun lain yaitu 1,57 termasuk kategori sedang. vegetasi yang dijumpai pada stasiun ini adalah kebun kopi (coffea arabica) yang ditanam oleh warga sekitar lokasi stasiun. area stasiun dua dinominasi oleh pohon-pohon yang tinggi dengan jarak yang cukup jauh sehingga stasiun ini cukup terbuka. spesies yang ditemukan di stasiun ini termasuk dalam famili accripidae adalah elang jawa dan elang-ular bido. elang jawa memiliki kebiasaan terbang secara soliter dan biasa terbang di daerah terbuka atau pegunungan sedangkan elang-ular bido memiliki kebiasaan bersoaring ketika terbang (mac kinnon dkk., 2010). jenis lain yang dijumpai di stasiun ini adalah cucak kutilang, jingjing batu, sepah kecil, takur tohtor, takur tenggeret, tekukur biasa, puyuh batu, uncal buau, walet linci dan walet-sarang hitam. stasiun 3 dijumpai 17 jenis burung dengan nilai indeks keanekaragaman 2,23 termasuk kategori sedang. stasiun ini terdapat satu jenis vegetasi yaitu pinus merkusii. kondisi stasiun tiga memiliki vegetasi pohon dengan tajuk yang tidak rimbun sehingga termasuk dalam kawasan yang terbuka, sehingga dapat ditemukan jenis burung famili accripidae pada stasiun ini. selain itu karena seluruh vegetasi yang ada pada stasiun ini memiliki batang pohon yang berkayu maka batang tersebut biasa digunakan oleh burung pelatuk untuk bersarang atau hanya sekedar bertengger. stasiun 4 merupakan stasiun dengan kondisi lingkungan yang cukup rimbun dengan jenis vegetasi yang tumbuh pada stasiun ini didominasi oleh pohon rasamala (altingia excelsa) dan pohon cengal pasir (hopea odorata). jenis burung yang dijumpai di stasiun ini terdapat 14 jenis. nilai indeks keanekaragaman yang diperoleh pada stasiun ini sebesar 2,01 termasuk kategori sedang. jenis burung yang dijumpai pada stasiun ini antara lain cabai jawa, kadalan birah, takur tulung-tumpuk, punai penganten dan uncal buau. stasiun terakhir adalah stasiun 5 dengan vegetasi yang cukup jarang yaitu hanya ditemukan vegetasi jenis pohon rasamala dan cengal pasir. pada stasiun ini dijumpai elang jawa saat terbang kemudian bertengger. lokasi ini termasuk terbuka dengan kanopi pada pohon tidak seluruhnya tertutup. pada stasiun ini juga berdekatan dengan air terjun yang berasal dari gunung kelud sehingga dijumpai satu jenis burung air yaitu kiri-kirik senja. vegetasi yang sering dijumpai adalah pohon rasamala sering digunakan untuk bertengger beberpa jenis burung passerine yang dijumpai misalnya kadalan birah, punai penganten, uncal buau dan walik kembang. menurut nainggolan dkk (2015) strutur vegetasi sangat mempengaruhi terbentuknya habitat burung yang berada di kawasan hutan. struktur tajuk pada pohon yang membentuk kanopi juga dapat mempengaruhi kehadiran burung pada lingkungan tersebut. salah satu jenis pohon dengan kanopi sangat pendek serta memiliki batang tinggi dan berkayu adalah pinus merkusii. pohon pinus merkusii yang dijumpai hanya pada stasiun tiga, jarak antar pohon cukup jauh sehingga dapat menarik perhatian burung jenis pelatuk untuk bersarang di pohon pinus. burung pelatuk sangat menyukai jenis pohon berkayu yang digunakan untuk membuat lubang dengan mematukkan paruhnya sehingga dapat dibuat sarang (kusuma, 2017). selain jenis burung pelatuk beberapa jenis lain sering bertengger di pohon pinus adalah cucak kutiang, cekakak sungai, cinenen jawa, kepudang-sungu kecil, punai penganten, munguk beledu, perenjak padi dan sepah kecil. pohon dengan struktur kanopi yang cukup lebat adalah pohon beringin dan pohon pule. pohon beringin yang dijumpai memiliki akar yang menggantung (akar udara) serta memiliki batang kokoh dan kuat. struktur tajuk pohon ini sangat lebat dan rimbun daunnya sehingga dapat digunakan untuk bersembunyi beberapa jenis burung yang sensitif terhadap kehadiran manusia. burung kukuk beluk dijumpai bertengger pada pohon beringin sangat rimbun sehingga dapat menyembunyikan burung predator ini dari burung lain maupun mangsa yang diburunya (prasetya dan siswoyo, 2017). simpulan hasil penelitian menunjukkan bahwa kawasan cagar alam besowo gadungan dan sekitarnya 25 | wulandari dkk; keanekaragaman dan kelimpahan burung di cagar alam besowo dijumpai 38 jenis terdapat 21 famili dan sembilan ordo. keanaekaragaman pada kawasan ini termasuk dalam kategori sedang. kelimpahan jenis yang dijumpai pada kawasan cagar alam besowo dan sekitarnya yaitu jenis walet linci (collocalia linchi) 38,20%, cucak kutilang (pycnonotus aurigaster) 10,11% dan sepah kecil (pericrocotus cinnamomeus) 5,62%. lingkungan pada kawasan cagar alam besowo dan sekitarnya mendukung adanya keberadaan burung mulai dari aspek vegetasi yang dijumpai delapan jenis antara lain albizia chinensis, aleurites moluccanus, alstonia scholaris, altingia excelsa, coffea arabica, hopea odorata, ficus annulata, ficus benjamina danpinus merkusii. faktor fisik yang mendukung kehadiran burung pada pagi hari hingga sore hari suhu rata-ratanya 25,9-28,9⁰c; kecerahan sebesar 1833,77-2279,68 lux dan kelembapan udaranya 56,23-60,97%. ucapan terima kasih terima kasih kepada bbksda jatim untuk proses perizinan dan pendampingan selama pengambilan data berlangsung dan teman-teman dari kelompok studi srigunting biologi unesa yang telah membantu dalam proses pengambilan data. daftar pustaka ahmad, z., sinyo, y., ahmad, h., tamalene, m.n., papuangan, n., abdullah, a., bahtiar & hasan s. (2017). keanekaragaman jenis burung di beberapa obyek wisata kota ternate: upaya mengetahui dan konservasi habitat burung endemik. jurnal saintifika mipa. 1 (1). anonim. (2018). undang-undang republik indonesia nomor p.92 tahun 2018 tentang jenis tumbuhan dan satwa yang dilindungi, http://ksdae.menlhk.go.id/news/peraturan/p.922018-tsl-rev. diakses pada tanggal 17 oktober 2018. bksda jawa timur. (2018). cagar alam besowo gadungan. http://bbksdajatim.org/ca-besowogadungan-1508/ diakses pada tanggal 15 januari 2018. chrysanto, s. asiyatun, m.r. (2014). keanekaragaman jenis avifauna di cagar alam keling ii/iii kabupaten jepara jawa tengah. indonesian journal of conservation. 3 (1): 1-6. fitri, l.m., handika, h., & solina, i.d. (2015). burung strata bawah (understory) di hutan pegunungan taman nasional kerinci seblat (tnks) kerinci jambi. jurnal saintek. 8 (1) 82-85. karim, n.h.a & hamzah, a.s. (2016). keanekaragaman dan status konservasi spesies avifauna pada suaka margasatwa mampie, kabupaten polewali mandar, sulawesi barat. bioscientiae. 13 (1) : 1-10. kusuma, c & melyanti, r. (2017). keragaman komposisi jenis dan struktur vegetasi pada kawasan hutan lindung dengan pola phbm di bkph tampomas, kph sumedang, perum perhutani divisi regional jawa barat dan banten. jurnal silvikultur tropika. 8 (2) : 123-129. mackinnon, j., phillipps, k & balen, b.v. (2010). panduan lapangan pengenalan burung-burung di sumatera, jawa, bali dan kalimantan. bogor: burung indonesia. nainggolan, f.h, dewi, b.s & darmawan, a. (2015). “keanekaragaman jenis burung: studi kasus di hutan desa cugung kesatuan pengelolaan hutan lindung model gunung rajabasa kabupaten lampung selatan”. makalah disajikan dalam seminar nasional & teknologi vi, lampung, 3 november. nugroho, a.s., t. anis, m. ulfah. (2015). analisis keanekaragaman jenis tumbuhan berbuah di hutan lindung surokonto, kendal, jawa tegah dan potensinya sebagai kawasan konservasi burung. pros sem nas masy biodiv indon. 1 (3): 472-476. odum. (1993). ekologi umum. new york : mcgraw hill. prasetya, k.n & siswoyo, a. (2017). burung-burung taman nasional bromo tengger semeru. balai besar taman nasional bromo tengger semeru. penerbit ediide infografika: malang. rumanasari, r.d., saroyo & katili, d.y. (2017). biodiversitas burung pada beberapa tipe habitat di kampus universitas sam ratulangi. jurnal mipa unsrat online. 6 (1): 43-46. safanah, n.g., c.s. nugraha, r. partasasmita dan t. husodo. (2017). keanekaragaman jenis burung di taman wisata alam dan cagar alam pananjung pangandaran jawa barat. pros sem nas masy biodiv indon. 3 (2): 266-272. sutarno dan setyawan a.d. (2015). biodiversitas indonesia: penurunan dan upaya pengelolaan untuk menjamin kemandirian bangsa. pros sem nas masy biodiv indon. 1(1): 1-13. sriyanto a, 2013. perencanaan dan perancangan survey keanekaragaman hayati. bandung: icwrmipcwmbc. susanto, a. (2012). struktur komposisi vegetasi kawasan cagar alam manggis gadungan. agri-tek. 13 (2): 7887. 25 http://ksdae.menlhk.go.id/news/peraturan/p.92-2018-tsl-rev http://ksdae.menlhk.go.id/news/peraturan/p.92-2018-tsl-rev http://ksdae.menlhk.go.id/news/peraturan/p.92-2018-tsl-rev http://ksdae.menlhk.go.id/news/peraturan/p.92-2018-tsl-rev http://bbksdajatim.org/ca-besowo-gadungan-1508/ http://bbksdajatim.org/ca-besowo-gadungan-1508/ http://bbksdajatim.org/ca-besowo-gadungan-1508/ http://bbksdajatim.org/ca-besowo-gadungan-1508/ jurnal riset biologi dan aplikasinya. 1(2): 87-91, september 2019 |87 jurnal riset biologi dan aplikasinya, volume 1, nomor 2, september 2019 aklimatisasi tanaman hasil eksplorasi tahura r. soerjo dan pulau yamdena di kebun raya purwodadi the acclimatization of plants exploration results from tahura r. soerjo and yamdena island in purwodadi botanic garden apriyono rahadiantoro1 dan nita dwi indahsari2 1*purwodadi botanic garden, research center for plant conservation and botanic gardens, indonesian institute of sciences indonesia (lipi), purwodadi-pasuruan 2jurusan biologi, fakultas sains dan teknologi, universitas airlangga, surabaya abstrak kebun raya purwodadi sebagai lembaga konservasi exsitu yang mengoleksi berbagai jenis tumbuhan terutama dataran rendah kering kembali mengirimkan tim eksplorasi di beberapa kawasan hutan di indonesia. tanaman hasil eksplorasi tersebut sebelum menjadi tanaman koleksi membutuhkan proses adaptasi terhadap kondisi lingkungan baru yang dikenal dengan istilah aklimatisasi tanaman. proses tersebut dapat berlangsung lama dan menjadi salah satu tahapan yang kritis dalam konservasi tumbuhan dikarenakan adanya tingkat kelangsungan hidup tanaman. tujuan penelitian ini adalah untuk menentukan tingkat ketinggian hidup tanaman dari tahura r. soerjo dan pulau yamdena serta mempelajari faktor-faktor yang mempengaruhinya. berdasarkan hasil penelitian diketahui bahwa tingkat kelangsungan hidup tanaman di kedua lokasi tersebut berbeda. tanaman tahura r. soerjo memiliki tingkat kelangsungan hidup yang lebih tinggi dibandingkan pulau yamdena. berdasarkan analisis, faktor-faktor yang mempengaruhi tingkat kelangsungan hidup tanaman pada kedua lokasi tersebut lebih dikarenakan oleh kondisi iklim mikro lokasi asal dibandingkan zona ketinggiannya, sedangkan untuk jenis material tanaman masih dibutuhkan penelitian lebih lanjut. abstract purwodadi botanic garden as an exsitu conservation area again explored plants in several forest areas in indonesia. plants that are explored to become a collection plant must go through a process of adaptation to new environment known as the acclimatization process. the process can take place in quite a long time and is one of the critical stages in plant conservation activities because it is related to the survival rate of plants. the purposes of this research were to determine the survival rates of plant from tahura r. soerjo, yamdena island and describe the factors influence it. based on research it is known that the survival rates of plants in the two locations are different. tahura r. soerjo plant has a survival rate which is higher than yamdena island. based on the analysis, the factors that affect the survival rate of plants at the two locations are caused by microclimate conditions than the altitude zone, while for the type of plant material, further research is needed. how to cite: rahardiantoro, a & indahsari, n.d. (2019). aklimatisasi tanaman hasil eksplorasi tahura r. soerjo dan pulau yamdena di kebun raya purwodadi. jurnal riset biologi dan aplikasinya. 1 (2): 87-91. *correspondence author: e-issn 2655-9927 kebun raya purwodadi, jln. raya malang-surabaya km 65, purwodadi. e-mail: onoy29@gmail.com jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi history article received : 29 juli 2019 approved : 9 agustus 2019 published : 30 september 2019 keywords: exsitu conservation; tahura r. soerjo; yamdena island; acclimatization; purwodadi botanic garden; survival rates kata kunci konservasi exsitu; tahura r. soerjo; pulau yamdena; aklimatisasi; kebun raya purwodadi; tingkat kelangsungan hidup 88| rahardiantoro & indahsari. aklimatisasi tanaman hasil eksplorasi tahura r. soerjo dan pulau yamdena pendahuluan kebun raya purwodadi merupakan kawasan konservasi eksitu yang mana kegiatan pelestarian tumbuhannya dilakukan di luar habitat asli. jenisjenis tumbuhan kawasan dataran rendah kering menjadi ciri khas kebun raya tersebut (lestarini dkk., 2012). sebagai lembaga konservasi eksitu, kebun raya purwodadi berperan penting dalam berbagai fungsi konservasi meliputi eksplorasi tumbuhan, pengelolaan koleksi tumbuhan, penelitian dan pengembangan konservasi tumbuhan dataran rendah kering. dalam kaitannya dengan fungsi tersebut, kebun raya purwodadi kembali mengirimkan tim eksplorasi tumbuhan di beberapa kawasan di indonesia, salah satunya taman hutan raya (tahura) r. soerjo di lereng gunung arjuno, jawa timur dan hutan pulau yamdena di kepulauan tanimbar, maluku tenggara barat. untuk menjadi koleksi kebun, tanaman hasil eksplorasi tersebut harus melalui beberapa tahap yang cukup lama agar dapat beradaptasi pada lingkungan baru. tahapan tersebut lebih dikenal dengan istilah proses aklimatisasi tanaman. dalam mendukung proses aklimatisasi, kebun raya purwodadi membentuk subunit khusus yang dinamakan subunit bidang aklimatisasi. acuan utama subunit tersebut adalah menyediakan bibit yang siap untuk ditanam kebun. proses aklimatisasi bertujuan untuk membantu tanaman hasil eksplorasi agar dapat beradaptasi pada kondisi lingkungan yang baru, dalam hal ini ada area kebun (trimanto, 2012). dalam proses aklimatisasi perlu dilakukan monitoring secara berkala untuk mengetahui tingkat kelangsungan hidup tanaman hasil eksplorasi dan mempelajari faktor-faktor apa yang mempengaruhinya. tujuan dari penelitian ini adalah mengetahui tingkat kelangsungan hidup tanaman dari tahura r. soerjo dan pulau yamdena serta mempelajari faktor-faktor yang mempengaruhinya. bahan dan metode kegiatan aklimatisasi dan monitoring tanaman hasil eksplorasi dilakukan di area rumah kaca, subunit aklimatisasi, pengembangan dan kompos, kebun raya purwodadi-lipi. proses monitoring dilakukan pada desember 2018. metode yang digunakan pada penelitian ini yaitu menggunakan teknik observasi untuk mengetahui tingkat kelangsungan hidup tanaman hasil eksplorasi serta wawancara dan studi literatur untuk mempelajari faktor-faktor apa saja yang mempengaruhnya. alat yang digunakan dalam proses monitoring meliputi pengukur intensitas cahaya matahari (luxmeter), pengukur keasaman media (ph meter tanah) pengukur suhu udara (thermometer), pengukur kelembaban udara (higrometer), kamera, label dan alat tulis. parameter yang diamati meliputi jumlah tanaman asal, jumlah tanaman yang hidup pada saat monitoring, jenis material tanaman dan faktorfaktor lingkungan yang mempengaruhinya meliputi intensitas cahaya, suhu dan kelembaban udara. tingkat kelangsungan hidup tanaman dihitung menggunakan rumus persentase tanaman yang hidup. persentase tanaman yang hidup (%) = jumlah bibit yang hidup pada saat monitoring x 100 % jumlah bibit awal hasil dan pembahasan proses aklimatisasi merupakan salah satu tahap kritis dalam kegiatan konservasi tumbuhan di indonesia yang menentukan apakah suatu tanaman dapat beradaptasi dengan baik atau tidak terhadap lingkungan baru. menurut trimanto (2012), proses aklimatisasi di kebun raya purwodadi secara umum dilakukan melalui proses penanaman material tanaman hasil eksplorasi pada media pasir dan pemberian sungkup selama beberapa bulan. media pasir sering digunakan sebagai media tumbuh bibit hasil eksplorasi karena mempunyai berbagai keunggulan. media pasir memiliki porositas yang tinggi sehingga membantu pertumbuhan akar dan memudahkan proses penggantian media sehingga tanaman tidak mengalami stress berlebih. media pasir yang minim nutrisi atau unsur hara memiliki keuntungan yaitu mengurangi pertumbuhan tanaman gulma di sekitar material tanaman hasil eksplorasi. hal tersebut telah sesuai yang disampaikan oleh febrianto (2015) bahwa beberapa syarat media yang baik untuk aklimatisasi antara lain aerasi yang baik untuk memudahkan pertumbuhan akar dan tidak mudah ditumbuhi jamur. untuk menyiasati rendahnya unsur hara maka material tanaman khususnya dari material bibit atau stek perlu ditambahkan zat penumbuh akar. pemberian zat penumbuh akar bisa dilakukan dengan merendam bagian akar atau batang stek kedalam media penumbuh akar. khusus material tanaman dari biji atau umbi tidak perlu diberikan zat penumbuh akar dikarena material tanaman tersebut memiliki cadangan makan sendiri untuk tumbuh dan berkembang. kelebihan tersebut menjadikan media pasir sering digunakan sebagai media untuk proses perkecambahan biji. jurnal riset biologi dan aplikasinya. 1(2): 87-91, september 2019 |87 proses penyungkupan material tanaman dilakukan secara bertahap yaitu diawali penyungkupan 100 %, lalu penyungkupan 50 % hingga sungkup dibuka secara total. proses penyungkupan tersebut bertujuan menjaga kelembaban udara iklim mikro bibit tanaman dan disesuaikan dengan keadaan kondisi lingkungan di sekitarnya. setelah proses penyungkupan bertahap maka dilakukan pemindahan tanaman ke dalam media polybag di area pembibitan. media polybag yang digunakan bervariasi komposisi bahannya. untuk bibit pohon, komposisi sekam, katel, dan kompos adalah dengan perbandingan 1 : 2 : 1 sedangkan tanaman herba dan paku terestrial 2 : 1 : 1 (permatasari & rahadiantoro, 2015; trimanto & rahadiantoro, 2017). febrianto (2015) menyatakan bahwa beberapa syarat media yang baik adalah memiliki kemampuan menahan air yang tinggi dan aerasi yang baik. katel atau tanah endapan sungai mempunyai sifat sebagai penahan air yang tinggi, sementara sekam dan kompos berfungsi agar pertukaran udara (aerasi) berlangsung dengan yang baik dan kebutuhan unsur hara atau nutrisi tanaman tercukupi. selain itu perawatan bibit tanaman meliputi penyiraman, penyiangan dari tanaman gulma, dan penyemprotan hama perlu dilakukan secara rutin hingga tanaman siap ditanam di kebun. tingkat kelangsungan hidup tanaman hidup hasil eksplorasi tahura r. soerjo lebih tinggi jika dibandingkan pulau yamdena. jenis material tanaman juga mempengaruhi tingkat kelangsungan hidup tanaman. untuk tanaman hasil eksplorasi yang berasal dari pulau yamdena, jenis material biji merupakan salah satu penyebab penurunan nilai persentase tanaman yang hidup yaitu dari 47,8 % menjadi 33 % (tabel 1). jenis material tertentu terutama biji lebih sulit untuk ditentukan berapa jumah tanaman yang hidup karena sulit dibedakan biji yang dorman dan mati. berapa jenis biji tanaman memiliki kulit yang keras dan masa dorman yang sangat lama. selain dari jenis material tanaman, parameter lain yang bisa diamati adalah kondisi lingkungan atau habitat asal tanaman meliputi ketinggian lokasi (topografi), kerapatan vegetasi pohon penyusun hutan dan kondisi lingkungan (iklim mikro) yang terbentuk di dalamnya (tabel 2). lokasi tahura r. soerjo tergolong kawasan hutan pegunungan bawah (submontana) dengan ketinggian sekitar 1.000 1.400 m dpl (meter di atas permukaan laut) dengan kondisi vegetasi pohon cenderung jarang dan kondisi lingkungan yang terbuka serta relatif kering. sementara hutan pulau yamdena merupakan kawasan hutan dataran rendah dengan ketinggian sekitar 50-300 m dpl dengan kondisi vegetasi pohon rapat dan kondisi lingkungan sekitar yang cenderung ternaung dan memiliki kelembaban udara yang relatif tinggi (irawanto dkk., 2018). selain itu, berdasarkan pengamatan di hutan, kondisi serasah tanah juga sangat berbeda di kedua lokasi tersebut. hutan pulau yamdena memiliki serasah yang tebal dan banyak dijumpai anakan pohon sedangkan tahura r. soerjo lebih tipis sedikit dijumpai anakan pohon. berdasarkan pengamatan kondisi lingkungan diketahui bahwa tahura r. soerjo walaupun berada pada zona ketinggian submontana. dalam hubungannya dengan kesesuaian habitat bagi tanaman maka hutan r. soerjo lebih sesuai dibandingkan hutan yamdena walaupun segi ketinggian lokasi berbeda. berdasarkan pengamat lebih mendalam dapat diketahui bahwa kondisi lingkungan atau iklim mikro yang terbentuk di dalam hutan mempunyai pengaruh yang kuat terhadap karakter vegetasi tumbuhan, terutama kondisi kelembaban udara atau bagaimana kondisi serasah lantai hutan di dalamnya maka masingmasing jenis tanaman memiliki relung ekologis yang spesifik. persentase tanaman yang hidup tahura r. soerjo berdasarkan jenis material tanamannya bervariasi. persentase tanaman yang hidup tertinggi secara berurutan disumbangkan oleh jenis material umbi, biji dan anakan dengan nilai masingmasing 100 %, 88 % dan 77 % (gambar 1). nilai persentase tanaman yang hidup terendah adalah dimiliki jenis material stek sebesar 53 %. permatasari & rahadiantoro (2015) menyatakan bahwa nilai persentase tanaman hidup tahura r. soerjo relatif lebih tinggi dibandingkan pulau sempu (71,48 %). berdasarkan analisis lebih mendalam, presentase kematian tanaman terbesar adalah ketika proses pemindahan material tanaman dari bak pasir ke lokasi pembesaran bibit. hal tersebut bisa terjadi karena tanaman mengalami stress atau kondisi lingkungan sangat berbeda dengan habitat asli. persentase hidup jenis material yang rendah juga bisa disebabkan oleh faktor lain. jenis material umbi dan biji memiliki persentase hidup tanaman yang tinggi dikarenakan material umbi dan biji tersebut memiliki cadangan makanan yang cukup untuk proses pertumbuhan tanaman. jenis material tanaman stek terkenal memiliki tingkat kematian yang tinggi. kebanyakan material tanaman jenis stek mengalami mati akar atau kering batang. 90| rahardiantoro & indahsari. aklimatisasi tanaman hasil eksplorasi tahura r. soerjo dan pulau yamdena jurnal riset biologi dan aplikasinya. 1(2): 87-91, september 2019 |89 88| rahardiantoro & indahsari. aklimatisasi tanaman hasil eksplorasi tahura r. soerjo dan pulau yamdena tabel 1. tingkat kelangsungan hidup hasil eksplorasi kebun raya purwodadi tabel 2. kondisi lingkungan di kedua lokasi eksplorasi dan kebun raya purwodadi gambar 1. data tanaman tahura r. soerjo yang hidup berdasarkan jenis material tanamannya gambar 2. data tanaman pulau yamdena yang hidup berdasarkan jenis material tanamannya lokasi jenis material tanaman (anakan, stek, umbi atau biji) semua tanpa material biji tahura r. soerjo 73,8 % 71,8 % pulau yamdena 33 % 47,8 % lokasi zona ketinggian ( m dpl) kondisi iklim mikro vegetasi pohon dan ketebalan serasah kelembaban udara (%) intensitas cahaya (lux) suhu udara (oc) tahura r. soerjo submontana (1000-1400 ) jarang, lapisan humus tipis kering (60-70) 1.000-40.000 (sedang) 23-25 hutan pulau yamdena dataran rendah (50-300) rapat, lapisan humus tebal lembab (78-82 ) 160 -413 (rendah) 29-32 kebun raya purwodadi dataran rendah (300 ) jarang, lapisan humus tipis kering (65-73 ) 2.000-100.000 (tinggi) 30-34 90| rahardiantoro & indahsari. aklimatisasi tanaman hasil eksplorasi tahura r. soerjo dan pulau yamdena 88| rahardiantoro & indahsari. aklimatisasi tanaman hasil eksplorasi tahura r. soerjo dan pulau yamdena trimanto (2012) menyatakan bahwa salah satu faktor yang penting dalam aklimatisasi adalah pertumbuhan akar. penentuan tanaman untuk stek yang kurang baik berakibat pada ketidakmampuan tanaman untuk menumbuhkan akar. hal tersebut merupakan penyebab tanaman stek kering dan mati. persentase tanaman yang hidup dari pulau yamdena cenderung rendah. persentase tanaman hidup jenis material anakan hanya 58 % atau separuh bibit tanaman yang masih bertahan hidup, kemudian dilanjutkan umbi, biji dan stek masingmasing 25 %, 12 % dan 0 (gambar 2). untuk jenis material stek, tidak ditemukan tanaman yang hidup. hal tersebut dapat mengindikasikan adanya ketidaksesuai habitat yang sangat mencolok antara kebun raya purwodadi dan pulau yamdena, salah satunya terutama adalah tingkat kelembaban udara. kondisi kelembaban udara yang lebih kering dibandingkan dengan habitat asal mengakibatkan batang (stek) tanaman mengalami stress berlebih sehingga proses pembentukan akar terganggu lalu tanaman jadi kering dan mati. persentase hidup jenis material yang rendah juga bisa disebabkan oleh faktor lain. jenis material biji relatif lebih sulit untuk apakah biji tersebut berada dalam fase dorman atau mati sehingga biji yang tidak berkecambah dianggap tidak tumbuh saat dilakukan monitoring. simpulan berdasarkan hasil penelitian diketahui bahwa tingkat kelangsungan hidup tanaman di kedua lokasi tersebut berbeda. tanaman tahura r. soerjo memiliki tingkat kelangsungan hidup yang lebih tinggi dibandingkan pulau yamdena. berdasarkan analisis, faktor-faktor yang mempengaruhi tingkat kelangsungan hidup tanaman pada kedua lokasi tersebut lebih dikarenakan oleh kondisi iklim mikro habitat asal dibandingkan zona ketinggiannya. tahura r. soerjo secara keseluruhan memiliki kondisi iklim mikro yang lebih mirip kebun raya purwodadi dibandingkan pulau yamdena. sedangkan jenis material tanaman secara keseluruhan masih dibutuhkan penelitian lebih mendalam apakah berpengaruh terhadap kelangsungan hidup tanaman. hasil penelitian tersebut diharapkan dapat digunakan sebagai dasar rekomendasi perbaikan teknik aklimatisasi tanaman yang dilakukan di kebun raya. daftar pustaka irawanto r, rahadiantoro a, mudiana d, suhadinoto, sumaji, rumadi, huda a, sampu, saniman, purnomo d, gizano r. (2018). taman hutan r. soerjo sebagai ikon ekosistem hutan pegunungan tersisa di pulau jawa. program kerjasama konservasi tumbuhan bkt kebun raya purwodadi-pt gudang garam tbk. febrianto, r. s & syamsuardi. (2015). aklimatisasi planlet kantong semar (nepenthes gracilis korth.) pada berbagai campuran media tanam tanah ultisol. jurnal biologi universitas andalas 4 (2): 96-101. doi: https://doi.org/10.25077/jbioua.4.2.%25p.20 15. permatasari i & rahadiantoro a. (2015). tahap aklimatisasi dan monitoring tanaman hasil eksplorasi pulau sempu: blok waru-waru di kebun raya purwodadi. prosiding seminar nasional biologi / ipa dan pembelajarannya. universitas negeri malang. diakses dari https://docplayer.info/67651129-tahapaklimatisasi-dan-monitoring-tanaman-hasileksplorasi-pulauu-sempu-blok-waru-waru-dipurwodadi.html. trimanto & rahadiantoro a. (2017). acclimatization of plant collection from moyo island forest, west nusa tenggara, indonesia at purwodadi botanic garden. trop drylands, 1: 43-49. doi: https://doi.org/10.13057/tropdrylands/t010 107. trimanto t. (2012). aklimatisasi tumbuhan hasil eksplorasi dan perbanyakan tanaman unit seleksi dan pembibitan kebun raya purwodadi. prosiding seminar nasional x pendidikan biologi. fkip uns. diakses dari https://jurnal.fkip.uns.ac.id/index.php/prosb io/article/view/3194. lestarini w, matrani, sulasmi, trimanto, fauziah, fiqa ap. (2012). an alphabetical list of plant species cultived in the purwodadi botanic garden. purwodadi botanic garden, pasuruan. diakses dari http://www.krpurwodadi.lipi.go.id/unduhan /katalog_rumahkaca_2016_krp.pdf. 92 jurnal riset biologi dan aplikasinya. 1(2): 87-91, september 2019 |91 https://doi.org/10.25077/jbioua.4.2.%25p.2015 https://doi.org/10.25077/jbioua.4.2.%25p.2015 http://www.krpurwodadi.lipi.go.id/unduhan/katalog_rumahkaca_2016_krp.pdf http://www.krpurwodadi.lipi.go.id/unduhan/katalog_rumahkaca_2016_krp.pdf jurnal riset biologi dan aplikasinya. 1(2): 64-70, september 2019 | 20 jurnal riset biologi dan aplikasinya, volume 1, nomor 2, september 2019 perbandingan morfologi adipose-derived stem cells asal donor diabetes melitus tipe 2 dalam medium mengandung platelet-rich plasma dan fetal bovine serum morphology comparison of adipose-derived stem cells from type 2 diabetes mellitus donor on media contained platelet-rich plasma and fetal bovine serum karina1,2,3*, imam rosadi1, siti sobariah1, iis rosliana1, komang a. wahyuningsih1,2,4, tias widyastuti1, irsyah afini1 1hayandra lab, yayasan hayandra peduli, jakarta, indonesia, 2klinik hayandra, yayasan hayandra peduli, jakarta, indonesia, 3biomedik, universitas indonesia, jakarta, indonesia, 4histologi, universitas katolik indonesia atma jaya, jakarta, indonesia abstrak salah satu terapi luka pada diabetes melitus tipe 2 adalah terapi sel punca. lingkungan mikro bagi sel termasuk sel punca, dapat rusak akibat komplikasi dari diabetes. lingkungan mikro yang rusak tersebut dapat menyebabkan penuaan (senescent) dini pada sel punca. studi ini bertujuan untuk menganalisis pengaruh morfologi adipose-derived stem cells (adscs) dari donor diabetes mellitus tipe 2 dalam medium yang mengandung platelet-rich plasma (prp). tahapan studi yang dilakukan yaitu menghitung variasi densitas awal adscs. densitas awal untuk kultur adscs adalah 5,000; 10,000; dan 20,000 sel pada setiap kelompok. hasilnya menunjukkan bahwa morfologi adscs dalam medium prp umumnya lebih kecil dibandingkan morfologi adscs dalam medium fbs pada berbagai jumlah densitas awal adscs yang dikultur. morfologi adscs kelompok prp didapatkan semakin kecil luas morfologinya pada densitas kultur awal sel yang besar (20,000 = 0,014 mm2; 10,000 = 0,016 mm2; 5,000 = 0,018 mm2) begitu juga kelompok fbs (20,000 = 0,032 mm2; 10,000 = 0,032 mm2; 5,000 = 0,036 mm2). luas ukuran adscs yang dikultur menggunakan fbs jauh lebih besar dibandingkan prp dan berbeda bermakna pada densitas jumlah sel awal yang dikultur sebanyak 20,000 sel ( p <0,05). berdasarkan hasil tersebut menunjukkan bahwa morfologi adscs yang dikultur dengan kerapatan densitas 20,000 sel dalam medium prp memiliki ukuran sel yang lebih kecil secara signifikan dibandingkan medium fbs. abstract type 2 diabetes mellitus (t2dm) wound can be repaired by using stem cells therapy, but the complications of diabetes can damage the stem cells microenvironment. the damage can cause premature aging of stem cells. the study aimed to determine the effect of adipose-derived stem cells (adscs) morphology isolated from t2dm and supplemented with platelet-rich plasma (prp) medium. in this study, the variation of initial adscs density was conducted. the initial density of adscs was 5,000; 10,000; and 20,000 cells in each group. the morphology adscs in the prp medium was smaller than the adscs in the fbs medium at various quantities of the initial density of adscs. the density of cell culture has correlation with the cell size where the higher density the smaller adscs size in prp (20,000 = 0.014 mm2; 10,000 = 0.016 mm2; 5,000 = 0.018 mm2) and fbs group (20,000 = 0.032 mm2; 10,000 = 0.032 mm2; 5,000 = 0.036 mm2). the size of adscs morphology supplemented by fbs was higher than prp and significantly different in the group with density culture of cells was 20,000 (p <0.05). based on these results showed that adscs morphology with seeding density 20,000 cells which cultured on media contained prp has significantly smaller in size than on media contained fbs. how to cite: karina., rosadi, i., sobariah, s., roslina, l., wahyuningsih, k.a., widyastuti, t & afini, i. (2019). perbandingan morfologi adipose-derived stem cells asal donor diabetes melitus tipe 2 dalam medium mengandung platelet-rich plasma dan fetal bovine serum. jurnal riset biologi dan aplikasinya. 1 (2): 64-70. *correspondence author: karina@hayandra.com jl. kramat 6 no. 11, jakarta pusat email: karina@hayandra.com e-issn 2655-9927 jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi history article received : 26 juli 2019 approved: 26 agustus 2019 published: 30 september 2019 key words: adscs, diabetes, morphology, senescent, prp kata kunci adscs, diabetes, morfologi, penuaan, prp 19 | karina dkk; perbandingan morfologi adipose-derived stem cells asal donor diabetes melitus tipe 2 pendahuluan diabetes mellitus tipe 2 merupakan penyakit yang dapat menimbulkan beragam komplikasi sehingga menciptakan lingkungan mikro yang tidak baik bagi pertumbuhan sel (burton & faragher, 2018; palmer et al., 2015). kondisi lingkungan mikro tersebut menginduksi sel-sel untuk mengalami penuaan di jaringan sekitar. percepatan penuaan sel pada penderita diabetes disebabkan oleh tingginya kadar gula dalam darah dan kadar lowdensity lipoproteins (ldl) yang teroksidasi (burton & faragher, 2018). jenis sel yang mengalami penuaan akibat komplikasi diabetes sangat beragam termasuk sel induk/punca (palmer et al., 2015). sel punca merupakan sel yang dapat memperbaharui diri sendiri dan berdiferensiasi menjadi jenis sel lain (nicoletti et al., 2015). sel punca pertama kali ditemukan pada abad ke-19 yang dikelompokkan menjadi dua berdasarkan sumbernya, yaitu bersumber dari embrio (embryonic stem cells) dan jaringan dewasa (adult stem cells) (zuk, 2010). sel punca asal jaringan dewasa yang banyak dikembangkan diantaranya sel punca asal sumsum tulang (bone marrow stem cells/ bmscs) dan sel punca asal jaringan lemak (adipose derived stem cells/adscs) (zuk et al., 2002; xie et al., 2012). pada studi yang dilaporkan oleh guo et al., (2018) menunjukkan bahwa adscs berpotensi sebagai terapi untuk memulihkan luka pada pasien penderita diabetes lebih baik dibandingkan bmscs. akan tetapi, efek mayor akibat komplikasi diabetes dapat merusak sel punca sehingga berpotensi menurunkan efektivitas sel punca (palmer et al., 2015) jika digunakan sebagai terapi dalam pemulihan luka pasien diabetes. pada umumnya, adscs diperbanyak dalam medium pertumbuhan mengandung 10% fetal bovine serum (fbs). namun, perbanyakan sel dengan medium fbs dapat meningkatkan risiko kontaminan dan dapat menimbulkan reaksi penolakan tubuh (kandoi et al., 2018). platelet-rich plasma (prp) merupakan plasma yang kaya akan trombosit dan dilaporkan mampu meningkatkan pertumbuhan adscs (shen et al., 2015). kadar platelet dalam prp adalah 20 kali lipat lebih banyak dibandingkan dalam darah (araki et al., 2012) dan mengandung lebih dari 1.100 protein (pavlovic et al., 2016). sel yang disuplementasi prp pada konsentrasi tertentu dapat meningkatkan laju proliferasi (blande et al., 2009; kacaoemer et al., 2007). hal tersebut diduga karena banyaknya molekul bioaktif pada prp yang umumnya didominasi oleh protein platelet-derived growth factor (pdgf), transforming growth factor β (tgf-β), vascular endothelial growth factor (vegf), epidermal growth factor (egf), insulin-like growth factor (igf) dan fibroblast growth factor (fgf) (pavlovic et al., 2016; burnouf et al., 2016). protein fgf merupakan salah satu protein yang berperan penting dalam pertumbuhan sel termasuk sel punca (atashi et al., 2014). oleh karena itu, perlu dilakukan studi untuk perbaikan kualitas adscs dari pasien diabetes melitus tipe 2 dalam medium mengandung prp dibandingkan dengan fbs untuk meningkatkan efektivitas adscs. pada studi ini, sampel jaringan lemak sebagai sumber adscs berasal dari limbah operasi sedot lemak manusia penderita diabetes melitus tipe 2. perbaikan kualitas adscs donor diabetes melitus tipe 2 dilakukan dengan subtitusi nutrisi media pertumbuhan yang umumnya menggunakan nutrisi standar fbs menjadi prp asal manusia. uji efektivitas prp sebagai nutrisi pertumbuhan adscs juga dilakukan berdasarkan variasi densitas sel awal yang dikultur untuk mengetahui konsistensi prp dalam meremajakan dan memperbaiki kualitas morfologi adscs. bahan dan metode isolasi dan kultur adscs adipose-derived stem cells (adscs) diisolasi dari jaringan lemak manusia yang berasal dari satu donor penderita diabetes melitus tipe 2. isolasi adscs secara enzimatis mengacu pada protokol hremedy dari yayasan hayandra peduli (nomor paten: idp000055609). sampel jaringan lemak diberikan enzim h-remedy sebanyak 10% kemudian diinkubasi pada kondisi suhu 37oc, 300 rpm, selama 60 menit. inaktivasi enzim menggunakan penambahan medium dulbecco's modified eagle's (dmem) rendah glukosa (1 g/l) mengandung l-glutamin (4 mm) (gibco, usa) dan disentrifugasi pada kecepatan 600xg selama 5 menit. pelet sel mengandung adscs kemudian dikultur menggunakan medium dmem yang mengandung 1% antibiotic-antimycotic konsentrasi 100x (gibco, usa) dan 10% fetal bovine serum (fbs) (gibco, usa) pada suhu 37oc, 5% co2. proses peremajaan dilakukan hingga pasase 2 (p2) untuk mendapatkan jumlah sel yang cukup untuk pengamatan morfologi adscs pada p3. prp diperoleh dari palang merah indonesia (pmi), jakarta pusat. penelitian ini telah lulus kaji etik dengan nomor 666/un6.c.10/pn/2017. 65 jurnal riset biologi dan aplikasinya. 1(2): 64-70, september 2019 | 20 pengelompokan adscs adscs pada p3 dikelompokkan menjadi dua berdasarkan suplementasi medium yaitu adscs yang dikultur dalam medium mengandung 10% fbs (gibco, usa) dan adscs yang dikultur dalam medium mengandung 10% prp. medium basal yang digunakan adalah dmem (gibco, usa) dengan tambahan 1% antibiotic-antimycotic konsentrasi 100x (gibco, usa). pengelompokan berdasarkan densitas sel kultur awal pada masingmasing kelompok fbs dan prp dibagi menjadi 3 yaitu jumlah adscs awal sebanyak 5,000, 10,000 dan 20,000 sel. cawan kultur yang digunakan dalam penelitian ini adalah 96 well-plate. pengamatan morfologi dan pertumbuhan sel dilakukan pada jam ke 32. pengambilan gambar morfologi adscs gambar adscs monolayer yang dikultur pada 96-well plate berbagai kelompok perlakuan diambil pada jam ke-32 menggunakan mikroskop inverted fasa terbalik (optika, italy) dengan pengamatan lensa objektif 10x. gambar disimpan ke dalam perangkat komputer dalam bentuk file .jpg menggunakan kamera digital optika (optika, italy). kuantifikasi luas morfologi adscs luas area morfologi adscs dikuantifikasi menggunakan perangkat lunak image j (national institutes of health, usa). adapun tahapan kuantifikasi luas morfologi adscs yaitu dengan melakukan kalibrasi pengaturan skala kemudian menentukan parameter pengukuran yang akan dianalisis. pada studi ini parameter pengukuran adalah luas area (mm2), standar deviasi (sd). pengukuran luas morfologi adscs dilakukan sebanyak 35 sel menggunakan menu “polygon selection”. luas morfologi adscs yang telah terlingkupi “polygon” kemudian diubah hasilnya ke dalam bentuk angka luas area dengan satuan mm2. data yang diperoleh disimpan dalam bentuk excel untuk selanjutnya diolah dan dianalisis. kualitas adscs diukur berdasarkan bentuk, spreading dan kuantifikasi luas morfologi adscs. analisis statistik data yang didapat ditampilkan dalam bentuk gambar dan grafik (dinyatakan dalam rerata ± standar deviasi (sd). analisis statistik dimulai dengan uji normalitas dan homogenitas. analisis perbedaan menggunakan uji statistik parametrik analysis of variance (anova). hasil dan pembahasan hasil penelitian ini menunjukkan karakter adscs adalah menempel pada permukaan cawan (well). morfologi adscs yang dikultur menggunakan fbs memiliki ukuran sel yang lebih besar dan mengalami spreading maksimal, sedangkan adscs yang dikultur menggunakan prp umumnya membentuk seperti sel fibroblas dan memiliki ukuran yang normal (gambar 1). sifat sel yang menempel pada permukaan menunjukkan sel telah berinteraksi dengan substrat untuk menempel dan melakukan komunikasi selular (horwitz & webb, 2003). interaksi antara sel dan substrat teramati pada setiap kelompok adscs yang dikultur selama 32 jam, sebaliknya interaksi sel dengan sel sedikit teramati pada adscs yang dikultur sebanyak 5,000 dan 10,000 sel pada kelompok fbs. sedikitnya interaksi antar sel menyebabkan adscs mengalami spreading untuk melakukan penjuluran sitoplasma yang menyebar memenuhi permukaan cawan dan membentuk lamellipodia serta filopodia berukuran besar. akibatnya, luas ukuran morfologi adscs kelompok fbs lebih besar dibandingkan kelompok prp. suplementasi prp dalam medium kultur adscs donor dm meremajakan adscs sehingga terjaga pada ukuran normal dan teramati lebih sehat yang ditandai dengan bentuk morfologi seperti fibroblas (gambar 2). pada prinsipnya, adscs dengan densitas kultur awal yang sedikit akan mendorong sel untuk melakukan ekstrapenjuluran agar dapat berinteraksi dengan sel lainnya sehingga ukuran sel menjadi lebih besar sebagai tanda dari penuaan sel seperti yang terjadi pada kelompok fbs. penuaan sel adalah kondisi keadaan metabolik sel berubah baik secara in vitro maupun in vivo yang ditandai dengan perubahan morfologi sel, metabolisme, dan ekspresi gen (dulic, 2013). perubahan morfologi akibat penuaan sel umumnya ditandai dengan peningkatan volume ukuran sel dan bentuknya menjadi tidak beraturan serta sel mulai kehilangan kemampuan proliferasinya. fenomena ini pertama kali dijelaskan oleh leonard hayflick pada tahun 1960 yang dikenal sebagai fenomena hayflick (rochette & brash, 2010). pada studi ini, nutrisi yang digunakan merupakan nutrisi standar untuk mendukung pertumbuhan sel punca yaitu fbs. oleh karena itu, penuaan sel diduga tidak hanya akibat rendahnya interaksi antarsel namun juga karena sumber sel yang berasal dari donor diabetes melitus tipe 2. 66 19 | karina dkk; perbandingan morfologi adipose-derived stem cells asal donor diabetes melitus tipe 2 gambar 1. morfologi adscs p3 yang dikultur selama 32 jam menggunakan medium mengandung fbs (a,c,e) dan prp (b,d,f) dengan jumlah sel awal yang dikultur sebanyak 5,000 sel (a-b), 10,000 sel (c-d) dan 20,000 sel (e-f) (bar = 200 µm) 67 jurnal riset biologi dan aplikasinya. 1(2): 64-70, september 2019 | 20 gambar 2. morfologi adscs p3 yang dikultur menggunakan medium mengandung fbs (a) dan prp (b) yang menempel dan mengalami spreading dengan densitas kultur awal sel sebanyak 5,000 sel selama 32 jam; lingkar putus-putus warna merah adalah inti sel (nukleus), panah warna hijau adalah lamellipodia; panah warna kuning adalah filopodia; panah biru adalah sel yang belum mengalami spreading (bar = 100 µm) sel-sel yang mengalami penuaan lebih banyak ditemukan pada adscs dengan jumlah sel kultur yang sedikit pada kelompok fbs. sebaliknya, adscs yang dikultur pada medium mengandung prp dari donor yang sama menunjukkan morfologi yang lebih sehat meskipun jumlah densitas sel yang dikultur lebih sedikit (5,000 sel). hasil tersebut diduga karena tingginya kadar protein pertumbuhan yang terkandung dalam prp. 68 19 | karina dkk; perbandingan morfologi adipose-derived stem cells asal donor diabetes melitus tipe 2 gambar 3. ukuran morfologi adscs p3 yang dikultur selama 32 jam dengan variasi jumlah kultur awal dalam medium mengandung fbs dan prp; perhitungan diambil dari 35 adscs (*p <0,05) kadar protein pertumbuhan yang tinggi terkandung pada prp diduga mengakibatkan sel menjadi lebih aktif berproliferasi dan menjaga ukuran sel pada ukuran normal dan sel teramati lebih sehat. hal tersebut dibuktikan berdasarkan rerata data kuantitatif luas ukuran morfologi adscs dengan variasi densitas kultur (gambar 3). densitas kultur awal sebanyak 5,000 pada adscs dalam medium mengandung fbs (0,036 mm2) lebih besar ukuran morfologi spreding adscs dibandingkan jika densitas kultur sel awal ketika ditingkatkan menjadi 10,000 atau 20,000 sel (0,032 mm2 atau 0,032 mm2). hasil dengan kecenderungan serupa juga ditunjukkan pada adscs yang dikultur menggunakan medium prp. semakin besar densitas kultur awal maka semakin kecil luas morfologi adscs (20,000 = 0,014 mm2; 10,000 = 0,016 mm2; 5,000 = 0,018 mm2) namun perbedaannya tidak bermakna. luas ukuran morfologi adscs yang dikultur menggunakan fbs jauh lebih besar dibandingkan prp dan berbeda bermakna pada densitas jumlah sel awal yang dikultur sebanyak 20,000 sel (p <0,05). hal ini menunjukkan bahwa prp memiliki potensi bagi adscs asal donor diabetes untuk meremajakan dan memperbaiki kualitas pertumbuhan adscs agar tidak mengalami penuaan (senescent) dini. simpulan ukuran morfologi adipose-derived stem cells (adscs) dari donor diabetes melitus tipe 2 yang dikultur menggunakan medium mengandung platelet-rich plasma (prp) dengan densitas kultur awal sebanyak 20,000 sel teramati lebih kecil (normal) secara signifikan dibandingkan dengan adscs yang dikultur menggunakan medium mengandung fetal bovine serum (fbs). ucapan terima kasih peneliti mengucapkan terimakasih kepada donor yang telah bersedia secara sukarela memberikan limbah lemak untuk digunakan pada studi ini. daftar pustaka araki, j., jona, m., eto, h., aoi, n., kato, h., suga, h., doi, k., yatom,i y & yoshimura, k. (2011). optimized preparation method of platelet-concentrated plasma and noncoagulating platelet-derived factor concentrates: maximization of platelet concentration and removal of fibrinogen. tissue engineering part c: methods. 18(3): 176-185. doi: 10.1089/ten.tec.2011.0308. atashi. f., jaconi, m. e., pittet-cuenod, b & modarressi, a. (2014). autologous plateletrich plasma: a biological supplement to enhance adipose-derived mesenchymal stem cell expansion. tissue engineering part c methods. 21(3): 253-262. doi: 10.1089/ten.tec.2014.0206. blande, i., bassaneze, v., lavini-ramos, c., fae, k., kali,l j., miyakawa, a., schettert, i & krieger, j. 2009. adipose tissue mesenchymal stem cell expansion in animal serum-free medium * 69 jurnal riset biologi dan aplikasinya. 1(2): 64-70, september 2019 | 20 supplemented with autologous human platelet lysate. transfusion. 49(12): 2680-2685. doi: 10.1111/j.1537-2995.2009.02346. burnouf, t., strunk, d., koh, m.b & schallmoser, k. (2016). human platelet lysate: replacing fetal bovine serum as a gold standard for human cell propagation?. biomaterials. 76: 371387. doi: 10.1016/j.biomaterials.2015.10.065. dulic, v. (2013). senescence regulation by mtor. cell senescent. 965:15-35. doi: 10.1007/978-162703-239-1_2. guo, j., hu, h., gorecka, j., bai, h., he, h., assi, r., isaji, t., wang, t., setia, o., lopes, l & gu y. (2018). adipose-derived mesenchymal stem cells accelerate diabetic wound healing in a similar fashion as bone marrow-derived cells. american journal of physiology-cell physiology, 315(6): c885-896. doi: 10.1152/ajpcell.00120. horwitz, r & webb, d. (2003). cell migration. current biology. 13(19): 756-759. doi: 10.1002/cphy.c110012 kandoi, s., patra, b., vidyasekar, p., sivanesan, d., vijayalakshmi, s., rajagopal, k & verma, r.s. (2018). evaluation of platelet lysate as a substitute for fbs in explant and enzymatic isolation methods of human umbilical cord mscs. scientific reports. 8(1): 1-12. doi: 10.1038/s41598-018-30772-4. kocaoemer, a., kern, s., klüter, h & bieback, k. (2007). human ab serum and thrombin activated platelet-rich plasma are suitable alternatives to fetal calf serum for the expansion of mesenchymal stem cells from adipose tissue. stem cells. 25(5): 1270-1278. doi: 10.1634/stemcells.2006-0627. munro, j., barr, n.i., ireland, h., morrison, v & parkinson, e.k. (2004). histone deacetylase inhibitors induce a senescence-like state in human cells by a p16-dependent mechanism that is independent of a mitotic clock. experimental cell research. 295(2):525-538. doi: 10.1016/j.yexcr.2004.01.017 nicoletti, g.f.de, francesco, f., d'andrea, f & ferraro, g.a. (2015). methods and procedures in adipose stem cells: state of the art and perspective for translation medicine. journal of cellular physiology. 230(3): 489-495. doi: 10.1002/jcp.24837 pavlovic, v., ciric, m., jovanovic, v & stojanovic, p. (2016). platelet rich plasma: a short overview of certain bioactive components. open medicin. 11(1): 242-247. doi: 10.1515/med-2016-0048 rochette, p.j & brash, d.e. (2010). human telomeres are hypersensitive to uv-induced dna damage and refractory to repair. plos genetics. 6(4): 1-13. doi: 10.1371/journal.pgen.1000926 shen, j., gao, q., zhang, y & he y. (2015). autologous platelet-rich plasma promotes proliferation and chondrogenic differentiation of adipose-derived stem cells. molecular medicine reports. 11(2): 1298-1303. https://doi.org/10.3892/mmr.2014.2875. zuk, p.a., zhu, m., ashjian, p. de., ugarte, d.a., huang, j.i., mizuno, h., alfonso, z.c., fraser, j.k., benhaim, p & hedrick mh. (2002). human adipose tissue is a source of multipotent stem cells. molecular biology of the cell. 13(12): 4279-4295. doi: 10.1091/mbc.e02-02-0105 zuk, p.a. (2010). the adipose-derived stem cell: looking back and looking ahead. molecular biology of the cell. 21, 1783-1787. doi: 10.1091/mbc.e09-07-0589. 70 jurnal riset biologi dan aplikasinya, volume 2, nomor 1, maret 2020 difference of red blood cell count (rbc) levels in diabetes mellitus type ii with ulcers and without ulcers perbedaan jumlah sel darah merah (rbc) pada diabetes mellitus tipe ii dengan ulkus dan tanpa ulkus miftahul mushlih fakultas ilmu kesehatan, universitas muhamadiyah sidoarjo abstract type ii diabetes mellitus (t2dm) is a metabolic disorder that has potential causing ulcer complications. ulcers occur due to peripheral vascular abnormalities and trauma. the occurrence of ulcers allows differences in the hematology characteristics in sufferers. this study aimed to determine the comparison of the blood picture between t2dm with ulcers and t2dm without ulcers. this was an analytical descriptive research using 29 samples (10 t2dm samples with ulcers and 19 t2dm samples without ulcers). a complete blood test was performed using sysmex kx-21n hematology analyzer. data were analyzed using independent t-test and mann-whitney u depends on the normality. normality was done using shapiro wilk (confident level: 95%). the results of this study indicated that red blood cell count (rbc) and hemoglobin count (hgb) differ significantly between t2dm with ulcers and t2dm without ulcers (p: 0.012 and 0.006). identification of hgb levels was highly recommended to get proper treatment in t2dm. abstrak diabetes mellitus tipe ii (dmt2) merupakan kelainan metabolik yang berpotensi mengakibatkan komplikasi ulkus. ulkus terjadi akibat adanya kelainan pembuluh darah perifer dan trauma. kejadian ulkus menyebabkan perbedaan karakter hematologi pada penderitanya. penelitian ini bertujuan untuk membandingkan gambaran darah antara dmt2 dengan ulkus dan dmt2 tanpa ulkus. penelitian ini merupakan penelitian deskriptif analitik dengan menggunakan sampel sebanyak 29 (10 sampel dmt2 dengan ulkus dan 19 sampel dmt2 tanpa ulkus). pemeriksaan darah lengkap dilakukan menggunakan sysmex kx-21n hematology analyzer. analisis data dilakukan dengan independent t test dan uji mann-whitney u tergantung pada normalitas data. normalitas dianalisis menggunakan uji shapiro wilk (confident level: 95%). hasil penelitian ini menunjukkan red blood cell count (rbc) dan hitung hemaglobin (hgb) berbeda secara nyata antara dmt2 dengan ulkus dan dmt2 tanpa ulkus (p: 0.012 dan 0.006). identifikasi hgb sangat direkomendasikan untuk mendapatkan pengobatan pada dmt2. how to cite: muslih, m. 2020. difference of red blood cell count (rbc) levels in diabetes mellitus type ii with ulcers and without ulcers . jurnal riset biologi dan aplikasinya, 2(1),6-10. *corresponding author: jln. raya lebo no 4 rame pilang, kecamatan wonoayu, sidoarjo e-issn 2655-9927 e-mail: mif.mushlih@umsida.ac.id jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi article history received : 29 november 2019 approved : 6 februari 2020 published : 31 maret 2020 keywords: ulcers, without ulcers, diabetes mellitus, rbc, hgb kata kunci: ulkus, tanpa ulkus, diabetes mellitus, rbc, hgb mailto:mif.mushlih@umsida.ac.id 7 | mushlih; difference of red blood cell count (rbc) levels in diabetes mellitus type ii introduction diabetes mellitus is a metabolic disorder caused by unproductive, not optimal insulin performance or both (suneja et al., 2018). diabetes can be categorized into type i diabetes mellitus (t1dm), type 2 diabetes mellitus (t2dm), gestational diabetes mellitus and diabetes mellitus which causes are unknown (ekoe et al., 2018). currently, t2dm abnormalities in the sixth rank cause of death in the world. in 2030 the prevalence of dm in indonesia was predicted will increase within 366 million people. the prevalence of diabetes mellitus in the world tends to increase and reach 4.4% (who, 2004). it is caused the disorder not only comes from genetic factors but also environmental factors (hu, 2011). understanding of t2dm is more difficult caused it is a multi-genomics disorder (tsaih et al., 2014). t2dm complications cause sufferers to experience prolonged pain (lathifah, 2017). these complications may as macrovascular and microvascular complications. macrovascular complications include coronary artery disease, peripheral arteries, and stroke. while, microvascular complications include diabetic nephropathy, neuropathy, and retinopathy (yuhelma et al., 2015). in the long period, t2dm sufferers can cause several problems such as decreased quality of vision, the emergence of ulcers or gangrene, kidney damage, high blood pressure, liver damage and even stroke (tsaih et al., 2014). an ulcer is one of the complications that are often experienced by people with t2dm. as many as 15% of t2dm sufferers have ulcers (aumiller & dollahite, 2015). the dominant risk factors causing ulcers are peripheral artery disease (pad) and trauma (loviana et al., 2015). ulcers with extreme conditions will result in amputations to prevent wider complications (aumiller & dollahite, 2015). the occurrence of ulcers can also be more dangerous if accompanied by a serious infection (fitria et al., 2017). early treatment of ulcers is one of the keys to avoiding broader complications (mirtha et al., 2018). the factors that influence ulcer occurrence are the duration of dm, neuropathy, pad, history of trauma, and foot care are risk factors for diabetic ulcers (loviana et al., 2015). social support is needed for dmt2 to keep trying to heal and improve the awareness of treatment (ramkisson et al., 2017). hematology character influences someone with dm condition (biadgo, 2016). several studies have shown differences in the character of hemoglobin in people with t2dm with ulcers and without ulcers. however, information about the characteristics of hematology in patients with dm is still limited (thomas et al., 2005). this study aimed to determine differences in the characteristics of hematology in t2dm with ulcers and without ulcers. material and methods this research was cross-sectional. the ethical study was approved by the ethics commission of airlangga university, indonesia with no. 195 / hrecc.fodm / v / 2019. a total of 29 samples were taken from various places in sidoarjo. 10 t2dm samples were taken at rumah luka sidoarjo branch. whereas t2dm samples without ulcers were taken from several places (health centers) in sidoarjo. whole blood was taken by macro sampling in 3 cc venous blood into an edta anticoagulant tube. furthermore, t2dm blood samples were labeled and immediately stored in a cooling cupboard 4oc. complete blood count was conducted using hematology analyzer sysmex kx21n with analyzed parameters analyzed were white blood cell count (wbc); red blood cell count (rbc); calculate hemoglobin (hgb); hematocrit (ht or hct); average red blood cells (mean corpuscular volume / mcv); mean corpuscular hemoglobin or mch; mean corpuscular hemoglobin concentration or mchc; platelet (plt). calculation of different tests was conducted by using independent t-test and mann-whitney u test depending on the normality test. normality test used was shapiro-wilk. the confident level used was 95%. result and discussion based on the research results, it was found that diabetes mellitus type ii was obtained; with a composition of 60% being male and 40% were female. the sample was obtained from rumah luka sidoarjo. the results of this study can be described according to the observed parameters ie wbc on t2dm obtained at 7210 ± 3839.11 /ul (sign. 0.327) with a lower value compared to t2dm without ulcers 8663.15 ± 3668.81 ul; whereas the parameters of hct in t2 dm with ulcers have an average of 33.74 ± 11.41 lower when compared to t2 dm without ulcers 37.25 ± 5.27 (sign. 0.264). the mcv value in t2dm with ulcers has a lower value compared to t2dm with ulcers 88.97 ± 12.77 fl while in t2dm it is 81.35 ± 5.76 fl. mch and mchc values respectively in t2dm with ulcers jurnal riset biologi dan aplikasinya, 2(1), 6-10 , maret 2020 | 8 28.26 ± 9.03 pg and 32.11 ± 9.84 g/dl whereas in t2dm without ulcers 27.60 ± 3.44 & 33.66 ± 2.69 g/dl respectively were not significantly different, namely 0.148 and 0.748. the value of plt with ulcers was 387.8 ± 200.32 x 10³/µl and in t2dm without ulcers was 336.68 ± 124.27 x 10³/µl (sign. 0.206) (table 1). based on the analysis, rbc and hgb have significantly different values. the rbc and hgb values respectively in t2dm with ulcers were 3.77 ± 1.03 x 100/µl and 10.14 ± 2.33 g/dl whereas in t2dm without ulcers 4.56 ± 0.55 x 100/µl and 12.67 ± 2.06 g/dl (p: 0. 012 & 0.006). anemia is often found in diabetic patients (kothari & bokariya, 2012; kizilgul et al., 2018). this study is supported by wright (2014) study which stated that t2dm accompanied by ulcers was more likely to suffer from anemia. t2dm sufferers accompanied by ulcers are macrovascular complications that occur in about 15% of people with diabetes (salman et al., 2017). 60-80% of sufferers will recover but 5-24% will lead to amputation (alexiadou & doupis, 2012). the relationship between anemia and t2dm with ulcers is not yet well understood (salman et al, 2017). however, several supporting factors have been identified. among these factors are age (fitria et al., 2017), history of amputation, insulin use, sex, distal neuropathy, foot deformities (yazdanpanah et al., 2018). the number of reported events was also quite diverse. however, the majority stated that more than 50% of people with t2dm with ulcers had anemia (kothari & bokariya, 2012; salman et al., 2017). anemia may also occur in other dm complications, namely kidney failure (abate et al., 2013). other research on the description of blood components showed that fasting blood glucose levels were isolated with hemoglobin and hematocrit (christa, 2014). the incidence of anemia in diabetes allows for more severe complications including ischemic heart disease, hypertension, and kidney failure. anemia in dm ulcers is associated with vascular complications such as nephropathy, retinopathy, and neuropathy which result in slow healing of the wound (abate et al., 2013). ulcer incidence reached 15% of total sufferers. until now, amputation is the final path of complications (salman et al., 2017). anemia is reported to be a side effect of dm (kothari & bokariya, 2012). proteins from rbc membranes undergo oxidation through non-enzymatic glycosylation due to increased oxidative stress in diabetes and reduce levels of pcv, hb, rbc which can cause hemolysis and consequently become anemic (mohammed et al., 2013). conclusion the results of this study showed that red blood cell count (rbc) and hemoglobin count (hgb) differed significantly between t2dm with ulcers and t2dm without ulcers. identification of hgb levels was highly recommended to get proper treatment in t2dm. acknowledgments thank you to rumah luka for their availability as a place for sampling and respondent. thank you also delivered to qilmia, siska, dina, livia and tri as diabetes mellitus research team, molecular biology team, umsida. table 1. character and differences between t2dm ulcer and t2dm without ulcer . parameters means + sd dm ulcer means + sd without ulcer total means + sd statistical test pvalue wbc (/µl) 7210 ± 3839.11 8663.15±3668.81 8162.06±3726.20 independent ttest 0.327 rbc ( x 100/µl) 3.77 ±1.03 4.56±0.55 4.28±0.82 independent ttest 0.012 hgb (g/dl) 10.14 ±2.33 12.67±2.06 11.8±2.44 independent ttest 0.006 hct 33.74 ±11.41 37.25±5.27 36.04±7.91 independent ttest 0.264 mcv (fl) 88.97 ±12.77 81.35±5.76 83.97±9.34 mann-whitney u 0.141 mch (pg) 28.26 ±9.03 27.60±3.44 27.83±5.82 mann-whitney u 0.148 mchc g/dl 32.11 ±9.84 33.66±2.69 33.12±6.03 mann-whitney u 0.748 plt (x 10³ / µl) 387.8 ±200.32 336.68±124.27 354.31±153.09 mann-whitney u 0.206 glucose (mg/dl 239.2 ±752.52 266.63±73.79 257.17±74.23 9 | mushlih; difference of red blood cell count (rbc) levels in diabetes mellitus type ii references abate, a., birhan, w., & alemu, a. (2013). association of anemia and renal function test among diabetes mellitus patients attending fenote selam hospital, west gojam, northwest ethiopia: a cross sectional study bmc hematology. bmc blood disorders, 13(1), 1-12. doi: 10.1186/2052-1839-13-6. alexiadou, k., & doupis, j. (2012). management of diabetic foot ulcers. diabetes therapy, 3(1), 115. doi: 10.1007/s13300-012-0004-9. aumiller, w. d., & dollahite, h. a. (2015) pathogenesis and management of diabetic foot ulcers. journal of the american academy of physician assistants, 28(5), 28–34. doi: 10.1097/01.jaa.0000464276.44117.b1. biadgo, b. (2016). hematological indices and their correlation with fasting blood glucose level and anthropometric measurements in type 2 diabetes mellitus patients in gondar, northwest ethiopia. diabetes, metabolic syndrome and obesity: targets and therapy, 9(1), 91–99. doi: 10.2147/dmso.s97563. christa, m.w.r. (2014). hematological parameters and prediabetes and diabetes in adults from the general population: a cross-sectional study. journal of diabetes & metabolism, 5(2), 335. doi: 10.4172/2155-6156.1000335. ekoe, j.m., goldenberg, r., & katz, p. (2018). clinical practice guidelines screening for diabetes in adults diabetes canada. canadian journal of diabetes, 42, s109–s114. doi: 10.1016/j.jcjd.2017.10.013. fitria, e., nur, a., marissa, n., & ramadhan, n. (2017). karakteristik ulkus diabetikum pada penderita diabetes mellitus di rsud dr. zainal abidin dan rsud meuraxa banda aceh. buletin penelitian kesehatan, 45(3), 153 160. doi: 10.22435/bpk.v45i3.6818.153-160. hu, f.b. (2011). globalization of diabetes: the role of diet, lifestyle, and genes. diabetes care, 34(6), 1249–1257. doi: 10.2337/dc11-0442. kizilgul, m., sencar, e., ucan, b., beysel, s., ozcelik, o., ozbek, m., & cakal, e. (2018). components of the complete blood count in type 2 diabetes mellitus with inadequate glycemic control. dicle medical journal, 45(2), 113–120. doi: 10.5798/dicletip.410811. kothari, r., & bokariya, p. (2012). a comparative study of haematological parameters in type i mellitus patients & healthy young adolescents. international journal of biological and medical research, 3(4), 2429–2432. retrieved from https://pdfs.semanticscholar.org/49bc/c96acd 6efea6a556750b8c8273e10b9108ff.pdf. lathifah, n.l. (2017). hubungan durasi penyakit dan kadar gula darah dengan keluhan subyektif penderita diabetes mellitus. jurnal berkala epidemiologi, 5(2) 231–239. doi: 10.20473/jbe.v5i2.2017.231-239. loviana, r.r., rudy, a., & zulkarnain, e. (2015). artikel penelitian faktor risiko terjadinya ulkus diabetikum pada pasien diabetes mellitus yang dirawat jalan dan inap di rsup dr. m. djamil dan rsi ibnu sina padang. jurnal kesehatan andalas, 4(1), 243–248. doi: https://doi.org/10.25077/jka.v4i1.229 mirtha, l.t., ariono, m., & putra, s.m. (2018). the effect of foot exercise on diabetic patients with foot ulcer: an evidence-based case report. diabetes & metabolic disorders, 5(1),1–5. diakases dari https://doi.org/10.24966/dmd-201x/100026 mohammed, r.k., ibrahim, s., atawodi, s.e., eze, e.d., suleiman, j.b., ugwu, m.n., & malgwi, i.s. (2013). anti-diabetic and haematological effects of n-butanol fraction of alchornea cordifolia leaf extract in streptozotocininduced diabetic wistar rats. scientific journal of biological sciences, 2(3), 45–53. doi: 10.13140/rg.2.2.35936.17921 ramkisson, s., pillay, b. j., & sibanda, w. (2017). social support and coping in adults with type 2 diabetes. african journal of primary health care and family medicine, 9(1), 8. retrieved from https://phcfm.org/index.php/phcfm/article/vi ew/1405/2160. salman, i. n., wadood, s. a., & abualkasem, b. a. (2017). low hemoglobin levels in infected diabetic foot ulcer. iosr journal of pharmacy and biological sciences, 12(01), 05–09. https://doi.org/10.9790/3008-1201040509 suneja, s., christian, y., & chandra, n. c. (2018) milieu of diabetes in the 2nd decade of 21st century. journal of diabetes & metabolism, 09(09), 1–14. doi: 10.4172/2155-6156.1000804. thomas, m., tsalamandris, c., macisaac, r., & jerums, g. (2005). anaemia in diabetes: an emerging complication of microvascular disease. current diabetes reviews, 1(1), 107– 126.https://doi.org/10.2174/15733990529525 87 tsaih, s.w., holl, k., jia, s., kaldunski, m., tschannen, m., he, h., woods, l. c. s. (2014). identification of a novel gene for diabetic traits in rats, mice, and humans. genetics, 198(1),17–29. https://doi.org/10.1534/genetics.114.16298 who. (2004). estimates for the year 2000 and projections for 2030. world health, 27(5), 1047–1053. wright, j.a., oddy, m.j., & richards, t. (2014). presence and characterisation of anaemia in diabetic foot ulceration. anemia, 2014, pp. 1–8. doi: 10.1155/2014/104214. https://doi.org/10.24966/dmd-201x/100026 https://phcfm.org/index.php/phcfm/article/view/1405/2160 https://phcfm.org/index.php/phcfm/article/view/1405/2160 https://doi.org/10.1534/genetics.114.16298 jurnal riset biologi dan aplikasinya, 2(1), 6-10 , maret 2020 | 10 yazdanpanah, l., shahbazian, h., nazari, i., arti, h. r., ahmadi, f., mohammadianinejad, s. e., & hesam, s. (2018). incidence and risk factors of diabetic foot ulcer: a population-based diabetic foot cohort (adfc study)-two-year follow-up study. international journal of endocrinology, 2018. https://doi.org/10.1155/2018/7631659 yuhelma., hasneli, i.y., & annis, n.f. (2015) identifikasi dan analisis komplikasi makrovaskuler dan mikrovaskuler pada pasien diabetes mellitus. journal online mahasiswa, 2(1), 569–579. diakses dari https://jom.unri.ac.id/index.php/jompsik/a rticle/view/8343/8012. https://jom.unri.ac.id/index.php/jompsik/article/view/8343/8012 https://jom.unri.ac.id/index.php/jompsik/article/view/8343/8012 jurnal riset biologi dan aplikasinya. 1(2): 80-86, september 2019 | 20 jurnal riset biologi aplikasinya, volume 1, nomor 2, september 2019 produksi inokulum vesikular arbuskular mikoriza pada inang sorghum bicolor (l.) moench dengan variasi jenis inokulum dan pupuk npk inoculum production of vesicular arbuscular mycorrhiza on sorghum bicolor (l.) moench host using inoculum variation types and npk fertilizers nisa raudatul auli, rina sri kasiamdari* fakultas biologi universitas gadjah mada, yogyakarta abstrak penelitian ini bertujuan untuk menentukan kombinasi antara jenis inokulum vesikular arbuskular mikoriza (vam), kandungan npk, dan umur tanaman yang paling efektif dalam produksi inokulum. tanaman inang menggunakan sorghum bicolor yang merupakan anggota dari famili poaceae yang memiliki sistem perakaran yang luas, jumlah akar banyak, dan tumbuh dengan cepat sehingga berpotensi sebagai inang vam yang kompatibel. penelitian ini menggunakan analisis rancangan acak lengkap (ral) dengan faktorial 2x2x2 meliputi jenis mikoriza yang digunakan yaitu glomus aggregatum (g) dan campuran glomus aggregatum dan gigaspora margarita (c). konsentrasi npk, yaitu npk grower 15-9-20 (p9) dan growmore 20-20-20 (p20). umur tanaman 6 minggu dan 9 minggu. parameter pertumbuhan yang diukur meliputi tinggi tanaman, berat kering batang dan akar, persen kolonisasi dan jumlah spora vam. berdasarkan penelitian didapatkan hasil, tanaman dengan inokulum campuran vam dengan p20 menghasilkan tinggi tanaman dan berat kering batang dan akar tertinggi. inokulum campuran mempunyai persen kolonisasi dengan nilai yang paling tinggi, sedangkan inokulum tunggal (glomus aggregatum) dengan p rendah menghasilkan produksi spora paling tinggi. inokulum campuran vam dan p9 lebih baik dalam produksi inokulum, baik berupa akar terkolonisasi maupun spora. abstract this study aimed to determine the combination of vesicular arbuscular mycorrhizal inoculum (vam) types, npk content, and age of plants that were most effective in the production of inoculum. host plant was sorghum bicolor, which is a member of the poaceae family that has a wide root system, a large number of roots, and grows rapidly, so that it has the potential as a compatible vam host. this study used a completely randomized design (crd) analysis with 2x2x2 factorial consisted of glomus aggregatum (g) and mixtures of glomus aggregatum and gigaspora margarita (c). fertilizers used npk 15-9-20 (p9) and npk 20-20-20 (p20). plant harvest was at 6 weeks and 9 weeks. measurement of growth parameters included plant height, stem and root dry weight, percent colonization and number of vam spores. based on the research results obtained, plants with vam mixed inoculum with p20 produced the highest plant height and dry weight of stems and roots. mixed inoculum had the highest percentage of colonization, while glomus aggregatum inoculation with low p produced the highest spore production. mixed vam inoculum and p9 was better in the production of inoculums, both in the form of colonized roots and spores. how to cite: auli, n. r & kasiamdari, r.s (2019). produksi inokulum vesikular arbuskular mikoriza pada inang sorghum bicolor (l.) moench dengan variasi jenis inokulum dan pupuk npk. jurnal riset biologi dan aplikasinya. 1(2): 80-86. *correspondence author: e-issn 2655-9927 jl. teknika selatan., senolowo, sinduadi, kec. mlati, kabupaten sleman, daerah istimewa yogyakarta 55281 e-mail: rkasiamdari@ugm.ac.id jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi history article received : 5 agustus 2019 approved : 26 agustus 2019 published : 30 september 2019 key words: glomus aggregatum, gigaspora margarita, inoculum, npk, sorghum bicolor kata kunci: glomus aggregatum, gigaspora margarita, inokulum, npk, sorghum bicolor 19 | auli & kasiamdari; produksi inokulum vesikular arbuskular mikoriza pendahuluan pemanfaatan pupuk hayati atau biofertilizer yang berasal dari organisme tanah seperti mikoriza telah menjadi perhatian (tarbell & koske, 2007). potensi sebagai biofertilizer terletak pada manfaat dan kemampuannya berinteraksi dengan tanaman. mikoriza memiliki peranan penting dalam pertanian berkelanjutan (rodrigues & rodrigues, 2014). inokulasi mikoriza diketahui dapat meningkatkan pertumbuhan tanaman dan membantu tanaman mengatasi tekanan biotik dan abiotik. simbiosis mikoriza dengan tanaman yang memberikan perlindungan terhadap patogen, hama, dan tanaman parasit telah dilaporkan untuk banyak spesies tanaman, termasuk varietas tanaman yang penting secara pertanian (jung et al., 2012). lohman et al., (2010) menyatakan bahwa mikoriza dapat meningkatkan resistensi terhadap penyakit, dan memperbaiki struktur tanah, dan dapat meningkatkan pertumbuhan karena meningkatkan perolehan fosfor (p) dan unsur lainnya seperti zinc dan tembaga. vesikular arbuskular mikoriza (vam) merupakan mikoriza paling penting dalam ekosistem pertanian karena vam mengkolonisasi mayoritas tanaman pertanian. vam diketahui sebagai simbion obligat, sehingga harus berasosiasi dengan akar tanaman untuk bertahan hidup (lohman et al., 2010). vam dapat bersimbiosis dengan banyak tumbuhan inang, namun menghasilkan kolonisasi yang berbeda pada tiap tanaman (muis et al., 2016). muller et al. (2017) menyatakan bahwa pertumbuhan tanaman juga dipengaruhi oleh pembentukan organ penyimpan misalnya spora dan vesikel merupakan bagian yang terpenting dalam siklus hidup vam. oleh karena itu, pemilihan tanaman inang sangat penting dalam perbanyakan inokulum vam. selain tanaman inang, media tumbuh juga merupakan hal-hal yang perlu diperhatikan dalam perbanyakan inokulum. keberadaan fosfor (p) dalam jumlah banyak akan menurunkan tingkat kebutuhan tanaman terhadap asosiasi mikoriza (smith & read, 2008). di wilayah tropis, seperti indonesia tanaman yang umumnya bermikoriza adalah tanaman poaceae dan leguminosae. menurut rini dan rozalinda (2010), berdasarkan jumlah spora yang banyak dan persen kolonisasi akar yang tinggi pada bulan ke-3, dapat disimpulkan bahwa tanaman inang yang lebih sesuai untuk produksi vam adalah tanaman dari famili poaceae. poaceae memiliki sistem perakaran yang luas, jumlah akar yang banyak, dan tumbuh dengan cepat, sehingga efektif digunakan sebagai tanaman inang. akar yang banyak dan tingginya kolonisasi akar oleh vam merupakan indikator bahwa tanaman tersebut dapat digunakan sebagai sumber inokulum vam yang baik (anas dan tampubolon, 2004). berdasarkan penelitian yang dilakukan oleh carrenho et al. (2002), sorghum bicolor (l.) moench berpotensi menjadi tanaman inang dari banyak spesies vam, tanaman ini lebih banyak berasosiasi dengan berbagai jenis vam (12 jenis) dibandingkan dengan zea mays (10 jenis) dan arachis hypogaea l. (7 jenis). spora glomus geosporum adalah yang paling banyak ditemukan pada tanaman inang s.bicolor. hindumathi dan reddy (2011) menyatakan bahwa mikoriza indigenus pada tanah memiliki kemampuan yang bervariasi dalam melakukan kolonisasi dengan enam kultivar s. bicolor. glomus fasciculatum merupakan vam yang paling mendominasi dan ditemukan hampir pada semua sampel tanah. tujuan penelitian ini adalah menguji pengaruh s. bicolor (l.) moench sebagai tanaman inang untuk produksi inokulum vam dengan menggunakan variasi inokulum dan pupuk p. bahan dan metode penelitian ini dilakukan di greenhouse di fakultas biologi universitas gadjah mada. rancangan percobaan yang digunakan adalah rancangan acak lengkap (ral) dengan faktorial 4 ulangan, 2x2x2. inokulum yang digunakan adalah glomus aggregatum (g), dan campuran antara glomus aggregatum dan gigaspora margarita (c) asal seameo biotrop. konsentrasi npk, yaitu npk grower 15-9-20 (p9) dan growmore 20-20-20 (p20). umur tanaman 6 minggu dan 9 minggu. media tanam (800 gr) yang digunakan berupa zeolite-pasir-zeolit (4:3:1). (muis et al., 2016 dengan modifikasi). untuk inokulasi tanaman dimasukkan inokulum sebanyak 50 spora/pot, kemudian lubang ditutup dengan media tanam setinggi ± 2 cm. selanjutnya, benih tanaman inang berumur 2 minggu ditanam pada media tanam tersebut (rini & rozalinda, 2010). pemberian pupuk setelah 2 minggu masa tanam dalam pot sesuai dengan rancangan percobaan dengan konsentrasi 10% sebanyak 100 ml setiap pot. parameter yang diukur meliputi: tinggi tanaman diukur dari bagian leher akar hingga bagian ujung batang setiap 1 minggu sekali menggunakan meteran, berat kering dilakukan dengan pengeringan pada oven pada suhu 800c sampai beratnya konstan. untuk menghitung kolonisasi vam, sampel akar tanaman diwarnai dengan metode pengecatan dengan tryphan blue 81 https://www.ncbi.nlm.nih.gov/pubmed/?term=m%c3%bcller%20a%5bauthor%5d&cauthor=true&cauthor_uid=27838855 jurnal riset biologi dan aplikasinya. 1(2): 80-86, september 2019 | 20 tabel 1. tinggi tanaman sorghum bicolor dengan inokulasi tunggal dan campuran vam dan variasi pupuk umur 6 dan 9 minggu perlakuan tinggi tanaman (cm) 6 minggu 9 minggu kp9 29,3±5,7a 70,4±4,3b kp20 38,4±3,5b 69,4±2,9b gp9 27,8±2,2a 50,6±7,2a gp20 38,1±1,6b 69,9±5,7b cp9 38,9±7,9b 54,1±4,6a cp20 33,6±1,6ab 69,4±6,4b keterangan: angka-angka yang diikuti huruf yang sama pada kolom yang sama tidakada beda nyata pada taraf 5% menurut uji dmrt. k=kontrol, p9=npk 15-9-20, p20=npk 20-20-20, g=glomus aggregatum, c=glomus aggregatum dan gigaspora margarita tabel 2. berat kering batang dan akar tanaman sorghum bicolor dengan inokulasi tunggal dan campuran vam dan variasi pupuk umur 6 dan 9 minggu perlakuan berat kering (g) (6 minggu) berat kering (g) (9 minggu) batang akar batang akar kp9 0,32±0,09a 0,06±0,04a 0,43±0,12a 0,09±0,01a kp20 0,39±0,16a 0,11±0,05ab 0,58±0,10a 0,12±0,05a gp9 0,29±0,35a 0,05±0,04a 0,28±0,13a 0,06±0,02a gp20 0,34±0,04a 0,11±0,03ab 0,47±0,20a 0,10±0,03a cp9 0,36±0,24a 0,07±0,03a 0,55±0,26a 0,13±0,05a cp20 0,53±0,08b 0,15±0,05b 0,97±0,29b 0,27±0,10b keterangan: angka-angka yang diikuti huruf yang sama pada kolom yang sama tidak ada beda nyata pada taraf 5% menurut uji dmrt. k=kontrol, p9=npk 15-920, p20=npk 20-20-20, g=glomus aggregatum, c=glomus aggregatum dan gigaspora margarita gambar 1. kolonisasi akar pada s. bicolor dengan variasi inokulum vam tunggal dan campuran serta variasi pupuk umur 6 minggu dan 9 minggu 82 19 | auli & kasiamdari; produksi inokulum vesikular arbuskular mikoriza gambar 2. jumlah spora vam per 100 gram media tanam dengan variasi inokulum vam tunggal dan campuran serta variasi pupuk pada s. bicolor umur 6 minggu dan 9 minggu setelah dilakukan clearing dengan koh dan hcl (phillips and hayman, 1970). persentase kolonisasi vam menggunakan metode grid-line intersect (giovannetti dan mosse, 1980). spora dihitung per 100 gr tanah dengan metode wet sieving (penyaringan basah), yakni menyaring spora dengan penyaring bertingkat dengan ukuran mess masing– masing 0,85; 0,425; 0,25; 0,18; dan 0,15 mm (brundrett et al., 1984 dengan modifikasi). hasil dan pembahasan berdasarkan hasil tinggi tanaman menunjukkan secara umum bahwa pada minggu ke6 dan minggu ke-9, tanaman tidak berbeda antar perlakuan dengan tanaman kontrol, tanaman dengan perlakuan p20 cenderung lebih tinggi dibandingkan tanaman dengan perlakuan p9. hasil penelitian menunjukkan bahwa tidak memperlihatkan pengaruh nyata terhadap parameter pertumbuhan yang diamati, tetapi secara umum dengan inokulasi vam terutama dengan inokulum campuran terjadi indikasi peningkatan nilai parameter tinggi tanaman (tabel 1). tanaman s. bicolor dengan perlakuan npk 20-20-20 dan perlakuan inokulum vam campuran memiliki berat kering pada batang dan akar yang lebih tinggi berbeda nyata dengan perlakuan lainnya (tabel 2.). hal ini menunjukkan bahwa inokulum campuran dapat memberi pengaruh yang baik terhadap tanaman inang pada konsentrasi npk 20-20-20. pada tanaman s. bicolor terjadi peningkatan persen kolonisasi pada umur tanaman 9 minggu dibanding umur 6 minggu. pada umur 6 minggu nilai persen kolonisasi s. bicolor yang paling tinggi adalah 19.97±4.15% berbeda nyata dengan semua perlakuan, dan pada umur 9 minggu 18.77±5.20 % berbeda nyata dengan gp20 (gambar 1). pada umur 6 minggu, jumlah spora tertinggi pada tanaman s. bicolor adalah perlakuan gp9 (133,33±14,49). pada tanaman ini, jumlah spora dengan perlakuan npk 15-9-20 lebih banyak dibanding npk 20-20-20, baik pada perlakuan mikoriza tunggal maupun campuran (gambar 2). pada umur 9 minggu, jumlah spora terbanyak pada s. bicolor adalah pada perlakuan gp9 (80±5), jumlah spora perlakuan mikoriza tunggal, mengalami penurunan jumlah dibanding umur 6 minggu, sedangkan pada perlakuan inokulasi campuran, jumlah spora di umur 9 minggu lebih banyak daripada 6 minggu (gambar 2). sesuai yang dinyatakan musfal (2010) bahwa pertumbuhan tanaman yang diinokulasi vam menunjukkan hubungan yang positif yaitu meningkatkan pertumbuhan tanaman inangnya. belum terjadinya pengaruh yang nyata terhadap parameter pertumbuhan serta belum terlihat nyata terjadinya efisiensi pemupukan, hal tersebut kemungkinan disebabkan karena aplikasi vam membutuhkan waktu yang lebih lama untuk bersinergi dan memproduksi jaringan hifa eksternalnya dibandingkan bila aplikasi vam dilakukan sejak di pembibitan. vam belum bekerja secara optimal mengingat jaringan hifa vam membentuk jalinan hifa eksternal yang intensif 83 jurnal riset biologi dan aplikasinya. 1(2): 80-86, september 2019 | 20 setelah 65 hari akar tanaman inang terinfeksi (smith and read, 2008), sedangkan hifa eksternal inilah yang dapat memperluas bidang serapan air dan hara (symanczik, 2018), sehingga pada 6 bulan setelah tanam, kapasitas jaringan hifa dalam penyerapan unsur hara belum optimal, yang mengakibatkan pengaruh inokulasi vam belum terlihat nyata. beberapa penelitian menunjukkan bahwa setiap jenis vam memiliki efisiensi dan keefektivan yang berbeda dalam meningkatkan pertumbuhan tanaman, tergantung jenis vam, jenis tanaman inang, dan jenis tanah (lingkungan) serta interaksi ketiganya (hindumathi and reddy, 2011). pemberian vam menyebabkan peningkatan serapan hara oleh tanaman. berat kering merupakan indikasi keberhasilan pertumbuhan tanaman karena berat kering merupakan petunjuk adanya kandungan protein dan organik lainnya yang merupakan hasil fotosintesis yang dapat diendapkan setelah kadar air dikeringkan. semakin besar berat kering tanaman menunjukkan semakin efisien proses fotosintesis yang terjadi dan produktivitas serta perkembangan sel jaringan semakin tinggi dan cepat, sehingga pertumbuhan menjadi lebih baik, yang akhirnya berat kering tanaman meningkat (lizawati et al., 2014). smith and read (2008) menyatakan persentase kolonisasi fungi tergantung pada jenis vam dan tanaman inang dan sering dikaitkan dengan pertumbuhan akar maupun kepekaan akar. persen kolonisasi pada perlakuan mikoriza campuran (glomus aggregatum dan gigaspora margarita) lebih tinggi dibanding perlakuan mikoriza tunggal (g. aggregatum) meskipun demikian persen kolonisasi s. bicolor termasuk kategori rendah karena tidak lebih dari 25%. persen kolonisasi mikoriza pada perlakuan npk 15-9-20 lebih tinggi dibanding npk 20-20-20. keberadaan fosfor (p) dalam jumlah banyak akan mengurangi kolonisasi dan mempengaruhi struktur komunitas vam (wang et al., 2017). ketika jumlah fosfor di dalam tanah rendah, maka asosiasi mikoriza akan semakin tinggi. menurut liu et al. (2000), kolonisasi akar maksimal akan dihasilkan pada kondisi tanah yang memiliki kesuburan rendah. nitrogen (n) dan fosfor (p) pada tingkat ketersediaan yang tinggi akan menurunkan kolonisasi akar. kolonisasi akar akan meningkat saat ketersediaan n dan p rendah, sedangkan pada kondisi tanah kaya p, maka penambahan n akan menghambat persen kolonisasi dan jumlah spora (muis et al., 2016). penelitian tentang jumlah spora yang dihasilkan oleh hindumathi and reddy (2011) menunjukkan rata-rata jumlah spora yang teramati pada minggu ke-4 adalah 4-23 spora/10 g tanah. pada minggu ke-8, rata-rata jumlah spora adalah 942 spora/10 g, sehingga pada penelitian ini jumlah spora yang dihasilkan relatif banyak. perlakuan dengan konsentrasi fosfor yang lebih tinggi (p20) menunjukkan jumlah spora yang lebih rendah dibandingkan perlakuan dengan fosfor yang lebih rendah (p9) pada minggu ke-9. menurut khanam (2006), nitrogen (n) dan fosfor tanah (p) memiliki korelasi negatif terhadap jumlah spora. tingginya jumlah spora kemungkinan lebih dipengaruhi hifa dan tanaman inang yang semakin tua (rini and rozalinda, 2010). chalimah et al., (2007) menyatakan bahwa kelembapan, keadaan spora, cekaman lingkungan, dan media merupakan faktor yang dapat mempengaruhi perkecambahan spora dan kolonisasi vam. simpulan sorghum bicolor dapat menjadi tanaman inang bagi vesikular arbuskular mikoriza (vam) untuk produksi inokulum. inokulasi dengan inokulum campuran vam (glomus aggregatum dan gigaspora margarita) menghasilkan kolonisasi dengan nilai yang paling tinggi, sedangkan inokulum tunggal (glomus aggregatum) dengan p rendah menghasilkan produksi spora paling tinggi. npk 15-9-20 lebih baik dalam produksi inokulum, baik berupa akar terkolonisasi maupun spora. ucapan terima kasih peneliti mengucapkan terima kasih kepada fakultas biologi ugm atas dana penelitian melalui hibah penelitian bpptnbh fakultas biologi ugm tahun 2018 dengan nomer kontrak: ugm/bi/1691/m/01/05. daftar pustaka anas, i.j., & l.o. tampubolon. (2004). media campuran tanah-pasir dan upuk anorganik untuk memproduksi inokulan cendawan mikoriza arbuskula (cma). buletin agronomi, 32(1): 26-31. doi: https://doi.org/10.24831/jai.v32i1.1433 brundrett, m.c., y. piche & r.l. peterson. (1984). a new method for observing the morphology of vesicular-arbuscular mycorrhizae. canadian jurnal of botany, 6: 2128-2134. doi: https://doi.org/10.1139/b84290. carrenho, r., s.f.b. trufem, and v.l.r. bononi . (2002). effects of using different host plants 80 83 84 19 | auli & kasiamdari; produksi inokulum vesikular arbuskular mikoriza on the detected biodiversity of arbuscular mycorrhizal fungi from an agroecosystem. brazilian journal of botany, 25(1): 93-101. doi: http://dx.doi.org/10.1590/s010084042002000100012. chalimah, s., muhadiono., l. aznam., s. haran & n. toruan-mathius. (2007). perbanyakan gigaspora sp. dan acaulospora sp. dengan kultur pot di rumah kaca. biodiversitas, 8 (1): 12-19. diakses dari : https://biodiversitas.mipa.uns.ac.id/d/d0801 /d080103.pdf giovanneti, m., & b. mosse. (1980). an evaluation of techniques for measuring vesicular arbuscular mycorrhizal infection in roots. new phytologist, 84: 489-500. doi: https://doi.org/10.1111/j.14698137.1980.tb04556.x. hindumathi, a., & b.n. reddy. 2011. dependency of sorghum on arbuscular mycorrhizal colonization for growth and development. j mycol plant pathol. 41 (4), 537-542. diakses dari: https://www.researchgate.net/profile/hindu mathi_amballa3/publication/308320439_dep endency_of_sorghum_on_arbuscular_mycorr hizal_colonization_for_growth_and_develop ment/links/57e0a39a08aece48e9e1ff8a.pdf. jung s.c, a. martinez-medina, j.a. lopez-raez & m.j. pozo. (2012). mycorrhiza-induced resistance and priming of plant defenses. journal of chemical ecology: 38(6):651-64. doi: 10.1007/s10886-012-0134-6 khanam, d., m.a.u. mrida., a.r.m. solaiman & t. hossain. (2006). effect of edaphic factors on root colonization and spore population of arbuscular mycorrhizal fungi. bulletin of the institute of tropical agriculture, kyushu university kyushu university, 29: 97-104. doi: https://doi.org/10.11189/bita.29.97. liu, r.j., & x.s. luo. (1994). a new method to quantify the inoculum potential of arbuscular mycorrhizal fungi. new phytologist, 128: 8992. doi: https://doi.org/10.1111/j.14698137.1994.tb03990.x. lizawati, e. kartika, y. alia y & r. handayani. (2014). pengaruh pemberian kombinasi isolat fungi mikoriza arbuskula terhadap ertumbuhan vegetatif tanaman jarak pagar (jatropha curcas l.) yang ditanam pada tanah bekas tambang batu bara. biospecies, 7(1): 1421. diakses dari https://onlinejournal.unja.ac.id/biospecies/article/view/149 2. lohman, m., c. ziegler-ulsh & d. douds. (2010). a complete how-to: on-farm am fungus inoculum production. rodale institute. diakses dari: https://rodaleinstitute.org/acomplete-how-to-on-farm-am-fungusinoculum-production. muis, r., m. ghulamahdi., m. melati., purwono & i. mansur. (2016). diversity of arbuscular mycorrhiza fungi from trapping using different host plants. international journal of sciences: basic and applied research, 27 (2): 158169. diakses dari: https://pdfs.semanticscholar.org/88d1/9ccf08 f4beb09d02b52597d132826e27b981.pdf. müller a, b. ngwene, e. peiter & e. george. (2017). quantity and distribution of arbuscular mycorrhizal fungal storage organs within dead roots. mycorrhiza, 27(3):201-210. doi: 10.1007/s00572-016-0741-0 musfal. (2010). potensi cendawan mikoriza arbuskula untuk meningkatkan hasil tanaman jagung. jurnal litbang pertanian, 29 (4): 154158. doi: http://dx.doi.org/10.21082/jp3.v29n4.2010.p1 54-158 phillips, j.m & d.s. hayman. (1970). improved procedures for clearing roots and staining parasitic and vesicular-arbuscular mycorrhizal fungi for rapid assessment of infection. transactions of the british mycological society, 55: 158–160. doi: https://doi.org/10.1016/s00071536(70)80110-3. rodrigues, k.m & b.f. rodrigues. (2014). arbuscular mycorrhizal (am) fungi for sustainable agriculture. published in: advances in plant sciences for sustainable rural development. ed. by: n.m. ghangaonkar. c.t. bora college, shirur: 8-21. doi: 10.1007/9781-4020-8770-7 rini, m.v & v. rozalinda. (2010). pengaruh tanaman inang dan media tanam pada produksi fungi mikoriza arbuskular. jurnal agrotopika, 15 (1): 37-43. diakses dari https://docplayer.info/33637539-pengaruhtanaman-inang-dan-media-tanam-padaproduksi-fungi-mikoriza-arbuskular.html. smith, s.e & d. read. (2008). mycorrhizal symbiosis third edition. elsevier. new york. pp 1-43. symanczik s, m.f. lehmann, a. wiemken, t.boller & p.e. courty. (2018). effects of two 82 85 https://www.ncbi.nlm.nih.gov/pubmed/?term=pozo%20mj%5bauthor%5d&cauthor=true&cauthor_uid=22623151 https://rodaleinstitute.org/a-complete-how-to-on-farm-am-fungus-inoculum-production. https://rodaleinstitute.org/a-complete-how-to-on-farm-am-fungus-inoculum-production. https://rodaleinstitute.org/a-complete-how-to-on-farm-am-fungus-inoculum-production. https://www.ncbi.nlm.nih.gov/pubmed/?term=m%c3%bcller%20a%5bauthor%5d&cauthor=true&cauthor_uid=27838855 https://www.ncbi.nlm.nih.gov/pubmed/?term=george%20e%5bauthor%5d&cauthor=true&cauthor_uid=27838855 jurnal riset biologi dan aplikasinya. 1(2): 80-86, september 2019 | 20 contrasted arbuscular mycorrhizal fungal isolates on nutrient uptake by sorghum bicolor under drought. mycorrhiza, 28: 779-785. doi: 10.1007/s00572-018-0853-9. tarbell, t.j & r.e. koske. (2007). evaluation of commercial arbuscular mycorrhizal inocula in a sand/peat medium. mycorrhiza. 18: 51–56. doi: 10.1007/s00572-007-0152-3. wang c, p.j. white, c & li. (2017). colonization and community structure of arbuscular mycorrhizal fungi in maize roots at different depths in the soil profile respond differently to phosphorus inputs on a long-term experimental site. mycorrhiza, 27(4):369-381. doi: 10.1007/s00572-016-0757-5. 85 86 https://www.ncbi.nlm.nih.gov/pubmed/?term=wang%20c%5bauthor%5d&cauthor=true&cauthor_uid=28039601 https://www.ncbi.nlm.nih.gov/pubmed/?term=white%20pj%5bauthor%5d&cauthor=true&cauthor_uid=28039601 https://www.ncbi.nlm.nih.gov/pubmed/28039601 jurnal riset biologi dan aplikasinya, volume 2, nomor 2, september 2020 antibacterial activity of beluntas (pluchea indica l.) leaves extract using different extraction methods uji aktivitas antibakteri ekstrak daun beluntas (pluchea indica l.) menggunakan metode ekstraksi yang berbeda kinanti ayu puji lestari*, putri priliawati pranoto, sofiyah, majidah musyirah, faizatin isnaini pratiwi d3 pharmacy study program, akademi farmasi surabaya abstract escherichia coli and bacillus subtilis are bacteria that cause disease in the digestive tract. pluchea indica l. had the pharmacological activity of antiseptic power against bacteria that cause digestive tract infections because of contained antibacterial compounds. the study on the comparison of extraction methods will enable the public to choose a better extraction method to use as an antibacterial agent. this study aimed to identify the content of antibacterial compounds in pluche indica l. and to determine the antibacterial ability of pluche indica l. extract using maceration, percolation, and soxhletation methods. the results showed that pluchea indica l. contains flavonoids, alkaloids, saponins, and tannins. the highest diameter inhibition of escherichia coli and bacillus subtilis was obtained from pluchea indica l. leaves extract extracted by using the soxhletation method. abstrak escherichia coli dan bacillus subtilis merupakan bakteri penyebab penyakit pada saluran pencernaan. pluchea indica l. memiliki aktivitas farmakologi daya antiseptik terhadap bakteri penyebab infeksi saluran pencernaan karena mengandung senyawa antibakteri. kajian tentang perbandingan metode ekstraksi akan memungkinkan masyarakat untuk memilih metode ekstraksi yang lebih baik untuk digunakan sebagai agen antibakteri. penelitian ini bertujuan untuk mengidentifikasi kandungan senyawa antibakteri dalam pluche indica l. dan untuk mengetahui kemampuan antibakteri ekstrak pluche indica l. menggunakan metode maserasi, perkolasi, dan soxhlet. berdasarkan hasil penelitian menunjukkan bahwa pluchea indica l. mengandung flavonoid, alkaloid, saponin, dan tanin. hambatan diameter tertinggi escherichia coli dan bacillus subtilis diperoleh dari ekstrak daun pluchea indica l. dengan metode soxlet. how to cite: lestari, k.a.p., pranoto, p.p., sofiyah, musyirah, m., & pratiwi, f.i. (2020). antibacterial activity 0f beluntas extract (pluchea indica l.) using a different extraction method. jurnal riset biologi dan aplikasinya, 2(2), 49-54. *corresponding author: e-issn 2655-9927 jln. ketintang madya no.81, ketintang, kec. jambangan, kota sby, jawa timur 60232 e-mail: kinanti.lestari@akfarsurabaya.ac.id jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi article history received : 14 june 2020 approved : 16 august 2020 published : 30 september 2020 keywords: antibacterial activity, beluntas leaves, soxhletation method kata kunci: aktivitas antibakteri, daun beluntas, metode soxhlet 50 | lestari et al. antibacterial activity 0f beluntas extract (pluchea indica l.) introduction pathogenic bacteria in the gastrointestinal tract are a group of bacteria that can cause gastrointestinal disease (radji & maksum, 2011). digestive tract disease which is diarrhea, can be caused by bacteria and parasites (zein, 2004). the bacteria that cause diarrhea are escherichia coli. besides, bacillus subtilis also has the ability as a pathogen in the digestive tract. most of the escherichia coli and bacillus subtilis are in the digestive tract as the normal flora (bettelheim, 2000).these bacteria become pathogenic and caused diarrhea when their numbers increase in the digestive tract (jawetz, 2005). various medicinal plants have been believed to have properties to treat certain diseases and as an alternative treatment for certain diseases (agoes, 2010). one of the plants containing medicinal compounds is pluchea indica l. (nurhalimah et al., 2015). pluchea indica l. also has a pharmacological activity of antiseptic power against bacteria that cause digestive tract infections (ismi et al, 2010). pluchea indica l. leaves contain alkaloids, tannins, essential oils, sodium, potassium, aluminum, calcium, magnesium, phosphorus, and flavonoids (dalimartha, 1999), and these compounds are believed to be antibacterial compounds. most of the research on pluchea indica l. leaves focuses more on antibacterial testing, such as research on the antibacterial testing of pluchea indica l. leaves against propionibacterium acne (hafsari et al, 2015; suru et al., 2019), staphylococcus aureus, bacillus subtilis, and pseudomonas aeruginosa (manu, 2013), mycobacterium tuberculosis (amilah & ajiningrum, 2015), and escherichia coli (mulyadi et al., 2016). research about the use of the extraction method used to obtain extracts is still minimal, even though the type of extraction method can affect the content and biological activity of chemical compounds that are suspected to be antibacterial. besides, a study on the comparison of extraction methods will allow the public to choose an extraction method that allows better extraction for use as an antibacterial agent. this study aims to determine the antibacterial ability of beluntas leaves extract (pluchea indica l.) in inhibiting the growth of escherichia coli and bacillus subtilis using three different extraction techniques, maceration, percolation, and soxhletation. materials and methods reagen and chemical compound reagen and chemical compound were collected from department of chemistry, universitas negeri surabaya which are reagen mayer, reagen dragendorf, dan reagen wagner, hcl, mg powder and fecl3. bakteria and sample the bacteria used in this study were bacillus subtilis collected from ulp (research service unit) airlangga university surabaya, and escherichia coli atcc 25922 collected from bblk (central health laboratory) surabaya. the bacteria then recultured in nutrient agar media (merck, jerman) and stored in an incubator at the temperature of 30°c. pluchea indica l. leaves were collected from mmi (materia medika indonesia). extraction preparation the extraction methods used in this research were maceration, percolation and soxhletation methods. 1. maceration method. dried pluchea indica l. leaves powder (100 g) was extracted using methanol (1000 ml) solvent in a ratio of 1:10 for 10 days at 25-30°c and then filtered. the extraction was remaceration twice with the new solvent in same volume. the extract was filtered using whatman filter paper no.1. 2. percolation method dried pluchea indica l. leaves powder (100 g) was soaked using methanol (1000 ml) solvent in a ratio of 1:10 in a percolator for 24 hours at a temperature of 25-30°c. extraction was repeated twice with the new solvent and the same volume. 3. soxhletasion method dried beluntas leaves powder (100 g) was soaked using methanol (1000 ml) solvent in a ratio of 1:10 using the soxhlet method for 10 hours. the entire filtrate from each extraction method was evaporated using a rotary evaporator under pressure at a temperature of 40 °c. the filtrate was then diluted with sterile aquadest to make a concentration of 1500 ppm, 2000 ppm and 2500 ppm. aquadest were also as a control. qualitative phytochemical assay a qualitative phytochemical test was carried out to determine the presence of compounds that play a role in the process of inhibiting bacterial jurnal riset biologi dan aplikasinya, 2(2), 49-54, september 2020 | 51 growth. these compounds are limited to include flavonoids, alkaloids, saponins and tannins. 1. flavonoid assay pluchea indica l. leaves filtrate (1 ml) was added with 2n hcl (2 ml) and mg powder (1 mg) then shaken homogeneously. the sample was stated as positive for containing flavonoid compounds if there was appearence a yellow or red orange color in the tube. 2. alkaloid assay pluchea indica l. leaves filtrate (1 ml) was put in 3 different test tubes then added with 2n hcl (2 ml). dragendroff reagent was dropped on tube 1, mayer's reagent in tube 2, and wagner reagent in tube 3 three drop each test tube then shaken homogeneously. the sample is said to be positive for containing alkaloid compounds if there is appearence an orange red precipitate in tube 1, greenish white in tube 2 and brownish black in tube 3. 3. saponin assay pluchea indica l. leaves filtrate (1 ml) was added with hot aquadest (2 ml) then cooled. then shake vigorously for 10 seconds. the sample is said to be positive for containing saponin compounds if a constant foam is formed for 10 minutes in the test tube. 4. tannin assay pluchea indica l. (1 ml) added 2 drops of fecl3 then shaken homogeneously. the sample is said to be positive for containing tannin compounds if there is appearence a blackish green color in the tube. bacterial suspension nutrient broth (merck, jerman) (3,6 g) dissolved in aquadest (180 ml) then sterilized using autoclave under a pressure of 1 atm, temperature 121 °c for 30 minutes. each bacteria were inoculated in sterile nutrient broth aseptically and incubated in an incubator at 30 °c for 24 hours. antibacterian activity test antibacterial activity test was in vitro using the well method with four replications. the bacterial suspension (1 ml) was put in a sterile petri dish and added with sterile nutrient agar media (15 ml) then homogenized (pour plate method). make a well hole using the well tool no.6 aseptically. pluchea indica l. leaves extract with each concentration (30 μl) was inserted into the hole that was made and then incubated in an incubator at 30 ° c for 24 hours. results and discussion qualitative phytochemical assay the phytochemical content that wanted to observed were flavonoids, alkaloids, saponins and tannins. it is known that the pluchea indica l. leaves extract using the maceration, percolation and soxhletation method on the flavonoid test tube appeared a yellow color so that it showed positive results containing flavonoids (table 1). in the alkaloid test, there was an orange red on the mayer tube, greenish white on the dragendorf tube and brownish black on the wagner tube, so that it showed positive results containing alkaloids. in the saponin test, a constant foam was formed for 10 minutes, so it showed a positive result containing saponins and the tannin test a blackish green color was formed, so that it showed a positive result containing tannins. phytochemical qualitative testing is carried out to determine the presence of antibacterial compound contained in pluchea indica l. leaves. these compounds included flavonoids, alkaloids, saponins and tannins. the results of the phytochemical screening of the pluchea indica l. leaves extract (table 1) showed that flavonoids, alkaloids, saponins and tannins were found in the extracts that were extracted by three different methods, which were maceration, percolation and soxhletation. this is the same as the results of previous studies (khotimah, 2016; widyawati et al, 2011) which stated that beluntas leaves extract positively contained flavonoids, alkaloids, saponins and tannins. table 1. qualitative phytochemical assay pluchea indica l. leaves no. compound extraction method maserasion perkolasion soxhletasion 1. flavonoid + + + 2. alkaloid + + + 3. saponin + + + 4. tannin + + + note: += positif for the test compound; -= negative for the test compound 52 | lestari et al. antibacterial activity 0f beluntas extract (pluchea indica l.) phytochemical qualitative testing was carried out to determine the presence of antibacterial compound contained in pluchea indica l. leaves. these compounds included flavonoids, alkaloids, saponins and tannins. the results of the phytochemical screening of the pluchea indica l. leaves extract (table 1) showed that flavonoids, alkaloids, saponins and tannins were found in the extracts that were extracted by three different methods, which were maceration, percolation and soxhletation. this is the same as the results of previous studies (khotimah, 2016; widyawati et al., 2011) which stated that beluntas leaves extract positively contained flavonoids, alkaloids, saponins and tannins. antibacterial activity test the aims of this research were to determine the antibacterial ability of pluchea indica l. leaves extract in inhibiting the growth of escherichia coli and bacillus subtilis bacteria. the results of the antibacterial activity test data are presented in table 2. this test aims to determine the ability of pluchea indica l. extract to inhibited the growth of escherichia coli and bacillus subtilis bacteria. based on the interpretation of the test results (table 2), it is known that the inhibition response of the escherichia coli and bacillus subtilis bacteria carried out by the pluchea indica l. extracts, both extracted using maceration, percolation and soxhletation methods, is in the moderate inhibition category (pan et al., 2009). however, the mean results show that each has a different value. beluntas leaves extract with a concentration of 2500 ppm with the soxhletation method was known to be able to form the largest inhibition zone in escherichia coli and bacillus subtilis. this result caused by the extraction method, the solvent used, the well test method and the antibacterial compounds, which affect the bacterial inhibition mechanism. the maceration and percolation methods were chosen because they are cold extraction methods or without heating, so they can prevent damage to chemical components that are not resistant to heating (syukur et al., 2012). the purpose of maceration is also to get the chemical components in the sample, where the solvent will penetrate the cell wall and enter the cell cavity containing the active compound. however, the mean results of the inhibition zone diameter of the extracts obtained by the percolation and maceration methods were not higher than the extracts obtained by the soxhletation method. this can be because the extraction process carried out in the soxhletation method is more effective so that the results obtained are better and the solvent used is relatively small. in addition, the extraction process carried out by the soxhletation method was able to produce high rendemen and high total phenolic (puspitasari & proyogo, 2017) including flavonoids, alkaloids, saponins and tannins which affected the diameter of the inhibition zone of each bacteria. this study used methanol as a solvent because it was the polar compound, so it is able to dissolve polar compounds (tannins, alkaloids, flavonoids, saponins). this statement is in accordance with previous research (thompson, 1985) which states that methanol can attract alkaloids, flavonoids and saponins from plants. methanol was also chosen because the flavonoid content in pluchea indica l. is a polar compound so it must be dissolved with a polar type solvent (koirewoa et al., 2012). methanol can affect the effectiveness of antibacterial substances so that it can inhibit the growth of the tested bacteria. the test method used is the well method. this method was chosen because in the process, bacterial cells were not only present on the surface of the medium but also inside to the bottom of the agar medium (endang & maimunah, 2018). this is in accordance with the types of tested bacteria (escherichia coli and bacillus subtilis) which are facultative anaerobes whose life is scattered from the surface to the inside of the media. table 2. diameter of inhibitory zone bakteri konsentrasion (ppm) diameter of inhibitory zone (mm) maserasion perkolasion soxhletasion eschericia coli kontrol 0 0 0 1500 4.3 3.9 4.7 2000 4.7 4.2 5.1 2500 5.4 4.9 5.8 bacillus subtilis kontrol 0 0 0 1500 3.8 3.4 4 2000 4.2 3.9 4.9 2500 4.8 4.5 5.1 jurnal riset biologi dan aplikasinya, 2(2), 49-54, september 2020 | 53 in the well method, the pit is filled with a concentration of pluchea indica l. extract to determine its antibacterial properties. the well method can produce a clearer diameter of the inhibition zone than the disc disk method (prayoga, 2013). this is because the well method occurs better osmolarity than the disk method, because each hole is filled with extract concentrations. the well method allows the osmolarity process to occur more thoroughly and more homogeneously and the resulting extract concentration is higher and stronger to inhibit bacterial growth. factors that influence the activity of antibacterial include the amount of antibacterial substances contained in pluchea indica l., antibacterial compounds in pluchea indica l. extracts such as flavonoids, alkaloids, saponins and tannins. the mechanism of antibacterial action is saponins which interfere with cell wall permeability resulting in the release of important components, namely proteins, nucleic acids and others (ismi, 2010). tannin compounds can shrink cell walls so that they can interfere with the permeability of the cell itself, flavonoids can cause damage to the permeability of bacterial cell walls (kurniawati, 2001). alkaloids have antibacterial activity by disrupting the components of peptidoglycan in bacterial cells, so that the cell wall layer is not formed intact and causes cell death (robinson, 1991). these results indicate that natural ingredients such as pluchea indica l. have a fairly good ability to be applied as natural antibacterial agents (paz et al., 2017). conclusion pluchea indica l. extract that obtained from maceration, percolation and soxhletation extraction contained flavonoids, alkaloids, saponins and tannins. in addition, the extracts from the three extraction methods have antibacterial ability to inhibit escherichia coli and bacillus subtilis which are included in the moderate inhibition category. the highest diameter was obtained from pluchea indica l. leaves extract using the soxhletation method. references agoes, a., (2010). tanaman obat indonesia. jakarta: salemba medika. bettelheim, k. a. (2000). role of non-0157 vtec. journal of applied microbiology symposium supplement, 88(s1), 38s-50s. https://doi.org/https://sfamjournals.onlinelibrary.wi ley.com/doi/abs/10.1111/j.13652672.2000.tb05331.x. dalimartha, s. (1999). atlas tumbuhan obat indonesia. jilid i. jakarta: trubus agriwidya. endang & maimunah. (2018). uji efektivitas air buah jeruk nipis (citrus aurantifolia) dalam menghambat candida albicans (studi di stikes icme jombang). karya tulis ilmiah. http://repo.stikesicmejbg.ac.id/1477/2/151310011_endang%20maimunah _%20kti%20pdf.pdf. hafsari, a.r., cahyanto, t., sujarwo, t (2015). uji aktivitas antibakteri daun beluntas (pluchea indica (l.) less. ) terhadap propionibacterium acnes penyebab jerawat anggita. journal istek, ix(1), 142–161. https://journal.uinsgd.ac.id/index.php/istek/article/ view/174/191 ismi, r., ratnawati, d.m. and yudi, r. (2010). uji aktifitas antibakteri fraksi aktif ekstrak etanolik daun beluntas (pluchea indica l.) dengan metode maserasi dan soxhletasi terhadap salmonella typhi atcc 13311 secara dilusi. biomedika, 1(2). http://portalgaruda.org/?ref=browse&mod=viewartic le&article=152949. jawetz, e. (1995). mikrobiologi kedokteran. terjemahan edi nugroho dan maulany dari medical microbiology (1995). jakarta : egc. khotimah, k.(2016) skrining fitokimia dan identifikasi metabolit sekunder senyawa karpain pada ekstrak metanol daun carica pubescens lenne & k. koch dengan lc/ms (liquid chromatograph-tandem mass spectrometry). undergraduate thesis, universitas islam negeri maulana malik ibrahim. koirewoa, y. a., fatimawali, & wiyono, w. i. (2012). isolasi dan identifikasi senyawa flavonoid dalam daun beluntas (pluchea indica l.). pharmacon, 1(1), 47–52. https://doi.org/https://doi.org/10.35799/pha.1.2012 .445. kurniawati, m. (2001). uji aktivitas antibakteri fraksi daun sirsak (anonna murrcata) terhadap staphylococcus aureus dan escherichia coli serta profil kromatografi lapis tipusnya. skripsi fakultas farmasi gadjah mada, yogyakarta. manu, r. r. s. (2013). aktivitas antibakteri ekstrak etanol daun beluntas (pluchea indica l.) terhadap staphylococcus aureus, bacillus subtilis dan pseudomonas aeruginosa. calyptra: jurnal ilmiah mahasiswa universitas surabaya, 2(1), 1–10. http://www.journal.ubaya.ac.id/index.php/jimus/arti cle/view/162/139 mulyadi, a. f., pulungan, h., & qayyum, n. (2016). pembuatan edible film maizena dan uji aktifitas antibakteri (kajian konsentrasi gliserol dan ekstrak daun beluntas (pluchea indica l.) producing of cornstarch edible film and antibacterial activity test (the study of glycerol concentration and beluntas l. industria: jurnal teknologi dan manajemen agroindustri, 5(3), 149–158. https://doi.org/https://doi.org/10.21776/ub.industri a.2016.005.03.5 nurhalimah, h., wijayanti, n., & widyaningsih, t. d. (2015). efek antidiare ekstrak daun beluntas pada mencit. jurnal pangan dan agroindustri, 3(3), 1083– 1094. https://jpa.ub.ac.id/index.php/jpa/article/view/231. pan, x., chen, f., wu, t., tang, h., & zhao, z. (2009). the acid, bile tolerance and antimicrobial property of lactobacillus acidophilus nit. food control, 20(6), 598–602. https://doi.org/10.1016/j.foodcont.2008.08.019. paz, j.e.w., contreras, c.r., munguia, a.r., aguilar, c.r., inungaray, m.l.c. (2017). phenolic content and http://portalgaruda.org/?ref=browse&mod=viewarticle&article=152949 http://portalgaruda.org/?ref=browse&mod=viewarticle&article=152949 54 | lestari et al. antibacterial activity 0f beluntas extract (pluchea indica l.) antibacterial activity of extracts of hamelia patensobtained by different extraction methods. braz j microbiol. 49(3), 656–661. puspitasari, s. a., & proyogo, l. s. (2017). kadar fenolik total ekstrak etanol daun kersen (muntingia calabura). jurnal ilmiah cendekia eksakta, 2(1), 1–8. https://doi.org/perbandingan metode ekstraksi maserasi dan sokletasi terhadap kadar fenolik total ekstrak etanol daun kersen (muntingia calabura). prayoga, e. (2013). perbandingan efek ektrak daun sirih hijau (piper betle l) dengan metode difusi disk dan sumuran terhadap bakteri staphylococcus aureu. tesis. 1-3. universitas islam negeri syarif hidayatullah jakarta. syukur,r., alam, g., mufidah., & rahim, r. t. (2011). aktivitas antiradikal bebas beberapa ekstrak tanaman familia fabaceae radical. kesehatan, 1(1), 61–67. http://pasca.unhas.ac.id/jurnal/files/e72a6e54ecc12a 1c6d06853e9e5cd778.pdf. radji and maksum., (2011). buku ajar mikrobiologi panduan mahasiswa farmasi & kedokteran. jakarta: kedokteran ecg.54 robinson, t. 1991. kandungan organik tumbuhan tingkat tinggi. diterjemahkan oleh prof. dr. kosasih padmawinata. bandung: penerbit itb. amilah, s & ajiningrum, p.s. (2015). uji efektivitas daya hambat sari daun pegagan (centella asiatica) dan daun beluntas (pluchea indica less) terhadap pertumbuhan mycobacterium tuberculosis. stigma journal of science, 8(2), 6–11. https://doi.org/https://doi.org/10.36456/stigma.vol 8.no02.a253 suru, e., yamlean, p. v. y., & lolo, w. a. (2019). formulasi dan uji efektivitas krim antibakteri ekstrak etanol daun beluntas (pluchea indica less .) terhadap bakteri propionibacterium acnes. pharmacon, 8(2), 209–218. https://doi.org/https://doi.org/10.35799/pha.8.2019 .29256. thompson, e.b. (1985). drug biosreening. america: graceway publishing company, inc, pp, 40, 118 widyawati, p. s., wijaya, c. h., hardjosworo, p. s., & sajuthi, d. (2011). evaluasi aktivitas antioksidatif ekstrak daun beluntas (plucea indica) berdasarkan perbedaan ruas daun. jurnal teknologi pangan, 5(1), 1–17. https://core.ac.uk/download/pdf/234615371.pdf. zein, u. (2004). diare akut disebabkan bakteri. e-usu repository, january 2004, 1–15. https://www.researchgate.net/publication/42321299 _diare_akut_disebabkan_bakteri. https://www.ncbi.nlm.nih.gov/pmc/articles/pmc6066736/ https://www.ncbi.nlm.nih.gov/pmc/articles/pmc6066736/ jurnal riset biologi dan aplikasinya, volume 2, nomer 1, maret 2020 karakterisasi enzim amilase dari bakteri bacillus megaterium pada variasi suhu, ph dan konsentrasi substrat characterization of amylase enzyme from bacillus megaterium bacteria on various temperature, ph and substrate concentration dina istia’nah*, ulfah utami, ahmad barizi jurusan biologi, fakultas sains dan teknologi, universitas islam negeri maulana malik ibrahim malang abstrak bacillus megaterium merupakan salah satu mikroorganisme potensial yang dapat menghasilkan enzim amilase. karakterisasi enzim amilase dapat membantu mengetahui kondisi optimum enzim saat bekerja. penelitian ini bertujuan untuk mengetahui karakteristik enzim amilase yang dihasilkan oleh bacillus megaterium pada variasi suhu, ph dan konsentrasi substrat. karakterisasi enzim ditentukan dengan menguji aktivitas enzim pada tiga variasi yakni variasi suhu dengan menggunakan ph netral, variasi ph yang dilakukan pada kondisi suhu optimum hasil perlakuan sebelumnya dan variasi konsentrasi substrat ypss yang dilakukan pada kondisi suhu dan ph optimum hasil perlakuan sebelumnya. data aktivitas enzim amilase dianalisis secara deskriptif dengan menentukan nilai aktivitas enzim amilase tertinggi pada setiap perlakuan. hasil penelitian ini menunjukkan bahwa bacillus megaterium mampu menghasilkan enzim amilase. indeks aktivitas amilase (iaa) bacillus megaterium sebesar 2,35 mm. secara kuantitatif aktivitas enzim amilase ditentukan dengan metode dns yang untuk mengukur kadar gula reduksi yang diproduksi oleh mikrob dengan tingkat ketelitian yang tinggi. ekstrak kasar enzim amilase yang diproduksi oleh bacillus megaterium memiliki karakteristik pada suhu 37oc dengan aktivitas enzim sebesar 1,279 u/ml, sedangkan karakteristik ph berada pada ph 5,0 dengan aktivitas enzim sebesar 1,241 u/ml dan karakteristik konsentrasi substrat berada pada konsentrasi 1,50% dengan aktivitas enzim sebesar 0,548 u/ml. abstract bacillus megaterium is one of potential microorganisms that can produce amylase enzyme. characterization of an amylase enzyme is useful to determine the optimum condition of the enzyme. this study aimed to determine the characteristics of amylase enzyme from bacillus megaterium on various temperature, ph and substrate concentration. characterization of the enzyme was determined by testing the enzyme activity at various temperatures by using a neutral ph. various ph conducted at an optimum temperature from the previous treatment and the variety of substrate concentration ypss conducted under optimum temperature and ph condition from the previous treatments. amylase enzyme activity data were analyzed descriptively to determine the value of the highest amylase enzyme activity in each treatment. the results of this study showed that bacillus megaterium are able to produce the amylase enzyme. the amylase activity index (iaa) bacillus megaterium was 2.35 mm. the enzyme activity quantitatively determined by the dns method for measuring the reduction of sugar levels produced by microbes with a high level of precision. the crude extract of amylase enzyme produced by bacillus megaterium had characteristic of temperature of 37oc with the enzyme activity of 1.279 u/ml. the characteristic of ph was 5.0 with the enzyme activity 1.241 u/ml. the characteristic of the substrate concentration was at a substrate concentration of 1,50% with the enzyme activity of 0.548 u/ml. how to cite: istia’nah, d., utami, u & barizi, a. 2020. karakterisasi enzim amilase dari bakteri bacillus megaterium pada variasi suhu, ph dan konsentrasi substrat. jurnal riset biologi dan aplikasinya, 2(1), 11-17. *corresponding author e-issn 2655-9927 jln. gajayana no.50, dinoyo, kecamatan lowokwaru, malang e-mail: dina.istianah@gmail.com jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi article history received : 6 desember 2019 approved : 20 februari 2020 published : 31 maret 2020 kata kunci: bacillus megaterium, enzim amylase, suhu, ph, substrat keywords: bacillus megaterium, amylase enzyme, temperature, ph, substrate 12 | isti’anah et al; karakterisasi enzim amilase dari bakteri bacillus megaterium pendahuluan industri enzim telah berkembang pesat dan menempati posisi penting dalam bidang industri. penggunaan enzim semakin meningkat dari tahun ke tahun hingga mencapai 10-15% (mufarrikha et al., 2014). kegunaan utama enzim bagi organisme adalah sebagai katalis hayati. namun, kebutuhan enzim di indonesia masih belum dapat terpenuhi dengan baik sehingga indonesia masih harus mengimpor enzim (naiola, 2002). hal tersebut menyebabkan para peneliti untuk lebih meningkatkan kemajuan dalam bidang teknologi, salah satunya dengan memanfaatkan peran mikroorganisme dalam bidang industri. enzim amilase merupakan enzim yang mampu menghidrolisis amilum dan menghasilkan glukosa. enzim amilase dapat dihasilkan oleh semua makhluk hidup untuk mengkatalis reaksi biokimia, sehingga reaksi-reaksi tersebut dapat berlangsung lebih cepat. enzim amilase untuk kebutuhan industri diekstraksi dari berbagai jenis sel mahluk hidup, tetapi pada saat ini enzim lebih banyak diekstraksi dari berbagai jenis mikroorganisme, sebab mikroorganisme menghasilkan enzim yang dapat dimanfaatkan manusia dalam jumlah dan jenis yang sangat bervariasi. selain itu, mikroorganisme dapat dikultur untuk memperoleh enzim yang dihasilkan (ningsih et al., 2012). genus bakteri yang termasuk kelompok bakteri amilolitik di antaranya bacillus, clostridium, bacteriodes, lactobacillus, micrococcus, thermus, dan actinomycetes (reddy et al., 2003). bakteri yang banyak dimanfaatkan sebagai produksi enzim amilase adalah dari golongan genus bacillus. salah satu bakteri yang digunakan untuk produksi enzim amilase yakni bacillus megaterium. tu et al., (2015) menjelaskan bahwa penggunaan bacillus megaterium t04 dapat menghasilkan aktivitas enzim amilase sebesar 174,7 u/ml menggunakan media tepung gandum dengan masa inkubasi selama 72 jam. bacillus megaterium dapat dengan mudah ditemukan di berbagai tempat karena bakteri tersebut dapat tumbuh pada suhu 3 oc sampai 45 oc (de vos, 2009). selain itu b. megaterium juga termasuk ke dalam bakteri endofit. bakteri ini banyak ditemukan pada permukaan daun. bakteri endofit adalah bakteri yang hidup di dalam jaringan tanaman inang tanpa menyebabkan penyakit. bakteri endofit masuk ke dalam jaringan tanaman umumnya melalui akar, namun bagian tanaman yang terpapar udara langsung seperti bunga, batang, daun dan kotiledon juga dapat menjadi jalur masuk bakteri endofit (desriani et al., 2014). produksi enzim amilase yang tinggi, tidak lepas dengan adanya faktor-faktor yang mendukung keberhasilan produksi suatu enzim. faktor yang sangat terpenting adalah suhu, ph dan substrat yang mengandung kadar pati tinggi. suhu sangat memengaruhi aktivitas enzim karena enzim adalah rangkaian asam amino yang sistem kerjanya berkaitan erat dengan suhu lingkungan (tarigan et al., 2015). aktivitas enzim juga akan dipengaruhi oleh ph. ph akan berkaitan dengan keberadaan ion hidrogen. konsentrasi ion hidrogen sangat memengaruhi aktivitas enzim, karena enzim dapat aktif apabila asam amino yang merupakan sisi aktif enzim berada dalam keadaan ionisasi yang tepat. ph terlalu asam atau basa akan menyebabkan enzim terdenaturasi sehingga enzim tidak aktif (supriyanti & poedjiadi, 2007). faktor berikutnya yang perlu diperhatikan dalam memproduksi enzim amilase dari bakteri adalah konsentrasi substrat yang digunakan harus mengandung kadar pati yang tinggi. bakteri sangat membutuhkan substrat untuk mendegrasi pati menjadi karbohidrat yang lebih sederhana (maarel., 2002). untuk menentukan aktivitas enzim amilase dapat dilakukan dengan menggunakan substrat yang spesifik, kemudian aktivitas enzim amilase dapat diukur dengan memantau jumlah glukosa pereduksi yang dihasilkannya. berdasarkan latar belakang tersebut, dapat diketahui bahwa enzim amilase yang dihasilkan oleh bakteri memiliki rentan suhu, ph dan konsentrasi substrat yang optimum dengan kondisi lingkungan yang berbeda-beda. oleh karena itu, perlu dilakukan penelitian lebih lanjut untuk mengetahui karakterisasi enzim amilase yang dihasilkan oleh bacillus megaterium pada variasi suhu, ph dan konsentrasi substrat, agar nantinya hasil dari produk enzim amilase dapat diaplikasikan pada industri dengan skala yang lebih besar. bahan dan metode penelitian ini menggunakan rancangan acak lengkap. penelitian ini terdiri atas tiga perlakuan dan setiap perlakuan diulang sebanyak tiga kali. perlakuan pertama yakni variasi suhu yang terdiri atas suhu 25oc, 27oc, 35oc, 37oc dan 45oc. perlakuan kedua yakni variasi ph yang meliputi ph 4, 5, 6, 7, dan 8 serta perlakuan ketiga yakni variasi konsentrasi substrat yang terdiri atas 1%, 1,25%, 1,50%, 1,75% dan 2%. bakteri bacillus megaterium yang digunakan dalam penelitian ini, diisolasi dari daun kenikir (cosmos sulphureus cav.). jurnal riset biologi dan aplikasinya, 2(1), 11-17 , maret 2020 | 13 pengujian secara kualitatif dilakukan untuk mengetahui adanya enzim amilase pada bakteri yang diuji. pengujian ini dilakukan dengan cara mencampurkan media yeast pepton starch soluble (ypss) dengan 100 ml aquades (naiola, 2001). kemudian koloni bakteri digoreskan pada media ypss yang telah memadat dan diinkubasi pada suhu 37oc di dalam inkubator selama 2 hari (soeka, 2015). adanya aktivitas enzim amilase dapat dilihat dengan munculnya zona bening di sekitar koloni bakteri setelah dituang dengan larutan iodin (naiola, 2011). diameter zona bening diukur dan digunakan untuk menghitung rasio zona bening dengan rumus berikut (sudiana, 2002). pembuatan kurva pertumbuhan bakteri dan aktivitas amylase dilakukan dengan tahapan berikut. sebanyak 2 ose bacillus megaterium hasil peremajaan diinokulasikan ke dalam 150 ml media ypss cair. inokulum diinkubasi pada shaker inkubator dengan kecepatan 150 rpm pada suhu 30 oc selama 24 jam. inokulum diambil 15 ml dan dipindahkan ke dalam 150 ml media ypss cair yang baru. inokulum diambil 10 ml setiap 24 jam sekali dan diukur jumlah sel serta aktivitas amilasenya. kurva pertumbuhan ditentukan dengan membuat plot antara waktu, absorbansi dengan panjang gelombang 540 nm menggunakan spektrofotometer dan aktivitas enzim. aktivitas amilase ditentukan dengan mengukur kadar glukosa dengan metode dns. produksi ekstrak kasar enzim amilase dilakukan dengan cara mengambil 2 ose koloni bakteri yang berumur 24 jam, kemudian dimasukkan ke dalam 100 ml media inokulum yang telah disterilkan. selanjutnya media yang mengandung koloni bakteri diinkubasi menggunakan shaker inkubator pada suhu 30 oc selama 120 jam dengan kecepatan 150 rpm (ajayi & fagade, 2006). ekstraksi enzim amilase dilakukan dengan cara mengambil kultur bakteri yang telah diinkubasi di dalam shaker inkubator, kemudian kultur bakteri tersebut disentrifugasi dengan suhu 4 oc pada kecepatan 10.000 rpm selama 10 menit. supernatan yang diperoleh merupakan ekstrak kasar enzim amilase. penentuan suhu optimum enzim amilase dilakukan dengan cara mereaksikan 1 ml enzim amilase dengan 1 ml substrat ypss pada suhu 25 oc, 27 oc, 35 oc, 37 oc dan 45 oc ke dalam buffer fosfat 0,05 m ph 7,0 dan diinkubasi dalam water bath selama 15 menit. aktivitas enzim amilase dilakukan dengan mereaksikan ekstrak kasar enzim amilase pada variasi suhu. suhu optimum yang didapatkan digunakan untuk menentukan ph optimum enzim amilase. penentuan ph optimum enzim dilakukan dengan mereaksikan 1 ml ekstrak kasar enzim amilase dengan 1 ml substrat ypss pada suhu optimum dan sesuai ph perlakuan. kemudian diinkubasi ke dalam water bath selama 15 menit (sari, 2010). variasi ph dilakukan dengan penambahan buffer sitrat 0,2 m ph 4,5,6, buffer fosfat 0,2 m ph 7, buffer tris-hcl 0,2 m ph 8. aktivitas enzim amilase dilakukan dengan mereaksikan ekstrak kasar enzim amilase pada variasi ph. penentuan konsentrasi substrat optimum aktivitas enzim amilase dilakukan dengan mereaksikan 1 ml ekstrak kasar enzim amilase dan 1 ml substrat ypss dengan konsentrasi yang berbeda yaitu 1,0%, 1,25%, 1,50% , 1,75% dan 2,0% pada suhu dan ph optimum. diinkubasi dalam water bath selama 15 menit. aktivitas enzim amilase dilakukan dengan mereaksikan ekstrak kasar enzim amilase pada variasi konsentrasi substrat. hasil dan pembahasan pengujian aktivitas enzim amilase secara kualitatif dapat diketahui dengan mengamati zona bening yang berada di sekitar koloni bakteri. hasil dari pengujian secara kualitatif menunjukkan bahwa bakteri bacillus megaterium membentuk zona bening, artinya bakteri tersebut mampu menghasilkan enzim amilase. zona bening pada bacillus megaterium dapat diamati pada gambar 1. gambar 1. zona bening yang dihasilkan oleh bakteri bacillus megaterium yang dapat memproduksi enzim amilase setelah diinkubasi selama 24 jam. keterangan: a: zona bening dan b: koloni bakteri bacillus megaterium. 14 | isti’anah et al; karakterisasi enzim amilase dari bakteri bacillus megaterium aktivitas enzim amilase ekstraseluler dapat diukur berdasarkan diameter zona bening yang terbentuk di sekitar koloni bacillus megaterium dengan menggunakan rumus indeks aktivitas amilase (iaa). indeks aktivitas amilase pada isolat bacillus megaterium yang diinkubasi selama 24 jam sebesar 2,35 mm dan dapat dikatakan bahwa isolat bakteri bacillus megaterium dapat memproduksi enzim amilase dengan rasio yang sangat tinggi. menurut choi et al., (2005), rasio enzim ekstraseluler dengan nilai indeks aktivitas amilase di atas 2 termasuk dalam rasio ekstraseluler tinggi. pengujian selanjutnya yakni mencari kurva pertumbuhan bakteri bacillus megaterium untuk dijadikan sebagai patokan dalam menentukan karakterisasi enzim amilase, pertumbuhan bakteri tertinggi terjadi pada jam ke-72 dengan nilai od sebesar 12 dan produksi gula reduksi sebesar 8160 ppm serta dapat memproduksi aktivitas enzim amilase sebesar 6,044 u/ml (gambar 2). gambar 2. kurva pertumbuhan bacillus megaterium hasil tertinggi dari kurva pertumbuhan bakteri bacillus megaterium digunakan sebagai waktu panen enzim saat proses produksi enzim amilase. selanjutnya panen enzim amilase pada jam ke-72 tersebut digunakan untuk pengkarakterisasian enzim amilase. karakterisasi enzim yang pertama, dilihat dari suhu optimum bakteri dalam memproduksi enzim amilase. berdasarkan penelitian yang telah dilakukan, didapatkan hasil bahwa suhu optimum bakteri bacillus megaterium dalam memproduksi enzim amilase yakni pada suhu 37oc dengan aktivitas amilase sebesar 1,279 u/ml (gambar 3). karakterisasi enzim yang kedua, dilihat dari ph optimum bakteri dalam memproduksi enzim amilase. berdasarkan penelitian yang telah dilakukan, didapatkan hasil bahwa ph optimum bakteri bacillus megaterium dalam memproduksi enzim amilase yakni pada ph 5,0 dengan aktivitas enzim sebesar 1,241 u/ml (gambar 4). gambar 3. pengaruh suhu terhadap aktivitas enzim amilase dengan menggunakan buffer fosfat ph 7,0. gambar 4. pengaruh ph terhadap aktivitas enzim amilase karakterisasi enzim yang ketiga, dilihat dari konsentrasi substrat optimum bakteri dalam memproduksi enzim amilase berdasarkan hasil penelitian yang dilakukan, maka didapatkan hasil bahwa konsentrasi substrat 1,50% menjadi konsentrasi substrat yang optimum dengan aktivitas enzim amilase sebesar 0,548 u/ml (gambar 5). gambar 5. pengaruh konsentrasi substrat terhadap aktivitas enzim amilase bacillus megaterium merupakan bakteri yang dapat menghasilkan enzim dalam skala yang sangat besar. banyak ilmuwan telah mengembangkan protein bacillus megaterium dalam bidang medis dan pertanian. sebagai contoh, banyak pembuatan jurnal riset biologi dan aplikasinya, 2(1), 11-17 , maret 2020 | 15 penisilin sintetik dari bakteri tersebut. studi bioteknologi banyak membuktikan bahwa protein yang dihasilkan oleh bacillus megaterium dapat memberikan kemajuan dalam bidang medis, pertanian dan industri (vary et al., 2007). enzim yang dapat dihasilkan oleh bacillum megaterium yakni enzim amilase. enzim amilase digunakan untuk menghidrolisis pati menjadi molekul karbohidrat yang lebih sederhana yaitu maltosa dan glukosa. pati yang belum terhidrolisis sempurna menjadi glukosa juga menghasilkan produk berupa dekstrin. saat ini produk enzim amilase mencapai skala yang tinggi yaitu sekitar 25% dari perdagangan enzim (reddy et al., 2003). produksi enzim amilase dapat menggunakan berbagai sumber karbon, misalnya molase, tepung jagung, tepung tapioka dan sebagainya. dalam produksi enzim amilase dengan menggunakan mikrob, pengendalian terhadap faktor lingkungan sangat penting dilakukan karena dalam produksinya, mikrob dipengaruhi oleh beberapa hal yakni suhu dan lama inkubasi, ph awal, jumlah inokulum dan faktor yang berpengaruh lainnya yang dapat diperoleh melalui eksperimen. jenis mikrob juga berpengaruh terhadap jumlah enzim yang dihasilkan. untuk dapat menghasilkan produk enzim amilase dengan kualitas dan kuantitas yang memuaskan, perlu dilakukan optimasi kondisi dan karakterisasi dari bakteri yang digunakan (dheeran et al., 2009). karakterisasi enzim amilase dilakukan dengan mencari suhu, ph dan konsentrasi substrat optimum bakteri dalam memproduksi enzim amilase. berdasarkan penelitian yang telah dilakukan didapatkan hasil bahwa pada suhu 37 oc, bacillus megaterium dapat menghasilkan aktivitas amilase sebesar 1,279 u/ml. menurut tarigan et al. (2015) menjelaskan bahwa pada suhu optimal, tumbukan antara enzim dan substrat sangat efektif, sehingga pembentukan kompleks enzim-substrat semakin mudah dan produk yang dihasilkan meningkat. penelitian ini dapat dikatakan sesuai dengan pernyataan vaseekaran et al. (2010), yang menyatakan bahwa enzim amilase pada umumnya aktif bekerja pada kisaran suhu 25-95oc. hasil penelitian yang kedua yakni karakterisasi enzim amilase berdasarkan ph optimum bakteri dalam memproduksi enzim amilase. berdasarkan penelitian yang telah dilakukan, ph optimum bakteri bacillus megaterium dalam memproduksi enzim amilase yakni pada ph 5,0 dengan aktivitas enzim sebesar 1,241 u/ml. ph optimum bakteri dikarenakan protein enzim membentuk struktur yang sangat tepat sehingga enzim dapat mengikat dan mengolah substrat dengan kecepatan yang tinggi. carvalho et al. (2008), menyebutkan bahwa aktivitas ph optimum enzim amilase berkisar antara 4,0-8,0. ajayi & fagade (2006) melaporkan bahwa bacillus megaterium dapat memproduksi enzim dengan aktivitas sebesar 1,01 u/ml pada ph 6,8. perbedaan hasil aktivitas enzim amilase dan ph dari penelitian yang dilakukan dengan penelitian sebelumnya dikarenakan adanya perbedaan prosedur dalam pembuatan buffer ph. perubahan ph dapat menyebabkan perubahan muatan pada molekul enzim sehingga dapat memengaruhi aktivitas enzim, baik dari perubahan struktur maupun perubahan muatan. selain itu, ph tinggi ataupun rendah dapat menyebabkan terjadinya denaturasi dan hal tersebut akan mengakibatkan menurunnya aktivitas enzim (supriyanti & poedjiadi, 2007). hasil penelitian yang ketiga yakni karakterisasi enzim amilase yang dilihat dari konsentrasi substrat optimum bakteri dalam memproduksi enzim amilase. berdasarkan hasil penelitian yang dilakukan, maka didapatkan hasil bahwa konsentrasi substrat 1,50% menjadi konsentrasi substrat yang optimum dengan aktivitas enzim amilase sebesar 0,548 u/ml. menurut purwoko (2009), konsentrasi substrat dapat memengaruhi kerja enzim, konsentrasi berbanding lurus terhadap kerja enzim. dengan kata lain, tingginya konsentrasi substrat akan meningkatkan pula aktivitas enzim. pada konsentrasi substrat rendah, sisi aktif enzim hanya akan menampung substrat yang sedikit, sedangkan jika konsentrasi substrat diperbesar, maka akan semakin banyak substrat yang akan bergabung dengan enzim pada sisi aktif tersebut sehingga kecepatan reaksi juga akan semakin besar. simanjuntak (2003), menjelaskan bahwa semakin banyak konsentrasi substrat maka sisi aktif enzim yang berkontak dengan substrat juga akan bertambah banyak, sehingga semakin banyak amilosa yang dihidrolisis menjadi glukosa. namun, glukosa yang terlalu banyak menyebabkan inhibisi produk glukosa karena glukosa akan menempel pada sisi alosterik enzim, sehingga sisi aktif enzim amilase tidak dapat lagi ditempati oleh substrat. simpulan berdasarkan hasil penelitian yang telah dilakukan, maka dapat disimpulkan bahwa bacillus megaterium dapat memproduksi enzim amilase pada suhu 37oc dengan aktivitas enzim amilase sebesar 16 | isti’anah et al; karakterisasi enzim amilase dari bakteri bacillus megaterium 1,279 u/ml, ph 5,0 dengan aktivitas enzim amilase sebesar 1,241 u/,l dan konsentrasi substrat 1,50% dengan aktivitas enzim amilase sebesar 0,548 u/ml. daftar pustaka ajayi, a. e., & fagade, o. e. (2006). growth pattern and structural nature of amylases produced by some bacillus species in starchy substrates. african journal of biotechnology, 5(5): 440-444. diakses dari http://www.academicjournals.org/ajb. carvalho, r. v., corrreat., & da silva, j. (2008). properties of an amylase from thermophilic bacillus sp. brazil. journal microbiology, 39(1) :102-107. doi: 10.1590/s1517838220080001000023. choi, y. w., hodgkiss, i.j., & hyde, k. d. (2005). enzyme production by endophytes of brucea javanica. journal of agricultural technology, 1(2), 55-56. diakses dari https://www.semanticscholar.org/paper/en zyme-production-by-endophytes-of-bruceajavanica-choihodgkiss/828bb0e288bcdaf65227780dabb7f 2663c73a7b9. de vos, p. (2009). bergey's manual of systematic bacteriology. john willey & sons, 5. doi: 10.1002/9781118960608. desriani, u. m. s. p., maria, b., akhmad, r.,& puspita, l. (2014). isolasi dan karakterisasi bakteri endofit dari tanaman binahong dan ketepeng cina. jurnal kesehatan andalas, 3(2), 89-93.doi: https://doi.org/10.25077/jka.v3i2.33 dheeran, p., kumar, s., jaiswal, j. y., &adhikari, d. k. (2009). characterization of hyperthermostable α-amylase from geobacillus sp. iiptn. applied microbiology and biotechnology, 86(6): 1857–1866. doi: https://doi.org/10.1007/s00253-009-2430-9. maarel, v. (2002). properties and applications of starch-converting enzyme of the α-amylase family. journal of biotechnology, 94(2),137155. doi: 10.1016/s0168-1656(01)00407-2. mufarrikha, i., roosdiana, a., & prasetyawan, s. (2014). optimasi kondisi produksi pektinase dari aspergillus niger. kimia student journal, 2 (1), 393-399. diakses dari http://kimia.studentjournal.ub.ac.id/index.p hp/jikub/article/view/479/196. naiola, e. (2001). karakterisasi amilase dari isolat bakteri yang berasal dari bali dan lombok. jurnal biologi indonesia, 3 (1), 32-42. diakses dari https://media.neliti.com/media/publications /61030-id-none.pdf. naiola, e. (2002). karakterisasi dan optimasi media produksi amilase dari aspergillus niger dan aspergillus clavatus. berita biologi, 6(3):415421. diakses dari http://ejournal.biologi.lipi.go.id/index.php/berita_biol ogi/article/view/1213 ningsih, d. r., rastuti, u., & kamaludin, r. (2012). karakterisasi enzim amilase dari bakteri bacillus amyloliquefaciens. prosiding seminar nasional:pengembangan sumber daya pedesaan dan kearifan lokal berkelanjutan ii, november 2012. diakses dari: https://www.neliti.com/publications/171850 /karakterisasi-enzim-amilase-dari-bakteribacillus-amyloliquefaciens#cite. poedjiadi, a. (2006). dasar-dasar biokimia edisi revisi. jakarta : ui press. purwoko, t. (2009). fisiologi mikroba. jakarta: pt.bumi aksara. reddy, n. s., nimmadagga, a., & sambasiva, r. 2003. an overview of themicrobial αamylase family. african journal of biotechnology. 2(12), 645-648. diakses dari: http://www.academicjournals.org/ajb. simanjuntak, m. t. (2003). biokimia. sumatera utara: fakultas matematika dan ilmu pengetahuan alam. soeka, y. s. (2015). kemampuan bacillus licheniformis dalam menghasilkan enzim αamilase. prosiding seminar nasional masyarakat biodiversitas indonesia,1 (5) : 11621166. doi: 10.13057/psnmbi/m010534. sudiana, i. m. (2002). characteristic of cmc-ase of bacillus sp. isolated from gunung halimun national park. berita biologi, 6(1), 131-136. diakses dari: http://ejournal.biologi.lipi.go.id/index.php/berita_bi ologi/article/view/1180 supriyanti, f. m. t., & poedjiadi, a. (2007). dasardasar biokimia. jakarta : universitas indonesia (ui-press). tarigan, w. f., sumardi., & setiawan, w.a. (2015). karakterisasi enzim selulase dari bakteri selulolitik bacillus sp (skripsi, prodi biologi, universitas lampung). diakses dari http://digilib.unila.ac.id/id/eprint/15915. tu, n., doan, v., & le, t. 2015. amylase producing bacillus megaterium t04 isolated in rach lang stream of vietnam. journal of applied pharmaceutical science,5(10), 012-015. doi: 10.7324/japs.2015.501003. unakal, c., kallur, r. i., & kaliwal, b. b. (2012). production of α-amylase using banana waste by bacillus subtilis under solid state fermentation. european journal of experimental biology, 2(4),1044-1052. diakses dari http://www.imedpub.com/articles/productio https://www.semanticscholar.org/paper/enzyme-production-by-endophytes-of-brucea-javanica-choi-hodgkiss/828bb0e288bcdaf65227780dabb7f2663c73a7b9 https://www.semanticscholar.org/paper/enzyme-production-by-endophytes-of-brucea-javanica-choi-hodgkiss/828bb0e288bcdaf65227780dabb7f2663c73a7b9 https://www.semanticscholar.org/paper/enzyme-production-by-endophytes-of-brucea-javanica-choi-hodgkiss/828bb0e288bcdaf65227780dabb7f2663c73a7b9 https://www.semanticscholar.org/paper/enzyme-production-by-endophytes-of-brucea-javanica-choi-hodgkiss/828bb0e288bcdaf65227780dabb7f2663c73a7b9 https://www.semanticscholar.org/paper/enzyme-production-by-endophytes-of-brucea-javanica-choi-hodgkiss/828bb0e288bcdaf65227780dabb7f2663c73a7b9 http://kimia.studentjournal.ub.ac.id/index.php/jikub/article/view/479/196 http://kimia.studentjournal.ub.ac.id/index.php/jikub/article/view/479/196 https://media.neliti.com/media/publications/61030-id-none.pdf https://media.neliti.com/media/publications/61030-id-none.pdf https://www.neliti.com/publications/171850/karakterisasi-enzim-amilase-dari-bakteri-bacillus-amyloliquefaciens#cite https://www.neliti.com/publications/171850/karakterisasi-enzim-amilase-dari-bakteri-bacillus-amyloliquefaciens#cite https://www.neliti.com/publications/171850/karakterisasi-enzim-amilase-dari-bakteri-bacillus-amyloliquefaciens#cite http://www.imedpub.com/articles/production-of-amylase-using-banana-waste-by-bacillus-subtilis-under-solidstate-fermentation.pdf jurnal riset biologi dan aplikasinya, 2(1), 11-17 , maret 2020 | 17 n-of-amylase-using-banana-waste-bybacillus-subtilis-under-solidstatefermentation.pdf. vary, s. p. (2007). bacillus megaterium from simple soil bacterium to industrial protein production host. applied environment microbiology,76(5),957-67.doi: 10.1007/s00253-007-1089-3. vaseekaran, s., balakumar, s., & arasaratnam, v. (2010). isolation and identification of a bacterial srain producing thermostable αamylase. tropical agricultural biology, 22(1) : 1-11. doi: 10.4038/tar.v22i1.2603. http://www.imedpub.com/articles/production-of-amylase-using-banana-waste-by-bacillus-subtilis-under-solidstate-fermentation.pdf http://www.imedpub.com/articles/production-of-amylase-using-banana-waste-by-bacillus-subtilis-under-solidstate-fermentation.pdf http://www.imedpub.com/articles/production-of-amylase-using-banana-waste-by-bacillus-subtilis-under-solidstate-fermentation.pdf jurnal riset biologi dan aplikasinya. 1(2): 71-79, september 2019 | 77 jurnal riset biologi dan aplikasinya, volume 1, nomer 2, september 2019 struktur komunitas ordo anura di lokasi wisata bedengan desa selorejo kecamatan dau kabupaten malang the community structure of anuran at bedengan selorejo village tourism, dau district, malang regency sa nd ra r af ik a de vi *, luh ur septiad i , muh a mma d prayogi e r f and a, b e rry f a kh ry h a nif a, d inda tina la nisa ri f iriz k i, q oyin na dh ori ju ru sa n b i ol og i , fak ul tas sa in s d an t eknol og i , un iv er si tas i s la m n eg er i mau l an a ma l i k i b ra h i m ma la ng abstrak amfibi (ordo anura) merupakan bagian dari komponen ekosistem yang memiliki peranan sangat penting. penelitian ini bertujuan untuk menganalisis struktur komunitas ordo anura di lokasi wisata bedengan daerah kabupaten malang. metode yang digunakan adalah visual encounter survey (ves) yang dikombinasikan dengan purposive sampling melalui jalur akuatik yang dibagi menjadi 2 zona yaitu 300×5 meter di bagian atas jembatan dan 300×5 meter di bagian bawah jembatan. penelitian dilakukan sebelum musim penghujan, penghujan awal, dan penghujan, pada bulan oktober-desember 2018. data yang diperoleh dianalisis dengan menggunakan indeks keanekaragaman shannonwiener, kepadatan dan kepadatan relatif. hasil penelitian menunjukkan bahwaempat famili yang berhasil diidentifikasi yang meliputi famili ranidae, bufonidae, microhylidae, dan megophrydae. perhitungan indeks keanekaragaman di bedengan menunjukkan nilai yang rendah yakni sebesar 0,96. kepadatan dan kepadatan relatif mengalami kenaikan dimulai dari sebelum penghujan, penghujan awal dan pada saat musim penghujan, akan tetapi keanekaragaman mengalami fluktuasi. abstract amphibians (ordo anura) are part of an ecosystem component that has a very important role. the purpose of the study to analyze the community structure of anuran in the tourism region of bedengan, malang regency. the data was collected by visual encounter survey (ves) using purposive sampling. each line transect was divided 2 zone aquatic 300×5 meters in the upper and lower of bridge. the data was collected during the period before the rainy season, early rainy season and the middle of rainy season, during october to december 2018. the data obtained were analyzed using the shannon-wiener diversity index, relative density and density. the result showed that there were four families of anuran, namely: ranidae, bufonidae, microhylidae and megophrydae. the diversity index in bedengan was 0.96 which mean low diversity. the density and relative density increased starting from before the rainy, early rainy and during the rainy season, but diversity had fluctuations. how to cite: devi, s.r., septiadi, l., ervanda, m.p., hanifa, b.f., firizki, d.t., & nadhori, q. (2019). struktur komunitas ordo anura di lokasi wisata bedengan desa selorejo kecamatan dau kabupaten malang. jurnal riset biologi dan aplikasinya, 1(2): 71-79. *correspondence author: e-issn 2655-9927 jl. jl. gajayana no.50, dinoyo, kec. lowokwaru, kota malang, jawa timur 65145 e-mail: sandrarafika23@gmail.com jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi history article received 29 juli 2019 approved 25 agustus 2019 published 30 september 2019 keywords: diversity, anura, malang. kata kunci: keanekaragaman, anura, malang 60 | devi dkk; struktur komunitas ordo anura di lokasi wisata bedengan pendahuluan indonesia merupakan negara kedua yang memiliki megabiodiversitas tertinggi di dunia (nilawati, 2019). salah satu jenis keanekaragaman hayati dari kelompok fauna yang ada di indonesia adalah amfibi (groobridge, 1992). indonesia mengalami ketertinggalan penelitian di bidang amfibi padahal lebih dari 450 jenis amfibi terdapat di indonesia, hal ini menyebabkan keterbatasan data yang dimiliki (kusrini, 2008). padahal, survei yang dilakukan oleh ahli dari luar indonesia, kerapkali menemukan jenis baru yang belum terdeskripsi. amfibi (ordo anura) adalah bagian dari komponen ekosistem yang memiliki peranan sangat penting bagi stabilitas lingkungan (yani, 2015). persepsi negatif masyarakat bahwa katak beracun atau menjijikan (kusrini, 2003) menyebabkan anura banyak dijauhi. dalam rantai makanan katak dan kodok berperan sebagai pemangsa konsumen primer (iskandar,1998) serta dapat digunakan sebagai bioindikator kondisi lingkungan (stebbins dan cohen, 1997). kondisi lingkungan seperti suhu dan kelembapan secara langsung dapat mempengaruhi kepadatan amfibi pada suatu wilayah. salah satu wilayah yang memiliki potensi kepadatan dan keanekaragaman anura adalah kabupaten malang. banyak lokasi wisata di malang yang berpotensi untuk menunjang kehidupan anura terutama di wilayah kabupaten malang yang dikelilingi oleh gugusan pegunungan. kebanyakan lokasi yang potensial tersebut terletak pada dataran tinggi yang memiliki aliran air yang jernih. di antara lokasi tersebut adalah lokasi wisata bedengan desa selorejo kecamatan dau kabupaten malang. lokasi wisata ini terletak di daerah perkebunan jeruk dan banyak didatangi oleh turis. terdapat aliran air berarus deras dan berbatu besar yang berasal dari sumber mata air langsung yang melewati lokasi wisata tersebut. naik turunnya debit air berpengaruh terhadap intensitas pencemaran air yang disebabkan oleh pestisida dan aktivitas manusia. ordo anura yang dalam beberapa spesiesnya dapat menjadi bioindikator lingkungan, seperti huia masonii yang biasa ditemui pada perairan jernih, berarus deras dan berbatu besar (iskandar, 1998). pada musim penghujan terjadi kenaikan debit air yang cukup tinggi dan bersifat fluktuatif. oleh karena itu, perlu dilakukan penelitian tentang komposisi ordo anura di lokasi wisata bedengan desa selorejo kecamatan dau kabupaten malang. penelitian ini bertujuan untuk menganalisis stuktur komunitas ordo anura sebagai bentuk inventarisasi terhadap potensi hayati di lokasi tersebut. hal ini juga berkaitan dengan upaya konservasi agar tetap mempertahankan populasi, kondisi lingkungan dan habitat amfibi. hasil penelitian ini diharapkan dapat memberikan informasi tentang struktur komunitas ordo anura yang bermanfaat bagi pemerintah, masyarakat dan lingkungan khususnya di desa selorejo kecamatan dau kabupaten malang. bahan dan metode penelitian ini dilakukan selama 3 bulan (15 oktober-15 desember 2018) dengan 5 kali pengambilan data untuk mengetahui pengaruh curah hujan terhadap kepadatan amfibi, maka sampling dilakukan pada waktu yang berbeda, yakni pada saat sebelum musim penghujan, penghujan awal dan musim penghujan. keanekaragaman, kepadatan dan kepadatan relatif ordo anura dilakukan pada sepanjang sungai. saat sampling dilaksanakan, dibentuk dua kelompok yang dibagi berdasarkan kemampuan dan skill yang dimiliki untuk meminimalkan perolehan hasil yang tidak seimbang. kelompok pertama melakukan pencarian disebelah barat sungai yang merupakan daerah zona wisatawan. kelompok kedua melakukan pencarian sebelah timur sungai yang merupakan daerah bervegetasi lebat dan minim aktivitas manusia. gambar 1. area kajian lokasi wisata bedengan (sumber: goggle map) 72 jurnal riset biologi dan aplikasinya. 1(2): 71-79, september 2019 | 77 gambar 2. lokasi sampling (a) bagian hulu sungai (b) bagian hilir sungai metode yang digunakan yaitu metode visual encounter survey (ves) (heyer et al, 1994) yang dikombinasikan dengan sistem jalur (transek sampling). transek dilakukan 5 meter dari tepi sungai dan transek sepanjang 300 meter di kanan dan kiri sungai (gambar 2). di setiap lokasi sampling, ditentukan area jelajah berupa tepi sungai (kusrini, 2009). pengambilan data dilakukan malam hari pada pukul 19.00 sampai pukul 23.00 wib dengan tiga kali pengulangan pada jalur yang sama. spesimen yang ditemukan dilapang ditangkap secara langsung untuk kemudian diidentifikasi karaker mofologinya dengan menggunakan buku panduan identifikasi amfibi jawa bali (iskandar, 1998). beberapa spesimen voucher ditangkap dan didokumentasi untuk mewakili jenisnya, sedangkan yang lain dilepaskan kembali ke habitatnya (reynolds et. al., 1994). spesimen yang ditangkap dipreservasi di laboratorium ekologi, jurusan biologi, universitas islam negeri maulana malik ibrahim malang. analilis data yang digunakan yaitu: a) indeks diversitas anura menggunakan persamaan shannon-wienner : h’ = ∑ 𝑝𝑖 ln 𝑝𝑖𝑆=1 (michael, 1994) keterangan: h’ = indeks diversitas shannonwiener pi = ni/n ni = jumlah individu jenis ke-i n = jumlah total individu kriteria nilai indeks keanekaragaman shannon–wiener (h’) adalah sebagai berikut: h’< 1 : keanekaragaman rendah 1<h’≤3 : keanekaragaman sedang h’>3 : keanekaragaman tinggi b) kepadatan (k) dan kepadatan relatif (kr) menggunakan persamaan : k= jumlah individu jenis pada suatu transek luas transek (dwijoseputro, 1994) kr = k jenis jumlah seluruh jenis (suin, 2002). hasil dan pembahasan hasil penelitian kepadatan amfibi di lokasi wisata bedengan menunjukkan adanya empat famili yang dijumpai pada sepanjang area sungai yang disusuri yakni famili ranidae, megophrydae, microhylidae dan bufonidae (tabel 1). hasil analisis data menunjukkan adanya perbedaan keanekaragaman, jumlah spesies, jumlah individu dan kepadatan pada masing-masing waktu dan tempat pengambilan sampel. kepadatan ordo anura mengalami kenaikan mulai dari sebelum hujan, penghujan awal dan pada saat musim penghujan (gambar 3). kepadatan terendahya pada saat sebelum hujan yakni sebesar 4.533 individu/m2. nilai kepadatan bertambah seiring dengan datangnya musim penghujan, yakni sebesar 4.73 individu/m2 setelah penghujan awal dan 6.66 individu/m2 pada saat musim hujan. kenaikan kepadatan ordo anura dapat disebabkan oleh kondisi faktor fisik lingkungan seperti suhu air, suhu udara dan kelembaban. berdasarkan analisis indeks keanekaragaman (tabel 3) pada setiap musim tergolong rendah. sebelum musim penghujan indeks keanekaragaman sebesar 0,809, awal musim penghujan 0,903 dan musim penghujan 0,700. tingginya indeks keanekaragaman dinyatakan jika >2.0, kategori sedang antara 1.5-2.0 dan rendah jika <1.0 (eprilurahman, 2009). hasil perhitungan kepadatan relatif (tabel 4) jenis amfibi diperoleh nilai tertinggi pada zona 1 yaitu spesies huia masnonii sebesar 58%, zona 2 dan 3 nilai tertinggi 73 a b 77 | devi dkk; struktur komunitas ordo anura di lokasi wisata bedengan tabel 1. diversitas ordo anura di lokasi wisata bedengan jenis herpetofauna habitat iucn ∑ individu seluruh sampling famili spesies ranidae odorrana hosii semi-akuatik lc 208 huia masonii akuatik vu 100 chalcorana chalconota semi akuatik lc 30 bufonidae duttaphrynus melanostictus terrestrial lc 4 megophyridae leptobrachium haseltii terrestrial lc 1 microhylidae microhyla achatina terrestrial lc 1 tabel 2. nilai densitas amfibi yang dipengaruhi musim di bedengan famili name spesies sampling sebelum hujan penghujan awal penghujan ranidae odorrana hosii 27 44 74 chalcorana chalconota 1 5 5 huia masonii 39 21 21 microhylidae microhyla achatina 0 1 0 bufonidae duttaphrynus melanostictus 1 0 0 gambar 3. komposisi ordo anura berdasarkan musim di lokasi wisata bedengan tabel 3. indeks keanekaragaman ordo anura di lokasi wisata bedengan indeks nilai indeks sebelum hujan penghujan awal penghujan n 68 71 100 h’ 0,809 0,903 0,700 d 0,487 0,476 0,594 k 4,53 4,73 6,66 ke t e ra ng a n : n : j u ml a h i n div i du s el u ru h j e nis ; h’ : i n d ek s d iv er si t a s s ha n n on w e i n er , d : do m in an s i, k: k ep ad a ta n 68 71 100 4 4 3 0 20 40 60 80 100 120 sebelum penghujan penghujan awal penghujan j u m l a h jumlah individu jumlah jenis 74 jurnal riset biologi dan aplikasinya. 1(2): 71-79, september 2019 | 77 tabel 4. komposisi anura (amphibia) pada lokasi wisata bedengan famili nama spesies sebelum hujan penghujan awal penghujan ∑i k (ind/ha) kr (%) ∑i k (ind/h a) kr (%) ∑i k (ind/ ha) kr (%) ranidae odorrana hosii 27 1,8 39 44 2,93 55 74 4,93 74 chalcorana chalconota 1 0,066 1 5 0,33 6 5 0.33 4 huia masonii 39 2.6 58 21 1,4 26 21 1,4 21 microhylida e microhyla achatina 0 0 0 1 0,66 12 0 0 0 bufonidae duttaphrynus melanostictus 1 0,066 1 0 0 0 0 0 0 ∑i 68 5,126 100 71 5,32 100 100 6,66 100 jumlah jenis 4 4 3 ∑i: jumlah individu-i, k: kepadatani, kr (%): kepadatan relative. tabel 5. paramater fisik pada saat sampling dilakukan di lokasi wisata bedengan no nama spesies sampling sebelum penghujan penghujan awal penghujan 1 suhuudara (°c) 18 19 19 2 suhu air (°c) 17 17 17 3 kelembaban (%) 89 90 95 tabel 6. kepadatan amfibi berdasarkan zona di lokasi wista bedengan famili nama sesies sampling zona 1 zona 2 ranidae odorrana hosii 28 35 chalcorana chalconota 5 6 huia masonii 16 3 megophrydae leptobrachium haseltii 1 0 microhylidae microhyla achatina 1 0 bufonidae duttaphrynus melanostictus 3 0 jumlah individu 54 44 jumlah spesies 6 3 kepadatan 0,060 0,049 gambar 4. komposisi ordo anura pada dua tipe zona di lokasi wisata bedengan tabel 7. indeks keanekaragaman total di lokasi wisata bedengan indeks nilai indeks n 344 h’ 0,9618 d 0,4579 k 0,2293 n : jumlah individu seluruh jenis; h’ : indeks diversitas shanon-weiner, d: dominansi, k: kepadatan 54 44 6 2 0 10 20 30 40 50 60 zona 1 zona 2 j u m l a h individu jenis 75 77 | devi dkk; struktur komunitas ordo anura di lokasi wisata bedengan gambar 5. dokumentasi spesimen ordo anura yang ditemukan di lokasi wisata bedengan : a) chalcorana chalconota, b) duttaphrynus melanostictus, c) huia masonii, d) leptobrachium haseltii, e) microhyla achatina, f) odorrana hosi pada odorrana hosii sebear 55% dan 74%. jenis anura yang ditemukan sebelum musim hujan yaitu berasal dari famili ranidae yaitu odorrana hosii, chalcorana chalconota dan huia masonii, serta dari famili bufonidae yaitu duttaphrynus melanostictus. jenis anura yang paling banyak ditemukan adalah huia masonii dan odorrana hosii. kedua spesies tersebut merupakan spesies yang banyak ditemukan di daerah perairan. menurut septiadi (2018) odorrana hosii ditemukan pada habitat semi-akuatik sedangkan huia masonii banyak ditemukan pada habitat akuatik. duttaphrynus melanostictus juga ditemukan pada sampling sebelum musim hujan. spesies ini ditemukan di sekitar jembatan berdekatan dengan daerah wisata dan identik banyak dijumpai di wilayah terganggu atau dekat hunian manusia (izza, 2014). hal ini mununjukkan bahwa duttaphrynus melanostictus menjadi bio-indikator sebuah kawasan yang mengalami degradasi kualitas lingkungan karena terletak diwilayah padat aktivitas wisatawan. jenis anura yang ditemukan setelah musim penghujan awal yang berasal dari famili ranidae antara lain: odorrana hosii, chalcorana chalconota dan huia masonii, serta dari famili microhylidae yaitu microhyla achatina yang merupakan katak kebanyakan ditemukan pada hutan primer maupun sekunder, terkadang juga ditemukan pada habitat di sekitar pemukiman manusia (iskandar, 1998). jenis anura yang ditemukan pada musim penghujan hanya berasal dari jenis ranidae yaitu jenis odorrana hosii, chalcorana chalconota dan huia masonii. kepadatan anura setelah musim penghujan merupakan kepadan tertinggi jika dibandingkan dengan kepadatan amfibi pada saat sebelum musim penghujan dan setelah penghujan awal. kemelimpahan famili ini berkaitan dengan faktor iklim mikro dan ketersediaan nutrisi yang cukupi. berdasarkan data di atas spesies-spesies yang paling banyak dijumpai pada setiap sampling antara lain: odorrana hosii dan huia masonii. huia masonii merupakan spesies dengan status konservasi menurut iucn tergolong vu (vulnerable/rentan). banyak ditemukannya huia masonii merupakan bioindikator yang menunjukkan sebuah kualitas lingkungan sungai di lokasi wisata bedengan tergolong baik. hal ini dapat disebabkan huia masonii hanya hidup pada habitat air yang jernih dan sungainya selalu berbatu-batu paling tidak berbatu besar, selalui terkait dengan sungai yang berarus deras, meskipun berudu pernah ditemukan di dalam sungai yang arusnya sedang (iskandar, 1998). berdasarkan hasil pengukuran faktor lingkungan selama penelitian (tabel. 5) diperoleh suhu udara di lokasi penelitian sebelum musim 76 jurnal riset biologi dan aplikasinya. 1(2): 71-79, september 2019 | 77 hujan, penghujan awal dan pada saat musim hujan berturut-turut sebesar 18°c, 19°c dan 19°c dan suhu air relatif konstan pada setiap sampling yakni 17°c. konstannya parameter suhu dan kelembaban disebabkan oleh debit air dan vegetasi yang terpelihara baik (hidayah, 2018). kelebihan air saat musim penghujan terserap dan tersimpan di dalam tanah, penyerapan panas dilakukan oleh vegetasi yang terpelihara dengan baik (hanifa, 2016). pada saat pengamatan suhu udara sesuai untuk lingkungan hidup amfibi yakni 3-41 °c. kehidupan herpetofauna seperti amfibi secara signifikan dipengaruhi oleh suhu (izza, 2014). hal ini disebabkan karena amfibi adalah hewan polikiotermik (adhiaramanti, 2016) dimana suhu tubuh berfluktuasi terhadap suhu lingkungan (qurniawan, 2012). kelembapan udara di lokasi penelitian sebelum musim hujan, penghujan awal dan pada saat musim hujan berturut-turut 89%, 90% dan 95%. hal tersebut menunjukkan lokasi kelembaban yang cukup tinggi. kelembapan yang cukup dibutuhkan anura untuk melindungi diri dari kekeringan pada kulitnya (iskandar, 1998). perkembangan dan pertumbuhan secara nyata dipengaruhi oleh suhu udara amfibi, serta seringkali mengatur reproduksi dan siklus perilaku (yuliana, 2000). pada zona 1 ditemukan 54 individu amfibi yang berasal dari enam famili. famili ranidae yang ditemukan yakni odorrana hosii sebagai spesies dengan populasi terbanyak sejumlah 28 individu, diikuti huia masonii sebanyak 16 perjumpaan dan chalcorana chalconota sebanyak 5 perjumpaan. famili bufonidae yang ditemukan sebanyak 3 kali perjumpaan yaitu spesies duttaphrynus melanostictus dan masing-masing 1 kali perjumpaan dari famili microhylidae yaitu microhyla achatina dan famili megophrydae yaitu leptobrachium haseltii. spesies leptobrachium haseltii berpotensi sebagai indikator habitat perairan yang baik (iskandar, 1998). mineral yang terkandung dalam perairan merupakan kebutuhan spesifik bagi berudu leptobrachium haseltii, karena digunakan untuk bermetamorfosis menjadi katak dewasa (iskandar, 1998). pada zona 2 ditemukan 44 individu yang hanya terdiri atas famili ranidae, yaitu perjumpaan terbanyak dari jenis odorrana hosii sebanyak 35 individu, disusul dengan chalcorana chalconota sebanyak 6 individu dan huia masonii sebanyak 3 individu. banyak ditemui odorrana hosii pada sepanjang sungai karena habitat odorrana hosii selalu berkaitan dengan parit atau sungai dalam hutan primer dan sekunder (iskandar, 1998). spesimen biasanya beristirahat di atas pinggiran atau tumbuhan sepanjang sungai, jarang di lantai hutan. nilai kepadatan amfibi pada zona 1 sebesar 0,060 individu/m2, dimana nilai ini lebih besar daripada kepadatan yang ditemukan di zona 2, yaitu sebesar 0,049 individu/m2. penyebab perbedaan kepadatan dapat dikarenakan oleh lingkungan amfibi yang secara signifikan dapat menyebabkan perubahan populasi pada suatu wilayah seperti pembukaan lahan sebagai perkebunan pada suatu habitat. kondisi lingkungan pada zona 1 lebih sesuai sebagai tempat hidup amfibi dikarenakan keadaan vegetasi cukup terjaga pada daerah sungai maupun tepi sungai sehingga dapat mempertahankan kemampuan hidup amfibi, sedangkan pada zona 2 telah minim vegetasi dan terdapat perkebunan jeruk di tepi sungai. keanekaragaman amfibi di hutan bekas tebangan dan hutan yang belum ditebang sangat berbeda nyata (utama, 2003). kepadatan anura di zona 2 yang rendah juga dapat dijadikan indikator bahwa pada daerah sungainya telah mengalami penurunan kualitas habitat yang disebabkan oleh intesifikasi pestisida dari perkebunan jeruk. populasi anura yang yang lebih sedikit dapat dipengaruhi oleh perubahan kualitas lahan basah melalui pencemaran, eutrofikasi yang menyebabkan hilangnya vegetasi di sekitarnya (kusrini, 2007). selain itu, zona 2 yang pada beberapa bagian sungainnya berdekatan dengan sawah dan perkebunan warga diduga mempengarui populasi amfibi. dimana amfibi rentan terhadap senyawa-senyawa seperti logam berat, produk petroleum, herbisida dan pestisida (sparling et al. 2000). pemakaian pestisida dan pupuk kimia menjadi ancaman yang besar bagi kelestarian berbagai jenis anura yang hidup di kawasan pertanian dan pemukiman. rendahnya kepadatan populasi katak diduga karena ketersediaan makanan dan aktivitas petani sedangkan faktor lingkungan tidak berpengaruh terhadap keberadaan katak sawah (mistar, 2003). perolehan hasil yang berbeda juga dapat disebabkan oleh effort pada saat pengambilan sampel. sampling pada sebelum musim penghujan mengalami kekurangan jumlah anggota jika dibandingkan dengan musim penghujan awal dan saat musim penghujan. sesuai dengan kusrini (2008) bahwa usaha (effort) dan musim pengambilan sampel berpengaruh terhadap hasil survei lapang. simpulan struktur komunitas ordo anura yang ditemukan di lokasi wisata bedengan kecamatan 77 | devi dkk; struktur komunitas ordo anura di lokasi wisata bedengan dau kabupaten malang ditemukan 6 spesies yang termasuk dalam empat famili. jenis-jenis anura tersebut antara lain: odorrana hosii, chalcorana chalconota, leptobrachium haseltii, duttaphrynus melanostictus,. dua jenis anura, yakni microhyla achatina dan huia masonii merupakan spesies endemik jawa. perhitungan indeks keanekaragaman di bedengan menunjukkan nilai yang rendah yakni sebesar 0,96. kepadatan dan kepadatan relatif mengalami kenaikan dimulai dari sebelum penghujan, penghujan awal dan pada saat musim penghujan. akan tetapi indeks keanekaragaman mengalami fluktuasi pada tiap musim yakni 0,89 sebelum musim penghujan, kemudian naik menjadi 0,903 saat penghujan awal dan kembali turun menjadi 0,700 pada pertengahan musim penghujan. ucapan terima kasih terimakasih kepada seluruh ranger kelompok studi maliki herpetology society di jurusan biologi uin maulana malik ibrahim malang yang telah membantu pengambilan data lapang. daftar pustaka adhiaramant, titis & sukiya. (2016). keanekaragaman anggota ordo anura di lingkungan universitas negeri yogyakarta. journal biologi. 5(6). diakses dari http://eprints.uny.ac.id/id/eprint/46793. dwidjoseputro, d. (1994). ekologi manusia dan lingkungannya. jakarta: erlangga. eprilurahman r., hilmy m.f., qurniawan t.f. (2009). studi keanekaragaman reptil dan amfibi di kawasan ekowisata linggo asri, pekalongan, provinsi jawa tengah. journal of biological researches. 15(1): 93-97. groombridge, b. (1992). global biodiversity status of the earth’s living resources. india: a report compiled by the world conservation monitoring. hlm 66. hanifa b.f., ismi n., setyobudi w., utami b. (2016). kajian keanekaragaman dan kemelimpahan ordo anura sebagai indikator lingkungan pada tempat wisata di karesidenan kediri. prosiding seminar nasional pendidikan dan saintek. diakses dari https://publikasiilmiah.ums.ac.id/handle/1161 7/7923. heyer, w.r., m.a. donnely, r.w. mcdiarmid, l.c. hayek & m.s. foster. (1994). measuringand monitoring biological diversity:standard methods for amphibians. washington: smithsonian institution press: hidayah, a., hanifa, b. f., devi, s. r., septiadi, l., alwi, m. z., & afifudin, f. a. (2018). keanekaragaman herpetofauna di kawasan wisata alam coban putri desa tlekung kecamatan junrejo kota batu jawa timur. prosiding seminar nasional vi hayati 2018, isbn : 978 – 602 – 61371 – 2 – 8. iskandar d.t. (1998). amfibi jawa dan bali –seri panduan lapangan. bogor: puslitbang lipi. izza, qotrun &kurniawan, nia. (2014). eksplorasi jenis-jenis amfibi di kawasan owa cangar dan air terjun watu ondo, gunung welirang, tahura r.soerjo. jurnal biotropika, 2(2): 103-108. diakses dari https://biotropika.ub.ac.id/index.php/biotropi ka/article/view/248/175. kholanus, f., yunanti, b.d., kaban, a & abdul, r.f. (2009). keanekaragaman amfibi di kawasan penyangga taman nasional bukitbaka bukit raya. pkm-artikelilmiah. ipb bogor. diakses dari http://repository.ipb.ac.id/handle/123456789 /19973. kusrini m.d. (2008). pedoman penelitian dan survey amfibi di alam. bogor: fakultas kehutanan ipb michael. (1994). metode ekologi untuk penyelidikan lapangan dan laboratorium. jakarta: ui press. mistar. (2003). panduan lapangan anfibi kawasan ekosistem leuser. bogor: the gibbon foundation & pili-ngo movement. kamsi, m. 2008. mengukur nilai konservasi amfibi dan reptil di suatu kawasan, contoh kasus pt. sari bumi kusuma kalimantan tengah. warta herpetofauna. 2 (1). diakses dari: issuu.com/herpetologiindonesia/docs/warta_h erpetofauna_edisi_september. nilawati, t. s., hernawati, h., & taufik, r. a. (2019). habitat and population characteristics of the endemic java tree frog (rhacophorus margaritifer) in ranca upas, west java, indonesia. biodiversitas. 20(6): 1644-1649. doi https://doi.org/10.13057/biodiv/d200621. kusrini m.d. (2007). konservasi amfibi di indonesia: masalah global dan tantangan. media konservasi. 7(2):89-95. doi: https://doi.org/10.29244/medkon.12.2.%25p. kusrini m.d. (2008). pedoman penelitian dan survey amfibi di alam. bogor: fakultas kehutanan. pemkab malang. (2018). kabupaten malang. diakses melalui ttp://kab\malang.stiki.web.id/ind/27452635/kab-malang_13067_stiki-malang_kabmalang-stiki.html pada 11 november 2018. qurniawan, t.f., & eprilurahman, r. (2012). keanekaragaman jenis herpetofauna di kawasan ekowisata goa kiskendo, kulonprogo, provinsi daerah istimewa yogyakarta. biota. 17(2):78-84. doi: https://doi.org/10.24002/biota.v17i2.132. 78 https://doi.org/10.29244/medkon.12.2.%25p http://kab/malang.stiki.web.id/ind/2745-2635/kab-malang_13067_stiki-malang_kab-malang-stiki.html http://kab/malang.stiki.web.id/ind/2745-2635/kab-malang_13067_stiki-malang_kab-malang-stiki.html http://kab/malang.stiki.web.id/ind/2745-2635/kab-malang_13067_stiki-malang_kab-malang-stiki.html http://kab/malang.stiki.web.id/ind/2745-2635/kab-malang_13067_stiki-malang_kab-malang-stiki.html jurnal riset biologi dan aplikasinya. 1(2): 71-79, september 2019 | 77 reynolds, r. p., crombie, r. i., & mcdiarmid, r. w. (1994). keys to a successful project: associated data and planning. voucher specimens. diakses dari https://repository.si.edu/bitstream/handle/10 088/18177/vz_1996reynoldsetal.pdf?sequence =1&isallowed=y. septiadi l. hanifa b.f, khatimah a, indawati y, alwi m.z, erfanda m.p. (2018). study of reptile and amphibian diversity at ledok amprong poncokusumo, malang east java. jurnal biotropika. 6 (2): 45-53. doi: http://dx.doi.org/10.21776/ub.biotropika.201 8.006.02.02. sparling, d. w., g. linder and c. a. bishop. (2000). ecotoxicology of amphibians and reptiles. columbia: setac technical publications. suin, n. m. 2002. metode ekologi. padang: universitas andalas press. utama, h. a. priyono dan m.d. kusrini. (2003). studi keanekaragaman amfibi (ordo anura) di areal pt. intracawood manufacturing, kalimantan timur. prosiding seminar hasil penelitian konservasi amfibi dan reptil di indonesia. bogor departemen konservasi sumberdaya hutan. institut pertanian: hal. 105-129. diakses dari: https://repository.ipb.ac.id/handle/12345678 9/16952. yani, a., & said, s. (2015). keanekaragaman jenis amfibi ordo anura di kawasan hutan lindung gunung semahung kecamatan sengah temila kabupaten landak kalimantan barat. jurnal hutan lestari, 3(1): 15-20. diakses dari: http://jurnal.untan.ac.id/index.php/jmfkh/art icle/view/8877. yuliana s. 2000. kenanekaragaman jenis amfibi (ordo anura) di kampus ipb darmaga. bogor. skripsi. bogor: jurusan konservasi sumberdaya hutan fakultas kehutanan, institutpertanian bogor. diakses dari: https://repository.ipb.ac.id/handle/12345678 9/18831. 79 https://repository.ipb.ac.id/handle/123456789/16952 https://repository.ipb.ac.id/handle/123456789/16952 jurnal riset biologi dan aplikasinya, volume 2, nomor 1, maret 2020 komunitas bivalvia yang berasosiasi dengan kerang lentera (brachiopoda: lingulata) di zona intertidal selat madura bivalves communities associated with lamp shells (brachiopoda: lingulata) from the intertidal zone of madura strait rakmawati1*, reni ambarwati2 1program magister biologi, fakultas sains dan teknologi, universitas airlangga 2jurusan biologi, fakultas matematika dan ilmu pengetahuan alam universitas negeri surabaya abstrak kerang lentera merupakan salah satu makrobentos penyusun ekosistem intertidal berlumpur. penelitian ini bertujuan untuk mendeskripsikan komunitas bivalvia yang yang berasosiasi dengan kerang lentera di zona intertidal selat madura. sampling dengan menggunakan metode simple random sampling pada lima lokasi yang telah ditentukan, yakni di kabupaten probolinggo, kabupaten situbondo, kabupaten bangkalan, kecamatan kwanyar-bangkalan, dan kabupaten pamekasan. pengambilan sampel dilakukan dengan menggali substrat pada area plot sedalam 5-10 cm. hasil penelitian menunjukkan bahwa dijumpai 15 spesies anggota kelas bivalvia yang memiliki ko-eksistensi dan berasosiasi dengan kerang lentera (brachiopoda) yang berasal dari famili arcidae, veneridae, solenidae, cardiidae, lucinidae, lasaeidae, laternulidae, mactridae, dan tellinidae. koreamya sp. merupakan spesies yang berasosiasi komensalisme dengan kerang lentera (brachiopoda: lingulata). abstract lamp shells can be associated life with bivalves communities. this research aimed to identify and describe the diversity of bivalves associated with lamp shells. sampling was conducted by using the simple random sampling method in five predetermined locations, namely in probolinggo regency, situbondo regency, bangkalan regency, kwanyar-bangkalan district, and pamekasan regency. sampling was done by digging the substrate in plot areas for 5-10 cm depth. the results revealed that there were 15 species of bivalves found in the habitat of lamp shells and associated with lamp shells (brachiopoda). they belong to arcidae, veneridae, solenidae, cardiidae, lucinidae, lasaeidae, laternulidae, mactridae, and tellinidae. koreamya sp. has commensalism association with the lamp shells (brachiopoda: lingulata). how to cite: rakmawati & ambarwati, r. (2020). komunitas bivalvia yang berasosiasi dengan kerang lentera (brachiopoda: lingulata) di zona intertidal selat madura. jurnal riset biologi dan aplikasinya, 2 (1), 36-42. *corresponding author: e-issn 2655-9927 jln. mulyorejo, kampus c, unair surabaya jawa timur 60115 e-mail: watio294@gmail.com jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi article history received : 2 maret 2020 approved : 27 maret 2020 published : 31 maret 2020 kata kunci: bivalvia, brachiopoda, kerang lentera, koreamya sp. keywords: bivalvies; brachiopoda, lantern shells, koreamya sp. jurnal riset biologi dan aplikasinya, 2(1), 36-42, maret 2020| 37 pendahuluan kerang lentera, atau juga dikenal dengan nama kerang lampu, tauge laut, kerang daun, maupun tebalan (ambarwati et al., 2019) merupakan anggota invertebrata purba yang termasuk dalam filum brachiopoda kelas lingulata. kerang lentera merupakan salah satu dari sedikit invertebrata laut yang memiliki catatan fosil terlengkap, yakni dari munculnya kerangka awal pada masa cambrian hingga terjadinya distribusi secara sporadis di lautan modern (koneva & ushatinskaya, 2008); skovsted et al., 2016). secara filogeni, kerang lentera merupakan anggota kelompok lophophorata (pechenik, 2010). lophophore merupakan istilah untuk struktur organ esensial yang dimiliki oleh kerang lentera yang merepresentasikan cara kerang lentera makan dengan menggunakan bantuan organ lophophore (carlson, 2016; samanta, choudhury, dan chakraborty, 2014; zhang et al., 2003). kerang lentera merupakan nama lokal untuk anggota filum brachiopoda yang dijumpai masih hidup hingga saat ini. bitner et al., (2012) dan samanta et al., (2014) memaparkan bahwa kerang lentera dapat dijumpai meliang di bawah sedimen atau substrat pada zona intertidal suatu perairan. berdasarkan tempat hidupnya, samanta et al (2015) memaparkan bahwa biasanya kerang lentera hidup di substrat lempung berpasir. mitra & pattanayak (2013) melaporkan bahwa kerang lentera lebih menyukai substrat berupa tanah lanau hitam yang mengandung materi dekomposisi dan lumpur yang berpasir. sementara itu, goto et al (2014) menyatakan bahwa biasanya kerang lentera hidup meliang di bawah substrat dan berko-eksistensi dengan beberapa anggota filum lain, di antaranya ialah anggota filum platyhelminthes, arthropoda, dan mollusca, termasuk anggota filum mollusca yang berasal dari kelas bivalvia. adanya ko-ekistensi kerang lentera dengan bivalvia mengindikasikan bahwa terjadi asosiasi antara kerang lentera dengan anggota bivalvia. asosiasi merupakan hubungan timbal balik antarspesies di dalam suatu komunitas dan dapat digunakan untuk menduga komposisi organisme dari suatu komunitas (macfarlan et al., 2009). selain itu, macfarlan et al., (2009) juga menambahkan bahwa peristiwa asosiasi dalam suatu komunitas dapat menunjukkan tingkat keragaman dari komunitas tersebut. dengan demikian, keberadaan anggota bivalvia yang hidup bersama dan berasosiasi dengan kerang lentera dapat mencerminkan tingkat keragaman bivalvia tersebut di dalam sebuah komunitas. menariknya, hanya anggota kelompok bivalvia tertentu yang dapat berasosiasi atau memiliki hubungan simbiosis (sebagian besar bersifat komensal) dengan kerang lentera (goto et al., 2014). asosiasi atau hubungan simbiotik yang terbentuk biasanya dengan hidup di tubuh kerang lentera atau di dalam liang kerang lentera, dan bivalvia akan memanfaatkan kerang lentera yang merupakan inangnya sebagai tempat berlindung dari predator dan untuk mendapatkan keuntungan dari arus air yang kaya akan oksigen dan partikel organik yang diciptakan oleh kerang lentera (goto et al., 2014). pada penelitian sebelumnya, dilaporkan bahwa koreamya arcuata merupakan satu-satunya bivalvia yang berasal dari superfamili galeommatoidea yang diketahui berasosiasi atau memiliki hubungan simbiotik dengan kerang lentera (luetzen, 2009; sato et al., 2011; savazzi, 2001). sementara itu, penelitian mengenai keragaman anggota bivalvia secara keseluruhan yang berasosiasi atau memiliki ko-eksistensi dengan kerang lentera belum pernah dilaporkan, terutama yang berasal dari selat madura. ambarwati et al., (2019) melaporkan keberadaan tebalan atau lamp shells yang dimanfaatkan oleh penduduk di pesisir probolinggo yang terletak di selat madura. penelitian ini bertujuan untuk mengidentifikasi dan mendeskripsikan keragaman bivalvia yang berasosiasi atau memiliki ko-eksistensi dengan kerang lentera yang berada di perairan selat madura. bahan dan metode pengambilan sampel bivalvia yang berasosiasi atau memiliki ko-eksistensi dengan kerang lentera dilakukan di lima lokasi yang telah ditentukan, yakni di perairan kabupaten probolinggo (pantai mayangan, bee jay bakau resort, dengan koordinat 7º43’42.15” s 113º13’24.93” e), kabupaten situbondo (pantai bhoong, kecamatan besuki, dengan koordinat 7º43’36.00” s 113º41’00.74” e), kabupaten bangkalan (7º02’06.69” s 112º44’19.46” e), kecamatan kwanyar-bangkalan (7º18’60.53” s 112º92’11.05” e), dan kabupaten pamekasan (7º09’07.59” s 113º34’57.37” e). kelima lokasi tersebut merupakan habitat kerang lentera. sampling dilakukan pada saat pantai surut terjauh di kelima lokasi (gambar 1). 38 | rakmawati & ambarwati; komunitas bivalvia yang berasosiasi dengan kerang lentera gambar 1. peta lokasi sampling metode simple random sampling, yakni sampling dilakukan dengan menggunakan metode plotting. sampel bivalvia yang berasosiasi dengan kerang lentera diperoleh dengan cara menggali substrat (pada area plot yang merupakan habitat kerang lentera) menggunakan sekop sedalam 5-10 cm. substrat yang merupakan habitat bivalvia dan kerang lentera juga diambil untuk dianalisis komposisinya berdasarkan ukuran partikelnya. metode simple random sampling, yakni sampling dilakukan dengan menggunakan metode plotting. sampel bivalvia yang berasosiasi dengan kerang lentera diperoleh dengan cara menggali substrat (pada area plot yang merupakan habitat kerang lentera) menggunakan sekop sedalam 5-10 cm. substrat yang merupakan habitat bivalvia dan kerang lentera juga diambil untuk dianalisis komposisinya berdasarkan ukuran partikelnya. sampel bivalvia yang diperoleh kemudian diletakkan ke dalam nampan maupun plastik klip yang sudah diberi label. setelah itu, sampel bivalvia dicuci bersih dengan air laut, kemudian diawetkan dengan menggunakan alkohol 70% dan diletakkan dalam botol koleksi. teknik identifikasi dan deskripsi bivalvia dilakukan berdasarkan ciri morfologi (bentuk dan pola dasar) cangkang yang mengacu pada dharma (2005) dan sato et al., (2011). sementara itu, sampel substrat yang diperoleh dianalisis komposisi berdasarkan ukurannya untuk menentukan persentase komposisi bahan atau partikel penyusun substrat tersebut. data dianalisis secara deskriptif. hasil dan pembahasan sebanyak lima lokasi berbeda dipilih sebagai lokasi sampling pada penelitian ini, yakni di kabupaten probolinggo, kabupaten situbondo, kabupaten bangkalan, kecamatan kwanyarbangkalan, dan kabupaten pamekasan. pemilihan kabupaten-kabupaten tersebut sebagai lokasi penelitian dikarenakan kelima lokasi tersebut memiliki komposisi partikel penyusun substrat yang berbeda-beda (tabel 1), sehingga kemungkinan keragaman komunitas bivalvia yang berasosiasi dengan kerang lentera juga berbeda. hal tersebut sesuai dengan yang dipaparkan oleh bloomfield & gillanders, (2005); handayani, (2017); dan negelkerken et al., (2000), bahwa komposisi atau partikel penyusun substrat akan menentukan struktur komunitas invertebrata (termasuk bivalvia) yang mendiaminya. bivalvia merupakan anggota filum mollusca yang sebagian besar anggotanya hidup bersama dan berasosiasi dengan anggota filum lain, termasuk dengan anggota filum brachiopoda. berdasarkan penelitian yang dilakukan di lima lokasi yang telah ditentukan, dijumpai sebanyak 15 spesies bivalvia berasosiasi atau juga dijumpai berada di habitat yang sama dengan kerang lentera (tabel 2). berdasarkan tabel 2 dapat diketahui bahwa anggota kelas bivalvia yang paling banyak berasosiasi dengan kerang lentera (brachiopoda) ialah berasal dari kelas veneridae, yakni sebanyak enam spesies, antara lain ialah spesies meretrix meretrix, callista chione, dosinia fibula, placamen lamellatum, marcia japonica., dan meretrix sp. hal tersebut diduga dikarenakan spesies anggota famili jurnal riset biologi dan aplikasinya, 2(1), 36-42, maret 2020| 39 veneridae memiliki keragaman yang lebih luas dibanding dengan anggota famili lainnya. selain itu, substrat yang didominasi oleh keberadaan lumpur dan pasir juga merupakan substrat yang cocok bagi sebagian anggota famili veneridae. nybakken & bertness (2005) menyatakan bahwa substrat pasir dan lumpur dapat memfasilitasi ketersediaan makanan yang berupa detritus dan makroalga, serta kondisi lingkungan pasir dan lumpur terlindung dan meminimalkan adanya gerakan air, sehingga kerang famili veneridae dapat bertahan hidup di dalamnya. selain itu, terdapat tujuh spesies kelas bivalvia yang dapat dijumpai berada di habitat yang sama dengan kerang lentera di semua lokasi penelitian, yakni spesies anadara antiquata, a. granosa, meretrix meretrix, meretrix sp., vasticardium flavum, mactra queenslandica, dan spesies tellina verrucosa. hal tersebut diduga dikarenakan spesies anadara antiquata, a. granosa, meretrix meretrix, meretrix sp., vasticardium flavum, mactra queenslandica, dan spesies tellina verrucosa memiliki batas toleransi yang lebih tinggi terhadap komposisi penyusun substrat dibandingkan dengan spesies lainnya. lindawaty et al (2016) menyatakan bahwa kerang anadara granosa banyak dijumpai di daerah intertidal suatu perairan, yang mana kerang anadara ini dapat hidup di perairan yang memiliki substrat berupa pasir berlumpur. hal tersebut dikarenakan kerang anadara merupakan jenis kerang pemakan suspensi pada perairan yang memiliki muatan padatan tersuspensi yang cukup tinggi. penelitian ini juga menemukan keberadaan kerang laternula truncata yang berada di habitat yang sama dengan kerang lentera di probolinggo. kerang laternula truncata meliang dalam ke dalam substrat dan membentuk lubang yang hampir serupa dengan lubang yang dibuat kerang lentera. keberadaan kerang laternula truncata di habitat yang sama dengan kerang lentera ini juga dilaporkan oleh mitra & pattanayak, (2013). tabel 1. data komposisi substrat (berdasarkan partikel penyusunnya) pada lima lokasi penelitian no. lokasi penelitian tipe substrat komposisi substrat 1. kabupaten probolinggo pasir berlumpur pasir (++) dan lumpur (++) 2. kabupaten situbondo pasir berlumpur pasir (++) dan lumpur (++) 3. kabupaten bangkalan lumpur lumpur (++++) 4. kecamatan kwanyar-bangkalan lumpur berpasir pasir (++) dan lumpur (+++) 5. kabupaten pamekasan pasir berlumpur pasir (++) dan lumpur (+) keterangan: (+): indikator dominansi tabel 2. data keragaman jenis bivalvia yang berasosiasi dengan kerang lentera no. famili spesies lokasi perjumpaan 1. arcidae anadara antiquata i, ii, iii, iv, dan v 2. anadara granosa i, ii, iii, iv, dan v 3. veneridae meretrix meretrix i, ii, iii, iv, dan v 4. meretrix sp. i, ii, iii, iv, dan v 5. dosinia fibula iii 6. placamen lamellatum iv 7. marcia japonica iii 8. callista chione iii 9. solenidae solen sp. iii dan iv 10. cardiidae vasticardium flavum i, ii, iii, iv, dan v 11. lucinidae fimbria sowerbyi iv 12. lasaeidae koreamya sp. i, v 13. laternulidae laternula truncata i 14. mactridae mactra queenslandica i, ii, iii, iv, dan v 15. tellinidae tellina verrucosa i, ii, iii, iv, dan v keterangan: i= probolinggo, ii= situbondo, iii= bangkalan, iv= kwanyar-bangkalan, v=pamekasan 40 | rakmawati & ambarwati; komunitas bivalvia yang berasosiasi dengan kerang lentera keberadaan spesies anadara antiquata, a. granosa, meretrix meretrix, meretrix sp., vasticardium flavum, mactra queenslandica, dan tellina verrucosa yang berasosiasi dengan kerang lentera di seluruh lokasi penelitian berbanding terbalik dengan keberadaan spesies dosinia fibula, placamen lamellatum, callista chione, fimbria sowerbyi, solen sp., marcia japonica, koreamya sp., dan spesies laternula truncata yang hanya dapat dijumpai di lokasi penelitian tertentu. spesies dosinia fibula, marcia japonica, dan callista chione hanya dijumpai berada di habitat yang sama dengan kerang lentera di kabupaten bangkalan yang memiliki komposisi substrat berupa lumpur, sedangkan spesies placamen lamellatum dan fimbria sowerbyi dijumpai di kecamatan kwanyar-bangkalan yang komposisi substratnya terdiri atas lumpur dan pasir (lumpur lebih mendominasi), dan spesies solen sp. yang dapat dijumpai berasoisasi dengan kerang lentera di perairan kabupaten bangkalan, sebagaimana diketahui bahwa solen sp. atau biasa disebut dengan lorjuk merupakan kerang yang lebih senang hidup di dasar perairan dengan jumlah pasir yang lebih banyak. subiyanto et al, (2013) memaparkan bahwa semakin tinggi kandungan pasir pada substrat suatu perairan, maka semakin tinggi pula kepadatan lorjuk yang dijumpai. hal tersebut disebabkan karena jenis sedimen pasir mempunyai pertukaran air yang cepat sehingga menambah persediaan oksigen dan merupakan penyangga yang baik bagi perubahan suhu dan salinitas yang besar. adanya campuran lumpur cenderung mengakumulasi bahan organik. bahan organik ini dimanfaatkan oleh fitoplankton yang merupakan sumber makanan bagi lorjuk subiyanto et al., (2013). sementara itu, keberadaan spesies laternula truncata yang berasosiasi dengan kerang lentera hanya dapat dijumpai di perairan probolinggo, sedangkan spesies koreamya sp. keberadaannya yang berasosiasi dengan kerang lentera dapat dijumpai di perairan probolinggo dan pamekasan. asosiasi merupakan hubungan timbal balik atau hubungan simbiotik antarspesies baik secara langsung maupun secara tidak langsung yang umumnya terjadi di dalam suatu komunitas. asosiasi antara kerang lentera dengan komunitas bivalvia bersifat komensalisme atau bahkan parasitisme. dalam penelitian ini, selain dijumpai bentuk asosiasi secara tidak langsung antara kerang lentera dengan komunitas bivalvia, juga dijumpai bentuk asosiasi secara langsung, yakni dijumpainya spesies koreamya sp. melekat pada bagian anterior cangkang kerang lentera. data penemuan tersebut mirip dengan hasil penelitian yang dilakukan oleh goto et al., (2014), yang mengungkapkan bahwa terjadi hubungan simbiotik antara kerang lentera dengan anggota mollusca, yakni anggota mollusca sering menempel di bagian anterior cangkang kerang lentera untuk memanfaatkan aliran air yang dibuat oleh inang (kerang lentera) untuk penyaringan makanan, sehingga dapat diperkirakan bahwa mollusca mungkin memanfaatkan organ kerang lentera untuk membantu pernapasan. selain itu, goto et al., (2014) dan sato et al., (2011) juga menambahkan bahwa kerang lentera yang menjadi inang bagi koreamya sp. ialah spesies lingula adamsi dan lingula anatina. berdasarkan data keragaman jenis bivalvia yang berasosiasi dengan kerang lentera pada tabel 2, dapat diketahui bahwa terdapat ketimpangan pada persebaran bivalvia. ketimpangan data persebaran tersebut mengindikasikan adanya ketidakmerataan persebaran bivalvia di suatu wilayah. persebaran bivalvia yang tidak merata tersebut dipengaruhi oleh faktor gerakan air, aktivitas biologis seperti pemangsaan, ketersediaan makanan yang ditinjau dari tipe substrat, diameter rata-rata butiran sedimen, kandungan debu dan liat, keberadaan cangkang-cangkang mati, dan kestabilan substrat (nybakken & bertness, 2005). lindawaty et al., (2016) juga menambahkan bahwa persebaran mollusca pada suatu daerah dipengaruhi oleh hubungan timbal balik dari beberapa faktor lingkungan, mulai dari derajat keterbukaan terhadap hantaman ombak, panjang massa air yang berada di atas permukaan, batas maksimum dan minimum suhu air dan udara, ada tidaknya kompetitor terhadap daya dukung lingkungan dan ketersediaan makanan. sementara itu, kabupaten bangkalan merupakan lokasi penelitian dengan jumlah keragaman bivalvia yang berasosiasi dengan kerang lentera tertinggi dibandingkan lokasi penelitian yang lain, yakni hampir seluruh spesies bivalvia dijumpai di kabupaten bangkalan (kecuali spesies placamen lamellatum, fimbria sowerbyi, laternula truncata, dan koreamya sp.) (tabel 2). hal tersebut kemungkinan dikarenakan kabupaten bangkalan memiliki substrat dominan lumpur (tabel 1). substrat dominan lumpur memiliki partikel-partikel penyusun substrat yang lebih halus dibandingkan dengan substrat pasir berlumpur dan substrat lumpur berpasir. taqwa et al., (2014) memaparkan bahwa semakin halus tekstur substrat dasar pada suatu perairan, maka kemampuan dalam menjebak bahan organik juga akan semakin besar. dengan jurnal riset biologi dan aplikasinya, 2(1), 36-42, maret 2020| 41 demikian dapat diketahui bahwa substrat lumpur memiliki kandungan bahan organik yang tinggi daripada substrat pasir berlumpur dan substrat lumpur berpasir. selanjutnya, riniatsih & kushartono, (2009) juga menambahkan bahwa substrat lumpur berpasir dan substrat pasir belumpur memiliki kandungan bahan organik kategori sedang, sedangkan substrat lumpur memiliki kandungan bahan organik kategori tinggi, dengan kata lain substrat lumpur lebih menyediakan daya dukung lingkungan yang tinggi (berupa makanan dan tempat untuk melekat) untuk keberadaan bivalvia dibandingkan dengan substrat lumpur berpasir dan pasir berlumpur. keragaman bivalvia yang tinggi di substrat lumpur sebanding dengan keberadaan kerang lentera yang melimpah di substrat berkomposisi lumpur, sehingga akan terjadi asosiasi antara kerang lentera dengan komunitas bivalvia yang lebih tinggi dibandingkan dengan asosiasi antara kerang lentera dengan komunitas bivalvia di substrat lain. simpulan hasil penelitian menunjukkan bahwa dijumpai 15 spesies anggota kelas bivalvia yang memiliki koeksistensi dan berasosiasi dengan kerang lentera (brachiopoda), yaitu anadara antiquata, a. granosa, meretrix meretrix, meretrix sp., dosinia fibula, placamen lamellatum, marcia japonica., callista chione, solen sp., vasticardium flavum, fimbria sowerbyi, koreamya sp., laternula truncata, mactra queenslandica, dan tellina verrucosa. koreamya sp. merupakan spesies yang berasosiasi komensalisme dengan kerang lentera (brachiopoda: lingulata) ucapan terima kasih penulis mengucapkan terima kasih kepada segenap tim sampling atas kerja samanya selama kegiatan sampling di lima lokasi penelitian. daftar pustaka ambarwati, r., rahayu, d. a., & faizah, u. (2019). the potency and food safety of lamp shells (brachiopoda: lingula sp.) as food resources. j. phys.: conf. ser., 1417, 12039. https://doi.org/10.1088/17426596/1417/1/012039 bitner, m. a., dulai, a., kocsis, l., & müller, p. m. (2012). lingula dregeri (brachiopoda) from the middle miocene of hungary. annales societatis geologorum poloniae, 82, 39–43. diakses dari https://yadda.icm.edu.pl/baztech/element/b wmeta1.element.baztech-4f70b2f8-82c2-47b1a1c7-f215861fb1cc bloomfield, a. l., dan gillanders, b. m. (2005). fish and invertebrate assemblages in seagrass, mangrove, saltmarsh, and nonvegetated habitats. estuaries, 28(1), 63–77. diakses dari http://www.issg.org/pdf/publications/gisp/ resources/seasia-1.pdf carlson, s. j. (2016). the evolution of brachiopoda. annual review of earth and planetary sciences, (44), 409–438. https://doi.org/10.1146/annurev-earth060115-012348 dharma, b. (2005). recent and fossil indonesian shells. conchbooks, hackenheim. goto, r., ishikawa, h., hamamura, y., sato, s., & kato, m. (2014). evolution of symbiosis with lingula (brachiopoda) in the bivalve superfamily galeommatoidea (heterodonta), with description of a new species of koreamya. journal of molluscan studies, 80(2), 148–160. https://doi.org/10.1093/mollus/eyu009 handayani, t. (2017). potensi makroalga di paparan terumbu karang perairan teluk lampung. oseanologi dan limnologi di indonesia, 2(1), 55–67. diakses dari http://www.jurnaloldi.or.id/index.php/oldi/article/view/15 koneva, s. p., dan ushatinskaya, g. t. (2008). new upper cambrian lingulata (brachiopoda) from the agyrek mountains (northeastern central kazakhstan). paleontological journal, 2(42), 139–148. https://doi.org/10.1134/s0031030108020044 lindawaty, dewiyanti, i., & karina, s. (2016). distribusi dan kepadatan kerang darah (anadara sp.) berdasarkan tekstur substrat di perairan ulee lheue banda aceh. jurnal ilmiah mahasiswa kelautan dan perikanan unsyiah, 1(1), 114–123. luetzen, j. (2009). koreamya arcuata (a. adams, 1856) gen. nov. (galeommatoidea: montacutidae), a commensal bivalve associated with the inarticulate brachiopod lingula anatina. journal of conchology, 39(6), 669–679. macfarlan, d. a. b., bradshaw, m. a., campbell, h. j., cooper, r. a., lee, d. e., mackinnon, d. i., robinson, j. h. (2009). phylum brachiopoda lamp shells. new zealand inventory of biodiversity, 255–267. diakses dari https://www.researchgate.net/publication/26 9519543_phylum_brachiopoda_lamp_shells mitra, s., dan pattanayak, j. g. (2013). studies on lingula anatina (brachiopoda: inarticulata) in subarnarekha estuary, odisha with special reference to habitat and population. rec. zool. surv. india, 113(part 3), 49–53. diakses dari http://recordsofzsi.com/index.php/zsoi/articl 42 | rakmawati & ambarwati; komunitas bivalvia yang berasosiasi dengan kerang lentera e/view/121795 negelkerken, i., dorenbosch, m., verberk, w. c. e. p., cocheret de la moriniere, e., & van der verlde, g. (2000). importance of shallowwater biotopes of a caribbean bay for juvenile coral reef fishes: patterns in biotope association, community structure and spatial distribution. marine ecology progress series, 202, 175–192. diakses dari https://www.intres.com/abstracts/meps/v202/p175-192/ nybakken, m. d., dan bertness, j. w. (2005). marine biology: an ecological approach (6th ed.). san fransisco: pearson education, inc. benjamin cummmings. pechenik, j. a. (2010). biology of the invertebrates (6th ed.). mcgraw-hill higher education. riniatsih, i., dan kushartono, e. w. (2009). substrat dasar dan parameter oseanografi sebagai penentu keberadaan gastropoda dan bivalvia di pantai sluke kabupaten rembang. ilmu kelautan: indonesian journal of marine sciences, 14(1), 50–59. diakses dari https://ejournal.undip.ac.id/index.php/ijms/a rticle/view/221 samanta, s., choudhury, a., dan chakraborty, s. k. (2014). morpho-anatomical study of lingula anatina lamarck, 1801 from west bengalodisha coast, india. journal of the marine biological association of india, 56(2), 26–33. https://doi.org/10.6024/jmbai.2014.56.2.017 75-04 samanta, s., choudhury, a., dan chakraborty, s. k. (2015). eco-biology of a precambrian intertidal benthic brachiopod, lingula anatina from the confluence of subarnarekha estuary with bay of bengal, india. journal of the marine biological association of india, 57(1), 41–46. https://doi.org/10.6024/jmbai.2015.57.1.183 6-06 sato, s., owada, m., haga, t., hong, j. s., lützen, j., & yamashita, h. (2011). genus-specific commensalism of the galeommatoid bivalve koreamya arcuata (a. adams, 1856) associated with lingulid brachiopods. molluscan research, 31(2), 95–105. diakses dari https://staticcuris.ku.dk/portal/files/164534570/sato_201 1_genus_specific.pdf savazzi, e. (2001). a review of symbiosis in the bivalvia, with special attention to macrosymbiosis. paleontological research, 5(1), 55–73. diakses dari https://www.jstage.jst.go.jp/article/prpsj199 7/5/1/5_1_55/_article/-char/ja/ skovsted, c., pan, b., topper, t. p., betts, m. j., li, g., & brock, g. a. (2016). the operculum and mode of life of the lower cambrian hyolith cupitheca from south australia and north china. palaeogeography, palaeoclimatology, palaeoecology 443: 123-130. https://doi.org/10.1016/j.palaeo.2015.11.042 subiyanto, hartoko, a., & umah, k. (2013). stuktur sedimen dan sebaran kerang pisau (solen lamarckii) di pantai kejawanan cirebon jawa barat. journal of management of aquatic resources, 2(3), 65–73. diakses dari http://ejournals1.undip.ac.id/index.php/maquares taqwa, r. n., muskananfola, m. r., & ruswahyuni. (2014). studi hubungan substrat dasar dan hubungan bahan organik dalam sedimen dengan kelimpahan hewan makrobenthos di muara sungai sayung kabupaten demak. management of aquatic resources, 3(1), 125– 133. diakses dari https://ejournal3.undip.ac.id/index.php/maqu ares/article/view/4429 zhang, x. g., hou, x. g., & emig, c. c. (2003). evidence of lophophore diversity in early cambrian brachiopoda. proceedings of the royal society b: biological sciences, 270(suppl. 1), 65–68. https://doi.org/10.1098/rsbl.2003.0013 jurnal riset biologi dan aplikasinya. 1(2): 54-63, september 2019 | 55 jurnal riset biologi dan aplikasinya, volume 1, nomer 2, september 2019 keanekaragaman burung di kawasan hutan mangrove banyuurip kecamatan ujungpangkah kabupaten gresik bird diversity of banyuurip mangrove forest area ujungpangkah, district gresik regency muhammad musthofa mubarrok*, reni ambarwati jurusan biologi, fakultas matematika dan ilmu pengetahuan alam universitas negeri surabaya abstrak kawasan hutan mangrove banyuurip ujungpangkah gresik memiliki potensi dalam mendukung keanekaragaman burung, namun terjadi penurunan dan alih fungsi lahan. penelitian ini bertujuan untuk mengidentifikasi jenis-jenis burung, menganalisis keanekaragaman dan kemelimpahan burung serta mendeskripsikan daya dukung lingkungan terhadap keanekaragaman burung di kawasan hutan mangrove banyuurip. sampling menggunakan pendekatan birdwatching dengan metode jelajah dengan berjalan sesuai jalur transek yang telah ditentukan sepanjang ± 150 meter yang terbagi menjadi tiga titik pengamatan. keanekaragaman dianalisis menggunakan indeks keanekaragaman shannonwiener, kemelimpahan dianalisis berdasarkan kemelimpahan relatif, dan daya dukung lingkungan dianalisis berdasarkan vegetasi dan faktor fisik lingkungan yang meliputi suhu dan kelembapan. hasil penelitian menunjukkan bahwa di kawasan hutan mangrove banyuurip terdapat 35 jenis burung yang termasuk 20 famili dan delapan ordo, yaitu anseriformes, apodiformes, charadriiformes, ciconiiformes, columbiformes, coraciiformes, passeriformes, dan piciformes dengan nilai indeks keanekaragaman sebesar 2,3 yang termasuk dalam kategori sedang. jenis burung yang paling melimpah adalah kuntul kecil (egretta garzetta) sebesar 39,25%, blekok sawah (ardeola speciosa) sebesar 14%, dan walet linci (collocalia linchi) sebesar 7,8%. selain itu, diketahui tujuh jenis vegetasi yang dominan dimanfaatkan dan mendukung keberadaan burung, yaitu avicennia marina, azadirachata indica, rhizophora apiculata, r. mucronata, calotropis gigantea, morinda citrifolia, dan pluchea indica. kawasan hutan mangrove banyuurip dapat mendukung kehidupan burung, bahkan di kawasan ini ditemukan enam jenis burung dalam status dilindungi. abstract banyuurip ujungpangkah gresik mangrove forest area has the potential to support bird diversity, but which land degradation and land use change. this research aimed to identify species of birds, analyze the diversity and abundance of birds, and describe the environmental carrying capacity for bird diversity. sampling was conducted by using birdwatching approach by walking according to the transect path that has been determined throughout ± 150 meters which was divided into three observation points. the diversity was analyzed using shannon-wiener diversity index, the abundance was analyzed based on relative abundance, and environmental carrying capacity was analyzed based on vegetation and environmental physical factors which include temperature and humidity. the results showed that were 35 species of birds in banyuurip mangrove forests, which belong to 20 families, and eight orders namely anseriformes, apodiformes, charadriiformes, ciconiiformes, columbiformes, coraciiformes, passeriformes, and piciformes with a diversity index value of 2.3 medium category. the most abundant species of birds are little eggret (egretta garzetta) of 39.25%, javan pond heron (ardeola speciosa) of 14%, and cave swiftlet (collocalia linchi) of 7.8%. there were seven dominant species of vegetation that were utilized and supported the existence of birds, namely avicennia marina, azadirachata indica, rhizophora apiculata, r. mucronata, calotropis gigantea, morinda citrifolia, and pluchea indica. banyuurip mangrove forest area can support the bird life, moreover there were six species of protected birds found in this area. how to cite: mubarrok, m.m & ambarwati, r. (2019). keanekaragaman burung di kawasan hutan mangrove banyuurip kecamatan ujungpangkah kabupaten gresik. jurnal riset biologi dan aplikasinya. 1 (2) : 54-63. *correspondence author: jalan ketintang gedung c3 lt. 2 surabaya 60231, indonesia e-issn: 2655-9927 e-mail: mubarrokmuhammad@gmail.com jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi history article received: 27 june 2019 approved:5 agustus 2019 published:30 september 2019 key words: bird, diversity, abundance, banyuurip mangrove forest kata kunci: burung, keanekargaman, kemelimpahan, hutan mangrove banyuurip jurnal riset biologi dan aplikasinya. 1(2): 54-63, september 2019 | 55 pendahuluan burung merupakan salah satu satwa liar yang banyak terdapat di hampir semua ekosistem (hadinoto dkk., 2012). berdasarkan catatan burung indonesia pada tahun 2018 jumlah burung bertambah menjadi 1771 jenis burung. jumlah burung endemik di indonesia tercatat sebanyak 513 jenis burung (burung indonesia, 2018). berdasarkan waktu aktivitasnya, burung dibagi menjadi dua kelompok, yaitu burung diurnal dan nokturnal (bismark, 2011). berdasarkan pengaruh musim beberapa jenis burung melakukan migrasi untuk tetap bisa bertahan hidup. burung migran merupakan kelompok burung yang menghabiskan sebagian waktunya untuk bermigrasi dengan tujuan menghindari perubahan kondisi alam di wilayah berbiak mereka (howes dkk., 2003), sedangkan burung penetap merupakan kelompok burung yang menetap dan mendiami suatu kawasan (aristides dkk., 2016). keanekaragaman jenis burung dapat mencerminkan tingginya keanekaragaman hayati pada kehidupan liar dan dapat dijadikan sebagai indikator kualitas lingkungan yang harus diperhatikan karena keberadaannya yang dipengaruhi oleh berbagai faktor seperti faktor fisik, kimia dan hayati (hidayat, 2013). salah satu habitat penting bagi burung adalah hutan mangrove. menurut fahrudin dkk. (2015) hutan mangrove adalah jenis hutan yang secara alami tumbuh di sepanjang daerah pasang surut perairan laut. hutan mangrove juga memberikan ruang bagi burung air untuk bersarang, karena sedikitnya ganguan dari predator serta memberikan tempat untuk bertengger dan menyediakan makanan yang berlimpah. bagi burung migran, selain sebagai tempat singgah, hutan mangrove juga berfungsi sebagai tempat untuk mendapatkan makanan dan tempat berlindung (noor dkk., 2006). jawa timur memiliki hutan mangrove yang terdapat hampir di seluruh pantai, seluas 85.000 ha atau 6,24% dari luas hutan di jawa timur (dinas komunikasi dan informatika provinsi jawa timur, 2009). kecamatan ujungpangkah merupakan kecamatan dengan luas hutan mangrove sebesar 12,68 ha (hidayah, 2018). hutan mangrove ujungpangkah terletak di kecamatan ujungpangkah gresik dan merupakan kawasan pengembangan ekowisata dan kawasan konservasi (mahardika, 2017). namun dalam pengelolaan dan pemanfaatannya oleh masyarakat sekitar, ekosistem mangrove di desa banyuurip kecamatan ujungpangkah dari tahun 2000 yang memiliki luas hutan mangrove sebesar 5.9 ha mengalami penurunan dari tahun 2004, 2010 dan 2017. dengan demikian luas ekosistem magrove di desa banyuurip kecamatan ujungpangkah menjadi sebesar 3.09 ha karena terjadinya konversi lahan menjadi tambak (hidayah 2018; prasetyo dkk., 2018). berdasarkan latar belakang tersebut, perlu dilakukan penelitian yang bertujuan untuk mengidentifikasi jenis-jenis burung, menganalisis keanekaragaman dan kemelimpahan burung serta mendeskripsikan daya dukung lingkungan terhadap keanekaragaman burung di kawasan hutan mangrove banyuurip kecamatan ujungpangkah kabupaten gresik. bahan dan metode penelitian ini merupakan penelitian deskriptif yang dilaksanakan dengan menggunakan metode observasi, karena pengumpulan data menggunakan pengamatan secara langsung di lokasi. sampling dilakukan di kawasan hutan mangrove banyuurip, kecamatan ujungpangkah, kabupaten gresik yang berada pada koordinat 6°54’17.11”s dan 112°31’43.71”e. penelitian di lapangan dilakukan pada 21-23 januari 2019. pengambilan data dilaksanakan pada pagi dan siang hari pukul 07.0010.00 wib dan 11.00-14.00 wib dengan tiga kali pengamatan di lapangan. pengamatan burung dilakukan dua kali pada pagi dan siang hari pukul 07.00-10.00 wib dan 11.00-14.00 wib. teknik yang digunakan dalam pengamatan adalah teknik observasi lapangan dengan metode jelajah. cara pelaksanaan di lapangan yakni saat berada pada stasiun pengamatan dan jalur transek yang telah ditentukan, kemudian berjalan di jalur transek yang sudah ditentukan sepanjang ± 150 meter yang terbagi menjadi tiga titik pengamatan. pengamatan menggunakan teropong binokuler busnell perbesaran 7x35. setiap perjumpaan berbagai jenis burung yang terdapat di lokasi pengamatan berdasarkan ciri morfologi yang teramati dan didokumentasikan dengan kamera sony dsc-h300 cyber shot. lama waktu pengamatan di setiap titik selama ± 15 menit sebelum bergerak ke titik selanjutnya sekitar 50 meter sehingga total waktu pengamatan di setiap stasiun adalah ± 45 menit. catatan pengamatan yang dibuat di lapangan berisikan nama burung, waktu perjumpaan, jumlah individu dan tingkah laku yang teramati seperti mencari makan, terbang dan bertengger. identifikasi berdasarkan buku panduan lapangan 55 | mubarok & ambarwati; keanekaragaman burung di kawasan hutan mangrove banyuurip burung-burung di sumatera, jawa, bali, dan kalimantan (mackinnon dkk., 2010) dan identifikasi vegetasi berdasarkan buku panduan pengenalan mangrove di indonesia (noor, dkk., 2006). status konservasi burung diidentifikasi berdasarkan peraturan menteri lingkungan hidup dan kehutanan (lhk) no. p. 106 tahun 2018 dan international union for conservation of nature and natural resources (iucn). analisis data burung dilakukan secara deskriptif kuantitatif. indeks keanekaragaman diukur menggunakan rumus indeks keanekaragaman shannon-wiener (odum, 1993). h’ =  n ni ln n ni keterangan: h’ = indeks keanekaragaman shannon-wienner ni = jumlah suatu jenis n = jumlah seluruh jenis rumus indeks kemelimpahan. 𝐷1 = 𝑛𝑖 𝑁 × 100% keterangan: di = kemelimpahan relatif (%) ni = jumlah burung setiap spesies n = jumlah total semua burung yang teramati menurut krebs (1989) analisis menggunakan parameter kerapatan relatif terdapat beberapa kategori, yaitu: kerapatan relatif > 5% : dominan kerapatan relatif 2%-5% : subdominan kerapatan relatif < 5% : nondominan vegetasi mangrove diidentifikasi berdasarkan noor, dkk. (2009) dan data dianalisis secara deskriptif. hasil dan pembahasan berdasarkan hasil pengamatan burung selama tiga hari di kawasan hutan mangrove banyuurip ujungpangkah gresik diperoleh sebanyak 35 jenis burung yang termasuk dalam 20 famili dan delapan ordo, yaitu anseriformes, apodiformes, charadriiformes, ciconiiformes, columbiformes, coraciiformes, passeriformes, dan piciformes. beberapa jenis burung dalam delapan ordo yang ditemukan di kawasan hutan mangrove banyuurip ujungpangkah gresik (gambar 1). jenis-jenis burung yang diperoleh selama pengamatan di kawasan hutan mangrove banyuurip ujungpangkah gresik. berdasarkan hasil identifikasi dari 35 jenis burung yang ditemukan di kawasan hutan mangrove banyuurip ujungpangkah gresik diketahui sembilan jenis termasuk burung migran dan 26 jenis termasuk burung penetap. selain itu, diketahui terdapat enam jenis burung yang termasuk dalam status dilindungi berdasarkan peraturan menteri lingkungan hidup dan kehutanan (lhk) no. p. 106 tahun 2018 (tabel 1). berdasarkan hasil pengamatan diperoleh sembilan jenis burung migran, yaitu cerek kernyut (pluvialis fulva), dara laut kumis (chlidonias hybrida), dara laut sayap putih (chlidonias leucopterus), gajahan penggala (numenius phaeopus), trinil kaki hijau (tringa nebularia), trinil kaki merah (tringa totanus), trinil pantai (actitis hypoleucos), trinil rawa (tringa stagnatilis), dan gagang bayam timur (himantopus leucocephalus). selain itu terdapat enam jenis burung di kawasan hutan mangrove banyuurip ujungpangkah gresik dari hasil pengamatan termasuk dalam status dilindungi berdasarkan peraturan menteri lingkungan hidup dan kehutanan no. p. 106 tahun 2018 dan status konservasinya menurut international union for conservation of nature and natural resources (iucn), yaitu cerek jawa (charadrius javanicus), dara laut kumis (chlidonias hybrid), dara laut sayap putih (chlidonias leucopterus), gajahan penggala (numenius phaeopus), cangak laut (ardea sumatrana), dan bangau tongtong (leptoptilos javanicus). berdasarkan hasil perhitungan nilai indeks keanekaragaman jenis burung di kawasan hutan mangrove banyuurip ujungpangkah gresik diperoleh nilai indeks keanekaragaman burung sebesar 2,3 yang termasuk dalam kategori sedang. setiap stasiun pengamatan di kawasan hutan mangrove banyuurip ujungpangkah gresik memiliki kondisi lingkungan yang berbeda. paling tinggi indeks keanekaragaman adalah stasiun tiga, namun semua stasiun memiliki keanekaragaman dengan kategori sedang (tabel 2). berdasarkan pengamatan burung di kawasan hutan mangrove banyuurip ujungpangkah gresik, diperoleh beberapa jenis burung yang memiliki kemelimpahan relatif yang paling tinggi yaitu, kuntul kecil (egretta garzetta) dengan nilai kemelimpahan relatif sebesar 39,25% merupakan jenis burung yang banyak dijumpai, kemudian blekok sawah (ardeola speciosa) dengan nilai kemelimpahan relatif sebesar 14%, dan walet linci (collocalia linchi) dengan nilai kemelimpahan relatif sebesar 7,8% (gambar 2). 56 jurnal riset biologi dan aplikasinya. 1(2): 54-63, september 2019 | 55 = jenis burung yang dilindungi berdasarkan peraturan menteri lh dan kehutanan no. p. 106 tahun 2018. tabel 1. jenis-jenis burung di kawasan hutan mangrove banyuurip kecamatan ujungpangkah kabupaten gresik no. ordo famili spesies nama indonesia 1. anseriformes anatidae anas gibberifrons itik benjut (p) 2. apodiformes apodidae collocalia linchi walet linci (p) 3. charadriiformes charadriidae charadrius javanicus cerek jawa (p)* pluvialis fulva cerek kernyut (m) laridae chlidonias hybrida dara laut kumis (m) * chlidonias leucopterus dara laut sayap putih (m)* scolopacidae numenius phaeopus gajahan penggala (m)* tringa nebularia trinil kaki hijau (m) tringa totanus trinil kaki merah (m) actitis hypoleucos trinil pantai (m) tringa stagnatilis trinil rawa (m) recurvirostridae himantopus leucocephalus gagang bayam timur (p) 4. ciconiiformes ardeidae ardeola speciosa blekok sawah (p) ardea sumatrana cangak laut (p)* butorides striata kokoan laut (p) egretta garzetta kuntul kecil (p) egretta alba kuntul besar (p) ciconiidae leptoptilos javanicus bangau tongtong (p)* 5. columbiformes columbidae streptopelia chinensis tekukur biasa (p) 6. coraciiformes alcedinidae todiramphus chloris cekakak sungai (p) alcedo coerulescens raja udang biru (p) meropidae merops philippinus kirik-kirik laut (p) 7. passeriformes acanthizidae gerygone sulphurea remetuk laut (p) campephagidae lalage nigra kapasan kemiri (p) estrildidae lonchura maja bondol haji (p) lonchura leucogastroide bondol jawa (p) lonchura punctulata bondol peking (p) hirundinidae hirundo striolata layang-layang loreng (p) muscicapidae rhipidura javanica kipasan belang (p) nectariniidae cinnyris jugularis burung-madu sriganti (p) ploceidae passer montanus burung-gereja erasia (p) pycnonotidae pycnonotus aurigaster cucak kutilang (p) pycnonotus goiavier merbah cerukcuk (p) sylviidae prinia inornata perenjak padi (p) 8. piciformes picidae dendrocopos macei caladi ulam (p) keterangan : p * = penetap, m = migran berdasarkan mackinnon, dkk. (2010), aplikasi burungnesia dan sukmantoro dkk. (2007). 57 57 | mubarok & ambarwati; keanekaragaman burung di kawasan hutan mangrove banyuurip gambar 2. burung di kawasan hutan mangrove banyu urip dengan kemelimpahan tinggi a. kuntul kecil (egretta garzetta), b. blekok sawah (ardeola speciosa), c. walet linci (collocalia linchi) (a) (b) (c) (d) (e) (f) (g) (h) gambar 1. beberapa jenis burung yang dijumpai di kawasan hutan mangrove banyuurip kecamatan ujungpangkah kabupaten gresik, a. itik benjut (anas gibberifrons), b. walet linci (collocalia linchi), c. gagangbayam timur (himantopus leucocephalus), d. kokoan laut (butorides striata), e. tekukur biasa (streptopelia chinensis), f. raja udang biru (alcedo coerulescens), g. kapasan kemiri (lalage nigra), h. caladi ulam (dendrocopos macei) tabel 2. indeks keanekaragaman jenis burung setiap stasiun pengamatan di kawasan hutan mangrove banyuurip kecamatan ujungpangkah kabupaten gresik no. stasiun jumlah jenis burung indeks keanekaragaman kategori 1. 1 23 1,96 sedang 2. 2 19 2,20 sedang 3. 3 23 2,57 sedang 4. 4 15 1,26 sedang keterangan: stasiun 1 merupakan area wisata mangrove banyuurip dan tambak, stasiun 2 merupakan area pesisir pantai, stasiun 3 merupakan area tambak, stasiun 4 merupakan area pesisir pantai. (a) (b) (c) 58 jurnal riset biologi dan aplikasinya. 1(2): 54-63, september 2019 | 55 (a) (b) gambar 3. a. bangau tongtong (leptoptilos javanicus), b. kipasan belang (rhipidura javanica) selain itu juga terdapat beberapa jenis burung yang sedikit dijumpai di kawasan hutan mangrove banyuurip ujungpangkah gresik, yaitu bangau tongtong (leptoptilos javanicus), kipasan belang (rhipidura javanica) (gambar 3), trinil rawa (tringa stagnatilis), dan remetuk laut (gerygone sulphurea) dengan nilai kemelimpahan relatif sebesar 0,04%. dalam beraktivitas, burung memanfaatkan berbagai vegetasi yang terdapat di kawasan hutan mangrove banyuurip ujungpangkah gresik untuk mendukung aktivitasnya. selama pengamatan yang dilakukan, tercatat 7 jenis vegetasi yang sering dimanfatkan dan mendukung keberadaan burung di kawasan tersebut, yaitu api-api putih (avicennia marina), imba (azadirachata indica), tinjang (rhizophora apiculata), jankar (rhizophora mucronata), biduri (calotropis gigantea), mengkudu (morinda citrifolia), dan luntas (pluchea indica). hasil pengukuran faktor fisik lingkungan yang dilakukan selama pengamatan pada pagi dan siang hari, diperoleh perbedaan pengukuran faktor suhu dan kelembapan udara. hasil nilai rata-rata pengukuran faktor fisik suhu seluruh stasiun pada pagi hari sebesar 30,3 °c dan nilai kelembapan udara sebesar 67,7%. nilai rata-rata pengukuran faktor fisik suhu seluruh stasiun pada siang hari sebesar 33,9 °c dan nilai kelembapan udara sebesar 57,1%. pengukuran faktor fisik berupa suhu dan kelembapan udara dilakukan untuk mengetahui perbedaan kondisi fisik kawasan saat pengamatan burung berlangsung pada waktu pagi dan siang hari. berdasarkan hasil pengamatan di kawasan hutan mangrove banyuurip ujungpangkah gresik diperoleh sejumlah 35 jenis burung yang berasal dari 20 famili dan delapan ordo, yaitu anseriformes, apodiformes, charadriiformes, ciconiiformes, columbiformes, coraciiformes, passeriformes, piciformes yang terdiri dari jenis burung hutan, burung air, burung pantai. nilai indeks keanekaragaman (h’) burung di kawasan hutan mangrove banyuurip ujungpangkah gresik yang telah dihitung diperoleh sebesar 2,3 yang termasuk dalam kategori sedang. hal tersebut dapat dinyatakan bahwa kawasan hutan mangrove banyuurip ujungpangkah gresik merupakan kawasan yang mendukung keberadaan burung dalam menyediakan berbagai sumber makanan dan tempat tinggal. keberadaan burung dalam suatu kawasan disebabkan karena pada kawasan tersebut tersedia sumber makanan dan minuman yang melimpah, serta memiliki manfaat bagi burung untuk berlindung, istirahat dan tempat berbiak (alikodra, 2002). selain itu, mangrove merupakan habitat yang penting bagi beberapa jenis burung air maupun burung darat. habitat mangrove banyak dimanfaatkan sebagai tempat mencari makan, beristirahat maupun berbiak. habitat mangrove juga memberikan ruang bagi beberapa burung air dalam membuat sarang. bagi burung migran selain akar mangrove yang dimanfaatkan sebagai tempat beristirahat saat air pasang, ketersediaan hamparan lumpur pada habitat mangrove merupakan tempat yang cocok untuk mencari makan (howes, dkk., 2003). perbedaan kondisi lingkungan setiap stasiun pengamatan memengaruhi keanekaragaman burung di setiap stasiun. stasiun satu merupakan kawasan wisata mangrove banyuurip dan sekitarnya, stasiun dua merupakan kawasan pesisir pantai sebelah barat, stasiun tiga merupakan kawasan pertambakan dan stasiun empat merupakan kawasan pesisir pantai sebelah utara. hal tersebut sesuai dengan pernyataan sajithiran dkk. (2004) bahwa keanekaragaman spesies burung dipengaruhi oleh beberapa faktor, yaitu habitat dan faktor lingkungan yang berupa iklim yang mampu mendukung keberadaan burung pada suatu kawasan. stasiun satu merupakan kawasan wisata hutan mangrove banyuurip dan kawasan tambak. pada stasiun satu dijumpai sebanyak 23 jenis burung dengan nilai indeks keanekaragaman 1,96. di area tersebut dijumpai berbagai macam vegetasi yang didominasi oleh api-api putih (avicennia marina), 59 59 | mubarok & ambarwati; keanekaragaman burung di kawasan hutan mangrove banyuurip jankar (rhizophora mucronata), dan luntas (plucea indica) yang dimanfaatkan oleh berbagai jenis burung untuk bersarang dan beristirahat seperti bondol peking dan layang-layang loreng. keberadaan vegetasi mangrove yang dominan di stasiun satu memberikan manfaat burung sebagai tempat bersarang maupun istirahat (swastikaningrum dkk., 2012). stasiun dua merupakan area pesisir pantai. pada stasiun dua dijumpai sebanyak 19 jenis burung dengan nilai indeks keanekaragaman 2,20. di area tersebut dijumpai berbagai macam vegetasi yang di dominasi oleh api-api putih (a. marina) dan imba (a. indica). keberadaan vegetasi di sepanjang pesisir pantai mendukung keberadaan burung–burung, selain itu kondisi substrat pantai yang berupa pasir dan lumpur merupakan tempat yang memiliki banyak sumber makanan bagi burung air maupun burung pantai. saat surut banyak dijumpai berbagai jenis burung pantai maupun burung air seperti blekok sawah, kuntul kecil, dara laut sayap putih, dara laut kumis, gajahan penggala, cerek jawa dan trinil kaki merah yang sedang mencari makan. daerah pasang surut merupakan area untuk mencari makan bagi burung pantai, sehingga burung pantai hanya mencari makan pada saat air pantai surut (arbi, 2008). pada substrat lumpur dijumpai berbagai jenis hewan invertebrata seperti moluska dan krustasea sehingga saat kondisi pasang merupakan tempat yang baik bagi burung air dan burung pantai untuk mencari makan (elfidasari, 2006). nilai indeks keanekaragaman tertinggi tedapat pada stasiun tiga yang merupakan area pertambakan dengan nilai sebesar 2,57. kondisi kawasan pertambakan pada stasiun tiga dapat dilihat pada gambar 4.6, pada stasiun ini jumlah burung yang dijumpai sama dengan satsiun satu, yaitu sebanyak 23 jenis burung selama pengamatan. tingginya keanekaragaman burung pada stasiun tersebut dikarenakan banyaknya sumber makanan dan air di area pertambakan serta banyak vegetasi yang mendominasi di area tersebut adalah api-api putih (avicennia marina), biduri (calotropis gigantea), dan luntas (pluchea indica). keberadaan vegetasi tersebut sangat mendukung keberadaan burung di stasiun tiga, sehingga sering dimanfaatkan sebagian besar burung untuk bertengger dan berlindung. tingginya nilai indeks keanekaragaman pada stasiun tiga disebabkan karena lokasi tersebut menyediakan banyak sumber makanan bagi berbagai jenis burung, terutama bagi burung air (swastikaningrum dkk., 2012). selain itu banyaknya vegetasi yang terdapat di lokasi seperti biduri dan luntas yang dimanfaatkan oleh berbagai jenis burung terutama bagi burung yang memiliki ukuran tubuh kecil sebagai tempat berlindung baik dari pemangsa, dingin dan hembusan angin kencang (rusmendro, dkk., 2009). lokasi pertambakan dapat mendukung keberadaan berbagai jenis burung, terutama burung air dikarenakan memiliki habitat berupa lahan basah serta kondisi yang dekat dengan laut, selain itu disebabkan karena pada tambak terdapat oulet atau kanal pembuangan air tambak terdapat sumber makanan yang banyak seperti udang dan ikan yang merupakan pakan bagi burung air (master dkk., 2016). pada stasiun empat yang merupakan area pesisir pantai yang memiliki nilai indeks keanekaragaman burung terendah dengan nilai sebesar 1,26 dengan jumlah burung yang teramati sebanyak 15 jenis burung. rendahnya nilai keanekaragaman pada stasiun tersebut dikarenakan saat proses pengamatan sering dijumpai aktivitas nelayan di sekitar area pengamatan serta hanya terdapat dua vegetasi mendominasi, yaitu api-api putih (avicennia marina) dan jankar (rhizophora mucronata). kondisi habitat yang baik bagi burung yakni menyimpan berbagai macam sumber makanan dan habitat tersebut jauh dari gangguan atau aktivitas manusia, sehingga memungkinkan banyaknya spesies burung yang singgah di lokasi tersebut (widodo dkk., 2009). keberadaan aktivitas manusia pada suatu kawasan dapat berpengaruh terhadap komposisi jenis burung di kawasan tersebut (wasito & yuliana, 2007). jenis burung yang paling banyak dijumpai selama pengamatan di kawasan hutan mangrove banyuurip ujungpangkah gresik adalah kuntul kecil (egretta garzetta) dengan nilai kemelimpahan relatif tertinggi sebesar 39,25%. selain itu blekok sawah (ardeola speciosa) dengan nilai kemelimpahan 14% dan walet linci (collocalia linchi) juga banyak dijumpai dengan nilai kemelimpahan 7,8%. kemelimpahan burung pada suatu kawasan dapat disebabkan karena ketersediaannya sumber makanan bagi burung. selain itu keberhasilan dalam membuat relung bagi burung, menyebabkan beberapa kelompok burung dapat bertahan hidup pada kawasan tersebut karena berkurangnya kompetisi dalam memenuhi kebutuhan sumber daya serta sebagai proses adaptasi pada kondisi lingkungan di kawasan tersebut (elfidasari & jurnardi, 2006). kuntul kecil (egretta garzetta) merupakan salah satu burung air yang sering terlihat hidup dan 60 jurnal riset biologi dan aplikasinya. 1(2): 54-63, september 2019 | 55 mencari makan secara berkelompok. keberadaan kuntul kecil yang mendominasi di kawasan hutan mangrove banyuurip ujungpangkah gresik dengan nilai kemelimpahan 39,25%, selain itu juga mendominasi pada stasiun 1, 2 dan 4 dengan nilai kemelimpahan relatif secara berturut-turut sebesar 48,05%; 26,05%; dan 59,07%. hal tersebut dikarenakan hutan mangrove banyuurip ujungpangkah gresik merupakan kawasan yang menyediakan sumber makanan yang berlimpah khususnya bagi berbagai burung. salah satu sumber makanan berasal dari area pertambakan yang menyediakan sumber makanan berupa air dan hasil tambak seperti udang maupun ikan yang mati. kegagalan panen hasil tambak seperti udang dan ikan memberikan keuntungan besar bagi berbagai jenis burung, sehingga dengan kondisi pertambakan tersebut burung mendapatkan banyak makanan. kegagalan panen tersebut menyebabkan keberadaan kuntul kecil sangat melimpah dibandingkan dengan jenis burung yang lain. hal tersebut sesuai dengan pernyataan elfidasari (2005) bahwa jenis mangsa yang biasa ditangkap kuntul kecil adalah ikan, katak, kepiting, udang, kerang, moluska, cacing tanah dan serangga. kuntul kecil banyak dijumpai mencari makan di daerah berlumpur dan tambak dikarenakan ketinggian air yang sedang dan banyaknya sumber makanan serta kondisi perairan yang tenang (elfidasari, 2006). bangau tongtong (leptoptilos javanicus) merupakan salah satu jenis burung yang teramati sekali selama pengamatan dan memiliki nilai indeks kemelimpahan terendah, yaitu sebesar 0,04%. perjumpaan dengan bangau tongtong terjadi di stasiun tiga sedang terbang berputar. menurut peraturan menteri lh dan kehutanan no. 106 tahun 2018, bangau tongtong merupakan salah satu jenis burung yang memiliki status dilindungi. menurunnya populasi burung ini yang salah satu faktor penyebabnya adalah degradasi dan konversi hutan (sutiawan dan hernowo, 2016). sehingga menurut iucn berada dalam status vulnerable. habitat sebaran bangau tongtong biasanya di lahan basah seperti tanah berlumpur dan genangan air, hal tersebut berkaitan dengan ketersediaan sumber makan, tempat istirahat dan tempat berlindung. karakter habitat bangau tongtong dalam mencari makanan adalah area terbuka dengan substrat berlumpur. jenis pakan bangau tongtong di area lahan basah berupa ikan dan kepiting (sutiawan dan hernowo, 2016). selama pengamatan di kawasan hutan mangrove banyuurip ujungpangkah gresik, diketahui beberapa vegetasi yang dimanfaatkan oleh burung adalah api-api putih (avicennia marina), imba (azadirachata indica), tinjang (rhizophora apiculata), jankar (rhizophora mucronata), biduri (calotropis gigantea), mengkudu (morinda citrifolia), dan luntas (pluchea indica). keberadaan jenis burung pada suatu kawasan dapat dipengarauhi oleh kondisi lingkungan seperti jenis vegetasi, habitat pendukung dan kenyamanan (hadinoto, dkk., 2012). keberadaan api-api putih yang hampir ada di setiap stasiun pengamatan sering dimanfaatkan oleh berbagai jenis burung seperti remetuk laut, merbah cerukcuk, cucak kutilang, madu sriganti, gereja erasia, bondol peking, bondol jawa, cekakak sungai, raja udang biru untuk bertengger maupun beristirahat. keberadaan vegetasi maupun komposisi tumbuhan berpengaruh terhadap keanekaragaman dan kemelimpahan burung di suatu kawasan karena terkait dengan ketersediaan sumber makanan, tempat tinggal, dan tempat berlindung (gafur, dkk., 2016; kuswanda, 2010). berdasarkan hasil penelitian yang dilakukan di kawasan hutan mangrove banyuurip ujungpangkah gresik dapat diketahui bahwa kawasan tersebut mendukung keberadaan burung dan dapat dijadikan sebagai kawasan konservasi. selain itu perlunya peran serta masyarakat dalam mendukung kegiatan konservasi burung di kawasan hutan mangrove banyuurip kecamatan ujungpangkah kabupaten gresik. oleh karena itu, dengan adanya program konservasi burung di kawasan tersebut, maka dukungan masyarakat setempat sangat diperlukan seperti menjadikan kawasan mangrove sabagai kawasan edukasi, membantu dalam melarang adanya kegiatan berburu burung, dan penanaman serta perawatan kawasan mangrove sehingga dapat terus mendukung keberadaan burung di kawasan tersebut. hal tersebut sesuai dengan prasenja (2018) yang menyatakan bahwa peran serta masyarakat dalam pengelolaan hutan mangrove sangatlah penting untuk dapat mencapai tujuan pengelolaan berkelanjutan dalam mengkonservasi kawasan hutan mangrove. simpulan berdasarkan hasil penelitian di kawasan hutan mangrove banyuurip kecamatan ujungpangkah kabupaten gresik diperoleh sejumlah 35 jenis burung yang termasuk dalam 20 famili dan delapan ordo, yaitu anseriformes, apodiformes, charadriiformes, ciconiiformes, columbiformes, coraciiformes, passeriformes, dan piciformes 61 61 | mubarok & ambarwati; keanekaragaman burung di kawasan hutan mangrove banyuurip dengan nilai indeks keanekaragaman sebesar 2,3 yang termasuk dalam kategori sedang. jenis burung yang paling melimpah adalah kuntul kecil (egretta garzetta) sebesar 39,25%, blekok sawah (ardeola speciosa) sebesar 14%, dan wallet linci (collocalia linchi) sebesar 7,8%. daya dukung lingkungan berdasarkan vegetasi diperoleh tujuh jenis vegetasi yang dominan dimanfaatkan dan mendukung keberadaan burung di kawasan tersebut, yaitu apiapi putih (avicennia marina), imba/mimba (azadirachata indica), tinjang (rhizophora apiculata), jankar (r. mucronata), biduri/widuri (calotropis gigantea), mengkudu (morinda citrifolia), dan luntas (pluchea indica). faktor fisik lingkungan yang mendukung keberadaan burung pada pagi dan siang hari suhu rata-rata 30,3-33,9°c dan kelembapan udara rata-rata 57,1-67,7%. ucapan terima kasih penulis mengucapkan terimakasih kepada pengelola kawasan hutan mangrove banyuurip ujungpangkah gresik, serta kepada rekan-rekan yang turut berkontribusi selama penelitian berlangsung. daftar pustaka alikodra. (2002). pengelolaan satwa liar jilid 1. bogor: yayasan penerbit fakultas kehutanan ipb. arbi, u. y. (2008).burung pantai pemangsa krustasea. oseana. 13 (2): 1-8. diakses dari http://oseanografi.lipi.go.id/dokumen/oseana _xxxiii(2)1-8.pdf. aristides, y., purnomo, a. & samekso, f. a. (2016. perlindungan satwa langka di indonesia dari perspektif convention on international trade in endangered species of flora and fauna (cites). diponegoro law jurnal. 5 (4): 1-17. diakses dari https://media.neliti.com/media/publications/ 58985-id-none.pdf. bismark, m. (2011). prosedur operasi standar (sop) untuk survei keragaman jenis pada kawasan konservasi. bogor: pusat penelitian dan pengembangan perubahan iklim dan kebijakan badan penelitian dan pengembangan kehutanan. burung indonesia. (2018, 31 mei). burung khas indonesia bertambah lagi. online. diakses 13 november 2019, dari http://www.burung.org/2018/05/31/siaranpers-jenis-burung-khas-indonesia-bertambahlagi/. dinas komunikasi dan informatika provinsi jawa timur. 2009. kerusakan mangrove di pantura gresik harus dikonservasi. online. diakses 02 oktober 2018, dari http://www.kominfo.jatimprov. go.id/read/umum/ 19294-luas-hutanmangrove. elfidasari, d. (2005). pengaruh perbedaan lokasi mencari makan terhadap keragaman mangsa tiga jenis kuntul di cagar alam pulau dua serang: casmerodius albus, egretta garzetta, bubulcus ibis. makara, sains. 9 (1): 7-12. diakses dari https://www.researchgate.net/publication/47 416687. elfidasari, d. (2006). lokasi makan tiga jenis kuntul casmerodius albus, egretta garzetta, dan bubulcus ibis di sekitar cagar alam pulau dua serang, propinsi banten. biodiversitas, 7(2): 187-190. doi: &#13;10.13057/biodiv/d070220. elfidasari, d. & junardi. (2006). keragaman burung air di kawasan hutan mangrove peniti, kabupaten pontianak. biodiversitas. vol. 7(1): 63-66. doi: 13057/biodiv/d070116. fahrudin, a., m. arsyad a. a., taryono k., andan h., andy a., & arif t. (2015). pemetaan sosial (social mapping). bogor: working paper pkspl-ipb. 6 (2) : 1-50. diakses dari http://pkspl.ipb.ac.id/berita/detail/pemetaansosial-social-mapping-di-wilayah-pesisirkabupaten-gresik. gafur, a., labiro, e., & ihsan, m. (2016). asosiasi jenis burung pada kawasan hutan mangrove di anjungan kota palu. warta rimba. 4(1): 4248. diakses darihttp://jurnal.untad.ac.id/jurnal/index.php /wartarimba/article/view/7069/5688. hadinoto, mulyadi, a., siregar, y.i. (2012). keanekaragaman jenis burung di hutan kota pekanbaru. jurnal ilmu lingkungan. 6(1): 2542. diakses dari https://docplayer.info/54092116keanekaragaman-jenis-burung-di-hutan-kotapekanbaru-abstract.html. hidayah, n. (2018). studi penurunan luasan lahan mangrove di kecamatan ujungpangkah, kabupaten gresik. jurnal swara bumi. 5(61): 162-169. diakses dari https://jurnalmahasiswa.unesa.ac.id/index.php /swara-bhumi/article/view/24134/22061. hidayat, o. (2013). keanekaragaman spesies avifauna di kdhtk hambala nusa tenggara 62 jurnal riset biologi dan aplikasinya. 1(2): 54-63, september 2019 | 55 timur. jurnal penelitian kehutanan wallacea. 2(1): 12-25. diakses dari http://www.fordamof.org/files/2.keanekaragaman_spesies_avif auna_di_khdtk_hambala.pdf. howes, j., bakewell, d.,&noor, y. r. (2003). panduan studi burung pantai. bogor: wetlands international-indonesia programme. kuswanda, w. (2010). pengaruh komposisi tumbuhan terhadap populasi burung di taman nasional batang gadis, sumatera utara. jurnal penelitian hutan dan konservasi alam. 7(2): 193-213. diakses dari http://ejournal.forda-mof.org/ejournallitbang/index.php/jphka/article/view/1126 /1047. mackinnon, j., phillipps, k., & balen b. v. (2010). panduan lapangan pengenalan burung-burung di sumatera, jawa, bali dan kalimantan. bogor: burung indonesia. mahardika, g. (2017). evaluasi kesesuaian lahan dan kelayakan hutan mangrove sebagai objek ekowisata di banyuurip ujungpangkah gresik. skripsi. malang: jurusan geografi. tidak diterbitkan. master, j., nurcahyani, n., natalia, s., & pertiwi, h. i. (2016). keanekaragaman jenis burung pada areal tambak intensif di sumatera selatan dan lampung. biospesies. 9(2): 24-31. diakses dari https://onlinejournal.unja.ac.id/biospecies/article/view/315 9. noor, y. r., khazali, m., & suryadiputra, i. n. n. (2006). panduan pengenalan mangrove di indonesia. cetakan ulang kedua. bogor: wetlands international – indonesia programme. odum. (1993). ekologi umum (terjemahan). new york: mcgraw hill. prasenja, y. 2018. peran masyarakat dalam pengelolaan ekominawisata pulauu lusi, kabupaten sidoarjo. majalah geografi indonesia. 32 (2): 123-129. doi.org/10.22146/mgi.28695. prasetyo, a., santoso, n. dan prasetyo, l. b. (2018). kerusakan ekosistem mangrove di kecamatan ujungpangkah kabupaten gresik provinsi jawa timur. jurnal silvikultur tropika. 8(2): 130-133. rusmendro, h., a. ruskomalasari, h. khadafi, b. prayoga, & apriyanti. (2009). keberadaan jenis burung pada lima stasiun pengamatan di sepanjang daerah aliran sungai (das) ciliwung. jurnal vis vitalis. 2(2): 50-64. diakses dari https://docplayer.info/59572471keberadaan-jenis-burung-pada-lima-stasiunpengamatan-di-sepanjang-daerah-aliransungai-das-ciliwung-depok-jakarta.html. sajithiran, t. m., jamdhan, s. w., & santiapillani, c. (2004). a comparative study of the diversity of birds in three reservoirs in vavuniya, srilanka. tiger paper. 31 (4): 27-32. diakses dari https://www.researchgate.net/publication/ 312594111_a_comparison_of_floral_and_f aunal_diversity_between_two_small_distur bed_forest_patches_in_sri_lanka's_central_ highlands. sukmantoro, w., irham, m., novarino, w., hasudungan, f., kemp, n., & muchtar, m. (2007). daftar burung indonesia no. 2. bogor: indonesia ornitologits’ union. sutiawan, r. & hernowo, j. b. (2016). analisis populasi dan habitat bangau tongtong (leptoptilos javanicus horsfields 1921) di taman nasional alas purwo, jawa timur. media konservasi. 21(3): 207-215. doi 10.29243/medkon.21.3.207-215. swastikaningrum, h., hariyanto, s., dan irawan, b. (2012). keanekaragaman jenis burung pada berbagai tipe pemanfaatan lahan di kawasan muara kali lamong, perbatasan surabaya – gresik. berk. penelitian. hayati. 17: 131-138. wasito, h. dan yuliana, s. (2007). keanekaragaman jenis burung di saribi, numfrot barat, papua: beberapa catatan. jurnal penelitian hutan dan konservasi alam. vol. 4(6): 553-560. doi: 10.23869/bphjbr.17.2.20122. widodo, w. y., noor, r., & wirjoatmodjo, s. (2009). pengamatan burung-burung air di pantai indramayu cirebon, jawa barat. media konservasi. 5(1): 11—15. diakases dari http://repository.ipb.ac.id/handle/123456789 /30072. winassis, swiss. 2017. burungnesia. (online), (https://www.birdpacker.com/burungnesia,diu nduh 11 maret 2018). 63 http://ejournal.forda-mof.org/ejournal-litbang/index.php/jphka/article/view/1126/1047 http://ejournal.forda-mof.org/ejournal-litbang/index.php/jphka/article/view/1126/1047 http://ejournal.forda-mof.org/ejournal-litbang/index.php/jphka/article/view/1126/1047 jurnal riset biologi dan aplikasinya, volume 2, nomor 2, september 2020 defining the rearing cage for agriocnemis femina damselfly (odonata, zygoptera, coenagrionidae) penentuan kandang pemeliharaan capung jarum agriocnemis femina (odonata, zygoptera, coenagrionidae) muhammad nazri janra*, henny herwina, hafizhah rahmayani, lily rahmawati, dika putri sehati, shania refka fandesti biology department, faculty of mathematics and natural sciences, universitas andalas abstract rearing insects such as dragonflies and damselflies aim to gain uniform progeny that used for scientific purposes. in indonesia, unfortunately, this rearing type is not yet common which suggests the time for its initiation. this study has objective to define the type of rearing cage for agriocnemis femina damselfly (odonata, zygoptera, coenagrionidae). it was conducted descriptively by using two smalls (9 x 13 x 23 cm), four medium (14 x 15 x 22 cm) and two larges (20 x 23 x 33 cm) size boxes as cage setups, with or without ornamental plants in it. the feeding was with limited (10-15 drosophila flies provided per day) and unlimited provision. data was analyzed descriptively. the results showed that a. femina lived normally, including eating and mating, within the large cage setup equipped with ornamental plants and unlimited feeding. abstrak pemeliharaan serangga seperti capung dan capung jarum mempunyai tujuan untuk mendapatkan populasi anakan yang seragam yang dapat digunakan lebih lanjut untuk beragam tujuan ilmiah. sayangnya, hal ini belum banyak dilakukan di indonesia sehingga perlu untuk mulai diinisiasi. penelitian ini bertujuan untuk menemukan bentuk kandang pemeliharaan capung jarum agriocnmeis femina (odonata: coenagrionidae). penelitian dilakukan secara deskriptif dengan menggunakan settingan dua kandang kecil (9 x 15 x 25 cm), empat sedang (14 x 15 x 22 cm) dan dua besar (20 x 25 x 33 cm), dengan atau tanpa meletakkan tumbuhan penghias di dalamnya. data dianalisis secara deskriptif. pemberian makanan dilakukan secara terbatas (1015 lalat drosophila disediakan dua kali sehari) dan tak terbatas. hasil penelitian menunjukkan capung jarum a. femina hidup dan melakukan aktivitas makan serta kawin secara normal pada kandang besar yang dilengkapi dengan tumbuhan dan dengan pemberian makanan tak terbatas. how to cite: janra, m.n., herwina, h., rahmayani, h., rahmawati, l., sehati, d.p., & fandesti, s.r. (2020). defining the rearing cage for agriocnemis femina damselfly (odonata, zygoptera, coenagrionidae). jurnal riset biologi dan aplikasinya, 2(2), 42-48. *corresponding author: e-issn 2655-9927 jln. kampus unand limau manis padang, sumbar 25163 indonesia e-mail: mnjanra@sci.unand.ac.id jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi article history received : 14 june 2020 approved : 16 august 2020 published : 30 september 2020 keywords: agriocnemis femina; cage setup; feeding; ornamental plants; rearing kata kunci: agriocnemis femina; pengaturan kandang; makanan; tanaman hias; pemeliharaan 43 | janra et al.; defining the rearing cage for agriocnemis femina introduction dragonflies (including damselflies) are relatively large diurnal insects that have attracted the attention of biologists to learn for many of their biological aspects (corbet, 1999; sylsbi, 2001). this insect group has been subjected in many ecological, morphological, behavioral, and evolutionary studies for long time (tillyard, 1917; corbet, 1999; córdoba-aguilar, 2008). despite the long history of study on dragonflies, there still unknown aspects about them that need further investigation. hence, the efforts have been continuously deployed to study it, including with utilization of rearing methodology. rearing process, theoretically, allows researchers to follow through the development of dragonflies’ metamorphosis life stages. furthermore, many potential benefits can be gained from rearing dragonfly and other insects. rearing dragonflies or damselflies are mostly related to certain specific objectives from particular studies and very segmental in some previous studies. it is common to develop larvae found in the field to see all nymph stages and what its imago form emerges (mccullough et al., 2020). the larval and adult dragonfly can be used to simulate the effects of climate change onto aquatic and terrestrial organism (mccauley et al., 2018). odonata is also viewed as a good model for ecology and evolutionary genomic researches (bybee et al., 2016), or can be simply used as teaching subject in the classroom (switzer, 2002). rearing damselflies under laboratory condition is promising in order to answer so many biological questions (gossum et al., 2003). colonies resulted from laboratory rearing bring some advantages, such as largely uniform in age, genetic, morphological and physiological conditions that reduce experimental variability; they also become steady provision for long-term experiment and they come with high-performance and quality (roe et al., 2018). as entomophagous insect group, dragonflies and damselflies may become potential pest eradicators (chambers, 1977). a thorough review for the rearing works on odonata larvae was provided by (rice, 2008) with a specific notion of short-term maintenance on libellulidae larvae. meanwhile, some efforts may have shown prospect in rearing damselflies, such laboratory propagation for ischnura elegans (gossum et al., 2003), i. ramburii (locklin et al., 2012) and i. senegalensis (okude et al., 2017). in indonesia, despite the current massive emergence of interest on odonata, yet none dedicated to study about the rearing process itself. hence, this paper discusses the basic needs in doing dragonfly rearing i.e. finding the best cage or container arrangement, a simple yet essential aspect in rearing it (cohen, 2018). this is a starting point before conducting further rearing process, as the previous studies did not discuss about the detail of rearing cage used therein. materials and methods study species this study used wild individuals agriocnemis femina (odonata; coenagrionidae). it is a small damselfly with sexual dimorphism, where both sexes mainly look different in body color; hence it will help in individual and sexual identification (see figure 1). young males are in green and black body that slowly turns into white-pruinesce with its maturity with orange abdominal tip, while females are dominantly red (setiyono et al. 2017). this damselfly is distributed across india, southeast asia until pacific islands where it inhabits human affected habitats and considered as least concern species by iucn red list (janra et al. 2020). figure 1. morphology of agriocnemis femina: young male (left), adult male (middle) and female (right) jurnal riset biologi dan aplikasinya, 2(2), 42-48, september 2020 | 44 this damselfly is also non-terrestrial defending with short lifespan of couple weeks since its emergence as an adult (silsby, 2001). in padang city, it is easily found in ditches and sewages where it seems to dominate these polluted habitats (janra and herwina, in prep.). male and female adult a. femina were collected using an aerial insect net and placed inside a 9 x 13 x 23 cm transporting box, which lid replaced with mosquito wire to enact air circulation. rearing set up there were three dimensions (height x width x length) of boxes used in the trial of rearing cages; two 9 x 13 x 23 cm boxes, four 14 x 15 x 22 cm boxes, and two 20 x 23 x 33 cm boxes (hereinafter small, medium and large boxes or cages). each box was equipped with twigs intended as perching site for the damselflies and the opening side of the boxes covered with mosquito net. two small and two medium boxes were left plain without further additional materials inside the cages. the other two medium boxes were equipped with a small water container filled with water spinach (ipomoea aquatic). the inside of the two large boxes was decorated with living pogonantherum crinitum (poaceae) and sellaginella fern, two common plants found in the ditches around the place of this study undertaken. these plants planted into the inner bottom of boxes using soaked cotton as the growth medium. the moisture of the cotton was maintained with mild water drops from a squeeze bottle. all boxes are arranged near the window facing east in the laboratory of animal taxonomy, biology department, universitas andalas, padang. this side of the laboratory receives morning sunlight between 09.00-11.00 hours which ensures that all rearing cages received similar lighting intensity. damselflies in small and medium boxes were fed manually once or twice a day with wildly caught drosophila melanogaster. the flies were capture using a rotten banana as bait, then 10-15 flies placed inside a small tube before inserted into the cage. on the other hand, the feeding in large boxes was arranged differently. drosophila melanogaster flies were directly attracted to enter the cages by placing a 1.5 x 10 cm petri dish contained slices of ripped banana. the mesh size of mosquito wire used to cover the opening of large boxes is small enough to prevent the damselfly from escaping, but passable for drosophila melanogaster. hence, within these large boxes, food provision was considerably ad libitum. observation and analysis individuals agriocnemis femina were kept at 1:2 (female to male) ratio within the rearing cage, with the number of individuals adjusted to the size of cage. the sex ratio used in this study was lower than what was observed in its natural environment, which reached 1:6 (janra and herwina, in prep.). the damselflies individuals were marked carefully with faber-castle® 0.5 mm marker pen to assist recognition during observation. the observation, which was conducted in october 2019, focused at which rearing cage type that best to sustain the ‘normal’ living of damselflies, determined from damselflies’ longevity and exhibited behavior. feeding and mating activities were subjected to observation and recording among the longest survived damselflies. the room temperature as well as temperature in the large rearing cages were simultaneously measured using an alcohol thermometer, while documentation was with nikon coolpix p900 and cellular phone camera. data from observation was then tabulated and descriptively analyzed by comparing it with previous researches as well as giving our elaborated thoughts on it. results and discussion the observation was made from 7-30 october 2019 simultaneously at all rearing cages. the numbers of living individuals in each cage per observation day are presented in table 1. the damselflies in small and medium rearing cages survived until the first week the longest, while those in large cages remain living slightly beyond the third week (figure 2). we suspect that the plain set up in small and medium cages provide the least support for damselflies to perch, as the twigs placed within as the perching site was not always preferable for this purpose. the damselflies often were seen flew through the cage space, hit the box’s wall, and failure to cling onto the slippery surface of the box and subsequently fell down to the bottom. the concussion may immobilize the damselfly which later lay motionless at the bottom of the cage. perching is important for the dragonfly to roost and sustain their body condition (mazzacano et al., 2014) hence failing from doing it for a while may result in fatality. on the medium cages filled with water spinach, the damselflies lasted a bit longer, however, the water medium for water spinach potentially turned into pitfall trap for fallen damselfly. upon hitting the box wall, a damselfly can be drowned if fell to the water container. 45 | janra et al.; defining the rearing cage for agriocnemis femina it may suggest that equipping rearing cage with water container, despite odonata affinity to aquatic body, should be limited. water provision can be an exception for medium where females lay their eggs later, if the rearing succeeded. the longest living damselflies were observed in large rearing cages, especially cage 1, where its occupants lived throughout october 2019, before found dead the next day. we suspected that the more spacious cages, combined with plants set up inside and abundant food source provided more suitable microenvironment for a. femina damselflies. the stalks of pogonantherum crinitum and sellaginella provide comfortable pick for damselflies to perch. furthermore, the soaked cotton worked together with the ornamental plants in accommodating lower internal temperature in the rearing cages (the average 24.1oc and 24.0oc respectively in boxes 1 and 2 against 24.3oc of room temperature; figure 3). for insects, that are poikilotherms, surrounding temperature gives immense impact to their physiology that manifests outward into many of their living aspects. lower rearing cage temperature helps in preventing cannibalism among reared insect, as well as helps them to regulate their internal temperature, a feature that is important in combatting pathogens and maintaining physiology and genetic condition (bridges, 1933; carruthers et al., 1992; hinks & erlandson, 1994). table 1. observed longevity of reared agriocnemis femina damselfly (f = female, m = male) cage type observation period on october 2019 (detailed as nth day) 7 8 9 10 13 14 15 16 17 18 19 20 21 24 25 30 small 1 1f2m 1f1m small 2 1f2m 1f medium plain 1 1f3m 1f3m 1f1m 1m medium plain 2 1f3m 1f3m 1f1m medium with plant 1 1f3m 1f3m 1f2m 1f2m 1f medium with plant 2 1f3m 1f3m 1f3m 1f3m 1f3m 1f2m 1f large 1 3f9m 3f6m 3f6m 3f6m 3f6m 3f6m 3f6m 3f6m 2f3m 2f3m 2f3m 2f3m 2f3m 1f3m 1f1m 1f1m large 2 2f6m 2f6m 2f6m 2f6m 2f6m 2f6m 2f6m 2f6m 2f3m 2f3m 2f3m 2f3m figure 2. large cage setup jurnal riset biologi dan aplikasinya, 2(2), 42-48, september 2020 | 46 figure 3. temperature (oc) recorded in room and large rearing cages during observation table 2. feeding capacity of a. femina on d. melanogaster within 10 minutes of observation sex observation period 13-oct 16-oct 17-oct 18-oct 20-oct 24-oct 25-oct female(s) 1 2 1 3 1 1 1 male 1 providing ad libitum food resources by attracting drosophila melanogaster into the cage was advantageous in reducing interruption to the reared damselflies, as the cage lid did not need to be frequently opened to insert the captured flies. this was the case with other cage setups, as we observed the damselflies stressed out or even tried to escape from the cage during the feeding procedure commenced. this feeding procedure is potentially used as a ‘labor-saving’ method due to no time needed to prepare drosophila melanogaster culture, as the flies attracted directly into the cage using the bait of simple banana slices. simplifying the workload, especially on the mass-rearing of insects, is essential to produce a large amount of progeny on effective cost (gossum et al. 2003). upon their profound habituation in the large boxes, a scan sampling series was randomly conducted to see the feeding capacity of a. femina on d. melanogaster flies. scan sampling lasted 10 minutes in each session, by counting how many flies consumed by the damselflies in large rearing cage #1. the observation is presented in the following table 2. our data shows that female(s) recorded to feed more frequently than male within the observation time, which only seen feeding once on 18 october. this does not necessarily reflect the significant difference in the feeding rate between sexes, as the male(s) might feed outside the observation time. the feeding system used in this study, despite simplified the workload in providing food, had a flaw in term that the damselflies could feed indiscernibly. unless a thorough and continuous observation is conducted to draw a full picture on this matter, the feeding rate is sufficiently represented by random scan sampling or observation (altmann, 1974). three individuals d. melanogaster were consumed within the approximate 10 minutes by a female in large cage #1 on october 2018. interestingly, this female was seen to have mated on the previous day (figure 4). the mating, which occurred for more than four minutes during midday 17 october, became the only successful mating observed in this study. since then, up until the observation concluded on 30 october, males attempted to approach females but ended up in unsuccessful mating. albeit the observation failed to notice if female laid eggs, this mating alone indicated the acceptance of a. femina damselflies to the rearing setup. the elevated feeding rate on females has been previously reported as part of post-nuptial behavioral changes in most insect species (carvalho et al., 2006; perry, 2011; tsukamoto et al., 2014). 47 | janra et al.; defining the rearing cage for agriocnemis femina figure 4. mating a. femina in large cage on 17 october 2020. insert: male (top) and female (bottom) in wheel position rearing dragonflies or damselflies within artificial setup seems to be easier to conduct in temperate region (see gossum et al., 2003 or locklin et al., 2012). these insects, along with all other temperate organisms, have only spring and summer for commencing their reproductive cycle (silsby, 2001). the urge to produce progeny within this short period of time may impose on their acceptance toward rearing setups as their breeding environment. undertaking rearing effort onto tropical dragonflies possesses more challenges as a tropical environment supports them to breed all year, which in our opinion, creates somewhat resistance for the dragonflies to accept the artificial environment provided in the rearing setups. hence, finding suitable methods to comfortably persuade them inhabiting artificial rearing setups becomes crucial. conclusion our observation hinted that the use of large box (20 x 23 x 33 cm) decorated with plants from aquatic habitat can be the best rearing cage for damselfly agriocnemis femina. the feeding system used in this study gives benefits in reducing rearing workload, minimizing possible human disturbance and avoid distress on the damselflies. future study should be directed into looking at the effectiveness of the large box setup in massive rearing or how it works on different damselfly species. acknowledgement the authors thank to muhammad giffari aditama and dimas surya for their help with cage and feeding preparation, also to rezi rahmi amolia for her assistance in identifying the ornamental plants used in this study. the gratitude also goes to students who work in animal taxonomy laboratory, biology department of universitas andalas during the study performed, as they participated in monitoring the situation around the rearing arrangement. this study was made possible thanks to the “beginner researcher” provided by faculty of mathematics and natural sciences, universitas andalas with contract no. 03/un.16.03. d/pp/fmipa/2019, date 10 may 2019 that financed this study. references altman, j. (1974). observational study of behavior: sampling methods. behavior, 49 (3/4), 227-267. http://www.jstor.org/stable/4533591. bridges, c.b. (1933). apparatus and methods for drosophila culture. the american naturalist 66 (704), 250-273. https://doi.org/10.1086/280430. bybee, s., córdoba-aguilar, a., duryea, m. c., futahashi, r., hansson, b., lorenzo-carballa, m. o., schilder, r., stoks, r., suvorov, a., svensson, e. i., swaegers, j., takahashi, y., watts, p. c., & wellenreuther, m. (2016). odonata (dragonflies and damselflies) as a bridge between ecology and evolutionary genomics. frontiers in zoology, 13(1), 1–20. https://doi.org/10.1186/s12983-016-0176-7. carruthers, r.i., larkin, t.s., firstencel, h., & feng, z. (1992). influence of thermal ecology on the mycosis of a rangeland grasshopper. ecology, 73(1), 190-204. https://www.jstor.org/stable/1938731 carvalho, g. b., kapahi, p., anderson, d. j., & benzer, s. (2006). allocrine modulation of appetite by the sex peptide of drosophila melanogaster. current biology, 16(7), 692–696. https://doi.org/10.1016/j.cub.2006.02.064.allocrine. chamber dl. (1977). quality control in mass rearing. annual review of entomology, 22, 289-308. https://doi.org/10.1146/annurev.en.22.010177.00144 5 cohen, a. c. (2018). ecology of insect rearing systems: a mini-review of insect rearing papers from 1906http://www.jstor.org/stable/4533591 https://doi.org/10.1086/280430 jurnal riset biologi dan aplikasinya, 2(2), 42-48, september 2020 | 48 2017. advances in entomology, 06(02), 86–115. https://doi.org/10.4236/ae.2018.62008 córdoba-aguilar, a. (2008). dragonflies and damselflies: model organisms for ecological and evolutionary research. dragonflies and damselflies: model organisms for ecological and evolutionary research, 94(3), 1–304. https://doi.org/10.1093/acprof:oso/9780199230693. 001.0001. corbet ps. (1999). dragonflies, behavior and ecology of odonata. new york: cornell university press. gossum, h.v., rivera, a.c., & sánchez. (2003). observations on rearing damselflies under laboratory conditions. animal biology, 53(1),37:45. https://doi.org/10.1163/157075603769682567. hinks, c.f & erlandson, m.a. (1994). rearing grasshoppers and locusts: review, retionale and update. journal of orthoptera research, 3, 1-10. https://www.jstor.org/stable/3503403. janra mn, gusman d, susanto a, yatap h, fahrudin a, andriansyah f, prameswara a and herwina h, (2020). keanekaragaman hayati kphl seluma – odonata. bengkulu: dinas lingkungan hidup dan kehutanan provinsi bengkulu. locklin, j. l., huckabee, j. s., & gering, e. j. (2012). a method for rearing large quantities of the damselfly, ischnura ramburii (odonata: coenagrionidae), in the laboratory. florida entomologist, 95(2), 273–277. https://doi.org/10.1653/024.095.0205. mccullough, e. l., verdeflor, l., weinsztok, a., wiles, j. r., & dorus, s. (2020). exploratory activities for understanding evolutionary relationships depicted by phylogenetic trees: united but diverse. the american biology teacher, 82(5), 333–337. https://doi.org/10.1525/abt.2020.82.5.333. mazzacano, c., paulson, d., & abbott, j. (2014). guidelines for creating & managing habitat for dragonflies & damselflies. portland, or: migratory dragonfly partnership. okude, g., futahashi, r., tanahashi, m., & fukatsu, t. (2017). laboratory rearing system for ischnura senegalensis (insecta: odonata) enables detailed description of larval development and morphogenesis in dragonfly. zoological science, 34(5), 386–397. https://doi.org/10.2108/zs170051. perry, j.c. (2011). mating stimulates female feeding: testing the implications for the evolution of nuptial gifts. journal of evolutionary biology, 24 (8), 1727–1736. 10.1111/j.1420-9101.2011.02299.x. rice, t. m. (2008). a review of methods for maintaining odonate larvae in the laboratory, with a description of a new technique. odonatologica, 37(1), 41–54. roe, a. d., demidovich, m., & dedes, j. (2018). origins and history of laboratory insect stocks in a multispecies insect production facility, with the proposal of standardized nomenclature and designation of formal standard names. journal of insect science, 18(3), 1–9. https://doi.org/10.1093/jisesa/iey037. setiyono j, diniarsih s, oscilata enr and budi ns. (2017). dragonflies of yogyakarta. yogyakarta: indonesian dragonfly society. silsby j, (2001). dragonflies of the world. washington dc: smithsonian institution press. tilyard rj. (1917). the biology of dragonflies. cambridge university press, united kingdom. switzer, p. (2002). using dragonflies as common, flexible & charismatic subjects for teaching the scientific process. the american biology teacher, 64(2), 158–162. https://doi.org/10.1662/0002-7685(2007)69 tsukamoto, y., kataoka, h., nagasawa, h., & nagata, s. (2014). mating changes the female dietary preference in the two-spotted cricket, gryllus bimaculatus. frontiers in physiology, 5, 1–6. https://doi.org/10.3389/fphys.2014.00095. https://doi.org/10.1163/157075603769682567 https://www.researchgate.net/deref/http%3a%2f%2fdx.doi.org%2f10.1111%2fj.1420-9101.2011.02299.x jurnal riset biologi dan aplikasinya, volume 2, nomor 1, maret 2020 uji antagonisme beberapa fungi endofit pada tanaman kentang terhadap fusarium oxysporum secara in vitro antagonistic effect of several endophyte fungi in potato plants against fusarium oxysporum in vitro izzatinnisa’*, ulfah utami, ahmad mujahidin jurusan biologi, fakultas sains dan teknologi, universitas islam negeri malang abstrak pemanfaatan fungi endofit merupakan salah satu alternatif untuk mengendalikan fusarium oxysporum pada tanaman kentang (solanum tuberosum l.) tanpa menimbulkan dampak negatif terhadap lingkungan. penelitian ini bertujuan untuk mengetahui daya antagonisme fungi endofit hasil isolasi dari tanaman kentang terhadap f. oxysporum secara in vitro. penelitian ini bersifat deskriptif eksploratif dan eksperimen. fungi endofit dan f. oxysporum diisolasi dengan metode direct platting, selanjutnya dilakukan pemurnian dan identifikasi fungi. fungi endofit yang terpilih, dilakukan uji antagonisme terhadap f. oxysporum secara in vitro dengan metode dual culture. persentase hambatan dianalisis menggunakan uji anova dan uji lanjut tukey. hasil penelitian menunjukkan empat isolat fungi endofit berhasil diisolasi dari jaringan daun tanaman kentang yaitu mucor sp.1, mucor sp.2, neoscytalidium sp., dan aspergillus sp. fungi patogen hasil isolasi yaitu f. oxysporum. uji antagonisme dengan metode dual culture menunjukkan semua fungi endofit mampu menghambat pertumbuhan f. oxysporum pada tanaman kentang dengan persentase hambatan yang bervariasi, yaitu neoscytalidium sp. (73,09%), mucor sp.2 (70,88%), mucor sp.1 (59,84%) dan aspergillus sp. (66,06%). hasil analisis anova menunjukkan bahwa terdapat pengaruh dari perlakuan yang diberikan (p=0,001). dengan demikian, fungi endofit hasil isolasi memiliki potensi dalam menghambat fungi patogen tanaman kentang. abstract the utilization of endophyte fungi is an alternative to control fusarium oxysporum on potatoes without damaging the environment. this study aimed to know the antagonism of endophyte fungi isolation from potato plants against f. oxysporum in vitro. this study was a descriptive explorative and experimental study. endophyte and pathogenic fungi were isolated by direct platting method. the fungi were purified and identified. the selected endophyte fungi were antagonistically tested towards pathogenic fungi conducted in vitro using dual culture method. the inhibition percentage was analyzed by using anova and tukey test. the result of the study indicated that endophyte fungi were successfully isolated from the tissues of potatoes leaves were mucor sp.1, mucor sp.2, neoscytalidium sp. and aspergillus sp. the pathogenic fungi isolated were fusarium oxysporum. the antagonistic test with dual culture method showed that all endophyte fungi were able to inhibit pathogenic fungi growth on potatoes with the various inhibition percentage, namely neoscytalidium sp. (73.09%), mucor sp.2 (70,88%), mucor sp.1 (59,84%) and aspergillus sp. (66.06%). the result of anova analysis showed that there were effects of the given treatments (p=0.001). in conclusion, endophyte fungi were potentially able to inhibit pathogenic fungi on potatoes. how to cite: izzatinnisa’, utami, u., & mujahidin, a. (2020). uji antagonisme beberapa fungi endofit pada tanaman kentang terhadap fusarium oxysporum sacara in vitro. jurnal riset biologi dan aplikasinya, 2(1), 18-25. *corresponding author: e-issn 2655-9927 jln. gajayana no. 50 malang 65149 e-mail: izzatinnisa1994@gmail.com jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi article history received : 18 desember 2019 approved : 18 februari 2020 published : 31 maret 2020 kata kunci: antagonisme; fungi endofit; fusarium oxysporum; kentang keywords: antagonism; fungi endophyte; fusarium oxysporum; potato 19 | izzatinnisa’ et al; uji antagonisme beberapa fungi endofit pada tanaman kentang pendahuluan kentang (solanum tuberosum l.) merupakan salah satu bahan pangan yang mempunyai multifungsi sebagai sumber karbohidrat dan memiliki nilai ekonomi yang tinggi (setiadi, 2009). salah satu kendala dalam produksi kentang baik untuk keperluan konsumsi atau bibit adalah tidak tersedianya bibit yang tahan terhadap serangan penyakit sehingga produktivitasnya menjadi sangat rendah (rubatzky & yamaguci, 1998). penyakit yang menyerang tanaman kentang disebabkan oleh fungi patogen tanaman. fungi yang umumnya menyerang tanaman kentang adalah phytopthora infestans, fusarium oxysporum dan alternaria solani (rahayu et al., 2015). fusarium oxysporum merupakan fungi patogen penyebab penyakit layu yang menyerang tanaman kentang (ayed et al., 2006). gejala layu pada tanaman kentang umumnya dimulai dari daun yang lokasinya di bawah dan selanjutnya berkembang ke arah atas akibat pangkal batang mulai membusuk. daun yang layu akan menguning dan akhirnya mengering, meskipun daun pucuknya tetap tampak hijau (warda, 2008). pengendalian penyakit tanaman kentang selama ini menggunakan berbagai jenis pestisida yang memiliki efek samping berupa tingginya kadar toksisitas pada hewan, manusia, dan lingkungan jika digunakan secara terus menerus (mojica et al., 2011). salah satu komponen pengendali fungi patogen yang ramah lingkungan yaitu agen hayati menggunakan fungi endofit. fungi endofit merupakan fungi yang hidup di dalam jaringan tanaman seperti daun, bunga, buah atau akar tumbuhan yang memiliki sifat mutualistik terhadap inangnya sehingga mampu menghambat perkembangan patogen dan meningkatkan pertumbuhan tanaman, menyebabkan terinduksinya metabolit sekunder dan resisten terhadap fungi patogen tanaman (petrini, 1993). kemampuan antagonis fungi endofit dalam mengendalikan penyakit tanaman yang disebabkan oleh fungi patogen telah dikaji. berdasarkan penelitian terdahulu, diketahui bahwa fungi endofit pada jaringan tanaman kentang memiliki daya antagonisme terhadap p. infestans berbeda-beda, yaitu daya antagonisme tertinggi pada fungi hyalodendron sp. (66,56%), chepalosporium (61,52%). persentase hambat terkecil yaitu aspergillus sp.2 sebesar 11,11% (tirtana et al., 2013). sulistyowati et al. (2005) melaporkan bahwa jamur endofit trichoderma asperellum yang diisolasi dari jaringan batang jeruk bertindak sebagai antagonis terhadap fungi phytophthora sp. dan diplodia sp. penelitian ini bertujuan untuk mengetahui daya antagonisme fungi endofit hasil isolasi dari tanaman kentang terhadap f. oxysporum secara in vitro. bahan dan metode penelitian ini bersifat deskriptif eksploratif dengan mengisolasi fungi endofit dan fungi patogen f. oxysporum dari tanaman kentang, sedangkan eksperimen dengan menguji potensi isolat fungi endofit sebagai antagonis dalam menekan pertumbuhan fungi patogen f. oxysporum pada tanaman kentang. penelitian eksperimen dilakukan menggunakan rancangan acak lengkap (ral) yang terdiri atas empat perlakuan dan enam ulangan. penelitian dilaksanakan di laboratorium mikrobiologi jurusan biologi fakultas sains dan teknologi, uin malang. alat-alat yang digunakan dalam penelitian ini adalah autoklaf, destruk, laminar air flow, cutter, cawan petri, jarum ose, hot plate stirer, inkubator, timbangan analitik, mikroskop komputer merk yazumi, gelas ukur, gelas beker, pengaduk kaca, erlenmeyer, pinset, penggaris, object glass, deck glass, bunsen, erlenmeyer, spatula, alumunium foil, blue tip, botol flakon, dan nampan. bahan yang digunakan adalah daun tanaman kentang yang terserang patogen dan daun, batang, dan umbi tanaman kentang yang sehat, media pda, aquades steril, spirtus, tissue, alkohol 70%, natrium hipoklorit (naocl) 5,3%, naocl 1%, kloramfenikol, kertas label, kertas saring, plastik wrap, plastik petromaks, kapas steril, kain kasa dan karet gelang. sampel tanaman diambil dengan metode search sampling. sampel diperoleh dari kebun kentang di dusun lemah putih, bumiaji, malang. sampel untuk isolasi fungi f. oxysporum yaitu daun tanaman kentang yang terserang patogen. sampel untuk eksplorasi fungi endofit diambil bagian batang, daun, dan umbi tanaman kentang yang sehat. sampel dimasukkan ke dalam kantong plastik dan diberi label. isolasi fungi endofit dilakukan dengan teknik direct seed plating. daun, batang, dan umbi tanaman kentang segar dicuci di bawah air mengalir selama 10 menit, dikeringkan dengan tissue steril. selanjutnya sampel disterilisasi dengan naocl 5% selama 1 menit, alkohol 70% selama 1 menit sebanyak 2 kali, lalu dibilas dengan aquades steril selama 1 menit sebanyak dua kali (tirtana et al., 2013). jurnal riset biologi dan aplikasinya, 2(1), 18-25, maret 2020 | 20 sampel tersebut ditiriskan di atas kertas saring steril. selanjutnya sampel dipotong dengan ukuran 1 cm dan ditempatkan pada cawan petri yang berisi media pda. bagian potongan sampel harus menempel pada permukaan media. sampel diinkubasi selama 2-14 hari pada suhu ruang. akuades bilasan terakhir diambil 1 ml dan dituang ke dalam media pda yang baru untuk digunakan sebagai kontrol. pengamatan dilakukan selama dua hari sekali (tirtana et al., 2013). fungi f. oxysporum diisolasi dengan cara bagian daun tanaman kentang yang terinfeksi dipotong ukuran 1x1 cm. potongan sampel disterilisasi dengan naocl 1% selama dua menit sebanyak dua kali (rashid et al., 2016). selanjutnya dikeringanginkan di atas kertas saring steril. isolasi fungi f. oxysporum dilakukan dengan teknik direct plating, yaitu dengan meletakkan potongan sampel pada permukaan media pda (rashid et al., 2016). sampel diinkubasi selama lima hari pada suhu 27-28 oc (suhu ruang). biakan fungi endofit dan fungi f. oxysporum diidentifikasi secara makroskopis dan mikroskopis. parameter pengamatan secara makroskopis yaitu warna permukaan atas dan bawah, bentuk permukaan, dan tepi koloni fungi patogen. pengamatan secara mikroskopis dilakukan dengan membuat mikrokultur dari setiap isolat yaitu dengan memotong media pda ukuran 0,5 x 0,5 cm dari cawan petri secara aseptis dan diletakkan di atas kaca benda steril. kemudian isolat fungi yang diidentifikasi dikultur dengan menggoreskan di sisi tengah media dan ditutup menggunakan deck glass. kaca benda diletakkan dalam cawan petri dilapisi tisu dan dibasahi dengan sedikit akuades steril. inkubasi dilakukan pada suhu ruang selama 5-7 hari. pengamatan dilakukan dengan ditetesi 1 tetes larutan lactophenol cotton blue (lcb) sebagai pewarna. kemudian ditutup dengan deck glass dari hasil kultur fungi. selanjutnya, diamati di bawah mikroskop dengan perbesaran 100x dan 400x. parameter yang diamati yaitu bentuk konidia, hifa, dan letak konidiofor. hasil pengamatan dibandingkan dengan buku identifikasi fungi karangan barnett (1972). uji antagonisme dilakukan dengan metode dual culture. miselium isolat fungi endofit dan fungi f. oxysporum dibiakkan dalam satu cawan petri (gambar 1). media yang diinokulasikan isolat fungi f. oxysporum saja digunakan sebagai kontrol. setiap perlakuan dilakukan sebanyak enam kali. gambar 1. dual culture method; t = fungi antagonis; r1 = fungi f. oxysporum control; r2 = fungi f. oxysporum perlakuan kemampuan antagonisme ditentukan berdasarkan persentase hambat dan antibiosis dengan menilai ada tidaknya zona hambatan. persentase hambatan pertumbuhan fungi endofit dihitung berdasarkan rumus: keterangan: pi = persentase hambatan pertumbuhan miselium (%) r1= diameter miselium f. oxysporum pada cawan petri kontrol (cm) r2 =diameter miselium f. oxysporum pada cawan petri perlakuan (cm) kriteria persentase hambatan pertumbuhan (%) (amaria et al., 2013): 1. persentase hambat tinggi: 70-100% 2. persentase hambat sedang: 40-69% 3. persentase hambat rendah: 0-39 % hasil dari uji antagonis terhadap setiap perlakuan dianalisis menggunakan analisis varian (anova) dengan taraf kepercayaan 95% (p<0,05). perlakuan yang menunjukkan perbedaan yang signifikan, maka dilakukan uji lanjut dengan duncan 5% untuk mengetahui perbedaan antar perlakuan. hasil dan pembahasan fungi endofit hasil isolasi diperoleh dua isolat yang berasal dari daun yaitu mucor sp.1 dan neosytalidium sp., satu isolat berasal dari batang yaitu aspergillus sp. dan satu isolat dari umbi yaitu mucor sp.2 (gambar 2). r1 r2 t 21 | izzatinnisa’ et al; uji antagonisme beberapa fungi endofit pada tanaman kentang gambar 2. morfologi fungi endofit hasil isolasi pada hari ke-7 (a.) mucor sp.1, (b) neoscytalidium sp., (c) aspergillus sp., (d) mucor sp.2 tabel 1. morfologi makroskopis dan mikroskopis fungi endofit dari tanaman kentang (solanum tuberosum l.) pengamatan mucor sp.1 neoscytalidium sp. aspergillus sp. mucor sp.2  koloni pada medium pda warna koloni putih semburat kuning abu-abu tua putih kecoklatan putih semburat keabuan “colony reverse” putih semburat kuning hitam coklat putih keabuan permukaan koloni berserabut berserabut lebat berserabut berserabut tipis  konidia  spora/sporangia ada ada ada ada bentuk bulat oval, persegi bulat bulat warna transparan transparan transparan transparan permukaan halus halus halus halus  konidiofor permukaan halus halus halus halus warna transparan transparan transparan transparan percabangan ada  hifa tidak berseptat berseptat berseptat tidak berseptat fungi endofit hasil isolasi dari daun, batang dan umbi tanaman kentang yang sehat memiliki karakteristik beraneka ragam baik dari bentuk koloni dan warna koloni pada belahan bagian tanaman kentang. perbedaan karakteristik morfologi makroskopis dan mikroskopis fungi endofit hasil isolasi dapat ditunjukkan dalam tabel 1. pengamatan secara mikroskopis (gambar 2a.) menunjukkan bahwa isolat mucor sp.1 memiliki hifa tidak berseptat. sporangiospor memiliki diameter 6,70 µm yang berbentuk bulat dan tumbuh pada hampir seluruh miselia, kolumella berbentuk bulat atau silinder. sporangium bulat dan tidak membentuk stolon. ukuran sporangium yaitu 21,61 x 20,99 µm dan spora berbentuk bulat dengan berukuran 3,79 x 7,07 µm. sesuai dengan barnett (1972), bahwa genus mucor sp. memiliki sporangium bulat, tunggal atau bercabang pada pucuk sporangiofor dan memiliki kolumella. sporangiofor berbentuk sederhana. hifa tidak bersepta, sederhana atau bercabang. jurnal riset biologi dan aplikasinya, 2(1), 18-25, maret 2020 | 22 isolat neoscytalidium sp. memiliki ciri mikroskopis hifa yang bersekat (gambar 2b). konidiofor transparan, permukaan halus dan adanya percabangan. konidia berukuran 5,11 x 3,90 µm dan arthrokonidia berukuran 7,90 x 2,48 µm. arthrokonidia merupakan spora yang dihasilkan dari segmentasi hifa. sesuai dengan pengamatan dionne dkk. (2015) koloni genus neoscytalidium sp. pada media pfa (potato flakes agar) memiliki miselium yang berserabut dan berwarna hitam keabuan. secara mikroskopis memiliki arthrokonidia yang berwarna coklat pada rantai dengan ukuran 3,5 sampai 5 µm, berdinding tipis. hifa berseptat dan tidak berwarna atau hialin. arthroconidia merupakan spora yang dihasilkan dari segmentasi hifa. isolat aspergillus sp. (gambar 2c) memiliki ciri mikroskopis konidia berbentuk bulat, transparan, dan permukaannya halus dan konidia 1 sel. konidofor panjang tegak lurus dengan diameter 2,80 µm, bagian ujungnya membulat, memiliki phialid yang menyambung pada pucuk dan mengitari seluruh permukaan. sesuai dengan barnett (1972) bahwa aspergillus sp. memiliki konidiofor panjang, berseptat atau nonseptat yang muncul dari sel kaki, pada ujung konidiofor muncul sebuah gelembung, dari gelembung ini muncul sterigma dan konidium yang tersusun berurutan mirip bentuk untaian mutiara yang mendukung kepalanya yang besar. isolat fungi mucor sp.2 (gambar 2d) memiliki ciri-ciri hifa yang tidak bersekat dengan diameter 7,30 µm. sporangiospora berbentuk silindris dan tumbuh pada hampir seluruh miselia, kolumella berbentuk bulat. sporangium berbentuk bulat dan tidak membentuk stolon. sporangium berukuran 13,57 x 11,88 µm dan spora dengan ukuran 3 x 4,52 µm. fungi patogen f. oxysporum penyebab layu tanaman kentang hasil isolasi dapat dilihat pada gambar 3. isolat fungi patogen f. oxysporum memiliki karakteristik yaitu bentuk makrokonidia memanjang dengan ujung meruncing dan mikrokonidia ovoid. ukuran makrokonidia fusarium sp.3 sebesar 30,83 x 3,05 µm sedangan mikrokonidia berukuran 12,86 x 1,68 µm. menurut agrios (2005), mikrokonidia fusarium sp. mempunyai satu atau dua sel, terdapat dalam jumlah yang banyak, dan sering dihasilkan pada semua kondisi. jenis spora tersebut banyak dijumpai di dalam jaringan tanaman terinfeksi. sedangkan, makrokonidia fungi fusarium sp. mempunyai 2 sampai 5 sel dan berbentuk lengkung. gambar. 3 isolat fusarium oxysporum uji antagonisme dilakukan dengan metode dual culture pada media pda. morfologi koloni fungi f. oxysporum yang ditumbuhkan berpasangan dengan fungi antagonis dapat dilihat pada gambar 4. g a mb a r 4 . mor f ol og i k ol on i fu n gi p ad a u ji an tag on is m e h ar i k e 7 . (a ) mucor sp.1 vs f. oxysporum, (b) mucor sp.2 vs f. oxysporum, (c) neoscytalidium sp. vs f. oxysporum (d) aspergillus sp. vs f. oxysporum (e) f. oxysporum sebagai kontrol negatif 23 | izzatinnisa’ et al; uji antagonisme beberapa fungi endofit pada tanaman kentang r ata-rata p erse ntase antag onis me (%) f ungi e ndofi t terh adap fungi f. oxysporum pada hari ke-7 dapat dilihat pada gambar 5. gambar 5. histogram daya antagonisme (%) fungi endofit terhadap fungi f. oxysporum pada hari ke-7 uji antagonisme dilakukan dengan metode dual culture pada media pda dalam cawan petri berdiameter 9 cm. mekanisme penghambatan yang terjadi pada uji antagonisme adalah kompetisi, antibiosis dan parasitisme. hal ini dapat diamati dengan terbentuknya zona bening sebagai zona hambat pertumbuhan bagi fungi patogen (antibiosis) dan pertumbuhan miselium endofit yang menutupi seluruh permukaan medium termasuk koloni fungi patogen (hiperparasit). koloni fungi endofit yang menekan fungi patogen, ditandai dengan pertumbuhan fungi patogen yang menjauhi fungi endofit disebut kompetisi (gambar 4). pada pengamatan penghambatan fungi patogen pada hari pertama dan kedua, belum terjadi mekanisme antagonis antara kedua fungi. pada hari ketiga pertumbuhan kedua biakan saling mandekati sehingga terbentuklah zona penghambatan bagi fungi patogen. zona penghambatan ini tidak bersifat tetap selama pengamatan. sampai pada hari ketujuh lebar zona bening yang terbentuk semakin menyempit. pertumbuhan fungi endofit yang semakin cepat sehingga fungi patogen semakin terdesak karena kahabisan ruang tumbuh. ruang dalam medium sudah penuh, maka fungi patogen tumbuh dengan arah tumbuh ke atas. pengamatan makroskopis pada uji antagonisme masa inkubasi 7 hari menunjukkan bahwa tepi koloni fungi patogen mulai terdesak oleh fungi antagonis yaitu fungi endofit dan pertumbuhan koloni fungi patogen cenderung tumbuh ke arah atas. rerata persentase hambatan fungi endofit terhadap fungi f. oxysporum pada inkubasi hari ke-7 dianalisis statistik menggunakan spss 16.0 for windows. hasil uji kolmogorov-smirnov menunjukkan bahwa data terdistribusi normal karena memiliki nilai signifikansi sebesar 0,942 (p>0,05). uji homogenitas menunjukkan bahwa data tidak homogen dengan signifikansi sebesar 0,042 (p<0,05) sehingga dilakukan uji homogenitas data melalui uji welch dan diperoleh nilai signifikansi sebesar 0,001 (p<0,05) yang artinya terdapat pengaruh. hal ini dibuktikan dengan uji lanjut games-howell. persentase hambatan yang menunjukkan hasil berbeda nyata yaitu ditunjukkan perlakuan fungi mucor sp.1 karena memiliki persentase hambat terkecil (59,84%) dan berbeda dari perlakuanperlakuan yang lain. perlakuan pada fungi aspergillus sp. (66,06%) juga memiliki perbedaan nyata dari perlakuan yang lain. akan tetapi ada dua perlakuan yang memiliki perbedaan yang tidak nyata, karena memiliki rentang nilai yang kecil yaitu perlakuan fungi mucor sp.2 (70,88%) dan neoscytalidium sp. (73,09%). rerata persentase hambat fungi endofit terhadap seluruh fungi patogen hasil isolasi tertinggi berturut-turut yaitu fungi endofit neoscytalidium sp. (73,09%), mucor sp.2 (70,88%), mucor sp.1 (59,84%) dan aspergillus sp. (66,06%). penghambatan fungi endofit neoscytalidium sp. dinyatakan tinggi karena menurut amaria dkk. (2013) jika suatu fungi endofit memiliki kemampuan menghambat fungi patogen lebih dari 70%. hal ini disebabkan fungi neoscytalidium sp. memiliki kemampuan tumbuh yang sangat cepat dan mampu mengusai ruang tumbuh pada hari ke-4 setelah inkubasi. wulandari & ali (2018) menyatakan bahwa fungi yang memiliki pertumbuhan lebih cepat akan mampu menguasai ruang tumbuh dan akan menekan pertumbuhan fungi lawannya. hasil penelitian motaal et al. (2010) menunjukkan bahwa fungi neoscytalidium sp. memiliki daya antagonisme yang paling tinggi dalam menghambat seluruh pertumbuhan patogen pada tanaman kecubung (hyoscyamus muticus l.) yang merupakan tanaman herba dari famili solanaceae asal egypt (mesir). rata-rata persentase hambat pada fungi endofit mucor sp.1, mucor sp.2 dan aspergillus sp. tergolong sedang. hal ini karena persentase hambat terhadap patogen hanya mencapai 70%. menurut carrol (1988), beberapa genus mucor memiliki mekanisme antagonisme tinggi karena adanya mekanisme kompetisi ruang tumbuh dan nutrisi, mikoparasitisme dan antibiosis. hal ini diduga mucor sp. dapat memproduksi hidroksi sianida jurnal riset biologi dan aplikasinya, 2(1), 18-25, maret 2020 | 24 (hcn) dalam menghambat pertumbuhan patogen (chadha et al., 2015). fungi endofit aspergillus sp. juga memiliki kemampuan dalam menekan pertumbuhan fungi f. oxysporum. fungi endofit aspergillus sp. memiliki kemampuan aktivitas antimikroba, karena menurut neekety et al. (2016) isolat fungi genus aspergillus dapat memproduksi beberapa enzim yang dapat menghambat pertumbuhan mikrob lainnya. enzim yang diproduksi, yaitu amyloglucosidase, cellulases, laktase, invertase, pektinase, dan asam protease. simpulan fungi endofit yang diisolasi dari daun, batang dan umbi kentang adalah sebanyak empat isolat (mucor sp.1, mucor sp.2, neoscytalidium sp., dan aspergillus sp.). uji antagonisme dengan metode dual culture menunjukkan semua fungi endofit mampu menghambat pertumbuhan f. oxysporum pada tanaman kentang dengan persentase hambatan yang bervariasi yaitu neoscytalidium sp. (73,09%), mucor sp.2 (70,88%), mucor sp.1 (59,84%) dan aspergillus sp. (66,06%). ucapan terima kasih ucapan terima kasih penulis ditujukan kepada tim peneliti yang telah membantu penulis dalam menyelesaikan penelitian ini. daftar pustaka agrios, g. n. (2005). plant pathology edisi 5. usa: elsevier academic press. amaria, w., efi, t., & rita, h. (2013). seleksi dan identifikasi jamur antagonis sebagai agens hayati jamur rigidoporus microporus pada tanaman karet. journal of industrial and beverage crops, 4(1),20-31. doi: http://dx.doi.org/10.21082/jtidp.v4n1.2013.p 55-64. ayed, f., m., d. remadi, h. j. khiareddine., & m. e. mahjoub. (2006). potato vascular fusarium wilt in tunisia: incidence and biocontrol by trichoderma spp. plant pathology journal, 5(2), 92-98. doi: 10.3923/ppj.2006.92.98 barnett, h. l. (1972). illustrated genera of imperfect fungi. second edition. virgiana: burgess publishing company. carroll., g. c. (1988). fungal endophytes in stems and leaves. from latent pathogens to mutualistyc symbiont. ecology, 69 (1),2-9. doi: https://www.jstor.org/stable/1943154. chadha, n., ram, p., & ajit, v.(2015). plant promoting activities of fungal endophytes associated with tomato roots from central himalaya, india and their interaction with piriformospora indica. international journal pharmacy bio science, 6(1),333-343.diakses dari https://ijpbs.net/abstract.php?article=mzk1m a. dionne, b., luke n., samuel a. l., deanna a. s., nathan p.w., jonathan, l., & hongxin f. (2015). pulmonary fungal infection caused by neoscytalidium dimidiatum. journal of clinical microbiology, 53(7), 2381-2384. doi: 10.1128/jcm.00206-15. mojica, m. v., luna, h. a., sandoval, c. f., morales l.h., gonzález, n. a., pereyra, b., & elíaas, m. (2011). in vitro antifungal activity of gobernadora (larrea tridentata) against phytophthora capsici. african journal of agricultural research, 6(5),1058-1066. diakses dari: http://www.academicjournals.org/ajar. motaal, f. a., mortada, s.m.n., soad el zayat., magdi, a., & shin, i. i. 2010. antifungal activity of endophytic fungi isolated from egyptian henbane (hyoscyamus muticus l.). journal of botany, 42 (4),2883-2894. diakses dari http://www.pakbs.org/pjbot/pdfs/42(4)/pj b42(4)2883.pdf. neekety, a., mohamed s.a., amal s.h., ahmed h., bassem a.s., & mosad.(2016).molecular identification of newly isolated non-toxigenic fungal strains having antiaflatoxigenic, antimicrobial and antioxidant activities. der pharma chemica, 8(20), 121-134. diakses dari: http://derpharmachemica.com/archive.html. petrini, o. (1993). endophyt of pteridium sp.: some consederations for biological control. sydowia, 45(3), 282-293. diakses dari: https://www.semanticscholar.org. purwantisari, s., & rini, b. h. (2009). uji antagonisme jamur patogen phytophthora infestans penyebab penyakit busuk daun dan umbi tanaman kentang menggunakan trichoderma spp. isolat lokal. bioma, 11(1), 24-32. diakses dari https://core.ac.uk/download/pdf/11703255.p df. rahayu, s., fitri, n., & yuliana, p. (2015). jamur kontaminan pada umbi kentang. biogenesis, 3 (1), 28-32. doi: https://doi.org/10.24252/bio.v3i1.563. rashid, t s., kamaruzaman s., haiman k., halimi m., & jugah k. (2016). pathogenicity assay and molecular identification of fungi and bacteria associated with diseases of tomato in malaysia. american journal of plant sciences, 7(9), 949-957. doi: https://doi.org/10.4236/ajps.2016.76090. rashid, t s., kamaruzaman s., haiman k., halimi m., & jugah k. (2016). pathogenicity assay and molecular identification of fungi and https://www.jstor.org/stable/1943154 https://ijpbs.net/abstract.php?article=mzk1ma https://ijpbs.net/abstract.php?article=mzk1ma http://www.pakbs.org/pjbot/pdfs/42(4)/pjb42(4)2883.pdf http://www.pakbs.org/pjbot/pdfs/42(4)/pjb42(4)2883.pdf https://core.ac.uk/download/pdf/11703255.pdf https://core.ac.uk/download/pdf/11703255.pdf https://doi.org/10.24252/bio.v3i1.563 25 | izzatinnisa’ et al; uji antagonisme beberapa fungi endofit pada tanaman kentang bacteria associated with diseases of tomato in malaysia. american journal of plant sciences, 7(9), 949-957. doi: https://doi.org/10.4236/ajps.2016.76090. rubatzky, v.e., & yamaguchi m. 1998. sayuran dunia: prinsip, produksi dan gizi jilid ii. bandung: itb. setiadi. (2009). budidaya kentang. jakarta: penebar swadaya. sulistyowati, l., n. f. deci., & gendall, a. r.. (2005). isolation and sequencing of chitinase and glucanase genes of endophytic trichoderma asperellum from citrus stem. in program and abstract the 1st international conference of crop security 2005, malang: brawijaya university. tirtana, z.y.g., liliek s., & abdul c. (2013). eksplorasi jamur endofit pada tanaman kentang (solanum tuberosum l.) serta potensi antagonismenya terhadap phytophthora infestans de barry penyebab penyakit hawar daun secara in vitro. jurnal hama penyakit tanaman, 1(3), 91-101.diakses dari http://jurnalhpt.ub.ac.id/index.php/jhpt/articl e/view/75. warda. (2008). hama dan penyakit pada tanaman kentang di kabupaten gowa sulawesi selatan. balai pengkajian teknologi pertanian selawesi selatan. prosiding seminar ilmiah dan pertemuan tahunan pei pfi xix komisariat daerah sulawesi selatan, hal 397-401. wulandari, s.f. & ali, m. 2018. isolasi dan uji antagonis jamur endofit dari tanaman bawang merah (allium ascalonicum l.) terhadap alternaria porri ellis cif. jom faperta, 5 (1), 1-9. diakses dari https://www.onesearch.id/record/ios1772.a rticle-19238?widget=1. jurnal riset biologi dan aplikasinya, volume 2, nomor 2, september 2020 effectiveness of apu-organic liquid fertilizer (pistia stratiotes l.) on ipomoea reptans poir. growth efektivitas pupuk organik cair apu-apu (pistia stratiotes l.) terhadap pertumbuhan kangkung darat (ipomoea reptans poir.) ambar pratiwi*, arni isma nurrohmi biology study program, faculty of applied science and technology, ahmad dahlan university, yogyakarta fertilization uses organic fertilizers made of apu-apu (pistia stratiotes l.) can support nutrient availability there by increasing soil fertility. p. stratiotes l. contains nutrients but in elemental form that is not yet available. so far, the abundance of p. stratiotes l. has not been utilized properly by the society, hence that research is needed to make liquid organic fertilizer p. stratiotes l. by fermentation. the purpose of this study was to determine the increase in the growth of ipomoea reptans poir. by giving apu-apu liquid organic fertilizer and determine the optimum concentration of liquid organic fertilizer for apu-apu for the growth of ground water spinach. this research was conducted at the kemusuh green house, banyurejo, tempel, sleman. the independent variable used was the poc concentration of apu-apu plants with five replications and six levels of treatment (k = 0%, p1 = 4%, p2 = 8%, p3 = 12%, p4 = 16% and p5 = 20%). the data obtained were analyzed using anova followed by the duncan test. apu-apu liquid organic fertilizer contains elements c (4.6%), n (0.07%), p (0.09%) and k (0.07%). the application of liquid organic fertilizer made from apu-apu has an effect on the growth of water spinach on the parameters of the number of leaves, leaves width, fresh weight and chlorophyll content. the conclusion obtained from the results of this study is that the application of liquid organic fertilizer apu-apu provides an increase in the growth of ground water spinach. abstrak pemupukan dengan pupuk organik dari apu-apu (pistia stratiotes l.) dapat mendukung ketersediaan hara sehingga meningkatkan kesuburan tanah. p. stratiotes l. memiliki kandungan unsur hara namun dalam bentuk unsur yang belum tersedia. kemelimpahan p. stratiotes l. selama ini belum dimanfaatkan dengan baik oleh masyarakat sehingga perlu adanya penelitian untuk menjadikan pupuk organik cair p. stratiotes l. dengan cara fermentasi. tujuan penelitian ini adalah untuk menguji peningkatan pertumbuhan kangkung darat (ipomoea reptans poir.) dengan pemberian pupuk organik cair apu-apu dan menentukan konsentrasi pupuk organik cair apu-apu yang optimum untuk pertumbuhan kangkung darat. penelitian ini dilaksanakan pada bulan april-juni 2019 di green house kemusuh, banyurejo, tempel, sleman. variabel bebas yang digunakan adalah konsentrasi poc tanaman apu-apu dengan 5 ulangan dan 6 taraf perlakuan (k= 0 %, p1= 4 %, p2=8 %, p3=12 %, p4=16 % dan p5= 20%). data yang diperoleh dianalisis menggunakan anova dan dilanjutkan dengan duncan test. pupuk organik cair apu-apu mengandung unsur c (4,6%), n (0,07%), p (0,09%) dan k (0,07%). pemberian pupuk organik cair apu-apu memberikan pengaruh terhadap pertumbuhan kangkung darat pada parameter jumlah daun, luas daun, berat basah dan kadar klorofil. kesimpulan yang diperoleh dari hasil penelitian ini adalah pemberian pupuk organik cair apu-apu memberikan peningkatan pertumbuhan kangkung darat. how to cite: pratiwi, a & nurrohmi, a.i. (2020). effectiveness of apu-organic liquid fertilizer (pistia stratiotes l.) on ipomoea reptans poir. growth. jurnal riset biologi dan aplikasinya, 2(2), 55-63. *corresponding author: e-issn 2655-9927 jln. ringroad selatan, tamanan, banguntapan, bantul, diy indonesia e-mail: ambar@bio.uad.ac.id jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi article history received : 12 februari 2020 approved : 22 september 2020 published: 30 september 2020 keywords: organic liquid fertilizer, growth, ipmomoea reptans kata kunci: pupuk cair organik, pertumbuhan, ipmomoea reptans abstract mailto:ambar@bio.uad.ac.id 56 | pratiwi & nurrohmi; effectiveness of apu-organic liquid fertilizer (pistia stratiotes l.) introduction farmers in indonesia generally use inorganic fertilizers for cultivated crops. according to noviyanti (2019), based on the results of the 2013 bps agricultural census, the use of fertilizers was almost dominated by inorganic fertilizers, namely 86.41%. the use of inorganic fertilizers if carried out continuously can affect the quality of a soil and can also reduce yields (oviyanti & hidayah, 2016). one of the short comings of inorganic fertilizers is that they contain little or almost no micro-nutrients (lingga & marsono, 2006). the continuous use of inorganic fertilizers causes a decrease in the soil organic matter content, the soil becomes solid (sulaeman et al., 2016). low micro-nutrients can lead to plants experiencing micronutrient deficiency, so they can experience growth and productivity barriers (hayati, 2010). the way to get plant growth properly is by fertilizing using organic fertilizers. the use of organic fertilizers can increase soil productivity, crop yields and reduce the use of inorganic fertilizers (sulaeman et al. 2017). according to oviyanti et al. (2016), a source of organic fertilizer from plants that has the potential to be used as liquid organic fertilizer is the gamal plant gliricidia sepium (jacq.) kunth ex walp. with the organ of the plant used, namely gamal leaves. the liquid organic fertilizer of gamal leaves with a concentration of 120 ml / l of water gave the most optimum effect on the vegetative growth of mustard plants. another potential source of material for organic fertilizer is the apu-apu plant (pistia stratiotes l.). pistia stratiotes l has elements that are not yet available such as nitrogen, phosphate and potassium. according to putri et al. (2013), pistia stratiotes l. has useful ingredients such as n: 2.83%, p: 0.17%, k: 0.96%, c / n: 10 and 47.020 organic matter so that pistia stratiotes l. processed into liquid fertilizer. apu-apu plants are plants that grow wild and are included in the aquatic weed group (baroroh et al.,2018).the distribution of p. stratiotes l. naturally can be found in subtropical and tropical areas (rijal, 2014). reproduction of p. stratiotes l. occurs very quickly, namely by removing the stolon. the presence of p. stratiotes l. in abundant rice fields can disrupt cultivated plants. apu-apu abundance and high nitrogen content, and no research studies on the use of apu-apu as liquid organic fertilizer. this study examines the nutritional content of liquid organic fertilizer apu-apu and its effect on the growth of vegetable plants, especially kale. land spinach is a cultivated vegetable plant that is relatively familiar in indonesia. the part of kale that is consumed is the leaves, it tastes fresh and contains iron, vitamins a, b and c (djuariah, 1997; kusandriyani & luthfy, 2016). kale also contains fiber and antioxidant compounds, which support the body's health (edi & yusri, 2009). according to handriatni (2010) the production of i. reptans poir. influenced by nitrogen nutrients absorbed by plants. nitrogen-deficient plants can be seen on the underside of usually older leaves starting to turn light green, then turning yellow. leaves i. reptans poir. in its growth, it is easy to turn yellow due to deficiency of nitrogen nutrients, so that alternative efforts are needed to improve the quality of leaves of i. reptans poir. so that the productivity yields of i. reptans poir. can increase. therefore, it is necessary to make efforts to utilize p. stratiotes l. as a liquid organic fertilizer in this study. this study aims to determine the growth of ground water spinach by applying apu-apu liquid organic fertilizer and to determine the optimum concentration of liquid organic fertilizer for the growth of ground water spinach. materials and methods apu-apu (pistia stratiotes l.) was taken from the rice fields of banyurejo, tempel, sleman. apu-apu plants were washed, then dried in the sun for 30 minutes. apu-apu was weighed as much as 2.1 kg (oviyanti et al., 2016) then cut into small pieces. apu-apu was put into a plastic jar filled with 3.2 liters of water, 5 grams of brown sugar and 21 ml of em4 (oviyanti et al., 2016) then stirred until homogeneous. the jar was closed and left for 25 days. poc ph measurements were carried out twice, namely before the fermentation process and after the fermentation process, while the poc temperature was measured using a thermometer every 7 days. the liquid obtained was filtered using a filter and analyzed for the content of carbon, nitrogen, phosphors, and potassium. 150 ml of liquid fertilizer was given six times, namely 0, 1, 2, 3, 4 and 5 weeks after planting (mst) with each plant receiving a concentration of 0%, 4%, 8%, 12%, 16% and 20% liquid fertilizer for apu-apu plants according to the assigned randomization design. jurnal riset biologi dan aplikasinya, 2(2), 55-63, september 2020 | 57 weeding and watering were conducted every 2 days. measurement of humidity, temperature and light intensity was carried out every 7 days. observation of stem height, number of leaves, and leaf area was carried out every 7 days. observation of wet weight, dry weight and chlorophyll content test were carried out when kale plants were harvested. the data analysis used in this study was the analysis of variance (anova) with a 95% confidence level, and then followed by duncan test (oviyanti et al., 2016). results and discussion the organic fertilizer used is in the form of liquid organic fertilizer based on apu-apu (pistia stratiotes l.) because it contains compounds that provide nutrients such as carbon, nitrogen, phosphorus and potassium. the process of making pistia stratiotes l. fertilizer ends when there is a color change in the fertilizer material, from green to brownish yellow. in the process of fermentation of organic matter, microorganisms will work well if the conditions are right. the fermentation process will take place in semi anaerobic conditions, low ph (3-4), high salt and sugar levels, 30-40% moderate water content, presence of fermentation microorganisms, and temperatures around 40-50°c (indriani, 2002). the microorganisms contained in em4 have a good effect on the quality of organic fertilizers, while the availability of nutrients in organic fertilizers is strongly influenced by the length of time it takes for bacteria to degrade waste (amik & hardini, 2014). the aroma of fertilizer produced after the fermentation process is in the form of alcoholic aroma. this can be caused because in em4 contains saccharomyces sp. where these microbes are able to convert glucose into alcohol and co2. the initial acidity level of the fertilizer before fermentation is 7.1 and the final acidity after fermentation is 5.6. the degree of acidity as a minimum technical requirement for organic fertilizers ranges from 4-8 (nur et al., 2016). the degree of acidity has decreased, which is in acidic conditions. acidic conditions can occur due to the activity of bacteria that produce acid. the activity of lactobacillus sp. which is present in em4 converts carbohydrates into lactic acid (puspadewi et al., 2011). the effect of the activity of lactobacillus sp. causing the number of lactic acid bacteria to increase during the fermentation process followed by a decrease in ph environmental (puspadewi et al., 2011). the temperature of the fertilizer at the beginning of fermentation was 30°c, while the temperature of the fertilizer when it was harvested decreased when compared to the initial temperature of the fermentation process, which was 28°c. this is because at the end of fermentation the decomposition or respiration process has begun to decrease so that there is a decrease in the rate of reaction in producing energy so that the temperature decreases. the basic ingredients of the fertilizer have broken down in the fermenter, so that the activity and oxygen consumption decrease causing the temperature inside the fermenter to decrease. the results of the analysis of liquid organic fertilizer based on pistia stratiotes l. are presented in table 1. the results of the analysis of pistia stratiotes l. fertilizer nutrients (table 1) show that the four nutrients have not met the poc quality standard according to the regulation of the minister of agriculture number 70/permenten/sr.140/ 10/2011. the low nutrient content of the liquid organic fertilizer apu-apu can be caused by the incomplete anaerobic decomposition process. during the inorganic decomposition process, gases such as ch4, co2, n, co, o, ammonia are also produced, so that the nutrient content of liquid organic fertilizer is lower (sulaeman et al., 2016). degradations microorganisms also need carbon compounds as their energy source for degradation of organic matter in the fermentation process, hence the resulting carbon content is low because it is converted to energy and gas (jumirah, 2018). table 1. analysis results of pistia stratiotes l. liquid organic fertilizer. no parameter units results quality standards 1 carbon (c) % 4,59705 minimum 6 2 nitrogen (n) % 0,06755 3-6 3 phosphor (p) % 0,0949 3-6 4 potassium (k) % 0,06845 3-6 source: chem-mix pratama laboratory, 2019. 58 | pratiwi & nurrohmi; effectiveness of apu-organic liquid fertilizer (pistia stratiotes l.) low nitrogen content can be caused by a change in the element nitrogen into gas (jumirah, 2018). low phosphorus levels occur because these elements are needed by microorganisms such as lactobacillus sp, saccharomyces sp, and molds as a macro source for their growth and development (jumirah, 2018). the low levels of potassium are due to the basic ingredients of fertilizer consisting of high fiber content so that the decomposition process is not optimal (jumirah et al., 2018). provision of pistia liquid organic fertilizer can increase ipomoea growth as indicated by the following parameters. the height of the stems increases due to the growth of the segments. this is due to the presence of cell division and cell elongation which is influenced by the auxin hormone as well as nutrient content, especially n. lingga & marsono (2003) stated that the main role of n is to accelerate overall growth, especially stems and leaves. the average height of the stems of ground water spinach (ipomoea reptans poir.) is presented in figure 1. figure 1 shows that the highest average stem height of land spinach is obtained from treatment 16%. the increase in stem height in plants treated with apu-apu liquid organic fertilizer is caused because the fertilizer contains nitrogen nutrients needed by plants for physiological processes, such as the phases of vegetative growth and metabolism in plants which will trigger plant growth and height (oviyanti et al., 2016). the presence of n in organic fertilizers can support the synthesis of proteins and enzymes that support general growth, including the addition of plant height (rahmah, at al., 2014). the presence of p, n and k nutrients in the liquid organic fertilizer apu-apu plays a role in regulating growth. n and k nutrients support plant height increase because k helps metabolize carbohydrates and accelerate the growth of meristematic tissue (nyakpa et al., 1998). as for the results of observations on the height growth of ipomoea reptans poir stems. presented in figure 2 figure 1. average height of ground water spinach stems. p0: control (without fertilizer) p1: concentration 4%; p2: concentration 8% p3: concentration 12%; p4: concentration 16% p5: concentration 20%; m: week figure 2. the observation results of the stem height of ipomoea reptans poir. jurnal riset biologi dan aplikasinya, 2(2), 55-63, september 2020 | 59 the number of leaves is a parameter to indicate the size of the photosynthate produced by a plant which is related to the value of plant productivity. the results of counting the number of leaves of ground spinach (ipomoea reptans poir.) are presented in figure 3. figure 3. shows that the highest number of leaves of land spinach (ipomoea reptans poir.) is shown at a concentration of 8%, which is 62 pieces. increased vegetative growth is supported because of the presence of nitrogen nutrients needed in leaf formation and high auxin activity, so that it affects cell division and enlargement such as in leaf cells. as a result, the number of leaves will increase (handriatni, 2010). leaf area is an important parameter for determining the rate of photosynthesis of a plant (hariodamar & santoso, 2018). the results of leaf area measurements of ground water spinach (ipomoea reptans poir.) are presented in figure 4. according to larasati et al. (2018) the more leaves on a plant, the greater the resulting leaf area. the finding research of this study showed that the number of leaves and leaf area in treatment 8% had superior values compared to other treatments. according to hariodamar & santoso, (2018) that the larger the leaf area, sunlight can be absorbed optimally to increase the rate of photosynthesis. if the rate of photosynthesis is optimal, there will be an increase in photosynthate which is translocated to the vegetative parts of the plant to form new organs. nitrogen functions as a form of chlorophyll which plays an important role in the process of photosynthesis. the higher the nitrogen application (until the optimum limit), the amount of chlorophyll formed will increase (adil, 2006). increasing the amount of chlorophyll causes the rate of photosynthesis to increase so that plant growth is faster and maximum. the results of photosynthesis are used for the growth of plant organs, where the larger plant organs are formed, the more moisture the plant can bind to others (koryati, 2004). figure 3. number of leaves of ground water spinach in the 6th week p0: control (without fertilizer) p1: concentration 4%; p2: concentration 8% p3: concentration 12%; p4: concentration 16% p5: concentration 20% figure 4. leaf area of ground water spinach week 3; p0: control (without fertilizer); p1: concentration 4%; p2: concentration 8% p3: concentration 12%; p4: concentration 16% p5: concentration 20% 60 | pratiwi & nurrohmi; effectiveness of apu-organic liquid fertilizer (pistia stratiotes l.) figure 5. fresh weight of ground water spinach week 6; p0: control (without fertilizer); p1: concentration 4%; p2: concentration 8% p3: concentration 12%; p4: concentration 16% p5: concentration 20% figure 6. dry weight of ground water spinach week 6; p0: control (without fertilizer); p1: concentration 4%; p2: concentration 8% p3: concentration 12%; p4: concentration 16% p5: concentration 20% figure 7. chlorophyll test of ground water spinach: p0: control (without fertilizer); p1: concentration 4%; p2: concentration 8% p3: concentration 12%; p4: concentration 16%; p5: concentration 20% jurnal riset biologi dan aplikasinya, 2(2), 55-63, september 2020 | 61 wet weight is one of the parameters to determine the growth of a plant, namely by measuring the biomass and water produced by the plant. the wet weight of ipomoea reptans poir. which is the highest was produced at a concentration of 20% (figure 5). according to haryoto (2009), the availability of water at the roots of the ipomoea reptans poir plant of 89.7 grams. the water will be used as photosynthetic material and supported by the presence of nutrients from the additional treatment of liquid organic fertilizers so that it can increase biomass. nitrous nutrients play an important role in spurring the development of plant organs such as roots, so that plants are able to absorb more water and nutrients. n and k nutrients support plant height increase because k helps metabolize carbohydrates and accelerates the growth of meristematic tissue (nyakpa et al., 1998). an increase in the absorption of these nutrients will increase the photosynthetic activity and affect the increase in wet weight. dry weight is one of the parameters to determine plant production. ipomoea reptans poir. dry weight results presented in figure 6. figure 6. shows that there is an increase in the dry weight of kale plants with the application of liquid organic fertilizer with apu-apu. the dry weight in each treatment decreased when compared to the results of the wet weight weighing. this occurs because the water content in the plants has been lost due to heating in the drying process, so that what is left is the results of photosynthesis such as accumulation of carbohydrates, proteins, vitamins and other organic materials (rahmah et al., 2014). based on the anova test results (table 2), the concentration of liquid organic fertilizer apu-apu did not have a different effect. this can be due to the low nutrient content in the liquid organic fertilizer so that it has not been able to fulfill the elements n, p, k in the soil so that the accumulation of photosynthate between treatments is not different. plant dry weight is influenced by nutrient content absorbed during the growth process (satria et al., 2015). based on table 3, the humidity of the air during the observation tends to be low, with low humidity in the air it will spur the transpiration rate. thus, the water stored in the tissue will be reduced so that photosynthetic output will also be slower and the results of photosynthesis are also less. chlorophyll content test is a parameter to determine the main productivity of a plant. the main productivity in terms of the rate of production of organic matter (c=carbon) through photosynthetic reactions. the results of the chlorophyll test for ipomoea reptans poir. was presented in figure 8. figure 8 shows that the highest chlorophyll in the control treatment (without fertilizer). this can be due to the lack of nitrogen contained in the planting medium will affect the amount of chlorophyll formed for the photosynthesis process (wenno & sinay, 2019). the highest chlorophyll b was given 8% treatment. according to wenno et al. (2019), leaves that are supplied with nitrogen will form leaves that have wider leaf blades with a higher chlorophyll content. the highest total chlorophyll in control (without fertilizer). the presence of the element nitrogen will increase the green leaf color (chlorophyll). the formation of chlorophyll requires sufficient and balanced amounts of nitrogen, because nitrogen is the main component in the preparation of chlorophyll (alamsjah et al., 2019) the results of anova analysis followed by duncan's test showed that the treatment with a concentration of 8% showed a significant difference in the vegetative growth of land spinach (ipomoea reptans poir.) on the parameters of the number of leaves, leaf area, wet weight and plant height (table 2). table 2. observations on the growth of ipomoea reptans poir. at 6 mst treatment parameter number of leaves (unit) plant height (cm) leaf area (cm2) fresh weight (g) dry weight (g) p0 (0%) 53ab 60.0b 8.6a 44a 9 p1 (4%) 50a 58.4ab 9.0b 52b 9 p2 (8%) 62c 49.4a 9.3c 55c 10 p3 (12%) 58b 50.7a 8.7ab 58c 10 p4 (16%) 56b 112.8c 8.9b 58c 9 p5 (20%) 53ab 63.8b 8.5a 64c 10 note: different superscripts in the same column have significantly different treatment (p <0.05) 62 | pratiwi & nurrohmi; effectiveness of apu-organic liquid fertilizer (pistia stratiotes l.) table 3. observations of environmental factors in ipomoea reptans poir. factors average temperature (°c) 38,7 humidity (%) 46,6 light intensity (lux) 610,9 – 679,6 environmental factors observed in this study included temperature, humidity and light intensity. observation of environmental factors aims to determine the effect of environmental factors on the growth of ipomoea reptans poir., because plants have growing requirements so that they can grow optimally. observations on environmental factors in ipomoea reptans poir. was presented in table 3. the results of temperature observations are not suitable according to (utami & rachmawati, 2016), ipomoea reptans poir. have growing conditions with a temperature range of 28 33°c. the role of temperature on plant growth is very important because high and low temperatures affect enzyme activity (mulyono, 2019). the results of the humidity observation showed that the humidity was lower than the optimal humidity as a condition for growing ipomoea reptans poir. namely 80-90%. according to aulia et al. (2019), water spinach requires a minimum of 20,000 lux of light. plants are better able to grow well in slightly dim light intensity than full light. this condition is favorable for leaf size and stem lengthening of the plant. conclusion it can be concluded that the application of liquid organic fertilizer apu-apu (pistia stratiotes l.) increases the growth of land spinach (ipomoea reptans poir.). the optimum concentration of liquid organic fertilizer apu-apu (pistia stratiotes l.) for the growth of land spinach (ipomoea reptans poir.) is 8% capable of having an effect on the growth of leaf number, leaf area, and wet weight. references adil, w. h. (2006). effect of three different nitrogen fertilizers on several vegetable crops. biodiversitas, journal of biological diversity, 7(1), 77–80. https://doi.org/10.13057/biodiv/d070119. alamsjah, w., tjahjaningsih, w., & pratiwi, a.w. (2019). pengaruh kombinasi pupuk npk dan tsp terhadap pertumbuhan, kadar air dan klorofil a gracilaria verrucosa. jurnal ilmiah perikanan dan kelautan, 1(1), 103. http://dx.doi.org/10.20473/jipk.v1i1.11705. amik, k., & hardini, d. (2014). kajian beberapa dekomposer terhadap kecepatan dekomposisi sampah rumah tangga amik. buana sains, 14(2), 79– 89. ari handriatni, s. (2010). upaya peningkatan produksi tanaman kangkung darat ipomea reptans poir dengan pemangkasan dan pemberian pupuk n di lahan pantai. pena akuatika, 1(1), 1–11. http://dx.doi.org/10.31941/penaakuatika.v1i1.258. aulia, s., ansar, a., & putra, g. m. d. (2019). pengaruh intensitas cahaya lampu dan lama penyinaran terhadap pertumbuhan tanaman kangkung (ipomea reptans poir) pada sistem hidroponik indoor. jurnal ilmiah rekayasa pertanian dan biosistem, 7(1), 43–51. https://doi.org/10.29303/jrpb.v7i1.100 baroroh, f., handayanto, e., irawanto, r., (2018). fitoremediasi air tercemar tembaga (cu) mengguanakan salvinia molesta dan pistia stratiotes serta pengaruhnya terhadap pertumbuhan tanaman brassica rapa phytoremedation of copper (cu) contaminated water using salvinia molesta and pistia stratiotes and its. jurnal tanah dan sumberdaya lahan, 5(1), 2549–9793. https://jtsl.ub.ac.id/index.php/jtsl/article/view/188. djuariah, d. 1997. evaluasi plasma nutfah kangkung di dataran medium rancaekek. jurnal hortikultura 7(3):756-762. edi, s dan a. yusri. 2009. kandungan gizi dan manfaat kangkung. jambi: balai pengkajian teknologi pertanian. utami, b. l., & rachmawati, u. (2016). pengaruh pemberian pupuk organik pada media tanah yang mengandung timbal (pb) terhadap pertumbuhan kangkung darat (ipomoea reptans poir.). jurnal biologi udayana, 20(1), 6–10. https://ojs.unud.ac.id/index.php/bio/article/view/2 4943. hariodamar, h., & santoso, m. (2018). pengaruh pemberian pupuk nitrogen terhadap pertumbuhan dan hasil dua varietas tanaman sawi ( brassica juncea l .) jurnal produksi tanaman, 6(9), 2133–2141. http://protan.studentjournal.ub.ac.id/index.php/prot an/article/view/889. haryoto. 2009. bertanam kangkung raksasa di pekarangan. 1ed. yogyakarta: kanisius. hlm: 12-13. hayati, e., a.h. ahmad, dan c.t. rahman. 2010. respon jagung manis (zea mays, sacharata shout) terhadap penggunaan mulsa dan pupuk organik. agrista, 14(1), 21-24. http://jurnal.unsyiah.ac.id/agrista/article/view/691. indriani, y.h. 2002. membuat kompos secara kilat. cetakan 4. jakarta: penebar swadaya. jumirah, i., jati, a. w. n., & yulianti, l. i. m. (2018). kualitas pupuk cair organik dengan kombinasi limbah ampas jamu dan limbah ikan. biota, 3(2), 53–61. https://doi.org/10.24002/biota.v3i2.1893. koryati, t. (2004). pengaruh penggunaan mulsa dan pemupukan urea terhadap pertumbuhan dan produksi cabai merah (capsicum annum l .). jurnal penelitian bidang ilmu pertanian, 2(april), 13–16. http://repository.usu.ac.id/bitstream/handle/123456 789/15495/kpt-apr2004%20%285%29.pdf?sequence=1&isallowed=y. kusandriyani, y., & luthfy, n. (2016). karakterisasi plasma nutfah kangkung. buletin plasma nutfah, 12(1), 30-33. http://dx.doi.org/10.21082/blpn.v12n1.2006.p30-33. larasati, e. d., euis elih nurlaelih, & sitawati. (2018). tanggap pertumbuhan dan warna daun pucuk merah (syzygium oleana) pada dosis pupuk mgso4 jurnal riset biologi dan aplikasinya, 2(2), 55-63, september 2020 | 63 dan tingkat naungan. jurnal produksi tanaman, 6(9), 2094–2102. http://protan.studentjournal.ub.ac.id/index.php/prot an/article/view/884. lingga, p dan marsono. 2006. petunjuk penggunaan pupuk. jakarta: penebar swadaya. mulyono, d. (2019). pengaruh intensitas naungan dalam aklimatisasi pertumbuhan planlet gaharu (aquilaria beccariana). jurnal sains dan teknologi indonesia, 16(1), 28–33. https://doi.org/10.29122/jsti.v16i1.3404. nyakpa, y. m., a. m. lubis, m. a. pulung, a. g. amrah, a. munawar, g. b. hong, dan n. hakim. 1998. kesuburan tanah. universitas lampung. lampung. noviyanti, s. 2019. agar petani tak ketergantungan pupuk anorganik. http://kilaskementerian.kompas.com. nur, t., noor, a. r., & elma, m. (2016). tangga dengan penambahan biioaktivator em 4 (effective microorganisms). konversi, 5(2), 5–12. http://dx.doi.org/10.20527/k.v5i2.4766. oviyanti, f., & hidayah, n. (2016). pengaruh pemberian pupuk organik cair daun gamal (gliricidia sepium (jacq.) kunth ex walp.) terhadap pertumbuhan tanaman sawi (brassica juncea l.). jurnal biota, 2(1), 61–67. http://jurnal.radenfatah.ac.id/index.php/biota/article /view/531. puspadewi, r., adirestuti, p., & anggraeni, g. (2011). aktivitas metabolit bakteri lactobacillus plantarum dan perannya dalam menjaga kesehatan saluran pencernaan. konferensi nasional sains dasar dan aplikasinya, june 2011, 1–11. rahmah, a., izzati, m., & parman, s. (2014). pengaruh pupuk organik cair berbahan dasar limbah sawi putih (brassica chinensis l.) terhadap pertumbuhan tanaman jagung manis. buletin anatomi dan fisiologi, 22(1), 65-71. https://doi.org/10.14710/baf.v22i1.7810 rijal, m. (2014). p. stratiotes. jurnal biology science & education, 3(2), 94–105. satria, n.; wardati; & khoiri, m. a. (2015). pengaruh pemberian kompos tandan kosong kelapa sawit dan pupuk npk terhadap pertumbuhan bibit tanaman gaharu (aquilaria malaccencis). jom faperta, 2(1), 1– 14. https://jom.unri.ac.id/index.php/jomfaperta/ar ticle/view/7286. sulaeman,y., maswar, erfandi, & deddy. (2016). pengaruh kombinasi pupuk organik dan anorganik terhadap sifat kimia tanah, dan hasil tanaman jagung di lahan kering masam. jurnal pengkajian dan pengembangan teknologi pertanian, 20(1),1–12. http://dx.doi.org/10.21082/jpptp.v20n1.2017.p1-12. wenno, s. j., sinay, h., program, a., pendidikan, s., program, d., & pendidikan, s. (2019). kadar klorofil daun pakcoy (brassica chinensis l.) setelah perlakuan pupuk kandang dan ampas tahu sebagai bahan ajar mata kuliah fisiologi tumbuhan. biopendix, jurnal biologi, pendidikan dan terapan, 3(2), 130–139. https://doi.org/10.30598/biopendixvol5issue2page13 0-139. http://dx.doi.org/10.20527/k.v5i2.4766 jurnal riset biologi dan aplikasinya, volume 2, nomor 1, maret 2020 optimasi waktu induksi dalam mengekspresikan gen proinsulin secara intraseluler menggunakan inang pichia pastoris induction time optimation of intracellular proinsulin gene expression using pichia pastoris as the host efrida martius1,* febraska laoditta2, dewi yustika sofia2, anis herliyati mahsunah1 1balai bioteknologi, badan pengkajian dan penerapan teknologi (bppt) gedung 630, 2universitas surya, abstrak gen proinsulin telah berhasil diinsersi pada galur pichia pastoris x33, gs115 dan km71h pada penelitian sebelumnya, namun masih memerlukan optimasi. penelitian ini dilakukan untuk mengetahui ekspresi galur p. pastoris dan waktu induksi yang optimal dalam mengekspresikan proinsulin. ekspresi proinsulin dilakukan pada suhu 20 °c selama 120 jam untuk pemilihan galur terbaik. variasi lama induksi yang digunakan adalah 0, 24, 48, 72, 96, 120 dan 144 jam untuk mengetahui waktu induksi optimal. kultur kemudian dilisis, dielektroforesis menggunakan tricine sds page dan divisualisasikan dengan pewarnaan perak. berdasarkan ketebalan pita yang terbentuk pada gel elektroforesis, galur x33-x2 menghasilkan proinsulin terbanyak dibandingkan gs115-g11 dan km71h-k4.. ekspresi proinsulin optimal pada 120 jam dan mengalami penurunan proinsulin pada waktu induksi 144 jam akibat akumulasi metanol. galur x33-x2 merupakan inang terbaik dan waktu induksi 120 jam merupakan waktu induksi optimal dalam mengekspresikan proinsulin secara intraseluler. hasil ini diharapkan dapat menjadi referensi dalam mengembangkan produksi insulin di indonesia. abstract the proinsulin gene has been successfully inserted in the pichia pastoris x33, gs115 and km71h strains in former research, but still requires optimization. this research was conducted to determine the expression of p. pastoris strain and optimal induction time in expressing proinsulin. proinsulin expression was carried out at 20°c at 120 hours induction time for strain selection. various induction time, namely 0, 24, 48, 72, 96, 120 and 144 hours were used to determine the optimal induction time. the culture was then lysed, electrophoresed using tricine sds page and visualized with silver staining. the x33-x2 strain produces the most proinsulin compared to gs115-g11 and km71h-k4 based on band thickness on elctrophoresis gel. optimal proinsulin expression at 120 hours and decreased proinsulin at 144 hours induction time due to methanol accumulation. the x33-x2 strain is the best host and the 120 hours induction time is the optimal induction time for expressing proinsulin intracellularly. this result is expected to be used as a reference in developing insulin production in indonesia. how to cite: martius, e., laoditta, f., sofia, d.y., & mahsunah, a.h. (2020). optimasi waktu induksi dalam mengekspresikan gen proinsulin secara intraseluler menggunakan inang pichia pastoris. jurnal riset biologi dan aplikasinya, 2(1), 26-35. *corresponding author: e-issn 2655-9927 jln. kw. puspiptek, muncul, serpong, kota tangerang selatan, banten 15314 e-mail: efrida.martius@bppt.go.id jurnal riset biologi dan aplikasinya https://journal.unesa.ac.id/index.php/risetbiologi article history received : 5 november 2019 approved : 13 februari 2020 published : 31 maret 2020 kata kunci: proinsulin, pichia pastoris, diabetes, ekspresi, intraseluler keywords: proinsulin, pichia pastoris, diabetes, expression, intracellular. jurnal riset biologi dan aplikasinya, 2(1), 26-35, maret 2020 | 27 pendahuluan diabetes melitus merupakan kelainan metabolik akibat kurangnya sekresi insulin, rusaknya fungsi insulin atau keduanya yang ditandai dengan hiperglikemia (kharroubi & darwish, 2015). total penderita diabetes di indonesia mencapai lebih dari 10,2 juta pada tahun 2017 (idf, 2018) dan diprediksi akan meningkat menjadi 21 juta penderita pada tahun 2030. sebanyak 10-15% penderita diabetes membutuhkan insulin dalam menjaga kadar glukosa darah dan mencegah komplikasi, namun ketersediaan insulin di indonesia terbatas (who, 2016). kebutuhan insulin ini mendorong adanya produksi insulin. produksi insulin pada tubuh manusia dimulai dari transkripsi mrna preproinsulin dari nukleus menjadi preproinsulin, kemudian preproinsulin dipotong oleh enzim peptidase menjadi proinsulin (tokarz et al., 2018). proinsulin yang telah terkonformasi menuju badan golgi untuk dipotong dan menghasilkan insulin dan peptida-c (steiner et al., 1972). namun, karena adanya kelainan fungsi/ produksi insulin dalam tubuh, hal ini mendorong adanya produksi insulin dilakukan dengan teknologi dna rekombinan. goeddel et al. (1979) berhasil memproduksi insulin dengan menggabungkan rantai insulin-a dan insulin-b yang diproduksi oleh escherichia coli. produksi insulin dengan teknik lain juga dilakukan oleh moore et al. (1983) yang berhasil mengintroduksi cdna proinsulin pada sel sekresi hormon adenokortikotrofik (acth) untuk produksi proinsulin dan mengetahui mekanisme konversi proinsulin menjadi insulin. penemuan ini memberikan kemudahan bagi industri farmasi dalam meningkatkan purifikasi insulin hasil ekstraksi dari hewan dan produksi insulin manusia (philipson et al., 2015). produksi proinsulin dapat menggunakan berbagai inang, salah satunya adalah ragi pichia pastoris yang mampu memproduksi protein heterologous tanpa hiperglikosilasi (grinna & tschopp, 1988). selain itu, p. pastoris juga mampu memproduksi lebih dari 15 gram protein rekombinan dari 1 liter kultur secara intraseluler (hasslacher et al., 1997) sehingga dapat digunakan untuk produksi skala besar. pichia pastoris dikembangkan untuk menghasilkan protein rekombinan dengan sistem ekspresi yang menggunakan promotor kuat aox1 (cregg et al., 1985). promotor ini ditekan dengan keberadaan glukosa, gliserol dan etanol (inan & meagher, 2001). akan tetapi, akan dilepaskan saat diinduksi metanol (cregg et al., 1985). keberadaan metanol mengaktivasi faktor transkripsi methanol expression regulator 1 (mxr1) yang berada di sitoplasma untuk masuk ke dalam nukleus dan berikatan dengan promotor aox1 sehingga gen protein rekombinan dan gen aox ditranskripsi (zhan et al., 2017). enzim aox mengoksidasi metanol menjadi formaldehida dan hidrogen peroksida. formaldehida yang dihasilkan kemudian dioksidasi menjadi format dan karbon dioksida oleh dehidrogenase di sitoplasma sebagai sumber energi bagi sel untuk tumbuh (cereghino & cregg, 2000). berdasarkan kemampuannya dalam memetabolisme metanol, p. pastoris dibedakan menjadi tiga jenis (macauley-patrick et al., 2005). mut+ merupakan fenotipe yang dapat tumbuh dalam metanol dengan laju perkembangan wild-type dan membutuhkan asupan metanol yang tinggi dalam fermentasi skala besar (aoki et al., 2003). muts merupakan fenotipe yang lambat dalam memetabolisme metanol karena memiliki gen aox1 yang terganggu, sehingga bergantung pada promotor aox2 yang lebih lemah dalam memetabolisme metanol (cregg et al., 1987). muttidak mampu tumbuh dalam metanol karena tidak memiliki kedua promotor (cregg et al., 1987). penelitian oleh krainer et al. (2012) menyatakan bahwa fenotipe muts lebih baik dalam mengekspresikan protein rekombinan berupa horseradish peroksidase c1a dibandingkan fenotipe mut+ dalam produktivitas dan efisiensi ekspresi. secara umum, fenotipe mut+ memiliki pertumbuhan yang cepat sedangkan fenotipe muts memiliki produktivitas yang lebih tinggi (chirovulu et al., 1997). pichia pastoris mampu mengekspresikan protein rekombinan secara intraseluler dan ekstraseluler (invitrogen, 2010). menurut yin et al. (2012), yield protein intraseluler lebih banyak dibandingkan ekstraseluler. ekspresi proinsulin intraseluler berhasil dilakukan triyadi (2018) menggunakan p. pastoris galur x-33, gs115 dan km71h. galur p. pastoris yang menghasilkan proinsulin paling banyak adalah gs115 pada lama induksi 72 jam dan suhu 25°c menggunakan konsentrasi akhir metanol 0,5% (v/v). menurut cos et al. (2006) suhu rendah mampu meningkatkan produktivitas protein rekombinan sehingga menghasilkan protein rekombinan lebih banyak dibandingkan suhu tinggi. oleh sebab itu, tujuan penelitian ini adalah untuk mengetahui galur p. pastoris yang mampu mengekpsresi proinsulin secara intraseluler paling banyak pada suhu 20 °c dan menentukan waktu induksi optimalnya. 28 | martius et al; optimasi waktu induksi dalam mengekspresikan gen proinsulin bahan dan metode alat yang digunakan dalam penelitian ini antara lain; autoklaf, cawan petri (90 x 15 mm), tips mikropipet, eppendorf 1,5 dan 2 ml, mikropipet 2-20 µl, mikropipet 20-200 µl, mikropipet 100-1000 µl, tabung falkon, spatula, wadah timbang, neraca analitik, laminar uv, jarum ose, pipet ukur 25 ml, erlenmeyer 100 ml, pengaduk magnetik, hotplate, inkubator orbital, inkubator, inkubator goyang, spektrofotomer uv, kuvet spektrofotometer, botol schott 250 ml dan 500 ml, high speed refrigerated microcentrifuge, gelas ukur 100 ml, vortex, perangkat sds-page, power sds-page, ultrapure water system, membran filter 0,2 µm, pemindai, ph meter, lemari pendingin, lemari pembeku, tabung reaksi, plastic wrap, suntikan syringe dan 0,5 mm glass beads. bahan yang digunakan dalam penelitian ini, antara lain: ekstrak ragi (himedia), pepton teknis, d-glukosa (merck), agar bakteri (oxoid), asam klorida (hcl), dh2o, zeocin (invitrogen), gliserol (calbiochem), amonium sulfat (jt. baker), yeast nitrogen tanpa asam amino dan amonium sulfat (jt. baker), biotin (sigma), metanol (merck), l-histidin (bio basic canada inc.), alkohol 70%, kalium dihidrogen fosfat (kh2po4) (jt. baker), dikalium fosfat (k2hpo4) (emsure), kasa, tali, kapas, aluminium foil (total wrap), tris (applichem), tricine buffer (bio basic canada, inc.), sds (bio basic inc.), coomasie brilliant blue-r250 (merck), akrilamida (merck), bis-akrilamida (promega, usa), dithiothreitol (dtt) (promega, kanada), amonium persulfat (promega, usa), fenilmetanasulfonil fluorida (pmsf) (mp. biomedicals, llc., paris), asam etilenadiaminatetraasetat (edta) (applichem), sodium dihidrogen fosfat (nah2po4) (merck), disodium hidrogen fosfat (na2hpo4) (merck), drow, air miliq, tetrametietilendiamin (temed) (merck), amonium hidrogen karbonat ((nh4)2co3) (merck), etanol absolut (merck), asam asetat glasial (merck), natrium trisulfat (na2s2o3) (jt. baker), perak nitrat (agno3) (agu cicca reagent), kalium karbonat (k2co3) (jt. baker), formalin 37%, β-mercaptoetanol (mp. biomedicals), coomasie protein assay reagent 950 ml (thermo scientific). komposisi media yang digunakan digunakan adalah yeast extract peptone dextrose medium (ypd) + agar zeocin = 1% ekstrak ragi (m/v), 2% pepton (m/v), 2% d-glukosa (m/v), 2% agar (m/v), 100ug/ml zeocin. buffered glycerol-complex medium (bmgy) = 1% ekstrak ragi (m/v), 2% pepton (m/v), 100 mm kalium fosfat, ph 6,0 (v/v), 1, 34% ynb (v/v), 4 x 10-5% biotin (v/v). bmm(h) (buffered minimal) = 100 mm kalium fosfat, ph 6,0 (v/v), 1,34% ynb (v/v), 4 x 10-5% biotin (v/v), 0,5% metanol (v/v), 100 x h (v/v). komposisi larutan yang digunakan dalam fermentasi yaitu gliserol 30% = 15 ml gliserol 100% dalam 50 ml air. 1 m kalium fosfat ph 6,0 = 9,5 gram kh2po4 dan 5,25 gram k2hpo4 dalam 100 ml air, ph diatur dengan penambahan hcl. ynb 13,4% = 3,4 gram ynb tanpa amonium sulfat dan asam amino, dan 10 gram amonium sulfat dalam 100 ml air, filter steril. 0,02% biotin (500x b) = 20 mg biotin dalam 100ml air, filter steril. 100x h = 400 mg l-histidin dalam 100 ml air, filter steril buffer yang digunakan untuk lisis sel dan elektroforesis tricine sds-page adalah breaking buffer = 50 mm sodium fosfat, ph 7,4, 1 mm pmsf, 1 mm edta, 5% gliserol. 2x tricine sample buffer = 150 mm tris-hcl, ph 7,0, 30% gliserol, 12% sds, 0,05% coomasie brilliant blue r-250, 6% β-mercaptoetanol. bufer katoda 1 x = 0,1 m tris, 0,1 m trisin, 0,1% sds. bufer anoda 10 x = 0,2 m tris, hcl hingga ph 8,9. bufer gel 3x = 3 m tris, 0,3% sds, hcl hingga ph 8,45 larutan yang diperlukan dalam elektroforesis tricine sds-page sebagai berikut: larutan ab-3 = 48 gram akrilamid dan 1,5 gram bis-akrilamid dalam 100 ml air miliq. larutan ab-6 = 46,5 gram akrilamid dan 3 gram bis-akrilamid dalam 100 ml air miliq. larutan gliserol 50% = 30 ml gliserol 85% dalam 50 ml air miliq. larutan aps 10% = 0,1 gram amonium persulfat dalam 2 ml air miliq. larutan fiksasi = 0,78 gram amonium asetat ditambah 50 ml metanol, 10 ml asam asetat dan 40 ml air miliq. larutan staining = 0,05 gram coomasie brilliant blue r250 ditambah 20 ml asam asetat glasial dan 180 ml air miliq. larutan destaining = 20 ml asam asetat glasial ditambah 180 ml air miliq. larutan tris-hcl 0,5 m ph 7,0 = 6,057 gram tris ditambah 80 ml air dan diatur ph dengan hcl. larutan sodium fosfat 50 mm, ph 7,4 = 0,24 gram sodium fosfat (monobasic) dalam 40 ml air miliq, diatur ph dengan naoh larutan yang dibutuhkan dalam pewarnaan perak sebagai berikut: larutan amonium hidrogen karbonat = 0,2 gram amonium hidrogen karbonat dalam 25 ml metanol dan 25 ml air miliq. larutan fiksasi 30% etanol, 10% asam asetat = 15 ml etanol absolut ditambah 5 ml asam asetat dan 30 ml air miliq. larutan bilas 30% etanol = 15 ml etanol absolut dalam 35 ml air miliq. larutan sensitasi 0,8 mm na2s2o3 = 0,0064 gram na2s2o3 dalam 50 ml air miliq. larutan 12 mm agno3 = 0,1 gram jurnal riset biologi dan aplikasinya, 2(1), 26-35, maret 2020 | 29 agno3 dalam 50 ml air miliq. larutan developer 0,01% k2co3, 10% na2s2o3, formalin = 1,5 gram k2co3 6,25 μl na2s2o3, 14 μl formalin 37% dalam 50 ml air miliq. larutan stop 4% tris, 2% hac = 2 gram tris, 1 ml asam asetat glasial dalam 49 ml air miliq. tahapan pertama dilakukan fermentasi galur p. pastoris berupa x33 koloni 2 (x33-x2), gs115 koloni 11 (gs115-g11) dan km71h koloni 4 (km71h-k4) yang berasal dari stok kultur bppt diregenerasi dengan menggoreskan pada media padat yeast extract peptone dextrose (ypd) yang mengandung antibiotik zeocin dan diinkubasi selama 48 jam. koloni tunggal dikultivasi dalam media kultivasi buffered glycerol-complex (bmgy) dan diinkubasi dengan suhu 30 °c dan kecepatan 250 rpm selama 16-18 jam. setelah itu, biomassa p. pastoris diukur dengan spektrofotometer pada absorbansi 600 nm hingga mencapai nilai 2-6. kultur dipindahkan ke dalam tabung falkon steril dan disentrifugasi dengan kecepatan 6.000 g selama 5 menit pada suhu 4 °c, supernatan dibuang dan pelet dipindahkan ke media ekspresi buffered minimal (bmm(h). setelah itu, kultur ditambahkan metanol hingga mencapai konsentrasi akhir 0,5% (v/v) dalam media setiap 24 jam pada suhu 20 °c. setelah 120 jam, kultur disentrifugasi dengan kecepatan 12.000g selama 5 menit pada suhu 4 °c, supernatan dibuang dan pelet disimpan. pelet ditambahkan breaking buffer dengan perbandingan 1:1 (berat pelet: volume breaking buffer) dan diresuspensi. setelah itu, ditambahkan glass beads dengan perbandingan 1:1 (berat pelet : berat glass beads) dan divorteks dengan 12.000 g selama 30 detik. lalu, diinkubasi selama 30 detik dalam es dan dilakukan 8x pengulangan. hasil resuspensi kemudian disentrifugasi dengan kecepatan 12.000 g selama 10 menit dan supernatan dipisahkan. supernatan ditambahkan dengan 2x tricine sample buffer dengan perbandingan 1:3 dan diinkubasi dalam waterbath dengan suhu 37 °c selama 15 menit. setelah itu, sampel dimasukkan ke dalam sumur gel sds-page dan elektroforesis dijalankan dengan tegangan 30 volt selama 1 jam, selanjutnya dengan tegangan 90 volt hingga mencapai batas akhir. setelah itu, gel diinkubasi dalam larutan fiksasi selama 1 jam, dalam larutan staining selama 1 jam, dan destaining hingga gel menjadi bening. gel yang telah diwarnai dibilas terlebih dahulu dengan air miliq selama 5 menit dan dilakukan 2 kali pengulangan. kemudian direndam dalam larutan 50 mm amonium hidrogen karbonat selama 45 menit dan dibilas dengan air miliq selama 2 x 5 menit. setelah itu, gel direndam dalam larutan fiksasi selama 30 menit, diinkubasi dengan larutan 30% (v/v) etanol selama 2 x 10 menit dan dibilas dengan air miliq selama 2 x 10 menit. selanjutnya, gel diinkubasi dalam 0,8 mm selama 1 menit dan dibilas kembali dengan air miliq selama 2 x 1 menit. gel kemudian diinkubasi dengan larutan 12 mm agno3 selama 20 menit dan dibilas dengan air miliq selama 10 detik. setelah itu, gel diinkubasi dalam larutan developer dengan penambahan formalin hingga kontras warna yang diinginkan. kemudian gel dibilas dengan air miliq selama 10 detik. pewarnaan gel dihentikan dengan perendaman dalam larutan stop selama 30 menit dan dibilas dengan air miliq selama 2 x 30 menit. nilai rf digunakan untuk menghitung bobot molekul dengan membandingkan kurva linear antara nilai rf terhadap log bobot molekul. perhitungan nilai rf adalah sebagai berikut. setelah nilai rf diplot dengan log berat molekul marka protein dan didapatkan persamaan, nilai rf pita target dihitung berdasarkan persamaan tersebut sehingga mendapatkan nilai log berat molekul protein target. antilog nilai tersebut merupakan berat molekul protein target. hasil scan dari gel sds-page dengan format .jpeg dikuantifikasi menggunakan program imagej 1.51j8 dengan memotong gambar yang melingkupi daerah pita yang diinginkan dengan fitur rectangular selection kemudian mengklik crop. area yang diseleksi dianalisis dengan mengklik analyze dan diulangi hingga seluruh pita dianalisis sehingga akan muncul beberapa plot secara bersusun. pada masing-masing plot terdapat garis yang menggambarkan peak sehingga ditarik garis antara pangkal awal dan pangkal ujung menggunakan straight line. setelah itu, area dalam peak dihitung menggunakan wand (tracing) tool dan kotak result akan muncul menggambarkan luas area pita yang diseleksi. hasil dan pembahasan hasil visualisasi insulin standar menunjukkan adanya 2 pita, seperti pada gambar 1. pada penelitian ini, insulin standar yang digunakan merupakan produk komersial humulin eli lilly. insulin manusia dengan rumus empiris c257h383n62o77s6 memiliki bobot molekul 5808 da (lilly, 2018). pita yang lebih tipis di atas insulin 30 | martius et al; optimasi waktu induksi dalam mengekspresikan gen proinsulin standar merupakan proinsulin standar karena mengandung jumlah yang lebih sedikit dibandingkan insulin standar. regulasi fda memperbolehkan insulin komersial untuk mengandung kurang dari 10 ppm proinsulin dan residu lain yang berkaitan dengan insulin (bohannon, 1983). menurut binder et al. (1996), insulin manusia komersial telah bebas dari kontaminan residu, namun dapat mengandung <1 ppm atau 1 mg/l proinsulin. oleh karena itu, pita yang terbentuk di atas insulin standar merupakan proinsulin standar. penggunaan pewarnaan perak yang dapat mendeteksi protein dalam jumlah nanogram juga dapat memvisualisasikan proinsulin dengan kadar rendah. # gambar 1. visualisasi protein target. m= marka protein 10-180 kda, is= standar insulin, 1= galur x33-x2, pt = proinsulin target. hasil fermentasi p. pastoris x33-x2 pada suhu ekspresi 20 °c, metanol 0,5% setiap 24 jam sekali selama 120 jam. pita pt terdapat di antara pita marka protein 10 kda dan insulin standar 5808 da. hasil perhitungan bm proinsulin standar (ps), insulin standar (is) dan proinsulin target (pt) ditunjukkan pada tabel 1. nilai rf pita pt dimasukkan dalam persamaan dan bm yang dihasilkan adalah 6761 da. pita pt berada di antara ps dan is. is memiliki bm 5808 da secara teoretis, akan tetapi hasil dengan perbandingan nilai rf adalah 6165 da. perbedaan perhitungan ini dapat terjadi karena pita is dan pita target berada di luar marka 10-70 kda. perhitungan bm menjadi akurat apabila sampel protein berada pada jarak linear dari kurva standar. kesalahan perhitungan sebesar ± 10% dapat diterima (matsumoto et al., 2018). tabel 1. bobot molekul proinsulin dan insulin standar (ps dan is) serta protein target (pt) hasil fermentasi p. pastoris x22-x3 berdasarkan nilai rf r2 = 0.989. ps= proinsulin standar, is= insulin standar, pt= proinsulin target. nilai rf terhadap bobot molekul ps, is dan pt pada gel gambar 4.3. dan memiliki kesalahan perhitungan ≤10%. ketidaksamaan bm pita pt dan ps dapat terjadi akibat variasi antar protein, seperti struktur protein, perbedaan hasil pascatranslasi dan komposisi asam amino yang mempengaruhi migrasi elektroforesis (zahid et al., 2014). selain itu, jenis produksi ps juga tidak diketahui, seperti ekspresi ekstraseluler atau intraseluler dan bagaimana urutan sekuen yang digunakan. protein ekstraseluler memiliki komposisi yang lebih kompleks daripada intraseluler untuk menghalangi proses pelipatan protein karena protein yang disekresi harus dalam bentuk belum dilipat. polipeptida hidrofobik dan bermuatan kecil pada protein ekstraseluler memudahkan protein untuk transpor keluar membran (nakashima & nishikawa, 1994). komposisi yang lebih kompleks dapat menyebabkan protein yang dihasilkan secara ekstraseluler memiliki bm lebih tinggi dibandingkan intraseluler. urutan sekuen yang tidak mengikuti gurramkonda et al. (2010) mempengaruhi asam amino yang dihasilkan sehingga bm yang dihasilkan tidak sama. pemilihan galur p. pastoris dilakukan pada suhu 20 °c dengan induksi metanol 0,5% (v/v) setiap 24 jam sekali dengan waktu induksi 120 jam. pada suhu 20 °c, pita paling bawah dapat dihasilkan oleh seluruh inang pichia pastoris x33-x2, gs115-g11, dan km71h-k4. visualisasi proinsulin hasil ekspresi p. pastoris x33-x2, gs115-g11 dan km71h-k4 dapat dilihat pada gambar 2. pita yang terbentuk memiliki ketebalan yang berbeda-beda antara satu dengan yang lain. akan tetapi, setelah dicermati, x33-x2 menghasilkan pita dengan ketebalan yang serupa pada tiga perlakuan, dibandingkan pada gs115-g11 dan km711h-k4 yang memiliki ketebalan yang tidak sama pada tiga ps is pt nilai rf 0,76 0,80 0,77 bm (da) 7079 6165 6761 p si jurnal riset biologi dan aplikasinya, 2(1), 26-35, maret 2020 | 31 perlakuan. hasil yang konstan ini menandakan bahwa kemampuan ekspresi x33-x2 konsisten, sedangkan kemampuan ekspresi gs115-g11 dan km71h-k4 berbeda-beda. pita yang terbentuk juga tidak memiliki letak yang sejajar, hal ini dapat terjadi akibat adanya “doublet” yang mengindikasikan adanya polipeptida dengan asam amino yang sama namun memiliki residu berlebih atau berbeda posisi, seperti isoform (caprette, 2005). modifikasi pasca translasi akibat fosforilasi atau glikosilasi mampu menambahkan komposisi asam amino sehingga dapat menambah bm protein target sehingga letak yang dihasilkan lebih tinggi daripada bm teoritis. gambar 2.visualisasi hasil eskpresi proinsulin p. pastoris x33-x2, gs115-g11 dan km71h-k4 secara intraseluler pada suhu 20 °c. ekspresi proinsulin dilakukan dalam media bmm(h) pada suhu 20 °c dengan induksi metanol 0,5% setiap 24 jam selama 120 jam. seluruh inang menghasilkan pita proinsulin target. x33-x2 menghasilkan ketebalan pita yang konstan dengan 3 pengulangan. pita yang dihasilkan tidak sejajar akibat konsentrasi proinsulin atau adanya modifikasi pasca translasi sehingga bobot molekul berbeda nilai rf marka kemudian dibandingkan dengan log bm marka dan menghasilkan persamaan y = 1,709x + 2,288 dengan r2 = 0,987 dan hasil perhitungan bm terdapat pada tabel 2. nilai rf pita marka dihitung menggunakan batas bawah pita karena pita pt tidak terbentuk sempurna (menjadi sebuah pita) melainkan menempel dengan protein lain di atasnya. pita paling bawah yang dihasilkan p. pastoris x33-x2, gs115-g11 dan km71h-k4 berada di antara pita ps dan is, sehingga menandakan bahwa pita tersebut merupakan pita pt yang dihasilkan secara intraseluler. akan tetapi, perhitungan nilai rf pita paling bawah masingmasing galur menghasilkan bm yang berbeda. tabel 2. bobot molekul pt hasil eskpresi seluruh inang p. pastoris pada suhu 20 °c berdasarkan nilai rf sampel/kolom nilai rf bm (da) ps 0,82 7762 is 0,9 5623 x33-x2/1 0,85 6760 x33-x2/2 0,86 6606 x33-x2/3 0,86 6606 gs115-g11/1 0,85 6760 gs115-g11/2 0,84 7079 gs115-g11/3 0,84 7079 km71h-k4/1 0,84 7079 km71h-k4/2 0,83 7413 km71h-k4/3 0,85 6918 r2 = 0,987. nilai rf terhadap bm proinsulin standar (ps), insulin standar (is) dan proinsulin target (pt) pada gel gambar 3. pt seluruh galur berada di antara ps dan is. proinsulin target x33-x2 pengulangan 1-3 dan gs115-g11 pengulangan 1 memiliki kesalahan perhitungan ≤10%, sedangkan proinsulin target lainnya memiliki kesalahan perhitungan >10%. perbedaan bm dapat disebabkan adanya “doublet” berupa isoform proinsulin. ketebalan pita yang dianalisis menggunakan imagej menghasilkan data luas area, ditunjukkan pada tabel 3. x33-x2 memiliki rata-rata luas area yang paling tinggi dibandingkan gs115-g11 dan km71h-k4. ketebalan pita proinsulin x33-x2 terlihat konsisten dibandingkan gs115-g11 dan km71h-k4. oleh sebab itu, x33-x2 merupakan inang yang paling baik dalam menghasilkan proinsulin pada suhu ekspresi 20 °c. optimasi waktu induksi dilakukan menggunakan inang p. pastoris x33-x2 sebagai inang terpilih pada suhu ekspresi 20 °c dalam menghasilkan proinsulin. ekspresi proinsulin dilihat berdasarkan pita paling bawah (pt) yang tervisualisasi pada gel, seperti pada gambar 3. ekspresi proinsulin tidak terlihat pada 0 jam hingga 96 jam, namun terlihat ada penambahan variasi protein dan jumlah protein yang dihasilkan. konsentrasi protein total yang digunakan saat elektroforesis telah disamakan, oleh sebab itu adanya pita yang lebih tebal dapat disebabkan variasi protein yang terekspresi seperti isoform atau protein dengan bm yang hampir sama. 32 | martius et al; optimasi waktu induksi dalam mengekspresikan gen proinsulin tabel 3. rata-rata luas area pemilihan inang menggunakan imagej galur/kolom luas area rata-rata luas area x33-x2/1 2171.945 3643.844 x33-x2/2 5237.011 x33-x2/3 3522.576 gs115-g11/1 4934.153 2914.187 gs115-g11/2 2973.271 gs115-g11/3 835.137 km71h-k4/1 1726.17 2808.039 km71h-k4/2 1103.158 km71h-k4/3 5594.789 gambar 3. optimasi lama induksi dari p. pastoris x33-x2 pada suhu ekspresi 20 °c. keterangan gambar (kiri-kanan) m; marker, 0 jam, 24 jam, 48 jam, 72 jam, 96 jam, 120 jam, 144 jam, ni= x33-x2 non induksi, is= insulin standar. ps= proinsulin standar, pt= proinsulin target. ekspresi dilakukan menggunakan media bmm dengan induksi metanol 0,5% setiap 24 jam selama 120 jam. ekspresi proinsulin mulai terlihat pada lama induksi 120 jam dan 144 jam seperti ditunjukkan pada tanda panah ke atas. tabel 4. bobot molekul proinsulin target hasil eskpresi inang p. pastoris x33-x2 pada suhu 20 °c lama induksi 120 jam dan 144 jam berdasarkan nilai rf ps is pt nilai rf 0.72 0.80 0.77 bm (da) 7585 5754 6456 r2 = 0,962. nilai rf terhadap bm proinsulin standar (ps), insulin standar (is) dan proinsulin target (pt). pt berada di antara ps dan is. kesalahan perhitungan ≤10% dari bm teoritis menandakan hasil dapat diterima. ekspresi proinsulin mulai terlihat pada lama induksi 120 jam dan 144 jam. pita pt pada 120 jam dan 144 jam terbentuk sempurna (tidak menempel pada protein lain) dan ketebalan pita pt terlihat seragam. oleh sebab itu, ketebalan pita diukur berdasarkan luas area yang dihitung menggunakan software imagej. pita yang terpisah memudahkan dalam melihat ketebalan pita dengan software imagej dalam melihat peak pita. keberadaan pita dianalisis dengan memasukkan nilai rf pada persamaan y = -1,413x +1,900 dengan r2 = 0,962, hasil perbandingan nilai rf dengan log bm marka protein. setelah itu, bm pita yang merupakan pt ditunjukkan pada tabel 4. pita paling bawah dari hasil ekspresi p. pastoris x33-x2 pada lama induksi 120 jam dan 144 jam (6456 da) berada di antara ps dan is. hal ini menandakan bahwa pita tersebut merupakan pita pt. selain itu, kesalahan perhitungan ≤10% dari bm teoretis juga menandakan bahwa hasil ini dapat diterima. dalam menentukan lama induksi optimal, ketebalan pita dianalisis menggunakan software imagej berdasarkan luas area dari pita target seperti pada tabel 5. pita pt dengan lama induksi 120 jam memiliki luas area yang lebih tinggi dibandingkan 144 jam. proinsulin mulai terekspresi pada lama induksi 120 jam dan menghasilkan pita yang paling tebal sehingga merupakan lama induksi yang optimal pada suhu 20°c. fermentasi dengan inang p. pastoris fenotipe muts pada umumnya untuk jurnal riset biologi dan aplikasinya, 2(1), 26-35, maret 2020 | 33 mencapai konsentrasi protein rekombinan tinggi membutuhkan waktu yang lama, 150-200 jam (vassileva et al., 2001). muts memiliki tingkat konsumsi metanol dan pertumbuhan yang rendah sehingga membutuhkan waktu induksi yang panjang (zhang et al., 2003). tabel 5. hasil perhitungan luas area yang terbentuk pada 120 jam dan 144 jam berdasarkan imagej pita luas area 120 jam 3617.530 144 jam 3178.045 keberadaan gliserol pada medium bmgy menekan promotor aox1 untuk tidak mentranskripsi gen proinsulin. sisa gliserol dalam sel saat dipindahkan ke medium ekspresi bmm membuat promotor aox1 tertekan, namun seiring berjalannya waktu, ketidakberadaan gliserol dalam medium membuat sel harus beradaptasi dengan metanol (chauhan et al., 1999). muts memetabolisme metanol dengan lambat karena memiliki gen aox1 yang terganggu, sehingga bergantung pada promotor aox2 yang lebih lemah dalam memetabolisme metanol (cregg et al., 1987). ekspresi proinsulin menjadi rendah saat 144 jam dapat disebabkan akumulasi metanol yang masih tersisa sehingga menjadi toksik pada sel dan mendegradasi proinsulin yang ada. metanol dioksidasi menjadi formaldehida dan metanol peroksida oleh enzim aox (cereghino & cregg, 2000). hidrogen peroksida menghasilkan stress oksidatif pada sel dan dapat memicu degradasi protein rekombinan (hilt & wolf, 1992). simpulan inang p. pastoris x33-x2 merupakan inang yang mampu menghasilkan proinsulin secara intraseluler paling banyak dibandingkan gs115g11 dan km71h-k4 pada suhu 20°c. ekspresi proinsulin optimal pada waktu induksi 120 jam. waktu induksi yang panjang akibat aktivitas metabolik inang rendah sehingga kemampuan dalam memetabolisme metanol dan produksi protein rekombinan rendah. ucapan terima kasih terima kasih kepada balai bioteknologi bppt karena telah menyediakan tempat dan topik penelitian. kepada bapak danang, ibu uli, kakak titin atas dukungan moral dan penyedia informasi berkaitan pengerjaan penelitian. walbert christian sebagai partner kerja laboratorium. daftar pustaka aoki, h., watabe, s., & ahsan, n. (2003). heterologous expression in pichia pastoris and single-step purification of a cysteine proteinase from northern shrimp. protein expression and purification, 31(2), 213-221. doi: 10.1016/s1046-5928(03)00196-7 bohannon, n. j. v. (1983). newer forms of insulin. the western journal of medicine, 139(1), 115116. diakses dari https://www.ncbi.nlm.nih.gov/pmc/articles/p mc1010916/. cereghino, j. l., & cregg, j. m. (2000). heterologous protein expression in the methylotrophic yeast pichia pastoris. fems microbiology reviews, 24(1), 45-66. doi: https://doi.org/10.1111/j.15746976.2000.tb00532.x. chauhan, a. k., arora, d., & khanna, n. (1999). a novel feeding strategy for enhanced protein production by fed-batch fermentation in recombinant pichia pastoris. process biochemistry, 34(2), 139-145. diakses dari http://agris.fao.org/agrissearch/search.do?recordid=us201302911699. cos, o., ramon, r., montesinos, j.l.,& valero f. (2006). operational strategies, monitoring and control of heterologous protein production in the methylotrophic yeast pichia pastoris under different promoters: a review. microbial cell factories, 5(17), 1-20. doi: 10.1186/1475-28595-17 cregg, j. m., barringer, k. j., hessler, a. y., & madden, k. r. (1985). pichia pastoris as a host system for transformations. molecular and celluler biology, 5(12), 3376-3385. doi: 10.1128/mcb.5.12.3376. cregg, j. m., tschopp, j. f., stillman, c., siegel, r., akong, m., craig, w. s., buckholz, r. g., madden, k. r., kellaris, p. a., & davis, g. r. (1987). high-level expression and efficient assembly of hepatitis-b surface-antigen in the methylotrophic yeast, pichia pastoris. nature biotechnology, 5, 479–485. diakses dari https://www.nature.com/articles/nbt0587479. chiruvolu, v., cregg, j. m., meagher, m. m. 1997. recombinant protein production in an alcohol oxidase-defective strain of pichia pastoris in fed-batch fermentations. enzyme and microbiology technology, 21(4), 277–283. doi: https://doi.org/10.1016/s01410229(97)00042-2. goeddel, d. v., kleid, d. g., bolivar, f., heyneker, h. l., yansura, d. g., crea, r., hirose, t., kraszewski, a., itakura, k., & riggs, a. d. (1979). expression in escherichia coli of chemically synthesized genes for human insulin. proceedings of the national academy of https://www.nature.com/articles/nbt0587-479 https://www.nature.com/articles/nbt0587-479 https://doi.org/10.1016/s0141-0229(97)00042-2 https://doi.org/10.1016/s0141-0229(97)00042-2 34 | martius et al; optimasi waktu induksi dalam mengekspresikan gen proinsulin science, 76(1), 106-110. doi: 10.1073/pnas.76.1.106 grinna, l. s., & tschopp, j. f. (1989). size distribution and general structural features of n-linked oligosaccharides from the methylotropic yeast pichia pastoris. yeast, 5(2), 107-115. doi: 10.1002/yea.320050206. gurramkonda, c., polez, s., skoko, n., adnan, a., gäbel, t., chugh, d., & rinas, u. (2010). application of simple fed-batch technique to high-level secretory production of insulin precursor using pichia pastoris with subsequent purification and conversion to human insulin. microbial cell factories, 9(31), 111. doi: 10.1186/1475-2859-9-31. hasslacher, m., schall, m., hayn, m., bona, r., rumbold, k., lückl, j., griengl, h., kohlwein, s. d., & schwab, h. (1997). high-level intracellular expression of hydroxynitrile lyase from the tropical rubber tree hevea brasiliensis in microbial hosts. protein expression purification,11(1), 61–71. doi: 10.1006/prep.1997.0765. hilt., w., & wolf, d. h. (1992). stress induced proteolysis in yeast. molecular microbiology, 6 (17), 2437-2442. doi:https://doi.org/10.1111/j.13652958.1992.tb01419.x. international diabetes federation (idf). (2018). idf western pasific members. diakses pada 23 november 2018. https://www.idf.org. inan, m., & meagher, m. m. (2001). non-repressing carbon sources for alcohol oxidase (aox1) promoter of pichia pastoris. journal of bioscience and bioengginering. 92(6), 585-589. doi: 10.1016/s1389-1723(01)80321-2 invitrogen. (2010). easyselecttm pichia expression kit: for expression of recombinant proteins using ppicz and ppiczα in pichia pastoris. thermo scientific. kharroubi, a. t., & darwish, h. m. (2015). diabetes mellitus: the epidemic of the century. world journal diabetes, 6(6), 850-867. doi: 10.4239/wjd.v6.i6.850. krainer, f. w., dietzsch, c., hajek, t., herwig, c., spadiut, o., & glieder, a. (2012). recombinant protein expression in pichia pastoris strains with an engineered methanol utilization pathway. microbiology cell factories, 11(22), 114. doi: 10.1186/1475-2859-11-22. lilly, e. (2018). humulin. eli lilly and company: indianapolis. matsumoto, h., hanlu, h., & komori, n. (2018). determination of protein molecular weights on sds-page. electrophoretic separation of proteins, 1855, 101-105. diakses dari https://link.springer.com/protocol/10.1007/9 78-1-4939-8793-1_10. macauley-patrick, s., fazenda, m. l., mcneil, b., & harvey, l. m. (2005). heterologous protein production using the pichia pastoris expression system. yeast, 22(4), 249–270. doi: 10.1002/yea.1208 moore, h. h., walker, m. d., lee, f., kelly, r. b. 1983. expressing a human proinsulin cdna in a mouse acth-secreting cell. intracellular storage, proteolytic processing, and secretion on stimulation. cell, 35(2), 531-538. doi: 10.1016/0092-8674(83)90187-3. nakashima, h., & nishikawa, k. (1994). discrimination of intracellular and extracellular proteins using amino acid composition and residue-pair frequencies. journal molecular biology, 238(1), 54-61. diakses dari https://www.jsbi.org/pdfs/journal1/giw94/ poster/giw94p18.pdf. philipson, l. h., bell, g., & polonsky, k. s. (2015). donald f. steiner md, 1930-2014: discoverer of proinsulin. restropective,. 112(4), 940-941. doi: https://doi.org/10.1073/pnas.1423774112. steiner, d. f., peterson, j. d., tager, h., emdin, s., ostberg, & y. falkmer, s. 1973. comparative aspects of proinsulin and insulin structure and biosynthesis. integrative and comparative biology, 13(3), 591-604. doi: https://doi.org/10.1093/icb/13.3.591. tokarz, v. l., macdonald, p. e., klip, a. 2018. the cell biology of systemic insulin function. journal of cell biology, 217(7), 2273-2289. doi: 10.1083/jcb.201802095. martius, e., triyadi, a., yustika d., & mahsunah, a. h. (2019). pengaruh variasi konsentrasi metanol dan lama induksi terhadap ekspresi proinsulin oleh pichia pastoris secara intraseluler. jurnal bioteknologi dan biosains indonesia 6(1): 93-105. doi: http://dx.doi.org/10.29122/jbbi.v6i1.3176 vassileva, a., chugh, d. a., swaminathan, s., & khanna, n. (2001). effect of copy number on the expression levels of hepatitis b surface antigen in the methylotrophic yeast pichia pastoris. protein expression and purification, 21(1), 71-80. doi: 10.1006/prep.2000.1335. world health organization (who). (2016). global report on diabetes. who: geneva. yin, h., liu, z., zhang, a., zhang, t., luo, j., shen, j., chen, l., zhou, b., fu, x., fu, c., & zhang, z. (2012). intracellular expression and purification of the canstatin-n protein in pichia pastoris. gene, 504(1): 122-126. doi: 10.1016/j.gene.2012.04.073. zahid, a., jamil, w., & begum, r. (2014). method development and validation of sds-page for quality control testing of pegylated interferon alpha-2a. iosr journal of pharmacy https://www.idf.org/ https://doi.org/10.1073/pnas.1423774112 http://dx.doi.org/10.29122/jbbi.v6i1.3176 jurnal riset biologi dan aplikasinya, 2(1), 26-35, maret 2020 | 35 and biological sciences, 9(6), 32-36. doi: 10.9790/3008-09643236. zhan, c., yang, y., zhang, z., li, x., liu, x., & bai, z. (2017). transcription factor mxr1 promotes the expression of aox1 by repressing glycerol transporter 1 in pichia pastoris. fems yeast res, 17(4), 1-10. doi: 10.1093/femsyr/fox015. zhang w. h., potter k. j. h., plantz b. a., schlegel v. l., smith l. a., & meagher m. m. (2003). pichia pastoris fermentation with mixed-feeds of glycerol and methanol: growth kinetics and production improvement. journal of industrial microbiology and biotechnology, 30(4), 210-215. doi: 10.1007/s10295-003-0035-3.