404 not found not found the requested url /index.php/lmrj/article/download/459/10.38106/lmrj.2019.1.1-03 was not found on this server. 404 not found not found the requested url /index.php/lmrj/article/download/464/10.38106/lmrj.2019.1.1-06 was not found on this server. lmrj volume 2 issue 2 26 | p a g e bilateral axillary accessory breasts with multiple fibroadenomas agrawal a, mathew j division of breast surgery, university of nottingham, uk correspondence agrawal a division of breast surgery university of nottingham, united kingdom ng5 5pb lmrj.2020:2(2) doi: 10.3810/lmrj.2020.2.2.01 received: 2 jan 2020 revised:14 feb 2020 accepted for publication 19 feb 2020 introduction: developmental anomalies of the breasts are rare presenting complaints. they occur along the milk line of the mammary gland development, which extends from axilla to groin. these anomalies include accessory breasts (polymastia), absent breasts (amastia) and accessory nipples (polythelia). the development of accessory breasts is seen in 26 % of normal population [1], the incidence in females being twice as higher as compared to males. the most common site of accessory breasts is in the axilla, where they are seen in about 70% of cases [2], comprising 23.2% of all axillary lumps, but they can occur at ectopic sites anywhere in the body. we report a clinical case of multiple fibroadenomas in bilateral axillary accessory breast tissues. case report a 41 years old woman was referred to our breast unit with a lump in the right axilla for 4 weeks. the lump was painless without any history of discharge. there was no association with menstrual cycle and there was no known family history of breast cancer. she had two children. on examination, she had bilateral accessory breasts with a 1 cm nodule in the right axillary accessory breast tissue. ultrasound of both axillae confirmed accessory breasts on both sides and showed a 10 mm lump consistent with a lymph node in the right axilla. an ultrasound guided core biopsy was taken. histopathology of the core biopsy, however, revealed it be a fibroadenoma. as per patient’s wishes, bilateral accessory breast tissues were excised along with the aforementioned nodule in the right side. histopathological examination of the tissues confirmed bilateral accessory breast tissues with multiple fibroadenomas. discussion: the breast development begins at about 6 weeks of intrauterine life as mammary ridge bilaterally on the ventral surface of embryo extending from axilla to groin and by the end of 6 months has multiple duct systems. this ridge then starts to regress and at birth a single fully developed duct system remains which is capable of lactation in both sexes. the accessory breast and nipple develop as a result of incomplete regression of the mammary ridge. accessory breasts contain normal breast parenchyma; hence they too can be the site of spectrum of diseases which affect normal breasts, including fibroadenoma and carcinoma. the incidence of the research article lmrj volume 2 issue 2 27 | p a g e diseases in the accessory breasts is quite low resulting in delay in the diagnosis. the most common site of accessory breasts is the axilla (about 6070% of cases [4]), and they are usually bilateral. they can present anywhere from axilla to the groin. in females the mammary ridge extends to the vulva bilaterally, therefore accessory breast tissue can be found in the external genitalia. these accessory breast tissues become evident during pregnancy and lactation and also show some cyclical changes under the influence of the sex hormones. majority of the cases of the accessory breasts are asymptomatic and may be found incidentally on the imaging done for some other reason. histopathological examination is mostly required to confirm the diagnosis. in the axilla, accessory breast tissue can be found separately from the axillary tail, and this confirms its independent entity. the incidence of fibroadenoma in the accessory breast is extremely low and as reported by alghamdi et al, it is only 1.51% [2]. to date only few cases of fibroadenomas in the ectopic breast have been reported. most of the reported cases of fibroadenoma in the accessory breast are in the axilla although a case of fibroadenoma in accessory breast in pubic area has been reported [5] . in another case ectopic breast tissue in the perianal region was found to contain a fibroadenoma [6] . literature also comments on the presence of ectopic breast tissue on the face, neck, back, thigh and perianal region[7]. therefore, any of these sites can be a possible presentation site for fibroadenoma or even carcinoma of the accessory or ectopic breast tissue. due to the low incidence of these cases and thus low suspicion rate, majority of these cases are mistakenly diagnosed as lymphadenopathy and lipomas or even sebaceous cysts. fibroadenoma in the axillary accessory tissue is often misdiagnosed as lymph node even on ultrasound as in our case. the only reliable and confirmatory method of diagnosis is the histopathology. both the accessory breasts and the fibroadenomas do not usually require any treatment but on the wish of the patients these may be excised so as to reduce the anxiety of the patients due to apprehension of development of cancer; and also for cosmetic reasons and symptomatic accessory tissues. alghamdi et al reported the reasons for excision of the accessory breasts as cosmetic, pain and discomfort, cyclical mastalgia, fear of malignancy and lactational abscess[2]. however, cosmetic disfigurement remains the reason in majority of cases. the literature available is controversial regarding the association of congenital breast anomalies with the renal and cardiac malformations. previously in some studies [8] it has been suggested that the breast anomalies might be a marker of the underlying anomalies of the urogenital system and cardiac system. therefore, thorough examination of these systems is recommended in patients presenting with accessory nipples and breast, but other studies [8] on the subject did not show any association. in the case of our patient there was no clinical history, symptoms or signs attributable to any of these systems so the patient was discharged from further follow-up. references 1. coras b, et al., fibroadenoma of the axilla. american society for dermatologic surgery, 2005. 31: p. 1152-1154. lmrj volume 2 issue 2 28 | p a g e 2. alghamdi h and abdelhadi m, accessory breasts: when to excise? the breast journal, 2005. 11(2): p. 155157. 3. ciralik h, et al., fibroadenoma of the ectopic breast of the axilla-a case report. polish journal of pathology, 2006. 57(4): p. 209-211. 4. loukas, et al. (2007) accessory breasts: a historical and current perspective. 5. lilaia c, et al., ectopic breast fibroadenoma. the internet journal of gynecology and obstetrics, 2007. 6(2). 6. siam ga, et al., fibroadenoma of ectopic breast tissue in the perianal region. the breast journal, 2001. 11: p. 202-207. 7. rho, j., s. juhng, and k. yoon, carcinoma originating from aberrant breast tissue of the right upper anterior chest wall: a case report. journal of korean medical science, 2001. 16: p. 516-521. 8. rosen pp, rosen's breast pathology. 2 ed. vol. 1: lippincott williams & wilkins. lmrj volume 2 issue 1 9 | p a g e prevalence of positive montoux test in the province of sindh dr. abid hussain chang1 dr. faheem ahmed memon1 1department of pathology, liaquat university of medical & health sciences, jamshoro, pakistan correspondence: dr. faheem ahmed memon lmrj.2020:2(1) doi:10.3810/lmrj.2020.2.1.02 received: 10 jan 2020 revised: 4 feb 2020 accepted for publication 8 feb 2020 abstract tuberculosis is a global health emergency. at present this disease has a prevalence of >1% in pakistan. this study was designed to evaluate the prevalence of positive montoux tests in the province of sindh. it is a cross-sectional study carried out at various branches of diagnostic and research laboratory lumhs from january 2017 to september 2017. mantoux test was done by injecting a regular dose of 5 tuberculin units (0.1ml) into the skin intra-dermally. the results were read between 48-72 hours after the dose and the indurated area was measured in millimeters. a total of 3121 patients including 1614 males and 1507 females were included. mean age of study population was 14.6 years (range 195 years). out of 3121 patients 316 (10.1%) were positive, including 185 females and 131 male patients. citywise distribution showed that 223 were from hyderabad and jamshoro, 62 from mithi 14 from sukkur and 4 from other cities. keywords: tuberculosis, prevalence, montoux test. introduction tuberculosis is a global health emergency. pakistan is reported to be at 8th position in having highest burden of tuberculosis in the world. at present this disease has a prevalence of >1%. according to the united nation’s specialized agency, reported incidence of tuberculosis in pakistan as 23 out of every 100,000 individual in the year 20011. tuberculosis has posed severe threats to the human health even in this modern era of technological and medical excellence and has become a gigantic experiment to diagnose and manage. this incidence is even more predominant in less developed areas of the country. the reason might be the lack of awareness and less advanced facilities in these areas. malnutrition due to poverty and ignorance with repeated infections make children more susceptible for tuberculosis by weakening their immunity. this infection rate can be controlled by early and research article lmrj volume 2 issue 1 10 | p a g e proper diagnosis with prompt treatment. for correct diagnosis, key helping factors are histopathological detection of granulomatous lesions, identification of bacilli and chest x-ray along with clinical findings2. one of the main and established screening method for tb is tuberculin skin also known as mantoux test. it is cost effective and easy to perform and interpret. it detects the delayed type hypersensitivity reaction against the purified peptide derivative. however, there linger some uncertainties regarding the sensitivity, specificity and the outcome of previous bcg vaccine on cut-off dimension of positive mantoux interpretation3. this study was aimed to found out the prevalence of mantoux test positivity in sindh. material and methods it is a descriptive, one time observational study carried out at various branches of diagnostic and research laboratory lumhs in sindh from january 2017 to september 2017. mantoux test is done by injecting a regular dose of 5 tuberculin units (0.1ml) into the skin intradermally. results basic statistical tools were used for the analysis of data. a total of 3121 patients advised by physician’s clinically on the basis of symptoms of pulmonary tuberculosis like fever, productive cough and weight loss were included. mean age of the study population was 14.6 years (range 1 to 95 years). there was a little male dominance in the study sample with 1614 (51.7%) males and 1507 (48.3%) female patients in the study sample. out of total 3121 patients 2805 (89.9%) were negative and 316 (10.1%) were positive. from 316 positive patients 185 were females and 131 male patients and most belonged to hyderabad and jamshoro (n= 223), mithi (n=62), sukkur (n=14), mirpurkhas (n=4) and remaining from small cities including kandiaro (n=6), tando adam (n=4), kandhkot (n=2) and tando allahyar (n=1). figure 1: skin appearances after 72 hours of a positive test achieved. figure 2: male to female ratio in positive mt patients lmrj volume 2 issue 1 11 | p a g e discussion in this study frequency of positive mt was observed among sindh natives. in our results the mean age was found 14.6 years ranging from one to 95 years old and the proportion of positive mt population is female i.e. 185 females vs. 131 males, jamil b. et al showed similar findings. the mean age of their study population was 24 years ranging from one to 84 years and their diseased population had more females as compared to males4. according to national curriculum of tuberculosis for mbbs students of pakistan, sixty thousand people died due to tb in 20095. there has been no survey done in sindh to identify the true prevalence of this gruesome disease, this study gives a rough idea how grim the situation is in the second most populated province of pakistan. conclusion scientific research on the mt has revealed that a diagnosis of active case of tuberculosis is never made exclusively on the results of this test so it was stated that mt has minimum part in the diagnosis of active tuberculosis. references 1. ali, n. s., jamal, k., & khuwaja, a. k. (2010). family physicians understanding about mantoux test: a survey from a high endemic tb country. asia pacific family medicine, 9(1), 8. 2. khan, h. r., sohail, m. i., haider, m. f., & afzal, m. (2016). comparison of diagnostic bcg and mantoux tests in detection of tuberculosis in children. annals of pims issn, 1815, 2287. 3. loh, k. y. (2011). role of mantoux test in the diagnosis of tuberculosis. malaysian family physician: the official journal of the academy of family physicians of malaysia, 6(2-3), 85. 4. jamil, b., qamruddin, s., sarwari, a. r., & hasan, r. (2008). an assessment of mantoux test in the diagnosis of tuberculosis in a bcg-vaccinated, tuberculosis-endemic area. tuberculosis, 24, 17. 5. national tb control program “module for m.b.b.s students” on community based tb care (dots). type of the paper (article lmrj volume 4 issue 03 88 | p a g e editorial pandemonium of diseases after floods – an emerging major health issue in pakistan ikram din ujjan liaquat university of medical & health sciences, jamshoro, pakistan abstract floods and heavy rain bring another disaster of diseases and pose a huge burden on the health care system. pakistan is currently facing a major natural disaster of this decade, where sindh and baluchistan are badly affected. millions of people are homeless and live in camps, shelter homes, or tent cities. the diseases that emerge immediately after floods include gastroenteritis with diarrhoea and vomiting, followed by vector-borne diseases (i.e. malaria and dengue fever) influenced by the growth of mosquitoes in the stagnant water. due to unhygienic conditions and overcrowded camps, skin diseases emerge later. altogether this situation causes major burden on the already weakened health care system, which is devastated due to rain and even destroyed in some places. thus proper planning and preventive measures need to be taken on an urgent basis. key words: floods, water-borne diseases, vector-borne diseases introduction monsoon rain has badly affected more than 66 districts of pakistan, leaving sindh and baluchistan devastated. thousands of households were under water, and millions of people were displaced to other areas, temporary shelter homes and tent cities. many shelter homes are nearby the towns under water. the people living in crowds surrounded by water has drastically affected their health. several diseases are emerging from these areas and also from the camps where flood affectees are living. these diseases can be broadly categorized as water-borne, vector-borne, and skin diseases. water-borne diseases water-borne diseases emerge immediately after rain and floods(1). due to floods, it is virtually impossible for local people to manage clean drinking water. thus gastroenteritis arises as a significant health issue. watery diarrhoea and vomiting in young children and the elderly can be lethal, raising the death toll. there are reports from pakistan and other developing countries like bangladesh where such disasters occur quite often. there was a report from bangladesh where in 2004 immediately after floods, over 17000 acute diarrhoea cases were reported in a single centre (2). a similar situation was previously reported in pakistan during floods in 2010 and 2011, where a considerably higher proportion of flood-affected children had multiple co-infections (22%) as compared to non-flood-affected children (6%)(3). thus co-infection and then resistant pathogens lead to a significant problem which persists even after the flood victims return home and the situation normalizes. then there is an additional risk of other water-borne diseases, such as typhoid, correspondence: prof. ikram din ujjan department of pathology, liaquat university of medical & health sciences, jamshoro, pakistan email: ikramujjan@lumhs.edu.pk doi: 10.38106/lmrj.2022.4.3-01 received: 21.09.2022 accepted: 26. 09.2022 published: 30. 09.2022 mailto:ikramujjan@lumhs.edu.pk mailto:ikramujjan@lumhs.edu.pk lmrj volume 4 issue 03 89 | p a g e worm infestation, and hepatitis a, which will be coming in the way, thus causing health emergency and posing a great burden on the health care system. given the risk of polio in pakistan, the water condition and damaged sanitation bring a threat of increasing polio cases in very young children. this kind of catastrophe needs proper planning in emergency situation. vector-borne diseases vectors are common in pakistan such as mosquitoes and flies. the flood-affected areas have stagnant water in the vast land of sindh and baluchistan, providing the conductive environment for mosquitoes to grow exponentially. malaria and dengue fever are prevalent in pakistan even before floods. still, such a high level of growth of mosquitoes spreads malaria and dengue not only in the flood-affected areas but also in the neighbouring towns and cities. the literature shows that the average rain fall rate is directly proportional to the number of dengue cases(4). malaria and dengue in such situations can be lethal. flies, on the other hand, spread dirty material, facilitating disease by fecal oral route. thus a great deal on the health care system is imminent. skin problems after such natural disasters, people are destined to live in camps with dirty, stagnant water and in unhygienic conditions. due to these conditions skin diseases develop, and contiguous skin infections spread quickly, affecting children and adults equally. both bacterial and fungal infections occur during these situations. a report from taiwan analyzed 280 flood situations in 10 years' time, where skin and eye problems were reported to have emerged in a subacute phase after the decline of gastroenteritis(5). thus, it can be suspected that the storm of the patients with skin diseases is on its way to hit the healthcare system in sindh and baluchistan. conclusion considering all these situations, there is a dire need for preventive strategies, restoration of the damaged/ destroyed health care system and public awareness of the emerging health catastrophe. given the disruption of the polio campaign, it is essential that the facility may be provided within camps so that the outbreak in younger children may be controlled. medical camps are being arranged by philanthropists, government and non-government organizations but the camp for a short period may not control the outbreak of the diseases if they emerge. the establishment of small camp dispensaries with the availability of medicines round the clock and providing public awareness for the maintenance of hygiene may serve the purpose. references 1. baqir m, sobani za, bhamani a, bham ns, abid s, farook j, et al. infectious diseases in the aftermath of monsoon flooding in pakistan. asian pac j trop biomed [internet]. 2012 jan;2(1):76–9. available from: http://linkinghub.elsevier.com/retrieve/pii/s2221169111601949 2. qadri f, khan ai, faruque asg, begum ya, chowdhury f, nair gb, et al. enterotoxigenic escherichia coli and vibrio cholerae diarrhea, bangladesh, 2004. emerg infect dis [internet]. 2005 jul;11(7):1104–7. available from: http://wwwnc.cdc.gov/eid/article/11/7/04-1266_article.htm 3. bokhari h, shah ma, asad s, akhtar s, akram m, wren bw. escherichia coli pathotypes in pakistan from consecutive floods in 2010 and 2011. am j trop med hyg [internet]. 2013 mar 6;88(3):519–25. available from: https://ajtmh.org/doi/10.4269/ajtmh.12-0365 4. junaid tahir m, rizwan siddiqi a, ullah i, ahmed a, dujaili j, saqlain m. devastating urban flooding and dengue outbreak during the covid-19 pandemic in pakistan. med j islam repub iran [internet]. 2020 oct 30; available from: http://mjiri.iums.ac.ir/article-1-7110-en.html lmrj volume 4 issue 03 90 | p a g e 5. huang l-y, wang y-c, wu c-c, chen y-c, huang y-l. risk of flood-related diseases of eyes, skin and gastrointestinal tract in taiwan: a retrospective cohort study. shaman j, editor. plos one [internet]. 2016 may 12;11(5):e0155166. available from: https://dx.plos.org/10.1371/journal.pone.0155166 lmrj volume 1 issue 1 2 | p a g e clinico-hematological features in pure red cell aplasia patients diagnosed at diagnostic & research laboratory, hyderabad faheem ahmed memon diagnostic and research laboratory lumhs jamshoro / hyderabad received: 17 dec 2018 revised: 30 january 2019 accepted for publication: 14 march 2019 correspondence: dr. faheem ahmed memon diagnostic and research laboratory liaquat university of medical & health sciences, civil hospital hyderabad. email: drfamemon@hotmail.com this article may be sighted as: memon fa. clinico-hematological features in pure red cell aplasia patients diagnosed at diagnostic & research laboratory, hyderabad. lmrj. 2019; 1(1): 2-4. doi: 10.38106/lmrj.2019.1.1-01. pure red-cell aplasia (prca) or erythroblastopenia is a rare type of anemia or disorder that can be either idiopathic or associated with certain autoimmune diseases and affect red blood cell (rbc) precursors1,2. the disease is often present at birth, and it manifests in the first year of life in more than 90% of patients. it is a syndrome characterized by normochromic, normocytic anemia, reticulocytopenia (<1%), and an almost complete absence of erythroblasts (<0.5%) from the bone marrow3. prca is categorized into congenital and acquired classes4. studies elucidating the characteristics of prca in pakistani population are very limited5. the current study was aimed to identify the clinical and hematological features in local prca patients. this cross-sectional study was carried out at diagnostic & research laboratory lumhs hyderabad from october 2014 to december 2016. five patients from diagnostic & research laboratory lumhs hyderabad referred for bone marrow biopsy were selected. after taking detailed history and physical examination, clinical and hematological findings were recorded on a pre-designed proforma. bone marrow aspiration was done on all patients and trephine biopsies were taken where indicated6. blood samples were taken and complete blood count (cbc) was performed on xn 1000 five parts fully automated haematology analyzer (sysmex®, japan). peripheral blood films were stained with leishman stain and brilliant cresyl blue. these films were screened generally and the reticulocyte count was performed manually. patients with normochromic normocytic anemia, low reticulocyte count and isolated erythroblastopenia in the bone marrow were selected6. whereas those with other types of anemia and patients with abnormal myelopoiesis and/or thrombopoiesis were excluded. in the almost two years study duration, only two male and three female children, 9 months to 7 years in age, were diagnosed to have prca. main clinical findings recorded among these patients were fever, weakness, weight loss and pallor. abdominal distension was seen in one while hepatomegaly was seen in second patient. four patients received their first blood transfusion in the first four months after birth, while one patient, received the first transfusion at one year age. reticulocyte count was 0.6% and 1% in 2 patients while among the other three patients it was undetectable (figure 1). myeloid-to-erythroid (m/e) ratio in the bone marrow was found to range from 15:1 to 25:1. leucopoiesis and megakaryopoiesis were found to be normal in all the cases. a local study by muneeza natiq et al showed mean age of 4.12 years while in our study it was 3.8 years4. a study by ball et al from london7 shows male to female ratio of 1.4:1 while in our study it was 3:2. in a study from india by malhotra et al, pallor was found in all the patients; this is consistent with findings from the current study6. the mean hemoglobin concentration was 4.75 g/dl by el–beshlawy et al from egypt while in the present study it was 7.24 g/dl8. white blood cells count, platelets count and red cell indices were within normal limits in our study which was comparable to studies conducted by muneeza natiq et al and el–beshlawy et al4,8. the m/e ratio showed a much wider range (18:1 to 100:1) in the patients studied by malhotra et al6. the study was limited by the small sample size. we recommend more extensive studies conducted on larger number of patients from local population, in order to understand the clinico-hematological picture of the disease more accurately in local scenario. this study concluded that prca is a rare haematological disorder, commonly found in children. fever, weakness and anemia are the common presenting features, whereas decreased rbc count, low hemoglobin concentration, low reticulocyte count and suppressed erythropoiesis on bone marrow examination are the main laboratory feature. letter to editor mailto:drfamemon@hotmail.com lmrj volume 1 issue 1 3 | p a g e figure 1. key haematological parameters in the study patients. arabic numerals on x-axis represent the five patients. y-axis represent the test variable; the unit of measurement is provided in parenthesis alongside corre sponding chart title. rbc, red blood cell *erythrocyte precursors’ percentage could not be elicited in patient number 5. acknowledgment: all lab staff of diagnostic & research lab lumhs hyderabad. lmrj volume 1 issue 1 4 | p a g e conflict of interest i hereby declare that we do not have any conflict of interest related to publication of this article. grant support/ financial disclosures diagnostic & research lab hyderabad. references 1. fallahi s, akbarian m, dabiri s. pure red cell aplasia as a presenting feature in systemic lupus erythematosus and association with thymoma, hypothyroidism and hypoparathyroidism: a case report and literature review. iran j allergy asthma immunol april 2014;13(2):138-143. 2. yildirim r, bilen y, keles m, uyanik a, gokbulut p, aydinli b. treatment of pure red-cell aplasia with cyclosporine in a renal transplant patient. experimental and clinical transplantation volume 11 number 1 february 2013. 3. ozdena fo, gunduzb k, ozdenc b, iscid kd, fisgine t. oral and dental manifestations of diamondblackfan anemia: case reports. eur j dent 2011;5: 344-348. 4. natiq m, ahmad n, rashid j. frequency and clinico-hematological features of pure red cell aplasia in children. pak j med health sci apr jun 2010;4(2):82-8. 5. shuaib a, omer m, naeemullah s, latir z. pure red cell aplasia: a single centre experience. pak j pathol jan mar 2005;16(1):10-3. 6. malhotra p, muralikrishna gk, varma n, kumari s, das r, ahluwalia j, jain s, varma s. spectrum of pure red cell aplasia in adult population of north-west india. hematology. 2008 apr;13(2):88-91. 7. ball se, mcguckin cp, jenkins g, gordon – smith ec.diamond blackfan anemia in the united kingdom – analysis of 80 cases from a 20 year birth cohort. br j haematol 1996; 94: 645–653. 8. el–beshlawy a, ibrahim iy, rizk s, eid k. study of 22 egyptians patients with diamond blackfan anemia, corticosteroid and cyclosporin therapy results. pediatrics 2002; 110: 44. lmrj volume 2 issue 1 22 | p a g e a rare case of anterior abdominal wall abscess due to transmigrated fish bone from transverse colon qazi, almas1; calcuttawala2, murtaza; qazi, ikhlas3; khan, asad4 1newham university hospital nhs trust, bart’s health nhs trust, 2newham university hospital, 3st george’s university of london (king’s college london), newham university hospital, united kingdom corresponding authors: almas qazi and ikhlas qazi newham university hospital nhs trust, bart’s health nhs trust, dralmasqazi@gmail.com; ikhlasqazi1@hotmail.com lmrj.2020:2(1) doi: 10.3810/lmrj.2020.2.1.05 title of case transmigration of fish bone to the anterior abdominal wall after perforating transverse colon is a rare and unique condition in particular resulting in anterior abdominal wall abscess. introduction this report presents a case of a 42 years old caucasian male, presented to the accident and emergency department with upper abdominal pain and sepsis for three weeks. computed tomography showed a sealed perforation of the transverse colon with 10x5 cm abscess adjacent to the colonic bowel containing a fish bone. this was a delayed presentation which required emergency laparotomy due to abscess formation. therefore, we reviewed the literature and summarized our unique case presentation. background presentation of ingested foreign bodies causing gastrointestinal tract perforation in general population is not common, however can occur relatively more frequently in adults in cases of preexisting internal hernia or meckel’s diverticulum. according to the available literature more than 75% of swallowed foreign bodies get impacted at the cricopharyngeal sphincter of the esophagus, and those successfully pass this sphincter and reach the stomach 90% of them successfully pass through the intestine, with only few remaining can cause impaction and potentially resulting in severe complications [1]. there was a case reported of a patient with advanced gastric cancer with oesophageal stenosis, where a 13cm-long artificial oesophageal stent which passed through whole gastrointestinal tract without causing any perforation or impaction[2]. therefore a case of a small fish bone causing bowel perforation is probably a rare occurrence in an otherwise healthy individual. those patients having existing small bowel disease are at higher risk of perforation or if the impaction is at a site of acute angulation such as the areas of junction of the parts of the tract including ileocecal and rectosigmoid areas [3-5]. thus the presented case appears to be rare. case report mailto:dralmasqazi@gmail.com mailto:ikhlasqazi1@hotmail.com lmrj volume 2 issue 1 23 | p a g e case presentation a 42-year-old lithuanian, caucasian male presented to our accident and emergency department with a three-week history of upper abdominal pain. his symptoms got worst during the last week. the patient was otherwise fit and well and denied any significant past medical history or abdominal procedures. he remembered losing his lower denture one month back and was concerned. on examination, he was flushed and in moderate pain. his temperature was 38.1°c and his heart rate was 103 beats per minute. his blood pressure was 138/98 mmhg, his oxygen saturation was 95% on room air. his abdomen was generally soft but there was a palpable lump in the area above and to the left of the umbilicus. investigations his laboratory tests showed a white blood cell count of 14.6x109 and his c-reactive protein was 213 mg/l. his abdominal x-ray was unremarkable. a computed tomography of the abdomen was performed. a large, 9x6 cm, hypo dense lesion was noticed arising from the anterior abdominal wall just cranial to the umbilicus was seen. significant inflammatory changes in the surrounding tissues and a linear foreign body were noticed within this lesion (figure 1). these features were suggestive of an abdominal wall abscess which was extending deeper into the peritoneal cavity. it was in close contact with the transverse colon, but there was no evidence of perforation or fistula formation (figure 2). treatment the patient was admitted and consented for an open drainage and an exploratory laparotomy. the operating findings were as follows; a 10x5 cm abscess cavity was seen just below the anterior abdominal wall containing a long fish bone which was removed. the transverse colon was inspected and there were nosigns of perforation or fistula formation. the abscess was drained, and the peritoneal cavity was washed with saline. the abdominal wall was closed with a loop pds1 en masse closure. a redivac drain, size 10fr, was placed in the abscess cavity. the skin was stapled. co-amoxiclav (1.2g/8 hourly) and metronidazole (500mg/8 hourly) were given intravenously for five days. follow-up and outcome he made an uneventful recovery. his drain was removed on second post-operative day and the patients was discharged back home on day five. the patient was followed up in clinic for a period of six months. the wound healed without any complications. discussion in the accident and emergency department presentation of the ingested foreign body is not infrequent clinical presentation though more commonly seen in children, but it rarely presents with perforation of the gi wall [1], traversing through fat and then causing abscess in the anterior abdominal wall is even rarer. commonly the foreign bodies get impacted at the narrow parts of the bowel or the angulations [2, 3]. there are some reports in the literature suggesting perforations through weakened walls such as the areas with meckel’s diverticulum [4]. perforation of the colon seen at the recto-sigmoid, however other than the recto-sigmoid junction are so infrequent, that only a limited number of cases have been reported till date [3,5]. furthermore the presence of the abscess is extremely rare. the abdominal abscess in the presented case was located in front of the transverse colon. perforation of the small intestine could be a possibility; due to the reason that foreign body, perforation lmrj volume 2 issue 1 24 | p a g e of the large intestine tends to present with longer clinical duration as compared to the perforation in the jejunum or ileum [3]. in this case, we speculated perforation of the large intestine as the most likely site and the fish bone could have perforated the transverse colon due to movements of the colon (both propulsive and churning). the other reason for considering this possibility was the shape of the fish bone, it sharp and thin enough that the perforation site spontaneously without causing any major trouble to the gut wall. the abscess in this case was later developed as foreign body reaction of the body which took some time to develop, allowing the patient to remain asymptomatic without any significant clinical deterioration for one month. learning points/take home messages 1. elective drainage under imaging (ultrasound/ct) along with the use of antibiotics could be an option for cases. 2. following the standard management protocol our patient underwent drainage without any bowel resection. 3. patient has rapid uneventful recovery. patient’s perspective i thought initially that it was a lost denture but was relieved after surgery and came for follow up till 6 months and everything thankfully got better. figure 1: sagittal view showing fish bone and site of abscess. figure 2: coronal view showing site of anterior abdominal wall abscess. references 1. mapelli p, head lh, conner we, ferrante we, ray je. perforation of colon by ingested chicken bone diagnosed by colonoscope. gastrointest endosc 1980;26(1):20–21. lmrj volume 2 issue 1 25 | p a g e 2. kornprat p, langner c, mohadjer d, mischinger h. chicken-bone perforation of a sigmoid colon diverticulum into the right groin and subsequent phlegmonous inflammation of the abdominal wall. wien klin wochenschr 2009;121(5–6):220–222. 3. goh bk, chow pk, quah hm, ong hs, eu kw, ooi ll et al. perforation of the gastrointestinal tract secondary to ingestion of foreign bodies. world j surg 2006;30(3):372– 377. 4. mouawad nj, hammond s, kaoutzanis c. perforation of meckel's diverticulum by an intact fish bone. bmj case rep 2013. 5. mouchet a, jagailloux s, martin pa. case of pericolic phlegmon simulating tumor by fishbone with perforation of the transverse colon. arch mal appar dig mal nutr 1952;41(2):222–225. 6. brandão d, canedo a, maia m, ferreira j, vaz g. duodenocaval fistula as a result of a fish bone perforation. j vasc surg 2010;51(5):1276–1278. 7. ward ma, tews mc. small bowel perforation secondary to fish bone ingestion managed nonoperatively. j emerg med 2012;43(5):e295–298. 8. ng ct, htoo a, tan sy. fish bone-induced hepatic abscess: medical treatment. singapore med j 2011;52(3):e56–58. 9. kuo cc, jen tk, wen ch, liu cp, hsiao hs, liu yc et al. medical treatment for a fish bone induced ileal micro-perforation: a case report. world j gastroenterol 2012;18(41):5994–59. lmrj volume 2 issue 3 50 | p a g e comparison of platelet count in malaria positive and negative subjects with hematology analyzer and microscopic examination sajid jamil, azam ali1, muhammad farooq2 1department of biochemistry, rahbar medical and dental college, lahore, pakistan, 2emergency laboratory, sims/shl, lahore, pakistan correspondence sajid jamil department of biochemistry, rahbar medical and dental college, lahore, pakistan lmrj. 2020;2(3) doi: 10.38106/lmrj. 2020.2.3-01. abstract this study included 250 blood samples submitted for malaria investigation and were evaluated under microscope for malarial parasites and platelet count. all samples were additionally analyzed for platelet count with automated haematology analyzer. thirty seven (37) samples were found to be malaria positive microscopically. out of 37 cases with malaria positive microscopically, thrombocytopenia was observed in 24 (64%) cases of malaria. so there is association of thrombocytopenia with malaria. key words: malaria, thrombocytopenia, p. falciparum introduction over 300 to 500 million people are infected by malaria yearly1 with the mortality rate of 1%2. it is epidemic and endemic in africa, central and south america, the middle east and parts of asia; regions with hot, humid environment which is ideal for breading of anopheles mosquito and is transmitted by bite of infected female anopheles mosquito. it is also transmitted by blood transfusion, trans-placentally and between drug addicts by reusing syringes3. four species of plasmodia i.e. p. vivax, p.ovale, p. falciparum and p. malariae can cause malaria which is distinguishable on peripheral blood smear4. plasmodium sporozoites are injected by the bite of female mosquito, reach liver, multiply there and released after 1-2 weeks to infect red cells. severe cases of malaria are seen in falciparum infection. the severity of malaria may be determined by the magnitude of parasitaemia. the malaria is usually presented with febrile paroxysms, malaise and anemia2. the main hematological findings in patient’s blood are anemia, thrombocytopenia, variable (low, normal, high) white cell (wbc) count, bleeding and parasitaemia2,5. malaria is still common in oasis and costal areas of the saudi arabia. expatriate work force also imports malaria from their home countries especially endemic areas of malaria6. this study aimed to evaluate malaria and platelet count to assess correlation. methodology two hundred and fifty (n=250) adult subjects suspected of malaria were selected from riyadh medical research article lmrj volume 2 issue 3 51 | p a g e complex. thirty seven (37) were found positive for malarial infection microscopically by thick and thin smears. platelet counts were performed manually7 as well as with automated hematology analyzer (cell dyn 3700). all slides were stained by giemsa method8. identification and level of parasitemia was done for each positive case9. results in this study two types of plasmodium species, p. falciparum and p. vivax were found on thick and thin smear. there were 34(92%) cases of falciparum and 3(8%) cases of vivax. the comparison of positive and negative cases is given in table 1. five (20.1%) patients had platelet count less than 50×109/l, eleven (45.1%) had thrombocytopenia in the range of 50100×109/l and eight (34.8%) had thrombocytopenia in the range of 100 – 150 x 109/l. out of these five patients, three had parasitemia in the range of 3-10%. maximum parasitemia was found to be 10% while 0.1% was the lowest. there were 8 (21.6%) patients who have parasitemia of 1% or above. these patients had platelet count of 60×109/l or less and this high parasitemia was inversely related to platelet count. a low platelet count was associated with high parasitaemia (p<0.05). table 1: platelet count in malaria positive and negative cases with microscopy and hematology analyzer methods platelet count in malaria positive cases platelet count in malaria negative cases microscopy 117 ± 35.06 285.6 ± 41.01 hematology analyzer 137 ± 48.13 292.3 ± 40.3 discussion thrombocytopenia is a well-documented finding in falciparum malaria and in mixed falciparum/ vivax infection 10,11. a platelet count less than 150×109/l was considered thrombocytopenia but is not associated with adverse outcome12. thrombocytopenia is considered as an important indicator of malaria 13. maximum thrombocytopenia occurs on the fifth or sixth day of infection and gradually returns to normal within 5-7 days after parasitemia has ceased 14. in the present study thrombocytopenia of less than 150×109/l was found in 24 (65%) of the malaria cases. mean platelet count in p. falciparum infection was 141×10 9/l in hematology analyzer while on microscopy the mean platelet count was 120×10 9/l. thrombocytopenia has been observed in 60-80% of both p. falciparum and vivax infection15. the shortened life span of platelet is 2–3 days in comparison to 710 days in normal controls 15,16. the mechanism of thrombocytopenia in malaria is still unclear. fajardo and tallent 17 suggested a direct lytic effect of parasite on platelets. both non-immunological destruction and immunological mechanism involving platelet specific antibodies have been demonstrated 18-19. mohanty et al suggested that thrombocytopenia in malaria is partly immune mediated20. during malarial infection, initial lmrj volume 2 issue 3 52 | p a g e hyperactivity results in aggregation and later hypoactivity of platelets causes intravascular lysis. there is peripheral destruction and consumption of platelet in infected persons. srichaikul noted that despite thrombocytopenia, the number of megakarocytes in the bone marrow remained adequate or increased in malarial infection 18. ladhani et al found that a low platelet count is associated with parasite density but not with bleeding problem or mortality 13. thus screening complete blood count can be a rapid and inexpensive yet valuable component in the diagnostic investigation of any patient suspected of malaria, particularly the patient with pyrexia of unknown origin and thrombocytopenia. references 1world health organization. world malaria situation in 1994.wkly rec 1997;72: 269-76. 2michael jgf. infectious diseases, tropical medicine and sexually transmitted diseases. in: clinical medicine kumar p and clark m (ed). 4th ed 1998 london: wb saunders. 3causer lm, newman rd, barber am, robert jm, stennies g, poland pb et al. malaria surveillanceunited states, 2002. in: cdc surveillance summaries (july 12, 2002). mmwr2002; 51(no.ss-5): 9-23. 4filler s, causer lm, newman rd, barber am, robert jm, macarthur j. malaria surveillance united states, 2001. in: cdc surveillance summaries (july 18, 2003). mmwr2003; 52(no.ss-5): 1-14. 5mohapatra mk, mitra i, das sp, kar lk. haematological and coagulation profile in malaria. the indian practitioner 2002; 55(2): 75-8. 6-niazi ga. hematological aspects of malaria in a population based hospital, saudi arabia. j egypt soc parasitol 1995; 25(3):787-93. 7dacie jv, lewis sm. manual platelet count in: dacie jv, lewis sm(ed).practical haematology 9th edn: churchil living stone 1995 8dacie jv, lewis sm. preparation and staining methods for blood and bone marrow films. in: dacie jv, lewis sm(ed). practical haematology 9th edn: churchil living stone 1995:81. 9diagnostic procedures for blood specimens. laboratory identification of parasites of public health concern. diagnostic procedure. centre for disease control and prevention. 22.6.2004. from http://www.dpd. cdc.gov/dpdx/ diagnostic procedures,htm. 10crabbe g, van poucke m, cantinieaux b. artefactually normal automated platelet counts due to malaria infected rbc. clin lab haematol 2002; 24(3):179-82. 11sharma sk, das rk, das bk, das pk. haematological and coagulation profile in acute falciparum malaria. j assoc phsicians india 1992; 40(9): 581-3 lmrj volume 2 issue 3 53 | p a g e 12makkkar rp, mukhopadhyay s, monga a, gupta ak. plasmodium vivax malaria presenting with severe thrombocytopenia. braz j infect dis 2002; 6(5):263-5. 13ladhani s, lowe b, cole ao, kowuondo k, newton cr. changes in white blood cells and platelets in children with falciparum malaria: relationship to disease outcome. br j haematol 2002; 119(3): 839-47. 14scott cs, van zyl d, ho e, ruivo l, mendelow b, coetzer tl. thrombocytopenia in patients with malaria: automated analysis ofoptical platelet counts and platelets clumps with the cell dyn cd 4000 analyzer. clin lab haematol 2002; 24(5):295 302. 15srichialkul, pulket c, sirisatepisan t, prayoonwiwat w. platelet dysfunction in malaria. south asian j trop med pub hlth 1988:19;225-33. 16horstmann rd, dietrich m, bienzle u, rasche h. malaria induced thrombocytopenia. blut 1981; 42(3):157-64. 17fajardo lf, tallent c. malarial parasite within human platelets. jama 1974; 229:1205. 18looareesuwan s, davis jg, allen dl, lee sh, bunnag d, white nj. thrombocytopenia in malaria. southeast asian j trop med public health 1992; 23(1):44-50. 19yamaguchi s, kubota t, yamagishi t, okamoto k, izumi t, takada m et al. severe thrombocytopenia suggesting immunological mechanism in two cases of vivax malaria. am j hematol 1997; 56(3):183-6. 20mohanty d, marwaha n, ghosh k, sharma s, garewal g, shah s et al. functional and ultra structural changes of platelets in malarial infection. trans r soc trop med hyg 1988; 82 (3):369-75. case report pierre marie-bamberger syndrome: a unique case report syed a. abbas1, ahsan zil-eali1, umair ahmad1 & kashif anwar2 1fmh college of medicine and dentistry, 2department of radiology, dhq hospital, kasur, pakistan received: 25 march 2019 revised: 14 may 2019 accepted for publication 6 june 2019 correspondence: syed ahsan abbas fmh college of medicine and dentistry kasur. e-mail:ahsanzileali@gmail.com this article may be sighted as: abbas sa, zil-e-ali a, anwar k. pierre marie-bamberger syndrome: a unique case report. lmrj. 2019; 1(3): 58-60. doi: 10.38106/lmrj. 2019.1.3-5 abstract hypertrophic osteoarthropathy (hoa) was described by friedreich in 1868. it is a rare condition with variable presentations including clubbing of the toes and fingers, arthralgia with edema, bilateral ptosis, thickening of the skin and leonine facies. bone and periarticular tissue proliferation leads to expansive extremities. it is a distant effect disorder in various neoplasms (paraneoplastic syndrome); often associated with lung neoplasm. we report a case of a 36 year old pakistani male smoker, presenting with bilateral joint pains, shortness of breath and grade 4 digital clubbing on general examination. introduction hypertrophic osteoarthropathy (hoa) clinically presents with clubbing of the fingers and toes, increase in the size of extremities, arthralgia and swelling in the joints. a characteristic feature of hoa is symmetric periostitis which mainly affect the long bones of both upper and limbs. the disease can be either primary (pachydermoperiostosis) or secondary. the primary form, or idiopathic, is a rare familial autosomal dominant disease, corresponding to 3-5% of all cases. in majority of the cases, the disease is secondary to a pulmonary tumour, hence called hypertrophic pulmonary osteoarthropathy (hpo)1, 2. we present a case of 36 years old pakistani male, who presented with generalized malaise and lethargy. the patient complained chronic pain in joints of hands and axial skeleton and was later diagnosed to have non-small cell carcinoma, squamous cell cancer of lungs. case report we here in present a case of a pakistani 36 year’s old male, presenting in clinic with generalized malaise and lethargy. patient was stable with bp 130/90, pulse rate 74/min, respiratory rate of 16/min and afebrile. patient gave history of bilateral chronic pain in joints of hands and axial skeleton. pain in his hand joints started almost 5 years back, dull aching in character without any morning stiffness, worse on movement, relieved on taking acetaminophen and rest. there was swelling associated with the joint pain but no fever or chills. patient also reported of exacerbation of pain in joint of hand on motion and had been consuming over the counter painkillers for these arthritis like symptoms for last 5 years on © 2019 lmrj liaquat medical research journal, 2019, 1, 3 58 and off. he also complained of shortness of breath and occasional non-productive cough. he is known smoker for past 16 years with history of 24 pack years and has complained of chronic bronchitis for many years. there was also a positive family history of lung cancer. on general examination, a grade 4 clubbing of the digits was seen with excessive proliferation of skin. there was visible swelling of small joints of hands and elbows with no calor, warmth (a cardinal feature of inflammation) on palpation. there was severe pain on movement of interphalangeal joints. initially a provisional diagnosis of degenerative joint disease was made, although a positive family history of lung cancer and smoking habit, a paraneoplastic syndrome was considered a differential for diagnosing the case. patient was referred to radiologist for the radiographs of hands and the chest. the hand radiograph showed periosteal reaction around the shafts of all visible bone, (figure 1). figure 1. x-ray bilateral hand pa view. periosteal reaction is seen around the shafts of all visible bones with no cortical break. no fracture is seen. findings are consistent with hypertrophic pulmonary osteoarthropathy. the chest radiograph showed a right mid-zone focal lesion, suggestive of malignancy (figure 2). the lung biopsy was done, which showed a non-small cell carcinoma, squamous cell cancer. a diagnosis of pierre marie-bamberger syndrome, rare condition was made. patient was advised to continue nsaids for symptomatic management and was referred to surgery department for treatment of primary cause. figure 2. soft tissue density mass is seen in right mid zone with irregular indistinct margins suggestive of malignancy. discussion hoa is a syndrome manifesting bony deformities and multi-organ involvement3. the major work on the syndrome is done in 1889 by bamberger followed by further research by pierre marie in 1890, hence the name pierre marie– bamberger (pmb) disease was coined4. pmb is a rheumatologic disease with variable presentations. the common features include digital clubbing, increase in size of the limbs secondary to bone and periarticular tissue proliferation, arthralgia with edema, bilateral eyelid ptosis, leonine facies, and thickening of the skin. histological examination of tissue biopsy shows hyperplasia of the adjacent subcutaneous tissue5, 6. pmb is etiologically classified lmrj into primary (hereditary or idiopathic) or secondary disease. touraine et al divided the primary disease into three forms: complete, incomplete, and fruste form. the complete and fruste variety both present with pachydermia along with skeletal abnormalities. however digital clubbing and periostosis is seen in complete form7. incomplete form cases do not exhibit pachydermia. secondary hoa is associated with an underlying multiorgan involvement and often has a fatal course. hpo is an uncommon paraneoplastic syndrome which is frequently associated with pulmonary tumor; the actuarial incidence of hpo is, however, not well known8. our patient in the reported case initially presented with bilateral joint pains in the hands with increased pain on movement. he was on over the counter pain medications for chronic arthritis. on general physical exam he had grade 4 clubbing in hands, thickened skin, edema and joint pain on movement of the hands which are all features of hpo. considering shortness of breath, smoking history and digital clubbing in our reported case we suspected hypertrophic osteoarthropathy (hpo) secondary to lung pathology and sent the patient for chest x-ray. further tests and biopsy revealed lung carcinoma. simple clubbing of the fingers should be differentiated from osteoarthropathy. the preliminary alteration in the architecture of limbs of patients with pulmonary hpo is an overgrowth of vascular connective tissue involving structures in the distal part of the limb. the new tissue formed lies over the periosteum and osteogenesis takes place beneath it. surrounding the joints, the newly formed tissue gives the appearance of periarthritis, though there are no specific articular changes. the nail beds invasion gives rise to clubbing of the fingers. osteoarthropathy is commonly secondary to pulmonary disease, but it may be associated with thoracic lesions without pulmonary involvement9. in the end summarizing the treatment of secondary hypertrophic osteoarthropathy (hpo) we consider the option of treating underlying primary cause like resection of tumor, chemotherapy, radiotherapy etc. and supportive management including bisphosphonates, nsaids and vagotomy4. acknowledgment: the authors would like to thank dr. kashif anwar from the department of radiology, dhq hospital, kasur, pakistan for reviewing the images. references 1. jajic z, jajic i, nemcic t. primary hypertrophic osteoarthropathy: clinical, radio logic, and scinti graphic characteristics.arch med res. 2001; 32:136-142. 2. ntaios g, adamidou a, karamit sos d. hypertrophic pulmonary osteoarthropathy secondary to bronchial adenocarcinoma and coexisting pulmonary tuberculo sis: a case report. cases j. 2008; 1:221. © 2019 lmrj liaquat medical research journal, 2019, 1, 3 59 lmrj 3. martínez-lavín m, matucci-cer phia: w.b. saunders company. syndrome: the complete form inic m, jajic i, pineda c. hyper capítulo: enostosis, hyperostosis needs to be recognized. indian j trophic osteoarthropathy: and periostitis. resnick, d; nucl med. 2012 jul. 27(3):201-4. consensus on its definition, classi niwayama, g. 1995. 8. qian, xinyu, and jing qin. fication, assessment and diagnos6. carvalho tn, araújo cr jr., “hypertrophic pulmonary osteo tic criteria. j rheumatol. 1993 fraguas srf, costa mab, teixeira arthropathy with primary lung aug. 20(8):1386-7. ks, ximenes ca. osteoartropatia cancer.” oncology letters 7.6 4. nguyen s, hojjati m. review of hipertrófica primária (paquider (2014): 2079–2082. pmc. web. 11 current therapies for secondary moperiostose): relato de casos em july 2016. hypertrophic pulmonary osteoar dois irmãos. radiol bras 9. holling h, brodey rs. pulmonary thropathy. clin rheumatol. 2011 2004;37(2):147-9. hypertrophic osteoarthropathy. jan. 30(1):7-13. 7. karnan s, krishnamoorthy v, jama. 1961;178(10):977-982. 5. resnick d: diagnosis of bone and ethiraj p, sathyanathan bp. joint disorders, 3 ed., philadel t o u r a i n e s o l e n t e g o l e © 2019 lmrj liaquat medical research journal, 2019, 1, 3 60 lmrj volume 2 issue 3 54 | p a g e unusual presentation of factor xii deficiency with bleeding: a rare case report faryal qadir1, ayisha imran1, nauman aslam malik1, arshi naz2, tahir shamsi2 1department of hematology, chughtai lab, pakistan, 2national institute of blood disease and bone marrow transplantation, pakistan. correspondence: dr. faryal qadir department of hematology, chughtai lab, lahore, pakistan. email: dr.faryalqadir@gmail.com lmrj. 2020; 2(3) doi: 10.38106/lmrj. 2020.2.3-02. abstract: factor xii (fxii) is a coagulation protein involved in the initiation of coagulation via contact activation system. congenital fxii deficiency is a rare, asymptomatic disorder, associated with an isolated prolonged activated partial thromboplastin time (aptt). fxii deficiency is not commonly associated with any bleeding symptom except for a few cases presenting with occasional minor bleeds, which does not require treatment. instead, a few literature reports suggest an increased incidence of various thromboembolic events in these patients. we report a rare occurrence of fxii deficiency presenting with severe bleeding symptoms. key words: factor xii deficiency, contact activation system, thromboembolic events. introduction factor xii (fxii), also known as hageman factor, is an 80 kda plasma protein synthesized in liver. it is involved in coagulation of blood via contact activation as seen in the activated partial thromboplastin time (aptt). activation of fxii occurs when the complex of fxii, factor xi (fxi), prekallikrein, and high molecular weight kininogen contact a negatively charged surface. fxii subsequently activates fxi and thus plays a role in fibrin clot formation. a rather more important role of fxii is the conversion of plasminogen to plasmin and initiation of fibrinolysis1. congenital fxii deficiency is inherited as an autosomal recessive disorder with a very low incidence of approximately 1 in a million individuals.2 rare cases with autosomal dominant pattern have also been reported.3 the gene for fxii is located on chromosome 5. fxii deficiency is usually asymptomatic and associated with prolongation of aptt.4 the condition is usually diagnosed incidentally e.g. during preoperative coagulation work up. fxii deficiency is normally asymptomatic, however, a few patients with occasional minor bleeds have been previously reported.3 in contrast, this disorder has been associated with a significantly increased risk of thrombosis, due to impaired fibrinolytic system.4 case report mailto:dr.faryalqadir@gmail.com lmrj volume 2 issue 3 55 | p a g e case report a 17 years old female born to consanguineously married couple presented to us for diagnostic work up of a suspected bleeding disorder. she complained off and on right knee joint pain with associated swelling for the past two years. her past history included several episodes of epistaxis, gum bleeding, per rectal bleeding, melena and spontaneous bruising since childhood. she was transfused multiple times with whole blood and plasma for the mentioned bleeding symptoms; the symptoms would resolve with the transfusions. two years back, she underwent exploratory laparotomy and abdominal lavage due to primary peritonitis. in the process she was given multiple fresh frozen plasma (ffp) and whole blood transfusions. she also complained of menorrhagia since menarche. her complete blood count showed haemoglobin: 12 g/dl, total leukocyte count: 5.8 x 109/l, platelet count: 196 x 109/l. coagulation screen revealed a normal prothrombin time (pt) of 12 seconds, (reference range 10-13sec), bleeding time: 3 minutes (reference range 3-7 min) with a prolonged aptt: more than 120 sec (reference range 24-32sec). a 1:1 mixture of patient’s plasma and pooled normal plasma revealed complete correction of patient’s aptt, excluding the presence of any inhibitor. we further performed coagulation assays of factors viii, ix, xi and xii, (performed on sysmex ca 550) as these clotting factor deficiencies can cause a prolonged aptt. our results revealed normal levels of factors viii, ix and ix with absent fxii. von willebrand antigen (sysmex ca 500) levels and ristocetin co-factor activity (aggram helena) were also within normal limits. as fxii deficiency is usually not associated with any bleeding symptoms we further performed fibrinogen assays (sysmex ca 50), platelet aggregation studies (aggram helena) and factor xiii (fxiii) levels to rule out any concomitant pathology; all of these turned out to be normal. work up for renal and autoimmune disorders was also done to exclude the possibility of acquired deficiency. thus, she was diagnosed as a case of congenital fxii deficiency. interestingly, no mutations in the factor xii gene were found on snager’s sequencing. she was put on oral hormonal contraceptive for her menorrrhagia. ffps were given at 10ml/kg to treat right knee joint haemarthrosis after which her symptoms were resolved. she was offered physiotherapy for further management. discussion fxii deficiency is a blood disorder with a very low incidence. it may be congenital, in which case it is usually diagnosed incidentally by an isolated prolonged aptt during routine coagulation screen. other related disorders associated with a prolonged aptt include deficiency of factors viii, ix, xi, contact factors, von willebrands disease as well as a few inhibitors of coagulation including lupus anticoagulant and acquired inhibitors against various coagulation factors e.g factor viii. however, fxii deficiency is usually not associated with any bleeding manifestations, in contrast to other clotting factor deficiencies e.g factor viii, ix etc. another acquired form of factor xii deficiency may be caused by inhibitors against fxii. this has been reported in patients with nephrotic syndrome and leukemia.5 conversely, these patients have an increased risk of thromboembolic phenomenon due to impaired fibrinolysis in fxii deficiency. various researchers have reported association of fxii deficiency with myocardial infarction, pulmonary embolism and other life threatening thrombotic episodes.6 lmrj volume 2 issue 3 56 | p a g e parameter patient value reference range bleeding score 19* first line coagulation screening bleeding time 3 min 3-7 min pt 12 sec 10-13 sec aptt more than 120 sec 24-32 sec fibrinogen 213mg/dl 180-350 mg/dl intrinsic pathway factor viii 141% 50-150% factor ix 91% 50-150% factor xi 81% 50-150% factor xii 0% 50-150% associated factors factor xiii 76% 50-150% vwf antigen 89% 50-200% ricof 94% 50-200% platelet disorders normal platelet aggregation autoimmune work up anti dsdna 1.68 u/ml <20 u/ml ana <1:100 (negative) <1:100 renal work up urea 20 mg/dl 10-50 mg/dl creatinine 1.1 mg/dl 0.71.3 mg/dl genetic work up snager’s sequencing no mutation detected platelet aggregometry results ristocetin: 80.9% collagen : 80.7% adp : 82% few reports have also emphasized that female patients with hageman factor deficiency might also be at a higher risk for recurrent pregnancy losses.7, 8 therefore, once diagnosed, these patients should be followed up closely for any thrombotic events. in a study carried out on all the available members of swiss families affected by factor xii deficiency, it was found that patients with homozygous fxii deficiency are more likely to develop thromboembolic disease whereas partial fxii deficiency is not usually associated with thrombosis.9 however, different subsequent studies have shown that these patients developed thrombosis due to other risk factors rather than factor xii deficiency.10,11 recently, researchers are working on newer anticoagulants targeting factor xii.11 there were a few limitations in this case report. antigen level of fxii could not be performed because of non-availability of required resources and the diagnosis had to be made solely based on fxii activity. similarly, we were unable to rule out any concomitant deficiency of other contact factors e.g pre-kallikrein, high molecular weight kininogen etc. conclusion fxii deficiency is a rare genetic blood disorder; usually not associated with any bleeding tendencies. moreover, these patients also do not bleed following invasive procedures such as surgery and dental extraction. thus, these patients routinely do not need any treatment or prophylactic measures. however, as reported in our case a few patients with fxii deficiency may present with bleeding symptoms and lmrj volume 2 issue 3 57 | p a g e should be managed accordingly. a probable cause for these haemorrhagic incidents in our case might be the complete absence of fxii activity in the plasma. the purpose of this case report is to bring forth the rare occurrence of severe bleeding manifestations in patients with fxii deficiency. references 1. thomas renne, alvin h. schmaier, katrin f. nickel, margareta blomback and coen maas.in vivo roles of factor xii.blood 2012,120:4296-4303 2. colman rw.factor xii deficiency.nord guide to rare disorders. lippincott williams and wilkins.philadelphia,pa.2003,3 82-383 3. kumar r,gupta a,mathur p,garg m.factor xii deficiencya rare coagulation disorder.indian j child health.2016,3(4):349-350. 4. rygal p,kuc a.perioperative management of cardiac surgery patients with factor xii deficiency-two case reports.anaesthesiol intensive ther.2012,44(4):217-20. 5. wang y,wang z,li h,bi k,zhu c.essential thrombocytosis accompanied by coagulation factor xii deficiency.a case report.int j clin exp med. 2014,7(10):3725-9. 6. arphan azaad,m.,zhang,q.r. and li,y.p.factor xii (hageman factor) deficiency.a very rare coagulation disorder.open journal of blood diseases.2015,5,39-42. 7. mariano ml,yadira p,ana a,manuel l,lopez galvez jj.coagulation factor xii congenital deficiency in women with recurrent miscarriage.int j clin med.2011,2(4):469-72. 8. a.seval ozgu-erdinc,cihan togrul,ayla aktulay,umran buyukkagnici,elif gul yapar eyi ,salim erkaya. factor xii (hageman) levels in women with recurrent pregnancy loss. journal of pregnancy 2014, article id : 459192. 9. lammle b.,wuillemin w.a.,huber i.,furlan m. thromboembolism and bleeding tendency in congenital factor xii deficiency-a study on 74 subjects from 14 swiss families.thrombosis and haemostasis.1991,65(2):117-21. 10. a.girolami, m. morello,b. girolami,a.m. l ombardi,c. bertolo.myocardial infarction and arterial thrombosis in severe (homozygous) fxii deficiency: no apparent causative relation. clinical and applied thrombosis/hemostasis.2005,11 (1):49 – 53. 11. felicitas muller, david gailani, thomas renne.factor xi and xii as antithrombotic targets. curr opin hematol.2011,18(5): 349– 355. lmrj volume 2 issue 3 64 | p a g e determine the influence of prenatal stress on fetal development anila sharif1, hira saeed2, maham siddiqui3, safila naveed4, fatima qamar5 & syeda sarah abbas6 this article may be cited as: sharif a., saeed h., siddiqui m., naveed s., qamar f. & abbas s.s. determine the influence of prenatal stress on fetal lmrj. 2020 doi:10.38106/lmrj. 2020.2.3-04. abstract: prenatal stress is an epigenetic factor which can produce long-lasting alterations in brain structures and body functions. the objective of this was to examine the ratio of prenatal stress among pregnant women. it is necessary to assess stress separately at each trimester of pregnancy to differentiate chronic from acute stress in order to evaluate the effects on child development. prenatal stress can alter neurotropic growth factors, synapse development, neurotransmitter levels and also adult neuron development. prenatal stresses significantly influence the development of the brain and the organisation of behaviour. prenatal stress can also be the main cause of hypertension, type 2 diabetes, schizophrenia and cardiac disorders in adulthood. but the impact of stress is not very clear. the survey based on a cross-sectional study was conducted in karachi. the sample size calculated for the survey is 45. the pregnant women were asked to fill the questionnaire of 23 questions. keywords: prenatal stress, maternal stress, antenatal stress, fetal development & depression. introduction prenatal stress (or antenatal maternal stress) is exposure of the associated expectant mother to worry, which might be caused by disagreeable life events or by environmental hardships 1. the ensuing changes in the mother's secretion and the system might hurt the fetuses (and when birth, the infant's) immune perform and brain development 2 prenatal stress is shown to possess many effects in vertebrate brain development. within the hippocampus of male rats, antenatal stress has shown to decrease the speed of proliferation and necrobiosis within the hypothalamus-pituitary axis3,4. antenatal stressed animals have prolonged glucocorticoid response. removing the adrenal glands of the mother eliminates the impact of the pup's glucocorticoid response. supplementing the adrenalectomized mother with glucocorticoid, saved the hypothalamic-pituitary-axis response to maternal stress for prenatally stressed offspring5. antenatal stress caused high glucocorticoids that successively affect the hypothalamicpituitary-axis feedback 6. a study by garcía-cáceres et al. showed that antenatal stress decreases cell turnover and proliferation research article lmrj volume 2 issue 3 65 | p a g e within the neural structure of adult rats that reduces structural physical property and reduces the response to worry in adulthood 7. this study conjointly showed that once prenatally stressed rats were stressed in adulthood the females showed a rise in corticotrophin-releasing internal secretion suggesting it to be associate up-regulation within the hypothalamic-pituitary adrenal axis8. males showed no elevation of glucocorticoid levels. increase in adrenocorticotropic internal secretion adrenocorticotrophic hormone acth hormone, endocrine internal secretion} with no impact of adult stress and a decrease within the corticotrophin-releasing hormone ribonucleic acid within the neural structure showed a down-regulation. the author concludes that this makes prenatally stressed females less reactive to later life stressors than males. 9-11 methodology the cross-sectional study was conducted in karachi in november 2016, the surveillance study was conducted including pregnant women in the city. the sample size calculated for the survey was 45. a survey questionnaire was developed to address the study questions and was disseminated among the local population. the respondents were asked to answer 23 openended questions. according to our estimation, we analyzed that majority of pregnant women are the prey of prenatal stress. most of them didn’t know about prenatal stress as well as its adverse effects that come in the form of fetal abnormalities. result according to our report, 40% women feel changes in their behaviour due to prenatal stress and 60% have normal behaviour. only 40% women during pregnancy feel changes in appetite, 24.4% don’t feel changes in appetite. in our sample size 11.1% suffers environmental stress, 22.2% feels stress due to personal issues and 17.8 % suffers stress due to financial problem. in their relations with family and spouse, only 4.4% have a harsh relation, 11.1% have a good relationship with their family and spouse while others have a normal relation. the stress due to baby’s gender, 51.1% pregnant women have stress about baby's gender from their family. there is a good ratio that 57.8 pregnant women are aware of abnormality of the fetus due to stress. lmrj volume 2 issue 3 66 | p a g e questions frequency % significance value do you feel craving towards anything? 53.3 0.467 do you feel that your sense of smell is increased during pregnancy? 46.7 0.199 do you feel of being strictly spic and span? 40 0.511 do you feel of being more forgetful? 42.2 0.557 do you feel any kind of breathing problems? 46.7 0.15 do you feel any sort of problem in sleeping? 44.4 0.91 do you feel of being chronic towards any disease? 22.2 0.596 do you feel pain in any part of your body? 71.1 0.437 any sort of pressure you feel from your family? 60 0.258 do you have pressure about baby’s gender from your in-laws? 51.1 0.776 do you know that stress during pregnancy can cause abnormality in your child? 57.8 0.792 discussion according to charila et’al 12 reports that maternal mood is affected by stress during pregnancy and the physiology of fetus. as per our reports, we concluded that 40% maternal mood is affected by prenatal stress. in april 1991, a longitudinal study was conducted by t deaveet’al 13. the report suggests that prenatal stress is the cause of child development abnormality. as per our report, we concluded that 57.8% maternal stress can cause abnormality in child development. laura palagini 14 in august 2014 in a review article suggested that insomnia in pregnancy is a determinant of pregnancy outcome. as per our reports, 44.4% suffered from insomnia during pregnancy. helen christensen 15 in their reports suggested that pregnancy mothers become forgetful during pregnancy. as per or reports, 42.2% mothers become forgetful due to stress. w. hofhuis and his team 16 in their research suggested that breathing problems like apnea occurs during pregnancy and also due to maternal smoking. as per our reports, 46.7% pregnant women suffer breathing problems. matthew w gillman 17 in his reports showed that chronic diseases can be the cause of prenatal stress. as per or reports, we concluded that 22.2% maternal women are being chronic towards diseases like hypertension, diabetes type 2 and glucose intolerance. according to our reports; 53.3% feel craving towards anything, 71.1% feel pain in the body, 60% feel some sort of pressure from family and 51.1% have pressure about baby’s gender from their in-laws. conclusion as per our reports, we come up with the conclusion that: excessive use of abuse material such as alcohol, cocaine, caffeine, or tobacco is one of the major causes of fetus growth retardation. unhealthy relationships, physical or mental abuse, breakups of the relations or persistent hypertension also play a major role in fetus retardation and in depressed fetal physical or mental growth. by this crosssectional lmrj volume 2 issue 3 67 | p a g e study, we have tried to aware the majority of women about prenatal stress and its consequences regarding fetal development. to overcome the consequences and inconveniences of prenatal stress, we have to take some healthy and beneficial steps, in order to let the people know about it, awareness programs, seminars, and workshops should be arranged, ngo’s should be run to eliminate the marital abuse from the society, special units should be developed in the rehabilitation centers for pregnant women. references 1. doberczak, tatiana m., et al. "neonatal neurologic and electroencephalographic effects of intrauterine cocaine exposure." the journal of pediatrics 113.2 (1988): 354-358. 2. hall, wayne, and louisa degenhardt. "adverse health effects of non-medical cannabis use." the lancet 374.9698 (2009): 1383-1391. 3. koehl, muriel, et al. "prenatal stress alters circadian activity of hypothalamo–pituitary–adrenal axis and hippocampal corticosteroid receptors in adult rats of both gender." developmental neurobiology 40.3 (1999): 302315. 4. alder, judith, et al. "depression and anxiety during pregnancy: a risk factor for obstetric, fetal and neonatal outcome? a critical review of the literature." the journal of maternal-fetal & neonatal medicine 20.3 (2007): 189-209. 5. maccari, stefania, et al. "prenatal stress and long-term consequences: implications of glucocorticoid hormones." neuroscience &biobehavioral reviews 27.1 (2003): 119-127. 6. angelidou a, asadi s, alysandratos kd, karagkouni a, kourembanas s, theoharides tc. perinatal stress, brain inflammation and risk of autism-review and proposal. bmc pediatrics. 2012 dec;12(1):1-2. 7. kapoor, amita, et al. "fetal programming of hypothalamo‐ pituitary‐adrenal function: prenatal stress and glucocorticoids." the journal of physiology 572.1 (2006): 31-44. 8. barbazanges, arnaud, et al. "maternal glucocorticoid secretion mediates long-term effects of prenatal stress." journal of neuroscience 16.12 (1996): 3943 9. 3949. 10. mccormick cm, smythe jw, sharma s, meaney mj. sexspecific effects of prenatal stresson hypothalamic-pituitary-adrenal responses to stress and brain glucocorticoid receptor density in adult rats. developmental brain research. 1995 jan 14;84(1):55-61. 11. wright rj. perinatal stress and early life programming of lung structure and function. biological psychology. 2010 apr 1;84(1):4656. 12. wadhwa, p. d., sandman, c. a., &garite, t. j. (2001). the neurobiology of stress in human pregnancy: implications for prematurity and development of the fetal central nervous system. progress in brain research, 133, 131-142. 13. charil a, laplante dp, vaillancourt c, king s. prenatal stress and brain development. brain research reviews. 2010 oct 5;65(1):56-79. 14. lemaire v, koehl m, le moal m, abrous dn. prenatal stress produces learning deficits associated with an inhibition of neurogenesis in the hippocampus. proceedings of the national academy of sciences. 2000 sep 26;97(20):11032-7. lmrj volume 2 issue 3 68 | p a g e 15. palagini l, gemignani a, banti s, manconi m, mauri m, riemann d. chronic sleep loss during pregnancy as a determinant of stress: impact on pregnancy outcome. sleep medicine. 2014 aug 1;15(8):853-9. 16. christensen h, leach ls, mackinnon a. cognition in pregnancy and motherhood: prospective cohort study. the british journal of psychiatry. 2010 feb;196(2):126-32. 17. hofhuis w. clinical applications of infant lung function testing. 2004 jun 10. 18. gillman mw. epidemiological challenges in studying the fetal origins of adult chronic disease. international journal of epidemiology. 2002 apr 1;31(2):294-9 lmrj volume 1 issue 2 33 | p a g e evaluate the changes arise in the parameters of liver and kidney during adjuvant chemotherapy in breast cancer patients hina akbar memon, afsheen mushtaque shah institute of biochemistry, university of sindh, jamshoro, pakistan received: 28 march 2019 revised: 17 june 2019 accepted for publication 5 july 2019 correspondence: afsheen mushtaque shah, institute of biochemistry, university of sindh, jamshoro e-mail: afsheen.shah@usindh.edu.pk this article may be sighted as: akbar h, shah am. to evaluate the changes arise in the parameters of liver and kidney during adjuvant chemotherapy in breast cancer patients. lmrj. 2019; 1(2): 31-34. doi: 10.38106/ lmrj. 2019.1.203. abstract to find out the variation in basic parameters of liver and kidney during fac or caf adjuvant chemotherapy in breast cancer patients at nimra jamshoro. a follow up study conducted at nuclear, institute of medicine radiotherapy (nimra), jamshoro, sindh, pakistan. our findings include the variations in the level of total bilirubin, alkaline phosphatase and alanine transaminase as the parameters of liver. the mean ±sd of total bilirubin before fac (5-fluorouracil, doxorubicin and cyclophosphamide) or caf (cyclophosphamide, doxorubicin and 5fluorouracil) adjuvant chemotherapy in breast cancer patients was 0.76±0.23 and after it was 1.23±0.16. the mean ±sd of alkaline phosphatase before fac or caf adjuvant chemotherapy in breast cancer patients was 96.2±2.89 and after it was 131±14.3 and alanine transaminase before fac or caf adjuvant chemotherapy the mean ±sd was 25.5±6.18 and after it becomes 37.7±5.18. we found the variations in the level of urea and creatinine as the parameters of kidney. the mean ±sd of urea and creatinine before fac or caf adjuvant chemotherapy in breast cancer patients was 15.4±4.98 and 0.85±0.20 and after chemotherapy they were 28.0±1.70 and 1.76±0.09 respectively. the main parameters of liver and kidney were statistical significantly increased after fac or caf adjuvant chemotherapy in the woman with breast cancer. these changes will alter the working of these organs by making drastic effects on the normal metabolic and excretory function of liver and kidney. keyword: adjuvant chemotherapy, breast cancer, liver, kidney. introduction adjuvant systemic therapies such as endocrine therapy, anti her2 therapy and chemotherapy are very much effective to lower the risk of recurrence both distant and local cancer. mortality rates of breast cancer are also reduced with the use of adjuvant systemic therapy1. 5-fluorouracil has become the backbone drug in the chemotherapy treatment but it is involved in the development of liver injury, certain report showed that steatosis was developed after administration of 5fluorouracil in the chemotherapy treatment although some reaction may be reversible2. the liver toxicity caused by chemotherapeutic agents. they stated that cyclophoshamide, 5-fluorouracil and doxorubicin may cause the liver toxicity at first after administration of these drugs and then come to the normal. liver has their catabolism mechanism that reduces the toxicity of these drugs in the hepatic cells. liver toxicity is rarely produced by these drugs observed by king and perry3. chemotherapeutic drugs also damage the kidney. the functional unit of kidney is nephron and its glomerulus, renal tubules, interstitium badly affected resulting in rise of concentration of serum creatinine. the nephrotoxicity primarily show no sign and symptoms and then goes to serum electrolytes imbalance. short term side effects were nausea and vomiting as increase in urea and creatinine level in the body4. materials and methods: this work was designed as follow up study. we have selected breast cancer patients for research who are seeking treatment at nuclear, institute of medicine radiotherapy (nimra), jamshoro, sindh, pakistan from 1st april 2015 to 30th october 2015. we observed 131 patients and 105 patients were agreed to participate in our research. 105 chemotherapeutic women with age range between 20 to 60 years, having breast cancer. they underwent surgery and taking adjuvant treatment with fac or caf chemotherapy were included. the man having breast cancer, women with age limit less than 20 research article mailto:afsheen.shah@usindh.edu.pk lmrj volume 1 issue 2 34 | p a g e or greater than 60 years, who were not willing in participate in research were also excluded. having any other type of cancer, non-surgical, radio therapeutic, neoadjuvant chemotherapeutic and other chemo drugs were also excluded. 5 ml human blood sample was collected from the breast cancer women before the administration of fac/caf adjuvant chemotherapy and then after each cycle of fac/caf adjuvant chemotherapy in neutral jell tubes. the gap between each cycle of fac/caf adjuvant chemotherapy was 21 days. after every cycle of fac/caf adjuvant chemotherapy blood sample was drawn from each patient by the vacutainer needle for the quantitative analysis of total bilirubin, alkaline phosphates, alanine transaminase as the marker of liver function test and urea and creatinine as the marker of renal function test. the liver function test performed at biochemistry analyzer jh6020 and the analysis of urea and creatinine from serum at hitachi 902 automated instruments germany roche company at nimra hospital jamshoro. after six plus cycle of fac/caf adjuvant chemotherapy the values were calculated to find the mean ±sd of the parameters. ethical considerations the research proposal was approved by research ethics committee institute of biochemistry university of sindh jamshoro. statistical analysis all the data was entered and analyzed on statistical package for social sciences (spss) version 16.0 (spss inc., chicago, illinois, usa). mean +sd was calculated for liver function test and renal function test of fac/caf adjuvant chemotherapeutic patients. results our findings include the variations in the level of total bilirubin, alkaline phosphatase and alanine transaminase. the mean ±sd of total bilirubin before fac (5-fluorouracil, doxorubicin and cyclophosphamide) or caf (cyclophosphamide, doxorubicin and 5-fluorouracil) adjuvant chemotherapy in breast cancer patients was 0.76±0.23 and after it was 1.23±0.16. the mean ±sd of alkaline phosphatase before fac or caf adjuvant chemotherapy in breast cancer patients was 96.2±2.89 and after it was 131±14.3 and alanine transaminase before fac or caf adjuvant chemotherapy the mean ±sd was 25.5±6.18 and after it becomes 37.7±5.18. we found the variations in the level of urea and creatinine. the mean ±sd of urea and creatinine before fac or caf adjuvant chemotherapy in breast cancer patients was 15.4±4.98 and 0.85±0.20 and after chemotherapy they were 28.0±1.70 and 1.76±0.09 respectively. table 1 liver function test before and after fac (5-fluorouracil, doxorubicin and cyclophosphamide) or caf (cyclophosphamide, doxorubicin and 5-fluorouracil) adjuvant chemotherapy in breast cancer patients parameters before chemotherapy mean ± sd after chemotherapy mean ±sd minimum maximum normal ranges total bilirubin (mg/dl) 0.76±0.23 1.23±0.16 1.11 1.52 0.3-1.3 alkaline phosphotase ( u/l) 96.2±2.89 131±14.3 116 159 40 -150 alt (u/l) 25.5±6.18 37.7±5.18 31.7 44.2 0-40 table 2 renal function test before and after fac (5-fluorouracil, doxorubicin and cyclophosphamide) or caf (cyclophosphamide, doxorubicin and 5-fluorouracil) adjuvant chemotherapy in breast cancer patients parameters before chemotherapy mean ± sd after chemotherapy mean ±sd minimum maximum normal ranges urea (mg/dl) 15.4±4.98 28.0±1.70 25.8 31.2 6-22 lmrj volume 1 issue 2 35 | p a g e creatinine (mg/dl) 0.85±0.20 1.76±0.09 1.59 1.89 0.6-1.3 figure 1 liver function test before and after fac (5fluorouracil, doxorubicin and cyclophosphamide) or caf (cyclophosphamide, doxorubicin and 5fluorouracil) adjuvant chemotherapy in breast cancer patients figure 2 renal function test before and after fac (5 fluorouracil, doxorubicin and cyclophosphamide) or caf (cyclophosphamide, doxorubicin and 5-fluorouracil) adjuvant chemotherapy in breast cancer patients discussion liver is the metabolic center of the body. it plays a major role in detoxication. the metabolites of drugs and toxicities that are produced by the administration of drugs will cause the hepatoxicity. there are statistically significant results reported regarding level of total bilirubin, alkaline phosphatase and alanine transaminase in liver function test before and after the cycles of caf or fac adjuvant chemotherapy as shown in the table 1. the normal levels of the parameters of liver were increased at the end six plus cycle of fac/caf adjuvant chemotherapy. king and perry 2001 also discussed that the doxorubicin with cyclophosphamide and 5 – flurouracil in adjuvant setting developed liver abnormalities within the first three months and these elevated levels were normalized with the passage of time3. rise in the levels of alkaline phosphatase with alanine transaminases and total bilirubin initially caused the hepatotoxicity but will be normalized after the completion of treatment. kidney is the major excretory organ of the body that is chiefly performed the removal of nitrogenous waste from the blood and filter the blood. the elevated level of nitrogenous waste will affect the blood physiology and cause imbalance in the normal plasma concentration of the blood. during the study urea and creatinine levels were increased after caf or fac administration and statistically significant before and after the cycles of chemotherapy as appeared in the table 2. before administration of fac/caf adjuvant chemotherapy the mean ±sd of urea was 15.4 ±4.9 and creatinine was 0.85 ±0.20. after six plus cycles fac/caf adjuvant chemotherapy the mean ±sd of urea was 28±1.70 and creatinine was 1.76±0.09. this increased level of urea and creatinine will damage the nephron, glomerulus and put drastic effect of function of kidney. warmkessel 2011 reported that alkylating agent cyclophosphamide caused nephrotoxicity include increases urea and creatinine level in the blood. urea and creatinine was metabolic waste product of nausea and vomiting that accumulate in blood4. these elevated levels caused the asymptomatic renal disorders7,8. conclusion lmrj volume 1 issue 2 36 | p a g e the main parameters of liver and kidney were statistically significantly increased after the adjuvant chemotherapy in woman with breast cancer. they may put drastic effects on the normal metabolic and excretory function on both the organs. the patients should be warned regarding the drastic changes and must be known that how to face and recover from the changes occurring during and after fac/caf adjuvant chemotherapy. references 1. anampa, j., makower, d., & sparano, j. a. progress in adjuvant chemotherapy for breast cancer: an overview. bmc medicine (2015)., 13(1), [195] 2. y. maor and s. malnick, “liver injury induced by anticancer chemotherapy and radiation therapy,” international journal of hepatology, 2013, vol. 2013, article id 815105. 3. paul d. king and michael c. perry, “hepatotoxicity of chemotherapy”, the oncologist, 2001, vol. 6, pp 162-176 4. held-warmkessel, jeanne msn, rn, acns-bc, aocn, taming three high risk chemotherapy complications, nursing 2011; 41(11) 30 – 37 5. j k limdi and g m hyde, “evaluation of abnormal liver function tests”, postgrad med j, 2003,vol. 79, pp 307-312 6. b prabasheela , s baskaran , r arivazhagan, “evaluation of alkaline phosphatase in pre and post operative breast cancer patients”, int j biol med res., 2012, 3(2) pp 1536-1537. 7. martin m, villar a, sole-calvo a, gonzalez r., massuti b, lizon j. et al “doxorubicin in combination with uorouracil and cyclophosphamide (i.v. fac regimen day 1, 21) versus methotrexate in combination with fluorouracil and cyclophosphamide (i.v. cmf regimen, day 1, 21) as adjuvant chemotherapy for operable breast cancer: a study by the geicam group. annals of oncology. 2003-14.833-842 8. winkelman c, ignatavicius dd, workman ml “ assessment of the renal/urinary system” , in medicalsurgical nursing. 6th ed. st. louis, mo: elsevier saunders; 2010. lmrj volume 1 issue 1 13 | p a g e prevalence of hepatitis b, c and hiv viruses in blood donors at patel hospital adnan ali rana1, zahid ali1, fahad amin1, nimra sharif2 1mphil students humdard university, karachi. 2research assistant iobm, karachi. received: 9 january 2019 revised: 11 march 2019 accepted for publication: 27 march 2019 correspondence: nimra sharif, research assistant iobm korangi creek karachi. e.mail: nimra.sharif@iobm.edu.pk this article may be sighted as: rana aa, ali z, amin f, sharif n. prevalence of hepatitis b, c and hiv viruses in blood donors at patel hospital. lmrj. 2019; 1(1): 12-14. doi: 10.38106/lmrj.2019.1.1-04. abstract globally around 70 million people are suffering from chronic hepatitis b virus (hbv), chronic hepatitis c virus (hcv) and human immuno deficiency virus (hiv) infections. owing to inadequate health care facilities and lack of awareness at large, pakistan is also adversely affected by these diseases. the objective of this study was to determine the frequency of transfusion transmitted viral infections among voluntary blood donors at patel hospital karachi. participants were selected through stringent selection criteria ensuring safety of both the donor and recipient. specimens from donated blood were screened for hepatitis b surface antigen (hbsag), antibody against hepatitis c virus (anti hcv) and antibody against human immuno deficiency virus type 1 (hiv-1) and type 2 (hiv-2) using chemiluminosence based assays. a total of 4034 donors were identified, based on the selection criteria, 424 donors were deferred and 3610 were enrolled into the study. anemia was the most common cause for deferral. among the study participants 69 (1.91%) donors were hbsag, 81(2.24%) were anti hcv and 2 were anti hiv-1/hiv-2 infected. it was concluded that the most common cause for donor deferral was anemia and that a significant number of voluntary blood donors are infected with (hbv), (hcv) and (hiv). blood products should, therefore, be properly screened for these infections. keywords: hepatitis b, hepatitis c, hiv, screening, blood donors introduction hepatitis b virus (hbv), hepatitis c virus (hcv) and human immuno deficiency virus (hiv) infections are among the leading global public health problems1. prevalence of these infections is especially higher in the developing countries where it pertains to the lack of resources and appropriate measures2. worldwide, a total of around 248 million people suffer from chronic hbv infection3. hcv infection is relatively less common and affects approximately 80 million people4. hiv affects a total of around 36.9 million people5. hbv and hcv infections are most feared for their hepatic complications which may lead to severe morbidity and mortality. together, the two diseases account for more than 50% of the cases of cirrhosis liver and hepatocellular carcinoma1. however, globally 80% of deaths due to complications of hbv and hcv have been reported to be caused in the less privileged countries lacking in adequate prevention and cure of these diseases6. on the other hand transfusion of blood and its components have become a vital component of modern therapeutics and have a long list of indications7. transfusion transmitted infections (ttis) are, however, the major concern with this therapeutic modality and has led to meticulous screening measures. pakistan is an under-resourced country with inadequate provisions of health care services to majority of its population. a higher prevalence of the aforementioned diseases is hence anticipated. the current study aims at determining the prevalence of hbv, hcv and hiv infections among blood donors in a major tertiary health care hospital located at karachi, the largest city of pakistan. methodology this was a cross-sectional, descriptive study, conducted during the year 2015, at patel hospital karachi. all the individuals who volunteered for blood donation in the stipulated study year were processed. standard procedures of donor selection set at the native blood bank were observed during donor selection process. these included donor’s clinical and behavioral history followed by stringent physical examination and testing with complete blood count (cbc). only adult (18-55 years age) healthy volunteer blood donors were enrolled into the study. research article mailto:nimra.sharif@iobm.edu.pk lmrj volume 1 issue 1 14 | p a g e individuals with known or suspected mental, infectious, uncontrolled metabolic, immunological or systemic disorders and those taking any kind of medications were excluded. an informed consent was acquired in writing from all the enrolled donors. blood screening all the blood donations were screened for presence of hepatitis b surface antigen (hbsag), anti-hcv antibody (anti hcv), anti hiv-1 and hiv-2 antibodies. the tests were carried out onvitros® eciq immunodiagnostics system. the system employs enhanced chemiluminescence technology in its functioning. manufacturer’s guidelines were adopted in determining reactivity of the cases statistical analyses the data was recorded and analysed employing statistical package for social sciences (spss®) version 22. simple arithmetic means and standard deviations were deduced. categorical data were compared with each other using chi square test. the p-value of significance was set at 0.05. results a total of 4034 donors (voluntary and replacement) were processed at the native blood bank of patel hospital karachi during 1st january 2015 to 31st december 2015. after initial donor recruitment scrutiny, 424 donors were deferred. these included 394 (92.9%) cases of anemia, 10 (2.3%) cases of hypotension and 20 (4.7%) cases of active medication. rest of the 3610 donors were enrolled into the study (table 1). of the 3614 donors, a total of 152 (4.2%) donors turned out to be reactive in the screening assays. sixty nine (1.91%) donors were hbsag reactive and 81(2.24%) donors were anti hcv reactive. only two donors were found to be positive for anti hiv-1/hiv-2 (table 1). 80 70 69 70 60 50 40 30 20 10 0 study year (2015) cbc blood pressure drug figure 1. frequencies of various donor deferral causes in study patients 56 49 40 18 16 13 42 1 january 8 12 1 february 23 2 2 7 10 august 11 0 1 10 01 00 march april m uly september october november december j 01 une j 02 ay 40 n u m b e r o f p a ti e n ts lmrj volume 1 issue 1 15 | p a g e table 1. monthly frequency of viral seropositive cases among donors discussion meticulous screening of blood and its products ensures not only recipient’s safety but also imparts an insight into the prevalence of transfusion transmitted infections in general population8. this study was carried out to assess the frequency of designated infectious disease markers in donor population of patel hospital karachi. being a hospital based blood bank, majority of the cases were replacement donations. the overall sero-reactivity for hbsag, anti hcv and anti hiv-1/hiv-2 was determined to be 1.9%, 2.2% and 0.05%, respectively. in a survey conducted by the pakistan medical research council (pmrc) in 2009, it was found that a total of 2.5% of the pakistani population was infected by hbv whereas hcv prevails in around 4.9% of the population9. taking into account the evolving health care facilities in the country, findings from the current study are in agreement with those stated by pmc. these findings are also comparable with those from studies conducted earlier8. anemia was the most common cause for deferral in the current study. studies conducted earlier had comparable findings in terms of the most common cause of deferral10,11. the proportion of cases deferred due to anemia, however, varied considerably. findings in the current study are way too high when compared with previous studies12. iron deficiency has been elucidated to be the most common cause of anemia among donors13. conclusion the results showed that donor were more affected with hepatics c than that of hepatitis b, while none of them suffering from hiv. majority of the donors had awareness regarding the disease and most of them agreed to contribute blood in coming times, if need arises. conflict of interest we hereby declare that we do not have any conflict of interest related to publication of this article. grant support financial disclosures none references 1. easterbrook pj, roberts t, sands a, et al. diagnosis of viral hepatitis. current opinion in hiv and aids. may 2017;12(3):302-314. lmrj volume 1 issue 1 16 | p a g e 2. keramat f, eini p, majzoobi mm. seroprevalence of hiv, hbv and hcv in persons referred to hamadan behavioral counseling center, west of iran. iranian red crescent medical journal. jan2011;13(1):42-46. 3. ganczak m, dmytrzyk-daniłów g, korzeń m, et al. prevalence of hbv infection and knowledge of hepatitis b among patients attending primary care clinics in poland. journal of community health. 2016;41:635644 4. gower e, estes c, blach s, et al. global epidemiology and genotype distribution of the hepatitis c virus infection. journal of hepatology. nov 2014;61(1 suppl):s45-57. 5. stover j, andreev k, slaymaker e, et al. updates to the spectrum model to estimate key hiv indicators for adults and children. aids (london, england). nov 2014;28 suppl 4:s427-434. 6. lavanchy d. evolving epidemiology of hepatitis c virus. clinical microbiology and infection : the official publication of the european society of clinical microbiology and infectious diseases. feb 2011 ; 17 (2) :107-115. 7. seifried e, mueller mm. the present and future of transfusion medicine. blood transfusion. oct 2011 ;9(4) :371-376 8. arshad a, borhany m, anwar n, et al. prevalence of transfusion transmissible infections in blood donors of pakistan. bmc hematology. 2016;16 9. qureshi h, mohamud bk, alam se, et al. treatment of hepatitis b and c throughnational programme--an audit. jpma. the journal of the pakistan medical association.feb 2013;63(2):220-224. 10. nadeem a, salamat n, iqbal n, et al. demographic features of donors and causes of blood donor deferral at armed forces institute of transfusion, rawalpindi. pakistan armed forces medical journal. 2016;66(6). 11. waheed u, zaheer h. evaluation of deferral pattern among the blood donors in islamabad, pakistan. global journal of transfusion medicine. july 1,2016 2016;1(2):81-84. 12. bahadur s, pujani m, jain m. donor deferral due to anemia: a tertiary care center-based study. asian journal of transfusion science. jan 2011;5(1):53-55. 13. da silva ma, de souza carlos am, et al. etiology anemia of blood donor candidates deferred by hematologic screen ing. revista brasileira de hemato logia e hemoterapia. 2012;34(5):356-360 lmrj volume 2 issue 1 12 | p a g e leadership style employed by nurses’ directors and principals at nursing education institutes, hyderabad farah anil 1*, sikandar munir memon1, anil joseph2, erum isaac1, tasleem bibi1, sumera aftab1 1people’s nursing school, lumhs jamshoro. 2b.pharm, msc (business management) correspondence: sikandar munir memon email: drsikander.memon@lumhs.edu.pk lmrj.2020:2(1) doi: 10.3810/lmrj.2020.2.1.03 received: 10 january 2020 revised: 4 february 2020 accepted for publication 8 march 2020 abstract leaders who are able to observe their behavior by themselves as well as the effects of their leadership on workforce are capable enough to adjust to a better style of leadership. this study was intended to evaluate the dominant style of leadership employed by nurses’ leaders at nursing education institutes. overall 10 nurse’s leaders were selected from ten public as well as private school of nursing as participants by purposive sampling out of which one was director nursing and nine were principals at their respective institutes. a descriptive cross-sectional study was conducted by using self-reported questionnaire soughed for data collection. for data analysis spss for window version 20.0 was used for descriptive statistics such as frequency distribution (x), percentage (%), means (x-) and standard deviation (sd) respectively. in the study, four leadership styles were assessed: authoritative, democratic, facilitative, and situational. study findings revealed that the leadership styles practiced by greater part of the nurses leaders are authoritative in nursing education institutes. keywords: leadership, leadership style, nurse leaders, authoritative leadership style introduction according to american nurses credentialing center (ancc), “nursing leadership matters in today’s healthcare environment, experiencing extraordinary intense reforms. contrary to the requirements of leadership yesterday to achieve stability and growth, the leaders of today must transform their organizational values, beliefs and behavior”1. because it depends upon the demonstration of style or performance by supervisors or managers whilst dealing with subordinates. leadership is a significant factor that molds actions of employees for attaining the goals set forth by organizations2. to be an effective nurse manager (nm) it is required to continuously enhance the scope of responsibility along with the knowledge, skills, and attitudes in depth3. leadership in any organization commences to run with the values, behaviors and attitudes. in case of nurses the entrancement in leadership skills could be a probability, pursuit of career, or for the shortresearch article mailto:drsikander.memon@lumhs.edu.pk lmrj volume 2 issue 1 13 | p a g e lived basis. thus for the sake of achieving effective and winning leadership outcomes one of the most critical elements is its effective leadership. among various rational for nurses to turn over or leave the jobs in nursing include excessive workload, non-favorable work setting, however aberrant style of leadership is leading concern above all4. by means of adopting the leadership style which is effective nurse managers or leaders can offer high-quality and conducive environment to staff nurses that can enhance job satisfaction, line of work and intent for retention in an organization 5. the profession of nursing is people-oriented which is focused on humanism that may affect the way of leadership6. during times of remarkable changes in an organization the role of nursing leader is quite challenging and difficult due to complexity and convoluted health system reform. the superlative as well as favorable work setting, increases the tendency of leaders to control strategies not only in managing conflict but also to enhance people’s ability to work collaboratively with efficiency. it turns out to be crucial on behalf of a leader to accomplish organizational goals through emphasizing equivalently for rational and expressive aspects of contradictory issues despite the fact with the purpose to resolve conflicts or disputes which can happen at any stage within the hierarchy of an organization2. this study focuses on evaluation of the pattern of style of leadership used by nurse leaders through their selfassessment in order to boost up their awareness regarding an effective style of leadership for improved and successful outcomes in nursing education institutions. methodology consisted of 10 nurse leaders (04 women and 06 men) from government as well as private nursing institutes; the selection of sample was made by means of nonprobability purposive sampling method. all the participants subjected in the study consented and were well informed concerning the intention of the study along with assurance of protecting the provided information confidentially. overall 10 questionnaires were distributed and 100 percent returned back with complete information provided. the study used self developed selfreport questionnaire comprises of 16 items to facilitate measures of constructs with the complete range of leadership behaviors. for the assessment of tools’ validity, pilot study was done on three senior nursing instructors. participants were asked for reading a short statement on the subject of a precise leadership behavior, showing the scores in the right-side column against each question ascending from (not me at all= 0 ; a bit like me = 1 point; much like me = 2 points; and exactly like me = 3 points). scoring of survey was based on the scoring key provided on the questionnaire to encourage the labeling of a leader as authoritative, democratic, facilitative and situational. results and discussion descriptive statistics of all variables included in the study shows that the participants were primarily males (ie 60%), while 40% were females .the age range of the subjects was between 38 and 63years where 70% of the participants fall between 38 – 50 years, and 30% were lying between 51 63 years (mean= 46 and sd±7.05). the maximum educational level as reported by participants was ms nursing (40%), with the greater part of study participants (60%) having experience of below 5 years’ for being principal school of nursing (mean=1.4 and sd= 0.5). the type of institute revealed that 60% of respondents were government employees and 40 % were working in private settings in hyderabad/ jamshoro. further, lmrj volume 2 issue 1 14 | p a g e scrutiny was made determine the leadership ability in order to distinguish authoritative, democratic, facilitative and situational leadership styles and it was found that, greater part 60 % employed autocratic, 20 % facilitative and 10 % was rated for both 10% democratic, situational style of leadership. study variable (n = participants for question) frequenc y (%) gender 06 (60%) male femal e 04 (40%) age 07 (70%) 38 – 50 51 – 63 03 (30%) length of service as nurse leader <5 years 06(60%) >5 years 04(40%) title of designation director 01 (10%) principal 09 (90%) type of institute government 06 (60%) private 04 (40%) qualification bachelor in nursing 06 (60%) masters in nursing 04 (40%) style of leadership authoritative 06(60%) democratic 01 (01%) facilitative 02 (02%) situational 01(10%) figure 1: length of service table 1: demographic tabulation lmrj volume 2 issue 1 15 | p a g e table 3: scale7,8 figure 2: scale rating conclusion several styles of leadership have appeared to portray how leaders act in order to achieve an affluent product. there is no any single style of leadership that can be considered as the best suited for one individual or one situation. it is vital for nurse leaders to recognize the pattern of training that already have the affinity to generate autocratic leadership style9. nurse leader can be well fitted in place to lead descriptive statistics mean std. deviation n style of leadership 1.8 1.13529 10 i’m glad to act as the spokesperson for our group 2.4 0.69921 10 i’m determined to push projects forward and get results 2.3 0.82327 10 i am good at organizing other people 2.2 0.91894 10 i set myself high standards and expect others to do the same for themselves 2.4 0.69921 10 i believe teams work best when everyone is involved in taking decisions 2 0.8165 10 i enjoy working on committees 2 0.8165 10 i don’t mind how long discussions last, so long as we consider every angle 2.1 0.73786 10 i think all group members should abide by formal decisions, so long as we follow proper procedures 2 0.94281 10 i’m good at bringing out the best in other people 1.7 0.67495 10 i think people should be allowed to make mistakes in order to learn 1.8 0.78881 10 to me well-being of the members is the most important thing for a group 1.9 0.56765 10 love helping other people to develop 1.6 0.84327 10 i don’t consider myself as a ‘leader’but can take on a leadership role when required 1.6 0.69921 10 good adaptability to different situations 1.8 0.63246 10 can see situations from many different perspectives 1.7 0.67495 10 lmrj volume 2 issue 1 16 | p a g e only by means of education and training about various theories and styles of leadership. limitations while assessing manager’s style of leadership, it was unlikely to manage some of the perplexing factors such as the impact of organizational environment, structure as well as the availability of leaders themselves. additionally, study results were entirely based on self-report by participants. the likeli hood of variation along with the desirability of social aspect for response selection on the scales of research variables could not be reduced. recommendations further it is recommended that educational programs for nursing ought to incorporate training of nurse managers in order to recover leadership skills and their mirror image, in the course of which they prove themselves through better leadership style respectively. references 1. edmunds, e. a. (2014). leadership style of nurse managers in a designated magnet hospital. retrieved from http://rave.ohiolin k . e d u / e t d c / v ie w c_num=walsh1398030398. 2. saeed, t., almas, s., anis-ul-haq, m., & niazi, g.(2014). leadership styles: relationship with conflict management styles. international journal of conflict management, 25(3),214-225. 3. tyczkowski, b., vandenhouten, c., reilly, j., bansal, g., kubsch, s. m., & jakkola, r. (2015). emotional intelligence (ei) and nursing leadership styles among nurse managers. nursing admin istration quarterly, 39(2), 172–180 4. perez, j. w. l. (2014). impact of nurse managers â€tm leadership styles on staff nurses â€tm intent to turnover by. nursing thesis and capstone projects, 31 5. naseer, a., perveen, k., afzal, m., waqas, a., & gillani, s. a. (2017). the impact of leadership styles on staff nurses’ turnover intention. journal of medical and pharmaceutical sciences, 3(10), 1133– 1138. 6. azaare, j., & gross, j. (2011). the nature of leadership style in nursing management. british journal of nursing, 20(11), 672– 680. 7. asiri, s. a., rohrer,w. w., al-surimi, k., da’ar, o. o., & ahmed,a. (2016). the association of leadership styles and empowerment with nurses’ organizational commitment in an acute health care setting: a cross-sectional study. bmc nursing, 15(1), 1–10. 8. konstantinou, c., & prezerakos, p. (2018). relationship between nurse managers â€tm leader ship styles and staff nurses â€tm job satisfaction in a greek nhs hospital,7,45–50. 9. sfantou, d., laliotis, a., patelarou, a., sifakipistolla, d., matalliotakis, m., & patelarou, e. (2017). importance of leadership style towards quality of care measures in healthcare settings: a system atic review. healthcare, 5(4), 73. type of the paper (article lmrj volume 4 issue 03 120 | p a g e original article rise in mobile gadgets use for school learning and health issues of childrenlong-term sequelae of covid-19 pandemic nabia shah1, ahmed mohammad shaikh2, fasiha shah3 1school of education, university sans malaysia, malaysia, 2comsats university, islamabad, pakistan, 3school of social sciences, university sans malaysia, malaysia abstract covid-19 pandemic has brought a paradigm shift in education with a trend of online learning and even schooling. during complete lockdown period schools were shifted to smartphones and computers. this study aimed to explore the pattern of smartphone use before and after the covid-19 pandemic and the health issues of school-going children in post-covid-19 period. there was a significant rise in the timings of mobile phone use from 2 hours to 7 hours per day. a total of 90% of student’s mothers reported behavioral change where lack of socializing was the most commonly reported change. irritation of eyes and dryness were the most commonly reported ocular disorders. the rise of mobile phones has brought several behavioral and ocular disorders due to long hours of use. there is a need to confirm health-related issues of smartphone use in large prospective studies and develop preventive strategies. key words: smartphone use, ocular disorders in children, behavioural disorders in children introduction covid19 pandemic started in november 2019, caused by sar-2 virus, reported for the first time from wuhan, china, followed by the devastating spread worldwide resulting in global pandemic. the pandemic has changed the world, business, economy, science, and education(1). due to pandemic, the world was shut down for a long time, including schools. given the indefinite closure period, the education system moved towards work from home and online education. all physical working hours were spent in front of computers and smart phones. the children were greatly hit by the virus, where their education was stopped until the start of online education. all schools were shut for over a year during pandemic worldwide. the majority of students used laptops or mobile phones for online learning, a small proportion of children used desktops, where italian study reported more than 97% of children getting distant learning by using smartphones(2). the online classes timings vary from four to six hours. this means the students remained in front of smart phone or laptop screens for this time. followed by home work and sending it online further raised duration of exposure. a study from british columbia suggested a significant rise from mean 6 hours to mean 8 hours per day of mobile phone use in pre-covid to post-covid, respectively(3). another study focusing on university undergraduate students reported more than 65% of mobile phone addiction prevalence during covid-19 quarantine period(4). an indian study including 122 correspondence: fasiha shah school of social sciences, university sans malaysia penang, malaysia email: fasiha.sw@gmail.com doi: 10.38106/lmrj.2022.4.3-06 received: 26.08.2022 accepted: 16. 09.2022 published: 30. 09.2022 mailto:fasiha.sw@gmail.com lmrj volume 4 issue 03 121 | p a g e individuals reported that young adults aged 15 to 30 were badly affected by the hype in the use of mobile phones and detrimental effects on health(5). the life of children in play group and older without an exception were badly affected(6). there is limited literature available on exploring the impact of longer duration of smart screen exposure and effects on health of the school children. therefore, this study was conducted to evaluate the rise of the exposure hours and its association with ocular health and mental health. methods this was a prospective observational study including parents of school going children. the study was conducted population-based. students studying in class four and above were included. parents with at least one child attending school were requested to be part of the study. the parents were requested to respond to the questionnaire separately for each child if they had more than one child. the questionnaire had three parts, first asking about age and gender, followed by average use of hours per day of smartphone screens before covid-19 pandemic and online education. then post covid-19 use of mobile per day averagely. in the second part the parents were asked regarding eye symptoms or signs of recent onset in their children. section three asked questions regarding behavioral change in the recent past (i.e. post-covid-19). they were also asked about sleeping disturbances. the data was analyzed by using statistical package for the social sciences (spss), version 22.0 (ibm corp., armonk, new york). a p-value <0.05 was considered significant. results a total of 256 parents were included, with 300 children. the mean age of the children was 9.95 years (range 7 to 15 years). there was a significant rise in the use of mobile phone / smartphones or tablets per day (p<0.001), which has risen from the mean of 2 hours per day to the mean of 7 hours per day (figure 1). there was a change in the sleeping pattern of the children (figure 2). ocular symptoms were reported in 91% of children, which ranged from dryness, irritation to change in the vision and use of glasses. a summary of the ocular symptoms is presented in table 1. behavioural change was observed in 90% of children and lack of socialization was most commonly reported (i.e. 26%), a summary of behavioural change is presented in table 1. there was a significant association of behavioural change with increased hours of mobile change (p-value = 0.02). figure 1. hours of mobile phone use per day in school going children pre and post covid-19 figure 2. reported change in sleeping pattern of chidren in post-covid-19 period lmrj volume 4 issue 03 122 | p a g e table 1. pattern of ocular and behavioural disorders in children using smartphone ocular disorders behavioural disorders disorder n (%) disorder n (%) dry eyes 106 (35.3) lack of interest in socialization 78 (26) irritation 79(26.3) lack of interest in real life 52 (17.3) change in vision 54 (18) irritability 52 (17.3) spectacular use 34 (11.3) tiredness 47 (15.7) no change 27 (9.0) anger 39 (13.0) no change 32 (10.7) discussion the study showed a significant rise in the mobile use after covid-19 pandemic among school going children, which has badly affected their sleeping pattern, ocular health and behaviour. there are studies available reported on longer hours of mobile phone use in children and adults, where there is significant rise in post-covid 19 period(3). in one study the use of smart phones during quarantine period was the source of satisfaction and alleviation of loneliness(7). the use of smartphones increased not only for education but also for the awareness of masses regarding the disease. during the period of quarantine public awareness and also communication with patients was easier through health application on mobile phones, in such ways mobile phone use made considerable contribution(8). telemedicine became the most important part of the health care delivery system during covid-19 pandemic(9). the use of telemedicine, even after covid-19 continue to benefit the deprived population. thus, it has a great potential to strengthen healthcare system further. on one hand, it was helpful during the pandemic, but the use of smartphones in most places has remained an addiction. children of school-going age are particularly vulnerable in this situation. it was also feared at the beginning of the pandemic(10). since it is known that the mobile phones emit radiation that gets absorbed in the human tissues. the absorption of the radiation is directly proportional to the time used on mobile phone. international agency for research on cancer (iacr) in 2011 raised suspicion of mobile radiation to be carcinogenic(11). however, it is long term effect and postpandemic rise in particular cancers especially brain tumours and correlating with the mobile use will take time to be proven. in addition to these long term risks, prolonged smartphone use has been reportedly associated with cognitive disorders, issues in socializing, shyness, disorders of eating habits and musculoskeletal issues due to particular posture and lack of physical activity(12). our study has also confirmed short-term complications related to smartphone use, includingg reduced socializing and lack of interest in real life. these can probably lead to cognitive disorders in long term. the study has included young children and their parents were asked about the disorders, thus there is a chance of information bias. also parents themselves encourage use of mobile phones when the child gets irritated. thus information regarding social behaviour is difficult to assess. therefore we consider it as a limitation of our study. a long term prospective study with evaluation lmrj volume 4 issue 03 123 | p a g e of academic performance at school and at the same time evaluation from parents and teachers is suggested. conclusion the study concludes that there has been a significant rise in the use of mobile phones in schoolgoing children post-covid-19 pandemic. there have been health implications on the ocular health as well as on the behaviour of the children. ethical consideration all recruited parents provided informed consent. the identity of the participants was coded. conflict of interest authors declare no conflict of interest funding this was an observational study, no funding required. references 1. nicola m, alsafi z, sohrabi c, kerwan a, al-jabir a, iosifidis c, et al. the socio-economic implications of the coronavirus pandemic (covid-19): a review. int j surg. 2020 jun;78:185–93. 2. serra g, lo scalzo l, giuffrè m, ferrara p, corsello g. smartphone use and addiction during the coronavirus disease 2019 (covid-19) pandemic: cohort study on 184 italian children and adolescents. ital j pediatr [internet]. 2021 dec 2;47(1):150. available from: https://ijponline.biomedcentral.com/articles/10.1186/s13052-021-01102-8 3. jonnatan l, seaton cl, rush kl, li eph, hasan k. mobile device usage before and during the covid-19 pandemic among rural and urban adults. int j environ res public health. 2022 jul;19(14):8231. 4. saadeh h, al fayez rq, al refaei a, shewaikani n, khawaldah h, abu-shanab s, et al. smartphone use among university students during covid-19 quarantine: an ethical trigger. front public heal. 2021 jul;9. 5. tyagi a, prasad ak, bhatia d. effects of excessive use of mobile phone technology in india on human health during covid-19 lockdown. technol soc. 2021 nov;67:101762. 6. rashid a, zeb ma, rashid a, anwar s, joaquim f, halim z. conceptualization of smartphone usage and feature preferences among various demographics. cluster comput. 2020 sep;23(3):1855–73. 7. stevic a, koban k, binder a, matthes j. you are not alone: smartphone use, friendship satisfaction, and anxiety during the covid-19 crisis. mob media commun. 2022 may;10(2):294– 315. 8. pandit ja, radin jm, quer g, topol ej. smartphone apps in the covid-19 pandemic. nat biotechnol [internet]. 2022 jul 20;40(7):1013–22. available from: https://www.nature.com/articles/s41587-022-01350-x 9. smith ac, thomas e, snoswell cl, haydon h, mehrotra a, clemensen j, et al. telehealth for global emergencies: implications for coronavirus disease 2019 (covid-19). j telemed telecare [internet]. 2020 jun 20;26(5):309–13. available from: http://journals.sagepub.com/doi/10.1177/1357633x20916567 10. ratan za, zaman s bin, islam sms, hosseinzadeh h. smartphone overuse: a hidden crisis in covid-19. heal policy technol [internet]. 2021 mar;10(1):21–2. available from: lmrj volume 4 issue 03 124 | p a g e https://linkinghub.elsevier.com/retrieve/pii/s2211883721000022 11. naeem z. health risks associated with mobile phones use. int j health sci (qassim) [internet]. 2014 oct;8(4):v–vi. available from: http://www.ncbi.nlm.nih.gov/pubmed/25780365 12. wacks y, weinstein am. excessive smartphone use is associated with health problems in adolescents and young adults. front psychiatry [internet]. 2021 may 28;12. available from: https://www.frontiersin.org/articles/10.3389/fpsyt.2021.669042/full lmrj volume 1 issue 1 17 | p a g e diagnostic utility of conventional radiography in traumatic skull injury hafiza ummara rasheed1*, sabiha tariq2, noreen fatima3, abida asghar4, tehseena akram5 1college of ophthalmology and allied vision sciences, mayo hospital. 2radiology department, mayo hospital, lahore, pakistan.3,4&5college of ophthalmology and allied vision sciences, mayo hospital, lahore, pakistan. received: 14 january 2019 revised: 6 march 2019 accepted for publication 21 march 2019 correspondence: hafiza ummara rasheed, college of ophthalmology and allied vision sciences, mayo hospital, lahore, pakistan. email: ammara.hafiza15@gmail.com. this article may be sighted as: rasheed hu, tariq s, fatima n, asghar a, akram t. diagnostic utility of conventional radiography in traumatic skull injury. lmrj. 2019; 1(1): 15-17. doi: 10.38106/lmrj.2019.1.1-05. abstract this study was aimed to evaluate specific anatomical structures in patients who have sustained a traumatic brain injury and also to compare ct to x-ray in diagnosing brain injury. it was a cross sectional study, conducted at mayo hospital, from february to may 2017. a total of 65 patients were included in this study. ct was used as gold standard measure for evaluation of close head injuries. the most common trauma, which was found in this study, was motor vehicle 23(43.1%) and back of head was the most affected area 24(36.9%). close head injury was found in 33(58.5%) patients. the sensitivity of skull radiography was 78.85%, whereas specificity was 76.92%. other related risk factors were seen in trauma patients like double vision 28(43.1%), dizziness 59(90.3%), loss of balance 36(55.4%), loss of memory 4(6.2%), headache 58(89.2%), vomiting 21(32.3), and blurred vision 22(33.8%). the identification of fracture on the cranium suggests a significant brain and /or meningeal damage visible on a standardized x-ray film of skull bone. it is recommended that if ct scan is available, the victim of head injury must not have his rontgenogram done since it will give excessive radiations along with unnecessary interruption in reaching the actual diagnosis. however the choice of ideal tool used for the diagnosis for cranial wound is made on the basis of damage on the skull, if the damage is gigantic brain ct is the choice of investigation otherwise x-ray films can also be considered for some minimal problem. keywords: computed tomography (ct), x-ray, traumatic brain injury (tbi). introduction traumatic brain destruction is one of the most important reasons of mortality and morbidity in the developing and developed world alike causing almost half of the victims a permanent disability. radiology plays a pivotal role in determining the magnitude of actual degree of damage caused by the accident and is quite handy in dealing with acute damages. however it is very important to identify the crucial pathogenesis associated with the trauma and the deprived consequences that occur after the head injury in the long run1. injuries to brain, meninges, dura meter and skull bone remain are huge chunk of hospitalization after road traffic accidents and other unfortunate circumstances. these are the most cumbersome injuries responsible for deaths and disabilities1,2. now with the advent of high tech apparatus in the field of diagnostic imaging and radiology, ct scans i.e. computed tomography is considered as a baseline investigation especially in cases of accidents and head trauma. it is a highly reliable tool with precise results provided within a limited period of time that can identify from minute fractures to brain bleeds2. the objective of this study is to determine the utility of both conventional skull x-ray for detection of skull fractures and taking ct head as gold standard. material and methods it is a cross sectional study, conducted at the radiology department of mayo hospital from feb 2017 till may 2017. 65 patients of either gender who presented to emergency department with closed head injury were included in this study. those patients who had open head injuries or require immediate surgical manipulations were not included in this study. extensive physical examination of the injury site was taken before going to the radiology department. x-ray ap and the lateral view was done with philips x-ray machine. ct head was done with toshiba machine ct. research article mailto:ammara.hafiza15@gmail.com lmrj volume 1 issue 1 18 | p a g e scanner(tsx 002a), data was collected for the presence of a fracture and its exact anatomic location. ct was used as a gold standard measure for evaluation of closed head injuries2. results in this study. 46(70.8%) were males and 19(29.2%) were females (table 1). the mean age of the patient was 30.74 years with a range from 17 to 56 years. variable causes of head trauma were noted, most common cause was motor vehicle accident and falling from height and other causes summarised in (table 2). the most common site of trauma was back of head, however all other locations that were involved are described in (table 3). patient complains were double vision 23(43. 1%), dizziness 59(90.3%), loss of balance 36(55.4%), loss of memory 4(6.2%), headache 58(89.2%), vomiting 21(32.3), and blurred vision 22(33.8%). out of 65 cases, 52 patients had a skull fracture on ct. skull x-ray showed fracture in 41 cases, pseudo fractures were visible in 3 cases. 11 cases showed fracture on ct scan only. the sensitivity of skull radiography was found to be 73.35% and specificity was 76.92 %. table 1: gender distribution table 2: causes of traumatic head injury table 3: location of the injury gender frequency %age male 46 70.8 female 19 29.2 causes of injury frequency %age motor vehicle 28 43.1 blow to head 6 9.2 drug abuse 1 1.5 stroke 5 7.7 industrial accident 1 1.5 poison /toxic substance 2 3.1 hemorrhage 1 1.5 fall 21 32.3 site of injury frequency %age forehead 14 21.5 right-side 11 16.9 left-side 5 7.7 back of head 24 36.9 top of head 7 10.8 face 4 6.2 discussion the routine skull radiographic examination cannot detect minute hair line fracture of the cranium. the direction, size and spatial orientation of a fracture determines its visibility on a plain x-ray film. fractures at skull bone of temporal region as well as sphenoid bone fractures are usually missed on radiography. now x-ray is considered obsolete for the diagnosis of skull fractures3,4. ct scan is the investigation of choice for skull injury with sensitivity up to 93% with features like bone window and 3d reconstruction. for this reason it is more precise than conventional radiographs especially in identifying skull fractures causing depression in the cranial cavity5. in our study radiography missed 11 fractures. 56% of those fractures were at temporal bone, 20% at sphenoid bone and 24% in other bones. 3 fractures were misinterpreted as a fracture on radiography. radiography was clearly showing fractures in 41 cases 82% in temporal bone, 12% in occipital bone and 6% in frontal bone. many studies showed that radiographs are less accurate in detecting skull fracture, in a study conducted by goel et al showed that autopsies have more fractures as much as 63.6% as compared to the x-rays performed while alive6. another study also conducted by hiruppathy et al also stated the supremacy of ct over plain radiographs7. according to pfeifer & pape, wrong interpretation of bony breaches is the most significant factor in false negative x-ray films in 15-34.9% of the cases. naïve practioners (26.5%), measurement problems(33.3—60.5%) and different analytical difficulties are also important attributes in causing missed diagnosis of fractures on x-ray films. traces of veins and arteries can cause hindrance in identifying fractures8,9. skull base fractures are one of the most serious traumatic head injury which is almost missed to be diagnosed in radiography. elrahim et al showed in their work that 1.3% linear along with 5.1% depressed fractures were unrecognized on x-rays. also x-rays were unable to capture the breaches present at the base of cranium which were evident on ct scan among 12 patients. in most cases of severe traumatic head injury, there is usually intracranial hemorrhage associated with it10,11. ct head with bone algorithm have high accuracy in diagnosing, staging and preoperative planning of head injury. yousfani et al study on 100 cases concluded that ct scan had superior performance in grading of damage to cranium as compared to roentgenograms. these x-ray films were unable to identify 21 brain damaging fractures12,13. ct scan is the investigation of choice when it comes to correctly detect the lmrj volume 1 issue 1 19 | p a g e problem, grading it and instituting accurate management options timely. it is a very useful, time and cost-effective modality14. conclusion the identification of fracture on the cranium suggests a significant brain and /or meningeal damage visible on a standardized x-ray film of skull bone. it is recommended that if ct scan is available, the victim of head injury must not have his roentgenogram done since it will give excessive radiations along with unnecessary interruption in reaching the actual diagnosis. however the choice of ideal tool used for the diagnosis for cranial wound is made on the basis of damage on the skull, if the damage is gigantic brain ct is the choice of investigation otherwise x-ray films will be enough for some minimal problem. limitations the sample size of this study is quite small and is of the drawback of this study. references 1. davis, p. c. (2007). head trauma.american journal of neurora-diology, 28(8), 1619-1621. 2. tomar, s. s., bhargava, a., & reddy, n. (2013). significance of computed tomography scans in head injury. open journal of clinical diagnostics, 3(03), 109. 3. schiwy-bochat, k. h., langen, h.j., & althoff, h. (1992). limits for recognizing linear fractures of the cranial vault in radiologic diagno-sis. aktuelle traumatologie, 22(2), 57-60. 4. gentry, l. r. (1994). imaging of closed head injury. radiology, 191(1), 1-17. 5. chawla, h., malhotra, r., yadav, r. k., griwan, m. s., paliwal, p. k.,& aggarwal, a. d. (2015).diagnostic utility of conventional radiography in head injury.journal of clinical and diagnostic research: jcdr, 9(6), tc13. 6. goel, m. k., goel, r., kochar, s.r., goel, m. r., sitapura-jaipur, c. m., & goyal, m. k. (2007). fracture of the temporal bone: a tomographic v/s autopsy study. j indian acad forensic med, 29(4), 83-8. 7. thiruppathy, s. p., & muthukumar, n. (2004). mild head injury: revisited. acta neurochirurgica, 146(10), 1075-1083. 8. pfeifer, r., & pape, h. c. (2008). missed injuries in trauma patients: a literature review. patient safety in surgery, 2(1), 20. 9. bešenski, n. (2002). traumatic injuries: imaging of head injuries. european radiology, 12(6), 12371252. 10. culotta, p. a., crowe, j. e., tran, q. a., jones, j. y., mehollinray, a. r., tran, h. b., ... & cruz, a. t. (2017). performance of computed tomography of the head to evaluate for skull fractures in infants with suspected non-accidental trauma. pediatric radiology, 47(1), 74-81. 11. hofman, p. a. m., nelemans, p., kemerink, g. j., & wilmink, j. t.(2000). value of radiological diagnosis of skull fracture in the management of mild head injury: meta-analysis. journal of neurology, neurosurgery & psychiatry, 68(4), 416-422. 12. kim, y. i., cheong, j. w., & yoon,s. h. (2012). clinical comparison of the predictive value of the simple skull x-ray and 3 dimen-sional computed tomography for skull fractures of children. journal of korean neurosurgical society, 52(6), 528. 13. blackwood, b. p., bean, j. f.,sadecki-lund, c., helenowski, i.b., kabre, r., & hunter, c. j.(2016) 14. observation for isolated traumatic skull fractures in the pediatric population: unnecessary and costly. journal of pediatric surgery, 51(4), 654-658. 15. hans, p., mehrotra, a., kumar, p.,agarwal, m., kumar, l., parakh,p., & tyagi, s. (2017). role of computerized tomography as prime imaging modality in the evaluation of traumatic brain injury. int j advinteg med sci,2(1), 17-23. microsoft word article 3_3 mb research article distribution of mega-platelet units (platelet apheresis) during four years at blood bank and transfusion center lumhs hyderabad faheem ahmed memon, khalid yousaf, abdul rehman and ali raza department of pathology lumhs jamshoro/diagnostic and research laboratory lumhs hyderabad. received: 7 may 2019 revised: 24 july 2019 accepted for publication 9 august 2019 correspondence: faheem ahmed memon, department of pathology lumhs jamshoro/diagnostic and research laboratory lumhs hyderabad. e-mail: drfamemon@hotmail.com this article may be sighted as: memon fa, yousaf k, rehman a, raza a. distribution of mega-platelet units (platelet apheresis) during four years at blood bank and transfusion center lumhs hyderabad. lmrj. 2019; 1(3): 55-57. doi: 10.38106/lmrj. 2019.1.3-3 abstract the transfusion of constituents drawn from human blood strengthens up-to date medicine. but, transfusion is not devoid of hazards. platelet transfusions are rising more speedily than the transfusion of other parts. single-donor apheresis clusters are spent favorably commonly known as single donor platelet procedure; blood is obtained from a donor in anticoagulant solution. benefit of solo provider platelets upon shared donor platelets are of decreased hazard of bacterial infection. to determine the distribution of platelet concentrates from healthy donors to various units of luh hyderabad. this cross sectional and descriptive study was done at blood bank and transfusion center, diagnostic and research (d&r) laboratory lumhs hyderabad from march 2012 to february 2016. platelet apheresis was processed in 691 healthy males; age between 21 to 45 years. apheresis was done by cell separators (fresenius hemo care gmbh, germany and trima accel united states). and were distributed in different units of liaquat university hospital, hyderabad, i.e. oncology 176(25.47%), medicine 169 (24.45%), surgery 126 (18.23%), gynecology and obstetrics 115 (16.64%), intensive care unit (icu) 61 (8.82%), casualty 44 (6.36%). reviewing of blood component’s demand is an effective workout to decrease the figure of inapplicable transfusions, given the threats of transfusions despite progresses in preparing them harmless. keywords: platelet apheresis, transfusion, distribution, units. introduction the transfusion of constituents drawn from human blood strengthens up-to date medicine, but, transfusion is not devoid of hazards1. platelet transfusions are rising more speedily than the transfusion of other parts. single-donor apheresis clusters are spent favorably2, commonly known as single donor platelet procedure; blood is obtained from a donor in anticoagulant solution. platelets suspended in plasma are retained as end product and the remaining constituents i.e. red blood cells and plasma are returned to the donor. a single unit of platelet collection manufactured from a unit of entire blood contains, on the average, 7.5 x 1010 platelets and must rise the platelet tally by 5 to 10 x 109/l (5,000 10,000/ml) in a 70 kg beneficiary. apheresis platelet assembles normally contain 3 6 x 1011 platelets, subject on compendium preparation. therefore, 6-times more platelets can be collected at one time through the apheresis than through whole blood donation. benefit of solo provider platelets upon shared donor platelets are of decreased hazard of bacterial infection3. today 50% to 80% of patients with leukemia are given platelet apheresis. indications for platelet transfusion: leukemia, aplastic anemia, aids, hyper-spleenism, sepsis, bone marrow transplant, radioactivity treatment, organ transplant, cardio-pulmonary by pass and dengue fever. purpose/objectives: to determine the distribution of platelet concentrates from healthy donors to various units of lumhs hyderabad. material and methods: this cross sectional and descriptive study was done at blood bank and transfusion center diagnostic & research laboratory, lumhs hyderabad, samples were collected from 691 fit and fine first time voluntary and alternate platelet apheresis donors age between 21 to 45 years from march 2012 to february 2016, details of platelet apheresis were described to each donor who gave due consent earlier the process. donors were selected based on the criteria: weight more than 50 kg, as a minimum 3 months from last whole blood donation or 3 days from previous platelet apheresis, hemoglobin above 12.5 gm/dl, platelet count above 200 x 103/cmm, absence of any illness, no any intake of © 2019 lmrj liaquat medical research journal, 2019, 1, 3 55 non-steroidal anti-inflammatory drugs for last 7 days, not taken aspirin for last 72 hours, negative viral profile i-e hiv, hbv, hcv, syphilis and malaria, abo identical donor for the patient and adequate venous accesses and with request receiving protocol as: patient name, ward/bed # and arrange one mega unit. donor-cell separator choice was depend on the availability of a specific separator at the time of the procedure. procedure was performed on following cells separators platelet apheresis machines: 1. fresenius separator (com.tec), dn (fresenius hemo care gmbh, bad homburg v.d.h, germany) 2. trima accel automated blood collection system result a total of 691 donors were there and platelet apheresis were used in the following departments4 of attached liaquat university hospital hyderabad. no department no of plateletpheresi s percentag e 01 medicine 169 24.45% 02 oncology 176 25.47% 03 surgery 126 18.23% 04 gynaecology and obstetrics 115 16.64% 05 emergency room 44 6.36% 06 intensive care unit (icu) 61 8.82% total 691 100% distribution 61 medicine lmrj the unnecessary use of donor blood in clinical practice. this study revealed that platelet apheresis for obtaining platelet concentrates can be used in many clinical situations. transfusing patients with thrombocytopenia to sophisticated platelet counts has several prospective benefits; as one of the probable advantage is to diminish the frequency of hemorrhagic situations. attention should also be given to the long-lasting sustainability of platelet manufacturing systems, especially given the extraordinary per unit costs, a consideration of the blood service’s need to regain an increasing percentage of charge8. one important benefit of platelet apheresis is that no further supervision is required for the outcome to be labeled as ‘leukoreduced’. leukocytes must be <5 × 106 per concentrate corresponding to usa standards and <1 × 106 per concentrate according to european standards9. one of the negative point is that platelet concentrates have the shortest expiry time of all routine blood components; and they are also associated with risk of bacterial growth particularly beyond the shelf life of 5-day. as demand for platelet transfusions is continuing increasing, donor availability poses a major challenge for blood banks. for that ideal managing of platelet supply, a close relationship between clinicians, blood banks and transfusion specialists is compulsory10. comparative studies a study conducted by trivo et al7 in indonesia used 204 platelet apheresis from 2009-2013 in oncology department in another study by john p. pitman et al8 in namabia used 771 platelet apheresis from 2006-2011 in oncology department. a local study conducted at islamabad by samina tufail amanat et al3 used 200 platelet apheresis from 2010-2014 in dengue fever while a study in trauma center of india by arulselvi s et al4 used 950 platelet apheresis in only one year. 126 discussion 169 176 oncology surgery gynae & obs er icu limitations there is no stock available due to high cost and shelf life, non availability of volunteer’s donors, dependent only patient’s donor don’t know the actual requirement of platelets in wards. conclusion the platelet apheresis procedure is considered relatively safe. however, several complications may occur. it forms an important adjuvant to blood bank inventory. it is also useful platelet apheresis is practiced all over the world. platelet manufacture must comprise widespread guidance of clinicians (on proper component use) as it is an invasive procedure, but it requires a greater dedication to the donor because of the prolonged duration of the procedure as compared to whole blood collection. the primary goal of platelet transfusion is to ensure that it is done safely and used appropriately for specific clinical condition, thereby avoiding in wide variety of clinical situations; the need of platelet concentrates obtained from single donors by apheresis is growing5. transfusing patients with thrombocytopenia to sophisticated platelet counts has several prospective benefits; as one of the probable advantage is to diminish the frequency of hemorrhagic conditions. results of this study we praise that apheresis donors should be observed for post-donation haematological issues. donors © 2019 lmrj liaquat medical research journal, 2019, 1, 3 56 lmrj with noteworthy decrements should be reviewed successively to exclude or, if necessary, treat properly. the generation of high-dose apheresis concentrates has financial associations for transfusion services and blood centers. thus, in end, sensible execution of guidelines for the use of various blood products may help decrease unsuitable use of blood constituents and guarantee their availability to larger number of needy patients as well. knowledge and teaching amongst all those considering patients would go a long way in bringing the percentage of appropriate transfusion to nearly 100%. auditing of blood order is a productive practice to minimize the number of inappropriate transfusions, given the risks of transfusions despite advances in making them safe6. acknowledgment donors, patients and technical staff of diagnostic & research laboratory, lumhs. references 1. william n schofield, george l rubin and mark g dean appro priateness of platelet, fresh frozen plasma and cryoprecipitate trans fusion in new south wales public hospitals mja vol 178 3 february 2003 2. lawrence t. goodnough, david j. kuter, jeffrey mccullough, sherrill j. slichter, john dipersio, john romo, randolph peterson, kenneth j. smith, thomas raife, dianne tomita, and susan armstrong prophylactic platelet transfusions from healthy aphere sis platelet donors undergoing treatment with thrombopoietin blood, 1 september 2001 z volume 98, number 5 3. samina tufail amanat1, huma abdul shakoor1, masooma raza1, nadeem khan2 and abdul rauf2 clinical indications and adverse reactions of platelet apheresis journal of the college of physicians and surgeons pakistan 2015, vol. 25 (6): 403-406 4. arulselvi s, rangarajan k, sunita s, misra m c blood transfusion practices at a level one trauma centre: a one-year retrospective review singapore med j 2010; 51(9): 736 5. stefano fontanaa peter kellerb behrouz mansouri taleghanib platelet recruitment during multiple donor platelet apheresis differs between cell separators transfusion medicine and hemotherapy 2011; 38:195–198 6. minal wade · ratna sharma · mamta manglani rational use of blood components – an audit indian j hematology blood transfusion 25(2):66–69 indian society of hematology and trans fusion medicine 2009 7. trivo et al j clin apher 2015 jun;30(3):139-40. doi: 10.1002/j ca.21350. epub 2014 aug 12 8. john p. pitman1,7, sridhar v. basavaraju1, ray w. shiraishi1, robert wilkinson2, bjorn von finckenstein2, david w. lowrance4, anthony a. marfin1, maarten postma6,7, mary mataranyika3, and cees th. smit sibinga5 namibia’s transition from whole blood–derived pooled platelets to single-donor apheresis platelet collections author manuscript transfusion. author manuscript; available in pmc 2015 october 15. 9. fevzi altuntasa ismail sarib ismail kocyigita leylagul kaynara sibel hacioglub ahmet ozturkc mehmet oztekina musa solmaza bulent esera mustafa cetina ali unala comparison of plateletpheresis on the fenwal amicus and fresenius com.tec cell separators transfus med hemother 2008;35:368–373 10. andreas holbroa, laura infantia, jörg sigleb, andreas busera platelet transfusion: basic aspects swiss med wkly. 2013;143:w13885 © 2019 lmrj liaquat medical research journal, 2019, 1, 3 57 lmrj volume 1 issue 2 24 | p a g e risk factors for ischemic heart disease (ihd) among young and old age groups patients of district peshawar faria maqsood, zahra durrani, farah rabbani, sana khan, sehrish khan, laila wajid, saman gul, hifsa naseem, parkha izhar, sofia sarwar, ibrahim zaz, asad khan & asim hamza northwest school of medicine, peshawar. received: 14 february 2019 revised: 23 april 2019 accepted for publication 23 may 2019 correspondence: dr. fariamaqsood, lecturer, northwest school of medicine, peshawar, pakistan email: vitalvitamin.fm@gmail.com this article may be sighted as: maqsood f, durrani z, rabbani f, khan s, khan s, wajid l, gul s, naseem h, izhar p, sarwar s, zaz i, khan a, hamza a. risk factors for ischemic heart disease (ihd) among young and old age groups patients of district peshawar. lmrj. 2019; 1(2) doi: 10.38106/ lmrj. 2019.1.2-01. abstract ischemic heart disease (ihd) is an important health care problem worldwide. various associated risk factors have been identified for the disease. prevention of these risk factors in the public may improve the attributed mortality rate. to determine the most frequent risk factors among ihd patients of district peshawar, pakistan. a descriptive cross-sectional study design was adopted for this study. adult ihd patients were recruited from two tertiary healthcare centers of peshawar, kp pakistan. the study patients were divided into two age groups. a questionnaire depicting demographic and clinical details of the patients was filled out for each patient. the data collected was compared between the two age groups employing spss version 22. a majority of the younger age group patients lacked in exercise. smoking and hypertension were also found to be more frequent, in respective order, than other risk factors among younger age group patients. high body mass index (bmi) was the most frequent finding in the older age group patients, followed by consumption of fatty diet. inactivity, smoking, and htn were most frequent risk factors found in young adult cad patients of kp, whereas fatty diet and a consequential high bmi were the most frequent findings among the older patients. introduction ischemic heart disease (ihd), also designated as coronary artery disease refers to a group of closely related syndromes caused by an imbalance between myocardial oxygen supply and its demand1. in more than 90% of cases it is a consequence of decreased coronary blood flow secondary to obstructive atherosclerotic vascular disease2. in less frequent cases it results from increased oxygen demand (hypertension), diminished blood volume (pneumonia or chf) or diminished oxygencarrying capacity (anemia or carbon monoxide toxicity). the non-modifiable risk factors include age, gender and positive family history. the modifiable risk factors include hypertension (htn), smoking, stress, diabetes mellitus (dm), obesity and sedentary lifestyle3. ihd is considered a modern epidemic by who in 19824. in 1999 over 33.3% of all deaths in the us were due to ihd. it additionally accounts for more than 18% of disability adjusted life years (daly) in highincome countries and more than10% daly in middle and lowerincome countries5. indo-asian nations are reported to have the highest rates of cad, worldwide6.in a previously conducted study, the mortality rate in pakistani population due to cad was reported to be 410/100000 deaths per year7. the disease has been reported to pose a great amount of burden on health care system in various populations around the world8. studies’ depicting the frequency of various risk factors in different age groups of local cad patients belonging from the province of kp is lacking. the current study was hence aimed at elucidating this data. findings of the study will help the authorities and concerned health professionals in adopting appropriate preventive and curative measures. thus this study was designed to identify the common risk factors of ischemic heart disease in the elderly and young patients from kp. methodology this was a hospitalbased descriptive cross-sectional study.ihd patients were identified at khyber teaching hospital and hayatabad medical complex, peshawar. both hospitals have well-developed cardiology units for patients with ihd. the study was conducted from april 2012 to september 2012. adult patients of pakistani origin with ihd of research article mailto:vitalvitamin.fm@gmail.com lmrj volume 1 issue 2 25 | p a g e either gender were selected. the patients were divided into two age groups, i.e. >45 years and ≤45years. owing to the corresponding prevalence of patients in the respective age groups, the >45yrs age group was assigned 100 patients while the ≤45 years age group was assigned, 50 patients. those with concomitant congenital heart diseases or other syndromes were excluded from the study. a comprehensive questionnaire, taking into account the demographic details and assessment for various ihd risk factors were filled out for all the patients by appropriately trained healthcare professionals. the data was recorded and interpreted with the help of spss(version22). chi-square test was employed in comparison to qualitative variables among study patients; the coefficient interval was kept at 95%. results a total of 150 ihd patients, 100 in the older adults age group of >45 years and 50 in the younger adults age group (≤45 years), were enrolled in the study. among the study patients, 85 regularly performed exercise. the details regarding the kind and duration of exercise was not obtained. sixty-five patients did not observe exercise at all; a majority (n=32,64%) of these were from the younger age group(table1). on the contrary, 67% of those from older age group exercised regularly. in this study, we found a significant number of patients (n=55, 36.66%) had been smoking cigarettes (table1). the frequency of smokers was significantly higher (p value 0.042) in the patients from younger age group (48%). dietary history was obtained and compared between the two age groups. it was found that a majority of the patients in either age group took fatty diet; the difference, however, was statistically insignificant (p value 0.9). diabetes is a well-known risk factor for ihd. in the current study, a total of 51(34%) patients were suffering from dm. the frequency among patients from the young age group was especially high (48%) as compared to the older age group patients (27%). the difference between the two groups, however, was statistically insignificant (p value 0.10). hypertension is another leading risk factor for ihd. in the current study, a significantly higher number of patients (n=85,56.66%) was suffering from this disease. the frequency was significantly higher among patients from younger age group, i.e.78%, in comparison to those from the older age group (46%). subjective mental stress was comparable among the two age groups (table1). similarly, a non-significant difference was obtained among the two groups when compared for different body mass index (bmi) status (table1). a previous history of ihd in the family among blood relatives was also comparable between the two age groups (table 1). table 1. frequencies ofvarious ihd risk factors among young and adult age groups study parameter young age group n(%) old age group n(%) p-value exercise yes 18(36) 67(67) <.001 no 32(64) 33(33) smoking yes 24(48) 31(31) 0.042 no 26(52) 69(69) diet balanced 23(46) 47(47) 0.9 fatty 27(54) 53(53) dm yes 24(48) 27(27) 0.10 no 26(52) 73(73) htn yes 39(78) 46(46) <0.001 no 11(22) 54(54) mental distress yes 16(32) 29(29) 0.705 no 34(68) 71(71) bmi normal 15(30) 38(38) 0.393 overweight 14(28) 31(31) obese 21(42) 31(31) family hx of ihd yes 18(36) 17(17) 0.729 no 32(64) 83(83) bmi, body mass index; dm, diabetes mellitus; htn, hypertension; hx, history; ihd, ischemic heart disease lmrj volume 1 issue 2 26 | p a g e discussion the current study elicited frequencies of eight known ihd risk factors among younger and older adults of district peshawar.htn (n=39,78%) was the most frequently found risk factors in the younger age group patients. the incidence of htn is on the rise in young adults suffering from ihd9. in a study conducted in japan in 1990, htn was reported as the most common ihd risk factor among young ihd patients10. exercise has been reported to lower the incidence of ihd11. in the current study, lack of exercise was found to be the second most common ihd risk factor (n=32,64%) among patients from t h e younger age group. this may pertain to the relatively casual behavior at younger ages as compared to the older ones. in a previous study conducted on healthy individuals from other provinces of pakistan, a higher frequency (17%) of lack of exercise was reported12. this advocates findings from the current study. among patients from an older age group, the most frequent risk factor was high bmi (62%). this parameter is already reported as a common risk factor among ihd patients13. the higher prevalence in the current study may be attributed to the increased consumption of a fatty died in this age group. consumption of fatty diet was recorded to be the second most commonly found an ihd risk factor in older adults. the two age groups varied significantly for three ihd risk factors, i.e. lack of exercise, smoking and htn. regular exercise was more frequent among patients from older age group, whereas smoking was more common in the younger age group patients. both these attributes pertain to the inherent casual behavior among young adults as compared to the older ones. on the whole, in the current study hypertension was the leading ihd risk factor (31.75%). hypertension is a wellknown risk factor for ihd worldwide14.various behavioral and genetic factors may lead to htn15. an assessment of these are suggested in pakistani population. conclusion it was concluded that lack of exercise, smoking, and consumption of a fatty diet, dm, htn, mental distress, high bmi and previous family history of ihd are all frequently found in ihd patients of district peshawar. lack of exercise and smoking are especially more frequent among young adults whereas consumption of fatty diet and consequent rise in the bmi are relatively more common in the older adults. references 1. gertler mm, leetma he, saluste e, rosenberger jl, guthrie rg. ischemic heart disease.circulation. 1972; 46(1): 103-11. 2. mehta jl, nicolini fa, donnelly wh, nichols ww. plateletleuko-cyte -endothelial interactions in coronary artery disease. the american journalof cardiology.1992;69(7):b8-b13. 3. thayer jf, yamamoto ss, brosschot jf. the relationship of autonomic imbalance, heart rate variability and cardiovascular disease risk factors. international journal of cardiology. 2010;141(2):122-31. 4. manishad, kumargp, saxenag. role of terminalia arjunain ischemic heart disease (hridaroga):a review .international journal of ayurveda and pharma research. 2015;3(2). 5. abegundedo, matherscd, adam t, ortegonm, strong k. the burden and costs of chronic diseases in low-income and middle-income countries. the lancet. 2007;370(9603):1929-38. 6. jafar th,qadri z, chaturvedi n. coronary artery disease epidemic in pakistan: more electrocardio graphic evidence of ischaemia in women than in men. heart. 2008;94(4):408-3. 7. samada, sahibzadaw, mattua. risk factor analysis in a random population of 4 cities in pakistan. pak j cardiol. 1992;3:7-14. 8. tarride je, lim m, des meules m, luo w, burke n, o’reilly d, etal. a review of the cost of cardiovas cular disease. the canadian journal of cardiology. 2009;25(6):e195-202. 9. devenecia t, lu m,figueredo vm. hypertension in young adults. postgraduate medicine. 2016;128(2):201-7. 10. tomono s,ohshima s,murata k. the risk factors for ischemic heart disease in young adults. japanese circulationjournal.1990; 54(4):436-41. 11. la gerche a, prior dl. exercise—is it possible to have too much of a good thing? heart, lung and circulation. 2007;16:s102-s4. 12. jafary fh,aslam f,mahmud h, waheed a,shakir m,afzal a,et al. cardiovascular health knowledge and behavior in patient attendants at four tertiary care hospitals in pakistan–a cause for concern. bmc public health. 2005;5(1):124. 13. nordestgaard bg, palmer tm, benn m, zacho j,tybjærg-hansen a,smith gd, etal.the effect of lmrj volume 1 issue 2 27 | p a g e elevated bodymass index on ischemic heart disease risk: causal estimates from mendelian randomisation approach. plos medicine. 2012;9(5):e1001212. 14. wilson pw. established risk factors and coronary artery disease: the framingham study. american journal of hypertension. 1994;7(7_pt_2):7s-12s 15. kunes j, zicha j.the interaction of genetic and environmental factors in the etiology of hypertension. physiological research. 2009;58:s33. lmrj volume 1 issue 2 43 | p a g e the efficacy of hands on workshop on infection control to healthcare professionals: an intervention study samina naz mukry*, dilnasheen safdar, riafat ali, ashfaq ahmed attari and tahir sultan shamsi national institute of blood disease & bone marrow transplantation, karachi, pakistan. received: 1 april 2019 revised: 24 june 2019 accepted for publication 12 july 2019 correspondence: dr. samina naz mukry national institute of blood disease & bone marrow transplantation, st 2/a block17 gulshan-e-iqbal kda scheme 24, karachi, pakistan e-mail: smukry@gmail.com this article may be sighted as: mukry sn, safdar d, ali r, attari aa, shamsi ts. the efficacy of hands on workshop on infection control to healthcare professionals: an intervention study lmrj. 2019; 1(2): 58-60. doi:10.38106/ lmrj. 2019.1.2-05. abstract strict compliance with basic infection control practices such as standard precautions is a simplest way of controlling spread of hospital acquired infections. a one day hands on infection control workshop was conducted at national institute of blood diseases in april 2017. the nursing staff (ns; n=51) and allied healthcare professionals (ahcp; n= 24) at the institute were requested to participate in this study. the participants were informed verbally and asked to fill out a short questionnaire right before starting and at the end of the workshop to evaluate their knowledge and performance/attitude towards general infection control practices. the response rate, mean and standard deviation of each test score were determined using spss version 23. there was a significant difference between the pre-workshop and post-workshop test scores for nurses (p<0.001).the score for ahcp was comparatively better than the nurses in preworkshop test with an average of 11.25±1.11. although the result for the ahcp improved in post-workshop but difference between the mean scores was statistically insignificant (p=1). gaps in knowledge and attitude/ performance were observed based on percentage of right answers in both categories but a significant difference p=0.0042 was observed in performance and attitude category in post workshop test scores. it can be concluded that educational session along with hands on workshops can be a significant tool in building a culture of safety environment in a hospital. keywords: infection, nursing staff, healthcare professionals, performance/attitude, workshops, hospital. introduction hospital acquired infections (hais) have been reported as one of the cause of adverse outcomes in most disease conditions. the hais are the major cause of prolonged hospitalization, increased hospitalization cost and even mortality. patients particularly suffering from hematological malignancies or aplastic anemia etc often receive chemotherapy with bone/stem cell transplant as part of treatment regimen. these immuno-compromised patients are generally placed in isolations with controlled air pressures and designated staff to avoid hais. despite strict regulations patients acquire hais even in these wards as reported in other studies1-4. as an infection control initiative, blood and body fluids from any patients should be considered as potentially infective material thus standard precautions should be taken to avoid spread of infection at any possible instance. compliance with standard precautions plays an important role in preventing hais in these isolation wards6,7. standard precautions include considering strict hand hygiene compliance, proper use of personal protective equipments (ppe), safe injection practices, infection control measures during lumbar puncture procedures, cough etiquette, proper waste management and disposal10. who recommends training of staff regarding standard precautions with special emphasis on hand hygiene12. hands are the commonest vehicle for transmission of infections in closed isolation settings. literature supports the efficacy of education and hands on trainings in improving the overall rate of infections in different healthcare facilities worldwide. the main purpose of this study was to determine the level of knowledge of standard precautions/infection control practices as well as to determine performance/attitude towards these. material and methods: national institute of blood disease & bone marrow transplantation (nibd), karachi, pakistan is a teaching general hospital which provides medical care for patients. this interventional study was performed during and at the end of a hands on workshop on infection control held at nibd in april 2017. about 73 health care professionals participated in the workshop altogether. the participants were broadly divided into two categories i.e. nursing staff (ns=51) and allied health care professionals (ahcp=24). the ns included 9 registered nurses, 23 certified nurses and 19 nursing assistants while ahcp included 11 doctors, 6 pharmacists, 4 laboratory technologists, 2 faculty members and 1 administrative o fficer respectively. research article mailto:smukry@gmail.com lmrj volume 1 issue 2 44 | p a g e ethical approval was taken from the institutional ethical committee prior to workshop while verbal consent to fill out a selfreported questionnaire was taken from the participants at the beginning of the workshop (table-1). the questionnaire was specially designed containing 14 questions altogether to cover areas of knowledge and performance/attitude towards standard infection control practices with equal distribution of questions i.e. 7 for each category. the participants filled out these 14 questions questionnaire at the beginning and end of the workshop. the answers were marked as “right”, “wrong” or “no answer”. the response rate, mean and standard deviation of each test score were determined using spss version 21. the significant difference between the two tests were calculated by students t-test. the level of significance was set at 5% for all observations. results the rate of response to questionnaire was good i.e. 93.33% (70/75). there was a significant difference between the pre-workshop and post-workshop test scores for nurses(p=0.0058; table-2). the score for ahcp was comparatively better (11.25± 1.11) than the nurses (9.81±2.34) in pre-test (table -2) although the score for the ahcp improved in post test (12.1±0.85) but difference between the mean scores was statistically insignificant (p=1). gaps in knowledge and attitude/ performance were observed based on percentage of correct responses to questions in both categories. frequency of right response to questions in pre-workshop and post-workshop test was lower in attitude/ performance category in both groups. a significant difference p=0.0042 was observed in performance and attitude category in cumulative post workshop test scores of all participants (figure-1). table 1: knowledge and performance/ attitude questions knowledge questions performance and attitude questions 1. standard precautions are precautions taken to reduce the transmission of infections 1. ppe like gloves and gowns should not be worn in corridors, staff room, office or linen room etc. 2. the hand washing is an effective substitute for use of gloves 2. masks and goggles must be worn for care activities such as care of patients who have a cough. 3.the objective of standard precautions is infection prevention inside a hospital 3. hands must always be washed after removing gloves. 4. the use of personal protective equipments along with hand washing is effective in infection control. 4. in a hospital, standard precautions are the responsibil ity of nurses and doctors only. 5. microorganisms can spread through food, drinks, water and fomites etc 5.effective hand washing should be performed for 30-40 seconds with use of friction to clean between fingers, palms, nail beds, back of hands and wrists 6. hands cannot be cleaned with alcohol-based hand gel if visibly dirty. 6. you should wash your hands before/after: preparing food, taking off gloves, entering into a patient’s room. 7. all the hospital staff is responsible for cleanliness within the hospital to control spread of infection. 7. no objects like rings, watches nail art etc are allowed when you are bare below the elbows. table2: test scored of workshop participants lmrj volume 1 issue 2 45 | p a g e workshop participants pre-workshop test mean score±sd post-workshop test mean score±sd pvalue ns 9.07±2.35 11.41±1.57 0.0058 ahcp 11.25±1.11 12.1±0.85 1.00 ns=nursing staff; ahcp= allied healthcare professionals figure 1: frequency of positive response to the knowledge category and performance/attitude category of questions in pre-workshop and post-workshop tests by nursing staff (ns) and allied health care professionals (ahcp). discussion there are multiple factors which contribute significantly to occurrence and persistence of hais in healthcare facilities7. the nurses and patients are the highly susceptible group to hais due to continued risk of exposure to pathogen9. non compliance of healthcare workers with good infection control practices or basic standard precautions is the commonest factor2,3,6. the reported reasons for non compliance by healthcare workers are: over-occupied staff with multiple responsibilities expressing shortage of time, natural skin irritation due to rubber or latex in ppe, absentmindedness due to lack of training and knowledge. in a recent study vincent et al., suggested that training regarding standard precautions particularly of hand hygiene during and after patient care may reduce hais11. the rate of hand hygiene is estimated to be less than 50% in most studies3,4. brevidelli and colleagues quoted a 38.5% global compliance rate for standard precautions owing greatly to personal and organizational factors5. educational workshops and availability of required resources like availability of hand rubs, soap and paper towel etc. have been a proven source of betterment in the compliance rate as reported in earlier studies4,5. during the present study the observed rate of positive response to performance and attitude category questions was lower than the knowledge category (figure 1).in a qualitative study with a focus group efstathiou et al noticed low or nonexistent adherence to standard precautions despite prior knowledge by the nursing staff 6. there was a significant difference (p=0.0058) in response to knowledge and performance /attitude category right after the workshop among ns (table-2). adly et al also observed a significant difference in knowledge of aims and indications of standard precautions among nurses with a response rate of 91.7% and 63.3% immediately after the interventional training compared to 83.3% and 38.3% at three months follow up1. it was interesting to note that the mean score for the registered nurses in pre-workshop and post-workshop tests was 8.75±1.83 and 11.37±0.51 (p=0.0016) while doctors had a mean score of 10.90±1.30 and 12.09±0.94 (p=0.024) respectively. these results are in contrary to other studies where compliance was higher in nurses compared to doctors4,9. difference in the two tests scores indicates that the educational session with hands on workshop had a positive impact on the overall knowledge and attitude towards standard infection control practices. continued educational and training modules are desirable. such sessions will have positive impact on the goal of satisfactory implementation of good infection control practices at nibd. furthermore, planned and structured training cum teaching models should be followed to achieve this goal. references 1. khan s, siddiqui n. pharmacotherapeutics knowledge of some nonemergency and emergency conditions among medical undergraduates in an indian medical college. indian j pharmacol. 2016;48(3):252. 2. tevatia s, chaudhry s, rath r, dodwad v. a questionnaire based survey on knowledge, attitude and practice of antibiotics among dental and paramedical students a cross sectional survey. world j pharm pharm sci. 2016;5(5):1205–16. 3. fluent mt, jacobsen pl, hicks la. considerations for responsible antibiotic use in dentistry. vol. 147, journal of the american dental association. 2016. p. 683–6. lmrj volume 1 issue 2 46 | p a g e 4. wise r, hart t, cars o, streulens m, helmuth r, huovinen p, et al. antimicrobial resistance. is a major threat to public health. bmj. 1998;317(7159):609–10. 5. van spreuwel pcjm, blok h, langelaar m, kullberg bj, mouton jw, natsch s. identifying targets for quality improvement in hospital antibiotic prescribing. neth j med. 2015;73(4):161–8. 6. bell bg, schellevis f, stobberingh e, goossens h, pringle m. a systematic review and meta-analysis of the e f fects of antibiotic consumption on antibiotic resistance. bmc infect dis. 2014 dec 9;14(1):13. 7. jain a, bhaskar d, gupta d, khurana r, yadav p, garg y, et al. knowledge regarding prescription of drugs among dental students: a descriptive study. j basic clin pharm. 2016;7(1):12. 8. hassan nb, ismail hc, naing l, conroy rm, abdul rahman ar. development and validation of a new prescription quality index. br j clin pharmacol. 2010 oct;70(4):500–13. 9. karibasappa g, sujatha a. antibiotic resistance – a concern for dentists? iosr j dent med sci. 2014;13(2):112– 8. 10. kotwani a, wattal c, joshi p, holloway k. knowledge and perceptions on antibiotic use and resistance among high school students and teachers in new delhi, india: a qualitative study. indian j pharmacol. 2016;48(4):365. 11. segura-egea jj, gould k, en bh, jonasson p, cotti e, mazzoni a, et al. antibiotics in endodontics: a review. vol. 50, international endodontic journal. 2017. p. 1169–84. 12. dhingra s, khan m, maharaj s, pandey s, patel i, ahmad a. knowledge, attitude and practice of b.sc. pharmacy students about antibiotics in trinidad and tobago. j res pharm pract. 2015;4(1):37. lmrj volume 1 issue 3 47 | p a g e differential viral load of hbv and hcv in co-infected patients: a potential battle between the viruses saeed khan1, muhammad shahid1, shaheen malik2, amanullah lail1, nazir ahmed3, mohammad asif qureshi1, rameela rizvi1, suleman khan4, naseem ahmed1, ambreen khokar1, maria zahid1, asif iqbal6, shaheen shrafat1 1dow universityof health sciences, karachi 2baqai medical university, karachi 3barrett hodgson university, karachi 4lady reading hospital, peshawar 5hamdard university, karachi correspondence: dr. saeed khan, department of pathology dow diagnostic reference and research lab (ddrrl), dow university of health sciences, karachi, pakistan. email:saeed.khan@duhs.edu.pk saeedkhn@gmail.com received: 1 june 2019 revised: 21 august 2019 accepted for publication 4 september 2019 doi: 10.38106/lmrj. 2019.1.3-01. abstract viral hepatitis is one of the major health problems, in which hepatitis b virus (hbv) and hepatitis c virus (hcv) have the highest affinity to cause chronic liver disease. 5% of the people are infected from hbv and 1% are infected from hcv worldwide. in pakistan 7.4% of the population is suffering with hbv and hcv (an overview of hepatitis b and c in pakistan). co-infection is more frequent than single infection particularly in areas where these two viruses are endemic. this study was conducted to observe and compare the viral loads of hbv and hcv in co-infected and mono infected patients in karachi, pakistan. a total 419 serum samples were collected from suspected patients with hbv and hcv infection. 276 were males and 143 were females, with the age ranging from 10 to 40 years. hbv dna and hcv rna were extracted. hcv viral load was detected in 86 patients (20%), whereas hbv/hcv co-infected patients were detected in 89 (21%) patients. in co-infected patients, an hcv viral load of <1000 was found in 37 (41%) patients while the viral load >1000 was 52 (58%) patients. the hbv viral load of <1000 was found in 32 (35.95%) patients and >1000 was in 57 (64.04%). 87 (20.76%) of the patients tested negative for both hbv and hcv. the hbv viral load was higher than hcv viral load in co-infected patients, indicating that there may be a competition between the two viruses in which hcv is suppressed by hbv. keyword: hbv/hcv; viral load; pakistan introduction globally hbv and hcv are important human pathogens that can cause chronic liver disease resulting in cirrhosis and even hepatocellular carcinoma. it is estimated that nearly 350 million people around the world are infected with the hepatitis b virus (hvb) and 170 million people are infected with hepatitis c virus (hcv)1. the viruses are classified as hepatotropic viruses because they replicate primarily in the liver. both viruses belong to different families and therefore have different life cycles. hbv belongs to a hepadnaviridae family and hcv belongs to a flaviviridae family2. co-infection of these two viruses is prevalent in areas where these viruses are endemic. in non-endemic areas, co-infection of hbv/hcv is found in the high risk population which includes research article mailto:saeed.khan@duhs.edu.pk mailto:saeedkhn@gmail.com lmrj volume 1 issue 3 48 | p a g e injection drug users, immunocompromised patients, organ transplantation recipients, and persons having multiple sex partners3. some cross-sectional studies have shown that in comparison with monoinfection of hbv and hcv the co-infection has a higher prevalence of liver cirrhosis4-6. clinical observation on disease outcome and procession among patients with both hbv and hcv are uncertain and inconsistent. reports declare reciprocated replicative abstinence of these two viruses and viral disturbance7,8. there is a lack of an appropriate model system, thus molecular and virological aspects of the co-infection of hbv and hcv are not well established2. co-infection of hbv/hcv can occur because they share same route of transmission and patients are at high risk of progression to hepatocellular carcinoma (hcc)9-11. numerous studies have revealed the possible interaction of hbv and hcv and their associated effects on immune response. these studies also discovered that in co-infection both viruses are capable of inducing suppression over the other depending on the condition of co-infection11-13. in coinfected patients, the suppression of either one of the viruses depends on which virus was introduced first. hbv superinfection is less common than hcv superinfection comparatively. some reports have declared the clearance of hcv infection after the superinfection of hbv, whereas in asian countries, hcv superinfection is common where hbv is prevalent13,14. materials and methods: a total of 419 samples were collected, out of which 276 were male (65.8%) and 143 were female (34.1%) within the age group of 10 to 40 years. patients known to have chronic liver disease due to any reason other than hbv and hcv were excluded. patients with dual infection of hbv/hiv, hbv/hdv, hcv/hiv or with triple infection were also excluded. hbv dna was extracted from 500 µl of serum by using the abbott m2000sp, an automated sample preparation system designed for the purification of nucleic acids from the samples. hbv dna was quantified with abbott hbv quantification kit by using abbott rt2000 amplification and detection system. the target region of this kit is the conserve region of hbv surface antigen and the lower detection limit of kit is 10 iu/ml. hcv rna was also extracted from 500 µl of serum by using the abbott m2000sp. hcv rna was quantified with abbott hcv quantification kit by using abbott mrt2000 amplification and detection system. the target region of this kit is the conserve region of hcv (5 prime utr) and the lower detection limit of kit is 12 iu/ml. results a total of 419 samples were extracted and amplified to obtain hbv and hcv viral loads. out which 332 were positive and 87 were negative for hbv and hcv (figure 1). gender distribution showed that 276 (66%) were male and 143 (34%) were female (figure 2). this showed a higher prevalence of hbv and hcv in males as compared to females. hbv was detected in 157 patients and hcv was detected in 86 patients with co-infection of hbv/hcv detected in 89 patients. (figure 3). out of 89 co-infected samples, the hbv viral load <1000 was observe in 32 (36%) samples, whereas, hbv viral load > 1000 is observe in 57 (64%) samples. on the other hand, hcv viral load < 1000 was observe in 37 (42%) samples and hcv viral load >1000 is observe in 52 (58%) samples. lmrj volume 1 issue 3 49 | p a g e figure 1: total no of positive and negative patients figure 2: hbv and hcv viral loads in 419 samples figure 3: frequency of hbv, hcv and co-infection hbv/hcv figure 4: hbv and hcv viral load in coinfected patients discussion a medical condition like co-infection of hbv/hcv is of great concern due to its treatment response, unpredictable clinical appearance and development of liver cirrhosis or carcinoma. hbv and hcv have common risk factors for infection, so the co-infection of these viruses is not uncommon15-17. to the best of our knowledge the data regarding the prevalence of hbv/hcv co-infection is still limited3. and there is not ample information regarding the treatment of these coinfected patients. the recent guidelines cannot approve any specific treatment for co-infected patients16. pakistan is included in developing countries with limited economic and health care resources, low literacy rate and limited awareness about diseases. hbv and hcv share the same route of transmission, so there is a high risk of developing co-infection of hbv/hcv. the combined action of both hbv and hcv increases the chances of cancer due to combined oncogenic effects of both viruses. in this study, we observed the age of infected individuals ranging from 10 to 40 years. males were more infected than females which may be due to exposure of high risk activities. lmrj volume 1 issue 3 50 | p a g e out of 419 patients 157 (37.4%) were hbv positive patients and 86 (20%) were hcv positive. there was a higher chance of hbv infection as opposed to hcv. 89 (21%) of the patients were con-infected with both viruses, which established that there was a higher increase in co-infection. combination therapy of peginterferon and ribavirin is recommended as a standard treatment for mono infection of hcv17. unfortunately, because of little data available on the co-infection, there is no established treatment for hbv/hcv co-infected patients3. a study reported that in hbv with chronic hepatocellular carcinoma both peg-interferon and conventional interferon-based regimens were not effective18. recently in taiwan a randomized prospective trial showed that for both hcv mono-infection and hbv/hcv co infection the combination therapy of peg interferon and ribavirin is equally effective19. we observed high viral load of hbv dna as compared to hcv rna in co-infected patients, which is, may be due to possible competition of both viruses and in result possible suppression of hcv by hbv. there is also a possibility of inactive carriers. in hbv and hcv co-infected patients the treatment ability of the combination therapy of ribavirin and peg-interferon alpha was relatively similar to hcv monoinfection patients, though there are less studies to support this data. the recurrence of hbv replication is very susceptible after the viral suppression of hcv and the treatment of chronic hepatocellular carcinoma. references 1. koff r. s. risks associated with hepatitis a and hepatitis b in patients with hepatitis c. j clin gastroenterol. 2001;33(1):20-6. 2. volker brass darius moradpour. new insights into hepatitis b and c virus co-infection. journal of hepatology. 2009;51(3):423–5. 3. chu c. j., lee s. d. hepatitis b virus/hepatitis c virus coinfection: epidemiology, clinical features, viral interactions and treatment. j gastroenterol hepatol. 2008;23(4):512-20. 4. mohamed ael s., al karawi m. a., mesa g. a. dual infection with hepatitis c and b viruses: clinical and histological study in saudi patients. hepatogastroenterology. 1997;44(17):1404-6. 5. chakravarti a., verma v., jain m., kar p. characteristics of dual infection of hepatitis b and c viruses among patients with chronic liver disease: a study from tertiary care hospital. trop gastroenterol. 2005;26(4):183-7. 6. fong t. l., di bisceglie a. m., waggoner j. g., banks s. m., hoofnagle j. h. the significance of antibody to hepatitis c virus in patients with chronic hepatitis b. hepatology. 1991;14(1):64-7. 7. liaw y. f., tsai s. l., chang j. j., sheen i. s., chien r. n., lin d. y., et al. displacement of hepatitis b virus by hepatitis c virus as the cause of continuing chronic hepatitis. gastroenterology. 1994;106(4):1048-53. 8. zarski j. p., bohn b., bastie a., pawlotsky j. m., baud m., bostbezeaux f., et al. characteristics of patients with dual infection by hepatitis b and c viruses. j hepatol. 1998;28(1):27-33. lmrj volume 1 issue 3 51 | p a g e 9. chiaramonte m., stroffolini t., vian a., stazi m. a., floreani a., lorenzoni u., et al. rate of incidence of hepatocellular carcinoma in patients with compensated viral cirrhosis. cancer. 1999;85(10):2132-7. 10. kaklamani e., trichopoulos d., tzonou a., zavitsanos x., koumantaki y., hatzakis a., etal. hepatitis b and c viruses and their interaction in the origin of hepatocellular carcinoma. jama. 1991;265(15):1974-6. 11. pontisso p., gerotto m., ruvoletto m. g., fattovich g., chemello l., tisminetzky s., et al. hepatitis c genotypes in patients with dual hepatitis b and c virus infection. j med virol. 1996;48(2):157-60. 12. chu c. m., yeh c. t., liaw y. f. low-level viremia and intracellular expression of hepatitis b surface antigen (hbsag) in hbsag carriers with concurrent hepatitis c virus infection. j clin microbiol. 1998;36(7):2084-6. 13. jardi r., rodriguez f., buti m., costa x., cotrina m., galimany r., et al. role of hepatitis b, c, and d viruses in dual and triple infection: influence of viral genotypes and hepatitis b precore and basal core promoter mutations on viral replicative interference. hepatology. 2001;34(2):404-10. 14. sagnelli e., coppola n., pisaturo m., masiello a., tonziello g., sagnelli c., et al. hbv superinfec tion in hcv chronic carriers: a disease that is frequently severe but associated with the eradica tion of hcv. hepatology. 2009;49(4):1090-7. 15. peters m. g. special populations with hepatitis b virus infection. hepatology. 2009;49(5 suppl):s146-55. 16. lok a. s., mcmahon b. j. chronic hepatitis b: update 2009. hepatology. 2009;50(3):661-2. 17. dalgard o., mangia a. management of patients with hepatitis c virus genotype 2 or 3: comments on updated american association for the study of liver diseases practice guidelines. hepatology. 2009;50(1):323; author reply 4-5. 18. senturk h., tahan v., canbakan b., uraz s., ulger y., ozaras r., et al. chronic hepatitis c responds poorly to combination therapy in chronic hepatis b carriers. neth j med. 2008;66(5):191-5. 19. liu c. j., chuang w. l., lee c. m., yu m. l., lu s. n., wu s. s., et al. peginterferon alfa-2a plus ribavirin for the treatment of dual chronic infection with hepatitis b and c viruses. gastroenterology. 2009;136(2):496-504 e3. © 2019 lmrj liaquat medical research journal, 2019, 1, 3 47 research article an evaluation of rubber-dam acceptability by dental practitioners in rakcods feroze kalhoro1, sikander munir memon1*, jodat askari2, hussain dhia2, hareb mofti.2 1liaquat university of medical & health sciences, jamshoro, 2rakcods, uae. received: 23 april 2019 revised: 28 june 2019 accepted for publication 5 july 2019 correspondence: prof. dr. feroze kalhoro, dean institute of dentistry, liaquat university of medical & health sciences, jamshoro e-mail:feroze.kalhoro@lumhs.edu.pk this article may be sighted as: kalhoro f, memon sm, askari j, dhia h, mofti h. an evaluation of rubber-dam acceptability by dental practitioners in rakcods. lmrj. 2019; 1(3): 47-50. doi: 10.38106/lmrj. 2019.1.3-02. abstract to evaluate the prevalence of usage and reasons why rubber-dam used and not being used as well as the patients concerns and to determine if rubber-dam does improve the quality of care or no. it was an observational study. this study was conducted at rakcods clinics, uae. a paper-based questionnaire was distributed to 120 candidate of 4th, 5th year clinical students and inters in rakcods clinics. the data collected were statistically analyzed. a low 26% of the responders answered that they always use rubber when compared to other studies done by national dental practice-based research network which had 44% of practitioners always use rubber-dam. patients who refuse the application of rubber-dam claimed that it is harder for them to breath, painful, lack of communication with the dentist and that they are terrified. a 90% of participants answered that the rubber-dam improved the success rate of the treatments. the study showed that rubber-dam usage in rakcods clinic is less than it should be. hence promotion of rubber-dam usage must be done more effectively in pre-clinical. solutions should be provided to eliminate the discomfort while using rubber-dam. keywords: rubber-dam, rakcods, dental practitioners, dentistry introduction a dental rubber-dam is a thin sheet of latex rubber which isolates the operative site from the rest of the mouth. the rubber-dam has been the most useful way of care when performing operative and root canal treatment. rubber-dam is an excellent mean of providing infection control during dental procedure. it is used to prevent saliva from contaminating the work field and to keep the operation field dry as well as stopping the dental material to be inhaled by the patient. yet it is not always used. in this research we are going to gather information and see why dentists think its very time consuming or is it because patients don’t accept it or is it both. isolation is the adjunct for the success of dental treatment in its various fields and aspects. it can be achieved by different means. for example, the direct methods which are (rubber-dam, cotton rolls, retraction cord and suction devices) also indirect methods are available such as local anesthesia and drugs. but among them all, the rubber is said to be the most successful and effective method1,2. rubber-dam is being used in dentistry since it was invented in 1986 by sanford christie barnum, and it’s considered by countless textbooks to be the standard of care in dental practice3. the rubber-dam has many components such as sheets which varies in thickness size and color, retainers (clamps) which anchors the tooth and retracts gingiva and have different types, holder (frame) which maintains the rubber-dam borders in position (they are available for children and adults) as well as punch, clamp forceps, dental floss, scissors and lubricant4,5,8. the rubber-dam offers the dentist and the patient a variety of advantages such as isolation of the operative area, provision of aseptic field, prevention of infection transfer, prevent ingestion or aspiration of instruments, tooth debris, hemorrhage and materials or irrigants. as well as protection and retraction of soft tissue during operative procedures, minimizes patient conversation during treatment hence reduces the need for frequent rinsing. however, there are some factors limiting the application such as patient’s asthma, mal positioned teeth, third molars and teeth that have not erupted sufficiently 4,6,7. with all these advantages as well as legal point of view favoring the rubber-dam, the use of rubber-dam there still seems to be ignored by practitioners and dental students. this issue has been drawing attention by authors who determined a significant underuse in general practice8,9. it has been indicated that dentists believe that rubber-dam is too time consuming and patients do not accept the rubber-dam © 2019 lmrj liaquat medical research journal, 2019, 1, 3 48 lmrj experience. many patients are afraid of the rubber-dam because they think that they won’t be able to breath, there are limited clamp sizes and unlimited tooth shapes. if the dentist chooses the wrong size the clamp it can damage the gingiva8-10. the aim of this study was to determine the attitude of a group of clinical year’s students and interns in rak college of dental science (rakcods) towards rubber-dam application specifically focusing on endodontic and operative aspect of dentistry. objectives 1-prevalence of rubber-dam usage and reasons for it being used and not used. 2-to interpret the reasons why the practitioners claim that patients do not accept rubber-dam. 3-to evaluate the treatment outcome with rubber-dam according to the students and interns. methodology this study was performed through a paper-based questionnaire, given to 120 candidates from the 4th and 5th year bds program and interns at rakcods, during march 20th 2017 to september 2017. the study included questions about the usage of rubber-dam and the reasons for it being used or not being used. this study focused on establishing the number of dental students using who actually use the rubber-dam and why they use it and why they don’t and provide solutions for the problems they face. the data were entered and analyzed in spss version 20. the frequency and distribution of the data were analyzed using chi square tests. according to inclusion criteria the 4th and 5th year bds program and interns at rakcods were eligible to participate in the study. exclusion criteria was non clinical year students and 3rd year students. results after collecting 90 responses from 4th 5th year students and interns, data was analyzed. table 1: shows the frequency of use of rubber-dam in rakcods clinic and the reasons why they use it and the reasons why it’s been ignored in percentage. a statistical significance was found in the frequency of usage as the majority of participants often use rubber and a very low proportion rarely and never use it. students and interns are aware of the advantages of rubber-dam and the table below shows the reasons why they use it. the reasons to refuse the rubber-dam was mostly because it is very difficult to take x-rays as the patients are not trained to hold the film and students take extra radiation just to make sure of the quality of the images and to make it less time consuming and less exposure to the patient. a significance was found because of low percentage of responders to point that cost is a reason to ignore rubber-dam. proportion p-value significance f re q u e n c y o f u se always 26% 0.00 significance often 41% occasionally 29% rarely 4% never 0% r e a so n ( y e s) minimize patient conversation 15% 0.0965 not significance retraction of soft tissue 17% isolation and provision of a septic field 25% prevention of infection transfer 20% prevention of material aspiration 23% r e a so n ( n o ) difficult to use 16% 0.0001 significance time consuming 26% patient discomfort 22% difficult when taking x-ray 29% cost 7% © 2019 lmrj liaquat medical research journal, 2019, 1, 3 49 lmr j fig (1). shows whether the patients accept or refuse rubber-dam according to the students and interns in percentage. (53%) accepted and (47%) refused and the reasons will be shown in fig (2). not applied properly which caused difficulties during the treatment which effected the end result. treatment outcome p-value = 0.1 patients attitude 53% 90% 47% accept refuse 3% 7% better worst did not matter fig (2). shows the reasons behind patient’s refusal and the percentages of each.(27%) of patients says it’s painful because each tooth is different than the other and the clamps do not fit all the time so pain can be felt from the pressure on the gingiva. (31%) said lack of communication as they cannot tell their doctor what they are feeling and if they want to ask or recommend something. (25%) difficulty in breathing, especially in mouth breathers were the sheet covers the mouth and sometimes the doctors extend the sheet to cover the nose. (17%) are terrified as they are not introduced to the rubber-dam earlier and about its advantages, but they only see the sheet, frame clamp and clamp holder going into their mouth and on the tooth which makes them anxious and think that the doctor might extract the tooth without telling the patient. p-value = 0.29401 27% 31% 25% discussion 90 students out of 120 participated and replied to the questionnaire. the results in table (1) were found less than adequate when compared to the results of ndpbrn (national dental practice-based research network) which has showed that 44% of practitioners always the rubber-dam, 24% used often, 17% occasionally and 15% not being used. the participant was also asked whether if the patient refusal is a factor in not using the rubber-dam or not and results were as followed 53% of the patients accept the use of rubber-dam while 47% refuse it .31% refused because of lack of communication. 27% being painful. 25% difficulty in breathing and the other 17% terrified. one of the questions referred to the success rate of the treatment with rubber-dam according to the participants experience and knowledge in comparison with fig (3), only 68% of students in a study which was done in two british schools implied that rubber-dam had enabled higher clinical standards. this percentage is lower than rakcods clinic. a higher 59% of students use rubber-dam in endodontic treatment compared to a 41% in operative treatment to provide good isolation of the canals and prevent aspiration of files and irrigation solutions. 65% of responders preferred single tooth isolation over 35% multiple isolation stating that it’s easier and less time consuming 64% implied that they prefer using rubber-dam in the mandible as there is more accumulation of saliva and fluids when compared maxilla. painful terrified difficulty in breathing lack of communication conclusion the study showed that rubber-dam usage in rakcods clinic fig (3). shows the findings regarding the treatment outcome according to the responders and the results were, (90%) said that rubber-dam provides better treatment outcome to prove once again the importance and effectiveness of rubber-dam in dental care. (7%) said it did not matter which includes that they do not know what happened to the patient after the treatment as there was no feedback or recall visits. (3%) reported that the treatment was worst maybe because it was is less than it should be. a very high 90% of the responders admitted that rubber-dam increased the success and effectiveness of treatments done. hence promotion of rubber-dam usage must be done more effectively in pre-clinical and clinical practice in various ways such as information regarding better brands of rubber-dam sheet, patient education, providing film holders and more strict approach by the supervisor towards rubber-dam application. lmrj © 2019 lmrj liaquat medical research journal, 2019, 1, 3 50 limitations the number of the responders was not large enough because the study setting was limited to rakcods clinics and not all the candidates participated in the survey. future direction we suggest for the future research to include a larger number of participants and include other dental schools in uae. another research could be conducted to evaluate the effectiveness of rubber-dam against other isolation methods. references 1. garg, n., & garg, a. (2010). textbook of endodontics. boydell & brewer ltd. 2. lynch, c. d., & mcconnell, r. j. (2007). attitudes and use of rubber-dam by irish general dental practitioners. international endodontic journal, 40(6), 427-432. 3. anabtawi, m. f., gilbert, g. h., bauer, m. r., reams, g., makhija, s. k., benjamin, p. l., … the dpbrn collaborative group. (2013). rubber-dam use during root canal treatment: findings from the dental practice-based research network. journal of the american dental association (1939), 144(2), 179–186. (rub ber-dam use during root canal treatment findings from the dental practice-based research network) 4. heymann, h. o., swift jr, e. j., & ritter, a. v. (2014). sturdevant's art & science of operative dentist ry. elsevier health sciences. 5. g, s., jena, a., maity, a. b., & panda, p. k. (2014). prevalence of rubber-dam usage during endodontic procedure: a ques tionnaire survey. journal of clini cal and diagnostic research/z: jcdr, 8(6), zc01–zc03. 6. tanalp j, kayata� m, ba�er can ed, kayahan mb, timur t. evalu ation of senior dental students’ general attitude towards the use of rubber-dam: a survey among two dental schools. the scientif ic world journal. 2014 7. gilbert gh, litaker ms, pihlstrom dj, amundson cw, gordan vv. rubber-dam use during routine operative dentistry procedures: findings from the dental pbrn. operative dentist ry. 2010;35(5):491-499. 8. robbins, j. w., hilton, t. j., & schwartz, r. s. (2006). funda mentals of operative dentistry: a contemporary approach. j. b. summitt (ed.). quintessence pub. 9. zou, h., li, y., lian, x., yan, y., dai, x., & wang, g. (2016). frequency and influencing factors of rubber-dam usage in tianjin: a questionnaire survey. international journal of dentistry, 2016, 7383212. 10. madarati, a. a. (2016). why dentists don’t use rubber-dam during endodontics and how to promote its usage? bmc oral health, 16, 24. lmrj volume 1 issue 1 5 | p a g e 3 4 demographic, dietary and biochemical risk factors associated with the causation of goiter in plane areas of sindh province tayyab uddin khand1, fatehuddin khand2, abdul hafeez kandhro3, mohammad yousif memon4 . 1,2,4department of biochemistry, liaquat university of medical and health sciences, jamshoro 3clinical lab manager, healthcare molecular & diagnostic laboratory, hyderabad , sindh. received: 13 december 2018 revised: 18 february 2019 accepted for publication: 8 march 2019 correspondence: dr. fatehuddin khand, professor of biochemistry, liaquat university of medical & health sciences, jamshoro. e.mail: khandfd@yahoo.com this article may be sighted as: khand tu, khand f, kandhro ah, memon my. demographic, dietary and biochemical risk factors associated with the causation of goiter in plane areas of sindh province. lmrj. 2019; 1(1): 5-8. doi: 10.38106/lmrj.2019.1.1-02. abstract present study was conducted to find out the demographic, dietary and biochemical risk factors associated with the causation of goiter in plane areas of sindh province. this case-control study was carried out at liaquat university of medical and health sciences, jamshoro from july 2009 to december 2009. a total of 200 subjects (100 goiter patients and 100 normal control subjects matched for age and gender) were recruited for present study. the demographic characteristics and dietary history of both goiter patients and control subjects were studied with the help of a standard questionnaire developed for that purpose. serum samples from goiter patients and control subjects were analyzed for iodine, tsh, ft3 and ft4 levels, while urine samples were analysed for iodine content. of the 100 goiter patients 87 were females and 13 were males. majority (53%) of the study patients were young adults (20-39 years age). odds ratio analysis of the dietary data showed that consumption of cabbage and pickle in mustard oil containing mustard seeds had a significant positive association with goiter. similarly, consumption of fish, eggs, milk products, chicken, beef and peas had a significant inverse association with goiter. blood and urine iodine levels were significantly (p<0.001) lower in goiter patients than in control subjects whereas, the reverse was true for serum tsh and ft4 levels. all the goiter patients were found to be iodine deficient with 33 percent having mild and 77 percent moderate iodine deficiency. it was concluded that consumption of underground water, cabbage, and pickle in mustard oil containing the mustard seeds and low intake of animal protein diet is associated with mild to moderate iodine deficiency found in the inhabitants of plane areas of sindh province. keywords: goiter, tsh, ft , ft , iodine introduction goiter is a condition in which the thyroid gland is abnormally enlarged. it is a common disorder affecting around 200-300 million population around the world. inadequate supply of iodine causes insufficient production of tri-iodothyronine (t3) and thyroxine (t4) which leads to an increased influx of thyroid stimulating hormone (tsh) by the pituitary gland. this in turn stimulates thyroid gland hyperplasia and hypertrophy which leads to goiter formation. goiter is found in all age groups. however, people above 40 years of age are significantly, more likely to have goiter than younger people. goiters are more common in females than in males. in females it is associated with pregnancy and menopause. most of the mountainous areas in the world particularly the arc of himalayas from pakistan across india and nepal into northern thailand and vietnam are one of the most highly endemic goiter regions of the world1. goiter is said to be endemic when its prevalence is more than 5% in children aged 6-12 years within a population1, 2. the prevalence of goiter in mountainous areas of pakistan is reported to be 80-90%, whereas in plane areas it is reported to be as high as 55%3. in pakistan, gilgit and chitral are recognized as highly endemic goiter regions, since food and drinking water consumed in these areas is deficient in iodine4. in the plane areas of southern part of sindh province, especially in hyderabad and its adjacent districts, the incidence of goiter is reported to be increasing5,6. the reason for this rise in the incidence of goiter cases is difficult to elucidate, as it is generally assumed that surface drinking water and agriculture products consumed by the inhabitants of these areas have sufficient iodine content. besides this, several common food products used by local population, especially salt, are fortified with iodine. the possible demographic risk factors associated with the prevalence of goiter in these areas could be tobacco smoking, age, gender, parity, ingestion of large amounts of goiterogens in foods and drugs 1,7,10. the original article mailto:khandfd@yahoo.com lmrj volume 1 issue 1 6 | p a g e purpose of present study was to find out the demographic, dietary and biochemical risk factors associated with the causation of goiter in hyderabad and its adjacent districts. material and methods during july 2009 to december 2009, one hundred diagnosed cases of goiter belonging to hyderabad and its adjacent districts were randomly recruited from opd of nuclear institute of medicine and radiotherapy (nimra) jamshoro. similarly, age and gender matched 100 non-goiter subjects from the same region, with similar socioeconomic status and with no family history of goiter were recruited as controls. before obtaining written informed consent, the study participants were explained the nature and purpose of study and of possible harms and benefits from study. the ethical approval of the study was granted by the ethical committee of liaquat university of medical and health sciences, jamshoro. a questionnaire encompassing demographic and clinical parameters including age, gender, district of residence and dietary history was filled for each study participant. serum and urine samples from patients and control subjects were analyzed for iodine content by spectrophotometric method using hitachi-220 spectrophotometer. serum samples were also analyzed for tsh, ft and ft levels by radioimmuno assays using oak field health care product gamma counter (uk) england. statistical analysis dietary data of the goiter patients and control subjects were analyzed by odds ratio, while statistical comparisons for biochemical variables were done by using student’s t-test. results were considered statistically significant at p≤0.05 and highly significant at p≤0.001. results of the 100 goiter patients, 53% were of 20-39 years age; 87% were females; and 56% belonged to hyderabad district. the association of various study parameters with goiter in current study have been presented in table 1. of the 10 smokers involved in present study 8 (80%) were goiter patients. majority of the goiter patients (93%) and control subjects (84%) were non-iodized salt consumers. the odds ratio (or) analysis of the data showed that the intake of underground water, cabbage and pickle in mustard oil containing the mustard seeds had a significant positive association with goiter. similarly, consumption of fish, eggs, milk products, chicken, beef, and peas had a significant inverse association with goiter (table 1). table 2 gives the comparison of mean values for biochemical variables measured in serum and urine samples of goiter patients and control subjects. the mean iodine levels in serum and urine samples of goiter patients were found to be significantly lower (p<0.001) than the control subjects. similarly, the mean serum tsh, ft3 and ft4 levels were significantly higher in goiter patients compared to control subjects. thyroid profile of the goiter patients revealed euthyroidism in 60 cases, hyperthyroidism in 25 cases and hypothyroidism in 15 cases. iodine intakes calculated from urinary iodine levels according to unicef criteria are shown in table 3. only 3 categories namely optimal intake, mild iodine deficiency, and moderate iodine deficiency were seen on the basis of results obtained. accordingly all the control subjects were found to have an optimal iodine intake (iodine in urine = 100-199 µg/l). however, 76% of the goiter patients were found to have mild (iodine in urine= 50-99µ g/l) and 24% moderate (iodine in urine= 20-49 µg/l) iodine deficiency. blood iodine levels less than 6µg/l were noted in 51% goiter patients only lmrj volume 1 issue 1 7 | p a g e table 1.association of various study parameters with goiter variables cases (n=100) controls (n=100) odds ratio (95% confidence interval) p-value smoking habits smokers 08 02 4.261 (0.991-18.144) 0.052 non-smokers 92 98 salt consumed iodized 07 16 0.3952 (0.1550 1.0075) 0.0518 non-iodized 93 84 source of drinking water surface 62 94 0.1041 (0.0416-0.2610) <0.0001 underground 38 06 cabbage users 70 28 6.0 (3.2564-11.0552) <0.0001 non-users 30 72 turnips users 37 25 1.762 (0.962-3.224) 0.067 non-users 63 75 peas users 61 84 0.298 (0.154-0.578) 0.0004 non0users 39 16 spinach users 92 94 0.734 (0.256-2.111) 0.579 non-users 08 06 pickle with mustard seeds users 32 06 7.373 (2.986-18.120) <0.001 non-users 68 94 soya oil users 09 17 0.483 (0.208-1.123) 0.093 non-users 91 83 mustard oil users 18 06 3.439 0.009 non-users 82 94 (1.338-8.804) other oils branded 12 65 0.073 (0.035-0.152) <0.000 non-branded 88 35 fish users 10 38 0.2029 (0.010-0.425) <0.0001 non-users 90 62 eggs users 08 81 0.020 (0.009-0.049) <0.0001 non-users 92 19 milk products users 12 82 0.030 (0.014-0.066) <0.0001 non-users 88 18 table 2. comparison of mean values for continuous biochemical variables measured in cases and controls variables study group mean s.d p-value iodine in urine (µg.l) cases 60.26 11.99 <0.0001 controls 128.9 9.95 iodine in blood (µg/l) cases 6.02 1.35 <0.0001 controls 9.88 0.64 tsh (mµ/l) cases 23.01 17.46 <0.0001 controls 1.49 0.83 ft3 (pmol/l) cases 7.73 3.63 <0.0001 controls 3.72 0.76 ft4 (pmol/l) cases 26.74 20.92 0.01 controls 18.58 2.76 table 3. descriptive statistics for biochemical variables measured in cases and controls cases (n=100) controls (n=100) iodine in urine (µg/l) (unicef criteria) moderate deficiency (20-49 µg/l) 24 00 mild deficiency (50-99 µg/l) 76 00 optimal intake (100-199 µg/l) 00 100 discussion the finding of the present study that goiter is about seven times more common in females than in males is in accordance with the findings from many other studies which reported 2-10 times higher prevalence of goiter in females as compared to males2,7,11. a greater proportion of females as against males had been reported to develop goiter when exposed to iodine deficiency7. in present study peak occurrence of goiter cases were seen in 20-39 years age group. kundsen et al. (2002) had also noted greater prevalence of goiter in 30-40 years age group in areas of mild to moderate iodine deficiency. this association of goiter prevalence with age seems to be iodine intake dependent as in severe iodine deficiency areas the peak occurrence of goiter occurs around the middle age7. of the ten smokers involved in the present study, eight were found to be goiter cases. although, smoking was not positively associated with goiter in present study, the predisposition of smokers to goiter has been reported from iodine deficient areas7,9,12. smoking undoubtedly is not the cause of goiter, but certainly could contribute in promoting iodine deficiency. this is suggested because thiocynate, which is abundant in cigarette smoke is known to produce goitrogenic effects through competitive inhibition of iodine uptake and organification7,10,13,15. comparison of the dietary intakes between goiter patients and control subjects revealed that goiter patients as against the control subjects had significantly lower intake of fish and animal proteins in the diet. contrary to this they had significantly higher consumption of underground water, cabbage and pickle in mustard oil with mustard seeds. chemical compounds in underground drinking water samples might be interfering with the synthesis of thyroid hormones and hence contributing in the causation of goiter. ingestion of the large amounts of goitrogenic foods (cabbage, turnips, soybeans, peanuts, peaches, peas, strawberries, spinach, onions, sweet potatoes, seeds of mustard and rape) and low amounts of animal and fish proteins might be involved in the causation of iodine deficiency in goiter patients. this is because both fish and animal proteins as compared to vegetable proteins are good dietary sources of iodine. the finding of present study that iodine levels in both blood and urine samples were significantly (p<0.001) lower in goiter lmrj volume 1 issue 1 8 | p a g e patients than in control subjects suggests that iodine deficiency could be the major cause of goiter in hyderabad and adjacent districts. this is further supported by the observation that all the goiter patients according to unicef criteria were iodine deficient; 24% had mild and 76% had moderate iodine deficiency. conflict of interest we hereby declare that we do not have any conflict of interest related to publication of this article. grant support/ financial disclosures none references 1. who, unicef and iccidd. assessment of the iodine deficiency disorder and monitoring their elimination. a guide for program managers. who publ., geneva 2001. 2. hegedus l, bonnema sj and bennedback fn. management of simple nodular goiter current status and future perspective. endocrinol j o, 2003;24:102-132 3. tehzeeb za, riffat aa, shami sa fasiha ijlal. prevalence of goiter in school going children in a union council near islamabad pak med res, 2007,46:1-4. 4. mccarrison r. observations on endemic goiter in the chitral and gilgit valleys. med chir trans, 1906; 89:437-470 5. shaikh z, hussain n, anwar b, sajjad h and zubairi a. thyroid related disorders at civil hospital karachi. specialist, 1993;126:8-12. 6. iqbal z and zaffar t. nodular goiters. professional medj 2006;13:165-174. 7. knudsen n, lauberg p, perrild h, bulow i, ovesen l, jorgensen t. risk factor for goiter and thyroid nodules. thyroid, 2002; 12; 879-885. 8. vestergaard p. smoking and thyroid disorders-a meta-analysis. eur j endocrinol, 2002;146:153-161. 9. volzke h, schwahn t, kramer a. robinson dm john u and meng w. risk factors for goiter in a previously iodine deficient region thieme e journals-abstract.exp clin endocrinol diabetes, 2005;113:507-515. 10. steinmaus c, miller md, howd r impact of smoking and thiocynate on perchlorate and thyroid hormone association in the 2001-2002 national health and nutrition examination survey. environ health perspect, 2007;115: 1333-1338. 11. hazarika nc and mahanta j. environmental iodine deficiency and goiter prevalence in a block area of the north eastern region. a retrospective analysis. j human ecol, 2004;15:113-117 12. vejbjerg p, knudsen n, perrild h, carle a, laurberg p, bulow i, rasmussen lb, ovesen l, jorgensen t. the impact of smoking on thyroid volume and function in relation to a shift towards iodine sufficiency. j epidemiol, 2008; 23: 423-429 13. kapoor d, jones th. smoking and hormones in health and endocrine disorders. eur j endocrinol, 2005; 152:491-499 14. brauer vfh, below h, kramer a, fuhrer d, paschke r. the role of thiocynate in the etiology of goiter in an industrial metropolitan area. eur j endocrinol, 2006;154: 229-235. 15. gibbs jp. a comparative toxicological assessment of perchlorate and thiocynate based on competitive inhibition of iodine uptake as the common mode of action. human and ecological risk assessment. intern j,2006;12:157-173. lmrj volume 2 issue 1 17 | p a g e effect of environmental factors on job performance among nurses of tertiary health care sector tehseena akram1, hafiza ummara rasheed2, abida asghar3, noreen fatima4 1university of lahore, nursing instructor at (college of ophthalmology and allied vision sciences, mayo hospital, lahore). 2college of ophthalmology and allied vision sciences, mayo hospital, lahore. 3university of lahore, nursing instructor at (college of ophthalmology and allied vision sciences, mayo hospital, lahore). 4college of ophthalmology and allied vision sciences, mayo hospital, lahore. correspondence: tehseena akram university of lahore, nursing college of ophthalmology and allied vision sciences, mayo hospital, lahore. e-mail: tehseenaakram@gmail.com lmrj.2020:2(1): doi: 10.3810/lmrj.2020.2.1.04 received: 10 december 2019 revised: 4 january 2020 accepted for publication 8 january 2020 abstract this study was designed to assess effects of environmental factors on job performance among nurses of tertiary health care sector. a crosssectional study was conducted. a total of 200 nurses were selected from services hospital lahore, pakistan. this study reveals that the physical environment plays the important role on job performance which is already cited in literature and also affects retention of the staff. materialistic facilities, surroundings, a physical condition, worry capability affects tremendously on the performance of the workers. this study suggests that performance may be improved by addressing safety, infection control measures, and environment temperatures and supplies availability. keywords: environmental factors, job performance, nurses. introduction career routine is an extremely important aspect argumentative winner of an organization 1. disorganized career routine is associated with lesser efficiency which leads to less cost-effectiveness and weakening of general managerial effectiveness2-3. healthy occupational routine as actions to be completed towards accomplishing the organization’s aims and intents4. healthier job routine is the fundamental concept of today’s work place for patient centered care 5 and for business success and employee satisfaction 6. nurses are significant part of health structures thereafter better performance is expected from them, and performance of nurses is closely linked to the output and worth of concern conditions surrounded by wellbeing of the concern organizations. for this motive, it was significant on the way to identify factors influencing appropriate delivery of the system 7. nurses’ performance in the health care system can potentially be dependent on the familiarity, skills, motivation and favorable environment 8. although there are many factors which can affect the performance, such as a superior profitable location, a stiff employment promote, and aged personnel. however, in many studies it is hypothesized that good environmental factors act as a buffer against low satisfaction levels that can lead to poor performance9. moreover, environmental factors also influence the place of work by increasing professional pressure research article mailto:tehseenaakram@gmail.com lmrj volume 2 issue 1 18 | p a g e which is the leading cause of burnout and poor performance hence, more attention has to be given to the conducive environment for the high productivity of the employees, patient satisfaction, and low turnout and can even increase the revenue of the organization 10. thus it’s the employer responsibility to give proper working environment so that the routine of workers meet the preferred values. unfortunately nurse are still struggling with the lower two levels defined by the maslow framework11. it is also stated that the work place incivility is the major cause of the staff leaving their present position12. the objective of the study was to assess the effects of environmental factors on the job performance among nurses of tertiary health care sector. this study will help nurses to know about contact of job green factors on nurses’ employment routine. secondly, this study will help the organization to aware about the study result, which it will helpful to overcome weakness. methodology a cross-sectional study was adopt to reply the investigate inquiry. logical, traverse-sectional learn aim was be deployed used for this study. the study was conduct in the services hospital, lahore, pakistan. inclusion criteria are those staff nurses in all departments in services hospital who show willingness to participate in study and those who are present during the time of data collection. participants who concur to contribute in the study and indication the learned assent form and willingness to fill the selfadministered questionnaire. the exclusion criteria, the students nurses, and head nurses or nurses in the administration department. a number of research studies use the slovin’s formula for obtaining the sample size. denoting by n, the sample size, was given as n=n/1+ (n) (e) 2 where n is the population size and e is the margin of error 13-14. sample size of the study was calculated as 200. the convenient sampling strategy was adopted for this study. from beomcheol, (2006) study, questionnaire variables were chosen 15. moreover in the independent variable data was collected against age, gender, mother tongue, level of education, years of experience. instrument of workplace environment was adopted from awases, (2006) which contains 8 items as independent variables. the instrument was about the physical environment and the availability of the supplies in the work place environment e.g., safe environment, necessary instruments are available, equipment’s are working condition, contamination control plan procedures were accessible and that sterilized solution for security of employees and patients are available. the data compilation procedure was in progress after receiving the consent from the university of lahore, and from the management of services hospital. pre-testing of the survey on 15 % of the participant was carried out. involvement in the study was life form unpaid; no reimbursement, aid or monetary incentive was obtainable. data entry was done in spss. the data was stored in hard and soft copies. out of 200 participants age distribution was given as 18-25 years, 25-35 years, 3550 years and above 50 years, reside in union (less than 1 year, 1-5 years, 6-10 years, and above 10 years), married category (married, single), and requirement (nursing diploma, specialization, post rn and others). result the around 70% (n= 140) of the respondents were single and rest of them were married. in the age group of above 50 years only 23 (11.5%) of the participants lie. only 12.5 percent of the participants (n=21) were having work experience more than 10 years. a summary is given in table 1. the overall mean score of the work place environment tool was 4.1 and its standard deviation was 1. moreover the overall mean score of the job performance was 4 (sd ±0.7). lmrj volume 2 issue 1 19 | p a g e the work environment tool was on likert scale. it had 8 items, each have the five values for the participants to score on. around 54 percent of the participants were agree that their workplace is really safe. only 8 % individuals do feel that they are not secure at their workplace. a summary is presented in table 2. regarding the layout of the workplace around 90 (45%) agree and 32 (n=16) strongly agreed that it is good. a total of 73(36.5%) of the participants agreed that they have the comfortable temperatures at work place and 39% of the participants said that the instruments provided at their workplace were most of the time in working condition. on the subject of availability of the supplies 4.5% and 11% of participants were strongly disagree and disagree respectively. surprisingly 9% of the nurses revealed that they are not even privileged to have antiseptic solution at their workplace. only 36.5% participants stated that they have well defined infection control strategy. 31% of the participants showed their neutral response on being the top performer. majority of the nurses agreed 75(37.5%) that they are among the top 10 percent of the frontline performer. where 30(15%) are well aware about operational system than others. a summary of the results is presented in table 3. in this study the correlation coefficient (r) equals to 0.987, indicating a strong positive relationship (p< 0.001). multivariate linear regression is summarized in table 4, persons who reported to have better work place environment have significantly (p= .001) better performance as the β is positive 0.48. frequency percent gender female 200 100.0 age 18-25 50 25 25-35 74 37 35-50 53 26.5 above 50 23 11.5 stay in organization less than 1year 50 25 1-5years 59 29.5 6-10years 66 33 above 10years 25 12.5 marital status married 60 30 single 140 70 qualification nursing diploma 145 72.5 specialization 25 12.5 post rn 14 07 other 16 08 variables my work environment is safe and free from hazards. strongly disagree 16(8) disagree 18(9) neutral 51(25.5) agree 73(36.5) strongly agree 42(21) my work place has good workplace layout. 15(7.5) 23(11.5) 40(20.0) 90(45) 32(16) my work place has comfortable temperature. 15(7.5) 26(13.0) 51(25.5) 73(36.5) 35(17.5) necessary instruments are available at my work place. 10(5) 22(11) 56(28) 59(29.5) 53(26.5) instruments available at my work place in working conditions. 10(5) 19(9.5) 52(26) 78(39) 41(20.5) materials and supplies sufficient at my work place. 9(4.5) 22(11) 48(24) 75(37.5) 46(23) antiseptic hand solution for safety of team and patients is obtainable at my work place. 9(4.5) 18(9) 54(27) 67(33.5) 52(26) infection control strategy guidelines are available at my work place. 10(5) 14(7) 52(26) 73(36.5) 51(25.5) table 1: demographic characteristics of study population table 2: work environment related variables lmrj volume 2 issue 1 20 | p a g e table 3: job performance variables table 4: regression for work place environment factors associated with job performance variables i am a top performer. strongly disagree 12(6) disagree 13 (6.5) neutral 62 (31) agree 62 (31) strongly agree 51(25.5) i am in the top 10 percent of frontline employees here. 12(6) 16(8) 61 (30.5) 75(37.5) 36(18) i am very dedicated to satisfying the needs of customers. 13(6.5) 12(6) 61 (30.5) 81(40.5) 33(16.5) i know what customers expect better than others. 11(5.5) 17 (8.5) 43(21.5) 97(48.5) 32 (16) i know more about menu items than others. 11(5.5) 18 (9) 58 (29) 78 (39) 35 (17.5) i know more about operational system than others. 16 (8) 19 (9.5) 55 (25) 85(42.5) 30(15) variables standard error t p value constant 2.178 .177 12.286 .001* work place environment 0.480 0.042 11.491 .001* discussion this is the first study in pakistan on the green factor and its effects on career routine among nurses in lahore, pakistan to best of author’s knowledge. thus the study presents first information of factor which affect job act. job presentation is a very important factor in growth of any organization 1-3,16 . moreover, this study reveals that good working conditions pursue the nurses to be dedicated towards patients needs. this is in agreement with other studies which says that better job environment is the core build of today’s labor rest for patient centered care 6-7 . the direct and positive relationship between conducive environment and high productivity by the employees is also coherent to other studies which further relate it with more patient satisfaction, and low turnout and can even increase the revenue of the organization 9-11, 18. the present study showed that safety among all the working conditions is necessary which is also discussed extensively in other studies 2, 10, 14, 18 . these studies reveal that the physical environment plays the important role on job performance which is already cited in literature the retention of the staff 7,9,14 . the significant factors in the physical settings were the accessibility of the equipment’s and the cooperation of the staff. it is consequently imperative for employer to supply inappropriate working environment to make sure that the performance of staff meet the much loved values. moreover, majority of the nurses provide this information that they do not have the availability of the hand wash solution whereas. pittet et al., (2000) also shared that compliance to hand washing can only increase if recourses like soap and water are available15. proper temperature of the work place is as important as food and water13, which is quite evident in the present study also, nurses who are satisfied with the indoor temperature were more perceptive to patient need than others. in the last we can conclude that for the lmrj volume 2 issue 1 21 | p a g e nurses there is evidence that better workplace environmental is strongly related to better work place environment. references 1. allison e. aiello, rebecca m. coulborn, vanessa perez, and elaine l. larson. effect of hand hygiene on infectious disease risk in the community setting: a meta-analysis . american journal of public health: august 2008, vol. 98, no. 8, pp.1372-1381. 2. applebaum, d., fowler, s., fiedler, n., osinubi, o., & robson, m. (2010). the impact of environmental factors on nursing stress, job satisfaction, and 9. turnover intention. the journal of nursingadministration, 40, 323. 3. al-mailam, f. f. (2005). the effect of nursing care on overall patient satisfaction and its spredictive value on return-to-provider behavior: a survey study. quality management in healthcare, 14(2), 116-120. 4. bakker, a. b., demerouti, e., & verbeke, w. (2004). using the job demands-resources model to predict burnout and performance. human resource management, 43(1), 83-104. 5. christmas, k. (2008). how work environment impacts retention. nursing economics, 26(5), 316. 6. cooke, f. l. (2000). human resource strategy to improve organisational performance: a route for british firms: esrc centre for business research, university of cambridge. 7. kumar, r., ahmed, j., shaikh, b. t., hafeez, r., & hafeez, a. (2013). job satisfaction among public health professionals working in public sector: a cross sectional study from pakistan. human resources for health, 11(1), 2. 8. motowidlo, s. j., & schmit, m. j. (1999). performance assessment in unique jobs. pulakos (eds.), the changing nature of performance, 56-86. 9. muchhal, d. s. (2014). hr practices and job performance. iosr journal of humanities and social science (iosr-jhss), 19(4), 55-61. 10. okoye, p., & ezejiofor, r. a. (2013). the effect of human resources development on orga nizational productivity. international journal of academic research in business and social sciences, 3(10), 250. 11. pittet, d., hugonnet, s., harbarth, s., mourouga, p., sauvan, v., touveneau, s., & perneger, t. v. (2000). effectiveness of a hospital-wide programme to improve compliance with hand hygiene. the lancet, 356(9238), 1307-1312. 12. raza, m., kazi, b., mustafa, m., & gould, f. (2004). developing countries have their own characteristic problems with infection control. journal of hospital infection, 57(4), 294-299. 13. roche, m., diers, d., duffield, c., & catling-paull, c. (2010). violence toward nurses, the work environment, and patient outcomes. journal of nursing scholarship, 42(1), 13-22 14. shahzad, a., & malik, r. (2014). workplace violence: an extensive issue for nurses in pakistan— : a qualitative investigation. journal of interpersonal violence, 0886260513516005. 15. viswesvaran, c., & ones, d. s. (2000). perspectives on models of job performance. international journal of selection and assessment, 8(4), 216-226. 16. waldman, d. a. (1994a). contributions of total quality management to the theory of work performance. academy of management review, 19, 510-536. 17. waldman, d. a. (1994b). designing performance management systems for total quality imple mentation. journal of organizational change, 7(2), 31-44. 18. zafar, w., siddiqui, e., ejaz, k., shehzad, m. u., khan, u. r., jamali, s., & razzak, j. a. (2013). health care personnel and workplace violence in the emergency departments of a volatile metrop olis: results from karachi, pakistan. the journal of emergency medicine, 45(5), 761-772. lmrj volume 2 issue 3 58 | p a g e patterns, types and causes of mandibular condyle fractures, association with other mandibular fractures at lumhs hospital hyderabad, sindh. vikram pal1, mehwish umair2, ramesh lal3, rabiya bano4, sikander munir memon 5 1department of oral medicine/periodontology, lumhs jamshoro, pakistan, 2department of science of dental material lumhs jamshoro, pakistan, 3department of orthodontics, lumhs jamshoro , pakistan, 4department of oral medicine, lumhs jamshoro, pakistan, 5 medical research center, lumhs jamshoro, pakistan correspondence vikram pal department of oral medicine/periodontology, lumhs jamshoro, pakistan lmrj. 2020; 2(3) doi: 10.38106/lmrj. 2020.2.3-03. abstract: the objective of current study was to assess the patterns, causes and types of mandible condylar fractures and relationship between mandible condylar fractures with associated mandible fractures. this prospective study was conducted at oral & maxillofacial surgery department lumhs jamshoro/ hyderabad. history, clinical examination and radiographic analysis of 60 mandibular condylar fracture patients were performed and data were recorded. data was analyzed on spss 16. out of total 60 patients with mandible condylar fractures, n=51 (85%) were male and n= 09 (15%) were female. age range of patients was 4 to 56 years) and mean age of 28 years and third decade was most common. the road traffic accident was common cause of mandibular condylar fractures n=29 (48.33%) followed by assault n=14 (23.33%) and fall n=12 (20%). unilateral fractures were n=49 (82%) and n=11 (18%) were bilateral fractures. mandible subcondylar fractures were the most common, both in the unilateral and bilateral groups which accounted for 38 (63%), condylar neck were 16 (27%), condylar head were 06 (10%). 36 (60%) were isolated condylar fractures and 24 (40%) were associated with other mandible fractures. road traffic accident was found to be common cause of condylar fracture. young male adults were involved in most of the accidents, with the unilateral pattern and subcondylar fractures type were more common. it divulges inadequate road traffic logic in road users, lack of road protection methods and rule in our population. key words: assault, mandible condylar fractures, road traffic accident and subcondylar fracture. introduction mandible is the most commonly fractured bone in facial region. 1-3 an analysis of fractures frequency in different anatomic sites of the mandible shown that, condylar fractures are most common fractures in the mandible 2,4,5 . it is also frequently over-looked and least detected fracture site in the facial region.6 mandibular condyle is involved in up to one third of all mandible fractures, with a frequency that range research article lmrj volume 2 issue 3 59 | p a g e from 10% to 57%. 7-9 several studies suggest that after the angle and body fracture, the second most mandible fractures are condyle region. 7,10 while few studies showed that condyle fractures are most common after symphysis and parasymphysis. 1, 9 direct or indirect trauma can fracture condyle, usually result from force applied at the body or symphysis region which is transmitted to the condylar process. 11,12 etiology of the condyle fractures varies in accordance with both sociologic and age factors. different studies have confirmed that motor vehicle accidents are the most common cause,1,13 others proved that ipv are most common cause, 11,14,15 while falls are also predominant cause in few studies, especially in females and young children.6,16 condylar fractures may occur isolated or associated with other mandible fractures.14 extracapsular fractures are more predominant than intracapsular in all age, subcondylar fractures are more common in adults than children.14,17 in particular, in children mandibular fractures differ significantly from adults because of growth and inadequate dentition of the mandible.16 in children the condylar intracapsular fracture usually cause temporo-mandibular joint ankylosis and masticatory disability.16 treatment of mandible condylar fracture is still controversial in respect of conservatively or surgically. principal factors that determine the treatment decision include level of fracture, site of fracture, and patient’s age. 18, 19 therefore it is important for both functional and cosmetic reasons that condylar fractures should be properly diagnosed and adequately treated. there have been many articles published about fractured mandible, but only few of them have focus on patterns of mandibular condylar fractures. this study will determine the patterns of mandibular condylar fractures, with all their relative characteristics, common age group and causes of condylar fracture in this part of the country. this will help in proper diagnosis and management of fractured mandibular condyle. patients and methods this descriptive study was conducted at lumhs hyderabad. a total of 60 patients of mandibular condylar fracture who attended the opd or emergency department from 1st july 2014 to 30th june 2015 were part of this study. an informed consent was taken from the all patients or their attendants. history of trauma was asked from the patient or attendant and recorded. diagnosis of mandibular condylar fracture was made by history, clinical findings and appropriate radiographs. conventional radiographs orthopentomograme (opg) and postero-anterior view of face (p.a) x-rays were used for all the patients. all the significant information was recorded on pre-designed proforma, including patient’s demographic data, etiology, patterns and relationship of fractures. we classified fractures as described by lindahl classification of fracture mandible condyle; condylar head fracture, condylar neck fracture and sub condylar fracture. data was analyzed on (spss) version 16.0. categorical variables (ie sex, etiologies, and pattern) was analyzed by frequency and percentages and for continuous variables, (like age) mean was computed. no inferential test was used because of descriptive statistics. results out of 60 patients, n=51 (85%) were males and n=9 (15%) were females, with male/female ratio of 5.7:1. males were predominant in all age groups of patients. road traffic accident (rta) was the common cause lmrj volume 2 issue 3 60 | p a g e of mandibular condylar fractures n=29 (48.33%) followed by inter personal violence (ipv), n=14 (23.33%). male patients were predominated involved in rta and ipv, which accounted 27 (45%) and 14 (23.33%) respectively. while fall was more prevalent in females. among unilateral fractures, right side was 27 (55%) slightly more than left side which accounted 22 (45%). bilateral condylar fractures were mostly occurred by considerable force through (rta and fall) as compared to lesser force through (assault). of the total samples, n=36 (60%) were isolated condylar fractures and n=24 (40%) were associated with other mandibular fractures. table 1: age distribution with gender of condylar mandibular fractures. table 2: causes of the mandibular condylar fractures with gender age (yrs) male femal e total percentage 01-10 06 02 08 13% 11-20 08 02 10 17% 21-30 18 02 20 33% 31-40 12 00 12 20% 41-50 04 02 06 10% 51-60 03 01 04 07% total 51 09 60 100% etiology male % female % total % rta 27 (45%) 02(3.33%) 29 (48.33%) ipv 14 (23.33%) _ 14 (23.33%) fall 05 (8.33%) 07(11.67%) 12 (20%) sport 03 (5%) _ 03 (5%) others 02 (3.33%) _ 02 (3.33%) total 51 (85%) 09 (15%) 60 (100%) table 3: pattern of mandibular condylar fracture. table 4: types of mandibular condylar fractures. pattern male female total percentage bilateral fracture 09 02 11 18% unilateral fracture 42 07 49 82% total 51 09 60 100% etiology condylar head condylar neck sub condylar total rta o2 07 20 29 ipv -02 12 14 fall 04 05 03 12 sports -01 02 03 others -01 01 02 total % 06(10%) 16(27%) 38(63%) 60(100) table 5: isolated and combine fractures of mandible condyle region patter n bilater al unilater al tota l percenta ge combin e fracture 02 22 24 40% isolated fracture 09 27 36 60% total 11 49 60 100% discussion among gender 85% (n=51) of patients presenting with mandible condyle fractures were males, and lmrj volume 2 issue 3 61 | p a g e only 15 % (n=9) were females, this male dominance in this study could be because of such fractures result from road traffic accident, assault, fall, sports injury etc, where men are dynamically involved. this ratio is comparable to those reported by kim yk at al 19 bormann k h et al, 11 and silvennoinen u et al. 14 however it is greater than that reported by amaratunga n.a.de s, 20 thoren h et al. 21 marker p et al. 15 increase in female ratio in their studies indicates that women in this part of world are more vulnerable to facial injuries, because of their participation in outdoor activities. the low ratio of female in our study was because most female are house bound and their outdoor activities are limited. male in the third decade constituted the major group in this study, similar to the data reported by sawazaki r et al, 13 silvennoinen u et al, 14 and marker p et al.15 during this age of life, the young adults are dynamically involved in outdoor activities, which makes them more prone to facial injuries in this age. the causes of facial injuries have changed by decade to decade. data reported in our study showed, road trafficaccident was the common cause of mandible condyle fracture 29 (48.33%). this result was different from the results of kim yk et al,[19] silvennoinen u et al,14 rikhotso e et al,23 and adam cd et al 24 from australia, this show that the causes of maxillofacial trauma varies because of social, cultural and geographic setup. the result of this study is comparable with those reported by klenk g et al, 10 and abbas i et al. 25 in our country, road traffic related maxillofacial injuries occurred because of not properly followed traffic regulations , poor condition of vehicles and inappropriate size of roads. as compared to developed countries there is, well-trained drivers, broader roads, and traffic regulation is also strictly followed which make different in accident. subcondylar fractures were most common in present study that was 63%, and condylar neck fractures 27%, which is comparable with study of silvennoinen u et al,14 and zachariades n et al, 19 but different from sawazare r et al, 13 and marker p et al. 15 studies. present study observed condylar head fractures 10% and mostly occurred in below age 6 years, similar to the data reported by choi j et al, 6 and thoren h et al. 22 type of condylar fractures seems to be influenced directly by its cause. subcondylar fractures are tension failures in response to bending of the mandibular neck, because the mandible distributes the force of impact, frequently fractures occur only in subcondylar region. 26 in present study unilateral condylar fractures were reported 49 (82%), similar to the data observed by previous studies in finland 1992, 14 and south africa 2008 23 and denmark 2000, 15 among unilateral condylar fractures right side was encounter more as compare to left side in our study. in our study 36 (60%) of condylar fractures were isolated and 24 (40%) were combine with other mandible fractures. those results are comparable with previous study by silvennoinen u et al, 14 and newman a. 17 it seems that condylar fractures consequences from an indirect force applied to the mandible 26 this submits that condyle fractures may be the result of the exertion of force which is not fully absorbed in the majority of cases in the area of its primary application, i.e the mental region. conclusion this study showed that rta were the main cause of condylar fractures, subcondylar fracture and unilateral mandibular condylar fracture is more common. diagnosis of patterns and types of condylar fracture is essential for proper treatment and management. references 1. patrocinio lg, patrocinio ja, borba bhc, bonatti bds, pinto lf, vieira jv, et al. mandibular lmrj volume 2 issue 3 62 | p a g e fractures: analysis of 293 patients treated in the hospital of clinics, federal university of uberlandia. brazil j otorrinolaringol 2005; 71:56065. 2. gassner r, tuli t, hach o, et al: craniomaxillofacial trauma: a 10 year review of 9543 cases with 21,067 injuries. j craniomaxillofacial surg 2003; 31:5161. 3. lida s, kogo m, sugiura t, et al: retrospective analysis of 1502 patients with facial fractures. int j oral maxillofac surg 2001; 30:286-90. 4. fasola ao, obiechina ae, arotiba jt: incidence and pattern of maxillofacial fractures in the elderly. int j oral maxillofac surg 2003; 32:206208. 5. fasola ao, nyako ea, obiechina ae, et al: trends in the characteristics of maxillofacial fractures in nigeria. j oral maxillofac surg 2003; 61:1140-43. 6. choi j, oh n and kim i.k. a follow-up study of condyle fracture in children. int j oral maxillofac surg 2005; 34: 851– 858. 7. nayyak ms, ekanayake mbk. assessment of maxillofacial injuries. pakistan oral dent j 2001; 21:1218. 8. martini mz, takahashi a, neto hgo, junior jpc, curcio r, shinoharaeh. epidemiology of mandibular fractures treated in a brazilian level i trauma public hospital in the city of sao paulo, brazil. braz dent j 2006; 17(3): 243-8. 9. zakai ma, islam t, memon s, aleem a. pattern of maxillofacial injuries received at abassi shaheed hospital, kmdc, karachi. annual abassi shaheed hospital 2002; 7:291-3. 6. klenk g, kovacs a. etiology and patteren of facial fractures in the united arab emirates. j craniofac surg 2003; 14:78-84. 7. bormann k h, wild s, gellrich n c,et al. five-year retrospective study of mandibular fractures in freiburg, germany: incidence, etiology, treatment, and complications. journal of oral and maxillofacial surgery 2009; 67:1251-1255. 87 8. chrcanovic br, freire-maia b, souza ln, et al: facial fractures:a 1-year retrospective study in a hospital in belo horizonte. braz oral res 2004; 18:322.26. 9. sawazaki r, lima s m and asprino l. incidence and patterns of mandibular condyle fractures. j oral maxillofac surg 2010; 68:1252-9. 96 10. silvennoinen u, lizuka t, lindqvist c, oikarinen k. different patterns of condylar fractures: an analysis of 382 patients in a 3-year period. j oral maxillofac surg 1992; 50:1032-1037. 11. maker p, nielsen s, bastian l. fracture of the mandibular condyle.part 1: paterns of distribution of types and causes of the fractures in 348 patients. br j oral maxillofac surg 2000; 38:417-21. 12. guven o. a clinical study on temporomandibular joint ankylosis in children. j craniofac surg 2008; 19(5): 1263-9. 13. newman a. a clinical evaluation of the long term outcome of patients treated for bilateral fracture of the mandibular condyles. br j oral and maxillofac surg 1998; 36:176-79. 14. villarreal pm, monje f, et al. mandibular condyle fractures: determinants of treatment and outcome. j oral maxillofac surg 2004; 62:155-63. 15. zachariades n, mezitis m, mourouzis c, et al: fractures the mandibular condyle: a review of 466 cases. literature review, reflections on treatment and proposals. j craniomaxillofacial surg 2006; 34:421. lmrj volume 2 issue 3 63 | p a g e 16. kim yk, min bi.clinical study of mandibular condyle injury. taehan chikkwa uisa hyophoe chi 1989; 27:1073 87. 17. amaratunga n.a.de s. a study of condylar fractures in srilankan patients with special reference to the recent views on treatment, healing and sequelae. british journal of oral and maxillofacial surgery 1987; 25: 391-397. 18. thoren h, iizuka t, hallikainen d, nurminen m, lindqvist c. an epidemiological study of patterns of condylar fractures in children. br j oral and maxillofac surg 1997; 35:306-11. 19. rikhotso e and ferretti c a prospective audit over a six month period of condylar fractures at chris hani baragwanath hospital. sadj 2008; 63:222-29. 20. adam cd, januszkiewcz js, judson j. changing patterns of severe cranio maxillofacial trauma in auckland over eight years. aust nz j sur 2000; 70:401-4. 21. abbas i, ali k, mirza yb. spectrum of mandibular fractures at a tertiary care dental hospital in lahore. j ayub med coll abbottabad 2003; 15:1214. 22. huelke df, harger jh. maxillofacial injuries .their nature and mechanism of production. j oral surg 1969; 27:45 lmrj volume 2 issue 4 69 | p a g e histological grade and breast cancer – are we using it right? jawaid naeem qureshi1 department of surgery, indus medical college, tando mohammad khan, pakistan corresponding author prof. jawaid naeem qureshi department of surgery, indus medical college, tando mohammad khan, pakistan email:drjnq@hotmail.com lmrj.2020; 2(4) doi: 10.38106/lmrj.2020.2.4-01 abstract: breast cancer is the most common malignancy among women all around the world. there is geographical variation in the relative rate from one country to the other, breast cancer is the most common malignancy among women all around the world. there is geographical variation in the relative rate from one country to the other, nevertheless it remains at the top. not only it is the top most cancer among females but it is also the leading killer and the oldest known disease among women. introduction breast cancer is the most common malignancy among women all around the world (1-3). however there is geographical variation in the relative rate from one country to the other, nevertheless it remains at the top. not only it is the top most cancer among females but it is also the leading killer and the oldest known disease among women. the history of breast cancer is as old as of human being which can be evidenced by the oldest books on medicine, written in different ages like nei jing; written by huang di chinese emperor in 2698 bc (4). the oldest description of the breast cancer was given by edwin smith, written on papyrus leaves in egypt in 1600 bc (5)who described it as the bulging lump, cool to touch, having no treatment. in the period of greeks the hippocrates linked breast cancer with cessation of menstrual cycle in today’s terminology menopause(6) . major milestone in the history of breast cancer is the discovery of the lymphatic system in 1650s by jean pecquet, thomas bartholin and olofrudbeck and another is the association of hormonal factors with the development and progress of the cancer by george beaston in 1896 when he demonstrated the remission of the cancer after oophorectomy (5). subsequently the discovery of oestrogen receptors in 1962 by jenson & jacobson, and identification of genetic mutations have added in the understanding of the disease(6). the realisation of the importance of the understanding of the breast cancer biology also dates back to the review article lmrj volume 2 issue 4 70 | p a g e centuries ago, when the medical scholars and treating physicians observed that patients of the same age group and similar clinical parameters of the tumours behave so differently that with even minimal treatment survive almost natural life span while others with maximum possible aggressive treatment die within a short period of time(7). this realisation made them study inside of the tumours. this understating improved step by step, first the scientists noticed that morphological differences in terms of the histological type and grade and further advanced to the more sophisticated molecular and genetic differences(8, 9). recent advances in the understanding of the disease have greatly improved survival. this improved understating of the biology has resulted in the development of more targeted therapy such as use of hormonal therapy in oestrogen receptor (er) positive patients and trastuzumab in patients having human epidermal growth factor (her2)-2 positive(10, 11). the understanding of the biology of the disease therefore remains the fundamental to the oncologists dealing with the disease. histologically breast cancer arises from the duct cells or the lobular cells, thus the basic histological types of breast cancer are named after these cells of origin(12). further specialised types of cancers are also seen but usually perceived as variants of ductal carcinoma. these cancer types include no special type, mucinous, papillary carcinoma, tubular and tubular mixed, comedo carcinoma etc. breast cancer has potential to disseminate away from the breast, resulting in the metastases spread to lymph nodes and systemic spread to bone, liver, lung and brain. in order to identify the cases at highest risk of distant metastases a number of histopathological, molecular and genetic factors have been studied resulting in basic prognostic index such as nottingham prognostic index or more sophisticated such as oncotype dx are in practice. given the economic burden associated with high tec analysis it is important to identify some economic tool. grade could be one of those. histological grade of breast cancer histological grade of the breast cancer is the degree of differentiation of the tumours cells define in the terms of mitotic count, nuclear pleomorphic and the tubular formation. it was given by the scarff-bloomrichardson in 1957, which was then modified by the eliston and elis in 1991[1,2]. the eliston ellis modification of the histological grade of the breast cancer is also known as nottingham histological grading system. the eliston ellis modification of the histological grade considers three components of the tumour cells including tubule formation, mitotic count and the nuclear pleomorphism in a specified field, cumulative score of these three components is then considered as the tumour grade[2]. figure 1 summarises the grading system of the breast cancer. grade i is the well differentiated tumour while grade iii is the poorly differentiated tumour. biologically they pose different characteristics, their growth rate is also different, where poorly differentiated tumours show high rate of growth, resulting in poor prognosis. lmrj volume 2 issue 4 71 | p a g e three components is then considered as the tumour grade[2]. figure 1 summarises the grading system of the breast cancer. grade i is the well differentiated tumour while grade iii is the poorly differentiated tumour. biologically they pose different characteristics, their growth rate is also different, where poorly differentiated tumours show high rate of growth, resulting in poor prognosis. tubular formation 1= >75% of tumour area forming tubules 2=10-75% of tumour area forming tubules 3=<10% of tumour area forming tubules nuclear pleomorphis m 1= little variation in size and shape of nucleus 2= moderate increase in size and change of shape of necleus 3=marked variation in size and shape of nucleu figure.1. histological grade of breast cancer correlation between the histological grade and the doubling time of tumour cells the cell doubling time is the duration of the cell required to divide (ie mitosis). figure 2 shows log of the doubling of cells in the cell division. the cell divides in log manner. one cell divides into two, two into four, four into eight, eight into sixteen and so on. the cells when divide at 20th time the theoretical number of cells would be around 1million and the clump of this number of cells make a mass of 1 mm[3]. when these cells divide 30 times they make a mass of 1 cm[3]. however in tumours all cells do not divide at one time. some remain at resting stage for sometime before they enter into cell division again. tumours with increased mitotic count and shorter interval between mitosis increase in size quickly. • cumulative score 3-5 grade i • cumulative score 6-7 grade ii • cumulative score 8-9 grade iii mitotic count 1=≤7mitosis/ f 2=8-14mitosi 0hpf 3=≥15mitosi 0hpf lmrj volume 2 issue 4 72 | p a g e when tumours have adequate blood supply the cells can divide at almost constant rate and also the supply of the activators of the cell growth such as oestrogen and progesterone e.g rapidly growing tumours have high mitotic count, shorter mitotic interval and reached to palpable stage quickly. the grade i tumours having <10% mitotic count show low growth rate because only 10% of cells dividing thus the increase in the size of the tumour takes longer duration as compared to the tumours having >75% of cells dividing. the study by mehara et al analysed computer simulated doubling time to assess tumour growth rate. they used doubling time of the cells[4]. they measured tumour at day 1 and 200[4]. they concluded that the doubling time is not the sole predictor of the growth rate. here again comes the theory that the tumour mass has heterogeneous pattern of cells. some divide rapidly some at slow rate and at the same time some cells may be lost. thus the increase in the size of tumour takes into account all these factors. however if 75% of cells are dividing and a constant rate of 10% are lost even then 65% of cells will increase in number with each cell division making the tumour mass grow rapidly as compared to the tumour where only 10% of cells are dividing and 5% of which are lost during that period. practical example is of the er positive tumours (where majority show low grade tumours) in older women where great majority present with low grade and show very slow growth rate. sometimes it may take years to increase in size. in contrast triple negative breast cancer in younger population where majority show high grade of tumours grow rapidly and show a poor prognosis. the rate of mitotic count and average doubling time of the tumours have potential to accurately predict the growth rate of the tumours (figure 3.). figure 2. log of the cell division pattern first cell division= second cell division = 4 5th cell division= 10th cell division= 20th cell division= 1048576 lmrj volume 2 issue 4 73 | p a g e figure 3. relationship of the mitotic count with the cell doubling time in correlation with the tumour growth prognostic and predictive significance of grade in breast cancer overall there is predominance of grade ii and the grade i & iii remain at the nearly similar pattern(13, 14). the studies have reported change in the pattern of grading distribution with age. in young patients there is predominance of the aggressive tumours with (ie. grade iii) while with advancing age there is change in the pattern and there is predominance of the less aggressive phenotype (ie grade i & ii). as a result of change in the demographic characteristics of the breast cancer in different continents, african and asian national have predominance of younger age group resulting in majority of high grade tumours. the sbr grading system was known for years but couldn’t get acceptance as the prognostic factor in breast cancer due to lack of reproducibility and high level of subjectivity. however eliston ellis modification was tried on a large nottingham/ tenovus series (n=1831) with operable primary breast cancer in patients <70 years of age(15, 16). this series was aimed to analyse prognostic factors in breast cancer. the nottingham tenovus series analysis showed that tumour grade is the strong prognostic factor which differentiates between the patients enjoying better survival and those who develop progression of disease early. as a result histological grade was also included in the nottingham prognostic index. a number of studies then followed and tested prognostic significance of the histological grade(17-19). the histological grade has even maintained it prognostic significance in the modern era of the genetic testing. in other words it wont be wrong if we say that the morphological pattern in terms of grade in a way represents molecular and genetic pattern of the tumours. however with advancements in the management and targeted therapies the survival has improved though categorical distribution among the grade ranks remained the same. there is also indirect relation of the grade with the prognosis in terms of direct relationship with poor prognostic factors such as the s-phase fraction and ki-67 and inverse relation with good prognostic factors such as hormone receptor status(14, 20). mitotic count in the cells cell doubling time lmrj volume 2 issue 4 74 | p a g e histological grade represents cell differentiation and the rate of growth. thus theoretically it can predict response to the therapeutic agents which act on dividing cells such as cell cycle specific chemotherapy ie methotrexate(21). technically it is not appropriate to assess the predictive response of a therapy when tumour is being removed. once tumour is removed there are a number of confounding factors which may affect the predictive value of the histological grade. chemotherapy on the other hand is the systemic therapy indicated as neo-adjuvant (before surgery) in locally advanced breast cancer, adjuvant (after surgery) in operable primary breast cancer or as primary therapy in advanced cancer. there are different groups of cancer chemotherapy drugs classified on the basis their pharmacological groups or their mechanisam of action. a summary of the drugs used in breast cancer is given in figure 4. on the basis of their phamocological groups they are divided as cell cycle specific and non specific drugs. the cells have mixed pattern of cells having some cells dividing and others are at resting state. thus a mixture of both group is given. cell cycle specific chemotherapy affects the cells dividing actively. these drugs act on the cells in the log manner such that 50% of the dividing cells will be killed by one cycle. these drugs include fluorouracil, methotraxate, paclitaxil and docitaxel. thus these drugs would ideally be useful for high grade tumours. cell cycle non specific chemotherapy affects resting cells. these drugs include cyclophosphamide, epirubicin and doxorubicin. low grade tumours can get maximum benefit from this group of drugs. figure. 4. chemotherapeutic agent groups in relation to cell division lmrj volume 2 issue 4 75 | p a g e conclusion histological grade of the breast cancer is not merely a morphological feature of the tumour but it portrays a whole spectrum of the molecular architecture of the tumour. thus have potential to predict survival and role of different therapeutic agents. further exploration of the factors governing histological grades need further exploration. references 1. carol d, melissa m, siegel r, jemal a. breast cancer facts & figures 2009-2010. american cancer society, research s, amp, health p; 2010. 2. jemal a, siegel r, ward e, hao y, xu j, thun m. cancer statistics, 2009. ca cancer j clin. 2009;59(4):225-49. 3. globocan. cancer statistics. 2020. 4. bland k ce. the breast. third ed. saunders, editor. missouri2004. 5. cheung kl. endocrine therapy for breast cancer: an overview. the breast. 2007;16:327-43. 6. rabaglio m as, gertsch mc,. controversies of adjuvant endocrine treatment for breast cancer and recommendations of the 2007 st gallen conference. lancet oncology. 2007;8. 7. bloom hj, richardson ww, harries ej. natural history of untreated breast cancer (1805-1933). comparison of untreated and treated cases according to histological grade of malignancy. br med j. 1962;2(5299):21321. 8. champion hr, wallace iw. breast cancer grading. br j cancer. 1971;25(3):4418. 9. champion hr, wallace iw, prescott rj. histology in breast cancer prognosis. br j cancer. 1972;26(2):129-38. 10. syed b, johnston s, wong d, green a, winterbottom l, kennedy h, et al. longterm (37 years) clinical outcome of older women with early operable primary breast cancer managed in a dedicated clinic. ann oncol. 2011. 11. syed bm, green ar, paish ec, soria d, garibaldi j, morgan l, et al. biology of primary breast cancer in older women treated by surgery: with correlation with long-term clinical outcome and comparison with their younger counterparts. br j cancer. 2013;108(5):1042-51. 12. mathew j, lee s, syed bm, morgan da, ellis io, cheung kl. a study of ductal versus non-ductal invasive breast carcinomas in older women: long-term clinical outcome and comparison with their younger counterparts. breast cancer res treat. 2014;147(3):671-4. 13. amat s, penault-llorca f, cure h, le bouedec g, achard j, van praagh i, et al. scarff-bloomrichardson (sbr) grading: a pleiotropic marker of chemosensitivity in invasive ductal breast lmrj volume 2 issue 4 76 | p a g e carcinomas treated by neoadjuvant chemotherapy. int j oncol. 2002:791-6. 14. ehinger a, malmstrã¶m p, bendahl po, elston cw, falck ak, forsare c, et al. histological grade provides significant prognostic information in addition to breast cancer subtypes defined according to st gallen 2013. acta oncol. 2017;56(1):68-74. 15. elston cw. the assessment of histological differentiation in breast cancer. aust n z j surg. 1984;54(1):11-5. 16. elston cw, ellis io. pathological prognostic factors in breast cancer. i. the value of histological grade in breast cancer: experience from a large study with long-term follow-up. histopathology. 1991;19(5):40310. 17. aaltomaa s, lipponen p, eskelinen m, kosma vm, marin s, alhava e, et al. mitotic indexes as prognostic predictors in female breast cancer. j cancer res clin oncol. 1992;118(1):75-81. 18. au fw, ghai s, lu fi, moshonov h, crystal p. histological grade and immunohistochemical biomarkers of breast cancer: correlation to ultrasound features. j ultrasound med. 2017;36(9):1883-94. 19. rakha e, el-sayed m, lee a, elston c, grainge m, hodi z, et al. prognostic significance of nottingham histologic grade in invasive breast carcinoma. j clin oncol. 2008;26(19):3153-8. 20. abd el-rehim d, ball g, pinder s, rakha e, paish c, robertson j, et al. highthroughput protein expression analysis using tissue microarray technology of a large wellcharacterised series identifies biologically distinct classes of breast cancer confirming recent cdna expression analyses. int j cancer. 2005:340-50. 21. a'hern rp, jamal-hanjani m, szã¡sz am, johnston sr, reis-filho js, roylance r, et al. taxane benefit in breast cancer--a role for grade and chromosomal stability. nat rev clin oncol. 2013;10(6):35764. research article quality of nursing care in the perspective of nurses at tertiary care public hospital, karachi ameer ullah khan1, sajjan a. halepoto1, sineer micah2, sikander munir memon 1, victoria samar1, muzafar ali, mehar ali, imran ali shah1 people’s school of nursing, lumhs, jamshoro, sindh government hospital liaquatabad, karachi correspondance: ameer ullah khan people’s school of nursing, lumhs, jamshoro received: 10 october 2019 revised: 25 november 2019 accepted: 2 january 2020 lmrj.2020:2(1) doi: 10.38106/lmrj.2020.2.1.01 abstract quality care is essential for patient safety and positive outcome. nurses have to play pivotal role in patient care. this study was aimed to explore quality of nursing care in perspective of nurses at a tertiary care public hospital karachi, pakistan. a descriptive cross-sectional study was conducted at a tertiary care public sector hospital. data was collected by using a pre-defined questionnaire. activities in four dimensions including patient satisfaction, prevention of complications, functional re-adaptation health promotion are almost always fulfilled while, well-being and self-care and responsibilities and rigor were less executed. nurses are empathetic and show respect to the patient but not engaged in acre process. key words: nursing, nursing care, quality care, standard care. tertiary care introduction quality of health care standard is an essential part of patient safety and positive outcomes. in united states of america (usa) approximately 250,000 deaths account for laps in quality care1-3. studies have been conducted to explore quality of care taking into account only patient’s perspective, though nurses have a key to play in this regard4-5. therefore it is important to consider nurse’s perspective in quality care. registered nurse (rn) practice in a therapeutic and professional relationship with individuals and their attendants6. nurses provide safe and quality care and are also responsible to perform comprehensive assessment, interpret information and make critical decisions, administer medications and execute other necessary interventions7. this study was aimed to assess quality of nursing care in perspective of nurses as there is strong need to quantify overall magnitude of problem so that policy can be established. methodology descriptive cross-sectional study was conducted at tertiary care public hospital karachi, pakistan from september 2017 to december 2017. all the staff nurses working in cardiology and cardiac surgery departments who had spent at least three months in the institution and willing to participate were included using convenient sampling technique. an adopted questionnaire “nurses’ perceptions and practices: contributions to care quality” was used for data collection. it is a likert scale with four options; never, rarely, often and always, consisted of 25 items categorized in seven dimensions; patient satisfaction, health promotion, prevention of complications, well-being and self-care, functional readaptation, nursing care organization, responsibility and rigor. the tool is valid and reliable having crohncach’s alpha of 0.940a. permission was taken from chief nursing superintendent; thereafter proceed to the respective participants and explained objectives and purpose of the study then asked to give consent in written form. after it, questionnaire forms were distributed in participants and explained each point of questionnaire for minimizing the error. each form was checked at the time of collection to make sure of their completion on spot. statistics/data analysis software (stata), version 12.1 was used for data analysis. results a total of 44 nurses participated in the study with mean age of 35.36 (sd ±9.12) years. majority of participants were female (ie 63.64%). there was a predominance of staff nurses (93.18%) while 6.82% were head nurses. more than half (59.09%) of the participating nurses have three years rn qualification followed by bachelors of science(bsn) degree (ie 40.91%). with regards to department of work, most of the respondents were from ccu (27.27%), followed by cardiac ward (22.73%), cicu and cardiac surgery icu (18.18%) and cardiac surgery ward (13.64%). there was a high proportion of nurses (45.45 %) having experience of six to ten years (table 1). in the results of the scale “nurses’ perceptions and practices that contribute to quality care, within the dimension of patient satisfaction (table 2) most participants replied always at the of 72.73%). within context of dimension health promotion most participants (68.18%) replied rarely (table 3). in response to activity “nurses use the hospitalization time to promote healthy lifestyles”, majority replied often (50 %) (table 4). responses of “well-being and self-care” are summarized in table 5. responses of functional re-adaptation are summarized in table 6. responses of nursing care organization are given in table 7, while responsibility and rigor was summarized in table 8. table 1: demographic characteristics variable frequency percentage age 35.36" 9.12** gender male 16 36.36 female 28 63.64 nursing qualification rn 26 59.09 bsn 18 40.91 msn nil 00.00 department cardiac ward 10 22.73 cicu 08 18.18 ccu 12 27.27 cardiac surgery ward 06 13.64 cardiac surgery icu 08 18.18 designation head nurse 03 6.82 stawurse 41 93.18 total work experience less than one year 02 4.55 1 — 5 years 10 22.73 6 — 10 years 20 45.45 11 — 15 years 04 9.09 16 — 20 years 02 4.55 21 years and above 06 13.64 table 2: patient satisfaction n % n % n % n % n % “nurses show respect for the abilities, beliefs, values and desires of individual patient”. 02 4.55 04 9.09 06 13.64 32 72.73 44 100.0 “nurses are constantly seeking to show empathy in interactions with the patient” 00 00 08 18.18 10 22.73 26 59.09 44 100.0 “nurses involve cohabitants of individual patient in the nursing care process” 04 9.09 28 63.64 04 9.09 08 18.18 44 100.0 table 3: health promotion n % n % n % n % n % “nurses identify the health situation of the population and the resources of patient”. 02 4.55 30 68.18 10 22.73 02 4.55 44 100.0 “nurses use the hospitalization time to promote healthy lifestyles”. 02 4.55 12 27.27 22 50.00 08 18.18 44 100.0 “nurses provide information that generates cognitive learning and new abilities in the patient”. 04 9.09 16 36.36 12 27.27 12 27.27 44 100.0 table 4: prevention of complications n % n % n % n % n % “nurses identify potential problems of the patient”. 06 13.64 18 40.91 10 22.73 10 22.73 44 100.0 “nurses prescribe and perform interventions to prevent complications”. 04 9.09 02 4.55 20 45.45 18 40.91 44 100.0 “nurses evaluate the interventions that help prevent problems or minimize undesirable acts.” 02 4.55 10 22.73 18 40.91 14 31.82 44 100.0 table 5: well-being and self-care n % n % n % n % n % “nurses identify patient’s problems that will help improve the patient’s well-being and daily activities.” 02 4.55 20 45.45 16 36.36 06 13.64 444 100.0 “nurses prescribe and perform interventions that will help improve the patient’s well-being and daily activities.” 2 4.55 22 50.00 16 36.36 4 9.09 44 100.0 “nurses evaluate the interventions that help improve the patient’s well-being and daily activities.” 4 9.09 16 36.36 20 45.45 04 9.09 44 100.0 “nurses address problematic situations identified that will help improve the patient’s well-being and daily activities.” 06 13.64 20 45.45 10 22.73 08 18.18 44 100.0 table 6: functional re-adaptation n % n % n % n % n % “nurses ensure continuity of nursing service provision.” 0s 00 04 49.09 16 36.36 24 54.55 44 100.0 “nurses plan discharge of patients according to each patient’s needs and community resources.” 04 9.09 10 22.73 06 13.64 24 54.55 44 100.0 “nurses optimize the abilities of the patient and his/her cohabitants to manage the prescribed therapy.” 06 13.64 16 36.36 20 45.45 02 4.55 44 100.0 “nurses teach, instruct and train patients for adaptation and teach, instruct and train patients what is required for functional readaptation'’ 06 13.64 08 18.18 12 27.27 18 40.91 44 100.0 table 7: nursing care organization n % n % n % n % n % “nurses know how to handle the nursing record system.” 00 00 06 13.64 06 13.64 32 72.73 44 100.0 “nurses know the hospital’s policies.” 02 4.55 08 18.18 06 13.64 28 63.64 44 100.0 table 8: responsibility and rigor n % n % n % n % n % “nurses show responsibility for the decisions they make and for the acts they perform and delegate, aiming to prevent complications.” 00 00 08 18.18 20 45.45 216 36.36 44 100.0 “nurses show responsibility for the decisions they make and for the acts they perform and delegate, aiming to ensure well-being and self-care of patients.” 2 4.55 16 36.36 16 36.36 10 22.73 44 100.0 “nurses show technical/scientific rigor in the implementation of nursing interventions aiming to prevent complications.” 00 00 08 18.18 18 40.91 18 40.91 44 100.0 “nurses show technical/scientific rigor in the implementation of nursing interventions that help improve the patient’s well-being and daily activities.” 02 4.55 18 40.91 18 40.91 06 13.64 44 100.0 “nurses refer problematic situations to other professionals, according to the social mandates.” 04 9.09 08 18.18 10 22.73 22 50.00 44 100.0 “nurses supervise the activities that support nursing interventions and the activities they delegate.” 04 9.09 16 36.36 14 31.82 10 22.73 44 100.0 discussion the results of demographic data of participants revealed that the mean (+sd) age of the participants was 35.36 (+9.12) years. there was majority of female (63.64%) and staff nurses (90.91%). most of the participating nurses (59.09 %) have three years registered nurse (rn) qualification. it is matter of concern that there is no any single nurse, having master degree in nursing. according to barret, there is a significant relationship between quality care and level of nurses education' and recommended to increase qualified nurses in specialized care units, but abdul rahman et al. do not agree with their findings“. a high percentage of nurses (45.45 %) have experience of six to ten years. regarding the scale “nurses’ perceptions and practices that contribute to quality care”, in the dimension “patient satisfaction” mostly participants replied always in the activities “nurses show respect for the abilities, beliefs, values and desires of individual patient while providing nursing care.” and “nurses are constantly seeking to show empathy in interactions with the patient”. the main area of concern is most of the nurses replied rarely (63.64%) in the activity “nurses involve significant cohabitants of individual patient in the nursing care process.” understanding patient’s abilities is important to involve them as a shared partner in health care.” patients’ perceived their involvement in care seemed to be associated with their attitudes about their illnesses and recovery and preferred shared decision making " about “health promotion dimension”, most of the nurses answered rarely in the statements “nurses identify the health situation of the population and there sources of patient/family and community” and “nurses provide information that generates cognitive learning and new abilities in the patient”. a study conducted by ribeiro, martins and tronchin , majority of nurses replied often, which is differ from this study while most of the participants in this study responses often in “use the hospitalization time to promote healthy lifestyles”, which is in line with their study. these finding are significant for concern. nurses are the foundation of patients’ behavioral changes by means of approaches focused on health promotion". but, the findings of this study recommend that this may not be executed by nurses in hospital setups. in the dimension prevention of complication, results showed that nurses often perform and evaluate intervention to prevent complication but they are rarely able to identify potential problems of the patient. these finding differ from the results of the aforementioned study. according to american nurses association, nurses must increase their efforts for development and implementation of nursing actions to support promotion of health and prevention of disease/ illness and disability’. with regards to dimension “wellbeing and self-care”, most of the participants replied rarely while few answered always which are oppose to the findings of the study by martins et al. the findings suggest that there is a strong need to focus on this domain as it is necessary for a healthy recovery. in the context of “functional re-adaptation”, majority of respondents answered always in the activity nurses ensure continuity of nursing service provision. continuity of care insures high quality care and cost effectiveness. if care is episodic, chronically ill patients might develop adverse effects and complications; results in high expenses and poor outcome. most of the nurses replied always in this study for the activities “nurses plan discharge of patients according to each patient’s needs and community resources and teach, instruct and train patients for adaptation and teach, instruct and train patients what is required for functional re-adaptation”; mostly answered often in the response of “nurses optimize the abilities of the patient and his/her cohabitants to manage the prescribed therapy”. mabire et. al. did a study and reported that discharge planning helps in transition from hospital to home care and decrease post-discharged complications and adverse events but comprehensive discharged planning did not benefit the patients results in less readiness and frequent readmission within 30 days”. most of the respondents answered rarely in the activities “nurses show responsibility for the decisions they make and for the acts they perform and delegate, aiming to ensure well-being and self-care of patients”, “nurses show technical/scientific rigor in the implementation of nursing interventions that help improve patient’s well-being and daily activities” and “nurses supervise the activities that support nursing interventions and the activities they delegate.” even after delegating activity, it is the responsibility of the nurses to supervise subordinates for patient safety and prevent unwanted outcomes. nurses are professionally and legally responsible for providing care, decisions taken and its consequences. references 1. makary ma, daniel m., medical error-the third leading cause of death in the us. bmj 2016; 353(i2139):1—5. 2. irfan sm, ijaz a. comparison of service quality between private and public hospitals empirical evidences from pakistan. j qual technol. manag. 2011; vii(i): 1—22. 3. siddiq a., quality of healthcare services in public and private hospitals of peshawar, pakistan: a comparative study using seroquel. c i t y u n i v e r s i t y . e d u . p k . 2016; 06(02): 242—55. 4. gunther m., alligood mr., a discipline-specific determination of high quality nursing care. j adv nurs. 2002; 38(4): 353—359. 5. tafreshi mz, pazargadi m, abed saeedi z., nurses’ perspectives on quality of nursing care: a qualitative study in iran. int j health care qual assur. 2007; 20 (4): 320—8. 6. nursing and midwifery board of australia –registered nurse standards for practice [internet]. [cited 2018 jul 31]. available from:http://www.nursingmidwiferyboard.gov.au/ 7. american nursing association[ana]. what is nursing &amp; what do nurses do? | ana enterprise [internet]. 2018 [cited 2018 jul 31]. 8. koy v, yunibhand j, angsuroch y. nursing care quality: a concept analysis. int j res med sci. 2015; 1832-8. 9. martins mmfp da s, goncalves mn da c, ribeiro ompl, tronchin dmr. quality of nursing care: instrument development and validation. rev bras enferm. 2016; 69(5): 920—6. 10. barret d. degree level education in nursing — time to move the discussion on. evidence-based nursing blog. 2016; 11. abdul rahman h, jarrar m, don ms. nurse level of education, quality of care and patient safety in the medical and surgical wards in malaysian private hospitals: a cross-sectional study. glob j health sci. 2015; 7(6):331—7. 12. bob wertz. improving patient participation in health care nejm catalyst [internet]. 2018 [cited 2018 aug 5]. 13. ambigapathy r, chia yc, ng cj. patient involvement in decision-making: a cross-sectional study in a malaysian primary care clinic. bmj open. 2016 jan 4;6(1):e010063. 14. ribeiro o, martins m, tronchin d. nursing care quality: a study carried out in portuguese hospitals. rev enferm ref. 2017 sep 29;iv série(no14):89—100. 15. international council of nurses (icn). definition of nursing. retrieved june. 2010;2(1):2011. 16. the sentinel watch. brent nursing roles in the continuum of care — the sentinel watch [internet]. 2015 [cited 2018 aug 5]. 17. mabire c, bula c, morin d, goulet c. nursing discharge planning for older medical inpatients in switzerland: a cross-sectional study. geriatr nurs (minneap). 2015nov 1;36(6):451—7. 18. nursing and midwifery board of ireland. nmbi nmbi scope of practice responsibility, accountability & autonomy. lmrj volume 2 issue 1 8 | page lmrj volume 1 issue 2 28 | p a g e awareness and practices regarding needle stick injuries among health care professionals: findings at a tertiary care hospital of karachi kashif pirwani, muhammed raza & syed hassan abbas rizvi khadim ali shah bukhari institute of technology, (kasbit) karachi, pakistan. received: 28 february 2019 revised: 9 april 2019 accepted for publication 16 may 2019 correspondence: nawaz ahmad assistant professor at iobm, karachi. nawaz.ahmad@iobm.edu.pk this article may be sighted as: pirwani k, raza m, rizvi sha. awareness and practices regarding needle stick injuries among health care professionals: findings at a tertiary care hospital of karachi. lmrj. 2019; 1(2): 27-30. doi: 10.38106/ lmrj. 2019.1.2-02. abstract assesment of the knowledge, attitude and practices of healthcare professionals (hcps) regarding needle stick injuries (nsis) at a tertiary care hospital in karachi. this was a cross-sectional study, conducted among 404 health care workers at a tertiary care hospital in karachi. a self -administered questionnaire was used to collect the data which was analyzed by using spss version 22.0. out of 404 hcps, 83.17% were actively involved in the human activity of distributing any kind of injection during their duties. a total of 117 (29%) study participants were sufficiently educated regarding nsi practices (p<0.001). among the hcps, 64.9% had never read the institutional guidelines regarding nsis. a total of 253 (62.7%) hcps had sustained a needle stick injury at least once in the last one year; 75% of them were previously immunized with hepatitis b vaccination. the level of awareness among hcps at tertiary health care level at karachi is not satisfactory. frequent training workshops, teaching sessions and symposia should be arranged to promote awareness regarding nsis among hcps. keywords: needle stick injuries (nsi), health care professionals (hcps), tertiary care, hospital, karachi. introduction health care professionals (hcps) are at the highest risk to suffer needle stick injuries (nsis). these injuries can transmit several viral infections, and can lead to serious morbidity and mortality 1, 2.studies have revealed that almost three million out of thirty five million hcps experience needle stick injury every year, worldwide3. the issue is of concern among both the developed and developing countries4,5. more than 20 types of pathogens have been reported to transmit through nsis; the most feared ones are hepatitis b virus (hbv), hepatitis c virus (hcv) and human immunodeficiency virus (hiv)6. according to world health organization (who) 40% of hbv, hcv and 2.5% of hiv infections among hcps are attributed to nsis3. it has been, likewise, reported that hcps do not stick with proper infection control techniques7-9. a majority of the inexperienced workers regularly perform recapping of needles; a majority of them, however, do not know the importance of utilizing personal protective measures10,11. the most likely reason to this menace is inadequate professional training regarding nsis 11,12. a basic aim of safe and efficient nursing care is to prevent and control infections. in the nutshell, nsis pose a significant threat of infections to the hcps in general. the issue is of special attention in communities which lack awareness and proper training in nsi handling. gravity of this problem and the causative factors have not been investigated in local population as yet. findings from this study would hence assist the authorities in taking appropriate preventive measures. thus this study was designed to assess knowledge and practices regarding nsis among hcps. methodology the cross-sectional study was conducted among the health care workers in tertiary care hospitals at karachi. study participants health care workers serving at tertiary health care hospitals in karachi were randomly selected; those who consented were enrolled into the study. health care workers of either gender and all age groups, dealing with research article mailto:nawaz.ahmad@iobm.edu.pk mailto:nawaz.ahmad@iobm.edu.pk lmrj volume 1 issue 2 29 | p a g e syringes in diagnostic or therapeutic interventions, were included into the study. data collection primarily incidence of nsi was assessed among different caders of health care workers. questionnaires depicting awareness regarding nsi, preventive techniques and history of infliction, if any, were filled out for each patient by pre-trained individuals. nsi was defined as any cut or prick sustained by a needle previously used on a patient during execution of a medical procedure sustained within the hospital premises. data analysis the data was collected on questionnaires and transferred to the statistical package for social sciences (spss) version 22 for analysis. arithmatic means and standard deviations were calculated from normally distributed continuous variables. differences among the subgroups of variables were analyzed for statistical significance keeping the limit for confidence interval at 95%. results a total of 500 health care workers were randomly selected of whom 404 consented and were enrolled into the study. these included 36 (8.91%) consultants, 77 (19.5%) house officers, 179 (44.3%) nurses, 77 (17.32%) trns/trms and 42 (10.39%) others. table 1 presents general demographic and professional information of study participants. among the study participants 269 were females while 135 were males. a majority of them, i.e. 52%, were from the age group 25 to 30 years. a total of 191 participants (47.3%) had a work experience of 2-4 years. table 2 presents the proportion of at-risk healthcare workers and the nsi incidence rate among study participants. it was found that 88% (n = 358) were at risk of suffering from an nsi. a significant number of study participants, i.e. 251, had suffered from at least one incidence of nsi in the last 12 months. to elucidate the risk factors for infliction of nsis, various administrative and intellectual factors were analyzed; these have been listed in table 3. it was found that the participants lacked in their understanding of nsis. is mainly pertained to the lack of proper education/training while at service. the incidences of nsis were infrequently reported to the concerned department. the hepatitis b vaccination status among the healthcare workers was also unsatisfactory. merely 28.70% participants were aware of the organizational/ hospital policies related to health and safety. moreover, only 35.10% of the participants were following personal protective equipment (ppe) guidelines, which is suggestive of a lack of knowledge among healthcare workers. among the study participants, only 37.10% responded that they have a sharp box in the clinical setting they are working at; 25.2% of the respondents denied the presence of any such box in their work settings, whereas 37.7% admitted that they did not know if a sharp box exists in their setting or not. in the current study we found that nursing sta was the most common cader of healthcare workers suffering from nsi, however, house officers were the most at risk for nsi. consultants, in the other hand were the least at risk for nsi. among the various age groups, those from 25-30 years age comprised majority of the cases. males were found to have significantly increased prevalence of nsi in comparison to the female participants. it was also found that the inexperienced ones were the most at risk for nsi (table 4). upon further elucidation, it was found that the inappropriate understanding of nsis among healthcare workers was mainly due to lack of training and awareness about institutional policies regarding nsis (table 5). unfortunately, only 25.5% hcps sustained nsi were trained. and only 32.6% out of the population that had “needle stick injuries” were aware of organizational policies. table 1: demographic and professional data of study respondents (n=404) table 2: proportion of healthcare workers at-risk for nsi and frequency of nsi among study participants. variable frequency percentage age in years 18-24 years 100 24.79% 25-30 years 210 52.00% more than 30 years 94 23.30% gender female 269 66.60% male 135 33.40% job category consultant 36 8.91% house o cers 77 19.05% nursing sta 179 44.30% trainee nurses & midwife 70 17.32% variables (n=404) yes no don’t know/don’t remember administration of injections during work 336 (83.17%) 68 (16.83%) assistance in removal of needle 358 (88.61%) 46 (11.39%) recapping needles 357 (88.33%) 47 (11.67%) sustained any nsi during last 12 months 251 (62.10%) 153 (37.90%) 0% ≥2 nsis in the last 12 months 135 (33.4%) 116 (28.7%) 153 (37.9%) lmrj volume 1 issue 2 30 | p a g e others 42 10.39% length of service in years (study hospital) 0-2 years 151 37.40% 2-4 years 191 47.30% 4-6 years 36 8.90% > 06 years 26 6.40% incident form lled 66 (16.3%) 153 (37.90%) 185 (45.80%) table 3: nsi education level and prophylactic measures among study respondents. variables (n=404) yes no don’t know/ others knowing hospital policies 28.70% 71.30% 0 following universal precautions (following complete ppe) 35.10% 64.90% 0 sharp box placed in clinical area 37.10% 25.20% 37.7% incident reported to infection control dept. 15.3% 53.8% 30.9% received training in the prevention and/ or treatment of needle stick injury 29.0% 71% 0 read any copy of the hospital's "health and safety policy", on the safe and ethical disposal of clinical wastes during the last two years 35.1% 64.9% 0 hepatitis b vaccination 75% 11.1% 13.9% table 4: frequency of nsi in the last 12 months among various caders of hcps in context of various study parameters. table 5: knowledge and training regarding nsis among hcps (n=404) variable yes % no % p.value job category consultant (n=36) house o cers (n=77) nursing sta (n= 179) trns /trms (n= 70) others (n= 42) 2.9% 15.3% 26.7% 13.6% 4.2% 5.5% 3.2% 15% 10.5% 3.1% p < 0.001 age in years 18-24 years (n=100) 25-30 years (n=210) more than 30 years (n=94) 10.3% 43.8% 8.6% 12.9% 8.5% 15.9% p < 0.001 gender female (n=269) male (n=135) 37.1% 25.6% 29.0% 8.3% p < 0.001 years of experience in the industry 0 2 years (n= 151) 2 4 years (n=191) 4 6 years (n=36) more than 6 years (n=26) 26.4% 25.4% 7.7% 3.2% 10.2% 21.6% 1.8% 3.7% p < 0.001 variables yes % no % don’t know/ others p value knowledge of lling incident form 26.2% 60.7% 13.1% p < 0.001 a practice of reporting the injury 73.7% 26.3% 0% p < 0.001 training 25.5% 74.5% 0% p < 0.001 policies 32.6% 67.4% 0% p < 0.001 discussion in this study a higher prevalence rate of nsis (n = 251, 62.10%) among hcps was identified. this rate is significantly higher in comparison to studies conducted in the developed countries13. however, similar incidence rates have been reported in studies from the developing countries14,15. a previous study conducted in karachi also reported similar findings16. low socio-economic status is related to inadequate training of hcps, lack of resources and a higher patient to hcp ratio. all these factors may hence be implicated in the higher incidence rates of nsis. it was found that nurses comprise the majority of nsi cases at the tertiary healthcare centers of karachi. similar findings were reported in contemporary studies17,18. the higher numbers pertain to the relative majority of nurses in strength as compared to professionals of other caders. besides, nurses are in close contact with patients and more at lmrj volume 1 issue 2 31 | p a g e risk of inflicting nsi17,18. in the current study, house officers were found to be the most at risk. in a study conducted at the aga khan hospital of karachi pakistan, almost similar findings were observed19. similar findings were also reported by studies conducted in india14,15. the higher frequency of nsis among the young doctors is possibly due to the relative naiveness, lack of professional experience and overwhelming enthusiasm in comparison to the experiences hcps of other caders20. professional experience has previously been found to inversely correlate with frequency of nsis among hcps16,21. the current study also endorses this fact. lack of training and unawareness about nsis has been reported to be the most important risk factor for nsi among hcps22. in the current study we also found that the hcps lacked in appropriate training for tackling nsis. it is hence suggested that such training sessions and seminars be regularly conducted in tertiary health care centers and a minimum level of necessary understanding of the issue be rendered mandatory. conclusion it is concluded that nsis are frequent in local hcps of karachi pakistan. young doctors are the most at risk, whereas nursing sta comprise the major bulk of affectees. lack of awareness and immunization against hbv are issues of concern and need attention. references 1. prüss-üstün a, rapiti e, hutin y. estimation of the global burden of disease attributable to contaminated sharps injuries among health-care workers. american journal of industrial medicine. 2005;48(6):482-90. 2. niosh alert: preventing needle stick injuries in health care settings. u.s. department of health and human services, public health service, centers for disease control and prevention, national institute for occupational safety and health, 1999/11/01 3. world health organization: e-world health report: 2002: reduce risks, promoting healthy life geneva: world health organization. 2002 4. yacoub r, al ali r, moukeh g lahdo a, mouhammad y, nasser m. hepatitis b vaccination status needlestick injuries among healthcare workers in syria journal of global infectious 2010;2(1):28. 5. o’connor mb, hannon mj cagney d, harrington u, o’brien f, hardiman n, et al. a study of stick injuries among non-consultant hospital d o c t o r s in ireland. irish journal of medi cal science.2010; 180 (2):445-9. 6. muralidhar s, singh pk, jain rk, malhotra m, bala m. needle stick injuries among health care workers’ in a tertiary care hospital of india. the indian journal of medi research. 2010;131:405-10. 7. smith dr, mihashi m, adachi y, shouyama y, mouri f, ishibashi n, et al. organizational climate and its relationship with needlestick and sharps injuries among japanese nurses. american journal of infection control 2009;37(7):545-50 8. makary ma, al-attar a holzmueller cg, sexton jb, syin d, gilson mm, et al. needlestick injuries among surgeons in training. new england journal of medicine. 2007;356(26):2693-9. 9. smith dr, choe m-a, jeong js jeon m-y, chae yr, an gj. epidemiology of needlestick and sharps injuries among professional korean nurses. journal of professional nursing 2006;22(6):359-66. 10. i̇lhan mn, durukan e, aras en,türkçüoğlu s, aygün r. long working hours increase the risk of sharp and needlestick injury in nurses: the need for new policy implication. journal of advanced nursing. 2006;56(5):563-8 11. salehi as, garner p. occupational injury history and universal precautions awareness: a survey in kabul hospital staff. bmc infectious diseases. 2010;10(1). 12. nsubuga fm, jaakkola ms needle stick injuries among nurses in sub-saharan africa. tropical medicine and international health. 2005;10(8):773-81 13. elmiyeh b, whitaker is, james mj, chahal ca, galea a, alsha k. needle-stick injuries in the national health service: a culture of silence. journal of the royal society of medicine. 2004;97(7):326-7. lmrj volume 1 issue 2 32 | p a g e 14. goel v, kumar d, lingaiah r, singh s. occurrence of needlestick and injuries among health-care workers of a tertiary care teaching hospital in north india. journal of laboratory physicians. 2017;9(1):20-5. 15. isara ar, oguzie ke, okpogoro oe. prevalence of needlestick injuries among healthcare workers in the accident and emergency department of a teaching hospital in nigeria. annals of medical sciences and health research. 2015;5(6):392-6. 16. khan afridi aa, kumar a, sayani r. needle stick injuries – risk and preventive factors: a study among health care workers in tertiary care hospitals in pakistan. global journal of health science. 2013;5(4):85-92 17. ebrahimi h, khosravi a. needlestick injuries among nurses. journal of research in health sciences. 2007;7(2):56-62. 18. smith dr, leggat pa. needlestick and sharps injuries among nursing students. journal of advanced nursing. 2005;51(5):449-55. 19. zafar a, aslam n, nasir n, meraj r, mehraj v. knowledge, attitudes and practices of health care workers regarding needle stick injuries at a tertiary care hospital in needle pakistan. jpma the journal of pakistan medical association. 2008;58(2):57-60. 20. chalya pl, seni j, mushi mf, mirambo mm, jaka h, rambau pf, et al. needle-stick injuries and splash exposures among health-care workers at a tertiary care hospital in north-western tanzania. tanzania journal of health research. 2015;17(2). 21. hana mi, mohamed am kassem ms, shawki m. needle stick injuries among health care workers of university of alexandria hospitals. eastern mediterranean health journal. 2011;17(1):26-35 22. nsubuga fm, jaakkola ms. needle stick injuries among nurses in sub-saharan africa. tropical medicine & international health: tm & ih. 2005;10(8):773-81. lmrj volume 2 issue 2 38 | p a g e factors contributing to phlebitis among patients admitted in medical-surgical units at tertiary care bherulal, parveen akh r t e ar s , e m ar u c sa h rra a t r f ti a c ti l m e a, sikander munir memon, victoria samar, rubina dean college of nursing, lumhs, jamshoro, sir cj institute of psychiatry hyderabad, corresponding author dr sikander munir memon bds, msc. (phd) research officer mrc/oric lumhs, jamshoro email: drsikandermemon@gmail.com contact # 03003022786 lmrj.2020:2(2) doi: 10.3810/lmrj.2020.2.2.03 received: 2 april 2020, revised:14 may 2020, accepted for publication 19 may 2020 abstract in the health care settings, there is a constant use of peripheral venous catheters for different purposes, however, its use is not risk-free. this study aimed to assess the risk factors and identify prevalence of phlebitis amongst adult patients admitted in the medical-surgical units at liaquat university hospital hyderabad. a descriptive cross sectional study was conducted. data was collected from medical-surgical units at liaquat university hospital hyderabad in three months. questionnaire was used as a data collection tool consisting of 25 questions for the different categories. a total of 246 subjects, having 59.8% male and 40.2% females with the average age of 75.77 years, participated in study. phlebitis grade 2 & 3 appeared to be more common in age between 18 to 70 years with average percentage of 41.1and 40.2 respectively. statistically, hepatitis c virus and pyrexia found significantly associated with development of phlebitis. the study concluded that high rate of phlebitis grade ii & iii in the study population. keywords: infusion, risk factors, phlebitis, short peripheral catheter introduction phlebitis is an intravenous infection and a significant public health issue with prevalence rate of 20% in pakistan, 27.7% in india and 4% in united states of america. the use of peripheral venous catheters for various purposes is constant in health care settings. however, its use is not risk-free. most common local complication reportedly include phlebitis, and its occurrence ranges from 4.5% to 60% depending on the different settings.1 in patients with intravenous treatment, phlebitis ranks third among in-hospital complications. this complication also causes functional impairment of the affected part presenting with pain, swelling, heat, flushing of the venous canal and adjacent tissues.2 research article lmrj volume 2 issue 2 39 | p a g e the pathophysiology of phlebitis has had many hypotheses. the theory widely accepted is catheterization leading to vein pain, inflammation of tunica intima, and possible development of thrombus.3 a major role in developing phlebitis would be the catheter type, the insertion site, skin preparation method, site dressing, the method of fixing catheter, length of the catheter, frequency of exchange, irritating drugs, infusion rates, catheter fixation dressings, catheter placement procedures, and staff skills. phlebitis clinical manifestations are pain, swelling, erythema and palpable catheterized vein thrombosis.4,5 replacement of intravenous peripheral cannulas to reduce the phlebitis development in adult patients every 72 to 96 hours.6,7 a possible risk of infection includes manual dexterity, technical skills, expertise of pharmaceutical therapies, and familiarization with vascular system intravenous anatomy and physiology.8 the frequently catheter use puts patients at risk and expose to a series of complications. these intravenous catheterization risks and complications can affect the clinical condition, well-being and potential result of a patient who needs to have a peripheral catheter inserted in another location.9 intravenous catheter replacement causes patient discomfort and can lead to permanent damage of affected veins, longer hospitalization, increased cost and treatment, and possible death if complications occur.10 the visual infusion phlebitis score (vips), which assesses presence, severity and location of phlebitis. a value of 0 means there are no phlebitis signs; 1, first probable sign of phlebitis; 2, early phlebitis stage; scales 3, 4 and 5 show moderate phlebitis, advanced phlebitis/ thrombophlebitis or advanced thrombophlebitis.4,11 many institutions in the country may not be use a scale to assess phlebitis. it is important to determine the phlebitis rate and the risks to facilitate the measurement.12 there is a dearth of information on studies of phlebitis factors in pakistan. the study may help to assess and inform healthcare professionals about the factors that contribute to phlebitis. this data will be useful for healthcare systems to improve patient outcome and to reduce the length of stay of patient, reducing the costs for healthcare and subsiding the discomfort among patients that will ultimately decrease burden of disease. the objectives of the study were to assess the risk factors for phlebitis and to identify the prevalence of phlebitis among adult patients admitted in medical-surgical units at liaquat university hospital hyderabad. materials and methods a descriptive cross-sectional study was carried out at medical-surgical units i, ii, iii & iv at liaquat university hospital hyderabad during october 1st to december 31st 2019. a total of 246 patients were selected by using a non-probability convenience sampling technique. inclusion criteria was patients of both genders aged more than 18 years, being admitted within the medical and surgical units, undergoing any form of intravenous therapy, having catheter in situ in use or not. the exclusion criteria was medically compromised patients with no ability to give informed consent, being institutionalised (for example prisoners). data was collected following clearance approval from research ethics committee of lumhs (doc#lumhs/reg/acd/28274/75). data was collected from the sample population receiving some form of intravenous therapy within the medical-surgical units of liaquat university hospital. the patients were presented with a data sheet and informed consent was obtained. using the vip scale, patients at catheter placement sites were examined from the bedside for any phlebitis signs and reported the presence and severity of phlebitis. using the patient notes and charts, patientrelated characteristics leading to phlebitis, including demographic details, medical diagnosis and current medical history, were reported on the clinical audit lmrj volume 2 issue 2 40 | p a g e form. on examination, catheter characteristics were noted, and the patient was asked to explain the dates of catheter insertion and removal of the catheter. using the patient's notes, drug chart and fluid balance sheets, infusion-related features leading to phlebitis were observed. the data was analyzed in statistical package for social sciences (spss) version 23. frequencies and percentages were calculated for qualitative variables and were presented in bar charts. means and sd+ were calculated for continuous variables. the chi-square test was used to analyze qualitative categorical data among risk factors association with phlebitis. p-value <0.05 was set as significance. results phlebitis was often found to be elevated in medical units relative to surgical units. 26% (n=64) of those admitted to the medical ward # iii developed phlebitis in the participants, 15.4% (n=38) were in medical iv, 14.6% (n=36) were in medical-i and 9.8% (n=24) were in medical-ii. the percentages of phlebitis in all surgical units were significantly different, with 10.2% (n=25) in surgical-iv, 9.3% (n=23) in surgical-i and 7.3% (n=18) in each surgical ii & iii unit being observed as indicated in figure 1. figure 2 shows that in 41.1% and 40.2% of cases, the majority of participants had level ii & iii phlebitis, while 10.6% had level iv, 6.5% had level i and 1.6% had level v. the mean= 2.60, sd= 0.826, min: = 1, max: = 5, mode = 2. grade ii and iii were the most severe grades observed. phlebitis stages ii & iii and iv & v that require catheter re-setting and possible treatment. ninety-nine (37.8%) participants had infection and 124 (81.7%) participants of those without infection had phlebitis stage ii & iii, while 75 (80.7%) of those infections had phlebitis stage ii and iii, but there was no significance (p = 0.916). table 1 shows. there were no comorbidities in 5 (10.9 percent) participants, while 41 (89.1%) participants had 1 or more comorbidities. there were ii, iii & iv phlebitis stages in 200 out of 219 participants without comorbidities, while 26 (96.2%) of those with 1 or more comorbidities had ii, iii & iv phlebitis stages. the co-morbidity is not significant (p = 0.615) associated with the development of phlebitis, similar to medical diagnosis. only 7.3% of participants were unknown about their hbv status, 85.8% of participants were hbv negative but 82.0% of participants developed stage ii & iii phlebitis, while 6.9% of participants were hbv positive and 82.4% developed stage ii & iii phlebitis. the frequent development of phlebitis is not significant (p = 0.675). 66.7% of participants were hcv negative, but 82.4% of participants developed phlebitis in stage ii & iii, while 26.4% of participants were hbv positive and 80.0 percent developed phlebitis in stage ii & iii and 7.3 percent of participants were unaware of their hbv status. 76.50% developed phlebitis in stage ii & iii. hcv is a significant difference that leads to phlebitis (p = 0.015). of the 48 (19.5%) who had diabetes mellitus, all had phlebitis, but 79.3% had phlebitis in stages ii & iii. 55.7% of participants had pyrexia, 82.5% of them had phlebitis in stage ii & iii; 44.3% of participants had no pyrexia, but 79.8% of participants developed phlebitis in stage ii & iii. pyrexia leads to the statistically significant development of phlebitis (p= 0.044) as shown in table 2. lmrj volume 2 issue 2 41 | p a g e figure 1: distribution of subjects admitted in surgical and medical units figure 2: grades of phlebitis (vip scale) of the subjects table 1: distribution of diagnosis and comorbid medical conditions of the subjects n % grades of phlebitis frequency p value 1 n (%) 2 n (%) 3 n (%) 4 n (%) 5 n (%) medical/surgical diagnosis of the subjects infectious 93 37.8 7 38 37 9 2 diseases 7.5% 40.9% 39.8% 9.7% 2.2% non infectious diseases 153 62.2 9 5.9% 63 41.2% 62 40.5% 17 11.1% 2 1.3% 0.961 total 246 100 co-morbid medical conditions of the subjects none 219 89.02 15 93 88 19 4 6.8% 42.5% 40.2% 8.7% 1.8% 1 or more 27 10.98 1 3.7% 8 29.6% 11 40.7% 7 25.9% 0 0.0% 0.615 total 246 100 lmrj volume 2 issue 2 42 | p a g e table 2: distribution of hbv, hcv, dm n % grades of phlebitis frequency p valu e 1 n (%) 2 n (%) 3 n (%) 4 n (%) 5 n (%) hbv status unknown 18 7.3 3 7 6 2 0 16.67% 38.9% 33.3% 11.1% 0.0% negative 211 85.8 11 5.2% 88 41.7% 85 40.3% 23 10.9% 4 1.9% 0.67 5 positive 17 6.9 2 6 8 1 0 11.8% 35.3% 47.1% 5.9% 0.0% total 246 100 hcv status unknown 17 6.9 3 7 6 1 0 17.6% 41.2% 35.3% 5.9% 0.0% negative 164 66.7 12 7.3% 68 41.5% 67 40.9% 16 9.8% 1 0.6% 0.01 5 positive 65 26.4 1 26 26 9 3 1.5% 40.0% 40.0% 13.8% 4.6% total 246 100 diabetes mellitus no 198 80.5 14 80 82 20 2 7.1% 40.4% 41.4% 10.1% 1.0% 0.47 3 yes 48 19.5 2 4.2% 21 43.8% 17 35.4% 6 12.5% 2 4.2% total 246 100 pyrexia (> 38.5 c) no 109 44.3 9 52 35 13 0 8.3% 47.7% 32.1% 11.9% 0.0% 0.04 4 yes 137 55.7 7 5.1% 49 35.8% 64 46.7% 13 9.5% 4 2.9% total 246 100 discussion the present study represented the incidence of phlebitis, with 41.1% grade ii phlebitis and 40.2% grade iii phlebitis, followed by 10.6% grade iv phlebitis, 6.5% grade i phlebitis, and 1.6% grade v phlebitis, the highest percentage. the rates of phlebitis grade ii in studies were 35.1% and higher rates were 53.6%, while the grade iii rate (23.7%) was contrary to this research in another study.13–15 in current study, the average number of catheters was 1.30+0.49. there was a higher percentage of grade ii & iii phlebitis 86.3% and pyrexia status of the subjects in patients who had one catheter in situ compared to those who had two simulation catheters 68.7%; however, there were phlebitis grade iv & v (22.4%) in patients who had 2 simulation catheters. similarly to this study results, a study indicated the chances of phlebitis chances of developing phlebitis with more than one coexisting spc were significantly higher. the frequency also rises when inserting the catheters into the same arm is repeated.16,17 in the present study, hbv was not found significant (p = 0.615), while hcv and pyrexia (>38c) were found significant (p = 0.015) and (p = 0.044), respectively to develop phlebitis. however, the results were lmrj volume 2 issue 2 43 | p a g e not found to compare the results with this study findings, though in a study chronic diseases (p = 0.005) and infections (p = 0.007) found significant to develop phlebitis.15 as observed in this study, placement of the catheter at the joint sites of the wrist’s dorsal aspect had a higher proportion of phlebitis grade ii 51.9% right wrist dorsal aspect, 44.6% right forearm, 50.0% left forearm, 30.2% left wrist dorsal aspect and iii 36.5% right wrist dorsal aspect, 39.3% right forearm, 30.0% left forearm, 45.3% left wrist dorsal aspect. one study showed only the forearm's threat.16 another study indicated that phlebitis grade i, 46.1% was related to the hand veins and grade ii, iii and iv with the forearm veins 85.0%, 81.8% and 69.2%, respectively, these findings were higher than this present study.13 the current study reported that the most frequently catheter gauge 22 was used with incidence of phlebitis grade ii 43.7%, which was higher than a study findings 29.3%, whereas grade iii was 38.0% as compared to other study findings 52.1% which were higher. the phlebitis grade ii and iii was reported 38.5% each as compared to a study results 18.9% and 54.2%, respectively, the grade iii reported findings were higher than the current study.18 many other authors stressed that using smaller size catheters allows the circulation of blood in adjacent tissue, thus avoiding vein injuries.7,19,20 the present study showed that 80.5% catheters were in current use and developed phlebitis grade ii (44.4%) and iii (37.9%), while 14.6% catheters were in situ with regular flushing. catheter flushing found significant (p= 0.022) as a risk factor to develop phlebitis and no similarly result found in other studies. a study presented that the saline were not flushed in patients, they developed more than 10 times higher risk of incidence of phlebitis.1 in this study, the phlebitis grade ii (41.7%) and grade iii (39.1%) developed in patients who received antibiotics iv therapy. the similar results found in other studies, grade ii and iii of phlebitis were the most common in patients receiving intravenous antibiotics.8,21 this study showed that 51.2% and 26.4% of subjects received continuous infusion and reported most common phlebitis grade ii and iii. it is evident that there is a strong link (p = 0.015) between phlebitis development and the form of infusion and similarly a study highlighted continuous infusion to be a predictor of phlebitis and found more statistically significant (p = 0.006), while another study reported a higher risk of phlebitis in spcs with intermittent infusions .22–24 conclusion the catheter flushing, infusion system, hcv and pyrexia variables were statistically significantly linked to the development of phlebitis, while the catheter gauge was the least significant. this study concluded that there was a high prevalence of phlebitis and the highest percentage of grade ii & iii phlebitis was found, followed by grade i, grade iv, and grade v phlebitis. conflict of interest authors declare no conflict of interest related to publication of this article. grant support financial disclosure: none lmrj volume 2 issue 2 44 | p a g e references 1. oliveira adss, basto ml, braga lm, sena ca, melo mn, parreira pmdsd. nursing practices in peripheral venous catheter: phlebitis and patient safety. texto e context enferm. 2019;28. 2. johann da, danski mtr, vayego sa, barbosa da, lind j. risk factors for complications in peripheral intravenous catheters in adults: secondary analysis of a randomized controlled trial. rev lat am enfermagem. 2016;24(march 2017). 3. lee y, lee e. factors associated with development of early symptoms of phlebitis in hospitalized patients in general wards: a retrospective study. korean j adult nurs. 2019;31(2):136–45. 4. sarı d, eşer i̇, akbıyık a. phlebitis associated with peripheral intravenous catheters and nursing care. j hum sci. 2016;13(2):2905. 5. webster j, mcgrail m, marsh n, wallis mc, ray-barruel g, rickard cm. postinfusion phlebitis: incidence and risk factors. nurs res pract. 2015;2015:1–3. 6. dwivedi r, singh ak, gaharwar aps. thrombophlebitis at infusion sites in surgical ward: a clinical study. int surg j. 2018;5(6):2103. 7. yu x, yue s, wang m, cao c, liao z, ding y, et al. risk factors related to peripherally inserted central venous catheter nonselective removal in neonates. biomed res int. 2018 may 30;2018:1–6. 8. urbanetto j de s, peixoto cg, may ta. incidência de flebites durante o uso e após a retirada de cateter intravenoso periférico. rev lat am enfermagem. 2016;24(0). 9. chang wp, peng yx. occurrence of phlebitis: a systematic review and meta-analysis. nurs res. 2018;67(3):252–60. 10. rojas-sánchez l, parra d, camargofiguera f. incidence and factors associated with development of phlebitis: results of a pilot study cohort. rev enferm ref. 2015;iv série(no 4):61–7. 11. urbanetto j de s, freitas apc de, oliveira apr de, santos j de cr dos, muniz f de om, silva rm da, et al. fatores de risco para o desenvolvimento da flebite: revisão integrativa da literatura. rev gauch enferm. 2018;38(4):e57489. 12. qamar, zonobia & azfal, muhammad & kousar, robina & waqas, ali & gilani s. assess nurses knowledge and practices towards care and maintenance of peripheral intravenous cannulation in services hospital lahore, pakistan. saudi j med pharm sci. 2017;3(6b):622–30. 13. nobre a, martins m. prevalence of peripheral intravenous catheterrelated phlebitis: associated factors. rev enferm ref. 2018 mar 31;iv série(no16):127–38. 14. jamal z, umair m, zubair r, zafar n, rauf f, affif m. peripheral intravenous catheter related thrombophlebitisincidence and risk factors a cross sectional study. j rawalpindi med coll. 2019;23:22–7. lmrj volume 2 issue 2 45 | p a g e 15. enes sms, opitz sp, de faro arm da c, pedreira m da lg. phlebitis associated with peripheral intravenous catheters in adults admitted to hospital in the western brazilian amazon. rev da esc enferm. 2016 apr;50(2):261–9. 16. osei-tutu e, tuoyire da, debrah s, ayetey h. peripheral intravenous cannulation and phlebitis risk at cape coast teaching hospital. postgrad med j ghana. 2015;4(1):11–8. 17. heng sy, yap rt-j, tie j, mcgrouther da. peripheral vein thrombophlebitis in the upper extremity – a systematic review of a frequent and important problem. am j med. 2019; 18. simin d, milutinović d, turkulov v, brkić s. incidence, severity and risk factors of peripheral intravenous cannula-induced complications: an observational prospective study. j clin nurs. 2019 may 17;28(9– 10):1585–99. 19. marsh n, webster j, mihala g, rickard cm. devices and dressings to secure peripheral venous catheters to prevent complications. cochrane database syst rev. 2015 jun 12;(6):110–70. 20. oliveira a, costa p, graveto j, costa f, osório n, cosme a, et al. nurses’ practices in intravenous catheterization: a descriptive study. rev enferm ref. 2019 jun 28;iv série(no 21):111–20. 21. salma u, sarker mas, zafrin n, ahamed ks. frequency of peripheral intravenous catheter related phlebitis and related risk factors: a prospective study. j med. 2019 jan 1;20(1):29– 33. 22. lee s, kim k, kim js. a model of phlebitis associated with peripheral intravenous catheters in orthopedic inpatients. int j environ res public health. 2019 sep 14;16(18):3412. 23. heng sy, yap rt-j, tie j, mcgrouther da. peripheral vein thrombophlebitis in the upper extremity: a systematic review of a frequent and important problem. am j med. 2019 oct;30(2):32–9. 24. parreira p, serambeque b, costa ps, mónico ls, oliveira v, sousa lb, et al. impact of an innovative securement dressing and tourniquet in peripheral intravenous catheterrelated complications and contamination: an interventional study. int j environ res public health. 2019 sep 2;16(18):3301. type of the paper (article lmrj volume 3 issue 3 79 | p a g e research article impact of mandibular resection guidance prostheses on oral health related quality of life (ohrqol) a prospective study s. parithimar kalaignan, syed ershad ahmed1 1 department of prosthodontics, vinayaka missions sankarachariyar dental college, vinayaka missions research foundation, salem, tamilnadu, india. abstract this prospective study was aimed to measure the impact of mandibular resection guidance prostheses on oral health-related quality of life (ohrqol). a total of 35 patients with mandibulectomy defects were included. all the patients were rehabilitated with mandibular resection guidance prostheses respectively. these patients were subjected for assessment of ohrqol. the assessment was done by using ohipedent-19 and a novel scale—maxillofacial prosthesis performance scale (mfpps). the assessment was done on all the patients at two weeks and three months of prosthesis function. the scores of ohipedent, and mfpps for mandibular resection guidance prostheses after two weeks were 33.20and 18.74 respectively. the scores of ohipedent and mfpps for mandibular resection guidance prostheses prostheses at three months were 27.71and 15.20 respectively. these findings show significant improvements of prosthesis in terms of functional, physical, psychological and social parameters after longterm follow-up (3 months). key words: maxillofacial defects, oral health impact profile (ohip), intraoral prostheses, guide flange prostheses introduction maxillofacial defects result from both congenital and acquired causes leading to significant changes in the anatomic structures of the maxillofacial region1, 2. maxillofacial defects can be classified as maxillary defects and mandibular defects, both need surgical correction and rehabilitation with prostheses. mandibulectomy involves extensive loss of tissues and associated functions resulting in an inability to masticate efficiently. functional activities such as mastication, deglutition, phonetics, mandibular movements, control of saliva and psychic functioning are adversely affected post mandibulectomy3. the greatest challenges faced by maxillofacial prosthodontist in rehabilitating these conditions include the rate of disease occurrence and financial constraints .they are frequently associated with functional, physical, psychosocial and esthetic impairments4. brown‘s classification proposal depends upon the standard shape of the mandible having four corners: two vertical corners making the angles of the mandible, and two horizontal corners that are centred at the canine teeth on each side in the dentate mandible, and are roughly 7 mm anterior from the mental foramen in the edentulous jaw. our proposed mandibular defect classification is logical and simple, and groups defects into categories that can be compared in an understandable way. the use of the corners of the mandible at the angles and the canine regions make this classification system a rational approach to categorise defects, increasing in size and complexity from class i (a simple lateral defect not including the condyle involving the angle or vertical corner) to class iv (which involves at least three corners) and class ivc (which includes total mandibulectomy). the proposed classification system shows the increase in morbidity in terms of aesthetics and function from class i to class iv. this morbidity is likely to increase with non-reconstructed cases in line correspondence: syed ershad ahmed assistant professor department of prosthodontics. vinayaka missions sankarachariyar dental college, vinayaka missions research foundation salem,tamilnadu , india email: drsyedershadahmed@vmsdc.edu.in doi: 10.38106/lmrj.2021.3.3-06 received: 07.11.2020 accepted: 25. 08..2021 published: 30. 09.2021 lmrj volume 3 issue 3 80 | p a g e with the size of the defect, increasing from 70 mm in class i, 85 mm in class ii, 100 mm in class iii, and 152 mm in class iv. in modern years, oral health –related quality of life has gained enormous impact in cancer patients. evaluation of the treatment success is greatly influenced by the physical and mental strength of the patient5. this investigated the oral health related quality of life of patients with mandibular resection prosthesis. however, only a few cross-sectional studies have evaluated the change in quality of life in maxillofacial defect patients with intra oral prosthesis. thus this study was designed to establish and evaluate the specific questionnaire scale system for maxillofacial defects (mandibular defects), and to evaluate the impact of mandibular resection guidance prosthesis on oral health related quality of life (ohrqol) in mandibular defects (brown’s classification) by oral health impact profile (ohip-edent) and maxillofacial prosthesis performance scale. methodology this was a prospective study including patients with acquired mandibular defects having provision of mandibular resection guidance after 3 months, aged between 30 to 75 years. during the period between 2015 to 2019, a total of thirty-five (35) mandibulectomy patients according to brown classification were selected for this study. informed consent was obtained for all participating patients. mandibular resection prostheses were fabricated in the author’s department. the ohrqol was evaluated by means of the oral health impact profile (ohip-edent-19), obturator functioning scale (ofs-15) and maxillofacial prosthesis performance scale (mfpps-10) with standardized questionnaire subsequently at two weeks and three months of prosthesis function for all rehabilitated patients. patients were asked questions by using all three scales. answers were recorded by a single operator. the ohip-edent comprises of 19 statements derived from the ohip using an item impact method (table 1 ). oral health impact profile (ohip-edent) which includes seven subscales: functional limitation, physical pain, psychological discomfort, physical disability, psychological disability, social disability &handicap. to assess the oral health related quality of life for patients with maxillofacial defects novel scale known as maxillofacial prosthesis performance scale (mfpps) was developed. validity and reliability was tested. maxillofacial prosthesis performance scale comprises of 10 statements which includes functional discomfort, retention/stability, phonetics, esthetics, oral hygiene, saliva, taste ability, psychology and satisfaction (table 2 ). internal consistency of the questions was assessed by alpha crohnbach’s test. total ohip –edent scores ranged from 195. a five point likert scale is used and the highest score indicates, function of the obturator prostheses with greater difficulties. lower scores indicating maxillo facial prosthesis enhance the oral health related quality of life. maxillofacial prosthesis performance scale (mfpps) and the subscales would be calculated by summing the score of the responses to the 10 items and items corresponding to the subscales.total mfpps scores range from 1-50. this scales suggest that lower scores indicate significant improvement of oral health related quality of life (ohrqol) with maxillofacial prostheses in terms of their functional, physical, psychosocial and aesthetics parameters. the collected data were analysed with ibm.spss statistics software 23.0 version. to describe the data descriptive statistics, frequency analysis and percentage analysis were used for categorical variables. mean & standard deviation (s.d) were used for continuous variables. the cronbach's alpha was used to check the reliability, to find the significant difference between the bivariate samples in paired groups the paired sample t-test and the wilcoxon signed rank test was used & for independent groups the unpaired sample t-test was used. in all the above statistical tools the probability value .05 is considered as significant level. lmrj volume 3 issue 3 81 | p a g e table 1: oral health impact profile –edentulous (ohip-edent) table 2 : maxillofacial prostheses performance scale (mfpps -10) domain /item s.no subscale 5 point likert 1 2 3 4 5 functional limitation (fl – 3) 1. have you had difficulty chewing any foods because of problems with your prosthesis? 2 have you had food catching in your prosthesis? 3 have you felt that your prosthesis not been fitting properly? physical pain (p1-4) 4 have you had painful aching in your mouth? 5 have you found uncomfortable to eat any foods because of problems with your prosthesis? 6 have you had sore spots in your spots? 7 have you had uncomfortable dentures psychological discomfort (p2-2) 8 have been worried by dental problems 9 have you been self-conscious because of your prosthesis? physical disability (d1-3) 10 have you had to avoid eating some foods because of your prosthesis? 11 have you been unable to eat with your prosthesis because of problem with them? 12 have you had to interrupt meals because of your prosthesis? psychological disability (d2-2) 13 have you been upset because of your prosthesis? 14 have you been bit embarrassed because of your prosthesis? social disability (d3-3) 15 have you avoided going out because of your prosthesis? 16 have you been less tolerant to your partner or family because of your prosthesis? 17 have you been irritable with others because of your prosthesis? handicap (h-2) 18 have you been unable to enjoy other people company as much because of your prosthesis? 19 have you felt that life in general less satisfying because of your prosthesis? total ohip-edent score range (1-95) item sr. no subscale measures: 5 point likert scale 1 2 3 4 5 functional discomfort 1. with respect to chewing, have you had difficulty of chewing any foods? 2. with respect to swallowing, have you felt any leakage of foods underneath the prosthesis? problems related to retention & stability 3. do you feel uneasy during meals due to loose & unstable prosthesis? speech problems 4. have you had difficulty speaking in public aesthetics problems 5. have you had any problem with the appearance? problems with oral hygiene 6. have you had any problem with cleaning /maintaining your prosthesis problems related to salivary control 7. have you had problem with drooling of saliva? problems related to taste ability 8. has your prosthesis altered your taste sensation? problems related to psychological aspect 9. have you had any problem with prosthesis that affects your mental well-being? problems associated with general satisfaction 10. do you have any dissatisfaction with overall performance of the prosthesis? lmrj volume 3 issue 3 82 | p a g e results the mean score of 35 mandibular resected patients rehabilitated with mandibular resection prosthesis after two weeks and three months of follow up were 33.20 and 27.71 respectively. after 2 weeks of follow up, the mean score of ohipedent subscales such as functional limitation (m=5.77/ 38%), physical pain (m=6.29/ 31.4%), psychological discomfort (m=4.26/42.6%), physical disability (m=5.66/37.6%), psychological disability (m=2.86/ 28.6%), social disability (m=4.57/30.4%) and handicap (m=3.8/ 38%) were observed. based on the observation, the most prevalent impact on ohrqol by ohip –subscale; psychological discomfort (42.5%) specified that nearly half of the patients were upset with dental problems and self-conscious about the prosthesis even after the 2 weeks of follow up. despite the discomfort in psychological subscale, there was significant improvement in functional limitation (30%), physical pain (26%), psychological disability (28%) and social disabilities (25.8%) after long term follow up. when analysing ohip scale, there was highly significant difference (p value = 0.005) were observed in all parameters except for psychological disability, no significant differences (p value = .157) after 2 weeks and 3 months of mandibular resection prosthesis function. on long term assessments, ohip scale scores revealed significant progress on oral health. psychological discomfort was the most prevalent ohrqol impairment with 36% of the patients followed by handicap (31.7%) and functional limitation (30%). a summary of the results is given in table 3. table 3: mean, standard deviation of ohip –edent scale after 2 weeks and 3 months of mandibular resection prostheses function mean n std. deviation p value std. error mean pair 1 functional limitation 2w 5.77 35 1.942 .0005 .328 functional limitation 3m 4.54 35 1.615 .0005 .273 pair 2 physical pain 2w 6.29 35 2.080 .0005 .352 physical pain 3m 5.20 35 1.471 .0005 .249 pair 3 psychological discomfort 2w 4.26 35 1.314 .0005 .222 psychological discomfort 3m 3.63 35 1.140 .0005 .193 pair 4 physical disability 2w 5.66 35 1.924 .0005 .325 physical disability 3m 4.49 35 1.704 .0005 .288 pair 5 psychological disability 2w 2.86 35 .974 .0005 .165 psychological disability 3m 2.80 35 .901 .0001 .152 pair 6 social disability 2w 4.57 35 1.539 .0002 .260 social disability 3m 3.89 35 1.301 .0005 .220 pair 7 handicap 2w 3.80 35 1.132 .0002 .191 handicap 3m 3.17 35 1.098 .0005 .186 p value <.005 significant lmrj volume 3 issue 3 83 | p a g e table 4 :mean, standard deviation of mfpps after 2 weeks and 3 months of mandibular prostheses discussion masticatory muscle balance and mandibular movements were adversely affected by mandibulectomy, leading to altered masticatory movement and deviation of residual fragment towards the surgical side. other observed dysfunction was mastication, speech and swallowing and angular path of opening and closing mandibular pattern. less precise envelope of motion occurs towards the surgical site during mastication .6-8 rehabilitation of mandibular defects after tumour resection is one of the most challenging problems facing maxillofacial prosthodontist. swallowing, mastication, speech, control of saliva and psychic functioning are most commonly seen adverse effects by mandibulectomy patients9-12. based on the clinical observation of rehabilitated mandibular patients, the most prevalent impact on ohrqol by ohip –subscale; psychological discomfort (42.5%) specified that nearly half of the patients were upset with dental problems and self-con mean n std.deviation std. error mean p value pair 1 f/c-2 mfpps 2w 3.71 35 1.526 .258 .0005 f/c-2 mfpps 3m 3.03 35 1.014 .171 .0005 pair 2 r/s -1 mfpps 2w 1.89 35 .718 .121 .0005 r/s -1 mfpps 3m 1.46 35 .505 .085 .0005 pair 3 ph-1 mfpps 2w 1.86 35 .845 .143 .0005 ph-1 mfpps 3m 1.57 35 .698 .118 .0005 pair 4 aest-1 mfpps 2w 1.74 35 .505 .085 .0005 aest-1 mfpps 3m 1.29 35 .458 .077 .0005 pair 5 oh-1 mfpps 2w 2.14 35 .355 .060 .0005 oh-1 mfpps 3m 1.43 35 .558 .094 .0005 pair 6 saliva-1 mfpps 2w 2.11 35 .583 .098 .0005 saliva-1 mfpps 3m 1.74 35 .657 .111 .0005 pair 7 taste-1 mfpps 2w 1.89 35 1.132 .191 .0005 taste-1 mfpps 3m 1.60 35 .736 .124 .0005 pair 8 pycho-1 mfpps 2w 1.71 35 .825 .139 .0005 pycho-1 mfpps 3m 1.54 35 .611 .103 .0005 pair 9 satis-1 mfpps 2w 1.69 35 .471 .080 .0005 satis-1 mfpps 3m 1.54 35 .505 .085 .0005 lmrj volume 3 issue 3 84 | p a g e scious about the prosthesis even after the 2 weeks of follow up. despite the discomfort in psychological subscale, there was significant improvement in functional limitation (30%), physical pain (26%), psychological disability (28%) and social disabilities (25.8%) after long term follow up. psychological discomfort was the most prevalent ohrqol impairment with 36% of the patients followed by handicap (31.7%) and functional limitation (30%).results obtained by the rehabilitated mandibular resected patients ohip-edent scores were also similar to that of definitive obturator prosthesis. the most ubiquitous impact on ohrqol was problems with appearance. since a considerable period of time had elapsed after the resection, the acceptance of the guidance appliance was much more difficult for the patient. guidance therapy improves form and function of the individuals and it serves as an interim basis for neuro muscular adaptation to correct the existing deranged occlusion. in addition to the above, other factors such as masticatory muscle pull, mandibular deviation and uncoordinated masticatory movements also influence facial disfigurement. facial aesthetics and oral functions are essential for social interaction and have an impact on individual’s ohrqol. the locations and sizes of the mandibular defect in the present study did not significantly affect hrqol. on the contrary, young et al. noted that the site of resection appears to have an impact with posterior resections involving the mandibular angle having the most adverse effects on appearance and those involving the parasymphysis (lateral) having the most deleterious effect on overall qol. young et al. and rogers et al have also concluded that resections involved in parasymphysis deleterious effect on mastication, lip support and aesthetics. our study observations were similar with young and rogers et al studies and it is likely that these factors contributed to significant impairment in ohrqol 13-15 .when analysing the mfpps score of rehabilitated mandibulectomy patients after 3 months’ improvement for various dimension were, psychological aspects (m=1.54/30.8%), aesthetics (m=1.29/25.6%), taste ability (m=1.60/32%) oral hygiene (m=1.43/28.4%), general satisfaction (m=1.54/30.8%) and saliva control (m=1.74/34%). highest score was recorded for problems with saliva control (34.8%) followed by general satisfaction and psychological aspects (30.8%). this may be due to problems in speaking and chewing and alterations in appearance may have been frequently reinforced by a range of strained and negative social interactions with others. due to loss of function and unpleasant appearance which leads to markedly restrict patient’s normal social activities. when comparing maxillofacial defect rehabilitation with conventional prosthesis, it may possess many challenges to enhance the oral health quality of life in restoring the maxillofacial defect. this may be successfully achieved through sound theoretical knowledge, appropriate surgical technique, and surgical skill of the operator, maxillofacial prosthetic experience and team approach. precise treatment planning and designing in fabrication of intra oral prostheses could certainly enhance the quality of life of patients with maxillofacial defects. there is significant improvement in mastication, speech, deglutition and appearance after rehabilitation with maxillofacial prostheses. therefore, it is an essential pre-requisite for oro-facial defects which in turns support the patient in resuming their normal social life. conclusion the study concludes a remarkable improvement of prosthesis in terms of functional, physical, psychological & social parameters after long term follow-up (3 months). after 2 weeks and 3 months’ follow-up, where mandibular resection guidance prosthesis showed highly significant differences were found in all three scales. there was a significant improvement of oral health related quality of life in terms of functional, physical, psychological and social aspects. within the confines of this study, a highly positive association exists between ohrqol and maxillofacial prosthesis ethical consideration: the study protocol and informed consent form were approved by the ethical committee of the vinayaka mission’s research foundation, salem, (ohip-edent-19) and tamilnadu, india. (ref: vmsdc/iec/approval no.069, dated: 15/7/2016) https://www.omicsonline.org/antibodies-to-an-intracellular-antigen-penetrate-neuronal-cells-and-cause-deleterious-effects-2155-9899.1000134.php?aid=11089 lmrj volume 3 issue 3 85 | p a g e conflict of interest: there is no conflict of interest. funding: this study was not funded by any agency references 1. gastaldi g, palumbo l, moreschi c, gherlone e.f, and cappare. prosthetic management of patients with oro-maxillo-facial defects: a long-term follow-up retrospective study. oralimplantol (rome). 2017 jul-sep; 10(3): 276–282. 2. oladimeji a. akadiri .evolution and trends in reconstructive facial surgery: an update. j maxillofac oral surg. 2012 dec; 11(4): 466–472. 3. aruna u, thulasingam c. prosthodontic management of segmental mandibulectomy patient with guidance appliance and overlay denture. j indian prosthodont soc. 2012; 13(4):593–599. 4. snehamantri and zafrulla khan (2012). prosthodontic rehabilitation of acquired maxillofacial defects, head and neck cancer, dr. mark agulnik (ed.), isbn: 978-953-51-0236-6, intech. 5. michaud pl, de grandmont p, feine js, emami e. measuring patient-based outcomes: is treatment satisfaction associated with oral health-related quality of life? j dent. 2012; 40:624. 6. finlay pm, dawson f, robertson ag, soutar ds. an evaluation of functional outcome after surgery and radiotherapy for intraoral cancer. br j oral maxillofac surg 1992; 30:14-7. 7. marunick m, mahmassani o, siddoway j, klein b. prospective analysis of masticatory function following lateral mandibulectomy. j surg oncol 1991; 47:92-7. 8. mcconnel fm, pauloski br, logemann ja, rademaker aw, colangelo l, shedd d, et al. functional results of primary closure vs flaps in oropharyngeal reconstruction: a prospective study of speech and swallowing. arch otolaryngol head neck surg 1998; 124:625-30. 9. schliephake h, schmelzeisen r, schonweiler r, schneller t, altenbernd.speech, deglutition and life quality after intraoral tumour resection. a prospective study. int j oral maxillofacsurg 1998; 27:99105. 10. komisar a. the functional result of mandibular reconstruction. laryngo-scope 1990; 100:364-74. 11. hidalgo da. fibula free flap: a new method of mandible reconstruction plast reconstr surg 1989; 84:71-9. 12. hidalgo da. aesthetic improvements in free-flap mandible reconstruction. plast reconstr surg 1991; 88:574-85; discussion 586-7. 13. jewer dd, boyd jb, manktelow rt, zuker rm, rosen ib, gullane pj, et al. orofacial and mandibular reconstruction with the iliac crest free flap: a review of 60 cases and a new method of classification. plast reconstr surg 1989; 84:391-403; discussion 404-5. 14. soutar ds, widdowson wp. immediate reconstruction of the mandible using a vascularized segment of radius. head neck surg 1986; 8:232-46. 15. matloub hs, larson dl, kuhn jc, yousif nj, sanger jr. lateral arm free flap in oral cavity reconstruction: a functional evaluation. head neck 1989; 11:205-11. https://www.ncbi.nlm.nih.gov/pmc/articles/pmc5735392/ https://www.ncbi.nlm.nih.gov/pmc/articles/pmc5735392/ https://www.ncbi.nlm.nih.gov/pmc/articles/pmc3485460/ https://www.ncbi.nlm.nih.gov/pmc/articles/pmc3485460/ lmrj volume 1 issue 2 37 | p a g e ultrasound imaging in settings of a natural disaster: experience from october 8th 2015 earthquake in pakistan fayyaz ahmad1, tariq mahmood1, abdul shakoor memon1, a.r.jamali2, kausar abbas1. 1department of radiology; 2department of orthopaedic surgery; jinnah postgraduate medical centre, karachi – 75510, pakistan received: 31 december 2018 revised: 6 february 2019 accepted for publication: 12 february 2019 correspondence: dr fayyaz ahmad h / no f – 10 , staff colony; jinnah postgraduate medical centre, karachi – 75510, pakistan. email: theconsultantradiologist@gmail.com this article may be sighted as: ahmed f, mahmood t, memon as, jamali ar, abbas k. ultrasound imaging in settings of a natural disaster: experience from october 8th 2015 earthquake in pakistan. lmrj. 2019; 1(2): 35-39. doi: 10.38106/ lmrj. 2019.1.204. abstract ultrasound (u/s) imaging has a broad spectrum of applications in medical practice. the earthquake of october 8, 2005 was one of the most severe in the history of pakistan, claiming around 80,000 lives in the region of azad kashmir. u/s imaging was the only diagnostic radiological investigation available in the region. the study was aimed to evaluate the role of u/s in diagnosing internal injuries among victims of the earthquake. all the patients referred for u/s imaging at abbas institute of medical sciences (aims)were accordingly examined and the data was recorded on a proforma. the procedures included examination of chest, abdomen, pelvis, extremities and fetal wellbeing (fwb). u/s findings were correlated with clinical, laboratory or surgical exploratory findings. a total of 87 patients, 22 males and 65 females, were examined. definitive diagnoses were established in 16.8% of abdominal examination cases, 76.6% of abdomen/pelvis examinations and 78.6% of gynae & obstetric examination cases. the course of management was changed completely using u/s observations in 36% of the cases of chest examinations, 71.9% of the cases of abdominal & pelvic examination and 75.8% of the cases of gynae & obstetrics. it was concluded that u/s is a useful diagnostic modality in the settings of a natural disaster. head and spine injuries, however, cannot be assessed with this diagnostic modality and needs special consideration. keywords: ultrasound, kashmir, earthquake disaster introduction ultrasound (u/s) imaging has a broad spectrum of applications in medical practice. it is a non-invasive technique used to assess internal body structures/organs. the findings are often definitive and have pivotal role in disease management. of particular importance is the use assessment of pregnancy. ultrasound works on waves generated by piezoelectric transducer at frequencies that are in-audible to humans (i.e. >20,000 hz)1. on october 8, 2005, a series of earthquakes measuring a maximum of 7.6 on the richter scale struck kashmir and other northern areas of pakistan. the epicenter was about 19 kilometers northeast of muzaffarabad (the capital of pakistan administered kashmir), and 100 kilometers north-northeast of islamabad, pakistan. the catastrophe resulted in widespread damage, wiping out entire villages and flattening towns and cities. it was the most severe disaster in the history of pakistan, claiming around 80,000 lives and severely injuring another 80,000. most hospitals were destroyed and limited medical facilities were available in the immediate aftermath. building collapse was associated with widespread crush injuries2-5. from a practical point of view, all the radiological instruments, along with others, were out of order for several weeks. a group of volunteers from jinnah postgraduate medical centre (jpmc), the national institute of child health (nich) and the national institute of cardiovascular diseases (nicvd) comprised of 20 members, including: four orthopedic surgeons, 02 thoracic surgeons, 01 cardiac surgeon, 01 radiologist, 02 postgraduate trainees and 10 paramedics. our team reached mansehra on the 2nd day of the disaster. the roads were blocked due to land sliding. there was no electric supply in muzaarabad. we settled in the abbas institute of medical sciences (aims). it took more than two days to establish generator based electric supply. the 600 mas x–ray machine of aims could not be operated by the generator based electric supply. the only radiologist/sonologist in the city of muzaffarabad & its surroundings was from the team mentioned above. the radiologist was equipped with a portable u/s machine (facuda®) and performed sonography of all body regions. all the radiological modalities, along with others, were out of order, the role of portable u/s was assessed in injured earthquake victims to confirm or change the clinical diagnosis. research article mailto:theconsultantradiologist@gmail.com lmrj volume 1 issue 2 38 | p a g e the current study shares experience of this group regarding utility of ultrasound imaging in settings of a natural disaster as the only radiological investigation modality. methods all the patients who were referred to aims for ultrasonographic assessment were enrolled into the study. data was recorded on a proforma excluding patients who could not be followed. examinations included that of chest, abdomen, pelvis, fetal wellbeing (fwb) and extremities. examination of the chest and abdomen were considered as separate entities. u/s findings were compared with clinical, laboratory and/or surgical exploratory findings. the cases diagnosed as hemothorax (with supportive history based evidence) on u/s were also measured for depth; if less than 4.0 cm, a diagnostic tap was performed. in those with >4.0-cm deep hemothorax, an urgent tube thoracostomy was performed by a thoracic surgeon. cases of hemopneumothorax, hemothorax, pneumothorax and subcutaneous/surgical emphysema were also confirmed by diagnostic tap, tube thoracostomy and/or x-ray chest. results thirty two patients were evaluated for abdomen and/or pelvic diseases, of which 14 were males and 18 were females. a total of 25 cases were sent for chest examination. the u/s findings in these cases are listed in table 1. two of the patients having spinal trauma and distended urinary bladder (ub) were diagnosed as having large fibroids by the gynecologist and general surgeon. u/s confirmed that it was simply a distended ub on both occasions; after catheterization 900 ml & 700 ml of urine was collected respectively and the distension disappeared. ub rupture cases were diagnosed and confirmed as mentioned above. pseudokidney sign was observed in three patients, two females and a male; all three were found to have colonic pathology. in pseudokidney sign, the diseased large gut, in some situations, give appearance similar to that of kidneys on u/s examination. in cases of peritonitis due to perforation of gut, fluid collection in the abdomen was confirmed on diagnostic tap and then laparotomy. in case of pneumoperitoneum, free gases with posterior acoustic shadowing were noted deep to the anterior abdominal wall. in case of paralytic ileus, no bowel movement was noted on u/s. cases of renal & gall bladder calculi did not need further confirmation. worm infestation of the small intestine was found in two children. a case of large renal cortical cyst measuring 50 ml was also found and dealt with accordingly. in total, 35 cases were referred for abdomino-pelvic examinations. their description is provided in table 2. the total number of patients evaluated for fwb and gynae/obs was 29. most of the pregnancies were in range of 3 to 4½ months of gestation. these were suspected to have intra-uterine deaths (iuds) and/or placental hemorrhage and were referred accordingly. among these cases, three iuds and two complete abortions were confirmed on u/s. one suspected case of early pregnancy revealed no sonological signs of conception i.e. decidual reaction etc. and was confirmed on pregnancy test. the findings and confirmative tests are presented in table 3. one male patient was evaluated for deep venous thrombosis (dvt) on u/s lower limb. a clot popliteal vein was observed in this case. blood flow pattern could not be detected as we had gray scale u/s machine. the management was changed completely using u/s observations in 36% of the cases of chest examinations, 71.9% of the cases of abdominal & pelvic examination and 75.8% of the cases of gynae & obstetrics. on cumulative scale the management was altered in 52 (62%) out 87 cases based on u/s findings. confirmatory tests were performed in 49 cases which were in concordance with u/s findings. table 1. findings on u/s chest table 2. findings on u/s abdomen table 3. confirmatory tests for u/s findings no. of pts % unilateral pneumothorax 1 4 unilateral mild hemothorax 3 12 unilateral moderate hemothorax 3 12 bilateral moderate hemothorax 1 4 unilateral hemopneumothorax 4 16 bilateral hemopneumothorax 2 8 consolidation 4 16 no. of pts % distended urinary bladder 3 8.5 urinary bladder rupture 2 5.7 peritonitis due to perforation of gut 2 5.7 blood clot in urinary bladder 2 5.7 growth in colon 2 5.7 gut distended with gasses 1 2.8 absent bowel movements (paralytic ileus) 1 2.8 pneumoperitoneum 1 2.8 no. of pts % x ray chest 14 28.6 diagnostic tap 8 16.3 tube thoracostomy unilateral 8 16.3 foley’s catheterization 7 14.3 tube thoracostomy bilateral 2 4.1 evacuation 3 6.1 laparotomy 2 4.1 flatus tube 1 2.0 lmrj volume 1 issue 2 39 | p a g e diaphragmatic injury 1 4 surgical/sub-cutaneous emphysema 2 8 normal u/s chest 4 16 total 25 100 cholelithiasis 1 2.8 enlarged prostate 2 5.7 worms in small intestine 2 5.7 renal calculi 2 5.7 large renal cortical cyst 2 5.7 cystitis 1 2.8 polycystic kidneys disease 1 2.8 normal u/s abdomen 10 28.5 total 35 100 recommendations for colonoscopy & biopsy † 2 4.1 pregnancy test 1 2.0 urine d/r 1 2.0 total 49 100 † the facility was not available there, on that occasion d/r, detailed report discussion in the current study we found ultrasound to be of significant diagnostic value in the settings of natural catastrophe. among the major challenges faced was inadequate experience with disaster medicine. the psychological consequences seem to be longlasting especially for those who have survived with elevated degree of exposure to trauma6. agility and pro-activeness is expected from field hospitals in their mode of functioning7.in the current study we found ultrasound to be of significant diagnostic value in the settings of natural catastrophe. among the major challenges faced was inadequate experience with disaster medicine. the psychological consequences seem to be long-lasting especially for those who have survived with elevated degree of exposure to trauma6. agility and proactiveness is expected from field hospitals in their mode of functioning7. when kinetic energy transfers to human body it frequently results in blunt trauma to chest. this may inflict severe injuries including thoracic skeleton fractures, pleural space disintegration, pulmonary parenchymal laceration and mediastinal structural damage. an organ-based assessment for thoracic trauma can be followed as a systematic approach. conventional radiography primarily helps in diagnosing thoracic trauma, accompanied by ultrasonic checkup of abdomen and pleura (efast & fast) one after another. it has been established that ct scan serves as vital innovation for evaluation of thoracic trauma. time consuming procedures in critically traumatized patients are being replaced potentially by fast helical ct scanning. it is helpful to spot intraperitoneal fluid and free air, detect the level of solid organ injury, spot injuries of retroperitoneal and often useful in deciding for conventional treatment. the time of patient to stay in ct scan room is reduced by rapidly performing helical ct. additionally; coronal and sagittal reconstruction images have been improved over the years; help is hence attained in spotting ruptured diaphragm8-12. nonetheless, importance of u/s imaging in the absence/unavailability of ct scan is of prime consideration13. same was the case observed in our situation in kashmir, muzaffarabad where all other service related to radiological modality was found. extended focused assessment with sonography for trauma(efast) has comparable utility as that of chest x-ray (cxr); the specificity of u/s rather exceeds in cases of occult pneumothoraces (optxs)14,15. a previous study found u/s to be comparable with ct scanning in assessment of optxs16. similarly sonographic findings are more accurate in diagnosis of fractures as compare to radiography17. despite advances in trauma care, significant morbidity and mortality exists which could be minimized provided all the injuries are immediately identified. mass disasters compound this challenge further due to delayed referral. two treatable factors are hypoxia and hypovolemia which may occur secondary to haemorrhage into the chest and abdomen. pneumothorax is also a frequent cause of preventable trauma death. clinical examination is often limited and attending physicians/surgeons often rely on radiological imaging18-21. in the current study, u/s findings significantly altered the course of management in cases with pneumothorax. besides diagnosis, u/s can be of great utility in therapeutic interventions in such cases. an ultrasound-guided thoracentesis not only facilitates the procedure but improves its safety22. feussner h & co-workers stated that lethality and morbidity of blunt abdominal trauma are directly dependent on the immediately valid diagnostic work-up. since blunt abdominal trauma usually occurs in the setting of multisystem injury and patients are no longer cooperative, clinical methods of diagnosis are unreliable. since the facilities to perform ultrasound are provided in all emergency units and knowledge of ultrasonography is an essential part of surgical training, contemporary diagnostic procedures like peritoneal lavage have almost completely lost their former important clinical role. similarly, diagnostic laparoscopy is, in contrast to abdominal perforations, no longer of importance23. griffin xl and co-worker found peritoneal lavage as a safe diagnostic strategy24. we, hoever, did not perform any peritoneal lavage because the sensitivity and specificity of ultrasonography in detection of free intraperitoneal fluid is over 90%25. in our case, the detection rate was 100%. lmrj volume 1 issue 2 40 | p a g e u/s is easy and quick to perform, it permits an accurate diagnosis with a low ratio of error. particularly, it gives the chance to operate in emergency patients with steady haemodynamic conditions and to follow up those with partial parenchymal lesions, monitoring the clinical status in order to properly choose between conservative treatment and delayed surgery. hence, unnecessary laparotomies are now uncommon, and a wide array of interventional radiological techniques can be used to treat abdominal emergencies without surgery26-29. a major drawback of ultrasound is its operator dependency, but when applied by a proficient examiner using a goal-directed, time sensitive protocol, does not delay patient management and provides diagnostic and therapeutic benefit30. in addition, a study performed by abuzidan fm and co-workers at university hospital, kuwait, showed that the sensitivity was lesser in the hands of the surgeon than the radiologist (67% compared with 90%)31. conclusion we concluded that u/s imaging in establishing diagnosis has a pivotal importance in settings of natural disasters. u/s served useful information in cases of abdomen, pelvis, gynecological/obstetric and thoracic trauma. the diagnostic modality, however, did not prove to be of significant help in those with head & spinal injuries. acknowledgement r.a.f. (radiology aid foundation) an ngo at j.p.m.c., karachi provided an automobile truck full of everyday life necessities enabling us to stay at muzaffarabad for eleven days. we acknowledge e orts of all the team members, both local & foreigners, who worked with great devotion. we particularly acknowledge services provided by dr. miranda voss a general surgeon. conflict of interest we hereby declare that we do not have any conflict of interest related to publication of this article. grant support financial disclosures none references 1. carovac a, smajlovic f, junuzovic d. application of ultrasound in medicine. acta informatica medica. 2011;19(3):168-71. 2. kopp jb, ball lk, cohen a, kenney rj, lempert kd, miller pe, muntner p, qureshi `n, yelton sa. kidney patient care in disasters: lessons from the hurricanes and earthquake of 2005clin j am soc nephrol. 2007 jul;2(4):814-24. 3. ventevogel p. from disaster to opportunity: the mental health care response to the october 2005 earthquake. j pak psychiatr soc 2005; 2: 59-61. 4. sabri aa, qayyum ma. why medical students should be trained in disaster management: our experience of the kashmir earthquake. plos med 2006; 3:382. 5. dhar sa, halwai ma, mir mr, wani za, butt mf, bhat mi, et al. e kashmir earthquake experience. eur j trauma emerg surg 2007; 6. salcioglu e, basoglu m, livanou m. long-term psychological outcome for non-treatment-seeking earthquake survivors in turkey. j nerv ment dis 2003; 191:154-60. 7. bozkurt m, ocguder a, turktas u, erdem m. e evaluation of trauma patients in turkish red crescent field hospital following the pakistan earthquake in 2005. injury. 2007 mar;38(3):290-7. 8. uffmann m, fuchs m, herold cj. radiologic imaging of thoracic trauma radiologe. 1998 aug;38(8):683-92. 9. löw r, düber c, schweden f, lehmann l, blum j, elen m. whole body spiral ct in primary diagnosis of patients with multiple trauma in emergency situations. rofo. 1997 may;166(5):382-8. 10. radwan mm, abu-zidan fm. focussed assessment sonograph trauma (fast) and ct scan in blunt abdominal trauma: surgeon's perspective. afr health sci. 2006 sep;6(3):187-90. 11. poletti pa, wintermark m, schnyder p, becker cd. traumatic injuries: role of imaging in the management of the polytrauma victim (conservative expectation). eur radiol. 2002 may;12(5):969-78. lmrj volume 1 issue 2 41 | p a g e 12. abu-zidan fm, sheikh m, jadallah f, windsor ja. blunt abdominal trauma: comparison of ultrasonography and computed tomography in a district general hospital. australas radiol. 1999 nov;43(4):440-3. 13. richardson mc, hollman as, davis cf. comparison of computed tomography and ultrasonographic imaging in the assessment of blunt abdominal trauma in children. br j surg. 1997. aug;84(8):1144-6 14. kirkpatrick aw, sirois m, laup land kb, liu d, rowan k, ball cg, hameed sm, brown r, simons r, dulchavsky sa, hamiilton dr, nicolaou s: hand-held thoracic sonography for detecting post-traumatic pneumothoraces: the extended focused assessment with sonography for trauma (efast). j trauma. 2004 aug;57(2):288-95. 15. rozycki gs, pennington sd, feliciano dv. surgeon-performed ultrasound in the critical care setting: its use as an extension of the physical examination to detect pleural effusion. j trauma. 2001 apr;50(4):636-42 16. soldati g, testa a, sher s, pignataro g, la sala m, silveri ng: occult traumatic pneumothorax: diagnostic accuracy of lung ultrasonography in the emergency department. chest. 2008 jan;133(1):204-11. 17. griffith jf, rainer th, ching as, law kl, cocks ra, metreweli c: sonography compared with radiography in revealing acute rib fracture. ajr am j roentgenol. 1999 dec;173(6):1603-9. 18. gales h, perry m. is there a role for planned serial chest radiographs and abdominal ultrasound scans in the resuscitation room following trauma? ann r coll surg engl. 2006 oct;88(6):535-9 19. dhar sa, bhat mi, mustafa a, mir mr, butt mf, halwai ma, tabish a, ali ma, hamid a. damage control orthopaedics' in patients with delayed referral to a tertiary care center: experience from a place where composite trauma centers do not exist. j trauma manag outcomes. 2008 jan 29;2:2. 20. sule az, kidmas at, awani k, uba f, misauno m. gastrointestinal perforation following blunt abdominal trauma. east afr med j. 2007 sep;84(9):429-33 21. sule az, kidmas at, awani k, uba f, misauno m. gastrointestinal perforation following blunt abdominal trauma. east afr med j. 2007 sep;84(9):429-33. 22. rozycki gs, cava ra, tchorz km. surgeon-performed ultrasound imaging in acute surgical disorders. curr probl surg. 2001 mar;38(3):141-212. 23. feussner h, papaziogas w, siewert jr. modern diagnostic workup of blunt abdominal trauma: chirurg.1999 nov;70(11):1246-54 24. griffin xl, pullinger r. are diagnostic peritoneal lavage or focused abdominal sonography for trauma safe screening investigations for hemodynamically stable patients a er blunt abdominal trauma? a review of the literature. j trauma. 2007 mar;62(3):779-84. 25. paajanen h, lahti p, nordback i. sensitivity of transabdominal ultrasonography in detection of intraperitoneal f l uid in humans. eur radiol. 1999;9(7):1423-5. 26. mcloughlin rf, mathieson jr. imaging and intervention in abdominal emergencies. baillieres clin gastroenterol. 1995 mar;9(1):1-19. 27. marinoni r, lamaro s, serao a, davoli e, innocenti p, pace a, picardi c. the role of echography in assessing abdominal trauma: the experience of 1750 cases: g chir. 1993 mar;14(3):190-3. 28. el abdullah hd, dar ma, shukla ak. e evaluation of the role of ultrasonography and ultrasound-guided aspiration as an initial screening test in blunt abdominal trauma. ann saudi med. 1996 may;16(3):300-3 29. cardì f, bucceri a, petralia g, catalano f, catania g. role of ultrasonography in abdominal surgical emergencies. our experience: ann ital chir. 1996 jan-feb;67(1):61-4. 30. busch m. portable ultrasound in pre-hospital emergencies: a feasibility study. acta anaesthesiol scand. 2006 jul;50(6):754-8. 31. abu-zidan fm, zayat i, sheikh m, mousa i, behbehani a. role of ultrasonography in blunt abdominal trauma: a prospective study. eur j surg. 1996 may;162(5):361-5. lmrj volume 1 issue 2 42 | p a g e lmrj volume 2 issue 2 29 | p a g e metabolic syndrome, telomere length and aginga review of literature tarachand devrajani1, sikander munir memon1 liaquat university of medical & health sciences jamshoro corresponding author tarachand devrajani mbbs, fcps department of medicine liaquat university of medical & health sciences, jamshoro contact#03333480764 email: tara_chand50@hotmail.com this article may be sighted as: devrajani.t. metabolic syndrome, telomere length and aging-review of literature. lmrj.2020; 2(2) doi:10.38106/lmrj.2020.2.202 abstract metabolic syndrome is reportedly one of the key health concerns worldwide. it is defined as a group of conditions including hypertension, dysglycemia, and abdominal obesity. the wear and tear of telomeres is known to be a major incident not only in mammalian aging, but also in distressed nutrient sensing, which may contribute to a number of metabolic dysfunctions. the metabolic syndrome was linked to the growing prevalence of obesity, which is at rise invariably in all age groups including elderly. the existing literature review focuses on the relationship of shorting of telomere and metabolic syndrome. as the shortening of telomeres influence cellular senescence and eventual stoppage of cell division. it is reviewed that the increasing number patients of the metabolic syndrome significantly affecting aging process by early diminishing the telomere lengthening. key words: metabolic syndrome, telomere length, aging introduction the metabolic syndrome (mets) is a group of metabolic derangements resulting in a cluster of clinical presentations including hypertension, diabetes mellitus and hypercholestrolemia. in 2005, a meeting planned by the international diabetes federation (idf) put forward the first united agreement on the definition of metabolic syndrome. the idf criteria for mets was, central obesity with specific values according to ethnicity (ie waist circumference (wc) for european males must be greater than 94 cm and females must be greater than 80 cm; japanese, chinese and south asian males must be greater than 90 cm and females must be greater than 80 cm. for sub-saharan africans and middle east and eastern mediterranean populace, european criteria is being used, for central and south americans, south asian criteria is being used) with presence of any two from the following four characteristics: 1. hdl-cholesterol in males below 40 mg/dl and in females below 50 mg/dl, 2. triglycerides equal to or greater than 150 mg/dl, review article mailto:tara_chand50@hotmail.com lmrj volume 2 issue 2 30 | p a g e 3. fasting glucose equal to or greater than 100 mg/dl, 4. bp equal to or greater than 130/85 mmhg obesity is measured by using the body mass index (bmi) and wc, which is stated as a key causative factor. besides abdominal obesity, other factors are also required to be considered in the diagnosis of metabolic syndrome include the assessment of triglycerides, blood pressure, fasting blood glucose, or reduced lipoprotein cholesterol levels.(1) the pathophysiology of the metabolic syndrome is very complex and yet uncertain. a considerable number of patients have a sedentary life style, with advanced age, usually showing insulin resistance. the influencing factors include advancing age, genetics, increase weight, excess caloric intake and lifestyle.(2) though, in spite of the significance of obesity people may not show signs of insulin resistance, occasionally others with normal weight can be resistant to insulin eventually ending up with metabolic syndrome.(3) the adult treatment paneliii, according to the commonly inferred definition, is used to diagnose a metabolic syndrome when no less than 3 out of 5 of the following variants were found: 1. visceral obesity (waist circumference of more than 102 cm in males or greater than 88 cm in females); 2. dysglycemia (fasting blood glucose > 100 mg dl); 3. elevated blood pressure (more than 130/85 mm hg); 4. elevated levels of blood lipids.(4,5) it is established that metabolic syndrome accounts for a significant pathophysiological combinations to study metabolic process within animal models and humans. this results in an increased risk of cardiovascular disease as a peripheral or coronary atherosclerosis or heart dysfunction if metabolic syndrome is present. furthermore, metabolic syndrome correlates with a few further systemic complications, which affect various systems and organs, for example osteoarticular disease, respiratory disease, fatty liver disease, and malignancy. consequently, patients with metabolic syndrome have a reduced lifespan and raised all-cause mortality contrasted to the general people.(6, 7)therefore, it is sequentially accepted that metabolic syndrome is associated with early ageing, which is of primary importance given the increasing global epidemic of metabolic syndrome. with this environment, it is very remarkable to understand biochemical processes associated with variations in metabolic syndrome with lifespan.(8) metabolic syndrome in pakistan metabolic disorders resulting in chronic illness and end organ damage have remained research focus for a long time. regardless of the nature of the syndrome, the truth remains that all its constituent anomalies have been repeatedly and independently presented with an increased risk of both diabetes mellitus and cardiovascular disease.(9) for practitioners, metabolic syndrome can only act as an indicator of amplified cardiometabolic risk, leading to any interventional endeavors, a function that can be offered most effectively by lmrj volume 2 issue 2 31 | p a g e the easiest way to measure abnormality of the component alone. the prevalent elevation and availability of carbonated drinks and fast foods influence children in particular. this requires a deep understanding of people's health status with respect to cardio metabolic risks.(10) oxidative stress and metabolic syndrome oxidative stress is a well-known mechanism that significantly contributes to several pathological conditions, and several human disorders have been strongly correlated with oxidative stress. many cell functions seem to be controlled by free radical molecules, which can function as well as intracellular signals.(11, 12)likewise, the protein redox state is associated with regulating a number of cellular activities, along with cell variation and stimulation of specific metabolic pathways.(13, 14) aging and oxidative stress aging is a biological process, characterized by a gradual wear and tear in metabolic functions and physiological activities resulting in morbidity and mortality. in line with the production of endogenous free radicals, reactive oxygen species and reactive nitrogen species as a result of different cellular mechanisms, which normally get neutralized, however with the ageing and obesity the production keep on rise while neutralization reduces. it is important to maintain a balance for proper physiological work between free radicals and antioxidants. in situations when free radicals production increases to override the body's capacity to neutralize them oxidative stress ensues. free radicals adversely alter lipids, proteins, and dna function and metabolism thus trigger a number of human diseases, causing cumulative and casual oxidative degradation of macromolecules stimulating loss with aging and ultimately cell death. mitochondria tends to play pivotal role in the senescence process, as they are thought to be the primary intracellular source of anti-oxidants. respiratory chain impairment causes reactive oxygen species (ros) to induce mitochondrial components, including mitochondrial dna, lipids, and proteins.(15) progressive accumulations of oxidantprovoked somatic mutation in human mitochondrial dna (mt dna) resulting in wear and tear in the mitochondrial bioenergetics functions and play a part in aging process. under physiological conditions, ros low levels are produced in the course of mitochondrial respiration. gradual oxidative impairment with age to mitochondrial (mt) dna may cause dna strand breaks and somatic mitochondrial dna mutations. the aggregation of these mt dna variants result in disruption to the complexes of the respiratory chain contributing to a vicious cycle of decreased mitochondrial ros synthesis and consequent production of additional mitochondrial dna mutations. this chain reaction was suggested to include increased oxidative impairment during ageing, which triggers a gradual decline in tissue and cellular functions due to insufficient energy supply and/or increased susceptibility to apoptosis.(16) ageing induced oxidative impairment of proteins, lipids and dna has been well reported, and thus provide an evidence to suggest mitochondrial dysfunction.(17) pathophysiology telomere length (18) is a fresh indicator of cellular aging, usually evaluated in leukocytes, and has been correlated with increased mortality lmrj volume 2 issue 2 32 | p a g e and morbidity risks. telomeres, consisting of mammalian dna tandem repeats (ttaggg) and associated proteins, are nucleoprotein complexes that are located at the ends of eukaryotic chromosomes. they contribute significantly to preserving the stability and integrity of the chromosome, forming an essential factor for cell survival. telomeric dna wears away whenever the cells divide, through partial "during dna synthesis, replication of the lagging strand, referred to as the "endreplication problem." through this method, each telomeric end reduces peripheral blood lymphocytes by about 20–60 base pairs (bp)/year. in vitro studies have shown that if telomeres turn out to be extremely small, cell division stops and encourages replicative senescence, leading to aging and consequent somatic cell death. cellular impairment because of raised oxidative stress can additionally speed up the reduction process of tl. thus, tl can be taken as an ageing biomarker, where elevated biological age could be seen by shorter tl. certainly, metabolic disorders for example metabolic syndrome, which relates to aging, exhibit functional deterioration in tissues and major organs where pancreas and heart are particularly affected by ageing. a few studies have exhibited considerable correlations between central adiposity and shorter tl. likewise, the tl was shorter as per the worsening of the metabolic conditions in demonstrative specimen of females. it is evident that a complex relation is present between metabolic syndrome components and tl with obesity. however, it is not yet known that the effect of tl in specific obesity groups such as metabolically healthy obesity (mho). in this setting, the main objective of the current literature review was to explore the scientific evidence regarding absolute telomere length (atl) in mho people who were contrasted with a control group consisting of non-obese people with no metabolic syndrome and a cohort of obesity and metabolic syndrome patients. metabolic syndrome and correlation with ageing metabolic syndrome directly correlated with raised mortality & atherogenesis due to mi as well as visceral adiposity accumulation during middle age correlated to exercise reduction & overeating. moreover, there seems to be a genomic tendency to acquire metabolic syndrome.(19) aging is taken into account as biological course of action typified by a gradual decline in metabolic course of actions as well as decline in physiological functions which results in mortality & morbidity.(20) consistent with the aging theory “free radical”, reactive oxygen species, produced as biological oxidations byproducts, stimulate cumulative & unintentional oxidative impairment to large molecules provoking the cellular abnormality with age then finally the cell dies.(20) metabolic syndrome is usually reflected to stimulate precocious aging even though the system which is responsible for it is not fully recognized. it is turning out to be evident that involvement of longevity genes can possibly be there. trials in over stimulation or disturbance of major lifecycle factor routes, for example mtor, p66shc, and sirtuins result in expression of ms features in mice. further routes are concerned in relating longevity and accessibility of nutrients, together with igf-1 signaling and insulin, in addition to factors of foxo transcription.(21) free radicals are continuous produced during metabolic disorder which is thus believed to generate stipulations in which oxidative lmrj volume 2 issue 2 33 | p a g e variations of cellular components increase, which consecutively results in dysfunction of mitochondria and finally loss of homeostasis of the cell. this motive has been convincingly applied as a factor of agerelated decline in physiological processes, thus resulting in mitochondrial sense of “biological clock” for aging of the cell.(22) according to this concept a survey by passos et al.(23) exhibited that the cellular senescence had greater ros levels, mitochondrial dysfunction, further double-strand breakdowns of dna as well as shorter telomeres, moreover it was exhibited that ros of mitochondria increased telomerereliant senescence. lately, a few authors exhibited the association amid metabolic disorder & tl proposing raised cellular regeneration rate and thus speeding cellular aging.(24) telomere shortening is mostly the result of “end-replication” issue, caused by dna polymerase inability to completely replicate the lagging strand’s identical end.(25) one more factor taking part in telomere shortening encompasses the telomere ends processing to reconstruct projections of 3′ single-strand, and telomere shortening because of the dna restoration system, especially for lone-stranded dna impairment, are fewer effective within telomeric dna as compared to other places within genome. the subsequent growth of single-strand breakdowns besides telomeres results in dna impairment-reliant shortening while copying.(25) therefore, shortening of telomere can possibly function as a marker of history of replication and cumulative genetic impairment of somatic cells. these shorter telomeres can either accredited to shorter length at childbirth liable to diabetes or to augmented telomere loss in the course of cell division due to raised oxidative stress within prediabetes conditions, or both. it has been noticed that shorter telomeres are present in circulating epithelial originator cells in cases suffering from metabolic syndrome and in other conditions of high oxidative stress.(26) several studies stated significant link between shorter tl and metabolic syndrome components, while other studies did not manage to confirm this.(27) whether tl predicts a wide range of metabolic disorder such as lipid profile derangements, glucose, or hypertension ranges over a wide period is unknown. table 1 shows findings of several researches for association of telomere shortening with aging, organ damage and metabolic syndrome table 1: findings from different researches association of metabolic syndrome with telomere length lmrj volume 2 issue 2 34 | p a g e s.n o. author year study sample findings 1 yang z et al.(28) 2009 767 subjects; cases: 388 essential hypertension patients, 379 healthy controls hypertensive subjects have shortened telomeres, and the occurrence of coronary artery disease was linked with shorter telomeres in hypertensive subjects (p<0.05) 2 demanelis k et al.(30) 2019 337522 subjects longer telomere length increases blood pressure and pulmonary function traits among middle-aged u.k. biobank participants (p<0.05). 3 nettleto n ja et al.(31) 2008 840 subjects after adjustment for demographic factors, age, lifestyle factors, other food or beverage consumption; the intake of processed meat was negatively influenced by telomere length (p<0.05) 4 ornish d et al.(32) 2008 30 males higher telomerase activity was significantly associated with decline in ldl cholesterol (r=0.36, p=0.041) and reduced psychological distress (r=-0.35, p=0.047). 5 nordfjäll k et al.(33) 2008 989 individuals borderline or significant relation was found between telomere length and obesity parameters (bmi, weight, waist circumference and hip circumference) in women after adjusting for age and center. whereas, a positive association to hdl was observed in males (p<0.05). 6 cassidy a et al.(34) 2010 2284 females waist circumference was negatively influenced by telomere length (p<0.05) 7 broer l et al.(35) 2014 11,448 participants raised leptin levels are associated with short relative telomere length (p<0.05). 8 njajou ot et al.(36) 2012 2721 elderly subjects shorter telomere length is significantly correlated with increased adiposity (p<0.05) 9 révész d et al.(27) 2014 2848 participants the shorter baseline telomere length was associated with hdl, waist circumference, triglycerides, and fasting glucose, as well as the presence of metabolic syndrome and the total number of components (p<0.05). though baseline differences gradually decreased over time, at the two-or six-year follow-up, shorter baseline telomere length was significantly associated with poorer scores of majority of metabolic syndrome components. https://www.ncbi.nlm.nih.gov/pubmed/?term=nettleton%20ja%5bauthor%5d&cauthor=true&cauthor_uid=18996878 https://www.ncbi.nlm.nih.gov/pubmed/?term=nettleton%20ja%5bauthor%5d&cauthor=true&cauthor_uid=18996878 https://www.ncbi.nlm.nih.gov/pubmed/?term=nettleton%20ja%5bauthor%5d&cauthor=true&cauthor_uid=18996878 https://www.ncbi.nlm.nih.gov/pubmed/?term=nettleton%20ja%5bauthor%5d&cauthor=true&cauthor_uid=18996878 https://www.ncbi.nlm.nih.gov/pubmed/?term=ornish%20d%5bauthor%5d&cauthor=true&cauthor_uid=18799354 https://www.ncbi.nlm.nih.gov/pubmed/?term=ornish%20d%5bauthor%5d&cauthor=true&cauthor_uid=18799354 https://www.ncbi.nlm.nih.gov/pubmed/?term=nordfj%c3%a4ll%20k%5bauthor%5d&cauthor=true&cauthor_uid=18820651 https://www.ncbi.nlm.nih.gov/pubmed/?term=nordfj%c3%a4ll%20k%5bauthor%5d&cauthor=true&cauthor_uid=18820651 https://www.ncbi.nlm.nih.gov/pubmed/?term=cassidy%20a%5bauthor%5d&cauthor=true&cauthor_uid=20219960 https://www.ncbi.nlm.nih.gov/pubmed/?term=cassidy%20a%5bauthor%5d&cauthor=true&cauthor_uid=20219960 https://www.ncbi.nlm.nih.gov/pubmed/?term=broer%20l%5bauthor%5d&cauthor=true&cauthor_uid=25064619 https://www.ncbi.nlm.nih.gov/pubmed/?term=broer%20l%5bauthor%5d&cauthor=true&cauthor_uid=25064619 https://www.ncbi.nlm.nih.gov/pubmed/?term=njajou%20ot%5bauthor%5d&cauthor=true&cauthor_uid=22005719 https://www.ncbi.nlm.nih.gov/pubmed/?term=njajou%20ot%5bauthor%5d&cauthor=true&cauthor_uid=22005719 lmrj volume 2 issue 2 35 | p a g e 10 zhang wg et al.(38) 2015 139 healthy subjects telomere restriction fragment length is associated with kidney function (p<0.05) and may serve as a marker of aging (r=0.314, p<0.001) 11 eunkyo ng k et al.(42) 2017 130 surgically resected paraffin‐ embedded hepatocellular carcinoma tumor tissue samples h2o2 contributes to telomere elongation in advanced hepatocellular carcinoma through protein kinase b (akt) activation no association of metabolic syndrome with telomere length 12 khalango t md et al.(37) 2019 115 adults a high risk of shorter telomeres, which remained important after adjustment for gender, age and 2hpg rates, was associated with metabolic syndrome. other components of metabolic syndrome and fasting plasma glucose levels did not influence the magnitude of the correlation, and the independent effect of these factors was not disclosed (p>0.05). controversial results 13 bhupatiraj u c et al. (29) 2012 194 subjects; 96 hypertensive and 98 normal subjects a significant negative correlation was found in both the hypertensive and normal individuals (p<0.05) between age and telomere length. although insignificant (p>0.05), the diastolic and systolic blood pressure were negatively correlated with relative telomere length. 14 verhulst s et al.(41) 2016 684 participants baseline insulin resistance during the follow-up period was not related with age-dependent changes in leucocyte telomere length (attrition), whereas baseline leucocyte telomere length was linked with increases in insulin resistance during this time. 15 kim nw et al.(43) 2015 101 biopsies telomerase become less active in somatic cells however their activity appears to be increased in cancer cells which help them in growing exponentially and make them immortal. conclusion this review concluded that there are two ways to decrease the important role of telomeric length as the well-known event in age. one reflects the impact of various chronic diseases such as insulin resistance and diabetes by attrition of telomeres, an effect most likely due to mitochondrial dysfunction https://aasldpubs.onlinelibrary.wiley.com/action/dosearch?contribauthorstored=ko%2c%2beunkyong https://aasldpubs.onlinelibrary.wiley.com/action/dosearch?contribauthorstored=ko%2c%2beunkyong https://aasldpubs.onlinelibrary.wiley.com/action/dosearch?contribauthorstored=ko%2c%2beunkyong https://aasldpubs.onlinelibrary.wiley.com/action/dosearch?contribauthorstored=ko%2c%2beunkyong http://www.frontiersin.org/people/u/638398 http://www.frontiersin.org/people/u/638398 http://www.frontiersin.org/people/u/638398 http://www.frontiersin.org/people/u/638398 https://www.ncbi.nlm.nih.gov/pubmed/?term=willeit%20p%5bauthor%5d&cauthor=true&cauthor_uid=25390655 https://www.ncbi.nlm.nih.gov/pubmed/?term=willeit%20p%5bauthor%5d&cauthor=true&cauthor_uid=25390655 lmrj volume 2 issue 2 36 | p a g e and proinflammatory state. second, shortening the telomere causes damage to dna, cellular senescence and apoptosis, and triggers associated metabolic syndrome-related ageing disorders. in contrast, telomer length maintenance or elongation is associated with cell immortality and ultimately tumor growth. future directions there is still an unresolved and puzzling relationship between obesity and telomere morphology. interesting work on this relationship is therefore needed in order to cure life and prolong survival. future welldesigned multi-faceted intervention studies must take this bidirectional relationship into account and examine whether targeting obesity can minimize, interrupt, or even reverse telomere attrition to avoid further deterioration to cardiovascular and agingrelated complications. references 1. wilson pw, d'agostino rb, parise h, sullivan l, meigs jb. metabolic syndrome as a precursor of cardiovascular disease and type 2 diabetes mellitus. circulation. 2005;112(20):3066-72. 2. katzmarzyk pt, leon as, wilmore jh, skinner js, rao dc, rankinen t, et al. targeting the metabolic syndrome with exercise: evidence from the heritage family study. medicine and science in sports and exercise. 2003;35(10):1703-9. 3. fauci as, braunwald e, kasper dl, hauser s, longo d, jameson j. harrison's principles of internal medicine: mcgraw-hill. medical publishing division; 2008. 4. grundy sm, cleeman ji, daniels sr, donato ka, eckel rh, franklin ba, et al. diagnosis and management of the metabolic syndrome: an american heart association/national heart, lung, and blood institute scientific statement. circulation. 2005;112(17):2735-52. 5. borch-johnsen k, wareham n. the rise and fall of the metabolic syndrome. diabetologia. 2010;53(4):597-9. 6. guize l, thomas f, pannier b, bean k, jego b, benetos a. all-cause mortality associated with specific combinations of the metabolic syndrome according to recent definitions. diabetes care. 2007;30(9):2381-7. 7. zambon s, zanoni s, romanato g, corti mc, noale m, sartori l, et al. metabolic syndrome and all-cause and cardiovascular mortality in an italian elderly population: the progetto veneto anziani (pro.v.a.) study. diabetes care. 2009;32(1):153-9. 8. haffner s, taegtmeyer h. epidemic obesity and the metabolic syndrome. circulation. 2003;108(13):1541-5. 9. vasudevan ar, ballantyne cm. cardiometabolic risk assessment: an approach to the prevention of cardiovascular disease and diabetes mellitus. clinical cornerstone. 2005;7(2-3):7-16. 10. iqbal az, basharat s, basharat a, basharat s. prevalence of the metabolic syndrome and its component abnormalities among school age pakistani children. journal of ayub medical college abbottabad. 2014;26(2):194-9. lmrj volume 2 issue 2 37 | p a g e 11. knopp rh, paramsothy p. oxidized ldl and abdominal obesity: a key to understanding the metabolic syndrome. the american journal of clinical nutrition. 2006;83(1):1-2. 12. saez gt, tormos c, giner v, chaves j, lozano jv, iradi a, et al. factors related to the impact of antihypertensive treatment in antioxidant activities and oxidative stress byproducts in human hypertension. american journal of hypertension. 2004;17(9):809-16. 13. palmieri vo, grattagliano i, portincasa p, palasciano g. systemic oxidative alterations are associated with visceral adiposity and liver steatosis in patients with metabolic syndrome. the journal of nutrition. 2006;136(12):3022-6. 14. couillard c, ruel g, archer wr, pomerleau s, bergeron j, couture p, et al. circulating levels of oxidative stress markers and endothelial adhesion molecules in men with abdominal obesity. the journal of clinical endocrinology and metabolism. 2005;90(12):6454-9. 15. pak jw, herbst a, bua e, gokey n, mckenzie d, aiken jm. mitochondrial dna mutations as a fundamental mechanism in physiological declines associated with aging. aging cell. 2003;2(1):1-7. 16. judge s, leeuwenburgh c. cardiac mitochondrial bioenergetics, oxidative stress, and aging. american journal of physiology cell physiology. 2007;292(6):c1983-92. 17. paradies g, petrosillo g, paradies v, ruggiero fm. oxidative stress, mitochondrial bioenergetics, and cardiolipin in aging. free radical biology & medicine. 2010;48(10):1286-95. 18. nettleton ja, diez-roux a, jenny ns, fitzpatrick al, jacobs dr, jr. dietary patterns, food groups, and telomere length in the multi-ethnic study of atherosclerosis (mesa). am j clin nutr. 2008;88(5):1405-12. 19. morley je. the metabolic syndrome and aging. the journals of gerontology: series a. 2004;59(2):m139-m42. 20. bonomini f, rodella lf, rezzani r. metabolic syndrome, aging and involvement of oxidative stress. aging and disease. 2015;6(2):109-20. 21. veronica g, esther rr. aging, metabolic syndrome and the heart. aging and disease. 2012;3(3):269-79. 22. guarner v et al 2005.aging of the cardiovascular system. in: benhagen ef, editor. hypertension: new research. usa: nova biomedical books publishers,47–68. . 23. passos jf, saretzki g, ahmed s, nelson g, richter t, peters h, et al. mitochondrial dysfunction accounts for the stochastic heterogeneity in telomere-dependent senescence. plos biology. 2007;5(5):e110. 24. kong cm, lee xw, wang x. telomere shortening in human diseases. the febs journal. 2013;280(14):3180-93. 25. salpea kd, talmud pj, cooper ja, maubaret cg, stephens jw, abelak k, et al. association of telomere length with type 2 diabetes, oxidative stress and ucp2 gene variation. atherosclerosis. 2010;209(1):4250. lmrj volume 2 issue 2 38 | p a g e 26. valdes am, andrew t, gardner jp, kimura m, oelsner e, cherkas lf, et al. obesity, cigarette smoking, and telomere length in women. lancet (london, england). 2005;366(9486):662-4. 27. revesz d, milaneschi y, verhoeven je, penninx bw. telomere length as a marker of cellular aging is associated with prevalence and progression of metabolic syndrome. the journal of clinical endocrinology and metabolism. 2014;99(12):4607-15. lmrj volume 2 issue 2 47 | p a g e intralesional steroid injection and dilatation for subglottic stenosis in patients with wegener’s granulomatosisa review of literature jawaid naeem qureshi department of surgery, indus medical college, tando mohammad khan, pakistan corresponding author prof. jawaid naeem qureshi department of surgery, indus medical college, tando mohammad khan, pakistan email:drjnq@hotmail.com lmrj.2020; 2(2) doi: 10.38106/lmrj.2020.2.2-04 abstract subglottic stenosis is one of the major complications of the wegener’s granulomatosis. there are no set guidelines available for management. intralesional steroid injection and dilatation seems to be a safe and successful method of treatment. we report a review of available literature on intralesional steroid injection and dilatation for subglottic stenosis in patients with wegener’s granulomatosis. introduction wegener’s granulomatosis is a rare autoimmune disease, predominantly affects middle aged males. subglottic stenosis is one of the complications seen in the patients with upper airway involvement (1020% of all cases) 1 even when the disease is in the remission. as a result of better systemic control and improved life span of the patients suffering from wegener’s disease increasing number of the patients are expected to present with subglottic stenosis2. despite being a major issue for the consultants dealing with these cases and troublesome for the patients who are in remission, there are no set guidelines for the management of this condition. it is suggested that the stenosis of the subglottic region results from scarring of the inflamed upper airway, however in some cases localised inflammation in the region leading to stenosis was the only symptom of the wegener’s disease. it is also thought that extensive surgery would lead to more scarring and worsening of the condition but recently a number of surgical options have been tried including reconstruction of the region, in the patients with remission, however there was associated interference with phonation and/or long term morbidity. the most attractive results from the author’s point of view were of the intralesional steroid injection and dilatation. the studies presented have a very small number of patients or were case reports; hence we now report review of these studies. literature search was done using pubmed database with key words “wegener’s granulomatosis/ disease / subglottic stenosis/ intralesional steroid injection” final search was done on 24th january 2021. all the studies reporting results of intralesional steroid injection in the subglottic stenosis in patients with wegener’s granulomatosis were included. there was no restriction of sample size; even case reports were considered given the fact of rare condition and comparatively new approach of mini review lmrj volume 2 issue 2 48 | p a g e management. a total of 5 publications were found including 2 case reports and 3 case series. a total of 46 patients had intralesional steroid injection with dilatation. none of the patients required tracheostomy and 47% of the patients required more than one session. there was no major adverse effect of the procedure reported in any of the studies. an additional relatively recent study has been reported in children with compromised air way due to wegener’s, the study suggested that children require surgical management for correction of their airway eventually even after intralesional injection therapy with cortisteroids3 the same study has reported extensive review of literature which also reported only a few cases. the review of the studies showed promising results of intralesional injection and dilatation in patients with subglottic stenosis developed as a complication of wagener’s granulomatosis. there was 100% success rate of the procedure in all studies and none of the patients required tracheostomy4, 5. the surgical procedures in the wegener’s granulomatosis have a higher rate of recurrence as well as long term morbidities. most of the procedures e.g. partial cordectomy or tracheostomy, and even reconstruction have higher morbidities and undue stress to the patients affecting their quality of life6, 7. for the patients who are in the remission and responded well to steroid therapy, and given the suspicion of more scarring following their surgery, intralesional injection is an attractive option. most of the studies reported on the subject have a day care procedure, minimal stay to the hospital and with long term good results in association with prevention of unnecessary surgical trauma 1, 2, 8. there is no standard treatment for this condition in patients with wegener’s granulomatosis available at this stage to compare with, but it is strongly recommended to opt this option as first line management in patients with troublesome stenosis. the study has limited importance as there was a small number of studies with a small sample size and some were merely case reports, hence prospective studies with long term follow-up and acceptable sample size are required to set guidelines for recommendations for management of this condition. we conclude that from the evidence given, it is suggested that the intralesional steroid injection with dilatation of the stenosis is safe and successful method in most cases and should be used as the first line of management in these cases. larger prospective studies are required to set the guidelines. references 1. langford c, sneller m, hallahan c, hoffman g, kammerer w, talar-williams c, et al. clinical features and therapeutic management of subglottic stenosis in patients with wegener's granulomatosis. arthritis rheum. 1996;39(10):1754-60. 2. wierzbicka m, tokarski m, puszczewicz m, szyfter w. the efficacy of submucosal corticosteroid injection and dilatation in subglottic stenosis of different aetiology. j laryngol otol. 2016;130(7):674-9. epub 2016/04/28. 3. lee py, adil ea, irace al, neff l, son mb, lee ey, et al. the presentation and management of granulomatosis with polyangiitis (wegener's granulomatosis) in the pediatric airway.laryngoscope. 2017;127(1):233-40. epub 2016/04/27. lmrj volume 2 issue 2 49 | p a g e 4. bakhos d, lescanne e, diot e, beutter p, morinière s. [subglottic stenosis in wegener's granulomatosis]. ann otolaryngol chir cervicofac. 2008;125(1):35-9. epub 2008/02/12. maladie de wegener et sténose sous glottique. 5. hoffman gs, thomas-golbanov ck, chan j, akst lm, eliachar i. treatment of subglottic stenosis, due to wegener's granulomatosis, with intralesional corticosteroids and dilation. j rheumatol. 2003;30(5):1017-21. epub 2003/05/08. 6. rookard p, hechtman j, baluch ar, kaye ad, manmohansingh v. wegener's granulomatosis. middle east j anaesthesiol. 2009;20(1):21-9. epub 2009/03/10. 7. thompson ld. wegener granulomatosis. ear nose throat j. 2013;92(1):18-22. epub 2013/01/29. 8. solans-laqué r, bosch-gil j, canela m, lorente j, pallisa e, vilardell-tarrés m. clinical features and therapeutic management of subglottic stenosis in patients with wegener's granulomatosis. lupus. 2008;17(9):832-6 404 not found not found the requested url /index.php/lmrj/article/download/10.38106/lmrj.2021.3.2-01/10.38106/lmrj.2021.3.2-01 was not found on this server. 404 not found not found the requested url /index.php/lmrj/article/download/https://doi.org/10.38106/lmrj.2021.3.2-2/10.38106/lmrj.2021.3.2-02 was not found on this server. lmrj volume 3 issue 1 27 | p a g e what does breast cancer screening mean from economy point of viewa pakistani perspective? jawaid naeem qureshi indus medical college, tando mohammad khan, pakistan correspondence: jawaid naem qureshi email: drjnq@hotmail.com 10.3390/lmrj.2021.3.1-05 received: 30.12.2020 accepted: 20.02.2021 published: 31.022021 breast cancer is known for centuries, where oldest evidence reported from edwin smith papyrus who called it as having no cure. however that is still true in some way when it comes to advance disease, however for early breast cancer its not true. the credit for cure goes to screening techniques followed by appropriate treatment options with availability of modern drugs. breast cancer screening has been in practice for dec ades and reportedly reduces breast cancer mortality. in developed countries where there are national breast cancer screening programs widely practiced breast cancer survival in screened population has reached to almost 100%. developing countries have seen considerable rise in breast cancer incidence in the recent past and suspected to rise even more in the upcoming years. apparently national screening programs pose a great economic bur den on any country. the screening tools such as mammogram machines, training of the human resource the start then recurring cost of x-ray films if digital mammograms are not being used. therefore many developing countries do not consider it cost effective including pakistan. now let’s take a look at the upcoming burden of breast cancer as predicted by globocan 2020 (figure 1). the reported rate of breast cancer in 2020 in pakistan was approximately 26000, this rate will approach to 50000 by 2040[1]. when we say 50000 per annum means 137 women per day will be coming with breast can cer. as reported earlier that a great majority of breast cancer in pakistan comes with advance stage. thus the burden of treatment on one hand and poor survival is a challenge of the other hand. the benefit of breast cancer screening are multifaceted: 1. as screen detected cancer are very small, can be successfully treated by surgery only minimal or even without any further adjuvant therapy, thus saving cost on expensive chemotherapy, immunotherapy and hormonal therapy. 2. as a less aggressive treatment is given thus less hospitalization and early discharge with less morbidity, reducing the cost of hospitalization and additional expenditure of prolonged hospital stay. 3. early detection improves survival producing positive impact on the family and saving them from stress they can potentially go through in case of breast cancer mortality. there are direct and indirect economical benefits are chemotherapy. lets take it in the cost comparison. each patient going through breast cancer treatment government even through sehat card pays 2.0 million rupees per patient. thus for 50000 patients the amount will be 100 billions per year, with the mortality rate of more than 26000 per annum. on the other hand providing screening service at selected points or each bhu (taken that there are approximately 5300 bhus in the country) will cost less than one year cost of the treatment for all these women. in conclusion it is utmost important to develop strategies at provincial and national level to start mass screening following international guidelines followed by audits and extensive research programs to make national guidelines in order to improve survival outcome and reduce economic burden. editorial mailto:drjnq@hotmail.com lmrj volume 3 issue 1 28 | p a g e figure 1. globocan 2020: cancer statistics data of breast cancer in pakistani women and prediction -2040 references: 1. globocan, cancer statistics. 2020 lmrj volume 3 issue 1 29 | p a g e lmrj volume 2 issue 4 77 | p a g e attention deficit hyperactivity disorder (adhd) in children consuming junk food bakht rawan1, muhammad tariq masood khan1, abid ali1, ejaz ahmed khan2, shujaat ali khan2 1northwest school of medicine, peshawar, pakistan, 2khyber institute of medical sciences, kohat, pakistan correspondence: dr. bakht rawan, northwest school of medicine, peshawar email: drbakhtmrcp@gmail.com mob#+92-300-5888867 lmrj.2020 doi: 10.38106/lmrj.2020.2.4-02 abstract: objective: the current study was aimed to determine relationship between junk food consumption and attention deficit hyperactivity disorder (adhd) in school going children. methods: standard questionnaires for the diagnosis of adhd, junk food consumption among children and their mothers during pregnancy and lactation were distributed among children and parents of enrolled students. results: parents of 84 students were contacted, of whom 47 were enrolled into the study. a total of 8 (17.02%) student were found to have adhd, with a higher frequency in male students. junk food consumption was found to have an association with adhd. conclusion: adhd is a common finding in school going children of district kohat. the frequency is particularly high in male children and is strongly associated junk food consumption. key words: attention deficit hyperactivity disorder, junk food, district kohat, artificial food colours introduction attention deficit hyperactivity disorder (adhd) is a neuro-developmental disorder, characterized by impairment in the executive functions of brain that include inattention, hyperactivity and impulsivity.1 adhd is diagnosed before the age of six years. in around 60% of the cases the individuals carry adhd symptoms in their adulthood.2 adhd is a predisposing factor for other psychiatric conditions such as antisocial personality disorder, substance abuse, low educational level and tendency towards criminality.3, 4 several genetic and environmental factors have been implicated in the pathogenicity of adhd.5 it has recently been found that artificial food colors (afcs) and preservatives have a role in the development of adhd among children in the general population.6 the strength of association between the two is, however, still a subject of debate.7 afcs are frequently used in junk foods. the term junk food was first coined by michael jacobson (1972) for certain food categories with little or no nutritional value, or the ones which contain unhealthy ingredients (afcs, preservatives etc.) as well.8 research article mailto:drbakht_kmc@yahoo.com mailto:drbakht_kmc@yahoo.com lmrj volume 2 issue 4 78 | p a g e junk foods also interfere with the neuronal activity of brain and have an addictive potential.9 the neuronal pathways affected are seriously interrupted by the in-utero exposure of fetus to junk food which increases the offspring’s preference for junk food leading to its overuse of junk food in later life.10, 11. a study conducted on rats reported that the fetal exposure of maternal junk food significantly interrupts the neuronal pathways of the mesolimbic reward center by altering the receptor expression in these specialized areas of brain resulting in increased preference for junk food in the offsprings.9 studies supporting this hypothesis in the humans are lacking. this study elicits the inter-relationship of junk food preference in the children with that of mothers during pregnancy. the study also determines frequency of adhd among children who prefer junk food. methodolgy this school based study was conducted from october 2011 to february 2012 on 150 children (4–7 years old) in three schools, namely the educators, beacon house school system, the islamic happy land montessori school system, and the pakistan foundation academy, all located in kohat city, khyber pakhtunkhwa province of pakistan. the approval was taken from the institutional review board for bioethics, kmu institute of medical sciences. letters were sent to the principals of the above mentioned schools explaining the objectives, methodology, and the duration of the study. after approval, a research team visited the schools and distributed the consent forms and self-reporting questionnaires among the class teachers of the study subjects. another consent form and three different questionnaires were sent to the parents of students from the respective schools. the questionnaires used in this study was translated bilingually from english to urdu and then from urdu to english by three language experts separately, to establish reliability. the questionnaire distributed among the school teachers was the diagnostic and statistical manual of mental disorders fourth edition (dsm-iv) diagnostic criteria for the diagnosis of adhd. it consisted of 18 items, for the teacher rating of children hyperactivity level. three different types of questionnaires were distributed among parents. the first questionnaire encompassed the demographic details and a detailed dietary history during their respective pregnancies, specifying the food taken during the first, second and third trimester. the second questionnaire delineated food preferences of the children towards healthy or junk food items. the third questionnaire was the dsm-iv diagnostic criteria for the parental rating of children hyperactivity. the questionnaires were collected after one month of distribution. the hyperactivity scores recorded at the school (by teachers) and at homes (by the parents), were compared for determining the adhd status. all the children labeled as adhd or hyperactive but below the threshold of adhd were examined by the psychiatrist for the confirmation of the hyperactivity. finally, the hyperactivity level was compared with the food preferences among the children. results initially, parents of a total of 84 students were contacted of whom only 47 consented and were enrolled into the study. these included 21 female and 26 male students. the mean age of students enrolled was 5.7 years (age range: 4-7 years). it was found that 9 (19.15%) students were mild, 11 (23.40%) were moderate and 27 (57.45%) were excessive junk food users (figure 1). lmrj volume 2 issue 4 79 | p a g e a total of 27 students were found to be consuming junk foods; a majority of these were males (table 1). among children with mild junk food preferences, only one (11.11%) had adhd (figure 1). in the moderate junk food consuming group of children, 2 (18.18%) had adhd, a male and a female child. similarly, among excessive junk food consuming students 5 (18.52%) had adhd. it was found that among the study participants adhd had a propensity for male gender, the maternal feedback depicting dietary histories in pregnancy and at the time of lactation was very poor; none of the mother could recall dietary history with certainty. this segment of research project was hence left unprocessed. the common coloring agents used in the junk food items found in this study included e122 (carmoisine), e129 (allura red), e133 (brilliant blue) and e150. figure 1activity status among junk food using children. adhd, attention deficit hyperactivity disorder adhd 0 1 inattention/hyperactivity 1 1 asymptomatic 3 4 0 1 2 3 4 5 number of patients female male adhd 1 1 inattention/hyperactivity 1 3 asymptomatic 2 3 0 0.5 1 1.5 2 2.5 3 3.5 number of patients female male adhd 2 3 inattention/hyperactivity 3 5 asymptomatic 9 5 0 2 4 6 8 10 number of patients female male table 1. gender wise distribution of study participants in various junk food usage categories junk food usage mild n (%) moderate n (%) excessive n (%) male 6 (12.76) 7 (14.89) 15 (31.94) female 4 (10.64) 4 (8.51) 12 (25.54) total 9 (19.14) 11 (23.40) 27 (57.44) n, number of patients discussion in the current study, among 47 students, 8 (17.04%) were found to have adhd. in a study conducted in the us, the adhd prevalence rate among school going children was found to be 6.9% 12. in another study from germany, a prevalence rate of 4.8% was found.13 this significant disparity may be attributed to the geographical, cultural, and social differences. lmrj volume 2 issue 4 80 | p a g e an increased propensity of adhd for male gender was identified in the current study. previously studies have also reported similar findings of increased frequency in male children.14, 15 it has been found that the decreased frequency among female children is mainly due to the relatively vague expression of the disorder.16 another contributing factor is the frequent occurrence of co-morbid psychiatric conditions in female children which may have a masking effect on adhd.17 the study was delimited by small sample size. initially parents of 84 students were contacted, however, most of them (n = 37) denied to participate in the study. this higher frequency of denial may relate to the native cultural dilemma of strict traditional practices which prevents females from disclosing whereabouts of their pregnancies and lactation period. among those who consented, recall bias compromised the data generated. the segment of study encompassing dietary details among mothers at the time of pregnancy and lactation was hence omitted. it is, however, strongly suggested that a prospective study addressing these limitations be carried out in larger set of students. it is also suggested that comprehensive questionnaires, encompassing the dietary histories in detail, discerning the quality, quantity and timing of meals be prepared while carrying out such studies. in addition, we could not correlate the ingredients in junk foods with the psychiatric clinical outcome. we suggest studies elucidating the relationship of these agents with level of hyperactivity in students. conclusion adhd is a common psychiatric disorder among school going children of district kohat. males are affected more frequently by the disease as compared to females. adhd is strongly correlated with junk food consumption. abstinence of children from such food items is therefore warranted. acknowledgment we acknowledge the help and support provided by saddique aslam, ejaz ahmed khan, siddique akbar and muhammad asif of kims kohat. references 1. american psychiatric association: diagnostic and statistical manual of mental diseases (dsmiv). 4th ed. washington dc: american psychiatric publishing; 1994. 2. valdizan jr, izaguerri-gracia ac. [attention deficit hyperactivity disorder in adults]. rev neurol 2009; 48 suppl 2:s95-9. 3. wilens te. attentiondeficit/hyperactivity disorder in adults. jama 2004; 292:619. 4. patterns of psychiatric comorbidity, cognition, and psychosocial functioning in adults with attention deficit hyperactivity disorder. american journal of psychiatry 1993; 150:1792-8. 5. what causes adhd?: understanding what goes wrong and why. choice reviews online 2006; 44:441816-44 lmrj volume 2 issue 4 81 | p a g e 6. mccann d, barrett a, cooper a, crumpler d, dalen l, grimshaw k, et al. food additives and hyperactive behaviour in 3-year-old and 8/9-year-old children in the community: a randomised, double-blinded, placebo-controlled trial. the lancet 2007; 370:1560-7. 7. diet and attention deficit hyperactivity disorder. harvard mental health letter. [cited 2011 june 11]. 8. naeem z. increasing trend of junk food use in saudi arabia and health implications. international journal of health sciences 2012; 6:v-vi. 9. johnson pm, kenny pj. dopamine d2 receptors in addiction-like reward dysfunction and compulsive eating in obese rats. nat neurosci 2010; 13:635-41. 10. bayol sa, farrington sj, stickland nc. a maternal ‘junk food’ diet in pregnancy and lactation promotes an exacerbated taste for ‘junk food’ and a greater propensity for obesity in rat offspring. british journal of nutrition 2007; 98. 11. ong zy, muhlhausler bs. maternal "junk-food" feeding of rat dams alters food choices and development of the mesolimbic reward pathway in the offspring. the faseb journal 2011; 25:216779. 12. brown rt, freeman ws, perrin jm, stein mt, amler rw, feldman hm, et al. prevalence and assessment of attention-deficit/hyperactivity disorder in primary care settings. pediatrics 2001; 107:e43. 13. schlack r, holling h, kurth bm, huss m. [the prevalence of attention-deficit/hyperactivity disorder (adhd) among children and adolescents in germany. initial results from the german health interview and examination survey for children and adolescents (kiggs)]. bundesgesundheitsblatt gesundheitsforschung gesundheitsschutz 2007; 50:827-35. 14. meysamie a, fard md, mohammadi mr. prevalence of attention-deficit/hyperactivity disorder symptoms in preschool-aged iranian children. iranian journal of pediatrics 2011; 21:467-72. 15. rucklidge jj. gender differences in attention-deficit/hyperactivity disorder. psychiatr clin north am 2010; 33:357-73. 16. skogli ew, teicher mh, andersen pn, hovik kt, øie m. adhd in girls and boys – gender differences in co-existing symptoms and executive function measures. bmc psychiatry 2013; 13:298 17. quinn po. attention-deficit/hyperactivity disorder and its comorbidities in women and girls: an evolving picture. curr psychiatry rep 2008; 10:419-23. type of the paper (article lmrj volume 3 issue 2 48 | p a g e letter to editor risk of mental illness in doctors – a covid 19 perspective ahmed ali khan1 1 emeritus meritorious nhs consultant psychiatrist, london, united kingdom suicide claims nearly 800,000 lives every year globally in particular among 15-29 years age group. mortality of disease such as heart diseases, stroke and cancer have declined over the past 100years but suicide rate has remain unchanged. mental illness is the cause of suicide resulting from inequalities, racism and poverty in certain circumstances can be appropriately termed as “fearfuldemoralized“, further away from their work related goals. recent statement on racism and mental health stated by the president royal college of psychiatrist suggests traumatic interaction that can result in poorer selfesteem , internalized hatred , reflecting how adversity undermine resilience and ability to protest and protect. this warns the need to practice psychesocial education .it is virtually impossible to dispense social prescribing, unless we understand our local communities’ inequalities by public engagement. there is need to include religion and mental health into psychiatric care. measures of religious coping can be both positive and negative, provided how individual deploy good religious practice and other aspects of religious experiences. there is a gap in management protocols when religion is not involved, it is rarely part of standard psychiatric assessment and treatment. protocol for assessments ignore religious belief & there are few, intervention to take account of religious & spiritual beliefs. coronavirus -19 pandemic has changed every health professional practices including psychiatry. the virus leaves a trail of delirium, depression, and anxiety. perhaps post traumatic disorder in those who survive. the corona virus -19 pandemic , research shows placed additional crises on doctors and greater psychological distress elevated suicidal ideation, thus following pandemic there could be a major crises of mental illness arise. it is also feared that the greater proportion of the medical and allied community might suffer. doctors suicide rates 2 to 5 times higher than general population. but it is important to remember that the vast majority of doctors do not kill themselves .most doctors thrive in their working environment but post-covid period might not be the same. as doctors work harder , they blame themselves for not being able to deliver the care required by the patients and felt guilty for events beyond their control and can suffer from a” triad of guilt, low self-esteem and persistent. sense of failure might prevail more than ever and suspected that the most doctors suffering post-covid depression might take their own life. in uk, around 1in 5 adult has considered suicide, and 1 in 15 have attempted it. the thought of suicide is higher in doctors compared with the general population. 60% of doctors observed to be reluctant to seek help, because of concern that it could affect their medical license. sadly doctors shows the high rate of mental health discrete and lower access to treatment. with inequalities, co-morbidities, aging process and long covid illness at smirk , calls for need to improve response to mental health impact. as a psychiatrist with over 60 year’s experience, in my opinion in such situation upcoming major mental health issue more modern approach where religion and standard psychiatric care may be combined. the new evidence based medicine might take a little more time for trial and testing but it is worth considering. correspondence: email: drahmedkhan@hotmail.co.uk https://doi.org/10.38106/lm ej.2021.3.2-05 received: 31.05.2021 accepted: 21.06.2021 published: 30. 06.2021 lmrj volume 2 issue 4 95 | p a g e hemostatic defects in dengue infection at a tertiary care hospital in karachi samina naz mukry1, iffat shamim1, muhammad noman ramazan1, tahir sultan shamsi1 1national institute of blood diseases & bone marrow transplantation, karachi75300, pakistan. corresponding author dr. samina naz mukry, ph.d. department of post graduate studies & research, national institute of blood diseases bone marrow transplantation, karachi, pakistan. tel:92-21-348242503 email:smukry.nibd@gmail.com, smukry@gmail.com saminanaz.mukry@nibd.edu.pk lmrj.2020; 2(4):1-6. doi: 10.38106/lmrj.2020.2.4.05 abstract this study was aimed to investigate haemostatic defects in dengue infection. a cross sectional study was conducted from 2013-2014 at national institute of blood diseases & bone marrow transplantation, karachi. total 127 dengue patients of either sex were included. after clinical examination, serology was performed to confirm dengue. the complete blood picture (cbc), prothrombin time (pt), activated partial thromboplastin time (aptt), fibrinogen, d-dimer, liver function tests were performed. out of 127 cases about 95.8% patients presented with myalgia and 88 had headaches. no splenomegaly or hepatomegaly was observed. serologic antibodies were found in all patients. average platelet count and white blood cell count were 47.2x103 /ul and 5.3x103/ul respectively. eighty-three patients had prolonged pt while 92 patients had prolonged aptt value. raised total bilirubin, alkaline phosphatase and sgpt were found in 7, 91 and 87 patients respectively. highly elevated d-dimer values were recorded in 96% cases while only 12% patients had higher fibrinogen levels. marked hematological abnormalities were observed among all the patients diagnosed with df regardless of age, sex and clinical presentation. key words: dengue fever; fibrinolysis; ddimer; pt; aptt; hemostatic defects introduction dengue infection is a mosquito borne tropical illness caused by any of the four different viral serovers i.e. den i-iv. the common vectors for transmission in human are aedes aegypti and aedes albopictus. clinically apparent disease due to dengue virus varies in severity from mild undifferentiated dengue fever (df) through to more severe forms such as dengue hemorrhagic fever (dhf) and dengue shock research article tel:92-21-348242503 lmrj volume 2 issue 4 96 | p a g e syndrome (dss). the df and dhf are more commonly occurring pathological events due to dengue virus world-wide; accounting to more than 100 million annual cases.1,2 acute febrile phase is manifested by headache, body aches, weakness, joint pains, gi discomfort and last upto 3-5 days. capillary leakage due to increase vascular permeability is a key differentiating feature observed in dhf otherwise absent in df. excessive decrease of intravascular volume in dhf may lead to dss. common symptoms for dhf include skin petechiae or bruising, minor bleeding episodes but major hemorrhage is unusual.3 the exact cause of bleeding in dengue infections is still obscured. most evident physiological changes in df include thrombocytopenia (platelet counts less than 150,000/l), raised hemoglobin, and hematocrit, and decreased total leucocyte counts. viral attack on hepatocytes cause deranged liver function tests.4 abnormalities in platelets function are common in dengue infections such as adp induced impaired platelets aggregation response and increased secretory activities of platelets.5 furthermore, hyperfibrinogenemia, decreased fibrin monomers (fm) and slightly prolonged prothrombin (pt) and partial thromboplastin times (aptt) have also been reported in dengue infected patients.6,7 according to some studies small fraction of dhf patients may exhibit alteration in levels of coagulation factors, such as factor ii, v, vii, viii, ix, x, antithrombin, and α-2–antiplasmin.8 this study was aimed to investigate haemostatic defects in patients with dengue infection admitted to nibd. methods a total of 127 dengue patients of either sex were enrolled to conduct a cross sectional study over a period of two years from 2013-2014 at national institute of blood diseases & bone marrow transplantation, karachi. the study was conducted after approval by ethical review committee of nibd. a clinical examination with detailed history was carried out. serology was performed to confirm dengue using solid-phase immunochromatographic assays (mp diagnostics multisure dengue ab/ag rapid test kit). the primary and secondary infections were confirmed by presence or absence of ns-1 antigen and iga, igm, igg. primary dengue cases were ns-1, iga or igm positive while secondary dengue cases also showed positivity for igg. complete blood count (cbc) using edta blood sample analyzed by hematology analyzer xe2100. first line coagulation screening tests were performed to rule out the findings of hemostatic defects. citrated plasma was used for prothrombin time (ptt), activated prothrombin time (aptt), fibrinogen and d-dimer levels using sta compact r, diagnostic stago, france. serum was used for liver function test (lft) using biochemical analyzer mindray 200, china. the data obtained was subjected to simple descriptive analysis using spss version 23.0. results the dengue serological tests confirmed dengue infection in 127 patients. out of these, 90 were males and 37 were females; mean age of the patients was 24.8(3-41 yrs). overall, 79 patients had dengue secondary infection based on their serological findings i.e presence of igg, igm+igg or iga alone (figure-1). beside fever, vomiting and fatigue; other hematological manifestations observed were epistaxis, petechia, gum bleeding and hematemesis (table-1). the diagnostic findings such as mean hematocrit, platelet count, pt, aptt, and liver function tests (lfts) for df patients are shown in table-1. the hematological parameter were elevated with abnormally high count of reactive lymphocytes observed in all cases. mean platelets count was 80.76±84 x 10⁹/l (p<0.001) with significantly raised aptt (p=0.048) and d-dimer (<0.001) lmrj volume 2 issue 4 97 | p a g e values. raised aptt was observed in 104 (81.88%) patients most of these patients were also presented with bleeding and other coagulopathy symptoms as expected. deranged biochemical tests including abnormal lfts were also observed (table-1). table 1: laboratory and clinical findings of dengue infected patients (n=127) variables mean ±s.d (range) p-value clinical findings duration of illness (days) 5±2.1 (1-14) temperature (°f) 101.97±0.87 (100-105) headache (n%) 34 fatigue(n%) 48.4 epistaxis (n%) 19.82 petechia (n%) 81.62 gastrointestinal discomfort (n%) 23.48 gum bleeding (n%) 11.9 hematemesis (n%) 5.0 hematological parameters hematocrit (%) 38.05±6.22 (18-49) <0.001 tlc (x 10⁹/l) 5.32±3.09 (1.09-16.05) 0.001 reactive lymphocytes (%) 73 ±9.03 (40-82.03) 0.001 hemostatic parameters platelets (x 10⁹/l) 80.76±84.8 (2-421) <0.001 pt (seconds) 14.04±2.36 (10-18) 0.99 aptt (seconds) 37.39±7.29 (20-50) 0.048 d-dimer (mg/l) 2.58±2.72 (0.009-13.08) <0.001 fibrinogen (g/l) 2.56±0.78 (1.01-4.39) 0.99 biochemical parameters ast (u/l) 145.12±250.61 (18-1996) <0.001 sgpt (u/l) 92.10±119.55 (18-940) <0.001 gamma gt (u/l) 290.46±157.44 (128-840) <0.001 alkaline phosphatase (u/l) 83.49±114.44 (11-664) <0.001 direct bilirubin (mmol/l) 0.63±0.71(0.1-5.8) 0.94 albumin (g/dl) 4.64±3.63 (3.1-6.4) <0.001 n%, percentage of patient out of 127; sd, standard deviation; pt, prothrombin time; appt, activated partial thromboplastin time; ast, aspartate aminotransferase; sgpt, serum glutamic-pyruvic transaminase;gamma gt, gammaglutamyl transpepsidase. lmrj volume 2 issue 4 98 | p a g e figure 1: frequency of serological markers in patients confirmed primary and secondary dengue infection discussion over the past few decades df has become one of the major viral infections in pakistan. post-monsoon seasonal outbreaks were a common observation throughout the country.9,10 untreated or misdiagnosed cases result in death due to hemostatic defects causing increased vascular permeability associated with severe form of df i.e. dhf/ dss with serious bleeding manifestations. occurrence of dhf or dss is more common in secondary dengue infections or reinfection due to different serover of dengue virus.5 past immuno-pathological mechanistic studies of df suggest direct involvement of both humoral and cellmediated immune responses.11,12 halstead proposed; that beside complement system; the antibodies from previous df cause increased replication of virus infected macrophages/ mononuclear cells via an antibody dependent mechanism thereby contributing to pathogenesis of dhf.13 therefore, the present study was aimed to evaluate the possible association of defects in the extrinsic and intrinsic coagulation pathways with severity of df. about 62.20% patients in our study population were presented with secondary dengue infections with 5% patients having episodes of hematemesis. the frequency of common symptoms such as elevated body temperature, fatigue and headache is comparable to other local and international studies.9,7,14 elevated hematocrit and activated lymphocytes were observed in most df patients (table-1). to study the cause of bleeding complications in df; kurane and ennis hypothesized that activated lymphocytes such as t-cells along with monocytes release cytokines (il-2, ifn-γ, tnfα, il-6, etc.) along with chemical mediators (histamine and complement components etc.) which work synergistically to induce tissue injury due to dysfunctional vascular endothelial cells.15 the lmrj volume 2 issue 4 99 | p a g e shock due to plasma leakage causes defects in coagulation cascade resulting in hemorrhagic manifestations. transient coagulopathy which last for few days during the course of disease have been reported in previous studies.8,7 the abnormal pt and aptt correlate with defects in the extrinsic and intrinsic coagulation pathways significantly therefore, raised aptt (p= 0.048) and d-dimer (p=<0.001) were observed in 81.88% cases confirm abnormal events in intrinsic pathway in our study population. another important factor is the level of fibrinogen, an acute phase protein, which is degraded to thrombin in case of vascular injury. most of our patients had moderately low fibrinogen concentration which is in-line with previous studies.7,14 the mechanism of fibrinogen consumption in dengue is poorly understood. wills et al., has proposed that the presence of dengue virus in df directly activates fibrinolysis via molecular mimicry without the need of a usual thrombotic signal.14 the fibrinogen degradation in turn initiates secondary activation of pro-coagulant homeostatic cascade. therefore, hemorrhagic manifestations or bleeding episodes in df does not follow the classical disseminated intravascular coagulation pattern rather it may be a combined consequence of low platelets count, altered platelets function, and augmented lysis of fibrinogen.16 increased d-dimer values also confirmed increased fibrinolysis in our study. like most viral infections abnormal lft values were also observed as reported by giri et al., in a past study.4 conclusion: significant association of transient coagulopathy was observed in most of the df patients with suggested altered events in intrinsic coagulation and fibrinolytic pathways i.e. d-dimer. understanding the pathogenesis of df is important and may lead directly to more effective treatment of patients with df, particularly those with complex hemostatic disorders. further research with large sample size and more parameters like determination of levels of clotting factors and inhibitors of coagulation pathways is suggested to confirm the clinical relevance of the current findings. acknowledgements authors are thankful to all clinicians and staff at nibd. special thanks to mr. abdul sattar and mr. rizwan rehman for their co-operation. references 1. bhatt s, gething pw, brady oj, messina jp, farlow aw, moyes cl, drake jm, brownstein js, hoen ag, sankoh o, myers mf, george db, jaenisch t, wint gr, simmons cp, scott tw, farrar jj, hay si. the global distribution and burden of dengue. nature 2013; 496: 504-507. 2. kyle jl and harris e. global spread and persistence of dengue. annual review of microbiology 2008; 62:71-92. 3. world health organization. dengue guidelines for diagnosis, treatment, prevention and control. in: who, eds. who guideline. geneva: world health organisation; 2009:1-147. 4. giri s, agarwal mp, sharma v, singh a. acute hepatic failure due to dengue: a case report. cases journal 2008; 1 suppl 1: 204. lmrj volume 2 issue 4 100 | p a g e 5. lei hy, yeh tm, liu hs, lin ys, chen sh, liu cc. immunopathogenesis of dengue virus infection. journal of biomedical sciences 2001; 8: 377-388. 6. marchi r, nagaswami c, weisel jw. fibrin formation and lysis studies in dengue virus infection. blood coagulation & fibrinolysis 2009; 20:575-582. 7. huang yh, liu cc, wang st, lei hy, liu hl, lin ys, wu hl, yeh tm. activation of coagulation and fibrinolysis during dengue virus infection. journal of medical virology 2001; 63:247-251. 8. chuang yc, lin ys, liu cc, liu hs, liao sh, shi md, lei hy, yeh tm. factors contributing to the disturbance of coagulation and fibrinolysis in dengue virus infection. journal of the formosan medical association 2013; 112 suppl 1:12-17. 9. bostan n, javed s, nabgha ea, eqani sa, tahir f, bokhari h. dengue fever virus in pakistan: effects of seasonal pattern and temperature change on distribution of vector and virus. reviews in medical virology 2017; 27:1-17. 10. paul re, patel ay, mirza s, fisher-hoch sp, luby sp. expansion of epidemic dengue viral infections to pakistan. international journal of infectious diseases 1998; 2:197-201. 11. lei hy. transient hemophagocytic activity in dengue immunopathogenesis. journal of the formosan medical association 2009; 108: 595-598. 12. rothman al. dengue: defining protective versus pathologic immunity. journal of clinical investigation 2004; 113:946-951. 13. halstead sb. the pathogenesis of dengue: challenges to molecular biology. science 1988; 239:476481. 14. wills b, tran vn, nguyen th, truong tt, tran tn, nguyen md, tran vd, nguyen vv, dinh tt, farrar j. hemostatic changes in vietnamese children with mild dengue correlate with the severity of vascular leakage rather than bleeding. american journal of tropical medicine and hygiene 2009; 81:638-644. 15. kurane i, ennis fa. cytotoxic t lymphocytes in dengue virus infection. current topics in microbiology and immunology 1994; 189:93-108. 16. hottz, ed, oliveira mf, nunes pcg, nogueira rmr, valls-de-souza r, da poian at, weyrich as, zimmerman ga, bozza pt and bozza fa. dengue induces platelet activation, mitochondrial dysfunction and cell death through mechanisms that involve dc-sign and caspasesjournal of thrombosis and haemostasis 2013; 11 suppl 5:951–962. lmrj volume 2 issue 4 89 | p a g e emergence of multi drug resistant salmonella typhi as epidemic among lower sindh regions patients of pakistan aftab durrani1, noorulain qureshi1, maleeha soomro 1 1national institute of blood diseases and bone marrow transplantation, karachi pakistan. correspondence aftab durrani 1national institute of blood diseases and bone marrow transplantation, karachi pakistan email:aftab.d@yahoo.com lmrj.2020; 2(4):1-6. doi: 10.38106/lmrj.2020.2.4.04 abstract this study was aimed to determine the frequency of multidrug-resistant salmonella typhi (s. typhi) among patients from lower region sindh. this cross-sectional study was conducted at diagnostic and research laboratory, hyderabad by evaluating cultures and sensitivity reports collected from different health care centers during one year period (november 2016 to november 2017). total 92 patients were included in this study where most of patients were children with mean age of 6.2yrs and male population was predominant (63%). a detailed history and examination was done and blood culture reports were followed for sensitivity and resistance. blood culture and sensitivity results showed resistance to ampicillin, cefixime, ceftriaxone, ciprofloxacin, and sulphamethoxazole/trimethoprim in 80.4%, 66.3%, 63%, 63% and 82.6%, in respectively. the highest sensitivity (89.1%) was recorded against meropenem. it was concluded that mdr salmonella infection is prevalent in sindh, particularly in hyderabad. key words: salmonella, multidrug resistance, mdr, sindh, enteric fever inroduction typhoid fever remains as one of the major healthcare problems for this geographical location. it is one of those diseases which are diagnosed in areas where there is water contamination, poor hygiene and transmission of infection through feco-oral contamination from the affected person. it affects a large population and approx. 12-13 million cases are reported annually with high death toll of 1,90,000 people in the year 2010.1 about 1% of the cases are fatal. its occurrence is rare in developed countries, however it is endemic in developing countries especially in africa and asia.2 southeast asian countries seem to be the worst affected with high population density living in poor sanitary conditions and unavailability of clean water. lack of education and hygiene further complicates the problem causing sudden research article mailto:aftab.d@yahoo.com lmrj volume 2 issue 4 90 | p a g e outbreaks in such communities.1, 3 these outbreaks can be attributed to contaminated food due to poor cooking practice in restaurants or food stalls failing to follow standard hygienic practice in kitchens, drinking or using water for washing and cooking especially contaminated with human or animal waste, infected poultry and eggs, from waste material of sick and or clinically unhealthy people especially involved in cooking. typhoid fever or enteric fever is caused by salmonella enterica typhi (most commonly referred to as salmonella typhi) para typhi a, para typhi b and para typhi c.4 salmonella typhi is a motile, facultative gram-negative enteric bacillus, belonging to enterobacteriaceae family. it has six subspecies and includes about 2500 serotypes.[5] humans are the only known reservoir. it is a food borne pathogen. it is found in the intestinal tract of its host. numerous strains of this particular organism have been isolated; characterized by variable metabolic characteristics, different levels of virulence, and possessing multi-drug resistance genes.5 these genes then are responsible for complicating the treatment or resulting in failure causing death. a complete blood count test (cbc) may show decreased count of white blood cells (leukopenia), decreased neutrophil count (neutropenia), with decreased eosinophil count and a relative increase in lymphocyte count. diagnostic criteria other than complete blood count includes stool d/r or a bone marrow cultures.4 bone marrow culture is more superior since it has more bacterial concentration and therefore considered gold standard for the diagnosis of s. typhi. the growth on blood culture is attained on macconkey and eosin methylene blue (emb) agars. this bacterium is nonlactose fermenting therefore no gas is produced when it is grown in triple sugar iron (tsi) media, thus differentiating it from other enterobacteriaceae. symptoms of the disease include high grade fever spikes which may persists for several days with bradycardia, malaise, abdominal pain and occasionally cough. abdominal pain can also be associated with diarrhea.5 hepatosplenomegaly may also be present. dehydration can be found due to which patient may become delirious (typhoid state). about one third of the patients’ develop rose spots on lower chest and abdomen. complications include intestinal perforation which is a surgical emergency; septicemia, diffuse peritonitis, encephalitis, pneumonia and acute bronchitis, cholecystitis, endocarditis, and osteitis are the notable. timely empirical treatment and proper management can be curative for majority of the patients. however morbidity and mortality is significantly increased due to the emergence of multi drug resistant strains in endemic regions such as asia.6 prevention is the key in high risk areas. emergence of newer outbreaks of typhoid fever in large numbers formed the basis of this study. methods this cross-sectional study was conducted from november 2016 to november 2017. the consent of the patients were obtained both written and informed, before the commencement of study. the patients were selected from different areas of sindh province (figure 1). the study included patients who presented to the outpatient department of healthcare units with features of typhoid fever. lmrj volume 2 issue 4 91 | p a g e those with positive test for malaria or with signs of other infections on examination, having positive urine analysis for infection or any other systemic finding raising suspicion for any other infection were excluded from the study. history and systemic examination findings were recorded in predesigned data sheet. patient’s blood samples were collected for complete blood count (cbc) and peripheral smear examination. blood culture and sensitivity using was carried out on macconkey’s agar following standard procedures. currently recommended and commonly prescribed antibiotics were tested for sensitivity. the empirical treatment for enteric fever was continued in patients until the culture and sensitivity results were available. the regular follow up of patients was kept in routine for treatment response and improvement or deterioration of clinical symptoms. the data was clinically analyzed. statistical analysis was performed on spss version 16.0 employing descriptive statistics. results a total of 92 patients were included in this study, with a male to female ratio of 1.7:1. mean age of the patients was 6.24 years. the study patients were selected from different cities and districts of sindh province. majority of patients belonged from hyderabad city majority of the affected cases (51.1%) belonged to middle income group. the most affected ethnic group in this study were urdu speaking community (47.8%) (figure 2). among the study patients, 52.2% presented with high grade fever (figure 3). it was found that 41.3% of the patients relied on metropolitan board supplied water, which was neither filtered nor boiled; 92.4% of the patients relied on homemade food for their daily needs. hygiene status was satisfactory in 55.4% of the patients. there was no history of pet animals in 88% of the patients. all the patient samples were 100% positive for polyvalent antisera for o antigen. blood culture and sensitivity results showed resistance to ampicillin, cefixime, ceftriaxone, ciprofloxacin, and sulphamethoxazole/trimethoprim in 83%, 66%, 66%, 90% and 83%, in respective order (table 1). meropenem and azithromycin were found to be the most effective ones, with no resistance in any case. figure 1. frequency of study patients from different cities and districts of sindh province figure 2. representation of different ethnicities in salmonella typhi infection lmrj volume 2 issue 4 92 | p a g e table 1: antimicrobial resistance of s. typhi isolated from blood cultures of cases included in the study antimicrobial agent resistance rate % ampicillin 83% trimet/sulpha 83% chloramphenicol 83% ciprofloxacin 90% ceftriaxone 66% cefixime 66% meropenem 0 azithromycin 0 figure 3. distribution of fever found in patients with typhoid infection. trimet/sulpha, trimethoprim/sulphamethaoxazole discussion multi drug resistance (mdr) salmonella typhi infection poses a worldwide threat. this disease is especially attributed to the developing countries including asian and african countries; however, outbreaks have been reported in the developed world as well. researchers worldwide have identified the mdr salmonella strains lineage, h58, being involved in asian and african outbreaks and further studies are going on.7, 8 this study reports mdr salmonella based on blood culture and sensitivity study and the resistant drug pattern is similar to an earlier study in tajikistan india united states of america and kenya. 7,10-13 diagnosis of salmonella infection (typhoid fever) is important because of its complications and treatment challenges. in this particular study the number of patients was small, and most of the patients were children, there was an outbreak of a similar salmonella infection previously in pakistan also.14 adults need to be included in further studies so that the sensitivity of drugs can also be studied. patients from rural areas could not be included because the patient access was limited to tertiary care hospitals where all facilities are available for the diagnosis and treatment. another limitation of this study is that those cases where blood cultures were negative for any growth of salmonella were excluded; however bone marrow cultures were not performed. we believe that a bigger study including patients enrolled from all over the country should be initiated. this would provide the complete spectrum of the disease and the status of mdr salmonella in pakistan. we believe that a study should also be conducted for the identification of carriers of the disease and especially among workers involved in the food industry. health departments of provincial and federal governments should lead prevention efforts and implementation of laws related to clean drinking water and healthy food practices. lmrj volume 2 issue 4 93 | p a g e rational use of antibiotics, proper education, creating awareness through print, broadcast and social media should be made, observing good sanitary hygiene and vaccination of the susceptible should be undertaken. the future research should be conducted to identify the mdr strains prevalent in this location and their genetic identification. conclusion it was concluded that mdr salmonella infection is prevalent in sindh. it is warranted that practice guidelines be developed to tackle this obvious threat. conflict of interest: no conflict of interest to be declared regarding publication of this paper. acknowledgements: we would like to thank all technical staff at the diagnostic lab and opd for their contribution in collection and processing of samples, patients and their attendants for their participation and cooperation in this study. we would also like to thanks dr. tehmina nafees, sonia khan for her generous contribution in preparation of manuscript. references 1. buckle gc, walker clf, black re. typhoid fever and paratyphoid fever: systematic review to estimate global morbidity and mortality for 2010. journal of global health. 2012;2(1). 2. crump ja, luby sp, mintz ed. the global burden of typhoid fever. bulletin of the world health organization. 2004;82(5):346-53. 3. crump ja, mintz ed. global trends in typhoid and paratyphoid fever. clinical infectious diseases. 2010;50(2):241-6. 4. bhutta za. current concepts in the diagnosis and treatment of typhoid fever. bmj: british medical journal. 2006;333(7558):78. 5. fàbrega a, vila j. salmonella enterica serovar typhimurium skills to succeed in the host: virulence and regulation. clinical microbiology reviews. 2013;26(2):308-41. 6. coburn b, grassl ga, finlay b. salmonella, the host and disease: a brief review. immunology and cell biology. 2007;85(2):1128. 7. gupta a, fontana j, crowe c, bolstorff b, stout a, duyne sv et al. emergence of multidrugresistant salmonella enterica serotype newport infections resistant to expandedspectrum cephalosporins in the united states. the journal of infectious diseases. 2003;188(11):170716. 8. wong vk, baker s, pickard dj, parkhill j, page aj, feasey na et al. phylogeographical analysis of the dominant multidrug-resistant h58 clade of salmonella typhi identifies interand intracontinental transmission events. nature genetics. 2015;47(6):632-9. lmrj volume 2 issue 4 94 | p a g e 9. holt ke, dolecek c, chau tt, duy pt, la ttp, hoang nvm et al. temporal fluctuation of multidrug resistant salmonella typhi haplotypes in the mekong river delta region of vietnam. plos neglected tropical diseases. 2011;5(1):e929. 10. threlfall e, murdoch d, banatvala n, bone a, shoismatulloev b, ward l. epidemic ciprofloxacin-resistant salmonella typhi in tajikistan. the lancet. 1998;351(9099):339. 11. madhulika u, harish b, parija s. current pattern in antimicrobial susceptibility of salmonella typhi isolates in pondicherry. indian journal of medical research. 2004;120(2):111. 12. nagshetty k, channappa st, gaddad sm. antimicrobial susceptibility of salmonella typhi in india. the journal of infection in developing countries. 2009;4(02):070-3. 13. kariuki s, revathi g, kiiru j, mengo dm, mwituria j, muyodi j et al. typhoid in kenya is associated with a dominant multidrug-resistant salmonella enterica serovar typhi haplotype that is also widespread in southeast asia. journal of clinical microbiology. 2010;48(6):2171-6. 14. owais a, sultana s, zaman u, rizvi a, zaidi ak. incidence of typhoid bacteremia in infants and young children in southern coastal pakistan. the pediatric infectious disease journal. 2010;29(11):1035. lmrj volume 3 issue 1 20 | p a g e frequency of causes of spurious platelets count on routine complete blood count by an automated hematology cell analyser shaista kausar1, tooba fateen1, hammad tufail chaudary2 shaukat khanum memorial cancer hospital & research center1, the children hospital and ich lahore2, taif university, kingdom of saudi arabia3 keywords: pseudo-thrombocytopenia, edta, frequency, spurious platelet count. introduction automated hematology analyzers are widely used in clinical practice and research settings to characterize blood cells for disease detection and monitoring of blood cell counts. sophisticated analyzers correspondence: tooba fateen email id: drtoobafateen@gmail.com doi: 10.38106/lmrj. 2021.3. 1-04 received: date: 21-03-2021 accepted: date 24-04-2021 published: date: 30-04-2021 abstract: the present study was aimed to find out causes of platelet count flagging marked on complete blood count strip. this cross-sectional study was conducted at hematology department, children hospital and ich, lahore. a total of 350 blood samples were processed for the study and among them a total of 86 samples of blood in edta vial were studied with specific tag on platelet count on cbc strip. a specific designed performa was used for data collection. all the collected data was entered to spss 22 (statistical package for social sciences) for analysis. out of 86 samples 64 samples (74.4%) showed spurious platelet count due to edta. pseudo thrombocytopenia was observed in 9 samples (10.5%). abnormal cbc 4.7 %, overfilling of sample 4.7%, acute burn anemia with frequency of 3.5%, iron deficiency anemia and clotted samples have 2.3% frequency separately. while 3.5% samples were included in miscellaneous list. we concluded that edta dependent pseudo-thrombocytopenia is the most prevalent. other technical errors (pre-analytical, analytical) can be reduced by proper training and education of laboratory staff. it is very important to rule out the correct cause of spurious platelet count on cbc as otherwise it will lead to unnecessary medication and investigations for patient. research article mailto:drtoobafateen@gmail.com https://doi.org/10.38106/lmrj lmrj volume 3 issue 1 21 | p a g e can measure cell morphology and can also detect small cell populations to diagnose rare blood conditions1. its widespread use plays a major role in improvement of cellular hematology as it gives quick and accurate results2. when platelet count on the cbc strip goes out of range, the automated analyzer have ability to tag them on the strip. this tagging can be of any type according to the software of automated hematology cell analyzer2,3. automated cell analyzer may tag them with a flag, a dot or mark it on histogram etc. all the hematology instruments use software generated flagging to identify abnormal platelet distributions that may indicate presence of platelet specific interference or the presence of platelet clumping. the reporting hematologist must review the blood smear before sending out the complete blood cell count reports when the flag of platelet clumping occurred. hematologist have to observe the platelet in direct blood smear for approximate quantity and shape or detected by hematology analyzer. in both systems, the collected blood is diluted and counted by passing blood through an electric counter4. platelet tagging can be due to some pathological reasons but mostly platelet tags are due to spurious count of platelets which lead to pseudo thrombocytopenia or pseudo thrombocytosis. in these cases, following are the main reasons (5-11) 1. platelet clumping due to edta anticoagulant. 2. adherence of platelet to mature polymorphonuclear neutrophils 3. clotting within the sample. 4. fragmented nucleated cells. 5. lipids (sample taken after meals, lipid drips) 6. micro-organisms pseudo thrombocytopenia and pseudo thrombocytosis are very common in routine complete blood counts, which can have deleterious effects on patients, resulting in getting even platelet transfusion if it is not clearly checked. to analyze the cause of platelet flagging is very vital in dealing with automated hematology analyzer. it is an important aspect of quality assurance related to complete blood count automated analyzer. the objective of this study was to find out the causes of platelet count flagging marked on complete blood count strip. materials and methods it is a cross-sectional study conducted in hematology & transfusion medicine department, the chil dren’s hospital & ich lahore from july 2018 to jan 2019. data was collected with the help of designed proforma. a sample size of 350 blood samples was collected. sample was collected by aseptic technique. 5 cc of blood was drawn in sterile syringe and promptly poured in edta containing anticoagulant vial. this anticoagulated blood was received in hematology lmrj volume 3 issue 1 22 | p a g e department and processed within 2-3 hours. those samples giving flag on platelet counts were further investigated by manual checking of samples and peripheral films to find out causes of platelet flagging. samples were processed first by gently mixing of the vial, and then the blood was brought near the sucking tip of the hematology analyzer celltac mek-6450. the machine processes, counts the cells according to their size and granular morphology. data was presented in tables, graphs or pie diagrams and analyzed by using statistical package for the social sciences (spss) software computer program version 20. results out of total 350 samples that were analyzed, 86 samples showed platelet flags. all the 86 samples were considered for analysis making the response rate 100%. regarding the type of tag on cbc strip and the platelet count the frequency of “*” (flag) type tag is 82 (95.3%) (table 1). the most comment platelet count range was 150-400 × 109/l (table 2, figure 1). the distribution of causes of spurious platelet counts are shown in figure 2. edta was the cause in 74.4% samples. edta was the most common and highest causes of platelet count tag on cbc in range of 150-400x109. when platelet count is <150x 109 then again edta the common cause. when platelet count is >400 x 109 i.e., the upper limit pu, the most common cause of spurious count is multiple transfusions (figure 3). the most common platelet appearance on the slide was platelet clumps (39, 45.3%) followed by platelet satellitism around wbc (9, 10.5%) (table 3). table 1. type of tag on complete blood count strip tag type frequenc y percent * 82 95.3 pu* 2 2.3 ag* 2 2.3 total 86 100.0 *flag; pu=platelet upper limit; ag= aggregates table 2. platelet count of the samples enrolled in the study frequency percent 150-400 × 109 66 76.7 <150 × 109 8 9.3 >400 × 109 12 14.0 total 86 100.0 table 3. platelet appearance on slide and their frequency and percentages lmrj volume 3 issue 1 23 | p a g e platelet appearance frequency percent platelet clumps 39 45.3 platelet satellitism around wbc 9 10.5 platelet neutrophil clumps 7 8.1 coagulation within sample 6 7.0 rbc fragments 5 5.8 platelet aggregates 4 4.7 anistocytosis 4 4.7 normal platelets 4 4.7 small aggregates 3 3.5 miscellaneous 3 3.5 large platelets 2 2.3 total 86 100 figure 1. comparing platelet count and type of tag figure 2. distribution of causes of spurious platelet lmrj volume 3 issue 1 24 | p a g e figure 3. comparing platelet counts and causes of platelet flags discussion: automated hematology analyzers have great contribution in hematology department as they can cope up with high workload. however pseudo-thrombocytopenia remains a challenge in hematology laboratory. the pre-analytical problem that platelets tend to easily aggregate in vitro, giving rise to lower platelet counts, has been known since edta and automated platelet counting procedures were introduced in the hematology laboratory. the present study was aimed to know the frequency of causes of spurious platelet counts on cbc by automated hematology cell analyzer. out of 86 samples 82 (96%) were tag by “*” 2 (2%) with “pu*” and the remaining 2 (2%) with “ag*”. samples were divided into three categories on the basis of platelet count range. firstly 150-400* 109 i.e., normal range, secondly platelet count<150 * 109 (below lower limit) and thirdly platelet count >400 * 109 (above upper limit). eighty-six samples were considered in the current study. different causes of spurious platelet counts and these causes were based upon the platelet appearance on smear slide as mentioned in table 3, the most common cause with highest percentage was edta. out of 86 samples 64 samples (74.4%) were giving spurious platelet count due to edta. edta is the highest frequency cause of spurious platelet counts on cbc. as regard with the previous studies edta dependent pseudo thrombocytopenia is a common laboratory phenomenon with most prevalence rate (25%) according to a study conducted by peter keller in 2014. in some situations, platelet satellitism around wbc was also the cause of pseudo thrombocytopenia. in the current study this cause was observed in 9 samples (10.5%). this observation was the same as presented by dr. nicola bizzaroet al., (1991) which showed platelet satellitisms to polymorphonuclears. seven samples gave pseudo thrombocytopenia due to platelet neutrophils clumps (8%). other causes are minor but also of great importance. as causes for spurious counts vary from sample to sample. abnormal cbc 4.7%, overfilling of sample 4.7%, acute burn anemia with frequency of 3.5%, iron deficiency anemia and clotted samples have 2.3% frequency separately. so, with all this frequency distribution of causes, it is clear that the mostly spurious counts lmrj volume 3 issue 1 25 | p a g e of platelets is because edta anti-coagulant.spurious platelet counts may be induced in other situations as well and for one mechanism it can be different, ranges between the true and spurious counts, from the patient to patient. it is also pertinent to note that the tags in the results are generated because of other unusual findings in other parameters of the cbc as well. peter keller et.al in 2014 presented a research report named as “a case of edta-dependent pseudothrombocytopenia: simple recognition of an underdiagnosed and misleading phenomenon” in which they stated that edta-dependent pseudo-thrombocytopenia (edta-ptcp) may be a usual laboratory finding which can range from 0.1-2% in case of hospitalized subjects. this is commonly unnoticed because the blood smear films are not usually assessed neither the histograms in the analyzers are correctly interpreted by the lab staff. jianhua lin et.al in 2014 also found that the incidence of edta – ptcp was 0.09% in the duration ranges from 02 weeks to 6 months and found that it was time dependent which can be occurred as early as 10 minutes after sample collection. dr. nicola bizzaro et.al in april 1991 conducted a study on “platelet satellitisms to polymorphonuclears, cytochemical, immunological and ultrastructural characterization of eight cases” and concluded that satellitisms of platelets to polymorphonuclears was observed in 08 of the study subjects. they reported that this occurred only in the blood anticoagulated at room temperature with edta. however function of the platelets and the neutrophils remained normal both in vivo and in vitro. a report was presented in (2015) named as “edta dependent pseudo thrombocytopenia’’ in this report it is stated that since 1973, edta dependent ptcp is approximately 0.1-2%in hospitalized patients. the primary antibodies involved in this mechanism are immunoglobulins igg, igm, iga and combinations of them are also observed. in a study by the van der meer and colleagues the incidence pseudo thrombocytosis was found in 43 patients out of 169 patients with acute leukemia and among them 07 were categorized as patients with major bleeding risk because of actually low platelet counts. due to time and resource limitation, the study do not elaborate the procedures to reduce these spurious results. as this study is conducted on limited sample size. it should be conducted on vast level and solutions to minimize these spurious results should also be studied deeply for the betterment and reliability of cbc results by automated hematology analyzer. conclusion the present study concluded that edta dependent pseudo thrombocytopenia is the most prevalent. other technical errors (pre-analytical, analytical) can be reduced by proper training and education of laboratory staff. it is important to rule out the correct cause of spurious platelet count on cbc. otherwise, it will lead to unnecessary medication and procedures for patient’s treatment. acknowledgement: none conflict of interests: none funding : none lmrj volume 3 issue 1 26 | p a g e references: 1. tanaka y, tanaka y, gondo k, maruki y, kondo t, asai s, matsushita h and miyachi h. performance evaluation of platelet counting by novel fluorescent dye staining in the xn-series automated hematology analyzers. j clin lab anal, 2014;28:341. 2. baccini v, geneviève f, jacqmin h, chatelain b, girard s, wuilleme s et al. platelet counting: ugly traps and good advice: proposals from the french-speaking cellular hematology group (gfhc) j clin med, 2020;9:808. 3. wada a, takagi y, kono m and morikawa t. accuracy of a new platelet count system (plt-f) depends on the staining property of its reagents. plos one, 2015;10(10):e0141311. 4. ault ka, mitchell j, knowles c & van hove l. implementation of the immunological platelet count on a hematology analyser: the abbott cell-dyn ® 4000. lab hematol, 1997;3:125–128. 5. banfi g, salvagno gl, lippi g. the role of ethylenediamine tetraacetic acid (edta) as in vitro anticoagulant for diagnostic purposes. clin chem lab med, 2007;45(5):565-76. 6. naidoo yl and potgieter jjc. candida albicans in a peripheral blood film. br j haematol, 2008;143:453. 7. bartels pc, schoorl m and lombarts aj. screening for edta-dependent deviations in platelet counts and abnormalities in platelet distribution histograms in pseudothrombocytopenia. scand j clin lab invest. 1997;57:629–636. 8. don m. the coulter principle: foundation of an industry. j assoc lab auto, 2003;8(6):72-81. 9. lehto tm, vaskivuo t, leskinen p and hedberg p. evaluation of the sysmex xt-4000i for the automated body fluid analysis. int j lab hematol, 2014;36:114–123. 10. zandecki m, genevieve f, gerard j and godon a. spurious counts and spurious results on haematology analysers: a review. part i: platelets. int j lab hematol, 2007;29(1):21-41. 11. cohen a.m, lewinski uh, klein b and djaldetti m. satellitism of platelets to monocytes. acta haematologica, 1980;64:61–64. 12. bizzaro n. edta-dependent pseudothrombocytopenia: a clinical and epidemiological study of 112 cases, with 10-year follow-up. am j hematol, 1995;50(2):103-9. 13. cucchiara bl, jackson b, weiner m, messe sr. usefulness of checking platelet count before thrombosis in acute ischemic stroke. stroke, 2007;38:1639-1640. type of the paper (article lmrj volume 3 issue 4 112 | p a g e research article familial traits of attached and unattached earlobe in human population of different age groupsa case study of district nawabshah, pakistan sharmeen najeeb ashraf 1, nehal najeeb ashraf 1, haiqa sami 1, bisma aslam 1, sabin muhammad israr 1, safia ghullam abbas 1, sheeba fateh muhammad 1 1 department of molecular biology and genetics, shaheed benazir bhutto university, shaheed benazirabad pakistan abstract this study aimed to evaluate frequency of attached earlobes (dominant) and unattached earlobes (recessive) traits in humans of different age groups. this study was conducted in the department of molecular biology and genetics of shaheed benazir bhutto university, shaheed benazir abad from september to october 2020. a total of 200 families with attached and unattached earlobes were included by using non-probability convenient sampling. data was collected regarding attached and unattached earlobes of different people. the data was collected and analysed by using spss version 21.0. results of the study suggested that unattached earlobes were dominant feature, and the attached earlobe feature appears to be recessive among all 200 families. we observed that the dominant feature of the unattached earlobe was more common in the 1 to 20 years’ age group, while the recessive feature of the attached earlobe was common in 31 to 45 years old age group. the study concluded that unattached earlobes can be observed in people of every age group and associated with family traits. key words: earlobe; trait; frequency; unattached earlobes; attached earlobes introduction human ear is one of the key organ which lacks hardness and elasticity in nature. some people have attached earlobes, because earlobe lacks any kind of bone (1). although human ear is connected with head and receives enormous blood that makes ears cosy. earlobes do not have any important biological functions in the human body (2). the zoologist deamond morris said in his book "the naked monkey" (1967) that the earlobes plays an additional sexual region for the couples (3). the earlobe is stretched out in length and width with the age (4). according to mendelian law of inheritance attached and unattached/free earlobe trait is due to the “one gene-alleles" function, this function is not acceptable currently, because genetic influences are unpredictable (5, 6, 7). the earlobe is smooth in nature and hard earlobes are wrinkled. wrinkled earlobes is the cause of genetic illnesses in children, such as beck with wiedemann syndrome (8). folded earlobes increase the chances of coronary artery diseases according to the new research. according to the modern research the earlobe become more wrinkled with age, the increase in coronary heart disease risks more than younger age. this clearly shows the link of coronary heart disease and earlobe (8). the wrinkled earlobe is called frank’s sign. mostly unattached/free earlobes are found in the peoples. the kind of unattached/free earlobes is mostly bigger in size and hang below the attachment point to the head. this is due to the influence of dominant alleles. if the gene of correspondence: sharmeen najeeb ashraf department of molecular biology and genetics, shaheed benazir bhutto university, pakistan email: 20bsgen48@student.sbbusba.edu.pk doi: 10.38106/lmrj.2021.3.0406 received: 20.09.2021 accepted: 15. 12.2021 published: 30. 12.2021 mailto:20bsgen48@student.sbbusba.edu.pk mailto:20bsgen48@student.sbbusba.edu.pk lmrj volume 3 issue 4 113 | p a g e dominant alleles expressed the child is born with unattached earlobes and if recessive allele is expressed the child is born with attached earlobes. mostly unattached/free earlobes are found than the attached earlobes. mother and father with unattached/free earlobes may deliver the children with attached earlobes according to the genetic of alleles. this is due the presence of both dominant and recessive allele (9). attached earlobes are not commonly found. the attached earlobes are smaller in size and attached to the attachment point to the head. attached earlobes do not have any hangs, this type of earlobes are formed due to the absence of dominant alleles. recessive alleles are responsible for the attached earlobes. it is not necessary that the parents with attached earlobes give birth to the attached earlobes children or vice versa. appearance of a person depend on the traits in the shared pair of chromosomes. the strongest allele is responsible for the ruling on a trait. according to the scientists dominant alleles present in the parent body. if the dominant allele does not show its presence then recessive allele shows its presence. those expressed characteristics is called recessive characteristics (9). there is limited literature available to comment on the pattern of earlobes in pakistani population. thus this study was designed to explore the pattern in local families. methodology this research was conducted at the department of molecular biology and genetics, shaheed benazir bhutto university, shaheed benazir abad from september 2020 to october 2020. the attachment and non-attachment of the ear lobe of 200 families were assessed. the families were included by using non-probability convenient sampling technique. including data for people between the ages of 1 to 20, 21 to 30, and 31 to 45. among 200 families, 107 families had both types of people (with and without attachment of earlobes). the pattern of earlobes was assessed by inspection and recorded on a pre-designed proforma. data was collected by using spss version 21.0 and presented as frequency distribution. results a total of 200 families were observed, with 940 members from which 576 members had unattached/free earlobes and 364 members has attached earlobes. out of these 64% of males and 57% of females had unattached earlobes. 116 fathers had unattached earlobes and 64 fathers have attached earlobes, while 118 mothers had unattached earlobes, and 80 mothers had attached earlobes (figure 1). among children 98 sons had attached earlobes and 180 sons with unattached earlobes. among girls 122 had attached earlobes, and 162 daughters were observed to have unattached earlobes(figure 2). familial trait was observed but there was no association with the age was seen. figure 1. father and mother attached and unattached ear lobe figure 2. daughters and sons attached and unattached ear lobe lmrj volume 3 issue 4 114 | p a g e discussion our study suggested familial and gender pattern of the earlobe traits. other forms of earlobes were also discovered in both genders, along with conjoined and enjoined unfastened earlobes (10, 11, 12). regarding the form of the ear, there may be a bilateral asymmetry. the length and form of the tragus additionally range relying at the left and proper facets and gender. the earlobes display exclusive traits in individuals. in nearly 1/2 of the cases, each males and females discovered the earlobe connected to the face; in lots of cases, it's far free, and a few are partly closed (13, 14, 15). therefore, the dimensions and form of the earlobe additionally adjustments with the perimeters and gender. the form of the helix varies from individual to individual, displaying positive traits inclusive of concave, coiled, flat and huge scuba covering (16, 17, 18). darwin's nodules display numerous systems and proper aspects of each gender. the huge variability of the human ear may be attributed to the precise shape and traits of the ear (19, 20, 21, 22). previous studies has additionally proven that the variety of person outside ears is enough to permit individualization in forensic examinations and can assist solve the difficulty of whether or not a selected suspect may be diagnosed as a criminal. all those variable functions and personalization/unique functions of the ear additionally assist to customise the individual with inside the cctv photograph of the crime scene (21, 22). there are a few studies available on the morphological traits of ears in the literature. these research have progressed the anthropological and forensic expertise of ears and their variability in unique populations. conclusion it has been concluded that shape of the earlobes and its attachment with the head is a familial trait without any association with the age. clinical correlation and further genetic testing for its association with the transfer of genetic diseases are required to be studied. ethical consideration: the data was collected anonymized after informed consent. no identity was noted or disclosed in the database at any time. conflict of interest: there is no conflict of interest. funding: no funding source declared references 1. steinberg, avraham (2003). encyclopedia of jewish medical ethics: a compilation of jewish medical law on all topics of medical interest. jerusalem: feldheim publishers. p. 350. isbn 1583305920. 2. popelka (31 august 1999). "re:why do we have earlobes, what are they for, since when?". madsci network. retrieved 16 july2015. 3. desmond morris the naked ape (1967): a zoologist's study of the human animal (hardback: isbn 0-07-043174-4; reprint: isbn 0-385-33430-3) jonathan cape, . chapter 2, page 59 of corgi paperback ed 4. azaria r, adler n, silfen r, regev d, hauben dj (june 2003). "morphometry of the adult human earlobe: a study of 547 subjects and clinical application". plast. reconstr. surg. 111 (7): 2398–2402, discussion 2403–2404. https://books.google.com/books?id=aaklgzaid08c&pg=pa350&lpg=pa350&dq=false https://books.google.com/books?id=aaklgzaid08c&pg=pa350&lpg=pa350&dq=false https://en.m.wikipedia.org/wiki/isbn_(identifier) https://en.m.wikipedia.org/wiki/special:booksources/1583305920 http://www.madsci.org/posts/archives/aug99/934627537.ev.r.html https://en.m.wikipedia.org/wiki/isbn_(identifier) https://en.m.wikipedia.org/wiki/special:booksources/0-07-043174-4 https://en.m.wikipedia.org/wiki/isbn_(identifier) https://en.m.wikipedia.org/wiki/special:booksources/0-385-33430-3 lmrj volume 3 issue 4 115 | p a g e 5. mader s. s. (2000): human biology. mcgraw–hill, new york, isbn 0-07-290584-0. 6. boaz n. t. (1999). essentials of biological anthropology. prentice hall, new jersey,isbn 0-13080793-1. 7. dutta, p; ganguly, p (1965). "further observations on ear lobe attachment". acta genet stat med. 15: 77–86. 8. earlobe creases https://en.m.wikipedia.org/wiki/medlineplus 9. afsaneh khetrapal, bsc reviewed by benedette cuffari, m.sc. 10. adhikari k, reales g, smith aj, konka e, palmen j, quinto-sanchez m et al (2015). a genomewide association study identifies multiple loci for variation in human ear morphology. nat commun 6:7500. 11. ahmed aa, omer n (2015). estimation of sex from the anthropometric ear measurements of a sudanese population. leg med (tokyo) 17(5):313–319 12. alexander ks, stott dj, sivakumar b, kang n (2011). a morphometric study of the human ear. j plast reconstr aesthet surg 64(1):41–47 13. bertillon a (1893). identification anthropométrique, instructions signalétiques. imprimerie administrative, melun 14. bhowmik dc (1971). ear lobe attachment in uttar pradesh. man india 51:157–161 15. cameriere r, deangelis d, ferrante l (2011). ear identification: a pilot study. j forensic sci 56(4):1010–1014 16. chattopadhyay pk, bhatia s (2009). morphological examination of ear: a study of an indian population. leg med (tokyo) 11(suppl 1):s190–s193. 17. dinkar ad, sambyal ss (2012). person identification in ethnic indian goans using ear biometrics and neural networks. forensic sci int 223(1-3):373.e1–373.13 18. emersic z, struc v, peer p (2017). ear recognition: more than a survey. neurocomputing 255(13):26–39. 19. farkas lg (1978). anthropometry of normal and anomalous ears. clin plast surg 5:401–412 20. gable ne (1958). a racial study of the fijians. in: anthropological records. university of california press, berkeley and los angeles 21. gibelli d, mapelli a, obertovà z, poppa p, gabriel p, ratnayake m, tutkuviene j, sforza c, ritztimme s, cattaneo c (2012). age changes of facial measurements in european young adult males: implications for the identification of the living. homo 63(6):451–458 22. gurbuz h, karaman f, mesut r (2005). the variations of auricular tubercle in turkish people. institute of experimental morphology and anthropology. acta morphol anthropol 10:150–15 https://en.m.wikipedia.org/wiki/isbn_(identifier) https://en.m.wikipedia.org/wiki/special:booksources/0-07-290584-0 https://en.m.wikipedia.org/wiki/isbn_(identifier) https://en.m.wikipedia.org/wiki/special:booksources/0-13-080793-1 https://en.m.wikipedia.org/wiki/special:booksources/0-13-080793-1 https://en.m.wikipedia.org/wiki/medlineplus type of the paper (article lmrj volume 3 issue 4 103 | p a g e research article assessment of pattern of refractive errors in infantile esotropiaa single-center cross-sectional study mohammad asif1, naman akhtar1, mehak nazeer1, nabila noor1, kanwal parveen1, izmal urooj1 1 isra school of optometry, al-ibrahim eye hospital, karachi, pakistan abstract this was a cross-sectional study conducted to explore the patterns of refractive errors found in infantile esotropia patients from newborns to the age of 15 years, attending the pediatric clinic of al-ibrahim eye hospital, karachi, sindh, pakistan. data was collected on a pre-designed proforma. a total of 79 patients (total of 158 eyes) including 44 males (55%) and 36 females (45%) were recruited. all these patients had infantile esotropia. the study showed out of 79 patients (158 eyes), 89 eyes had hyperopia, 15 eyes had myopic astigmatism, 44 eyes had hyperopic astigmatism, while 4 eyes had mixed astigmatism, and 6 eyes had myopia. the hypermatropia was found to be the most commonly occurring refractive error in infantile esotropia resulting in inward eye deviation. key words: infantile, esotropia, refractive error introduction any deviation of binocular alignment is called strabismus. squint or the lazy eye is a common term used for strabismus, if remains untreated it can potentially result in consequences including permanent loss of best-corrected visual acuity (ie amblyopia) in otherwise anatomically normal eye (1). strabismus also badly affects the quality of life due to cosmetic disfigurement which in turn result in poor self-confidence and social dissociation (2). this can also badly affect career progression. esotropia is a type of strabismus which presents with an inward turning of one or both eyes (3). congenital esotropia patients tend to have compromised sensory function in a way that the focused object is seen by the fovea of one eye and the nasal retina of the second eye. it is reported that around 40% cases present within six months of age while other 60% by the age of 48 months (4). infantile estropia is most frequently seen comitant esotropia with a reported incidence between 0.2 to 0.6% in the united kingdom, and the united states of america (5,6). globally reported rate of visual impairment in children over the age of 5 years is 153 million due to untreated refractive errors, out of which 8 million are reported to end-up in blindness. according to world health organization approximately 12.8 million children between 5 to 15 years’ age group are reportedly visually impaired mainly due to untreated refractive errors resulting in a worldwide prevalence of 0.96%, where the highest rate has been reported in urban regions in south-east asia and china (7). refractive errors are correctable in a great majority of cases accounting for more than 50% of correctable cases where visual impairment can be successfully avoided. refractive errors in children have a higher chance of remaining undetected, potentially causing behavioral complications and negacorrespondence: muhammad asif isra school of optometry, al-ibrahim eye hospital, karachi, pakistan email: mohammadasif75050@yahoo.com doi: 10.38106/lmrj.2021.3.0404 received: 20.09.2021 accepted: 21. 12.2021 published: 30. 12.2021 mailto:mohammadasif75050@yahoo.com mailto:mohammadasif75050@yahoo.com lmrj volume 3 issue 4 104 | p a g e tively impacting social interaction and poor performance (academic or extra-curricular both activities) at school. there is evidence available suggesting an association of even slight reduction in vision can increased risk of poor performance regardless of age. while in children it has shown inverse relationship with the performance at school/ educational institution causing mental health issues in children (8). nevertheless, up to 75% of all visual impairments reported from urban and high income regions are due to un-corrected or partially corrected refractive errors (8). there is limited literature available suggesting types of refractive errors found in infants and younger children in the pakistani population. thus this study was designed to assess the types of errors found in our population that will help in the early diagnosis of refractive error and also the development of preventive strategies in infantile refractive errors. methodology this descriptive cross-sectional study was conducted at the pediatric ophthalmology department of al-ibrahim eye hospital, isra school of optometry, karachi, pakistan. the patients of infantile esotropia having eye deviation by birth or developed within the first six months of age and presented in the hospital by the age of 15 years were identified and recruited. data was collected between august 2019 and october 2019. patients were identified by using non-probability convenient sampling. initially patients had to register at the pediatric department and their visual acuity was checked and then they were referred to the orthoptic department for case assessment. all patients underwent the assessment of cycloplegic refraction as well as fundoscopy for anterior and posterior segment examination. data was collected and recorded on a pre-designed proforma. data was analyzed by using statistical package for social sciences (version 20.0). all continuous variables were presented as mean and ± standard deviation (sd). all categorical variables were presented as frequency distribution and percentages. results a total of 79 patients were recruited and 158 eyes were examined (ie 79 right eyes and 79 left eyes). there were 43 males and 36 females. the highest number of patients were presented in the age group 0-5 years, age distribution is given in figure 1. the low refractive error was reported in 47.5%, moderate refractive error in 35.0%, and severe refractive error was reported in 16.3%. females patients showed refractive errors in 36 (45%) patients while in males 43 (55%) had errors in refraction. a summary of the distribution of refractive errors according to age is presented in table 1. . figure 1. age distribution of patients presenting with refractive error lmrj volume 3 issue 4 105 | p a g e table 1: comparison between refractive error and age group type of refractive error of total eyes age myopia (%) hyperopia (%) myopic astigmatism (%) hyperopic astigmatism (%) mixed astigmatism (%) total no of eyes (%) 0 to 5 year 4 (2.5%) 58 (36.7%) 11 (6.9%) 20 (12.6%) 2 (1.2%) 95 (60.1%) 6 to 10 year 2 (1.2%) 27 (17.0%) 4 (2.5%) 22 (13.9%) 2 (1.2%) 57 (36.0%) 11 to 15 year 0 (0.0%) 4 (2.5%) 0 (0.0%) 2 (1.2%) 0 (0.0%) 6 (3.7%) total 6 (3.7%) 89 (56.3%) 15 (9.4%) 44 (27.8%) 4 (2.5%) 158 (100.0%) discussion this study shows that out of 79 patients, right eyes were 79 (50%) and left eyes were 79 (50%), the frequency was found higher in the male 43(55%) as compared to females 36(45%) from 79 esotropic (infantile) patients. similar results were previously reported in a study conducted by retina foundation of the southwest, usa, where all recruited patients were followed up for a minimum of 5 years for infantile esotropia (8). in this study frequency was found higher 48(60%) were falling in the age group between newborn to 5 years, 29(36.3%)were in the age group of 5 to 10 years, and 3(3.7%)were in the age group of 10 to 15 years. however, in study on longitudinal refractive changes in infantile esotropia from united states of america (8), 13 (ie 9%) participants had correction of their vision before their first birthday with or without use of spectacle. while those who presented late n=130 (ie 91%) participants had to undergo surgery. the mean age of patients who underwent surgery was 9.9±5.6 months (8). in contrast in our study out of 79 patients (ie 158 eyes), 15 eyes had myopic astigmatism, 44 eyes were found hyperopic astigmatism, while 4 eyes were found to have mixed astigmatism, 89 eyes were found to have hyperopic and 6 eyes were myopic, and none of them had correction within one year. one such study focusing on “longitudinal changes in refractive error of children with infantile esotropia” reported that 55% of low to moderate hypermetropic refractive errors had a spherical equivalent with (<+3.00 ds), while 27% had a spherical equivalent of +3.00 to +4.99 ds, and only 19 (13%) had a spherical equivalent ≥+5 .00 ds, eight (6%) had a myopic of infantile esotropia patients (5). in another study from asian population focusing on comitant horizontal strabismus reported that less to moderate hyperopes refractive errors were found in children (3). there was myopia (i.e., spherical equivalent ⩽ −0.5 d) present in 5%, while 58% of children had moderate hyperopes (with spherical equivalent ⩾2 d). however, in our study there were no difference observed in the type of refractive error, this might be because of difference in sample size. lmrj volume 3 issue 4 106 | p a g e similar studies have been reported from other regions of the world but limited literature has been presented from sindh therefore this study is first of its kind. another important factor observed beyond the scope of the study that people had lack of awareness to get their eye conditions checked or check their children at early age to exclude any visual impairment. conclusion in the study, hypermetropia found to be the most frequently occurring type of refractive error in infantile esotropia causing inward eye deviation. individuals with congenital esotropia fail to demonstrate typical patterns of emmetropisation. therefore, correction of refractive errors should be encouraged in children with esodeviation; so that visual impairment can be timely corrected. ethical consideration: approval of the study was taken from the research ethical committee of isra postgraduate institute of ophthalmology informed consent was taken from all the patients, the codes were used for data collection. names of the patients or any kind of identity was not mentioned in questionnaire or any other form of data. conflict of interest: authors declare no conflict of interest. funding: no funds required for the study. references 1. wong a. new concepts concerning the neural mechanisms of amblyopia and their clinical implications. can j ophthalmol 2012; 47:399–409. 2. kushner b. the efficacy of strabismus surgery in adults: a review for primary care physicians. postgrad med .j 2011;87:269–73. 3. tychsen l. visual cortex mechanisms of strabismus: development and maldevelopment. in: lorenz b, brodsky m, editors. pediatric ophthalmology, neuro-ophthalmology, genetics. springer-verlag; heidelberg: 2010. pp. 41–58. 4. anker s, atkinson j, braddick o, ehrlich d, hartley t, nardini m, et al. identification of infants with significant refractive error and strabismus in a population screening program using noncycloplegicvideorefraction and orthoptic examination. invest ophthalmol vis sci. 2003;44:497–504. 5. williams c, northstone k, harrad ra, sparrow jm, harvey i. amblyopia treatment outcomes after screening before or at age 3 years: follow up from randomised trial. br med j. 2002;324:1549. 6. serge resnikoff a, donatella pascolini a, silvio p mariotti a, gopal p pokhare (n.d.) global magnitude of visual impairment caused by uncorrected refractive errors in 2004', bulletin of the world health organization. 7. wilson fm; practical ophthalmology: a manual for beginning residents, american academy of ophthalmology, 2005. 8. eileen e. birch, sherry fawcett, david r. stager. why does early surgical alignment improve stereoacuity outcomes in infantile esotropia? major articles| volume 4, issue 1, p10-14, february 01, 2000. doi:https://doi.org/10.1016/s1091-8531(00)90005-3 lmrj volume 2 issue 4 82 | p a g e does ice slush placed inside pericardial well during mitral valve replacement cause injury to phrenic nerve? sharjeel abbas1, saira gul1, sumbal memon1 department of cardiothoracic surgery lumhs, hyderabad1 corresponding author: dr sharjeel abbas (mrcsed, fcps) assistant professor/incharge department contact no: 03009379750 and 0310 9379750 email: sharjeel.abbas@lumhs.edu.pk lmrj.2020; 2(4) doi: 10.38106/lmrj.2020.2.4-03 abstract this study was conducted to determine frequency of phrenic nerve injury during mitral valve replacement, with application of ice slush, and compare it with international data. this study was performed at punjab institute of cardiology pakistan from january 2010 to december 2015. a total of 931 patients with only primary rheumatic mitral valve disease were prospectively observed. a pre-designed proforma was used, that recorded phrenic nerve injury. out of 931 patients who underwent mitral valve repair or replacement, 466 (50.1%) were males. time spent on cpb ranged from 40 to 120 min; in 58.1% patients the time remained less than 80 minutes. post-operative chest x-ray remained normal in 97.5% patients whereas it showed atelectasis in 2.3% and elevated left hemidiaphragm in 0.2% of the patients. the total in-hospital mortality was 3.2% during study period. no patient was found to have phrenic nerve injury, unilateral or bilateral, during the study period. topical cooling of heart, during mitral valve replacement, with ice slush per se is not responsible for phrenic nerve injury. key words: cardiopulmonary bypass, mitral valve, phrenic nerve, ice slush introduction phrenic nerve is the principal innervation of the diaphragm. it is formed in the neck, from cervical nerve roots c3, c4 and c5. it runs vertically downwards on the anterior surface of scalenus anterior, behind the prevertebral fascia. it leaves the medial side of the muscle near its lower end and enters the thorax between the main arterial and venous structures lateral to the vagus nerve. the nerve is related to the mediastinal pleura and passes in front of the hilum as it descends across the pericardium. research article mailto:sharjeel.abbas@lumhs.edu.pk lmrj volume 2 issue 4 83 | p a g e this nerve on each side supply ipsilateral sensory fibres to the fibrous pericardium, the parietal serous pericardium and the mediastinal pleura, before terminating in diaphragm.1 during mitral valve repair or replacement procedures, the cardiopulmonary bypass (cpb) with hypothermia is used.2,3 after cross clamping and cardioplegia, the surface of the heart is further cooled down to reduce the local basal metabolic rate (bmr), especially over the left ventricle, in order to reduce myocardial damage.2,3 this makes left phrenic nerve at risk of paresis or paralysis; this may be short term or long term.1,2,3 once phrenic nerve injury occurs it can result into abnormal diaphragmatic movements & transitory diaphragmatic paralysis. this then results into higher rates of prolonged mechanical ventilation, failure of extubation, nosocomial pneumonia, pleural effusions & thoracentesis, prolonged icu stay, increased treatment cost and may be mortality.3,4 thus, this study was conducted to sort out issue of phrenic nerve injury, whether unilateral or bilateral, with application of ice slush, and compare it with international data. methodology this study was performed at department of cardiothoracic surgery, punjab institute of cardiology, lahore, pakistan, from 1st january 2010 to 31st december 2015. a total of 1105 patients with only primary rheumatic mitral valve disease, both stenosis and regurgitation, were prospectively observed, without coming into knowledge of primary surgeons who were either doing repair or replacement. both men and women aged 20-50 years, undergoing elective mitral valve repair or replacement were included in the study. however, patients for emergency mitral valve replacement, calcified mitral valve disease, redo mitral valve surgery, & combined valve surgery, those patients with associated additional cardiac pathologies (coronary artery disease, aortic aneurysm and congenital heart disease, detected preoperatively on echocardiogram and angiography), those patients with chronic obstructive pulmonary disease, chronic cough, diabetes mellitus, obesity (bmi (body mass index, ≥30) and neurological disorders, were excluded from the study. this left us with only 931 patients, suitable for study. all cases were operated at the same institute. patients were preoperatively assessed as per routine. as the left phrenic nerve injury is more common, we performed central venous catheter placement through the internal jugular vein of right side, for all cardiac operations. all operations were performed with sternotomy under cardiopulmonary bypass with double venous cannulation, and after cooling to 2832°c, with cardiac diastolic arrest by antegrade blood cardioplegia with potassium. ice slush was applied all the time during repair or replacement of the mitral valve, either directly into the pericardial well or ice slush wrapped inside gauze and then applied directly over the left anterolateral surface of heart. once the mitral procedure was over, the left atriotomy was closed with deairing. cross clamp was made off from the ascending aorta, cpb was disconnected along with its connections. patient was normothermized (37oc). hemostasis maintained and drains along with pericardial pacing wires placed. after the procedure stainless-steel no.5 wire were used in all cases for sternum closure. following sternal closure pre-sternal fascia, subcutaneous tissue and the skin closure was performed as per standard. lmrj volume 2 issue 4 84 | p a g e a pre-designed proforma was used, that recorded demographic data of patients, type of valvular pathology, type of procedure performed, the size of the valve used, whether pleura was opened, cardiopulmonary bypass time, cross clamp time, degree of hypothermia, total time of hypothermia, total operation time, time on mechanical ventilation, delayed extubation, reintubation, total icu stay, pleural effusion, nosocomial pneumonia, reciprocal or paradoxical diaphragmatic / abdominal movement, total hospital stay, chest x-ray findings (elevation of diagram, pleural effusion, no movement of diaphragm in expiration and inspiration) and ultrasonological detection of diaphragmatic movements, before operation during hospital stay and after 6 weeks of operation, need for chest intubation, echocardiographic findings ( lvesd, lvedd, ef, la diameter ), whether pericardial patch was taken, whether pericardium was closed before sternal closure, time to diagnosis of phrenic nerve injury, and mortality. statistical package for social sciences (spss) for windows version 21 was used for the analysis of data. all qualitative variables, like diaphragmatic paralysis and gender, were presented in the form of frequency tables, percentages, graphs and pie charts. all quantitative variables were presented in the form of mean ± standard deviation and bar charts. frequency of sternal wound dehiscence was compared in both groups by using pearson chi-square test, fischer exact test. a p-value of ≤0.05 was taken as significant. results out of 931 patients who underwent mitral valve repair or replacement, 466 (50.1%) were males. in 243 cases the primary pathology was stenosis, whereas regurgitation was found in 388 cases and mixed valvular disease in 300 patients. the preoperative echocardiography showed that the end systolic dimensions of left ventricle were less than 45 mm in 89 % patients (829) while end diastolic dimensions were between 56-60mm in 67.7% patients (630). the ejection fraction was more than 51% in 77.8% (725). the left atrial diameter was more than 56mm in 47.6% patients (419). mitral valve repair was performed in 10 patients, whereas the major treatment remained the valve replacement (921 patients, 98.9%). valve size of st jude mechanical prosthesis varied between 27-33, where valve size 29 was most used (502 patients) followed by size 27 (326 patients). the time on cpb varied from as little as 40 min to as high as 120 min. but in 58.1% patients the time remained less than 80 minutes. as far as the ascending aortic cross clamp time was concerned 83.1% patients had less than 40 minutes of cross clamp time. pericardial closure was performed in 7.7% patients. pleura remain intact in 27.1% patients. the right pleura was most common to open, either willingly or inadvertently, in 36.8% patients, left pleura opened in 17.6% patients, while both pleura were found opened in 18.5 % patients. total icu stay was 2 days in 85.7% patients while the total hospital stay was 6-7 days in 75.5% patients. 93% patients remained on mechanical ventilation for 1 day or less. post-operative chest x ray remained normal in 97.5% patients, showed atelectasis in 2.3% and elevated left hemidiaphragm in 0.2% patients. the total in-hospital mortality was 3.2% (30 patients) during study period. no patient was found to have phrenic nerve, unilateral or bilateral, injury during the study period. lmrj volume 2 issue 4 85 | p a g e table 1. various study variables in comparison with immediate postoperative x-ray chest findings normal chest x ray atelectasis (n=21) elevated left hemidiaphragm (n=2) age  mean 33.10 37.33 45  minimum  maximum  sd 20 50 7.719 21 49 8.575 45 45 0.000 gender  male 457 8 1  female 451 13 1 valve pathology  stenosis 238 4 1  regurgitation  mixed disease 379 291 8 9 1 0 cpb time  40-60 min 251 5  61-80 min  81-100 min  100-120 min 366 194 97 10 4 2 2 cross clamp time  20-30 min 559 14 1  31-40 min  41-50 min 194 155 4 3 1 hypothermia  28oc 274 4 2  30 oc  32 oc  34 oc 282 312 40 9 7 1 hypothermia time  20-30 min 559 14 1  31-40 min  41-50 min 194 155 4 3 1 pleura intact right pleura opened left pleura opened both pleurae opened 252 343 158 155 0 6 0 15 2 pericardial closure 70 2 0 total icu stay  1 day 519 12 1  2 days  3 days  4 days 259 95 35 6 3 0 1 mechanical ventilation <1 day 1 day 2 days 3 days > 3days 740 103 43 21 1 17 4 2 nosocomial pneumonia 3 0 0 mortality 30 0 0 lmrj volume 2 issue 4 86 | p a g e discussion topical hypothermia over heart into pericardial well is clinically applicable for myocardial preservation during heart operations, because during temporary individual coronary artery occlusion it protects regional myocardium detected as early return of function and decreased necrosis. this is the reason, an ice slush is used as topical cooling agent for conventional heart tissue preservation during open heart surgery.1-4 diaphragmatic dysfunction results from damage to phrenic nerve, a well-recognized complication observed in cardiac surgery. myriad of mechanism for phrenic nerve injury are proposed e.g. decreased body temperature, mechanical trauma and probably decreased blood flow. hypothermia, especially topical cooling with ice slush decreases cell membrane integrity during ischemia.2-5 canbaz et al found 5 cases from a total of 78 patients, who developed left phrenic nerve dysfunction, all in the hypothermic cardiopulmonary bypass groups and were of the opinion that hypothermic cpb and topical ice-slush application may be related to phrenic nerve dysfunction.6 similar results were shown by four studies by efthimiou, & dimopoulou, & mazzoni, & mills gh et al. 7-10 however, canbaz s et al also suggested that as both left and right phrenic nerves have been equally exposed to cpb and systemic hypothermia, hypothermic cardiopulmonary bypass is not itself the cause of the damage.6 they explained phrenic nerve injury caused by topical cardiac cooling. sarnowski w et al gave their impression that ice/saline slush used addition to cold cardioplegia for heart arrest during cardiac surgery can cause hypothermic injury of phrenic nerve. paralysis, partial or complete, of phrenic nerve results in raised ipsilateral diaphragm and delayed recovery of the patients.2 alassar a et al in their randomized study of patients undergoing elective cardiac surgery found significant phrenic nerve injury (p = 0.009) and failure of extubation (p = 0.034) with the use of with iced slush.11 efthimiou j7 found twenty (36%) patients developed unilateral diaphragm paralysis when topical hypothermia was used in open heart surgeries. similarly, cassese et al found that phrenic nerve injury and failure of extubation occurred more frequently with the use of iced slush (p = 0.009 and p = 0.034, respectively).12 additionally, maccherini et al in their study titled “warm heart surgery eliminates diaphragmatic paralysis”, found that topical hypothermia causes transitory diaphragmatic paralysis, pleural effusions, and thoracentesis.13 the opponents of topical cooling with iceslush suggested that such maneuver does not provide additional cardioprotective effects, and is an unnecessary adjunct to myocardial protection in patients undergoing cardiac surgery.2,14,15 fortunately, we have found no phrenic nerve injury during the study period. this study does not compass the whole cardiac surgical procedures and was performed only on those patients who underwent mitral valve surgical procedure, whether repair or replacement. in this group of patients iced slush was used whether covered in gauge and then applied over the anterolateral surface of heart or applied directly. the slush that turned water was immediately suctioned back. secondly, due to shorter cross clamp time, the ice slush remains for a short time in pericardial well. it is also our routine practice to lift the left and right leaves of pericardiotomy and hitch them with the skin or with the self-retaining sternal spreader. lmrj volume 2 issue 4 87 | p a g e this does not allow the spilling over of the ice or water slush into the pleural space, once found open, thus reducing direct contact of hypothermic solution with ipsilateral phrenic nerve. it is also our routine practice just to drift a little hypothermia (mostly to 32-34oc. all these factors may have contributed to no phrenic nerve injury noted in any of the cases in the study group during specified period. the main limitation of this study was the inability to conduct electrophysiological studies to detect phrenic nerve injury perioperatively. conclusion once ice slush stays in pericardial well, for a shorter period of time, in cases of mitral valve surgeries, this remarkably reduces the chances of phrenic nerve injury. thus topical cooling of heart with ice slush per see is not responsible for phrenic nerve injury. conflict of interest: no conflict of interest to be declared regarding publication of this paper. funding source: none references: 1. moore kl, dalley af. clinically oriented anatomy, 6th ed. baltimore: lippincott williams & wilkins, 2010. 2. sarnowski w, kulesza j, ponizynski a, dyszkiewicz w: elevation of the diaphragma after cardiac surgery. polski merkuriusz lekarski 2001; 10(55):24-6. 3. cruz-martinez a, armijo a, fermoso a, moraleda s, mate i, marin m: phrenic nerve conduction study in demyelinating neuropathies and open heart surgery. clinical neurophysiology 2000; 111(5):82-5. 4. hoch b, zschocke a, barth h, leonhardt a: bilateral diaphragmatic paralysis after cardiac surgery: ventilator assistance by nasal mask continuous positive airway pressure. pediatric cardiology 2001; 22(1):77-9. 5. aguirre vj, sinha p, zimmet a, lee ga, kwa l, rosenfeldt f. phrenic nerve injury during cardiac surgery: mechanisms, management and prevention. heart lung and circulation 2013; 22(11):895-902. 6. canbaz s1, turgut n, et al. electrophysiological evaluation of phrenic nerve injury during cardiac surgery--a prospective, controlled, clinical study. bmc surgery 2004; 14;4:2. 7. efthimiou j, butler j, woodham c, westaby s, benson m. phrenic nerve and diaphragm function following open heart surgery: a prospective study with and without topical hypothermia. qjm 1992; 85:845-53. lmrj volume 2 issue 4 88 | p a g e 8. dimopoulou i, daganou m, dafni u, et al. phrenic nerve dysfunction after cardiac operations: electrophysiologic evaluation of risk factors. chest. 1998; 113(1):8-14. 9. mazzoni m, solinas c, sisillo e, bortone f, susini g: intraoperative phrenic nerve monitoring in cardiac surgery. chest 1996; 109(6):1455-60. 10. mills gh, khan zp, moxham j, desai j, forsyth a, ponte j: effects of temperature on phrenic nerve and diaphragmatic function during cardiac surgery. british journal of anaesthesia 1997; 79(6):72632. 11. alassar a, bazerbashi s, moawad n, marchbank a. what is the value of topical cooling as an adjunct to myocardial protection?. interactive cardiovascular and thoracic surgery 2014; 19(5):856-60. 12. cassese m, martinelli g, nasso g, a nselmi a, de filippo cm, braccio m, et al. topical cooling for myocardial protection: the results of a prospective randomized study of the ‘shallow technique’. journal of cardiac surgery 2006; 21:357-62. 13. maccherini m, davoli g, sani g, ro ssi p, giani s, lisi g, et al. warm heart surgery eliminates diaphragmatic paralysis. cardiothoracic surgery 1995; 10:257-61. 14. allen b, buckberg g, rosenkranz e, plested w, skow j, mazzei e, et al. topical cardiac hypothermia in patients with coronary disease: an unnecessary adjunct to cardioplegic protection and cause of pulmonary morbidity. journal of thoracic and cardiovascular surgery 1992; 104:626-31. 15. braathen b, vengen oa, tønnessen t. myocardial cooling with iceslush provides no cardioprotective effects in aortic valve replacement. scandinavian cardiovascular journal. 2006 dec;40(6):368-73. type of the paper (article lmrj volume 3 issue 3 65 | p a g e research article prevalence of musculoskeletal impairment in traffic police of district swabi, pakistan zahoor ahmad1 & 2, kinza anwar3, umaira naz1, khizra tariq4, mah noor1, junaid anwar1 1ncs university & consultant physiotherapist in health & wellness physiotherapy rehabilitation center ,swabi campus, pakistan, 2health and wellness physiotherapy rehabilitation center: swabi, kpk, pakistan, 3riphah international university, islamabad, 4university of lahore, islamabad campus, pakistan abstract the number of vehicles has been increasing out of proportion for the capacity of road infrastructure in particular in developing countries. the duty of a traffic police officer includes the implementation of daily traffic regulations. this involves long-standing hours and also particular repeated body movements. there is limited literature available on the musculoskeletal disorders develop among traffic police. therefore this study was designed to include 219 traffic police officers from 23 traffic booths of district swabi, pakistan. data was collected using a structured questionnaire and cornell musculoskeletal discomfort questionnaires (cmdq). informed consent was taken before filling the questionnaire. age distribution of the participants was grouped as: 20 to 30 years (n=51, 23.4%), 31 to 40 years (n=141, 64.7 %), and over 40 years (n=26, 11.9%). out of 219, 23% were diabetics, hypertensive participants were 21.9% (n=48), while 54% (n=120) had no history of chronic illness. the majority of traffic cops in district swabi reported mild discomfort in their shoulders, arms, forearms, thighs, lower legs, knees, and feet, but moderate discomfort in their neck and back. the results of the study indicate that the traffic cops in the district of swabi suffer back and neck pain, causing them to have moderate difficulty doing their duties. key words: traffic police, cmdq, musculoskeletal impairments, wrmsds introduction musculoskeletal dysfunction has been identified as an occupational health issue among working population resulting in reduced working capacity and productivity. given the pattern and hours of duty, traffic police officers (tpp) are the most vulnerable category, as they are required to manage busy streets for extended periods in difficult conditions(1-2). traffic cops are required to stand for the whole of their shifts, putting them at risk for significant musculoskeletal ailments. additionally, being in a static posture exposes them to ergonomic risks. because of the rising number of automobiles, many cities have experienced traffic congestion, making tpp's job even more difficult and complex. traffic cops face occupational hazards related to their duties and obligations while managing a complicated traffic system(3). they are also exposed to physical variables such as noise, vibration, and radiation, which pose an additional health risk. while working on a busy and congested road, noise-induced hearing loss is a major health problem among tpp. they are susceptible to heat sensitivity and light-related illnesses as a result of their exposure to heat and light. carbon oxyhydroxide, sulfur oxyhydroxide, nitrogen oxyhydroxide, lead oxyhydroxide, and benzene oxyhydroxide oxyhydroxide oxyhydroxide oxyhydroxide oxyhydroxide oxyhydroxide oxyhydroxide tpp are also subjected to psychological stress as a result of the hurried nature of their employment, lengthy duty hours, traffic congestion, and monotonous nature of their labor. taking these factors into account, tpps are at higher risk correspondence: zahoor ahmed assistant professor, ncs university & consultant physiotherapist in health & wellness physiotherapy rehabilitation center, peshawar email: zahoor_riphah@hotmail.com doi: 10.38106/lmrj.2021.3.3-04 received: 29.06.2021 accepted: 22. 09..2021 published: 30. 09.2021 lmrj volume 3 issue 3 66 | p a g e of developing cardiovascular problems as well(4-7). a whole spectrum of inflammatory and degenerative cascades start causing pain and functional impairment particularly involving the neck, shoulders, elbows, wrists, and hands, according to the definition of work-related musculoskeletal disorder (wrmsd)(8). the prevalence of wrmsd has been reported to be high among tpp and is linked to work hours, years worked, awkward and static postures, repetitive movements, uncomfortable postures, vibration, manual handling, and other factors. this puts a strain on the joints and causes various musculoskeletal disorders, which is the leading cause of workplace absenteeism(9). wrmss is characterized by aching, pain, or discomfort in the neck, shoulder, elbow, wrist, upper back, lower back, hips/thigh, knee, and ankle/feet(10-11). low back pain (lbp) is the most common health problem among wrmss all over the world (12). according to the world health organization (who) report from 2013, lbp was the leading cause of time off work and visits to the doctor. around 70% to 80% of the world's population will have at least one episode of lbp during their lifetime(13). low back discomfort is the most common ailment among workers due to a lack of information about good posture. it's also a primary cause of sick leave, productivity loss, and long-term occupational disability(14). given the ever growing traffic congestion in pakistan, tpps are also at higher risk of musculoskeletal disorders. however there is limited literature available. thus this study was conducted to look at the pattern of musculoskeletal disorders reported by tpps in the district swabi. methodology after receiving ethical approval, this cross-sectional study was conducted. data was acquired from a total of 219 traffic police of district swabi, kpk, using a non-probability convenient sampling. the sample size was computed using a 95% confidence level. work-related musculoskeletal pain, male, road traffic police, 20 to 60 years old were the inclusion criteria. infection, tumor, trauma, recent fracture, and female were all ruled out. a questionnaire including past medical history chart and cornell musculoskeletal discomfort questionnaires (cmdq) were used to collect data after getting informed consent. participants completed the questionnaire whether or not they were in pain. the pain was separated into the following body areas: shoulder, arm, forearm, wrist, neck, lower back, leg, knees, and foot. statistical package for social sciences (version 23,0) was used for data analysis. results a total of 219 males were included in the study. ages of 20 to 30 years were represented by 51 (23.4%), 31 to 40 years by 141 (64.7 %), and over 40 years by only 26. (11.9) (figure 1). the majority of the participants were between the ages of 31 and 40 years. past medical history mainly focused on three categories including diabetics, hypertension, and none of these chronic medical conditions (figure 2). diabetic participants made up 23% (n=51), hypertensive participants made up 21.9 percent (n=48), and those with no prior history of disease made up 54.8 percent (n=120). mild discomfort was reported by 28 (12.8%), moderate discomfort by 118 (54.1%), and severe discomfort was reported by 72 (33%). table 1 presents summary of the pain distribution among participants. table 1. summary of pain distribution reported by traffic police officers n mean standard deviation neck 219 2.2018 2.2018 right shoulder 219 1.2156 1.2156 left shoulder 219 1.2523 1.2523 upper back 219 1.4587 1.4587 right upper arm 219 1.0000 1.0000 lmrj volume 3 issue 3 67 | p a g e left upper arm 219 1.0000 1.0000 lower back 219 2.0917 2.0917 right forearm 219 1.2569 1.2569 left forearm 219 1.1284 1.1284 right wrist 219 1.0000 1.0000 left wrist 219 1.0000 1.0000 hip/ buttocks 219 1.0000 1.0000 right thigh 219 1.0000 1.0000 left thigh 219 1.0000 1.0000 right knee 219 1.1147 1.1147 left knee 219 1.0872 1.0872 right lower leg 219 1.0367 1.0367 left lower leg 219 1.0000 1.0000 right foot 219 1.2248 1.2248 left foot 219 1.1468 1.1468 figure 1. age group distribution of the participants figure 2. distribution of the chronic health issues reported by traffic police officers discussion musculoskeletal disorders are a frequent health concern that affects people from all walks of life(15). these illnesses have resulted in enormous human misery, as well as diminished working ability and production(16). research conducted in 1995 a.d. in one of china's main cities estimated that 1.2 million men and women were suffering from work-related musculoskeletal complaints. lower back, neck, shoulder, and upper back were the most commonly affected areas, with prevalence rates of 28.0 percent, 24.0 percent, 18.6 percent, and 15.5 percent, respectively. about half of workers with msd reported pain or discomfort in less lmrj volume 3 issue 3 68 | p a g e than a month.(17) physical stress was identified by burton et al. in 1996 as one of the occupational risk factors for poor lbp among police officers controlling traffic, which often resulted in higher sickness and absenteeism(18). as a result, stress can cause a variety of physical symptoms, such as muscle strain and back pain. in 2014 a study was conducted including 353 participants, the rate of pain was 44.2% in the shoulder, 41.4 percent in the waist, 31.2 percent in the neck, 26.1 percent in the legs/foot, 16.7 percent in the hands/wrist/fingers, and 14.7 percent in the arms/elbows, indicating that the global burden of pain was 44.2 percent in the shoulder, 41.4 percent in the waist, 31.2 percent in the neck, 26.1 percent in the legs/foot furthermore, the shoulder had a 4.87 times higher risk in police lieutenants compared to those under the rank of corporal, and a 1.78 times higher risk in people with chronic diseases compared to those without chronic diseases, according to the comparative risk of the relevant part that was analyzed(19). in a recent study, 384 traffic cops in pakistan were interviewed. 69 percent felt discomfort in their upper extremities, while 54 percent had pain in their lower extremities felt pain radiating to other parts of the body. in this study, the participants' pain was caused by their long working hours(20). the results of this study show that the prevalence of wmsds varies significantly between participants with varying years of job experience. participants with >30 years of job experience had the highest prevalence of neck, back and foot pain discomfort followed by those with 20–30 years of work experience. this finding suggests that having more years of work experience is linked to a higher prevalence of wmsds, which is consistent with findings from a previous study(21), which found that having more years of work experience was a predisposing factor to the development of wmsds. furthermore, service length is linked to musculoskeletal problems(22). according to official swedish statistics, msk disorder accounts for roughly 74 percent of occupational diseases (23). the most painful areas in this study were the neck and back. according to one study, msk pain is very common among ibadan drivers, and the most common msk pain region is the low back,(24) which is similar to a study in mumbai, india.(25) the current study suggests that the district swabi, kpk traffic police are affected moderate discomfort of pain in neck and back but they are just mild discomfort of the shoulder, arm, forearm, thigh, knee, lower leg, and foot. which concluded that the traffic police of district swabi are feeling discomfort because of neck and back pain. conclusion the majority of traffic cops in district swabi reported mild discomfort in their shoulders, arms, forearms, thighs, lower legs, knees, and feet, but moderate discomfort in their necks and backs, according to the survey. this indicates that the traffic cops in the district of swabi are suffering from back and neck pain, causing them to have moderate difficulty doing their duties.. ethical consideration: this study was approved by research ethics committee conflict of interest: there is no conflict of interest. funding: this study was not funded by any agency references 1. satapathy dm bt, tripathy rm. health, brahmapur sotcppi, medicine. cijoc, 2009;34(1):71-2. 2. environment satiuow, and owpacoso, gas industry in lagos najo, 2010;4(3):299-307. bm. 3. health iosa, hazard ico, cer. d-pleo, and sios, 2000. hic. 4. wongsurakiat p mk, nana a, naruman, c am, chalermsanyakorn t. respiratory, policemen sapfotc, 1999;82(5):435-43. itjmat. 5. tamura k jw, yano e, karita k, boudoung, respiratory dpapac, arch satcpib, 2003;58(4):201-7. eh. 6. tripathi sr trs-rhq, study. otcpaq-b, environmental ijooa, 2006;10(2):82-4. m. lmrj volume 3 issue 3 69 | p a g e 7. karita k ye, jinsart w, boudoung d, tamura, function krsap, among traffi c police in bangkok ta, 2001;56(5):467-70. eh. 8. health vsw-rm, technology dati, j piiapsi, 2013;2(2). mrbs. 9. carayon p sm, haims mc. work organization,, job stress aw-rm, and dtjothf, 1999;41(4):644-63. es. 10. deb s ct, chatterjee p, srivastava n., job-related stress cfac, app sotccjia, 2008;34(1):19-28. p. 11. kuorinka i jb, kilbom a, vinterberg h, bieringsorensen f, andersson g ,et al. standardised nordic, musculoskeletal qftao, 1987;18(3):233-37. sae. 12. choobineh a ts, tozihian m, ghadami, an fmpawo, occup iccij, 11(1):32-6. em. 13. charoenchai l ca, chaiyakul p. the, scale rbhbap, southeast ipwlbpit, 2006;37(5):1040. ajtmph. 14. for ejeoo, physiotherapists. new delhi ijbs, 2003. mppl. 15. hafzi mim rs, noor faradila p, wong sv., musculoskeletal parfo, on domapcs, 2011:5-6. aieas. 16. work-related netso, lulea mdawibmfisas, 2003. uot. 17. umi kms kk, shamsul bmt, irniza r, ayuni, disorders nitrm, in amvwara, 2014;8(15):219-24. eb. 18. burton ak tk, symonds tl, burke c,, the mstorff, back fr-oascol, spine. tasospoc, 1996;21(22):2612– 20. 19. cho ts jw, lee jg, seok jm, cho jh. factors, korean aetmso, 2014;26(6):925-30. pocjpts. 20. ahmad g tf, ahmad a, gillani sa., c pouepat, police l, pakistan. rawal medical journal., 2018;43(1):64-7. 21. smith dr lpmdinanj-. 22. 2004;54:506-512 thmsatawom. 23. bao s wj, shahnavaz h. prevalence of, people's mdawit, safety rocijo, 2000;6:557-74 e. 24. akinpelu a oo, odole a, olukoya r., seeking pompah, behaviour among occupational drivers in ibadan, 2011;14:89-94. najbr. 25. phadke ssd rr, iqbal r. work related, musculoskeletal symptoms among traffic police: cross sectional survey using nordic musculoskeletal questionnaire. lmrj volume 3 issue 2 37 | p a g e high flow oxygen therapy machine using high flow nasal cannulation-a hope for covid-19 patients in acute respiratory failure sikandar munir memon1, adeel mehadi2, sehreen moorat2, ali raza khoso2, maria talpur2, bakhtawar hashim2, falak abro2 1 medical research centre, liaquat university of medical & health sciences, jamshoro, sindh, pakistan. 2 biomedical engineering liaquat university of medical & health sciences, jamshoro sindh,pakistan abstract objective: to provide humidified, heated and precise oxygen with high efficiency of functional residual to acute respiratory distress syndrome patients caused by covid-19. methodology: it was an observational research that took place at the lumhs hospital. in this study, 200 patients with severe respiratory distress, either caused by covid-19 or other respiratory disorders, were enrolled. lumhs hospital icu ward was used as a data source. this study showed that subjects in their late 30s, both male and female. patients with acute or chronic respiratory failure were included, but those with other pulmonary disorders were excluded. results: a total of 200 patients were selected for this study. out of them 122 (61%) were males and 78 (39%) were females with the standard deviation of 2.33. regarding age. 24%. were below 30s. 20% patients were in 30s.and 57% belonged to above 30s. while the efficiency of hfnc was 65%. in 65% cases it was proved to be lifesaving and in 39% cases patients were sent for intubation. oxygen delivery method using cannula was 65% in delivering spo2 equal to or greater than 10 lpm while face mask method was only 35% successful, which determines that higher concentration cannulation is a more efficient method than facemask. conclusion: hfnc is a recent innovation that reduces the need for intubation and oxygen loss while also providing high-flow oxygen with optimum humidification and temperature to patients with respiratory failure key words: covid-19, respiratory distress, syndrome, positive pressure respiration, cannula, chronic obstructive, respiration introduction various oxygen therapies are supposed to provide oxygen for oxygenation and breathing to respiratory failure patients, hfnc is an emerging and widely recommended oxygen therapy in developing countries these days. a modern technique that provides sufficient oxygen, adequate humidified and heated air with reduced complications and difficulties, since it is easy to run and high oxygen flow machines.1 clinically, this novel technique has gained considerable interest. for covid-19 patients, most of the countries continued with this therapy because it provides highly saturated oxygen and successful quality makes this therapy exceptional and enhances its specialty. hfnc is a recent development in oxygen therapy. it supplies oxygen above 30l/mint with sufficient heating and humidification. for oxygen therapy, niv and other oxygen therapies were previously incorporated while niv and cop pairing proved to be very convenient for ventilation and niv was also preferred for prolonged treatment of chronic obstructive pulmonary disease at home, although it can be exhausting and scary due to delivering high pressure in the airways, and it’s too complicated to synchronize. contrary to this, hfnc correspondence: email: drsikandermemon@gmail.com https://doi.org/10.38106/lmrj.2021.3.203 received: 03.06.2021 accepted: 15.06.2021 published: 30. 06.2021 research article lmrj volume 3 issue 2 38 | p a g e is a recent advance in oxygen therapy with sufficient oxygen supply2. although hfnc has been used for neonates since 2000 and since then it has been an important part of oxygen therapy in pediatrics, hfnc has also been successfully used for adults with acute respiratory failure, having been universally recognized as an inherent part in hospitals worldwide, high-flow nasal cannula (hfnc) oxygen therapy has gained attention as an innovative mechanical ventilation for severely sickly patients, particularly those with respiratory failure. at flow rate by up to 60 l/min, it provides adequate warmed and humidified medical gas and is proven to have a number of other advantages, which include anatomical elimination of empty space, positive end expiratory pressure (peep effects, continuous conservation of oxygen inspired fraction (fio2) and heavy humidification effects.3. oxygen treatment with high-flow nasal cannula (hfnc) is an oxygenation procedure first used in premature babies and most recently in intensive care units or patients that are postoperative. hfnc is able to provide up to 100% high and controlled fio2, including during acute respiratory distress4. the benefits of hfnc over nasal persistent positive airway pressure, like its simplicity of utilization and enhanced tolerance for reduced nasal damage, have resulted in expanded use outside the intensive care unit as well5. in the early 2000s, hfnc was first adopted into clinical practice as a non-invasive system for the treatment of apnea in newborn infants and has since been well known in pediatrics, especially in respiratory failure triggered by bronchiolitis. recently, this device is widely used in intensive care units particularly in respiratory units where it is commonly and frequently used, frequently replacing niv in the superintendence of respiratory failure from a number of etiologies2. earlier research on the feasibility of treatment with hfnc in the treatment of acute bronchiolitis comes mainly through observational work, although there are few randomized clinical trials that are significant. furthermore, earlier studies compared hfnc treatment with less reliable, low-flow systems6. for initial respiratory management in young infants with mild to extreme avb, we conducted a multicenter, randomized, non-inferiority study of hfnc compared with ncpa12. partial carbon dioxide pressure (paco2) declined in a lung-injured animal model as hfnc flow improved and paco2 decreased more successfully with enhanced gas release 7 .different observational trials in infants with bronchiolitis have shown that hfnc therapy is practical, safe, and reliable, although further studies are needed to ensure evidence-based recommendations for its use. latest publications show that a wider variety of ages and diagnoses could also be successful and safe to submit.14 methodology it was an observational research that took place at the liaquat university of medical & health sciences (lumhs) hospital. in this study, 200 patients with severe respiratory distress, either caused by covid19 or other respiratory disorders, were enrolled. lumhs hospital icu ward was used as a data source. this study showed that subjects in their late 30s, both male and female. patients with acute or chronic respiratory failure were included, but those with other pulmonary disorders were excluded. the data analysis was performed on spss version 22.0. the variables like efficiency, gender ware categorical variables and their result have been shown in pie charts, the efficiency compression of oxygen delivery was also represented in pie chart, while age is presented in bar chart. results a total of 200 patients were selected for this study. out of them 122 (61%) were males and 78 (39%) were females. regarding age. 24%. were below 30s. 20% patients were in 30s.and 57% belonged to above 30s. lmrj volume 3 issue 2 39 | p a g e figure-i shows efficiency of hfnc was 65%. in 65% of cases it was proved to be lifesaving and in 35% cases patients were sent for intubation. figure-ii illustrates oxygen delivery method using cannula was 65% in delivering spo2 equal to or greater than 10 lpm while face mask method was only 35% successful, which determines that higher concentration cannulation is more efficient method than face mask. figure i: efficiency of hoft for severe ards patients figure ii: success ratio of cannula and face mask in ards patients figure iii: gender figure iv: age criteria discussion the study was conducted to assess the use of hfot for adrs patients by using cannulation instead of facemask. due to different delivery systems, high flow nasal cannula can provide up to 60 l/min whereas high-velocity nasal insufflation can only supply up to 40 l/min. the open air is where you exhale. hfno decreases breathing frequency and labor of breathing while reducing dead space and providing low levels of peep15 the is cannulation is more preferred in case of severe hypoxia and for delivery of more oxygen a very reliable option that has been seen is cannulation when we need to send more concentrated oxygen. hfnc, like cpap, is a high-flow device that can provide positive end expiratory pressure, but unlike cpap, it lacks a valve. the use of hfnc has been suggested as a strategy to reduce upper airway dead space and resistance. hfnc is thought to be a less invasive treatment than cpap, as well as being better tolerated by patients and easier to manage by personnel. hfnc has been demonstrated to be more lmrj volume 3 issue 2 40 | p a g e effective than standard therapy (e.g., cpap) in several trials16. better tolerance, easier mobility, closer bonding between newborn and parents, and less nasal damage of hfnc have lately resulted in widespread usage of this form of nrs in most centers, particularly in preterm newborns17. during the covid-19 pandemic, a large number of clinicians became sick, raising worries about using aerosolgenerating methods. as a result, it looks like hfnc is being avoided. the scientific data of bio-aerosol formation and dispersion using hfnc summarized here demonstrates a danger comparable to that of regular oxygen masks. thus, using hfnc prongs with a surgical mask over the patient's face might be a feasible approach that might help hypoxemic covid-19 patients and avoid intubation18. due to the pandemic of new coronavirus illness (covid-19) in 2019, the global healthcare system is experiencing an unprecedented resource shortage. it is most commonly linked with fever, cough, dyspnea, myalgia, tiredness, and pneumonia. invasive mechanical ventilation is used by between 29.1% and 89.9% of icu patients. for the treatment of hypoxemic respiratory failure, supplemental oxygen therapy is the mainstay. in critically unwell patients, the high-flow nasal cannula (hfnc) is a unique non-invasive technique for improved oxygenation and breathing. in this bleak circumstance, hfnc can help reduce mechanical ventilation19. in patients with covid-19, hfnc can lessen the need for intubation, as well as the duration of stay in the intensive care unit and problems associated with mechanical ventilation. hfnc can also help patients with apneic oxygenation during airway control. aside from that, the use of high-flow oxygen cannulas might result in the formation of aerosols. as a result, hfnc therapy should be done in a negative pressure chamber if feasible; if this is not feasible, devices should be done in a single room20. the hfnc is very convincing high flow oxygen therapy, which can be obtained through invasive ventilation, but it is too heavy for the elderly and chronic. patients to endure. with our findings, we were able to discover that hfnc has a high efficiency and has proven to be very effective in adrs patients. face mask complications such as discomfort and oxygen leakage were very low in the cannulation oxygen delivery method, and patients were more comfortable. furthermore, when we consider the age factor and the complications of using oxygen therapy, this device received positive feedback. hfnc has established itself as a well-known oxygen therapy, and more research into this technology is currently underway. conclusion hfnc is a recent innovation that reduces the need for intubation and oxygen loss while also providing high-flow oxygen with optimum humidification and temperature to patients with respiratory failure conflict of interest: there is no conflict of interest. funding: this study was not funded by any agency references 1. frat jp, coudroy r, marjanovic n, thille aw. high-flow nasal oxygen therapy and noninvasive ventilation in the management of acute hypoxemic respiratory failure. ann transl med. 2017;5(14):1–8. 2. spicuzza l, schisano m. high-flow nasal cannula oxygen therapy as an emerging option for respiratory failure: the present and the future. ther adv chronic dis. 2020;11:1–15. 3. kim es, lee h, kim sj, park j, lee yj, park js, et al. effectiveness of high-flow nasal cannula oxygen therapy for acute respiratory failure with hypercapnia. j thorac dis. 2018;10(2):882–8. 4. macé j, marjanovic n, faranpour f, mimoz o, frerebeau m, violeau m, et al. early high-flow nasal cannula oxygen therapy in adults with acute hypoxemic respiratory failure in the ed: a before-after lmrj volume 3 issue 2 41 | p a g e study. am j emerg med [internet]. 2019;37(11):2091–6. available from: https://doi.org/10.1016/j.ajem.2019.03.004 5. bressan s, balzani m, krauss b, pettenazzo a, zanconato s, baraldi e. high-flow nasal cannula oxygen for bronchiolitis in a pediatric ward: a pilot study. eur j pediatr. 2013;172(12):1649–56. 6. banik s, parrent ag, noppens rr. awake craniotomy in a super obese patient using high flow nasal cannula oxygen therapy (hfnc). anaesthesist. 2019;68(11):780–3. 7. nisa l, giger r. practice clinical images lingua plicata. cmaj. 2012;184(3):2012. 8. nishimura m. high-flow nasal cannula oxygen therapy in adults. j intensive care. 2015;3(1):1–8. 9. scala r. high-flow nasal oxygen therapy in acute respiratory failure. geriatr care. 2018;4(3):408–13. 10. nishimura m. high-flow nasal cannula oxygen therapy in adults: physiological benefits, indication, clinical benefits, and adverseeffects. respir care. 2016;61(4):529–41. 11. betul ergul a, calıskan e, samsa h, gokcek i, kaya a, erturk zararsiz g, et al. using a high-flow nasal cannula provides superior results to oxymask delivery in moderate to severe bronchiolitis: a randomized controlled study fraction of inspired oxygen hfnc high-flow nasal cannula icu intensive care unit pco 2 partial pressure of car. eur j pediatr. 2018;177:1299–307. 12. milési c, essouri s, pouyau r, liet jm, afanetti m, portefaix a, et al. high flow nasal cannula (hfnc) versus nasal continuous positive airway pressure (ncpap) for the initial respiratory management of acute viral bronchiolitis in young infants: a multicenter randomized controlled trial (tramontane study). intensive care med. 2017;43(2):209–16. 13. ito j, nagata k, morimoto t, kogo m, fujimoto d, nakagawa a, et al. respiratory management of acute exacerbation of interstitial pneumonia using high-flow nasal cannula oxygen therapy: a single center cohort study. j thorac dis. 2019;11(1):103–12. 14. ballestero y, de pedro j, portillo n, martinez-mugica o, arana-arri e, benito j. pilot clinical trial of high-flow oxygen therapy in children with asthma in the emergency service. j pediatr [internet]. 2018;194(april):204-210.e3. available from: https://doi.org/10.1016/j.jpeds.2017.10.075 15. calligaro gl, lalla u, audley g, gina p, miller mg, mendelson m, et al. the utility of high-flow nasal oxygen for severe covid-19 pneumonia in a resource-constrained setting: a multi-centre prospective observational study. eclinicalmedicine [internet]. 2020;28:100570. available from: https://doi.org/10.1016/j.eclinm.2020.100570 16. comparison of cpap and hfnc in management of bronchiolitis in infants and young children. children. 2017;4(12):28. 17. suffredini da, allison mg. a rationale for use of high flow nasal cannula for select patients with suspected or confirmed severe acute respiratory syndrome coronavirus-2 infection. j intensive care med. 2021 jan;36(1):9–17. 18. li j, fink jb, ehrmann s. high-flow nasal cannula for covid-19 patients: low risk of bio-aerosol dispersion. eur respir j [internet]. 2020;55(5). available from: http://dx.doi.org/10.1183/13993003.008922020 19. singh a, khanna p, sarkar s. high-flow nasal cannula, a boon or a bane for covid-19 patients? an evidence-based review. curr anesthesiol rep. 2021 mar;1–6. 20. gürün kaya a, öz m, erol s, çiftçi f, çiledağ a, kaya a. high flow nasal cannula in covid-19: a literature review. tuberk toraks. 2020 jul;68(2):168–74. volume 3 issue 1 1 | p a g e molecular epidemiology of mycobacterium tuberculosis in division mirpur, azad jammu & kashmir akhlaaq wazeer 1, zahida qasim 1, amar riaz 1, usman waheed 2, amnah shaukat 3, sara azam 4, muhammad arshad 2 1 department of pathology, divisional headquarters teaching hospital, mirpur, aj&k 2department of biotechnology, international islamic university, islamabad 3 department of pathology, mbbs medical college, mirpur, aj&k 4 department of medicine, divisional headquarters teaching hospital, mirpur, aj&k correspondence: email: akhlaaq@yahoo.com received: date: 12-01-2021 accepted: date 12-02-2021 published: date: 30-04-2021 https://doi.org/10.38106/lmrj. 2021.3. 1-01 abstract: the causative agent for tb is mycobacterium tuberculosis a member of mycobaterium tuberculosis complex. it is non-motile, slow growing, acid fast and rod in shape (bacilli). according to who in 2013, 9 million people contracted while 1.5 million died due to this disease, 550,000 children got tb while 80,000 were died who were hivnegative. furthermore, approximately 0.5 million people developed multidrug resistant tb (mdr-tb) and they needed comparatively longer and costly treatment. pakistan has high incidence and prevalence of tb. the total 580 patients were examined during the study, out which of 332 were males while 248 were females. only 17 percent were admitted (indoor patient department) in different hospitals of the division while 83 percent were from outdoor patient department of various settings. pulmonary tuberculosis was detected in 97 patients while extra pulmonary tuberculosis was noticed in 5 individuals. all samples were examined by direct microscopy (88%) followed by fluorescent microscopy and found presence of acid fast bacilli in 91 cases, light microscopy missed 3 positive cases. of the 109 specimens 68 grew during seven weeks of incubation while 20 grew in four weeks and 21 grew in second week of incubation. genexpert detected 102 samples as positive for mycobacterium tuberculosis. rifampicin (rif) a first line treatment drug was detected as resistant in 2 (1.96%) patients thus, multi-drug resistant (mdr) was found in two cases, which was associated with pro-e gene mutation. keywords: tuberculosis (tb), genexpert, fluorescent microscopy, mirpur introduction the causative agent for tb is mycobacterium tuberculosis which is a member of mycobacterium tuberculosis complex (mtc). mycobacterium tuberculosis is a non-motile, with a very slow growth rate, acid fast and rod in shape (bacilli) belongs to the mycobacterium genus and differs substantially from other bacteria due to the exceptionally thick cell wall and high genomic guanine-cytosine content. on dna level species of mtc are alike to each other but different on the basis of phenotype, host tropism and disease causing ability (1,2,3). in 2013, 9 million people contracted while 1.5 million died due to this disease. according to world health organization (who), estimation 550,000 children got tb while 80,000 were died who were hiv-negative in the same year. furthermore, approximately 0.5 million people developed multidrug resistant tb (mdr-tb) and they needed comparatively longer and costly treatment. with high occurrence of tb and perhaps getting high number of mdr and xdr. pakistan is among the top five in the world (4), with overall rate of 85–100/100,000 but in northern area of pakistan, the rate is even higher where the rate has been reported to be 554/100,000. research article volume 3 issue 1 3 | p a g e for the first time, twenty diverse enzymes having cytochrome p450 or cyp were programmed for genome sequencing for h37rv strain of m. tuberculosis (6). the important functions of these enzymes were described by huge number of p450s. the main function of p450 was recognized, to metabolize cholest-4-en-3-one (ie cyp125a1 and cyp142a1), chain lipids branched (ie cyp124a1), cyclic dipeptides oxidative couture (ie cyp121a1) sterol demethylation (ie cyp51b1) and menaquinone hydroxylation (ie cyp128a1) respectively in the host (7,8,9,10,11,12,13,14). in organisms that do not have true nucleus in it, m. tuberculosis p450 was the first categorized on the basis of structure and chemical as cyp51b1 and the principal associate of cyp51 gene (15). for the diagnosis of active tb after physician’s thought radiological e.g; x-rays followed by different laboratory confirmation including culture initially smear microscopy of sputum is needed. rapid diagnosis and related treatment is required to control the tb and drug resistance especially in resource constrains and prevalent entities but through these techniques it’s impossible to assume the drug resistance in tb causing bacteria. although the occurrence of tb and death rate reduced but mdr strains of tb bacteria are responsible for 480,000 cases of mdr in 2014 which is a great threat for patients as well as for tb control programs. maximum frequency of mdr-tb is in european countries located on east. materials and methods the study was conducted at the state tb reference laboratory situated within the premises of divisional head quarter teaching hospital, mirpur, azad jammu & kashmir (aj&k). the laboratory was established by the ministry of national health services, regulation & coordination while functioning under the supervision of health department of government of aj&k. the laboratory has separate reception, an office of the manager and separate room for every procedure. the said setting has state of the art equipment/instrument including pcr-based fully automatic genexpert, bio-safety cabinets (bscs), autoclave, incubator, fume hood, conventional microscope, fluorescence microscope and all personnel protective equipments (ppes). research was conducted between september 2019 to march 2020. the patients referred by their physicians or coming directly to the centre of mirpur division and present any of the sign and symptom enrolled; the presence of symptoms like persistent cough >7 days, low or high grade fever, gradually or suddenly loss of weight, night sweating and tiredness. two sputum samples were taken from adult individuals while gastric wash was taken from infants and young children who were suspecting pulmonary tuberculosis. patients who were suspecting for extra pulmonary tuberculosis, all specimens except blood e.g; biopsy, aspiration of other body fluid were obtained. the culture for mycobacterium tuberculosis was performed by using lowenstein-jensen culture medium and incubated at 37⁰c for six weeks in specially designed incubator. molecular analysis of detection of tb by genexpert genexpert which is most precise and accurate tool for the molecular detection of mycobacterium tuberculosis was also done on all 580 samples. genexpert works on polymerase chain reaction (pcr) principal basis detect mycobacterium and it’s resistant against anti-tuberculosis drugs. all suspected patients with tb aged new born and above residing in division mirpur, aj&k during the research period and informed consent were included in the study while the patients disinclination to consent were excluded. the patients coming for follow-up were excluded and those with <1.5 ml sputum samples or salivary samples were also excluded from the study. the study was approved by local ethics committee. volume 3 issue 1 4 | p a g e figure 1. geographical map of azad jammu and kashmir (aj&k) results a total of 580 patients were examined during the study out of which 332 were males while 248 were females (figure 1). only 17 percent were admitted in different hospitals of the division while 83% were from outdoor patient department of various settings. the age distribution of the patients is presented in figure 2; where 9 patients were under one year of age while 105 patients between 1 to 20 years of age. pulmonary and extra pulmonary tuberculosis were detected in 97 and 5 patients reseptively (figure 3). out of 580 patients 89 were positive for afb with diverse loud of afbs which mean, in some samples the loud of afbs was scanty while others shows 1+, 2+, 3+ and 4+ respectively. the males were predominant over female. in 69 males tuberculosis was detected while 33 female were also victim by this disease detection of tb by fluorescent microscopy all 580 samples were than confirmed by fluorescent microscopy and found presence of acid fast bacilli in 91 cases which means light microscopy missed 3 positive cases (figure 4). the quantity of acid fast bacilli was variable, e.g; scanty, 1+, 2+, 3+ and 4+. 491 samples were negative for acid fast bacilli after examining z.n stained smear under fluorescent microscope. detection of m. tuberculosis by culture culture it was done on all patients and 109 showed growth of mycobacterium tuberculosis while 471 did not grow (figure 5). of the 109 specimens 68 grew during seven weeks of incubation while 20 grew in four week and 21 grew in second week of incubation. in mycobacterium tuberculosis culture positive category the ratio of males 61% (n=67) was greater in comparison with females 39% (n=42). volume 3 issue 1 5 | p a g e genexpert genexpert detected 102 samples as positive for mycobacterium tuberculosis. rifampicin (rif) which is one of the drugs from first line treatment was detected as resistant in 2 (1.96%) patients so, multi-drug resistant (mdr) was found in two cases. the mutation was noticed in pro-e gene which was responsible for rifampicin resistance. there was no drug resistance seen in 99 patients who were positive for tuberculosis by genexpert. in one sample status was shown as indetermined (ind) as genexpert cut off value is > 131/ml of sample. the bacteria other than mycobacterium tuberculosis from mycobacterium complex (mtc) were also found in 3 patients. figure 2: age distribution of study population figure 3: pulmonary vs extra-pulmonary tb breakout figure 4: light versus fluorescent microscopy in detection mycobacterium tuberculosis volume 3 issue 1 6 | p a g e discussion: the study presented, a detailed picture of tb, in the division mirpur, azad jammu & kashmir, pakistan by combining pcr based genexpert, biochemical analysis and classical epidemiological methods. in the researches from around the globe and in our country the prevalence of drugresistant tuberculosis was different. according to our study out of 580 clinical samples (both pulmonary and extra-pulmonary) 102 (17.58%) were positive for mycobacterium tuberculosis and the prevalence of rifampicin resistance to tuberculosis was only 1.96% from all pulmonary samples as well as extra-pulmonary samples. in india 9% were rifampicin (single drug-resistant) as reported in different studies. surajit lahiri et al. reported in 2011– 2012, rifampicin mono-resistance in 4.69% while m. giridhar kumar et al. shows 0% rifampicin resistance in mycobacterium tuberculosis in 2010–2012 chiefly from south india. high prevalence of multi-drug resistant tuberculosis were reported in many studies from different region of india mainly in patients first-time treated with deterioration, treatment after evasion and treatment after failure. the prevalence of drug-resistance in our study is low as compared to studies mentioned above. 20 – 60 years of age male patients were mostly infected with pulmonary mycobacterium tuberculosis while in female the burden was found in 20 – 40 years of age group. extra pulmonary tuberculosis was found in age group of 20 – 40 years in both male as well as in females. while in rifampicin resistant, males were main victim within the age of 20 – 60 having pulmonary tuberculosis. and in case of rifampicin resistance, majority of pulmonary cases found in males and females were also from the age group of 20 40 years. the development of resistance to anti-tb drugs used to treat tuberculosis (tb), and chiefly multidrug-resistant tb (mdr-tb), has become a momentous public health threat in a number of nations and is a problem to actual tb control. many researches for the surveillance of drug resistance conducted in india indicated relatively low rate of multi-drug resistance but, this interprets into a huge total number of drug resistant tb cases and as hitherto the management of patients with mdr-tb is insufficient. within the revised national tuberculosis control program (rntcp) specific measures are being taken to address the multi-drug resistant-tb problem through suitable management of individuals and policies to preclude the spread and dissemination of multi-drug resistant-tb. antimicrobial drug resistance in tb has clinical, microbial and programmatic reasons. in case of microbiological perspective, the drug resistant is caused by the genetic alteration which stops the drug to effects the organism and show ineffectiveness against the altered bacilli. the second major cause of drug-resistance is the administration of insufficient and poorly treatment regimen which makes strain dominant in patient infected with tuberculosis. therefore, the poor treatment, poor antimicrobial therapy is totally man-made phenomenon in the development of multi-drug resistance tuberculosis. volume 3 issue 1 7 | p a g e conclusion: the specimen for the diagnosis of tuberculosis should be tested by all techniques including; direct and fluorescent microscopy, culture and genexpert technology. microscopy by both technique has low sensitivity and specificity. genexpert technology is much better in terms of sensitivity and specify when compare with microscopy while till date culture is most predominant in the account of sensitivity but need longer time due to slow growth of mycobacterium tuberculosis. references: 1. brosch, r., gordon, s. v, marmiesse, m., brodin, p., buchrieser, c., eiglmeier, k., garnier, t., gutierrez, c., hewinson, g., kremer, k., parsons, l. m., pym, a. s., samper, s., van soolingen, d., & cole, s. t. (2002). a new evolutionary scenario for the mycobacterium tuberculosis complex. proceedings of the national academy of sciences of the united states of america, 99(6), 3684– 3689. https://doi.org/10.1073/pnas.052548299. 2. huard, r. c., lazzarini, l. c. de o., butler, w. r., van soolingen, d., & ho, j. l. (2003). pcr-based method to differentiate the subspecies of the mycobacterium tuberculosis complex on the basis of genomic deletions. journal of clinical microbiology, 41(4), 1637–1650. retrieved from http://www.ncbi.nlm.nih.gov/pubmed/12682155. 3. smith, n. h., gordon, s. v., de la rua-domenech, r., clifton-hadley, r. s., & hewinson, r. g. (2006). bottlenecks and broomsticks: the molecular evolution of mycobacterium bovis. nature reviews microbiology, 4(9), 670–681. https://doi.org/10.1038/nrmicro1472. 4. cyan, m., price, m., & rider, m. (2017). a health literacy rct toward improvement of programmatic outcomes of tuberculosis control in the tribal areas of pakistan governance support program postcrisis. international center for public policy working paper series, at aysps, gsu. retrieved from https://ideas.repec.org/p/ays/ispwps/paper1711.html. 5. alvi, a. r., hussain, s. f., shah, m. a., khalida, m., & shamsudin, m. (1998). prevalence of pulmonary tuberculosis on the roof of the world. the international journal of tuberculosis and lung disease, 2(11), 909–913. retrieved from http://www.ncbi.nlm.nih.gov/pubmed/9848612. 6. cole, s. t., brosch, r., parkhill, j., garnier, t., churcher, c., harris, d., gordon, s. v., eiglmeier, k., gas, s., barry, c. e., tekaia, f., badcock, k., basham, d., brown, d., chillingworth, t., connor, r., davies, r., devlin, k., feltwell, t., gentles, s., hamlin, n., holroyd, s., hornsby, t., jagels, k., krogh, a., mclean, j., moule, s., murphy, l., oliver, k., osborne, j., quail, m. a., 64 | p a g e rajandream, m.a., rogers, j., rutter, s., seeger, k., skelton, j., squares, r., squares, s., sulston, j. e., taylor, k., whitehead, s., & barrell, b. g. (1998). deciphering the biology of mycobacterium tuberculosis from the complete genome sequence. nature, 393(6685), 537–544. https://doi.org/10.1038/31159. 7. podust, l. m., poulos, t. l., & waterman, m. r. (2001). crystal structure of cytochrome p450 14alpha -sterol demethylase (cyp51) from mycobacterium tuberculosis in complex with azole inhibitors. https://doi.org/10.1073/pnas.052548299 http://www.ncbi.nlm.nih.gov/pubmed/12682155 https://doi.org/10.1038/nrmicro1472 https://ideas.repec.org/p/ays/ispwps/paper1711.html https://ideas.repec.org/p/ays/ispwps/paper1711.html http://www.ncbi.nlm.nih.gov/pubmed/9848612 https://doi.org/10.1038/31159 volume 3 issue 1 8 | p a g e proceedings of the national academy of sciences of the united states of america, 98(6), 3068–3073. https://doi.org/10.1073/pnas.061562898. 8. leys, d., mowat, c. g., mclean, k. j., richmond, a., chapman, s. k., walkinshaw, m. d., & munro, a. w. (2003). atomic structure of mycobacterium tuberculosis cyp121 to 1.06 a reveals novel features of cytochrome p450. the journal of biological chemistry, 278(7), 5141–5147. https://doi.org/10.1074/jbc.m209928200. 9. mclean, k. j., lafite, p., levy, c., cheesman, m. r., mast, n., pikuleva, i. a., leys, d., & munro, a. w. (2009). the structure of mycobacterium tuberculosis cyp125. journal of biological chemistry, 284(51), 35524–35533. https://doi.org/10.1074/jbc.m109.032706. 10. holsclaw, c. m., sogi, k. m., gilmore, s. a., schelle, m. w., leavell, m. d., bertozzi, c. r., & leary, j. a. (2008). structural characterization of a novel sulfated menaquinone produced by stf3 from mycobacterium tuberculosis. acs chemical biology, 3(10), 619–624. https://doi.org/10.1021/cb800145r. 11. belin, p., le du, m. h., fielding, a., lequin, o., jacquet, m., charbonnier, j.-b., lecoq, a., thai, r., courcon, m., masson, c., dugave, c., genet, r., pernodet, j.-l., & gondry, m. (2009). identification and structural basis of the reaction catalyzed by cyp121, an essential cytochrome p450 in mycobacterium tuberculosis. proceedings of the national academy of sciences, 106(18), 7426– 7431. https://doi.org/10.1073/pnas.0812191106. 12. capyk, j. k., kalscheuer, r., stewart, g. r., liu, j., kwon, h., zhao, r., okamoto, s., jacobs, w. r., eltis, l. d., & mohn, w. w. (2009). mycobacterial cytochrome p450 125 (cyp125) catalyzes the terminal hydroxylation of c27 steroids. journal of biological chemistry, 284(51), 35534– 35542. https://doi.org/10.1074/jbc.m109.072132. 13. johnston, j. b., kells, p. m., podust, l. m., & ortiz de montellano, p. r. (2009). biochemical and structural characterization of cyp124: a methyl-branched lipid -hydroxylase from mycobacterium tuberculosis. proceedings of the national academy of sciences, 106(49), 20687– 20692. https://doi.org/10.1073/pnas.0907398106.driscoll, m. d., mclean, k. j., levy, c., mast, n., pikuleva, i. a., lafite, p., rigby, s. e. j., leys, d., & munro, a. w. (2010). structural and biochemical characterization of mycobacterium tuberculosis cyp142. journal of biological chemistry, 285(49), 38270–38282. https://doi.org/10.1074/jbc.m110.164293. 14. hunter, r. l. (2016). tuberculosis as a three-act play: a new paradigm for the pathogenesis of pulmonary tuberculosis. tuberculosis, 97, 8–17. https://doi.org/10.1016/j.tube.2015.11.010. 15. bellamine, a., mangla, a. t., nes, w. d., & waterman, m. r. (1999). characterization and catalytic properties of the sterol 14alpha-demethylase from mycobacterium tuberculosis. proceedings of the national academy of sciences of the united states of america, 96(16), 8937– 8942. retrieved from http://www.ncbi.nlm.nih.gov/pubmed/10430874. 16. who. (2015a). global tuberculosis report 2015. world health organization. access https://doi.org/10.1073/pnas.061562898 https://doi.org/10.1074/jbc.m209928200 https://doi.org/10.1074/jbc.m109.032706 https://doi.org/10.1021/cb800145r https://doi.org/10.1073/pnas.0812191106 https://doi.org/10.1074/jbc.m109.072132 https://doi.org/10.1074/jbc.m110.164293 https://doi.org/10.1016/j.tube.2015.11.010 http://www.ncbi.nlm.nih.gov/pubmed/10430874 type of the paper (article lmrj volume 3 issue 1 1 | p a g e phytochemical analysis of some medicinal plants maham siddiqui1,2, noma shah1, dur-re-shahwar momin1, syeda yusra ali1, ammara muzammil2, naveena fatima2 1faculty of pharmacy, jinnah university for women 2department of research & development, national institute of blood diseases (nibd) correspondence: maham siddiqui email : mahamsid diqui2001@gmail.com https://doi.org/10.38106/lmrj.2021.3. 1-02 received: date: 14-02-2021 accepted: date 10-03-2021 published: date: 30-04-2021 abstract: the chemical compounds that formed in plants during normal metabolic process are termed as phytochemicals. the composition of phytochemicals is usually complex in nature and differs among stages of development and plant origin. phytochemicals used higher plants as warehouse for them which are useful in pharmaceutical industry. some useful medicinal properties are associated with different parts of plants that result from interaction of secondary metabolic products. the aim of this study was to determine the presence of different phytochemicals in 04 different medicinal plants including smilax china, tribulus terristris, glycyrrhiza glabra and curcuma amada. this study was conducted in karachi for determination of phytochemical activity of said plants by using plant extracts. results showed that saponins were only absent in curcuma amada while in all the other 3 they were present. reducing sugar was only present in smilax china and glycyrrhiza glabra and tannins were in smilax china, tribulus terristris and glycyrrhiza glabra. anthocyanins were only positive in glycyrrhiza glabra. it was concluded that glycyrrhiza glabra had all 04 targeted phytochemicals (i.e. saponin, reducing sugar, tannins and anthocyanins) while tribulus terrestris had only saponins and tannins in it. only saponin, reducing sugar and tannins were present in smilax china and none of the targeted phytochemical was present in the extract of curcuma amada. keywords: phytochemical properties, medicinal plants, smilax china, tribulus terristris, glycyrrhiz aglabra, curcuma amada introduction phytochemicals are the compounds that are formed in plants during normal metabolic process. the composition of phytochemicals is usually complex in nature and differs among stages of development and plant origin. there are varieties of functions of plants that are associated with these secondary metabolic products, some of them include medicinal effects1. the concept of development of semi synthetic and synthetic analogues of plant compound for medicinal use was brought in 20th century2. these analogues associated with the maximal therapeutic effects as a result phytochemicals attracted increasing research focus for therapeutic care and food industries3. in identifying the sources of industrially and therapeutically important compounds, the screening of phytochemicals in dietary plants is very important4. for identification of secondary metabolites in plants, it is imperative to take some crucial steps5. there are various types of phytochemicals that found in different types of plants. each of these has its own unique property and function too. these functions include nutritional benefits, physiological functions, phytotoxicity, anti-nutritional property, pro-oxidants, anti-oxidants, anti-carcinogenic, analgesic, anti-inflammatory properties & other therapeutic effects9. phytochemicals are commercially used in rotenone, nicotine and pyrethrins and pesticides. tannins contain astringent activity and antimicrobial agents (isquinones) such as hypericin11. research article mailto:mahamsiddiqui2001@gmail.com mailto:mahamsiddiqui2001@gmail.com lmrj volume 3 issue 1 2 | p a g e lmrj volume 3 issue 1 3 | p a g e phytochemicals should be evaluated from different extracts of plants. there is a significant method for extraction of phytochemicals, also some traditional extracting procedures are present and there are certain novel extraction methods. as maceration, soxhlet and percolation methods are mostly used in screening of phytochemical studies. they also include some forward procedures like microwave assisted (mae), ultrasound-assisted extraction (uae), accelerated solvent extraction and supercritical fluid extraction (sfe)14. the study was aimed to evaluate presence of targeted phytochemicals i.e. saponins, carbohydrates, tan nins and anthocynins in some medicinal plants i.e. smilax china, glycyrrhiza glabra, curcuma amada and tribulus terristris. as we all know, phytochemicals have many significant therapeutic effects, so the evaluation of the presence of these therapeutic effects in targeted plants is the core purpose of this study. materials and methods this analysis was conducted in the city karachi for the determination of phytochemical activity of some medicinal plants. from the given plants, extracts were taken, and following test were performed for the indication of their presence. for extraction, we took 04 medicinal plants i.e. glycyrrhiza glabra, smilax china, curcuma amada and tribulus terrestris. these plants were bought from local market and extracts were prepared in an aqueous environment. reagents/ chemicals and solutions used in the tests include naoh solution, methyl orange (indicator), fehling’s solution a and b & ferric chloride and aqueous water. methods: test for saponin: took 1 ml of aqueous extract, dissolved in distilled water in test tubes, following by shaking the solution vigorously. observed for the froth which indicate presence of saponins in the extract. test for carbohydrates: for reducing sugars: at the first step 2ml of the extract was taken, added 1 ml of water followed by 20 drops of fehling’s solution a + fehling ’solution b in test tube. presences of brick red color indicated presence of reducing sugar in the given extracts. test for tannins 1 ml of extract was taken then added 1 ml of distilled water followed by addition of 2 -3 drops of ferric chloride in diluted form. the change of color from green to blue green was observed. if green to blue green color change appears, it indicates presence of cathechic tannins, while if blue black color appear this indicates that gallic tannins are present. test for anthocyanins naoh 50 ml was taken in a burette, then took a beaker containing few ml of aqueous solution of the extract and titered it, the color change was then observed. if the color changes to red color, it indicates lmrj volume 3 issue 1 4 | p a g e the ph is less than 3, if the color changes to blue color, this indicates the ph is between 4 and 6. results phytochemical screening of the given plants showed that saponins were only absent in curcuma amada while in all the other 03 they were present. reducing sugar was only present in smilax china and glycyrrhiza glabra while the tannins were in smilax china, tribulus terristris and glycyrrhiza glabra. the results of anthocyanins are were only positive in glycyrrhiz aglabra. table 1: phytochemical analysis in plant extracts s. no. phytochemicals smilax china tribulus ter ristris glycyrrhiza glabra curcuma amada 1 saponins + + + 2 reducing sugar + + 3 tannins + + + 4 anthocyanins + discussion: phytochemicals have a number of significant therapeutic effects like allyl sulfides, carotenoids, flavonoids and polyphenols have antioxidant activity and reduces the risk of cancer. these are mainly found in onions, lleks, garlic, fruits and vegetables. similarly indoles, protease inhibitors and terpenes stimulate the enzymes and reduce the risk of breast cancer by making estrogen less effective. some phytochemicals that found in soy and cranberry have hormonal actions and physicals actions too like isoflavones and proanthocyanindins respectively. they reduce osteoporosis and menopausal symptoms by working same as estrogen and having anti-adhesion property too. phytochemicals like saponins and capsaicin interfere with dna replication and have anti carcinogenic property while alicin have antibacterial effects. all they are found in beans hot peppers and garlic respectively. in order to identify the sources of industrially and therapeutically important compounds, the screening of phytochemicals in dietary plants is very important. for identification of secondary metabolites in plants, it is imperative to take some crucial steps29. in our daily life we eat nutrients that contain phytochemicals, but there are some refined foods like liquor or sugar. few dietary nourishment for example vegetables, fruits, bean, whole grains and herb contain numerous phytochemicals. there are a number of methods for extraction of phytochemicals some of them are traditional extracting procedures in addition to a number of novel extraction methods. as maceration, soxhlet and percolation methods are mostly used in screening of phytochemicals studies. they also include some forward procedures like microwave assisted (mae), ultrasound-assisted extraction (uae), accelerated solvent extraction and supercritical fluid extraction (sfe)30. in this study we mainly focused on 04 phytochemicals including saponin that are glucosides with foaming property. saponins are phytochemicals found in beans, herb and plants and having anti-cancerous effects. lmrj volume 3 issue 1 5 | p a g e the next are reducing sugars, they have activity of reducing agent as they have free aldehyde group or a free ketone group. along with monosaccharides there are reducing sugar with some disaccharides, oligosaccharides and polysaccharides. they are involved in reproduction, help to boost immune system, blood clotting and development of disease. they are energy transporters. tannins are also called tannoids and tannic acid. they are amorphous substance having the color of pale yellow to light brow. physically they are in the form of powders, spongy volume. they are nayurally present in the plants. they are widely used in many purpose including dyeing of cloths and fabrics, making of ink, it has great importance in medicinal application. the last ones are anthocyanins, they are extracted by many edible plants and have anticancer, antidiabetic, antiinflammatory, anti-obesity and antimicrobial effects. they are used for the prevention of cardiovascular disease as well 31. conclusion: it is concluded that the glycyrrhiza glabra had all 04 targeted phytochemicals (i.e. saponin, reducing sugar, tannins and anthocyanins) while tribulus terrestris had only saponins and tannins in it. only saponin, reducing sugar and tannins were present in smilax china and none of the targeted phytochemical was present in the extract of curcuma amada. acknowledgement: authors are very thanksfull all techinal and non techanical satff . conflict of interests: there is no any conflict of interest of authors funding : there is no any funding agency references: 1. molyneux, r. j., lee, s. t., gardner, d. r., panter, k. e., & james, l. f. (2007). phytochemicals: the good, the bad and the ugly?. phytochemistry, 68(22-24), 2973-2985. 2. webster, f. x. (1994). phytochemical dictionary: a handbook of bioactive compounds from plants, jeffrey b. harborne and herbert baxter, editors. journal of chemical ecology, 20, 815-815. 3. higdon, j., & victoria, j. d. (2007). riboflavin. micronutrient information center, linus pauling institute, oregon state university. afr. j. pharm. pharmacol, 2, 29-36. 4. sharma, p. (2018). preliminary phytochemical screening of ankola seed. pharma. innovation j, 7(6). 5. higdon, j., & victoria, j. d. (2007). riboflavin. micronutrient information center, linus pauling institute, oregon state university. afr. j. pharm. pharmacol, 2, 29-36. 6. higdon, j., & victoria, j. d. (2007). riboflavin. micronutrient information center, linus pauling institute, oregon state university. afr. j. pharm. pharmacol, 2, 29-36. 7. kitani, y., zhu, s., omote, t., tanaka, k., batkhuu, j., sanchir, c., ... & komatsu, k. (2009). molecular analysis and chemical evaluation of ephedra plants in mongolia. biological and pharmaceutical bulletin, 32(7), 12351243. 8. yang, r. y., & keding, g. b. (2009). nutritional contributions of important african indigenous vegetables. african indigenous vegetables in urban agriculture. earthscan, london, 105-143. 9. ganzera, m., lanser, c., & stuppner, h. (2005). simultaneous determination of ephedra sinica and citrus aurantium var. amara alkaloids by ion-pair chromatography. talanta, 66(4), 889-894. 10. shibamoto, t., & bjeldanes, l. f. (2009). introduction to food toxicology. 11. white, l. m., gardner, s. f., gurley, b. j., marx, m. a., wang, p. l., & estes, m. (1997). pharmacokinetics andcardiovascular effects of ma‐huang (ephedra sinica) in normotensive adults. the journal of clinical pharmacology, 37(2), 116-122. 12. shaw, d. (2010). toxicological risks of chinese herbs. planta medica, 76(17), 2012-2018. lmrj volume 3 issue 1 6 | p a g e 13. smith, a. (2000). oxford dictionary of biochemistry and molecular biology: revised edition. oxford university press. 14. halliwell, b. (2007). dietary polyphenols: good, bad, or indifferent for your health?. cardiovascular research, 73(2), 341-347. 15. samani, n. b., jokar, a., soveid, m., heydari, m., & mosavat, s. h. (2016). efficacy of the hydroalcoholic extract of tribulus terrestris on the serum glucose and lipid profile of women with diabetes mellitus: a double-blind randomized placebo-controlled clinical trial. journal of evidence-based complementary & alternative medicine, 21(4), np91-np97. 16. higdon, j., & victoria, j. d. (2007). riboflavin. micronutrient information center, linus pauling institute, oregon state university. afr. j. pharm. pharmacol, 2, 29-36. 17. stevens, j. (2003). the ephedra story. application note, 215, 1-6. 18. freitag, h., & maier‐stolte, m. (1989). the ephedra‐species of p. forsskål: identity and typification. taxon, 38(4), 545-556. 19. parsaeimehr, a., sargsyan, e., & javidnia, k. (2010). a comparative study of the antibacterial, antifungal and antioxidant activity and total content of phenolic compounds of cell cultures and wild plants of three endemic species of ephedra. molecules, 15(3), 1668-1678. 20. bagheri-gavkosh, s., bigdeli, m., shams-ghahfarokhi, m., & razzaghi-abyaneh, m. (2009). inhibitory effects of ephedra major host on aspergillus parasiticus growth and aflatoxin production. mycopathologia, 168(5), 249. 21. roopashree, t. s., dang, r., rani, s. r. h., & narendra, c. (2008). antibacterial activity of antipsoriatic herbs: cassia tora, momordica charantia and calendula officinalis. international journal of applied research in natural products, 1(3), 20-28. 22. kitani, y., zhu, s., omote, t., tanaka, k., batkhuu, j., sanchir, c., ... & komatsu, k. (2009). molecular analysis and chemical evaluation of ephedra plants in mongolia. biological and pharmaceutical bulletin, 32(7), 12351243. 23. sagara, k., oshima, t., & misaki, t. (1983). a simultaneous determination of norephedrine, pseudoephedrine, ephedrine and methylephedrine in ephedrae herba and oriental pharmaceutical preparations by ion-pair high-performance liquid chromatography. chemical and pharmaceutical bulletin, 31(7), 2359-2365. 24. liu, y. m., sheu, s. j., chiou, s. h., chang, h. c., & chen, y. p. (1993). a comparative study of commercial samples of ephedrae herba. planta medica, 59(04), 376-378. 25. schneeman, b. o. (2015). qualified health claims: letter regarding tomatoes and prostate cancer (lycopene health claim coalition)(docket no. 2004q-0201). us food and drug administration. 26. smith‐warner, s. a., spiegelman, d., yaun, s. s., albanes, d., beeson, w. l., van den brandt, p. a., ... & hunter, d. j. (2003). fruits, vegetables and lung cancer: a pooled analysis of cohort studies. international journal of cancer, 107(6), 1001-1011. 27. sansalone, s., leonardi, r., antonini, g., vitarelli, a., vespasiani, g., basic, d., ... & russo, g. i. (2014). alga ecklonia bicyclis, tribulus terrestris, and glucosamine oligosaccharide improve erectile function, sexual quality of life, and ejaculation function in patients with moderate mild-moderate erectile dysfunction: a prospective, randomized, 28. placebo-controlled, single-blinded study. biomed research international, 2014. 29. adaikan, p. g., gauthaman, k., prasad, r. n., & ng, s. c. (2000). proerectile pharmacological effects of tribulus terrestris extract on the rabbit corpus cavernosum. annals of the academy of medicine, singapore, 29(1), 22-26. 30. sansalone, s., russo, g. i., mondaini, n., cantiello, f., antonini, g., & cai, t. (2016). a combination of tryptophan, satureja montana, tribulus terrestris, phyllanthus emblica extracts is able to improve sexual quality of life in patient with premature ejaculation. archivio italiano di urologia e andrologia, 88(3), 171-176. 31. sellandi, t. m., thakar, a. b., & baghel, m. s. (2012). clinical study of tribulus terrestris linn. in oligozoospermia: a double blind study. ayu, 33(3), 356. 32. sengupta, g., hazra, a., kundu, a., & ghosh, a. (2011). comparison of murraya koenigii–and tribulus lmrj volume 3 issue 1 7 | p a g e terrestris–based oral formulation versus tamsulosin in the treatment of benign prostatic hyperplasia in men aged> 50 years: a double-blind, double-dummy, randomized controlled trial. clinical therapeutics, 33(12), 1943-1952 article 2 relationship between academic stress and personal wellness in medical university students tahira yousaf, zarmina kawal, bushra zainab, humaira nawaz, aisha ahsan, laraib shaheen, momina azam bahria university, karachi campus. received: 17 june 2019 revised: 31 july 2019 accepted for publication 6 august 2019 correspondence: dr. tahira yousaf, consultant clinical psychologist/hypnotherapist institute of professional psychology bahria university. karachi campus e-mail: tahiraysf@yahoo.com abstract to explore the relationship of academic stress with personal wellness as well as academic stress as a predictor of personal wellness in medical university students. one seventy �ve under graduate students, i.e. sixty seven males and one hundred and eight females were selected through convenient sampling for the present study. �is study was conducted during february 2017 to july 2017 at jinnah medical & dental college (jmdc) and bahria university medical & dental college (bumdc). participants were assessed by using lakaev academic stress response scale (lakaev, 2009) and five factor wellness inventory adult form (witmer & sweeney, 2004). �e results found a signi�cant relationship between personal wellness in medical university students (p ≤ .001). �e �ndings indicated a moderate downhill (negative) relationship between academic stress and personal wellness as per the hypotheses statement. a slight deviation from the results has occurred which might be due to some extraneous variable. keywords: academic stress, personal wellbeing, medical students. introduction nowadays, every person in this world is su�ering from cravings for achievement. either it is job related, family related, social, economic or academics related stress. among variety of variables producing negative e�ects on people’s health and wellness, stress is one of them as described by many today’s psychological researches. researchers reported that it is prevailing vastly among the students of university level1. academic stress creates a sense of stringent among not only students but also on parents. �is clench has been extending day by day on the life of students, due to the competitive environment. �is competitive environment is playing a chief role in creating academic stress among students. �e word academic stress has been characterized as the disturbance in psychical capabilities due to some pre-empt frustration which is the result of unable to succeed in academic life as well as their probability has the same consequence2. without using any techniques to cope up with academic stress by students, it becomes very harmful and can result in serious physical as well as psychological health conditions including weakened immune system, insomnia, muscle pain, troubled social life, anxiety, troubled cognition and high blood3. researcher suggested that stress as a consequence of academic demands count as the major irritating daily life stressors i.e. persistent pressure of studying, writing assignments, taking quizzes, planning for future and listening to the lecture instructor4. it is the nature of human being that either they take challenges boldly or escapes from it. all this diversi�ed from person to person. �erefore, it has been concluded that in individuals, those challenges that surpass the coping benchmark lead to stress. in this modern world of compete-till-death competition, the students are more prone towards career orientation and having a bright future. �ose students who somewhat fail to cope up with such circumstances or sometimes when they do not succeed to gratify their these needs then as a result this fail-to-cope-up situation causes stress and further causes depression and personal wellness. furthermore, academic stress leads to the dissatisfying mental situation prevalence because of expectations in education from their family, instructors, etc. academic stress among adult students has researched on from a very long time. researchers have pin pointed stressors, which are piles of assignments, competitions in academics, failures and poor relationships with other students5. �e consequences of stress on adults may a�ect adult development, physical health, and psychological well-being while it can be seen that minor or daily life stressors have recently in hold increased recognition in the life span of stress and illness6. �erefore, research has shown that quality of learning would negatively impact if there will be high academic stress7. furthermore, this will even importantly impact physical and emotional wellness of the students8. multi-researches have shown the level of distress is increasing rapidly like depression symptoms, suicidal thoughts on medical students, these e�ects is highly responsible of classroom performance and clinical practices. however, due to stress the student’s emotional problem, social and physical problem may in�uence the learning ability of students9. a recent research conducted on assessing the symptoms of stress and depression within medical university students and the �ndings prelude the immense increase in the amount of stress at average level of 5.51-6.49% till third year of university. �ere is a signi�cant increase in number of students, which are at high risk for experiencing symptoms of depression and there is an increased risk of experiencing perceived stress as well10. �e objective of the present study was to explore the relationship of academic stress with personal wellness as well as academic stress as a predictor of personal wellness in medical university students. methodology �is study was conducted during february 2017 to july 2017 at jinnah medical & dental college (jmdc) and bahria university medical & dental college (bumdc) located in the city of karachi, pakistan. for this observational study convenience sampling was done. inclusion criteria included 3rd and 4th year medical students, free from any kind of psychiatric medication, not under any psychotherapy treatment. �e type of study that has used in this research is correlational research in order to gather information through questionnaires for analysing the relationship between two of the variables i.e. academic stress and personal wellness. before taking written consent all participants were informed regarding the nature and protocol of the study with reassurance of con�dentiality of identity and personal information. in this study, 175 participants were considered consisting of 67 males and 108 females age ranged from 19-26 years. participants were given consent form before the main questionnaires of the research. �e data has gathered by using two of the questionnaires according to the variables of study i.e. lakaev academic stress response scale (lasrs) and five factor wellness inventory adult form, both of the instruments were self-administered inventories. lakaev academic stress response scale (lasrs) is a 26-items scale that measures severity of academic stress from nil to high. �e alpha coe�cient for 26 items were .874, suggesting that the items have relatively high internal consistency. five factor wellness inventory adult form is a 96-items questionnaire that measures a person’s holistic health and wellness and represents it from illness to wellness. results percentages & frequencies of sample’s demographics (year of study, gender, marital status & age) was analyzed by descriptive statistics. moreover, for analyzing the relationship between variables i.e. academic stress and personal wellness, pearson correlation and regression analysis was calculated. out of 175 participants 67 (38%) were males and 108 (61%) were females. marital status as shown in (table i), there were 85.7% of the participant were unmarried, 10.9% were married and 3.4% were committed. �e demographic variable, year of study showed the frequency of participants from 2nd year (30.9%) and 3rd year (30.3%) was high as compared to 4th year (21.7%), 1st year (15.4) and 5th year (1.1%). overall we recruited 105 patients and 92 consented to participate in the study with a response rate of 88%. �e age-range of participants was 18-26 from which majority from the range of 21-23 has participated in the study. academic stress had a signi�cant negative relationship with personal wellness. pearson correlation -0.539** indicating a moderate downhill (negative) relationship between academic stress and personal wellness, while overall results of the study suggest that around 29% of wellness correlates with academic stress (table ii). coe�cient of independent variable is showing that academic stress is a predictor of personal wellness personal. if academic stress increases, personal wellness will decrease by -0.539 standard deviation (table iii). table 1: frequencies and percentages of demographic variables (n=175) table 2: relationship between academic stress and personal wellness among medical students (n=175) (p ≤ .001) table 3: academic stress as a predictor of personal wellness in medical students (n=175) discussion �e aim of the present study was to test whether there is a relationship between academic stress and individual health that is personal wellness among medical students, which was cleared in the results that academic stress can negative e�ect person’s wellness. managing stress has been the best test for understudies everywhere throughout the world particularly the ones concentrate in �elds that require more consideration and request more investigation time. �e same was identi�ed that studies burden in academic years mostly leads to stress in students that e�ect their health as well as learning abilities11. �e idea of performing best in the exams its self is a stressful situation for the students of medical colleges and universities. and continues stress e�ect the students physical and emotional health12. it was further supported by di�erent studies that medical students have high work load in their academic years as they have to give more hours of their day to their studies which in return e�ect their quality of life. approximately 50% of medical students in united states experience stress, 25% have depression, and many su�er from chronic anxiety 13,14. as lazarus and cohen study indicates that the environment of the individual become negative and unyielding, the weariness is regularly referred to as a stressor in the coming years, and numerous understudies envision they have the condition they are examining hypochondriacal wonder15. another study suggested that the clinical years end up plainly normal and the fourth year is less unpleasant. be that as it may, in the primary year of house work (the temporary job), fatigue, burnout and lack of sleep end up noticeably real stressors16. absence of individual time keeps on focusing on them assist in their training years. some level of anxiety is helpful and at �rst important for self-awareness to happen, however now and again the measure of stress can overpower an understudy and in�uence their capacity to adapt. concealment of feelings is not the sound way to deal with controlling feelings, it acts s moderate toxin and continues in�uencing emotional well-being time by time in face of stress, take diverse however sensible point of view and �gure out how to adapt to it by changing how you respond to it. scholarly stress can act naturally oversaw. di�erent studies showed that stress management skills’ training has a good impact on the psychological well-being of people. �e same was also analyzed in di�erent studies as well17,18. conclusion academic stress e�ect the personal wellbeing in medical students. our examination shows that students of medical colleges and universities are su�ering from emotional problems because of high level of academic stress. so must have the knowledge while entering and through the learning procedure can truly set the phase for their future results, so we would recommend that these developmental encounters and unpleasant learning issues can e�ect one's self-improvement and block in keeping up their own health. �e authors recommend for the teachers and parents to keep in mind the meaning and importance of academic stress that in�uence students’ personal wellness to better understand and evaluate students’ personal needs and values, in order to assist and help them through their personal growth and development. 51 © 2019 lmrj liaquat medical research journal, 2019, 1, 3 research article introduction nowadays, every person in this world is su�ering from cravings for achievement. either it is job related, family related, social, economic or academics related stress. among variety of variables producing negative e�ects on people’s health and wellness, stress is one of them as described by many today’s psychological researches. researchers reported that it is prevailing vastly among the students of university level1. academic stress creates a sense of stringent among not only students but also on parents. �is clench has been extending day by day on the life of students, due to the competitive environment. �is competitive environment is playing a chief role in creating academic stress among students. �e word academic stress has been characterized as the disturbance in psychical capabilities due to some pre-empt frustration which is the result of unable to succeed in academic life as well as their probability has the same consequence2. without using any techniques to cope up with academic stress by students, it becomes very harmful and can result in serious physical as well as psychological health conditions including weakened immune system, insomnia, muscle pain, troubled social life, anxiety, troubled cognition and high blood3. researcher suggested that stress as a consequence of academic demands count as the major irritating daily life stressors i.e. persistent pressure of studying, writing assignments, taking quizzes, planning for future and listening to the lecture instructor4. it is the nature of human being that either they take challenges boldly or escapes from it. all this diversi�ed from person to person. �erefore, it has been concluded that in individuals, those challenges that surpass the coping benchmark lead to stress. in this modern world of compete-till-death competition, the students are more prone towards career orientation and having a bright future. �ose students who somewhat fail to cope up with such circumstances or sometimes when they do not succeed to gratify their these needs then as a result this fail-to-cope-up situation causes stress and further causes depression and personal wellness. furthermore, academic stress leads to the dissatisfying mental situation prevalence because of expectations in education from their family, instructors, etc. academic stress among adult students has researched on from a very long time. researchers have pin pointed stressors, which are piles of assignments, competitions in academics, failures and poor relationships with other students5. �e consequences of stress on adults may a�ect adult development, physical health, and psychological well-being while it can be seen that minor or daily life stressors have recently in hold increased recognition in the life span of stress and illness6. �erefore, research has shown that quality of learning would negatively impact if there will be high academic stress7. furthermore, this will even importantly impact physical and emotional wellness of the students8. multi-researches have shown the level of distress is increasing rapidly like depression symptoms, suicidal thoughts on medical students, these e�ects is highly responsible of classroom performance and clinical practices. however, due to stress the student’s emotional problem, social and physical problem may in�uence the learning ability of students9. a recent research conducted on assessing the symptoms of stress and depression within medical university students and the �ndings prelude the immense increase in the amount of stress at average level of 5.51-6.49% till third year of university. �ere is a signi�cant increase in number of students, which are at high risk for experiencing symptoms of depression and there is an increased risk of experiencing perceived stress as well10. �e objective of the present study was to explore the relationship of academic stress with personal wellness as well as academic stress as a predictor of personal wellness in medical university students. methodology �is study was conducted during february 2017 to july 2017 at jinnah medical & dental college (jmdc) and bahria university medical & dental college (bumdc) located in the city of karachi, pakistan. for this observational study convenience sampling was done. inclusion criteria included 3rd and 4th year medical students, free from any kind of psychiatric medication, not under any psychotherapy treatment. �e type of study that has used in this research is correlational research in order to gather information through questionnaires for analysing the relationship between two of the variables i.e. academic stress and personal wellness. before taking written consent all participants were informed regarding the nature and protocol of the study with reassurance of con�dentiality of identity and personal information. in this study, 175 participants were considered consisting of 67 males and 108 females age ranged from 19-26 years. participants were given consent form before the main questionnaires of the research. �e data has gathered by using two of the questionnaires according to the variables of study i.e. lakaev academic stress response scale (lasrs) and five factor wellness inventory adult form, both of the instruments were self-administered inventories. lakaev academic stress response scale (lasrs) is a 26-items scale that measures severity of academic stress from nil to high. �e alpha coe�cient for 26 items were .874, suggesting that the items have relatively high internal consistency. five factor wellness inventory adult form is a 96-items questionnaire that measures a person’s holistic health and wellness and represents it from illness to wellness. results percentages & frequencies of sample’s demographics (year of study, gender, marital status & age) was analyzed by descriptive statistics. moreover, for analyzing the relationship between variables i.e. academic stress and personal wellness, pearson correlation and regression analysis was calculated. out of 175 participants 67 (38%) were males and 108 (61%) were females. marital status as shown in (table i), there were 85.7% of the participant were unmarried, 10.9% were married and 3.4% were committed. �e demographic variable, year of study showed the frequency of participants from 2nd year (30.9%) and 3rd year (30.3%) was high as compared to 4th year (21.7%), 1st year (15.4) and 5th year (1.1%). overall we recruited 105 patients and 92 consented to participate in the study with a response rate of 88%. �e age-range of participants was 18-26 from which majority from the range of 21-23 has participated in the study. academic stress had a signi�cant negative relationship with personal wellness. pearson correlation -0.539** indicating a moderate downhill (negative) relationship between academic stress and personal wellness, while overall results of the study suggest that around 29% of wellness correlates with academic stress (table ii). coe�cient of independent variable is showing that academic stress is a predictor of personal wellness personal. if academic stress increases, personal wellness will decrease by -0.539 standard deviation (table iii). table 1: frequencies and percentages of demographic variables (n=175) table 2: relationship between academic stress and personal wellness among medical students (n=175) (p ≤ .001) table 3: academic stress as a predictor of personal wellness in medical students (n=175) discussion �e aim of the present study was to test whether there is a relationship between academic stress and individual health that is personal wellness among medical students, which was cleared in the results that academic stress can negative e�ect person’s wellness. managing stress has been the best test for understudies everywhere throughout the world particularly the ones concentrate in �elds that require more consideration and request more investigation time. �e same was identi�ed that studies burden in academic years mostly leads to stress in students that e�ect their health as well as learning abilities11. �e idea of performing best in the exams its self is a stressful situation for the students of medical colleges and universities. and continues stress e�ect the students physical and emotional health12. it was further supported by di�erent studies that medical students have high work load in their academic years as they have to give more hours of their day to their studies which in return e�ect their quality of life. approximately 50% of medical students in united states experience stress, 25% have depression, and many su�er from chronic anxiety 13,14. as lazarus and cohen study indicates that the environment of the individual become negative and unyielding, the weariness is regularly referred to as a stressor in the coming years, and numerous understudies envision they have the condition they are examining hypochondriacal wonder15. another study suggested that the clinical years end up plainly normal and the fourth year is less unpleasant. be that as it may, in the primary year of house work (the temporary job), fatigue, burnout and lack of sleep end up noticeably real stressors16. absence of individual time keeps on focusing on them assist in their training years. some level of anxiety is helpful and at �rst important for self-awareness to happen, however now and again the measure of stress can overpower an understudy and in�uence their capacity to adapt. concealment of feelings is not the sound way to deal with controlling feelings, it acts s moderate toxin and continues in�uencing emotional well-being time by time in face of stress, take diverse however sensible point of view and �gure out how to adapt to it by changing how you respond to it. scholarly stress can act naturally oversaw. di�erent studies showed that stress management skills’ training has a good impact on the psychological well-being of people. �e same was also analyzed in di�erent studies as well17,18. conclusion academic stress e�ect the personal wellbeing in medical students. our examination shows that students of medical colleges and universities are su�ering from emotional problems because of high level of academic stress. so must have the knowledge while entering and through the learning procedure can truly set the phase for their future results, so we would recommend that these developmental encounters and unpleasant learning issues can e�ect one's self-improvement and block in keeping up their own health. �e authors recommend for the teachers and parents to keep in mind the meaning and importance of academic stress that in�uence students’ personal wellness to better understand and evaluate students’ personal needs and values, in order to assist and help them through their personal growth and development. 52 © 2019 lmrj liaquat medical research journal, 2019, 1, 3 gender male female total marital status committed married single total year of studies 1st year 2nd year 3rd year 4th year 5th year total 38.3% 61.7% 100.0% 3.5% 10.9% 85.7% 100.0% 15.4% 30.9% 30.3% 21.7% 1.1% 100.0% 67 108 175 6 19 150 175 27 54 53 38 2 175 frequencies percentages lmrj introduction nowadays, every person in this world is su�ering from cravings for achievement. either it is job related, family related, social, economic or academics related stress. among variety of variables producing negative e�ects on people’s health and wellness, stress is one of them as described by many today’s psychological researches. researchers reported that it is prevailing vastly among the students of university level1. academic stress creates a sense of stringent among not only students but also on parents. �is clench has been extending day by day on the life of students, due to the competitive environment. �is competitive environment is playing a chief role in creating academic stress among students. �e word academic stress has been characterized as the disturbance in psychical capabilities due to some pre-empt frustration which is the result of unable to succeed in academic life as well as their probability has the same consequence2. without using any techniques to cope up with academic stress by students, it becomes very harmful and can result in serious physical as well as psychological health conditions including weakened immune system, insomnia, muscle pain, troubled social life, anxiety, troubled cognition and high blood3. researcher suggested that stress as a consequence of academic demands count as the major irritating daily life stressors i.e. persistent pressure of studying, writing assignments, taking quizzes, planning for future and listening to the lecture instructor4. it is the nature of human being that either they take challenges boldly or escapes from it. all this diversi�ed from person to person. �erefore, it has been concluded that in individuals, those challenges that surpass the coping benchmark lead to stress. in this modern world of compete-till-death competition, the students are more prone towards career orientation and having a bright future. �ose students who somewhat fail to cope up with such circumstances or sometimes when they do not succeed to gratify their these needs then as a result this fail-to-cope-up situation causes stress and further causes depression and personal wellness. furthermore, academic stress leads to the dissatisfying mental situation prevalence because of expectations in education from their family, instructors, etc. academic stress among adult students has researched on from a very long time. researchers have pin pointed stressors, which are piles of assignments, competitions in academics, failures and poor relationships with other students5. �e consequences of stress on adults may a�ect adult development, physical health, and psychological well-being while it can be seen that minor or daily life stressors have recently in hold increased recognition in the life span of stress and illness6. �erefore, research has shown that quality of learning would negatively impact if there will be high academic stress7. furthermore, this will even importantly impact physical and emotional wellness of the students8. multi-researches have shown the level of distress is increasing rapidly like depression symptoms, suicidal thoughts on medical students, these e�ects is highly responsible of classroom performance and clinical practices. however, due to stress the student’s emotional problem, social and physical problem may in�uence the learning ability of students9. a recent research conducted on assessing the symptoms of stress and depression within medical university students and the �ndings prelude the immense increase in the amount of stress at average level of 5.51-6.49% till third year of university. �ere is a signi�cant increase in number of students, which are at high risk for experiencing symptoms of depression and there is an increased risk of experiencing perceived stress as well10. �e objective of the present study was to explore the relationship of academic stress with personal wellness as well as academic stress as a predictor of personal wellness in medical university students. methodology �is study was conducted during february 2017 to july 2017 at jinnah medical & dental college (jmdc) and bahria university medical & dental college (bumdc) located in the city of karachi, pakistan. for this observational study convenience sampling was done. inclusion criteria included 3rd and 4th year medical students, free from any kind of psychiatric medication, not under any psychotherapy treatment. �e type of study that has used in this research is correlational research in order to gather information through questionnaires for analysing the relationship between two of the variables i.e. academic stress and personal wellness. before taking written consent all participants were informed regarding the nature and protocol of the study with reassurance of con�dentiality of identity and personal information. in this study, 175 participants were considered consisting of 67 males and 108 females age ranged from 19-26 years. participants were given consent form before the main questionnaires of the research. �e data has gathered by using two of the questionnaires according to the variables of study i.e. lakaev academic stress response scale (lasrs) and five factor wellness inventory adult form, both of the instruments were self-administered inventories. lakaev academic stress response scale (lasrs) is a 26-items scale that measures severity of academic stress from nil to high. �e alpha coe�cient for 26 items were .874, suggesting that the items have relatively high internal consistency. five factor wellness inventory adult form is a 96-items questionnaire that measures a person’s holistic health and wellness and represents it from illness to wellness. results percentages & frequencies of sample’s demographics (year of study, gender, marital status & age) was analyzed by descriptive statistics. moreover, for analyzing the relationship between variables i.e. academic stress and personal wellness, pearson correlation and regression analysis was calculated. out of 175 participants 67 (38%) were males and 108 (61%) were females. marital status as shown in (table i), there were 85.7% of the participant were unmarried, 10.9% were married and 3.4% were committed. �e demographic variable, year of study showed the frequency of participants from 2nd year (30.9%) and 3rd year (30.3%) was high as compared to 4th year (21.7%), 1st year (15.4) and 5th year (1.1%). overall we recruited 105 patients and 92 consented to participate in the study with a response rate of 88%. �e age-range of participants was 18-26 from which majority from the range of 21-23 has participated in the study. academic stress had a signi�cant negative relationship with personal wellness. pearson correlation -0.539** indicating a moderate downhill (negative) relationship between academic stress and personal wellness, while overall results of the study suggest that around 29% of wellness correlates with academic stress (table ii). coe�cient of independent variable is showing that academic stress is a predictor of personal wellness personal. if academic stress increases, personal wellness will decrease by -0.539 standard deviation (table iii). table 1: frequencies and percentages of demographic variables (n=175) table 2: relationship between academic stress and personal wellness among medical students (n=175) (p ≤ .001) table 3: academic stress as a predictor of personal wellness in medical students (n=175) discussion �e aim of the present study was to test whether there is a relationship between academic stress and individual health that is personal wellness among medical students, which was cleared in the results that academic stress can negative e�ect person’s wellness. managing stress has been the best test for understudies everywhere throughout the world particularly the ones concentrate in �elds that require more consideration and request more investigation time. �e same was identi�ed that studies burden in academic years mostly leads to stress in students that e�ect their health as well as learning abilities11. �e idea of performing best in the exams its self is a stressful situation for the students of medical colleges and universities. and continues stress e�ect the students physical and emotional health12. it was further supported by di�erent studies that medical students have high work load in their academic years as they have to give more hours of their day to their studies which in return e�ect their quality of life. approximately 50% of medical students in united states experience stress, 25% have depression, and many su�er from chronic anxiety 13,14. as lazarus and cohen study indicates that the environment of the individual become negative and unyielding, the weariness is regularly referred to as a stressor in the coming years, and numerous understudies envision they have the condition they are examining hypochondriacal wonder15. another study suggested that the clinical years end up plainly normal and the fourth year is less unpleasant. be that as it may, in the primary year of house work (the temporary job), fatigue, burnout and lack of sleep end up noticeably real stressors16. absence of individual time keeps on focusing on them assist in their training years. some level of anxiety is helpful and at �rst important for self-awareness to happen, however now and again the measure of stress can overpower an understudy and in�uence their capacity to adapt. concealment of feelings is not the sound way to deal with controlling feelings, it acts s moderate toxin and continues in�uencing emotional well-being time by time in face of stress, take diverse however sensible point of view and �gure out how to adapt to it by changing how you respond to it. scholarly stress can act naturally oversaw. di�erent studies showed that stress management skills’ training has a good impact on the psychological well-being of people. �e same was also analyzed in di�erent studies as well17,18. conclusion academic stress e�ect the personal wellbeing in medical students. our examination shows that students of medical colleges and universities are su�ering from emotional problems because of high level of academic stress. so must have the knowledge while entering and through the learning procedure can truly set the phase for their future results, so we would recommend that these developmental encounters and unpleasant learning issues can e�ect one's self-improvement and block in keeping up their own health. �e authors recommend for the teachers and parents to keep in mind the meaning and importance of academic stress that in�uence students’ personal wellness to better understand and evaluate students’ personal needs and values, in order to assist and help them through their personal growth and development. references 1. zajacova a, lynch sm, espenshade tj. self-e�cacy, stress, and academic success in college. research in higher education. 2005 46;(6): 677-706. 2. kalariya nm, ramana kv, srivastav sk, van kujik fj. carotenoid derived aldehydes-induced oxidative stress causes apoptotic cell death in human retinal pigment epithelial cells. experimental eye research. 2008 86(1): 70-80. 3. shankar nl, park cl. e�ects of stress on students' physical and mental health and academic success. international journal of school & educational psychology, 2016 4(1): 5-9. 4. wilbert c. �e relationship between stress and mental health among students at the university of twente. bachelor's thesis, university of twente. 2012. 5. dhull i, kumari s. academic stress among adolescents in relation to gender. ijar. 2015 1(11): 394-396. 53 © 2019 lmrj liaquat medical research journal, 2019, 1, 3 lmrj academic stress pearson correlation sig. (2-tailed) n pearson correlation sig. (2-tailed) n academic stress personal wellness personal wellness 1 175 -.539** .000 175 -.539** .000 175 1 175 b 4.107 -.502 .180 .060 -.539 22.796 -8.425 std. errormodel beta (constant) academic stress unstandardized coe�cients standardized coe�cients t sig. .000 .000 6. brantley pj, garrett vd. psychobiological apporaches to health and disease. in comprehensive handbook of psychopathology. 2002 (pp. 647-670). springer us. 7. lumley ma, provenzano km. stress management through written emotional disclosure improves academic performance among college students with physical symptoms. journal of educational psychology. 2003 95(3): 641-649. 8. garlow sj, rosenberg j, moore jd, haas ap, koestner b, hendin h, nemero� cb. depression, desperation, and suicidal ideation in college students: results from the american foundation for suicide prevention college screening project at emory university. depression and anxiety. 2008 25(6): 482-488. 9. shaikh bt, kahloon a, kazmi m, khalid h, nawaz k, khan n, khan s. students, stress and coping strategies: a case of pakistani medical school. education for health abingdon carfax. 2004 17, 346-353. 10. ludwig ab, burton w, weingarten j, milan f, myers dc, kligler b. depression and stress amongst undergraduate medical students. bmc medical education 2015 15(1): 141. 11. khalatbari j, azizzadeh-haqiqi f. �e impact of life skills training and stress management strategies on the mental health of female university students. knowledge and research in applied psychology. 2011 2(12). 12. edwards mt and zimet cn. problems and concerns among medical students. journal of medical education 1976 51(8): 619–625. 13. dyrbye ln, �omas mr, massie et al. burnout and suicidal ideation among u.s. medical students. annals of internal medicine. 2008 5(149):334–341. view at publisher. 14. dyrbye ln, �omas mr, and shanafelt td. systematic review of depression, anxiety, and other indicators of psychological distress among u.s. and canadian medical students. academic medicine. 2006 4(81):354–373. 15. lazarus rs and cohen jb. environmental stress. 2000. springer us. 16. weidner g, kohlmann cw, dotzauer e and burns lr. �e e�ects of academic stress on health behaviors in young adults. anxiety, stress and coping. 1996; 9(2):123-133. 17. qadiri-bahramabadi f and mikaeli-manee f. �e e�ectiveness of cognitive-behavioral stress management training on psychological well-being and school satisfaction of teenage girls. a r m a q a n e d a n e s h . 2015;20(5):433–443. 18. chubforushzadeh a, kalantari m and molavi h. �e e�ectiveness of cognitive-behavioral stress management on the subjective well-being of infertile women. quarterly of clinical psychology. 2009;1(4):1–9. introduction nowadays, every person in this world is su�ering from cravings for achievement. either it is job related, family related, social, economic or academics related stress. among variety of variables producing negative e�ects on people’s health and wellness, stress is one of them as described by many today’s psychological researches. researchers reported that it is prevailing vastly among the students of university level1. academic stress creates a sense of stringent among not only students but also on parents. �is clench has been extending day by day on the life of students, due to the competitive environment. �is competitive environment is playing a chief role in creating academic stress among students. �e word academic stress has been characterized as the disturbance in psychical capabilities due to some pre-empt frustration which is the result of unable to succeed in academic life as well as their probability has the same consequence2. without using any techniques to cope up with academic stress by students, it becomes very harmful and can result in serious physical as well as psychological health conditions including weakened immune system, insomnia, muscle pain, troubled social life, anxiety, troubled cognition and high blood3. researcher suggested that stress as a consequence of academic demands count as the major irritating daily life stressors i.e. persistent pressure of studying, writing assignments, taking quizzes, planning for future and listening to the lecture instructor4. it is the nature of human being that either they take challenges boldly or escapes from it. all this diversi�ed from person to person. �erefore, it has been concluded that in individuals, those challenges that surpass the coping benchmark lead to stress. in this modern world of compete-till-death competition, the students are more prone towards career orientation and having a bright future. �ose students who somewhat fail to cope up with such circumstances or sometimes when they do not succeed to gratify their these needs then as a result this fail-to-cope-up situation causes stress and further causes depression and personal wellness. furthermore, academic stress leads to the dissatisfying mental situation prevalence because of expectations in education from their family, instructors, etc. academic stress among adult students has researched on from a very long time. researchers have pin pointed stressors, which are piles of assignments, competitions in academics, failures and poor relationships with other students5. �e consequences of stress on adults may a�ect adult development, physical health, and psychological well-being while it can be seen that minor or daily life stressors have recently in hold increased recognition in the life span of stress and illness6. �erefore, research has shown that quality of learning would negatively impact if there will be high academic stress7. furthermore, this will even importantly impact physical and emotional wellness of the students8. multi-researches have shown the level of distress is increasing rapidly like depression symptoms, suicidal thoughts on medical students, these e�ects is highly responsible of classroom performance and clinical practices. however, due to stress the student’s emotional problem, social and physical problem may in�uence the learning ability of students9. a recent research conducted on assessing the symptoms of stress and depression within medical university students and the �ndings prelude the immense increase in the amount of stress at average level of 5.51-6.49% till third year of university. �ere is a signi�cant increase in number of students, which are at high risk for experiencing symptoms of depression and there is an increased risk of experiencing perceived stress as well10. �e objective of the present study was to explore the relationship of academic stress with personal wellness as well as academic stress as a predictor of personal wellness in medical university students. methodology �is study was conducted during february 2017 to july 2017 at jinnah medical & dental college (jmdc) and bahria university medical & dental college (bumdc) located in the city of karachi, pakistan. for this observational study convenience sampling was done. inclusion criteria included 3rd and 4th year medical students, free from any kind of psychiatric medication, not under any psychotherapy treatment. �e type of study that has used in this research is correlational research in order to gather information through questionnaires for analysing the relationship between two of the variables i.e. academic stress and personal wellness. before taking written consent all participants were informed regarding the nature and protocol of the study with reassurance of con�dentiality of identity and personal information. in this study, 175 participants were considered consisting of 67 males and 108 females age ranged from 19-26 years. participants were given consent form before the main questionnaires of the research. �e data has gathered by using two of the questionnaires according to the variables of study i.e. lakaev academic stress response scale (lasrs) and five factor wellness inventory adult form, both of the instruments were self-administered inventories. lakaev academic stress response scale (lasrs) is a 26-items scale that measures severity of academic stress from nil to high. �e alpha coe�cient for 26 items were .874, suggesting that the items have relatively high internal consistency. five factor wellness inventory adult form is a 96-items questionnaire that measures a person’s holistic health and wellness and represents it from illness to wellness. results percentages & frequencies of sample’s demographics (year of study, gender, marital status & age) was analyzed by descriptive statistics. moreover, for analyzing the relationship between variables i.e. academic stress and personal wellness, pearson correlation and regression analysis was calculated. out of 175 participants 67 (38%) were males and 108 (61%) were females. marital status as shown in (table i), there were 85.7% of the participant were unmarried, 10.9% were married and 3.4% were committed. �e demographic variable, year of study showed the frequency of participants from 2nd year (30.9%) and 3rd year (30.3%) was high as compared to 4th year (21.7%), 1st year (15.4) and 5th year (1.1%). overall we recruited 105 patients and 92 consented to participate in the study with a response rate of 88%. �e age-range of participants was 18-26 from which majority from the range of 21-23 has participated in the study. academic stress had a signi�cant negative relationship with personal wellness. pearson correlation -0.539** indicating a moderate downhill (negative) relationship between academic stress and personal wellness, while overall results of the study suggest that around 29% of wellness correlates with academic stress (table ii). coe�cient of independent variable is showing that academic stress is a predictor of personal wellness personal. if academic stress increases, personal wellness will decrease by -0.539 standard deviation (table iii). table 1: frequencies and percentages of demographic variables (n=175) table 2: relationship between academic stress and personal wellness among medical students (n=175) (p ≤ .001) table 3: academic stress as a predictor of personal wellness in medical students (n=175) discussion �e aim of the present study was to test whether there is a relationship between academic stress and individual health that is personal wellness among medical students, which was cleared in the results that academic stress can negative e�ect person’s wellness. managing stress has been the best test for understudies everywhere throughout the world particularly the ones concentrate in �elds that require more consideration and request more investigation time. �e same was identi�ed that studies burden in academic years mostly leads to stress in students that e�ect their health as well as learning abilities11. �e idea of performing best in the exams its self is a stressful situation for the students of medical colleges and universities. and continues stress e�ect the students physical and emotional health12. it was further supported by di�erent studies that medical students have high work load in their academic years as they have to give more hours of their day to their studies which in return e�ect their quality of life. approximately 50% of medical students in united states experience stress, 25% have depression, and many su�er from chronic anxiety 13,14. as lazarus and cohen study indicates that the environment of the individual become negative and unyielding, the weariness is regularly referred to as a stressor in the coming years, and numerous understudies envision they have the condition they are examining hypochondriacal wonder15. another study suggested that the clinical years end up plainly normal and the fourth year is less unpleasant. be that as it may, in the primary year of house work (the temporary job), fatigue, burnout and lack of sleep end up noticeably real stressors16. absence of individual time keeps on focusing on them assist in their training years. some level of anxiety is helpful and at �rst important for self-awareness to happen, however now and again the measure of stress can overpower an understudy and in�uence their capacity to adapt. concealment of feelings is not the sound way to deal with controlling feelings, it acts s moderate toxin and continues in�uencing emotional well-being time by time in face of stress, take diverse however sensible point of view and �gure out how to adapt to it by changing how you respond to it. scholarly stress can act naturally oversaw. di�erent studies showed that stress management skills’ training has a good impact on the psychological well-being of people. �e same was also analyzed in di�erent studies as well17,18. conclusion academic stress e�ect the personal wellbeing in medical students. our examination shows that students of medical colleges and universities are su�ering from emotional problems because of high level of academic stress. so must have the knowledge while entering and through the learning procedure can truly set the phase for their future results, so we would recommend that these developmental encounters and unpleasant learning issues can e�ect one's self-improvement and block in keeping up their own health. �e authors recommend for the teachers and parents to keep in mind the meaning and importance of academic stress that in�uence students’ personal wellness to better understand and evaluate students’ personal needs and values, in order to assist and help them through their personal growth and development. references 1. zajacova a, lynch sm, espenshade tj. self-e�cacy, stress, and academic success in college. research in higher education. 2005 46;(6): 677-706. 2. kalariya nm, ramana kv, srivastav sk, van kujik fj. carotenoid derived aldehydes-induced oxidative stress causes apoptotic cell death in human retinal pigment epithelial cells. experimental eye research. 2008 86(1): 70-80. 3. shankar nl, park cl. e�ects of stress on students' physical and mental health and academic success. international journal of school & educational psychology, 2016 4(1): 5-9. 4. wilbert c. �e relationship between stress and mental health among students at the university of twente. bachelor's thesis, university of twente. 2012. 5. dhull i, kumari s. academic stress among adolescents in relation to gender. ijar. 2015 1(11): 394-396. 54 © 2019 lmrj liaquat medical research journal, 2019, 1, 3 31% 27% 17% 6. brantley pj, garrett vd. psychobiological apporaches to health and disease. in comprehensive handbook of psychopathology. 2002 (pp. 647-670). springer us. 7. lumley ma, provenzano km. stress management through written emotional disclosure improves academic performance among college students with physical symptoms. journal of educational psychology. 2003 95(3): 641-649. 8. garlow sj, rosenberg j, moore jd, haas ap, koestner b, hendin h, nemero� cb. depression, desperation, and suicidal ideation in college students: results from the american foundation for suicide prevention college screening project at emory university. depression and anxiety. 2008 25(6): 482-488. 9. shaikh bt, kahloon a, kazmi m, khalid h, nawaz k, khan n, khan s. students, stress and coping strategies: a case of pakistani medical school. education for health abingdon carfax. 2004 17, 346-353. 10. ludwig ab, burton w, weingarten j, milan f, myers dc, kligler b. depression and stress amongst undergraduate medical students. bmc medical education 2015 15(1): 141. 11. khalatbari j, azizzadeh-haqiqi f. �e impact of life skills training and stress management strategies on the mental health of female university students. knowledge and research in applied psychology. 2011 2(12). 12. edwards mt and zimet cn. problems and concerns among medical students. journal of medical education 1976 51(8): 619–625. 13. dyrbye ln, �omas mr, massie et al. burnout and suicidal ideation among u.s. medical students. annals of internal medicine. 2008 5(149):334–341. view at publisher. 14. dyrbye ln, �omas mr, and shanafelt td. systematic review of depression, anxiety, and other indicators of psychological distress among u.s. and canadian medical students. academic medicine. 2006 4(81):354–373. 15. lazarus rs and cohen jb. environmental stress. 2000. springer us. 16. weidner g, kohlmann cw, dotzauer e and burns lr. �e e�ects of academic stress on health behaviors in young adults. anxiety, stress and coping. 1996; 9(2):123-133. 17. qadiri-bahramabadi f and mikaeli-manee f. �e e�ectiveness of cognitive-behavioral stress management training on psychological well-being and school satisfaction of teenage girls. a r m a q a n e d a n e s h . 2015;20(5):433–443. 18. chubforushzadeh a, kalantari m and molavi h. �e e�ectiveness of cognitive-behavioral stress management on the subjective well-being of infertile women. quarterly of clinical psychology. 2009;1(4):1–9. lmrj type of the paper (article lmrj volume 3 issue 4 116 | p a g e case report hydroperitoneum: a complication of mini pcnl in pediatric age group? -a case report farheen batool1, waqar ahmed memon1, javed altaf jat1, shewak ram1, taimoor jatoi1, abdul qayoom ghangro 1 1department of urology, liaquat university of medical & health sciences, jamshoro, pakistan, abstract renal stones account for approximately 40% of renal disorders in pakistan including silent stones constituting up to 3%. nephrolithotomy and pyelolithotomy used to be the only surgical options offered to the patients presenting with large stones, with additional risk of complications. percutaneous nephrolithotomy (pcnl) has now being offered to the patients with even large renal stones for over the past three decades. with recent advances and provision of more modern equipments and technology, pcnl has become the gold standard treatment with quick recovery and reduced morbidity and mortality, and fewer associated complications. a boy aged 13 years, underwent mini pcnl for treatment of left side renal stone causing hydronephrosis, previously evaluated by kub x-rray and non-contrast ct scan. his retrograde-percutanous access to the collecting system was done under fluoroscopic guidance. after the procedure patient developed rigid and distended abdomen. aspiration revealed presence of intraperitoneal fluid. patient was effectively treated with immediate placement of abdominal drain with improvement of clinical presentation hydroperitoneum is a rare complication of conventional pcnl. based on our experience and review of published literature, our case of hydroperitoneum after mini pcnl, is the first of its kind. a high degree of sensitivity and knowledge of this complication during pcnl in children would help identify and manage this complication in future. we recommend examination of abdomen post-pcnl in every child before he/she is brought out of anesthesia key words: hyperperitoneum, renal stone, pcnl introduction urinary stone disease is a common global health issue involving 12% of the world population. urinary stones constitute 20% of the patients in the urology opd (1, 2). there is a geographical and age related variation in the incidence of urolithiasis but remains a major health concern in developing countries (3). renal stones account for 40% of renal disorders in pakistan (4), with silent stones constituting up to 3%, which are usually incidentally discovered while undergoing investigation for some other illness or on screening. percutaneous approach to access kidney for the first time described by goodwin et al. in 1955 for drainage of an obstructed renal system (5) followed by fernstrom and johansson in 1976 who removed a renal stone by using the same approach. these successful procedures opened up a whole new era of percutaneous renal surgery (6). before introduction of the percutaneous approach the only option available for large stones was the surgical removal by open surgical technique such as nephrolithotomy and correspondence: dr. waqar memon department of urology, liaquat university of medical & health sciences, jamshoro, pakistan email: drwaqarmemon@yahoo.com doi: 10.38106/lmrj.2021.3.0407 received: 12.11.2021 accepted: 22. 12.2021 published: 30. 12.2021 lmrj volume 3 issue 4 117 | p a g e pyelolithotomy, which was associated with a high risk of per-operative and post-operative complications. percutaneous nephrolithotomy (pcnl) is now being considered as the hallmark of treatment for large renal stones for past three decades(7). with advancement in the modern equipments and technology pcnl has now become the gold standard for this disease, resulting in reduced recovery time, shorter hospital stay and decreased morbidity and mortality (8, 9). pcnl is generally a safe procedure with a fewer complications(10). some of these complications occur secondary to tract access with injury to the adjacent organs such as lung, pleura, liver, colon and spleen. it may also be associated with general complications which can occur with any surgical procedure including hemorrhage, post-operative pain and fever (11). however, pcnl has advantage of having small incision, much less number of complications and shorter convalescence period (10). neverthless rate of stone removal has been reported to be almost 95% following pcnl. due to limited facility of eswl and pcnl open surgery remains the most commonly used procedure in many developing countries including pakistan(12). though many centres in pakistan are now offering these procedures but still limited to cities. mini pcnl (mpcnl), was introduced in early 1990s, where the modified procedure was defined as a pcnl performed through a track of < 22 f (13, 14). the first report of mpcnl presented 60 pediatric patients, who underwent pcnl using a 16-f sheath and 11-f pediatric cystoscope (15). case report a 13-years-old boy was brought to the urology clinic by his mother with 7-months history of left flank pain. he has recently developed pain in the right flank and dysuria for the same duration. he had been seen by many general practitioners and was on empirical medication off and on, with partial or no remission in symptoms. the patient looked well with no specific physical signs. his urine culture showed no bacterial growth. the ultrasound kub reported bilateral renal stones with hydronephrosis, which were further confirmed on x-ray kub which showed radiopaque shadows in both renal areas. a ct kub was done which revealed 3.5 cm size stone in renal pelvis and 1 cm size stone in lower pole with moderate hydronephrosis on left side and multiple stones without hydronephrosis on right side (figure. 1 a and b) a b figure 1: x-ray (a) and ct kub (b)of the 13-years-old child showing bilateral stones with left hydronephrosis lmrj volume 3 issue 4 118 | p a g e he was planned to undergo a mini pcnl in two stages, we opting to operate on the left side first. with the help of a 10 f pediatric cystoscope, a retrograde urogram (rgu) was done using a 4f ureteric catheter. a single radiopaque stone of approximately 3.5 cm size was visualized in the renal pelvis. a smaller stone (approx. 1 cm) was seen in the lower pole. initial puncture was done in the lower pole with ‘bull’s eye’ technique. serial dilatations were done up to 21f and a 22f amplatz’s sheath was placed. both stones were fragmented with pneumatic lithoclast. one fragment of stone migrated into upper calyx. for complete clearance of stones, another puncture was done with a simple dilator in upper pole. outer sheath of nephroscope was used in the tract and the stone was retrieved. the total time for the procedure, from rgu to skin suturing, was 60 minutes. after the procedure, abdominal distension was seen when the patient was turned supine. aspiration with 10cc syringe in the dependent part of abdomen was done. the aspirant was clear fluid and was thought to be irrigating fluid. an intra-peritoneal drain was placed. the patient’s postoperative recovery was uneventful. the drain output was 800cc on first postoperative day. on 3rd postoperative day, the drain was removed and patient was discharged. the postoperative x-ray kub showed no evidence of residual stones (figure. 2). figure 2: postoperative x-ray kub discussion surgical treatment of renal tract stones has been revolutionized in the recent past with availability of more minimal invasive options and less invasive techniques including eswl and pcnl (16). pcnl is now being commonly performed procedure in patients presenting with renal stones (17). it is generally safe procedure with quick recovery and shorter hospital stay. hemorrhage has been reported to the most frequently occurring complication, which can occur during needle passage or at the time of tract dilatation (18-20). other complications, rare albeit life-threatening, include injuries to colon, pleura, splenic and liver (11). hydroperitoneum, although a recognized complication of pcnl, is rarely mentioned in the literature. chen rui et al., in his article published in 2011, reported 2 cases of hydroperitoneum in a series of 86 adult patient undergoing pcnl (21). liu zhong-ze et al. report 11 cases of hydroperitoneum as complication among 436 patient series of pcnl done in age group 14 to 71 years (22). alfonso benincasa et al. report same complication occurring in two patients, both adults, who were managed by placement of intra peritoneal drain (23). no such complication in pediatric age group has ever been reported. we report hydroperitoneum occurring in a 13-year old boy, who was successfully treated by placement of an abdominal peritoneum drain. conclusion lmrj volume 3 issue 4 119 | p a g e hydroperitoneum is a rare complication of conventional pcnl. based on our experience and review of published literature, our case of hydroperitoneum after mini pcnl, is the first of its kind. a high degree of sensitivity and knowledge of this complication during pcnl in children would help identify and manage this complication in future. we recommend examination of abdomen post-pcnl in every child before he/she is brought out of anaesthesia. ethical consideration: this is a case report, anonymized. patient’s permission was sorted before using imaging. conflict of interest: there is no conflict of interest. funding: no funding involved in this case report. references 1. moe, o.w., kidney stones: pathophysiology and medical management. lancet, 2006. 367(9507): p. 333-44. 2. romero, v., h. akpinar, and d.g. assimos, kidney stones: a global picture of prevalence, incidence, and associated risk factors. rev urol, 2010. 12(2-3): p. e86-96. 3. resnick, m.i. and l. persky, summary of the national institutes of arthritis, diabetes, digestive and kidney diseases conference on urolithiasis: state of the art and future research needs. j urol, 1995. 153(1): p. 4-9. 4. naqvi, s.a., regional problems in pakistan-most prevalent kidney diseases and related problems. in jakarta, 1989: p. p.283–8. 5. goodwin, w.e., w.c. casey, and w. woolf, percutaneous trocar (needle) nephrostomy in hydronephrosis. j am med assoc, 1955. 157(11): p. 891-4. 6. fernstrom, i. and b. johansson, percutaneous pyelolithotomy. a new extraction technique. scand j urol nephrol, 1976. 10(3): p. 257-9. 7. brannen, g.e., et al., kidney stone removal: percutaneous versus surgical lithotomy. j urol, 1985. 133(1): p. 6-12. 8. türk, c., t. knoll, and a. petrik, guidelines on urolithiasis. . european urological association web site, 2014. 9. lam, h.s., et al., evolution of the technique of combination therapy for staghorn calculi: a decreasing role for extracorporeal shock wave lithotripsy. j urol, 1992. 148(3 pt 2): p. 1058-62. 10. zilberman, d.e., et al., tubeless percutaneous nephrolithotomy--the new standard of care? j urol, 2010. 184(4): p. 1261-6. 11. michel, m.s., l. trojan, and j.j. rassweiler, complications in percutaneous nephrolithotomy. eur urol, 2007. 51(4): p. 899-906; discussion 906. 12. khan, f.a. and j.h. khan, stone survey of punjab hospitals. pak post med j 1990. 1: p. 7-13. 13. schilling, d., et al., nomenclature in pcnl or the tower of babel: a proposal for a uniform terminology. world j urol, 2015. 33(11): p. 1905-7. 14. d'arcy, f.t., et al., renal track creation for percutaneous nephrolithotomy: the history and relevance of single stage dilation. can j urol, 2015. 22(5): p. 7978-83. 15. jackman, s.v., et al., the "mini-perc" technique: a less invasive alternative to percutaneous nephrolithotomy. world j urol, 1998. 16(6): p. 371-4. lmrj volume 3 issue 4 120 | p a g e 16. khan, s., l.a. toori, and k. anwer, the efficacy of percutaneous nephrolithotomy in renal and upper uretric calculi. pak j med res, 2005. 44: p. 89-91. 17. srivastava, a., et al., vascular complications after percutaneous nephrolithotomy: are there any predictive factors? urology, 2005. 66(1): p. 38-40. 18. roth, r.a. and c.f. beckmann, complications of extracorporeal shock-wave lithotripsy and percutaneous nephrolithotomy. urol clin north am, 1988. 15(2): p. 155-66. 19. lee, w.j., et al., complications of percutaneous nephrolithotomy. ajr am j roentgenol, 1987. 148(1): p. 177-80. 20. patterson, d.e., et al., the etiology and treatment of delayed bleeding following percutaneous lithotripsy. j urol, 1985. 133(3): p. 447-51. 21. chen, r., et al., prevention and management of complications of percutaneous nephrostolithotomy at initial stage. clinical journal of medical officers, 2011. 22. xue, l.z.-z.l.s.-j.z.f.-q.s.y.-q.w.x.-w., j.z.y.y.c.-s.j.w.-d.x.r.-t.c.j.-h. ji, and jie-ming., analysis of complications of minimally invasive percutaneous nephrostolithotomy. chinese journal of urology, 2006. 23. benincasa, a., et al., hydroperitoneum: a rare complication performing endoscopic combined intrarenal surgery. j endourol case rep, 2016. 2(1): p. 55-8. type of the paper (article lmrj volume 3 issue 3 49 | p a g e editorial an overview of the nottingham research programme on primary breast cancer in older women ruth m parks and kowk-leung cheung nottingham breast cancer research centre, university of nottingham, united kingdom abstract the incidence of breast cancer increases with age. despite this, most research in this field is aimed at the younger patient. preliminary studies have shown that older women with breast cancer have distinct biological features compared to their younger counterparts. in addition, the focus of treatment of older women may not simply be curative but may be a trade-off between risks of treatment and impact on independence and quality of life. the nottingham research programme is a unique programme dedicated to primary breast cancer in older women. there are two arms of the research programme 1) determining the biological differences of breast cancer in this cohort 2) exploring the use of geriatric assessment to understand the complex needs and factors contributing to treatment decision making in this group of patients. the overall aim of the research programme is to optimise both the biological and geriatric assessment of older women with primary breast cancer, to provide personalised data at diagnosis, on likely survival and quality of life outcomes following breast cancer treatment. this article will outline why this research programme is important, what it has achieved so far and future aspirations. key words: primary breast cancer, older women, biology, biomarkers, geriatric assessment, personalised medicine introduction importance of breast cancer in older women breast cancer is the most common cancer in women worldwide (1) and age is the biggest risk factor for development of breast cancer; risk increasing proportionally with age (2). in 2018, the number of new breast cancers diagnosed worldwide was approximately 2 million (3) with around 25% of cases in patients 70 years (4). due to ageing of the world’s population, it is expected that the number of older women living with breast cancer will double by 2040 to nearly 1 million cases in patients 70 worldwide per year (1, 5). the ageing of the world’s population is the result of the continued decline in fertility rates and increased life expectancy (6). this demographic change has resulted in increasing proportions of older persons. in 2019, approximately 9% of the global population were 65 years of age (7) and this is expected to double by 2050 (8). the crisis of our ageing population has been well documented (9, 10); the burden on health service resources in terms of financial and service provision will be unprecedented. breast cancer in older women will have a significant impact on this. differences between breast cancer in older compared to younger women existing data suggests that the biology of breast cancer in older women is different compared to their younger counterparts (11) and this may impact treatment decision making, alongside conventional factors, patient preference and discussion with the multidisciplinary healthcare team. for example, er-positivity of breast correspondence: dr. ruth m parks school of medicine, university of nottingham, biodiscovery institute university park, nottingham, ng7 2rd united kingdom email: ruth.parks@nottingham.ac.uk doi: 10.38106/lmrj.2021.3.3-01 received: 20.09.2021 accepted: 25. 09..2021 published: 30. 09.2021 lmrj volume 3 issue 3 50 | p a g e cancer increases with increasing age (12), thereby making primary endocrine therapy (pet) a potential primary treatment option in older women. a number of other biomarkers have been identified outside of those routinely measured, which could potentially have predictive and prognostic significance in older women with primary breast cancer (13). furthermore, it is recognized that there are other factors which influence treatment decision making in older compared to younger women, such as impact of treatment on quality of life and preservation of independence (14, 15). whilst younger women may consider curative intent the end goal of breast cancer treatment, older women may not be willing to tolerate the same level of invasive treatment if it means a reduction in their usual functioning, especially giving the slow growing nature of breast cancer in this age group. nottingham breast cancer research programme the nottingham team based in the united kingdom has a dedicated research programme focused on primary operable breast cancer in older women. the centre describes a large consecutive series of older women with primary breast cancer, for whom long-term follow-up data is available (11, 16). there is also a younger cohort of primary breast cancer patients, available for comparative analysis (17). there are currently two arms of the research programme in older women, one focussing on profiling the unique biology of primary breast cancer in this series and the second arm, focussing on the application of geriatric assessment (ga). biology theme the cohort consists of 1,758 women with early operable breast cancer aged 70 years. long-term follow-up data (up to 37 years) and survival outcomes for the whole cohort has been collected and described (18) for all patients, where available. from the whole series, 813 patients underwent primary surgery. it has been possible to construct 575 tissue microarrays (tmas) using the surgical excision (se) samples and a panel of 25 biomarkers has been assessed in these se tmas (11). it has been possible to construct 693 tmas from cnb samples from the overall cohort. a panel of 18 biomarkers has been measured in the cnb tmas in patients who had er-positive breast cancer (19). summary of significant findings to date cluster analysis in both the se tmas and cnb tmas identified a novel biological cluster of disease, which is distinct from standard clusters seen in younger women (11, 19). the unique cluster, termed ‘low er luminal’ had high expression of luminal cytokeratins, mucin (muc)1 and her3 compared to the other conventional clusters and had different bcss compared to conventional clusters. similar findings suggesting a differing biology (with differing clinical outcomes) according to age, have also been found in terms of histological type (20), as well as in her2-positive (21) and tnbc (22) and in response to treatment (23). both the work in the se and cnb tmas have identified potential biomarkers which may be of use in predicting response to therapy and overall survival in older women with primary breast cancer. geriatric assessment theme a prospective pilot study implementing a cancer-specific ga in older patients with primary breast cancer is in progress and is currently being conducted in four centres internationally. patient recruitment commenced in 2009 and invites women aged ≥70 years with early-stage operable primary breast cancer to participate. the aim is to examine the value of using a validated cancer-specific comprehensive geriatric assessment (cga) (24) to assess older patients undergoing surgery versus non-operative treatment. the cga is performed within 6-weeks and 6-months post-diagnosis, supplemented by using eortc qlq c-30 and br23 as formal measures of qol (25, 26). summary of significant findings to date a pilot study performed in nottingham specifically examined feasibility of implementation of ga in 47 older women (≥70 years) with early operable primary breast cancer (27). decision of primary treatment followed consultation with the clinical team and was not guided by ga. ga determined that increasing age, greater lmrj volume 3 issue 3 51 | p a g e comorbidity, greater number of daily medications and slower timed up and go (a measure of physical function) were significantly related to non-surgical treatment. quality of life remained stable at 6 months in all patients regardless of treatment. average time to complete the ga was 32 minutes (range 15 – 65 minutes) and was conducted by a variety of trained research team members, who were not necessarily clinicians; this pilot study confirmed the feasibility of ga in a research setting. the most recent findings of the study data from three uk centres, was presented at the international society of geriatric oncology (siog) 2019 annual conference and reported results from 88 women who underwent surgery (28). results were conflicting in that there was an improvement in some questions related to functional status and a decline in others, with no clear pattern and no relationship with intensity of surgery. the study is currently ongoing and involves several centres across the uk and hong kong, with the aim of recruiting over 1000 patients. summary – future of the research programme in the future we see the development of a tool to analyse an extensive panel of biomarkers for each individual older women with primary breast cancer, based on their core needle biopsy specimen. this would help to generate a predicted outcome for each potential treatment option they are considering. furthermore, development of a ga specific for primary breast cancer patients, which can be utilised alongside the above measures of biology either in the surgical clinic or before referral at the level of general practice in the community, will provide a detailed understanding of individual issues which must be considered in discussions between healthcare professionals and patient and their families. clear guidance needs to be developed as to how to use information derived from ga further and how to standardise potential interventions. effective utilisation of the unique biology and geriatric needs of older women with primary breast cancer will result in optimal treatment and quality of life outcomes for these patients and will provide a truly personalised approach. references 1. world health organisation. international agency for research on cancer. available at: https://www.iarc.fr [accessed: 24th june 2019]. 2019. 2. cruk. cancer research uk. breast cancer incidence (invasive) statistics. available at: https://www.cancerresearchuk.org/health-professional/cancer-statistics/statistics-by-cancer-type/breast-cancer/incidence-invasive#heading-one [accessed: 29th may 2020]. 2016. 3. american institue for cancer research: world cancer reserach fund. breast cancer statistics. available at: https://www.wcrf.org/dietandcancer/cancer-trends/breast-cancer-statistics [accessed: 12th may 2021]. 2018. 4. american institute for cancer research: world cancer research fund. breast cancer [online]. available at: https://www.wcrf.org/dietandcancer/breast-cancer [accessed: 12th may 2021]. 2018. 5. macmillan cancer support publication: breast cancer in older women. key statistics. 2012. 6. (who) who. population ageing. world health organization online. 2010. 7. un. united nations. world population prospects 2019 [online]. available at: https://www.un.org/en/sections/issuesdepth/population/index.html [accessed: 19th may 2020]. 2019. 8. un. united nations, department of economics and social affairs, population division. world population prospects 2019: data booklet (st/esa/ser.a/424). 2019. 9. united nations. economic and social affairs publication: world population ageing. highlights. 2017. 10. office for national statistics. how would you support our ageing population? available at: https://www.ons.gov.uk/peoplepopulationandcommunity/birthsdeathsandmarriages/ageing/articles/howwouldyousupportourageingpopulation/2019-06-24 [accessed: 29th april 2020]. 2019. https://www.iarc.fr/ https://www.cancerresearchuk.org/health-professional/cancer-statistics/statistics-by-cancer-type/breast-cancer/incidence-invasive#heading-one https://www.cancerresearchuk.org/health-professional/cancer-statistics/statistics-by-cancer-type/breast-cancer/incidence-invasive#heading-one https://www.cancerresearchuk.org/health-professional/cancer-statistics/statistics-by-cancer-type/breast-cancer/incidence-invasive#heading-one https://www.wcrf.org/dietandcancer/cancer-trends/breast-cancer-statistics https://www.wcrf.org/dietandcancer/breast-cancer https://www.un.org/en/sections/issues-depth/population/index.html https://www.un.org/en/sections/issues-depth/population/index.html https://www.ons.gov.uk/peoplepopulationandcommunity/birthsdeathsandmarriages/ageing/articles/howwouldyousupportourageingpopulation/2019-06-24 https://www.ons.gov.uk/peoplepopulationandcommunity/birthsdeathsandmarriages/ageing/articles/howwouldyousupportourageingpopulation/2019-06-24 lmrj volume 3 issue 3 52 | p a g e 11. syed bm, green ar, paish ec, soria d, garibaldi j, morgan l, et al. biology of primary breast cancer in older women treated by surgery: with correlation with long-term clinical outcome and comparison with their younger counterparts. british journal of cancer. 2013;108(5):1042-51. 12. cheung kl, wong aws, parker h, li vwy, winterbottom l, morgan dal, et al. pathological features of primary breast cancer in the elderly based on needle core biopsies—a large series from a single centre. critical reviews in oncology/hematology. 2008;67(3):263-7. 13. parks rm, alfarsi lh, green ar, cheung kl. biology of primary breast cancer in older women beyond routine biomarkers. breast cancer. 2021;28(5):991-1001. 14. howard p ck, cox k. decision making in older women with primary breast cancer: the trade-off of the risks and benefits of treatments. future oncol. 2019;15:02. 15. penny howard kc, kwok-leung cheung. o2. decision making in older women with primary breast cancer: the trade-off of the risks and benefits of treatment. future oncology. 2019;15(7s):14-5. 16. syed bm, al-khyatt w, johnston sj, wong dwm, winterbottom l, kennedy h, et al. long-term clinical outcome of oestrogen receptor-positive operable primary breast cancer in older women: a large series from a single centre. british journal of cancer. 2011;104(9):1393-400. 17. abd el-rehim dm, ball g, pinder se, rakha e, paish c, robertson jfr, et al. high-throughput protein expression analysis using tissue microarray technology of a large well-characterised series identifies biologically distinct classes of breast cancer confirming recent cdna expression analyses. international journal of cancer. 2005;116(3):340-50. 18. syed bm, johnston sj, wong dwm, green ar, winterbottom l, kennedy h, et al. long-term (37 years) clinical outcome of older women with early operable primary breast cancer managed in a dedicated clinic. annals of oncology. 2012;23(6):1465-71. 19. parks rm, albanghali m, syed bm, green ar, ellis io, cheung kl. biology of oestrogen-receptor positive primary breast cancer in older women with utilisation of core needle biopsy samples and correlation with clinical outcome. cancers (basel). 2020;12(8). 20. mathew j, lee s, syed bm, morgan dal, ellis io, cheung kl. a study of ductal versus non-ductal invasive breast carcinomas in older women: long-term clinical outcome and comparison with their younger counterparts. breast cancer research and treatment. 2014;147(3):671-4. 21. syed bm, green ar, ellis io, cheung kl. human epidermal growth receptor-2 overexpressing early operable primary breast cancers in older (≥70 years) women: biology and clinical outcome in comparison with younger (<70 years) patients. annals of oncology. 2014;25(4):837-42. 22. syed bm, green ar, nolan cc, morgan dal, ellis io, cheung k-l. biological characteristics and clinical outcome of triple negative primary breast cancer in older women – comparison with their younger counterparts. plos one. 2014;9(7):e100573. 23. parks rm, albanghali ma, syed bm, green ar, ellis io, cheung kl. patterns of biomarker expression in patients treated with primary endocrine therapy a unique insight using core needle biopsy tissue microarray. breast cancer res treat. 2021;185(3):647-55. 24. hurria a, gupta s, zauderer m, zuckerman el, cohen hj, muss h, et al. developing a cancer-specific geriatric assessment: a feasibility study. cancer. 2005;104(9):1998-2005. 25. ze winters ma, g rumpold, b holzner, a oberguggenburger, ra vieira, s hartnup et al. international phase 4 validation of the eortc patientreported outcome measure (prom) in breast reconstruction (brr): evaluating the psychometric properties and clinical effectiveness. 2016;25:66. 26. z winters ma, c rutherford, b holzner, g rumpold, ra da costa vieira, s hartup et al. international validation of the european organisation for research and treatment of cancer qlq-brecon23 quality-of-life questionnaire for women undergoing breast reconstruction. 2018;44:867. 27. parks rm, hall l, tang s-w, howard p, lakshmanan r, winterbottom l, et al. the potential value of comprehensive geriatric assessment in evaluating older women with primary operable breast cancer undergoing surgery or non-operative treatment &#x2014; a pilot study. journal of geriatric oncology. 2015;6(1):46-51. 28. parks r. impact of breast cancer surgery on functional status and independence. journal of geriatric oncology. 2019;10(6):s1. type of the paper (article lmrj volume 3 issue 4 86 | p a g e editorial global burden of gynecological cancers khashia sayed department of obstetrics and gynaecology, guys and st. thomas hospital, london, united kingdom abstract gynecological cancers include malignant tumours arising from reproductive organs in women including ovaries, uterus, vagina vulva, and cervix. cervical cancer is reported to be the most common cancer while the vagina is reported to have the lowest incidence all around the world. according to the world health organization report asia has the highest rate of gynecological cancers followed by africa, europe, latin america, north america, and the lowest rate is observed in oceania. the rate was predicted to rise in the upcoming years. thus appropriate strategies are needed to be adopted to control disease outcomes and adopt preventive strategies. key words: gynecological cancers, global burden introduction gynecological cancers include a group of malignant tumours arising from ovaries, uterus, vagina, cervix, and vulva. this also includes cancers arising from fallopian tubes but it is very rare. these are exclusively women's cancers, and given their anatomical location, these cancers are diagnosed late resulting in poor survival with exception of cervical cancer where screening is available with a chance of early diagnosis. gynecological cancers accounted for 671 875 reported deaths in 2020. the incidence and mortality are predicted to be doubled by 2040. this editorial aimed to discuss the current global burden of gynecological cancers, future predictions, and discuss strategies to prepare for this upcoming major health issue(1,2). figure 1 presents reported rates of gynecological cancers in all continents, where cervical cancer remains at the top among asian, african and, latin american populations while in europe and north american regions and oceania uterine cancer has been observed to be the most common malignancy. region-wise distribution of cancers is given in figure 2 and 3. cervical cancer not only shows high incidence but high mortality is also being reported due to cervical cancer. it can be debated that the high incidence of cervical cancer could be reported due to national screening programs, but looking at the high incidence among asian and african women it doesn’t seem to be applicable due to the lack of nationwide screening facilities in asia and africa. there is another point worth mentioning here that these are the reported cases or those who seek treatment; but among asian and african women it is also important that patients who were registered at a cancer hospital were the cases included here in statistical data, with a potential chance of excluding those patients who remained undiagnosed or did not reach cancer hospitals for treatment. given the limited resources in many asian and african countries, many women die of cancer without getting appropriately diagnosed. also due to the anatomical location of the reproductive organs of women, these tumours grow bigger without producing any specific signs or symptoms of cancer resulting in late diagnosis and high mortality. till to date, cervical cancer was the exception where screening is possible. however ovarian mass can be easily diagnosed on ultrasound; a non-invasive easily available facility which can be potentially used for early diagnosis. however, results of the studies testing per-vaginal ultrasound and additional serum level of ca125 could not show promising results due to the high rate of false positives(3,4). though there is a potential chance of influence of operative dependency of ultrasound. correspondence: khashia sayed, consultant gynecologist, guys and st. thomas hospital, london, united kingdom email: khashia.sayed@gstt.nhs.uk doi: 10.38106/lmrj.2021.3.04-01 received: 12.11.2021 accepted: 25. 12.2021 published: 30. 12.2021 mailto:khashia.sayed@gstt.nhs.uk lmrj volume 3 issue 4 87 | p a g e figure 1: distribution of gynecological cancerglobocan data(2) (adopted from globocan 2020 data) figure2: global incidence of gynecological cancers2020(2) (adopted from globocan 2020 data) 0 50000 100000 150000 200000 250000 300000 350000 400000 asia africa europe latin america north america oceania global incidence of gynecological cancer2020 uterus ovaries cervix vagina vulva lmrj volume 3 issue 4 88 | p a g e figure 3: global mortality of gynaecological cancers2020(2) (adopted from globocan 2020 data) ovarian cancer has shown an association with brca genes mutations, which is a known risk factor. thus a combination of ultrasound, serum markers, and genetic testing can potentially provide a robust screening and prediction system for ovarian cancer. thus instead of just one modality; if other markers are added in combination with genetic testing will increase its sensitivity and specificity. serum analysis and vaginal – abdominal ultrasound may also be tested. according to who prediction, the rate of gynecological cancers will be doubled by the year 2040 (figure 4). the highest rise is again expected in cervical cancer worldwide where asia will face more than 40% rise. the health care system among asian and african countries is not yet ready to bear such a huge burden. figure 4: current incidence (ie 2020) and predicted rise by 2040 in gynaecological cancers(2) (adopted from globocan 2020 data) 0 50000 100000 150000 200000 250000 asia africa europe latin america north america oceania global mortality of gynecological cancer2020 uterus ovaries cervix vagina vulva 0 100000 200000 300000 400000 500000 600000 700000 800000 900000 uterus ovary cervix vagina vulva chart title reported cases 2020 prediction for 2040 lmrj volume 3 issue 4 89 | p a g e thus it is important to understand the upcoming major health issue. a few measures need to be taken by all the governments and health care organizations: 1. establishment of cancer registries in most of the developing countries cancer registries are not yet established in their true spirit even if established they are not fully functional. lack of trained personnel to establish and run the registry is one of the major issues faced by most developing countries. therefore, in this regard developed countries may volunteer their services in providing human resource training and facilitation in establishing the registry. the developing countries on the other hand should also come forward and seek help from countries where cancer registries are fully functional. 2. understanding of clinical course and biology of cancer at national level since cancer is a heterogeneous disease, showing a differing pattern of clinical course and biology according to the age and race. thus an understanding of cancer biology is of utmost importance to develop appropriate treatment guidelines. understanding biology and biological mechanisms will lead to the identification of novel therapeutic targets. 3. development of new therapeutic agents since most cancer therapy options are very costly thus the rising rate of cancer will not only affect individuals, family units but also pose a huge economic burden on countries. developed countries have established centers and enough budget to control and further expand resources, but developing countries with limited resources will not be able to bear such a huge burden. thus the development of local lowcost drugs and targeted therapies will help them to be abreast with such upcoming major health issue. conclusion gynecological cancers are predicted to be doubled in the upcoming years, it is therefore recommended to understand its epidemiology, development of cancer registries, understanding of cancer biology and provision of new economical treatment/ therapeutic options. references 1. pilleron s, sarfati d, janssen-heijnen m, vignat j, ferlay j, bray f, et al. global cancer incidence in older adults, 2012 and 2035: a population-based study. int j cancer. 2019;144(1):49–58. 2. globocan. 2020. available from: https://www.uicc.org/news/globocan-2020-new-global-cancerdata. 3. charkhchi p, cybulski c, gronwald j, wong fo, narod sa, akbari mr. ca125 and ovarian cancer: a comprehensive review. cancers (basel). 2020 dec 11;12(12):3730. 4. roupa z, faros e, raftopoulos v, tzavelas g, kotrotsiou e, sotiropoulou p, et al. serum ca 125 combined with transvaginal ultrasonography for ovarian cancer screening. in vivo [internet]. 18(6):831–6. type of the paper (article lmrj volume 3 issue 3 53 | p a g e research article ligation of intersphincteric fistula tract as an alternative treatment for perianal fistula at tertiary care hospital nawaz ali dal1, ishrat raheem katyar1, mohammad qasim mallah1, ahsan laghari1, shiraz shaikh1, abdul ghafoor dalwani1 1 department of surgery, liaquat university of medical and health sciences, jamshoro, pakistan abstract this study was aimed to evaluate clinical outcome of patients with perianal fistula operated with the ligation of intersphincteric fistula tract (lift) technique. the study was conducted at department of surgery, liaquat university of medical & health sciences, jamshoro from july 2018 and august 2019. a total of 22 patients diagnosed with perianal fistula operated with the ligation of intersphincteric fistula tract (lift) technique were selected using non-probability consecutive sampling technique. physical examination and magnetic resonance imaging (mri) and/or endosonography (es) were performed to make a confirmed diagnosis of fistula. they were classified according to parks classification. all patients were subjected to intersphincteric fistulous tract ligation using the technique defined by rojanasakul modified. there were 16 males and 6 females. mean age was 42 years (range 23-68 years of age). out of 22 patients, 17 patients had a history of perianal abscess drainage prior to surgery and an average preoperative symptom presentation was 2.2 years (range 0-10 years). therapeutic success with first surgery was achieved in 77% and with a second surgery in 90%. none of this patients modified their preoperative wexner. it was concluded that lift technique appears to be a convenient, reproducible, and effective surgical alternative. this provides an appropriate closing rate and without continence modification, therefore indicated for complex cryptoglandular fistulas. key words: ligation of intersphincteric fistula tract (lift); perianal fistula; magnetic resonance imaging; endosonography; fistulotomy. introduction anorectal fistula represents the chronic phase of anorectal abscess and is defined as the persistence of a fibrous path covered by granulatory tissue between an internal primary hole and one or multiple external secondary holes in the skin of the perianal region, clinically resulting in fouling, wet anus, cyclic perianal pain and chronic drainage of associated purulent material, abscess formation and intermittent spontaneous drainage.1 its origin is cryptogladular in about 90% of cases and in the remaining it is due to other conditions such as crohn's disease, local radiation, cancer and trauma. the cryptoglandular theory is based on the constant exposure of fecal load in the internal fistulous orifice associated with the tightness of the path, ultimately causing the septic focus to be perpetuated.2 the surgical treatment of the fistula is basically aimed at achieving healing of the fistulous tract without altering function of the anal sphincter and avoiding the recurrence of the path as much as possible.3 the literature shows a variety of surgical techniques for resolution of the complex fistulas, although some achieve efficient control of the disease, with an average recurrence of 5%. however incontinence resulting from procedures range between 10% and 57%.4 currently, the best surgical alternative in complex anorectal fistula is being sought, unfortunately the evidence is low, given the series reported are heterogeneous, with variable and short post-operative follow-up.5 classical techniques such as fistulotomy and the seton or cutting line technique have a recurrence rate of up correspondence: nawaz ali dal department of surgery, liaquat university of medical & health sciences, jamshoro, pakistan email: drnawazdal001@gmail.com doi: 10.38106/lmrj.2021.3.03-02 received: 09. 06.2021 accepted: 28. 08..2021 published: 30. 09.2021 lmrj volume 3 issue 3 54 | p a g e to 9%, causing variable deterioration of anorectal function with the figures already described. fecal incontinence is one of the main problems of fistula treatment, since in both techniques the internal anal sphincter is sectioned.6 when considering aspects related to preservation of sphincter continence and rate of recurrence new techniques have been brought in order to solve the problem. such as biological sealants have emerged (ie. fibrin glue injection), use of caps of different materials, advanced therapies related to the use of stem cells and novel surgical techniques including lift.7 the lift fundamentally considers ligation and excision of the intersphincteric path, managing to block the entry of fecal material into it, eliminating the chronic cryptoglandular septic sinus.8 the technique contemplates the preservation of both anal sphincters, an aspect that almost completely reduces the risk of incontinence.9 the first report of this technique was a thai experience developed by rojanasakul et al.,10 in 2007, as a modification to the technique described by matos et al. where the description of this technique was made in 18 patients with a rate of success as 94%, without reporting alterations in continence. since then, other authors have published their experiences with success rates in relation to cure between 47% and 95%, not forgetting the real benefit regarding the maintenance of fecal continence.8,9 one of the most important bias identified in systematic reviews was the variability detected in the technique with respect to the classic lift. in addition, hybrid lift techniques have been incorporated with the combined use of biomaterials, which makes evaluating the potential of the technique even more complex. the objective of this study was to present our results in terms of clinical efficacy and incontinence with the lift technique and to enhance its role as a treatment alternative for anorectal fistula. methodology this study was conducted at department of surgery, liaquat university of medical & health sciences, jamshoro, from july 2018 and august 2019. twenty-two patients diagnosed with perianal fistula operated with the lift technique were selected using non-probability consecutive sampling technique. patients included in this study were informed of the procedure to be performed and the possible complications of the procedure. detailed written informed consent for the operation was obtained from the hospital treatment chart. this study was approved by local ethics committee. a physical examination and magnetic resonance imaging (mri) and/or endosonography (es) were performed to confirm diagnosis of fistula. they were classified according to parks classification11. complex fistulas identified as medium and high trans-sphincter were exclusively included, depending on the proportion of external anal sphincter involved (> 30%) and anterior fistulas in women. patients with fistulas whose origin was not cryptoglandular were excluded. colonoscopy was performed on all patients to rule out crohn's disease. all patients were subject to lift using the technique defined by rojanasakul modified10. surgical procedure the procedure was carried out under regional anesthesia. curved incision in the intersphincteric space over the path of the fistula was made and dissected until it was released. ligation and cutting of the fistula was done, curettage of the distal path and enlargement of the external orifice (ofe) was performed. the modified technique included curettage of the proximal path with gauze and invagination of the ligation ends with resorbable material. the internal orifice (ofi) was not closed (modification proposed in other series) due to the theoretical risk of a new abscess. demographic and clinical data were recorded in a prospective database, all patients had a preoperative clinical evaluation and an average postoperative follow-up of 48 weeks. clinical success was defined as the absence of symptoms and signs of fistula within 3 months of surgery. incontinence was measured and classified by the wexner scale12. statistical methods data was recorded and analysed by using statistical package for social sciences (spss version 22.0). mean of the continuous variables is presented along with range and frequency distribution was presented for categorical variables. lmrj volume 3 issue 3 55 | p a g e results out of 22 patients underwent surgery for perianal fistula using the lift technique, 16 were males and 6 were females, as shown in figure 1. the mean age was 42 years ranging between 23 and 68 years. 18 patients were asa i and 4 asa ii while 17 patients had a history of perianal abscess drainage prior to surgery and mean preoperative symptom presentation was 2.2 years (range 0-10 years). in 16 patients, it was decided to install a non-cutting seton prior to final surgery. this was done in order to manage the infectious part of the fistula and to obtain a more fibrous path. mean time between seton and lift was 60 days. the lift was performed on 6 patients without prior settling. in the preoperative study, 20 patients underwent enhanced contrast pelvic mri and 1 endosonography as described in table 1. twenty patients had a wexner score of 0 points and 2 of 1 point in the preoperative assessment. mean duration of surgical procedure was 39.7 minutes. all patients received a prophylactic antibiotic with 1 gram iv ceftriaxone and 500 mg iv metronidazole. none of the patients had intraoperative complications and all were discharged 24 hours post operatively. at discharge, all patients were given oral antibiotics for 7 days (ciprofloxacin 500 mg every 12 hours and metronidazole 500 mg every 8 hours), pain relievers and nonsteroidal antiinflammatory drugs for 3-5 days. an average follow-up of 48 weeks was performed with a range of 24 to 96 weeks. complete closure was achieved in 77% (n=17 patients). in postoperative follow-up, fistula recurrence was observed in 5 patients (23%) with a simpler fistula. all of them underwent fistulotomy along the way. after this second intervention, 90% clinical success was obtained in the follow-up. none of the 5 cases had reported any incontinence. no patient out of 22 has modified their wexner at follow-up as shown in table 2. figure 1. distribution of the gender of the patients included in the study 16 6 73.0 27.0 0 10 20 30 40 50 60 70 80 male female frequency percentage lmrj volume 3 issue 3 56 | p a g e tables 1. characteristics of the study patients (n=22) characteristics no. (% or range) mean age 42 years (23-68 years) mean symptoms time 2.2 years (0-10 years) previous abscess drainage 17 fishing line 60 days prior 16 mri-endosonography 20-2 table 2. summary of results (n=22) operated 22 patients mean operating time 39.7 minutes atb prophylaxis 22 mean days of hospitalization one mean postoperative eva high 0-1 early complications 0 tracing 48 weeks (24-96 weeks) full closure in 2 stages *77% (17/22 patients)90% (20/22 patients) recurrence (all were treated with a simple fistulotomy) 23% (5 patients with ofe secretion, down staging) recurrence and previous line 4/5 had no line ** wexner modification 0 * after the first lift, primary closure was obtained in 77% of the cases, 90% of closure was achieved after a second intervention in the relevant cases. ** recurrence occurred in 4 out of 5 patients, in whom a seton was not positioned in the first fistulotomy. discussion for a long time, the anal rectus mucosa advancement flap was considered the gold standard for the surgical treatment of complex fistulas with retention of sphincter function, showing success rates between 27-100%, but with incontinence rates of up to 35%8,9. precisely in order to improve these results, the lift procedure has recently emerged as an attractive alternative for the surgical treatment of complex anorectal fistulas. its principle is to treat the fistula and its origin without compromising the apparatus of the sphincter. it presents a final closing rate of 47% to 94% in different reported series, with no continence commitment in any of these series13. other advantages of the procedure are low postoperative pain, quick reintegration into the workplace and lower economic costs compared to other techniques requiring the use of biological materials. reviewing the literature, there is only one national publication on the subject, from the bahawal victoria hospital bahawalpur pakistan. this work shows an experience in 30 patients subjected to ligation of intersphincteric fistula tract. twenty-five (83%) patients were cured and only five (17%) patients had fistula recurrence and were thus considered as not cured. none of the patient was presented with incontinence14. the present study shows similar results of those who experienced the lift treatment, recorded in the literature. while the number of patients was small, the proportion of patients who had an indication to fistulotomy or other non-surgical procedures for a complicated and alternative treatment was similar to that. it should be noted that during the study period, 240 fistulas were operated at the main study center (department of surgery at liaquat univeristy hospital, lumhs jamshoro), of which only 22 (9%) were operated in lmrj volume 3 issue 3 57 | p a g e the lift; this indicates that the option of performing the technique is very limited and is not currently one of preferred techniques of colorectal surgeons. in relation to the patients in the present case, as in the series of patients with perianal fistula of cryptoglandular origin, these occur at intermediate ages, without significant comorbidities, and an outpatient procedure can be provided comfortably, with regional anesthesia, without greater analgesic requirements and with rapid functional and occupational recovery. no patient without recurrence had to consult urgently when monitoring patients during the postoperative period and all were able to control their surgery-related discomfort with the indications provided at discharge15. analyzing the findings, considering the closure of the fistula as the main goal, this series indicates a closure of 77% only with the lift treatment and if we find closure in two stages after a more basic (intersphincteric) recurrence, the closure rate is close to 90% (20 out of 22 patients), with 100% of them without sphincter continence modification, which is the main objective. when analyzing the recurrence cases (ie 5 patients, which makes only 23% of the total), 4 of them had a recurrence that was intersphincteric, as the literature indicates as a "downstaging" of a complex process in which the recurrence corresponds to the most frequent, proximal portion of the fistula, and that a simple fistulotomy can show good results and protection in the sphincter can be solved in a second period. it is interesting that most primary success patients have previously installed a line, indicating that previous drainage and pathway conduction may affect the success of fistula healing, but the literature is not categorical in this regard, given the limited number of cases, and this variable cannot be assigned a meaning. neither can we assume that the modifications in the procedure affect the success rate, but we postulate that the installation of a line in advance, the curettage with gauze of the fistulous tract, the closure of the internal orifice and the invaginating muscle plasticity of the ends of the ligation may impact better healing of the closure by decreasing the risk of recurrence. conclusion in conclusion, the lift technique appears to be a convenient, reproducible, and effective surgical alternative. this provides an appropriate closing rate and without continence modification, so we suggest it as a good option for cryptoglandular fistulas. ethical consideration: the study was approved by ethics committee of liaquat university of medical & health sciences, jamshoro, pakistan conflict of interest: there is no conflict of interest. funding: this study was not funded by any agency references 1. whiteford m. perianal abscess/fistula disease. clin colon rectal surg. 2007 may;20(2):102–9. 2. burney re. perianal abscess. in: clinical scenarios in surgery: decision making and operative technique. wolters kluwer health adis (esp); 2012. p. 229–34. 3. fung a, card g, ross n, yule s, aly e. operative strategy for fistula-in-ano without division of the anal sphincter. ann r coll surg engl. 2013 oct;95(7):461–7. 4. williams g, williams a, tozer p, phillips r, ahmad a, jayne d, et al. the treatment of anal fistula: second acpgbi position statement 2018. color dis. 2018 jul;20:5–31. 5. adegbola s. medical and surgical management of perianal crohn’s disease. ann gastroenterol. 2018; 6. bubbers e, cologne k. management of complex anal fistulas. clin colon rectal surg. 2016 feb 16;29(01):043–9. 7. limura e. modern management of anal fistula. world j gastroenterol. 2015;21(1):12. lmrj volume 3 issue 3 58 | p a g e 8. vergara-fernandez o. ligation of intersphincteric fistula tract: what is the evidence in a review? world j gastroenterol. 2013;19(40):6805. 9. hong kd, kang s, kalaskar s, wexner sd. ligation of intersphincteric fistula tract (lift) to treat anal fistula: systematic review and meta-analysis. tech coloproctol. 2014;18(8):685–91. 10. rojanasakul a, pattanaarun j, sahakitrungruang c, tantiphlachiva k. total anal sphincter saving technique for fistula-in-ano; the ligation of intersphincteric fistula tract. j med assoc thail. 2007;90(3):581–6. 11. barredo c, leiro f. abscesos y fístulas perianeales. cir dig. 2009; 12. claudio wainstein g, rodrigo quera p, maria isabel qg. incontinencia fecal en el adulto: un desafio permanente. rev médica clínica las condes. 2013 mar;24(2):249–61. 13. scoglio d, walker a, fichera a. biomaterials in the treatment of anal fistula: hope or hype? clin colon rectal surg. 2014 nov 10;27(04):172–81. 14. ch ms, khan mi, anwar m. eeffectiveness of the ligation of intersphincteric fistula tract in the treatment of high lying perianal fistula. pdfs.semanticscholar.org. 15. holzheimer rg, siebeck m. treatment procedures for anal fistulous cryptoglandular abscess how to get the best results. vol. 11, european journal of medical research. 2006. type of the paper (article lmrj volume 4 issue 01 22 | p a g e research article evaluation of the pattern of contrast sensitivity in glaucoma patients muhammad asif, sania raheem, abdul hameed talpur, mehak nazeer, muhammad karim, um-e-farwa isra school of optometry, al-ibrahim eye hospital, karachi, pakistan abstract this prospective cross-sectional study was conducted to measure the contrast sensitivity in different types of glaucoma patients. the patients for this study were identified using a non-probability convenient sampling method from 01st february 2020 to 30th august 2020. the diagnosis and sensitivity were tested using lea contrast sensitivity, snellen visual acuity charts, trial box, and occluder. the data were analyzed using statistical package for social sciences (spss version 20.0). out of 60 patients, including 37 males and 23 females, between 16-80 years of age. 33 (55 %) patients were diagnosed with primary open angle glaucoma(poag), 17 (28.3 %) patients with primary close angle glaucoma, 7 (11.7%) patients with acute closure glaucoma(pcag), and 3 (5%) patients with secondary glaucoma. similarly, with glasses, 46 (76.7 %) patients had visual acuity 6/6 to 6/12, 11 (81.3%) patients had 6/18 to 6/36 and 3 (5 %) patients had 6/60. according to contrast sensitivity 30 (50%) patients had 1.25% (80%), 21 had 2.50% (40%) and 9 had 5% (20%). 15 subjects had 1.25% (80%), 13 subjects had 2.5 %( 40%) and 5 subjects had 5% contrast sensitivity in poag. around 11 subjects had 1.25% (80%), 4 subjects had 2.5 % (40) and 2 subjects had 5% contrast sensitivity in pcag, 3 subjects had 1.25% (80%), 3 subjects had 2.5 % (40) and 2 subjects had 5% contrast sensitivity in pcag. there was a reduction in contrast visual acuity with and without refraction. most of the patients had variation at the level of contrast visual acuity in poag. key words: contrast sensitivity, close angle, glaucoma, intraocular pressure, open angle, introduction glaucoma is an ocular illness that damages the optic nerve and gradually progresses to blindness. rising pressure inside the eye (i.e. raised intraocular pressure) damages the optic nerve, failing to transmit images to the brain, resulting in blindness (1). increased intraocular pressure is a significant risk factor (2). the pathogenesis of glaucoma is not yet understood; however, the rising intraocular pressure is thought to cause retinal ganglion cell necrosis. there is an imbalance between aqueous humor secretion from the ciliary body and its drainage. aqueous humor is normally drained through two independent pathways: 1. the trabecular meshwork, 2. the uveoscleral outflow pathway the rate of flow through these pathways determines the intraocular pressure. open-angle glaucoma is related to increased resistance in the trabecular meshwork resulting in reduced outflow (3,4). the significant risk factors for glaucoma include age over 45 years, family history or personal history of correspondence: muhammad asif isra school of optometry, al-ibrahim eye hospital, karachi, pakistan email:mohammadasif75050@yahoo.com doi: 10.38106/lmrj.2022.4 .1-04 received: 09.12.2021 accepted: 12. 03..2022 published: 31. 03.2022 mailto:mohammadasif75050@yahoo.com mailto:mohammadasif75050@yahoo.com mailto:mohammadasif75050@yahoo.com lmrj volume 4 issue 1 23 | p a g e raised intraocular pressure, reduced corneal thickness and rigidity, ocular injury, and diabetes mellitus (5,6). glaucoma has been categorized into five major types, including: 1. open-angle or chronic glaucoma: this is the most common glaucoma presenting with gradual vision loss without any other sign symptoms (7,8). 2. angle closure (acute) glaucoma: it is an emergency where the flow of aqueous humor fluid is blocked suddenly, causing a rise of fluid pressure causing pain and visual impairment (9). 3. congenital glaucoma: it is the embryonic development defect in the angle of the eye, where an abnormally developed angle of the eye shows slow or complete blockage of fluid drainage. this type of glaucoma has a familial predisposition and presents with cloudy eyes, excessive tearing, or sensitivity to light in children(10). 4. secondary glaucoma: it is not a primary defect in the aqueous humor production or drainage but rather a complication of injury or any other eye condition, i.e., cataracts or even ocular tumors, and certain drugs such as corticosteroids may also cause glaucoma (11,12). 5. normal-tension glaucoma: it occurs without increased intraocular pressure. the exact cause is unknown, but extreme sensitivity or a reduced blood flow to the optic nerve could be a possible cause (13,14). contrast sensitivity deals with the ability to see fine points at low contrast levels. when a person can see minute details at very low contrast, it suggests their high contrast sensitivity, while otherwise, if a person doesn’t see that case. contrast sensitivity is directly related to three-dimensional (3d) vision or binocular single vision (bsv) (15). contrast sensitivity is vital in communication, orientation, and mobility, performing everyday tasks, particularly near vision tasks such as reading and writing. the vision in patients with age-related macular degeneration (armd) and glaucoma gets better in bright light (11). there is literature available suggesting variation in contrast sensitivity in different types of glaucoma. however, there is low-level literature available suggesting measures of contrast sensitivity in each type of glaucoma. thus, this study measured contrast sensitivity in different glaucoma patients using visual acuity and visual field. methods a prospective cross-sectional study was conducted at glaucoma clinic at alibrahim eye hospital malir, karachi, pakistan, from 1st february 2020 till 30th august 2020. sixty patients with various glaucoma types were included using a non-probability convenient sampling technique. these patients were between the ages of 16 to 80 years, with a confirmed diagnosis of glaucoma without any other ocular disease. after obtaining written consent, all patients were assessed in standardized room illumination with snellen’s chart. contrast sensitivity was evaluated with lea symbols contrast sensitivity chart (low contrast flip chart), visual acuity was checked using occluder and snellen visual acuity chart. the findings of the examination were recorded on a pre-designed proforma. statistical analysis statistical package for social sciences (spss) version 20.0 was used for data analysis. all continuous variables are presented as terms of mean± and standard deviation (±sd), and categorical variables are presented as frequency and percentages in graphs and tables. lmrj volume 4 issue 1 24 | p a g e results total 60 patients with a confirmed diagnosis of glaucoma consented to be part of this study, including 37 males and 23 females (figure 1). the mean onset age was 38.4 years, ranging from 16 to 80 years. out of 60 patients, 33 (55 %) patients were diagnosed with primary open angle glaucoma (poag), and 17 (28.3 %) patients were primary close angle glaucoma (pcag), 7 (11.7%) patients were acute closure glaucoma (acg), and 3 (5%) patients were secondary glaucoma (sg) (figure: 02). visual acuity with glasses 46 (76.7 %) patients had 6/6 to 6/12, 11 (81.3%) patients had 6/18 to 6/36 and 3 (5 %) patients had 6/60 (table: i). contrast sensitivity with glasses 30 (50%) patients had 1.25% (80%).21 patients had 2.50% (40%), 9 patients had 5% (20). (table: i) figure 1. gender distribution of the patients presenting with glaucoma figure 2: distribution of the types of glaucoma contrast sensitivity of 15 patients was 1.25% (80%), 13 patients had 2.5% (40) and 5 patients had 5% in poag. 11 patients had 1.25% (80%), 4 patients had 2.5% (40), and 2 patients had 5% in pcag. 3 patients had 1.25% (80%), 3 patients had 2.5% (40) and 2 patients had 5% in acg. 1 patient had 1.25% (80%), 1 patient had 2.5% (40), and 1 patient had 5% in sg (figure: 03) visual acuity with glasses frequency percent 6/6-6/12 46 76.7 6/18-6/60 11 18.3 6/60 3 5 total 60 100 contrast sensitivity with glasses frequency percent 5% 9 15.0 2.5% 21 35.0 1.25% 30 50.0 total 60 100.0 table 1: visual acuity with glass in patients with confirmed diagnosis of glaucoma figure 3. distribution of contrast sensitivity in each type of glaucoma lmrj volume 4 issue 1 25 | p a g e discussion in our study, 60 patients were included having confirmed glaucoma diagnosis, their visual acuity was checked, and a contrast sensitivity test of each patient was performed. the required methods for diagnosing and evaluating glaucoma progression include visual field measurement and optic disc evaluation (3). in addition, psychophysical tests are also helpful to explore each part of the visual pathway's functional status for assessment and monitoring of the disease progression. the deterioration in longitudinal contrast sensitivity in glaucoma patients has been reported in multiple studies. a test lea contrast can quickly measure contrast visual acuity by measuring the distance between the eye and clear visibility of the symbols at 25%, 10%, 5%, 2.5%, and 1.25% contrast (10). for the interpretation, the 0.10 visual acuity corresponds to the visibility of 10m symbols at 1 meter, similarly 0.05 at 0.5 meters, and 0.3 at 0.3 meters. thus, visual acuity values are easy to calculate and interpret, and there is also a table to convert these findings in snellen equaling va values (4). there are six pages and response keys available; the contrast to the peli-robsin chart test, the obtained results are more reliable and reproducible. the other limitation of the peli-robsin chart tests is the measurement of the spatial frequency of 1 cpd at a distance of 1 meter, while patients with ocular hypertension and glaucoma present with contrast sensitivity loss frequencies of 0.25 and 8cpd. although in the current study, a decline in the contrast sensitivity with glasses in glaucomatous patients had a maximum of 1.25% contrast sensitivity of high percentage of patients compared to the study conducted by maria et al. reported in 2016, that contrast sensitivity was affected more in glaucoma patients than high-contrast visual acuity (16). previously reported studies did not provide such evidence to support contrast sensitivity as a measure for early detection of glaucoma. the contrast sensitivity has been reported to correlate with the perimeter deviation. it is also believed that contrast sensitivity and visual field testing could help identify functional changes in glaucoma patients earlier when they still have good visual acuity. onal et al. 2008 investigated spatial-contrast sensitivity (cs) as a measure for diagnosing early glaucoma in patients whose visual acuity was still within normal limits. the study results suggested significantly lower contrast sensitivity at all spatial frequencies in glaucoma patients compared to the controls. the results in our study in terms of visual acuity with glasses were 46 (76.7 %) patients had 6/6 to 6/12, 11 (81.3%) patients had 6/18 to 6/36, and 3 (5 %) patients had 6/60. and if we compare contrast sensitivity between both studies, contrast sensitivity measurement was around 50%, while specificity ranged between 68 and 100%. fact contrast sensitivity scores of less than 22 at 12 cpd spatial frequency provided sensitivity and specificity values concomitantly exceeding 60% to contrast sensitivity with glasses 30 (50%) patients had 1.25% (80%).21 patients had 2.50% (40%), 9 patients had 5% (20%). contrast sensitivity has a high percentage in poag; approximately 33 patients with decreased contrast sensitivity about 15 subjects had 1.25% (80%), 13 subjects had 2.5% (40). five subjects had 5% than pcag approximately 11 subjects had 1.25% (80%), four subjects had 2.5% (40), and two subjects had 5% in pcag after than in acg approximately three subjects had 1.25% (80%), three subjects had 2.5% (40) and two subjects had 5% in acg (13). low percentage in sg approximately 1 subject had 1.25% (80%), 1 subject had 2.5% (40), and 1 subject had 5%. still, there was no evidence of current previous studies about the types of glaucoma affecting contrast sensitivity. lmrj volume 4 issue 1 26 | p a g e the study was prospective and conducted in a specialized hospital for eye diseases, having standardized methods and techniques used for the study; however, small sample size is appreciated as a limitation of this study. conclusion in this observational study, the result showed a reduction in contrast visual acuity with and without refraction. most patients had variation at the level of contrast visual acuity in primary open-angle glaucoma. therefore, it is recommended that contrast sensitivity be performed in patients with refractive errors; in glaucoma patients, visual acuity compared to contrast ability can determine the asymptomatic disorder of eyes. routine clinical tests for high and low contrast sensitivity should be done to evaluate patient detail resolving ability and disturbs daily activities, therefore patients must be counseled accordingly. conflict of interest: all the authors declared no conflict of interest. funding no funding was received for this project references 1. alan kozarsky, md (september 09, 2018) what is glaucoma? available at: https://www.webmd.com (accessed: 15/11/2018). 2. m.shafi.jatoi (2013) glaucoma, 4th end. hyderabad, pakistan: paramount publishing enterprise. 3. robert n. weinreb et al (2014, may) 'the pathophysiology and treatment of glaucoma', jama, 14(), pp. 1901–1911. 4. khandekar r, chauhan d, yasir zh, al-zobidi m, judaibi r, edward dp: the prevalence and determinants of glaucoma among 40 years and older saudi residents in the riyadh governorate (except the capital) a community based survey. saudi j ophthalmol. 2019, 33:332-337 5. al-shaaln ff, bakrman ma, ibrahim am, aljoudi as: prevalence and causes of visual impairment among saudi adults attending primary health care centers in northern saudi arabia. ann saudi med. 2011, 31:473-480. 6. andrew a. (2/27/2018) glaucoma, available at: https://www.medicinenet.com (accessed: 15/11/2018). 7. fechtner, r.d. and weinreb, r.n., 1994. mechanisms of optic nerve damage in primary open angle glaucoma. survey of ophthalmology, 39(1), pp.23-42. 8. burgoyne cf, downs jc, bellezza aj, suh jk, hart rt. the optic nerve head as a biomechanical structure: a new paradigm for understanding the role of iop-related stress and strain in the pathophysiology of glaucomatous optic nerve head damage. prog retin eye res. 2005;24(1):39–73. 9. aung t, ang lp, chan sp, chew pt. acute primary angle-closure: long-term intraocular pressure outcome in asian eyes. am j ophthalmol. 2001;131(1):7–12 10. mohammed, m.a. and haj, h.m.h., 2020. study of glaucoma s prevalence in atbara locality, sudan, from 2009 to 2016. sudanese journal of ophthalmology, 12(1), p.1. https://dx.doi.org/10.1016/j.sjopt.2019.02.006?utm_medium=email&utm_source=transaction https://dx.doi.org/10.1016/j.sjopt.2019.02.006?utm_medium=email&utm_source=transaction https://dx.doi.org/10.1016/j.sjopt.2019.02.006?utm_medium=email&utm_source=transaction https://dx.doi.org/10.4103/0256-4947.84624?utm_medium=email&utm_source=transaction https://dx.doi.org/10.4103/0256-4947.84624?utm_medium=email&utm_source=transaction https://dx.doi.org/10.4103/0256-4947.84624?utm_medium=email&utm_source=transaction lmrj volume 4 issue 1 27 | p a g e 11. porter, l.f., urquhart, j.e., o'donoghue, e., spencer, a.f., wade, e.m., manson, f.d. and black, g.c., 2011. identification of a novel locus for autosomal dominant primary open angle glaucoma on 4q35. 1-q35. 2. investigative ophthalmology & visual science, 52(11), pp.7859-7865. 12. boonyaleephan, s. and salim, s., 2011. how to diagnose & treat angle-recession glaucoma. glaucoma-changing paradigm, 9(1). 13. chen, m., kueny, l. and schwartz, a.l., 2018. the role of corneal hysteresis during the evaluation of patients with possible normal-tension glaucoma. clinical ophthalmology (auckland, nz), 12, p.555. 14. m.shafi. jatoi (2013) grades on the angle of gonioscopy, 4th end. hyderabad, pakistan: paramount publishing enterprise. 15. nichols, k.k., redfern, r.l., jacob, j.t., nelson, j.d., fonn, d., forstot, s.l., huang, j.f., holden, b.a. and nichols, j.j., 2013. the tfos international workshop on contact lens discomfort: report of the definition and classification subcommittee. investigative ophthalmology & visual science, 54(11), pp.tfos14-tfos19. 16. stulting, a.a. and labuschagne, m., 2013. glaucoma: the least the general practitioner should know: more about... ophthalmology. cme: your sa journal of cpd, 31(4), pp.159-163. type of the paper (article lmrj volume 3 issue 3 59 | p a g e research article analysis of factors inhibiting women from availing antenatal care facility at private sector outpatient department zahida parveen brohi1, uzma parveen2, roohi nigar1, aneela sadaf3 1 department of obstetrics and gynaecology, bilawal medical college for boys, jamshoro, sindh, pakistan, 2department of obstertics and gynaecology, isra university hospital, hyderabad, sindh, pakistan, 3 department of obstetrics and gynaecology, services hospital karachi, sindh, pakistan abstract this study aimed to evaluate factors influencing women to avail antenatal care among women attending outpatient department (opd), of private sector hospitals in hyderabad. this was an interview-based survey conducted during a period of six months (from1stjuly 2019 to 31st december 2019) at opd of private sector hospital in hyderabad. all the pregnant women and their female companions attending the antenatal opd were included. those women who regretted being part of the study were excluded. participants of the study were interviewed regarding the knowledge and factors affecting utilization of antenatal care among women attending opd as defined in a pre-set questionnaire. all the data was recorded in a proforma and analyzed by using spss version 20. a total of 500 pregnant women were interviewed regarding awareness of antenatal care. the study participants were grouped according to their age, 3% were 15-20 years of age, 30.9% were 21-30 years of age, 34.5% were 31-40 years of age and 31.5% were more than 41 years of age. out of those who did not avail antenatal care, 8.5% were not allowed due to family restrictions, 47.3% reported ignorance, 9.7% lived far away from the facility, 24.2% could not afford and 10.3% had other reasons of not availing antenatal care. the study concluded that the main reason for not utilizing antenatal care was ignorance by the women as well as their family members; affordability was also an important factors in a considerable number of participants. key words: antenatal care (anc),pregnancy, factors, primigravida, grandmultigravida introduction antenatal care is a program specifically designed for pregnant women provided from the period of conception till the onset of labor. it falls under the auspice of preventive medicine which deals with early detection of general medical disorders, nutritional deficiencies, and immunological disorders. the program also includes provision of health education and social medicine and early detection of pregnancy-related disorders which in turn provides timely management of existing co-morbidities and minimizes potential causes of maternal and neonatal mortality and morbidity (1). organized antenatal care historically dates back to the beginning of the 20th century in europe and north america and now it’s a global facility with a well-developed system in more advanced countries(2). recent research reported a correlation of inappropriate antenatal care with poor pregnancy outcomes. initially, following the world health organization (who) recommendations, four antenatal visits per pregnancy in normal conditions starting at the 12th week of gestational age (3) were advised however according to recently revised suggestions a minimum level of care to be eight visits all over the pregnancy to reduce maternal morbidity and mortality (4). maternal mortality is reported to be very high with the rate of 830 correspondence: zahida parveen brohi department of obsetrics & gynaecology, bilawal medical college, jamshoro, pakistan email: zahidaparveen66@yahoo.com doi: 10.38106/lmrj.2021.3.3-03 received: 02.07.2021 accepted: 15. 09..2021 published: 30. 09.2021 lmrj volume 3 issue 3 60 | p a g e women passing away during or after pregnancy or childbirth-associated complications per day worldwide. in 2015, approximately 303,000 women died during pregnancy or childbirth. such a high rate of maternal mortality around the world indicated disproportions in the provision of health care services where nearly all maternal deaths (99%) occurred in developing countries. more than 50% of these mortalities were reported from sub-saharan africa and approximately one-third from south asia (5,6,7). globally, while 85% of pregnant women access antenatal care with skilled health care providers at least once, only six out of ten (ie 58 %) be given at least four antenatal visits. though the areas with high maternal mortality the rate of antenatal visits were even low. regular contact with a doctor, nurse, or midwife during pregnancy allows women to get services crucial to their health as well as their baby. it is suspected that only half of pregnant women around the globe receive who-recommended four antenatal care visits during their pregnancy period (8). previous studies conducted in different countries on demographic and socio-cultural factors influencing the use of maternal health care services have shown that factors such as maternal age, number of living children, education, place of residence, occupation, religion, and ethnicity household level (women’s autonomy, husband’s attitude, husband’s support, and family income) and health service level appeared to be significantly associated with the use of antenatal care (4,9,10,11,12,13,14). however, there is limited literature available looking at the influencing factors from sindh. therefore this study was designed to explore factors influencing utilization of antenatal care among women attending the outpatient department of a private sector hospital in hyderabad. methodology this study was an interview-based survey conducted at opd of the private sector in hyderabad, sindh, pakistan. the study duration was 6 months from1stjuly 2019 to 31st december 2019. all the pregnant women and their female companions attending the antenatal opd were included in the study. women who were not willing to participate in the study were excluded. after taking informed consent women were interviewed regarding information about the factors affecting utilization of antenatal care among women attending opd, demographic information regarding age, education, occupation, socioeconomic status, and residence were obtained from the participants all the data was recorded in pre-defined proforma and data was analyzed by using spss version 20. results a total of 500 women were interviewed, according to their age, 3% were 15-20 years of age, 30.9% were 21-30 years of age, 34.5% were 31-40 years of age and 31.5% were more than 41 years of age. out of 500 respondents, 15.8% were primigravida, 49.7% were multigravida and 34.5% were found to be grand-multigravida (table 1). majority (ie 44.2%) were reported to be from urban areas while the rural residents were 33.9% and 21.8% of patients resided in semi-urban. most of the participants were 40% lower financial class and 40% middle class. while only 20% belonged to the upper-middle class. in our study, 52.1% of women were illiterate and the remaining 47.9% were literate and 63% had literate husbands while 37% were married to illiterate. there were 74.5% of women who were reported to be aware of antenatal care and 25.5% were unaware. 86.7% reported to be experiencing signs and symptoms of pregnancy whereas 13.3% did not report any symptoms. 65.5% of women knew the benefits of antenatal care regarding prevention of anemia and other dangerous complications of pregnancy while 34.5% did not know about it. 80.6% of women took care of their diet in pregnancy whereas 19.4% did not take any effort (figure 1). 66.7% of women were acknowledged the antenatal care benefits and 33.3% were ignorant. in 50.3% of cases, husbands were the decisionmakers, 21.8% of women made the decision themselves, father/mother-in-law was responsible for deciding 16.4% of cases, and 11.5% of women had other means(figure 2). out of those who did not avail antenatal care, 8.5% could not get permission from relatives to go to the antenatal care facility, 47.3% cited ignorance about the importance of antenatal care, 9.7% said that antenatal care facility was far away, 24.2% could not afford it and 10.3% had other reasons o f not availing antenatal care (figure 3). lmrj volume 3 issue 3 61 | p a g e table. 1. summary of the demographic characteristics of the study population figure 1. summary of the participants regarding knowledge of signs and symptoms, complications, and diet care during pregnancy figure 2. summary of the data regarding antenatal care decision of the participants demographic data frequency percentage age 15-20 yrs 21-30 yrs 31-40 yrs >41 yrs 15 154 170 161 3% 30.8% 34% 31.2% parity primigravida multigravida grand-multigravida 77 245 178 15.4% 49.% 35.6% residence urban semi-urban rural 220 105 56 44% 21% 35% socio-economic status upper middle low 100 200 200 20% 40% 40% literacy rate: literate: illiterate : 211 289 42.2% 57.8% awareness of antenatal care: yes no 374 126 74.80% 25.20% awareness of benefits of antenatal care: yes: no: 333 167 66.6% 33.4% lmrj volume 3 issue 3 62 | p a g e figure 3. summary of the factors inhibiting women from availing antenatal care facility discussion four pillars for safe motherhood concept suggested by who include family planning, antenatal care, clean & safe delivery & emergency obstetric care (1,6). maternal death is an important issue of developing countries and it can be prevented by identifying & treating its common causes during antenatal period. by giving adequate antenatal and obstetric care most perinatal deaths can be prevented. our study evaluated the factors which can potentially affect the utilization of antenatal care among women attending a private hospital in hyderabad. in our study 3% of women were 15-20 years of age, 30.9% were of 21-30 years, 34.5% were 31-40 years and 31.5% were more than 40 years of age. age is an important factor because it serves as a proxy for women's accumulated knowledge of health care utilization, where older women were more likely to have maternal care as compared to their younger counterparts. however, there are conflicting findings available in literature where some suggested younger age as a determinant of antenatal care while others suggested that advancing age was reported to be associated with more utilization of antenatal care (15,16,17,18,19). education plays a significant role in the utilization of antenatal care. in our study 52.1% women and 37% husbands were illiterate, here it is worth mentioning that even in the illiterate category, all those included had no years of schooling and could just read and write simple words, it may be the quality of education which increases the likelihood of using antenatal care services, educated couples are more aware of health issues, complications, and benefits of using health services. it is suggested that education empowers the female in terms of seeking health services, these mothers may have better chances to get health information and show more concern towards healthcare (4,20,21). it has been previously observed that mothers with less education were likely to have less information about antenatal care and added difficulties in its access. a study conducted in central ethiopia concluded that women with little schooling were more than two times more likely to avail of antenatal care (or=2.645) as compared to those who had no education and similar results were observed in different studies done in north ethiopia, nigeria, and china (,20,21,22). the pakistan integrated household survey (pihs) 96-97 shows that only 30% (urban 54%, rural 22%) of women who had given birth in the last three years had antenatal consultations, in our study the ratio of women utilizing antenatal care was 74.5% and 25.5% were not utilizing antenatal care in south asia the ratio of utilization is 52% and 68% in rest of the world(23). lmrj volume 3 issue 3 63 | p a g e the result of our study showed that the most common reason for not taking antenatal care was ignorance, while permission from family members, distance from health care centers, unaffordability were found to influence the use of antenatal care. according to a previously reported study carried out in nurpur shah, the main factor was permission (60%) from family. another study in sindh showed that the main reason for not utilizing antenatal care was long distance(24,25). as lack of money was also a reason for not utilizing antenatal care in 24.20% in our study population, poverty, financial crises were also important factors inhibiting women from seeking the health care facilities, similar findings were observed in previously reported studies(20,21,22). far-reaching hospitals were reported to be the important factor inhibiting women from seeking antenatal care, studies conducted in remote areas of africa also suggested that far away antenatal clinics were a major problem of third world countries because lack of transport and long-distance walk is troublesome for pregnant women (26,27) . as the main reason for not having antenatal care in our study was women being ignorant, therefore there is a dire need to continue educating expectant mothers and women in general public on regular basis. government should make an effort to set up health centers in rural areas to improve utilization and to eliminate the problem of transportation. conclusion we concluded that the main reason for not utilizing antenatal care was ignorance by the women as well as their family members; this ignorance may be due to lack of knowledge or illiteracy. while other factors such as permission from family members or husbands, lack of money, a long distance from the health care centers were also involved to avoid antenatal care. ethical consideration: the study was approved by local ethics committee. conflict of interest: there is no conflict of interest. funding: this study was not funded by any agency references 1).world health organization, who recommendations on antenatal care for a positive pregnancy experience, world health organization, geneva, switzerland, 2016. 2.rooney c. antenatal care and maternal health: how effective is it? document who/msm/92.4 geneva: who 1992, pp. 6-9. 3.abou-zahr cl, wardlaw tm, organization wh. antenatal care in developing countries: promises, achievements and missed opportunities: an analysis of trends, levels and differentials, 1990–2001. 2003. 4.ali sa, dero aa, ali sa, et al. factors affecting the utilization of antenatal care among pregnant women: a literature review. j preg` neonatal med 2018;2(2):41-45. 5. l. alkema, d. chou, d. hogan et al., “global, regional, and national levels and trends in maternal mortality between 1990 and 2015, with scenario-based projections to 2030: a systematic analysis by the un maternal mortality estimation inter-agency group,” the lancet, vol. 387, no. 10017, pp. 462–474, 2016. view at: publisher site | google scholar 6. world health organization, trends in maternal mortality: 1990–2015: estimates from who, unicef, unfpa, world bank group and the united nations population division: executive summary, world health organization, geneva, switzerland, 2015. 7. s. gabrysch and o. m. campbell, “still too far to walk: literature review of the determinants of delivery service use,” bmc pregnancy and childbirth, vol. 9, no. 1, p. 34, 2009. view at: publisher site | google scholar 8. unicef, “unicef data: monitoring the situation of children and women,” in the state of the world’s children report, unicef, new york, ny, usa, 2015. view at: google scholar lmrj volume 3 issue 3 64 | p a g e 9.boamah sa, amoyaw j, luginaah i. explaining the gap in antenatal care service utilization between younger and older mothers in ghana. journal of biosocial science. 2016;48(3):342–57. 10. finlayson k, downe s. why do women not use antenatal services in lowand middle-income countries? a meta-synthesis of qualitative studies. plos medicine. 2013;10(1):e1001373 10.1371/journal.pmed.1001373 [pmc free article] [pubmed] [crossref] [google scholar] 11. pell c, menaca a, were f, afrah na, chatio s, manda-taylor l, et al. factors affecting antenatal care attendance: results from qualitative studies in ghana, kenya and malawi. plos one. 2013;8(1):e53747 10.1371/journal.pone.0053747 [pmc free article] [pubmed] [crossref] [google scholar] 12. dahiru t, oche om. determinants of antenatal care, institutional delivery and postnatal care services utilization in nigeria. the pan african medical journal. 2015;21:321 10.11604/pamj.2015.21.321.6527 [pmc free article] [pubmed] [crossref] [google scholar] 13. nketiah-amponsah e, senadza b, arthur e. determinants of utilization of antenatal care services in developing countries: recent evidence from ghana. african journal of economic and management studies. 2013;4(1):58–73. [google scholar] 14. simkhada b, v teijlingen er, porter m, simkhada p. factors affecting the utilization of antenatal care in developing countries: systematic review of the literature. journal of advanced nursing. 2008;61(3):244–60. 10.1111/j.1365-2648.2007.04532. [pubmed] [crossref] [google scholar] 15. nketiah-amponsah e, senadza b, arthur e. determinants of utilization of antenatal care services in developing countries: recent evidence from ghana. african j econ manag stud. 2013;4:58-73. 16. roy mp, mohan u, singh sk, et al. determinants of utilization of antenatal care services in rural lucknow, india. j family med prim care. 2013;2:55. 17. efendi f, chen cm, kurniati a, et al. determinants of utilization of antenatal care services among adolescent girls and young women in indonesia. j women health. 2016:1-16. 18. birmeta k, dibaba y, woldeyohannes d. determinants of maternal health care utilization in holeta town, central ethiopia. bmc health serv res. 2013;13:1. 19.tran tk, gottvall k, nguyen hd, et al. factors associated with antenatal care adequacy in rural and urban contexts-results from two health and demographic surveillance sites in vietnam. bmc health serv res. 2012;12:1. 20 onasoga oa, afolayan ja, oladimeij bd. factors influencing utilization of antenatal care services among pregnant women in ife central lga, osun state nigeria. adv appl sci res. 2012;3:1309-15. 21 zhao qzjh, yang s, pan j, et al. the utilization of antenatal care among rural-to-urban migrant women in shanghai:a hospital-based cross-sectional study. bmc public health. 2012;12. 22 worku ag, yalew aw, afework mf. factors affecting utilization of skilled maternal care in northwest ethiopia: a multilevel analysis. bmc int health hum rights 2013;13:1. 23.pakistan integrated household survey[electronic]cited on 14th august 2020.available from;hptt/catalog.ihsn.org. 24.sadiq n, waheed q , hussain m , rana t a et al. factors affecting the utilization of antenatal care among women of reproductive age in nurpurshahan • jpma.2011;61(6):616-8 25.yousuf f, haiderg, shaikhbr. factors for inaccessibility of antenatal care bywomen in sindh j ayub med coll abbottabad 2010;22(4) 26.openshaw mr, bomela hn, pretlove s. an evaluation of the timing and use of healthcare during nicholas na, kyei omrc, sabine g. the influence of distance and level of service 27.provision on antenatal care use in rural zambia. plos one. 2012. pregnancy in birmingham, uk and pretoria, south africa. isrn obstet gynecol. 2011. type of the paper (article lmrj volume 4 issue 02 75 | p a g e original article assessment of macular function in dense cataract using maddox rod mohammad asif1, ayesha kazmi2, mehak nazeer1, abdul hameed talpur 1, muhammad munawar1, humdullah1 1isra school of optometry, isra post graduate institute of ophthalmology al˗ibrahim eye hospital, malir karachi, pakistan, 2 al-mustafa medical centre, karachi, pakistan abstract cataract is a leading cause of blindness worldwide. however there is surgical option available for treatment with complete cure in majority of patients. for dense cataract maddox rod was evaluated. a total of 200 patients were recruited. maddox rod test for macular function appears to be useful in a great majority of patients. the assessment of macular function in dense cataract is difficult but the psycho physiological test like maddox rod test was found to be the reliable in patients with cataract and its quick and understandable key words: cataract, macular function test, maddox rod assessment. introduction cataract is the prominent cause of vision loss globally, resulting in 47.8% (equals to 17.7 million) people blind (1). the survey was conducted to explore prevalence of blindness and reported to have 570 000 blind adults in pakistan due to cataract, additional 3560000 eyes have reduced visual acuity at <6/60 as a result of cataract. though the surgical management is now hallmark of treatment with complete reversal of vision but there are people who develop mature cataract and some present with hypermature due less privileged population with inadequate health care facilities (2). as reported in the literature that 253 million people around the globe are living with some degree of vision loss, out of which 36 million have complete vision loss to the degree of blindness and remaining 217 million with varying degree of impairment ranging from moderate to severe vision impairment. a demographic study report suggested that 81% of blind people or patients with varying degree of vision impairment are aged 50 years or older. primary cause of vision impairment globally is chronic eye diseases. untreated cataract and refractive errors which left untreated are most commonly reported causes of vision loss worldwide. however in developing and low-middle income countries untreated cataract remains at the top(3). the macula is a pigmented area, oval in shape presented in human eye adjacent to the center of the retina. in human’s eye macula measures around 5.5 mm (0.22 in) in diameter. it is mainly responsible for the central, high-resolution, color vision in good light. if the macula is damaged this kind of high resolution light vision is impaired, such condition include macular degeneration(4). the diagnosis and treatment outcome measurement in cases of macular diseases macular function tests are needed. this tests is also required for the evaluation of the macular function with opaque media in conditions including dense cataract and vitreous hemorrhage. dense cataract is a challenge for assessment of macular function. there is limited information regarding maddox rod is available for utilization in dense cataract. thus we have designed this study to evaluate the response of macular function in patients presenting with dense cataract by using maddox rod. correspondence: muhammad asif che, crcp, senior lecturer, isra school of optometry, al-ibrahim eye hospital, karachi, pakistan email: mohammadasif75050@yahoo.com doi: 10.38106/lmrj.2022.4.2-05 received: 02.02.2022 accepted: 26. 06.2022 published: 30. 06.2022 mailto:mohammadasif75050@yahoo.com mailto:mohammadasif75050@yahoo.com lmrj volume 4 issue 02 76 | p a g e methods this was hospital based cross-sectional, observational study. patients were selected by using a nonprobability convenient sampling method, where all the patients without any gender restriction coming to out patient department (opd) of al˗ibrahim eye hospital, karachi, pakistan were included. the study was conducted between may 2019 to october 2019. the patients included were presenting with dense cataract and above 30 years of age. their visual acuity must be ≤ 6/60-1/60, with no fundus glow and consented to be part of the study. maddox rod test method all patients were asked to sit approximately 1 foot away (33 cm) from a bright light source and maddox rod was placed in front of the eye planned to be examined. patient was asked to close the other eye. the maddox rod was rotated in two peaks in vertical and horizontal directions. patients were asked to see in a line, look at its color, focus on the continuity, the direction of the line and straightness it shows. the results were then graded as per standard protocol. statistical methods statistical package for social sciences (spss) version 20.0 was used for data collection and analysis in our project. mean and standard deviation were considered for continuous variables while the categorical variables were presented as frequency distribution. results out of 200 patients selected for this study there were 156 (78%) females and 44 (22%) males. mean age of the participants was 57.02 ± 9.0 years (range 3885 ±sd=9.011). the visual acuity of 62 (31.0%) patients was 1/60, 53(26.5%) had 6/60, 41(20.5%) had 3/60, 35(17.5%) had 2/60 and 9(4.5%) had 5/60. out of 200 patients 164 (82.0%) had shown a grade 1 response, 22 (11.0%) had shown grade 2 response, 9 (4.5%) had shown grade 3 response and 5 (2.5%) had shown grade 4 response with maddox rod (figure 1). the grading of maddox rod according to visual acuity is presented in table 1. figure 1. pattern of distribution of grading with maddox rod lmrj volume 4 issue 02 77 | p a g e table 1. frequency distribution of visual acuity according to grading with maddox rod discussion in this study total of two hundred patients attended opd during the data collection period. the maddox rod test appeared reasonable in making a diagnosis in dense cataract cases. it was recognized as a preferable clinical test to assess the functioning of macula prior to cataract surgery. however there were only 5 patients where the test did not appear to be useful which makes 2.5% only. the previously reported cases have shown that maddox rod test is a reliable pre-clinical assessment test before cataract surgery in addition to the clinical examination, visual acuity and ophthalmologic ultrasound(5). there is a wide variation in the ophthalmologists practice in the preference of tests being used in clinical practice. a national survey from st. lious reported in 1995, and showed that a considerable number of ophthalmologists did not perform such tests to make a firm diagnosis(6). in this study 164 (82.0%) patients given grade 1 response 22 (11.0%) had shown grade 2 response, 9 (4.5%) had shown grade 3 response and 5 (2.5%) had shown grade 4 response with maddox rod. which give a sign that they had potential visual acuity behind the cataract. on the other hand a study of conventional macular function test in cases of cataract was conducted in the rotary eye hospital in gujarat, india, out of operated 100 cases 80% achieved a visual acuity of 6/6 to 6/9 post surgically (7). these patients had grade i response on maddox rod test. in these reported cases four had grade ii response to maddox rod test. a total of six patients gained a visual acuity of 6/24 to 6/36, five of these cases were categorized as maddox rod response grade iii, and one was reported to have a grade i response. there has been reported variations in the interpretation of the ophthalmic reports between clinician(8). according to the previous study they performed the maddox rod test after cataract surgery and in this study the maddox rod test performed before cataract surgery. the answer to my question i finally found that the most common response in this study was grade 1 with maddox rod in 164(82.0%) amongst the total 200(100%) patients with dense cataract of 200 eyes, which gives the sign that the macula was functioning and the visual potentials were present behind the cataract. grading with maddox rod visual acuity total 6/60 5/60 3/60 2/60 1/60 grade 1 51 8 33 28 44 164 grade 2 1 0 6 6 9 22 grade 3 1 1 2 1 4 9 grade 4 0 0 0 0 5 5 total 53 9 41 35 62 200 lmrj volume 4 issue 02 78 | p a g e the limitations to the study were that the limited time duration, sample size and the category of visual acuity in patients with dense cataract. the macular diseases which inhibit the grading of maddox rod in some patients, was not documented in this study and the follow up results must be checked with maddox rod after the surgery. the recommendations to the study were to assess the macular functioning by psycho physiological test; maddox rod in opaque media if other devices like b-scan are not available, it is helpful in the assessment whether the macula is functioning or not, and the cataract surgery will reliable in any severe condition. conclusion the assessment of macular function in dense cataract is difficult but the psycho physiological test like maddox rod test was found to be the reliable in patients with cataract and its quick and understandable. conflict of interest authors declare no conflict of interest. ethical consideration the study was approved by local ethical committee funding the study was conducted from departments own resources no additional funds required. references 1. resnikoff s, pascolini d, etya’ale d, kocur i, pararajasegaram r, pokharel gp, et al. global data on visual impairment in the year 2002. bull world health organ [internet]. 2004 nov;82(11):844– 51. available from: http://www.ncbi.nlm.nih.gov/pubmed/15640920 2. jadoon z, shah sp, bourne r, dineen b, khan ma, gilbert ce, et al. cataract prevalence, cataract surgical coverage and barriers to uptake of cataract surgical services in pakistan: the pakistan national blindness and visual impairment survey. br j ophthalmol [internet]. 2007 oct 1;91(10):1269–73. available from: https://bjo.bmj.com/lookup/doi/10.1136/bjo.2006.106914 3. steinmetz jd, bourne rra, briant ps, flaxman sr, taylor hrb, jonas jb, et al. causes of blindness and vision impairment in 2020 and trends over 30 years, and prevalence of avoidable blindness in relation to vision 2020: the right to sight: an analysis for the global burden of disease study. lancet glob heal [internet]. 2021 feb;9(2):e144–60. available from: https://linkinghub.elsevier.com/retrieve/pii/s2214109x20304897 4. choi cj, melki sa. maddox rod effect to confirm the visual significance of laser in situ keratomileusis flap striae. j cataract refract surg [internet]. 2011 oct;37(10):1748–50. available from: https://journals.lww.com/02158034-201110000-00003 5. thurschwell lm. presurgical evaluation of patients with cataracts. optom clin [internet]. 1991;1(2):159–87. available from: http://www.ncbi.nlm.nih.gov/pubmed/1799825 lmrj volume 4 issue 02 79 | p a g e 6. bass eb. variation in ophthalmic testing prior to cataract surgery. arch ophthalmol [internet]. 1995 jan 1;113(1):27. available from: http://archopht.jamanetwork.com/article.aspx?doi=10.1001/archopht.1995.01100010029018 7. dubey ak, masani ph, shroff ap. quantitative assessment of conventional macular function tests in cases of cataract. indian j ophthalmol [internet]. 1983;31 suppl:895–7. available from: http://www.ncbi.nlm.nih.gov/pubmed/6544281 8. steinberg ep. variation in ophthalmic testing before cataract surgery. arch ophthalmol [internet]. 1994 jul 1;112(7):896. available from: http://archopht.jamanetwork.com/article.aspx?doi=10.1001/archopht.1994.01090190044020 type of the paper (article lmrj volume 4 issue 01 38 | p a g e research article awareness of mothers regarding use of natural probiotics in school going healthy children's diet fasiha shah1, nabia shah2, faisal hyder shah3 school of social work, faculty of social sciences, universiti sains malaysia, penang, malaysia, 2department of education and 3department of social work, university of sindh, pakistan abstract probiotics are recently getting popular as immunity enhancers, and being investigated to treat acute infections, including gastroenteritis. commonly used probiotics have been in practice for ancient periods. this study was thus conducted to evaluate the knowledge of mothers of school-going children regarding the use of probiotics in their children's diet. our results showed that 23% of women were aware of probiotics and their health benefits out of 200 women surveyed, while 16% had never heard of probiotics. however great majority were taking probioticrich food, including yogurt, buttermilk, and cheese, in their diet. the knowledge of the use of probiotics in mothers was significantly associated with mothers' level of education. we conclude that there is limited knowledge of probiotics and their health benefits in mothers, but given the anecdotal evidence and inherited dietary patterns, probiotics are part of the daily diet of the school-going children in our study population. key words: children, mother’s knowledge, probiotics introduction probiotics are living micro-organisms that produce health benefits when taken in a certain quantity. the probiotics are mainly bacteria that resemble normal organs' normal flora, including the gastrointestinal tract, mouth, and skin. using antibiotics and other conditions that can affect normal flora make patients further susceptible to infections most commonly observed are gastroenteritis. growing children have higher nutrition demands and protection from infections. probiotics boost immunity significantly strengthen gut flora to reduce gastrointestinal tract infection. on the other hand, gastrointestinal infection is the most common cause of illness in children of all age groups. a meta-analysis and systematic review including 34 studies of 4911 patients concluded that probiotics were beneficial in acute diarrhea in children(1). it has been suggested that the use of probiotics not only improves autistic symptoms but also improves gut health in young children (5 – 9 years old)(2). another interesting study included 120 children with recurrent respiratory tract infections and added probiotics. they showed that probiotics improved gut health by balancing gut flora, thus reducing respiratory tract infection(3). this is probably because of the postantibiotic effect in gut flora; therefore, the use of probiotics maintains normal intestinal flora. yogurt, cheese, pickles, kefir/ fermented milk are commonly used food having a live culture of micro-organisms, and these are everyday dietary items used around the globe. yogurt has been used since ancient times to improve health and is used as supportive therapy in gastrointestinal disease. there is evidence about fermented food like kefir showing evidence of modulation of gut flora and reducing the risk of non-communicable disease(4). correspondence: fasiha shah, school of social work, universiti sains malaysia penang, malaysia email: fasiha.sw@gmail.com doi: 10.38106/lmrj.2022.4.1-07 received: 01.01.2022 accepted: 18. 03.2022 published: 31. 03.2022 mailto:fasiha.sw@gmail.com lmrj volume 4 issue 1 39 | p a g e there is literature available suggesting using probiotics in children to reduce the risk of infection(5). however, there is still a lack of understanding of parents in using probiotics in the regular daily diet of growing children. therefore, this study was conducted to evaluate the knowledge of mothers of school-going children about probiotics and the pattern of probiotic-rich food in school-going children's nutrition. methods this was a questionnaire-based cross-sectional study conducted in two junior schools in hyderabad. questionnaires were sent to the mothers of children in junior school classes 1 to 5. the questionnaire had two sections one section had information regarding mothers' knowledge about probiotics and food containing probiotics and their health benefits on the growth and well-being of school-going children. the second part of the questionnaire was related to probiotic-rich food and the frequency of the mentioned food per week. the foods included yogurt, buttermilk, cheese, and pickle. the responses were recorded as categorical variables. data were analyzed using spss version 22. the frequency of responses was recorded as frequency distribution and presented in tables and graphs and 0.05 was taken as a cut-off for significance. results a total of 200 mothers consented to be part of the study with 285 children. the mean age of children was 7.2 years (range 511.5 years). out of 200 mothers who participated, 38 were working women, and all the children were city dwellers. educational level ranged from primary level to masters. the mother's education level was significantly associated with the understanding of the probiotics and their benefits on the health of children (figure 1). yogurt was the most frequently used probiotic source, and buttermilk was the least used probiotic source. a summary of the results is given in table 1. discussion the study suggested that mothers with high education levels were aware of the health benefits of probiotics; yogurt was the most commonly and frequently used source of probiotics included in the diet of schoolgoing children regardless of the mothers' knowledge. a study reported from turkey assessed knowledge of women regarding probiotics during pregnancy and for their infants. the study participants demonstrated inadequate ability, significantly associated with age, socio-economical status, educational level(6). the results regarding mothers' knowledge were consistent with our study, and though the children in this study were younger and in the infant group. similarly, the alberta pregnancy outcomes and nutrition (apron) analysis was conducted on 413 canadian mothers of two years and younger infants. one-third of mothers were not well aware of probiotics, though a great majority heard of probiotics. a considerable number was taken by themselves, but half of the mothers were not giving them to their infants as they were not aware of health benefits in infants(7). thus the lack of awareness of probiotics is a global issue. previously reported systematic review suggested that the parents received information from the internet or the other family members. however, many children were taking probiotics as part of their diet(8). a metaanalysis published in 2019 suggested that using probiotics as an adjuvant in acute diarrhea in children is useful for management(1). interestingly, probiotics suggest a preventive role then therapeutic as a metaanalysis including 33 studies showed a protective role in children's antibiotic-associated diarrhea. thus knowledge of parents and caretakers is essential in providing enough quantity. a double-blind placebocontrolled trial looked at the efficacy of yogurt in preventing antibiotic-associated diarrhea and showed promising results(9). there is data available evaluating the effectiveness of the probiotics where there are favorable reports in general. however, there is a limited role as a therapeutic agent. regardless of the use, the priority is safety, and the reported studies suggest that probiotics are well tolerated and that there were lmrj volume 4 issue 1 40 | p a g e no significant reported issues (10). the study evaluated mothers for their knowledge regarding probiotics in their school-going children. the small sample size was considered a limitation, though the prospective nature of the study is a strength. the educational level of mothers up to primary matric bachelors masters and above n=200 56(28%) 71(35%) 20(10%) 53(26.5%) knowledge of probiotics never heard heard but don't know the details know well n=200 32(16%) 122(61%) 46(23%) yogurt not used at least once a week more than three times a week n=200 35(17.5%) 71(35.5) 94(47%) buttermilk not used at least once a week more than three times a week n=200 158(79%) 30(15%) 12(6%) cheese not used at least once a week more than three times a week n=200 62(31%) 92(46%) 46(23%) pickle not used at least once a week more than three times a week n=200 168(84%) 21(10.5%) 11(5.5%) table 1: summary of the knowledge of mother’s regarding use of probiotics in diet of school going children figure 1. association of the education level of mothers regarding use of probiotics in the diet of school going children conclusion a considerable number of children take probiotics as part of their regular diet. however, most mothers were not aware of the probiotics—the knowledge of probiotics in mothers associated with the level of education. however, using a probiotic-rich diet is inherited as the dietary habits based on anecdotal evidence. further studies are required to assess the preventive role of probiotics in children's growth. conflict of interest all the authors declared no conflict of interest. funding no funding was received for this project lmrj volume 4 issue 1 41 | p a g e references 1. yang b, lu p, li m-x, cai x-l, xiong w-y, hou h-j, et al. a meta-analysis of the effects of probiotics and synbiotics in children with acute diarrhea. medicine (baltimore) [internet]. 2019 sep;98(37):e16618. available from: https://journals.lww.com/10.1097/md.0000000000016618 2. shaaban sy, el gendy yg, mehanna ns, el-senousy wm, el-feki hsa, saad k, et al. the role of probiotics in children with autism spectrum disorder: a prospective, open-label study. nutr neurosci [internet]. 2018 oct 21;21(9):676–81. available from: https://www.tandfonline.com/doi/full/10.1080/1028415x.2017.1347746 3. li k-l, wang b-z, li z-p, li y-l, liang j-j. alterations of intestinal flora and the effects of probiotics in children with recurrent respiratory tract infection. world j pediatr [internet]. 2019 jun 24;15(3):255–61. available from: http://link.springer.com/10.1007/s12519-019-00248-0 4. peluzio m do cg, dias m de m e, martinez ja, milagro fi. kefir and intestinal microbiota modulation: implications in human health. front nutr [internet]. 2021 feb 22;8. available from: https://www.frontiersin.org/articles/10.3389/fnut.2021.638740/full 5. depoorter l, vandenplas y. probiotics in pediatrics. a review and practical guide. nutrients [internet]. 2021 jun 24;13(7):2176. available from: https://www.mdpi.com/2072-6643/13/7/2176 6. cevik guner u, kissal a. mothers’ knowledge, attitudes and practices regarding probiotic use during pregnancy and for their infants in turkey. public health nutr [internet]. 2021 sep 5;24(13):4297–304. available from: https://www.cambridge.org/core/product/identifier/s1368980021000951/type/journal_article 7. bridgman sl, azad mb, field cj, letourneau n, johnston dw, kaplan bj, et al. maternal perspectives on the use of probiotics in infants: a cross-sectional survey. bmc complement altern med [internet]. 2014 dec 29;14(1):366. available from: https://bmccomplementalternmed.biomedcentral.com/articles/10.1186/1472-6882-14-366 8. irwin n, davis d, currie m. probiotic supplementation in well children: a scoping review. j child heal care [internet]. 2020 sep 25;24(3):386–401. available from: http://journals.sagepub.com/doi/10.1177/1367493519864750 9. fox mj, ahuja kdk, robertson ik, ball mj, eri rd. can probiotic yogurt prevent diarrhoea in children on antibiotics? a double-blind, randomised, placebo-controlled study. bmj open [internet]. 2015 jan 14;5(1):e006474–e006474. available from: https://bmjopen.bmj.com/lookup/doi/10.1136/bmjopen-2014-006474 10. van den nieuwboer m, brummer rj, guarner f, morelli l, cabana m, claassen e. safety of probiotics and synbiotics in children under 18 years of age. benef microbes [internet]. 2015 oct 15;6(5):615–30. available from: https://www.wageningenacademic.com/doi/10.3920/bm2014.0157 lmrj volume 3 issue 2 42 | p a g e comparison of post-operative refractive outcome after phacoemulsification and extra capsular cataract extraction shabana kausar1, parveen akhtar2, samia batool3, sumira hamid khuwaja4, moomal memon5, sindhia javed junejo5 1 department helper eye hospital, quetta, pakistan, people’s nursing school, liaquat university of medical & health sciences, jamshoro, sindh, pakistan. 2 biomedical workshop at liaquat university of medical & health sciences, jamshoro sindh,pakistan, department of coomunity medicine and public health sciences, liaquat university of medical & health sceinces, jamshoro, pakistan abstract objective: the objectives of the study was to identify the refractive outcome after phacoemulsification and extra capsular cataract extraction and to compare refractive outcomes after both surgeries. methodology: a comparative cross-sectional study was conducted at department of the ophthalmology at helper eye hospital quetta for 3 months from october 2019 to december 2019. in the study, patients aged 40 to 60 years with both unilateral and bilateral senile cataracts and willing to participate were chosen. all patients were organized into two categories, group a and group b, respectively. group a patients underwent a phacoemulsification surgical procedure (phaco) and group b patients underwent extra capsular cataract extraction. surgeries were conducted by senior and expert surgeons with a minimum of 5 years of experience. the spss 23.0 version was used to analyze the results. results: total 174 were enrolled and two separate treatment strategies were used; their mean age was 53.97 + 8.41 group a years and 55.58 + 5.27 group b years. most patients obtained 77.0% of group a visual acuity ucva (> 6/9) over three weeks, compared to 18.4% of group b, p-value 0.001. in group a, bcva (> 6/9) was also measured significantly higher by 88.5% relative to group b, p-value 0.001. the six-week visual acuity evaluation of ucva and bcva (> 6/9) was obtained in almost all group a cases, relative to group b, with a p-value of 0.001. conclusion: patients those underwent phaco had shown significant best final visual outcome on day one, three week and six weeks as compared to ecce. key words: cataract, refractive outcome, phaco, ecce introduction cataract is a chronic disease associated with aging process which is a main cause of reversible blindness worldwide, affecting around 20 million people, of which 95% are over 65 years of age, they have a noticeable opacity of lens.1 world health organization (who) has reported the presence of 285 million visually impaired people worldwide, 80% of whom are preventable. it is assumed that of the 39 million blind in the world, 82% are over 50, and the main causes include cataracts 51%, glaucoma 8% and age-related macular degeneration 5%. regarding the visual impairments, it appears that 65% are in the age group above 50 years old, and the main causes include uncorrected refractive errors 43%, cataracts 33% and glaucoma 2%.2 it is estimated that 90% of the blind live in developing countries, where cataracts appear early and last longer, causing problems in the social and economic progress, this being one of the causes and consequences of poverty.3 the presence of cataracts can correlate increasing mortality rate, estimated between 1.25 and 1.5 times, and in this context, the rate of cataract surgery that so far the only curative treatment is surgery, which has proven to be highly correspondence: memonmoomal8@gmail.co m email: missbana7@gmail.com https://doi.org/10.38106/lmr j.2021.3.2-04 received: 10.06.2021 accepted: 21.06.2021 published: 30. 06.2021 research article lmrj volume 3 issue 2 43 | p a g e cost-effective. this consists of replacing the opaque lens with an intraocular lens by procedures including conventional extraction techniques and two modern techniques are used including phacoemulsification (phaco) and extra capsular cataract extraction (ecce). 4,5 the most common cataract surgery technique due to it lower cost has been reported to be the extra capsular cataract extraction with implant of a polymethyl methacrylate lens (pmma) in the posterior chamber through a sclera corneal incision of approximately 6 to 7 mm. the results obtained in visual acuity are comparable to those of the phacoemulsification, after several weeks and during this time the improvement is slow and the visual acuity (va), and astigmatism is unstable.6 over time, technological improvements have been made that make the surgery of cataract easy and safe.7 this allows the extraction of the cataract lens through a 3 mm incision using a titanium tip that emits ultrasonic waves to mechanically fragment the lens and then aspirate it. patients operated with this technique achieve a remarkable improvement in visual acuity a month after having been operated and the number of post-surgical astigmatism is less than that obtained in the extracapsular extraction.8 phacoemulsification and extra capsular cataract extraction both are very important in regaining the vision, however no study has been done in baluchistan. this study is of great importance to help in the identification of the outcome which is cost-effective and best management option for cataract surgeries. the objective of the study were to identify the refractive outcome after phacoemulsification and extra capsular cataract extraction and to compare refractive outcomes after phaco and ecce methodology a comparative cross sectional study was conducted at department of the ophthalmology helper eye hospital quetta for 3 months from 1st october 2019 to 31st december 2019. total sample size calculated for this study was 174, divided in two groups (n= 87 in each group). simple random sampling technique was used. the ethical approval was taken from research ethics committee of liaquat university of medical & health sciences jamshoro and also the written permission was obtained from the head department of ophthalmology at helper eye hospital quetta. inclusion criteria of the study was all the patients who were aged 40 to 60 years, with both unilateral and bilateral senile cataract, with uneventful cataract surgery. patients with corneal opacity (were determined by eye surgeon), complicated cataract and surgery (were defined by eye surgeon) and patients with lens induced glaucoma were excluded from the study. a written consent obtained from all the subjects and the information collected through structured proforma. all the patients were divided into two groups ‘group a’ and ‘group b’. patients of group a underwent surgical procedure of phacoemulsification (phaco) and patients of group b underwent extra capsular cataract extraction. all the surgeries carried out by senior and expert surgeons with minimum experience of 5 years. all the data entered into spss 23.0 version and analyzed by using the same software. the quantitative data like age have been presented in form of mean ± s.d. simple frequency and percentage computed. for categorical variables, chi square test applied by taking pvalue of ≤0.05 considered significant. results total 174 were enrolled and underwent two different treatment methods, their mean age was 53.97 + 8.41 years of group a and 55.58 + 5.27 years of group b. mean disease duration was 3.66 + 2.44 years in group a and 3.49 + 2.69 years in group b. table-i. pre-operative mean of right eye visual acuity between phaco and ecce (n=174) variable surgical procedure p-value phacoemulsification extra capsular cataract visual acuity right eye 38.12 + 15.22 44.57 + 17.35 0.069 visual acuity left eye 39.66 + 15.39 46.90 + 18.16 0.197 lmrj volume 3 issue 2 44 | p a g e mean visual acuity of right eye was 38.12 + 15.22 in group a and 44.57 + 17.35 in group b, while mean visual acuity of left eye in group a was 39.66 + 15.39 and in group b was 46.90 + 18.16, findings were statistically insignificant. table-ii. day one visual acuity (ucva and bcva) comparison between phaco and ecce n=174 visual acuity day one surgical procedures p-value phaco ecce ucva 0.001 >6/9 18(20.7%) 00 6/12-6/18 62(71.2%) 65(74.7%) 6/24-6/60 7(8.0%) 22(25.13%) total 87(100.0%) 87(100.0%) bcva 0.001 >6/9 26(29.9%) 00 6/12-6/18 57(65.5%) 54(71.13) 6/24-6/60 4(4.6%) 33(28.7) total 87(100.0%) 87(100.0%) on post-operative day one visual acuity >6/9 (ucva) was achieved 18 (20.7%) cases of group a and no nay cases found in group b. 6/12-6/18 was achieved by 62(71.2%) patients of group a and 65 (74.7%) patients of group b. worsen acuity 6/24-6/60 was seen in 22 (25.13%) patients of group b, which statically significant as compared to group a, p-value 0.001. similarly day visual acuity bcva (>6/9) achieved by 26(29.9%) patients of group a, which was statistically significant, p-value 0.001. table-iii. three weeks visual acuity (ucva and bcva) comparison between phaco and ecce n=174 visual acuity three weeks surgical procedures p-value phaco ecce ucva 0.001 >6/9 67(77.0%) 18(18.4%) 6/12-6/18 20(23. %) 67(79.3%) 6/24-6/60 00 2(2.3%) total 87(100.0%) 87(100.0%) bcva 0.001 >6/9 77(88.5%) 67(77.0%) 6/12-6/18 10(11.5%) 19(21.9) 6/24-6/60 00 1(1.1) total 87(100.0%) 87(100.0%) on three weeks assessment visual acuity ucva (>6/9) was achieved by most of the patients 67(77.0%) of group a as compared to group b 18(18.4%), p-value 0.001. visual acuity bcva (>6/9) was also assessed significantly more in group a 77(88.5%) as compared to group b, p-value 0.001. on six weeks assessment visual acuity ucva and bcva (>6/9) were achieved by almost all cases of group a as compared to group b, p-value 0.001. lmrj volume 3 issue 2 45 | p a g e table-iv. six weeks visual acuity (ucva and bcva) comparison between phaco and ecce n=174 visual acuity six weeks surgical procedures p-value phaco ecce ucva 0.001 >6/9 86(98.9%) 58(66.6%) 6/12-6/18 1(1.1%) 29(33.4%) 6/24-6/60 00 00 total 87(100.0%) 87(100.0%) bcva 0.001 >6/9 77(88.5%) 74(85.0%) 6/12-6/18 10(11.5%) 12(15.0) 6/24-6/60 00 1(00) total 87(100.0%) 87(100.0%) discussion the study showed mean age of the participant was 53.97+8.41 years of group a and 55.58 + 5.27 years of group b. in this study most of the cases were illiterate and having low socioeconomic status. these findings were similar to the others studies as; associations have been documented between higher prevalence of blindness (regardless of cause) and being female, living in a rural area, having low socioeconomic status, being less educated and belonging to an ethnic minority.51 cabrera et al9 recently conducted a study in mexico to determine socio-economic factors associated with cataract patients; more than half the patients had not been educated beyond the primary level, while half the patients enrolled in primary ophthalmological care an year after the onset of symptoms. according to the gender distribution males were found in majority in both groups as 54.0% in group a and 51.7% in group b, while 46.0% were females in group a and 48.3% in group b, with insignificant difference p-value 0.761. most of the cases were illiterate in both groups as 66.7% in group a and 72.4% in group b. on other hand thevi t et al10 reported that most patients (38%) were in 61–70 years of age group. in this study males were found in majority in both groups as 47(54.0%) in phacoemulsification group a and 45(51.7%) in group b, while 40(46.0%) were females in group a and 42(48.3%) in extra capsular cataract extraction (ecce) group b. while a study conducted by naik et al11, in group i, the mean age was 59.2±9.8 years (range=44-87years), while in group ii it was 59.5±11.1 years (range=41-80 years). in both categories, the age distribution was comparable. there were 34 males and 21 females in category i. there were 28 males and 27 females in group ii. in another study of oderinlo o et al 12 stated that 50.4% were females and 49.6% were males, with a mean age of 65.3 ± 11.10 years. kara-junior n et al13 also found comparable findings regarding age and gender as mean age of patients in both groups were 69 ± 9 years (eccegroup) and 68 ± 9 years (phaco-group), (p = 0.70), where (in phaco-group) 35.3% and (in ecce-group) 44.1% of the patients were males. in this study on six weeks assessment visual acuity ucva and bcva (>6/9) were achieved by almost all cases of phacoemulsification treated group as compared to those underwent extra capsular cataract extraction (ecce), pvalue 0.001. and on six weeks assessment visual acuity ucva and bcva (>6/9) were achieved by almost all cases of group a as compared to group b, p-value 0.001. similarly in the study of thevi t et al10 reported that in the setting of a district hospital, phaco showed to have a superior final visual outcomes than ecce. it was similar to ned findings (2002-2011), in which 91.5 percent of cases undergoing phaco had a better vision (6/12) than those 83 % cases undergoing extra capsular cataract extrection.14 this supports the findings of nepalese study, in which 91.7% of cases in phaco-group showed better visual outcomes than ecce-group.15 study performed by baig et al16 reported contrary results, in the msics community, the induced astigmatism was lower relative to the ecce group at the first day, but no substantial difference was observed after six weeks. after three weeks, corneas lmrj volume 3 issue 2 46 | p a g e were clear in both groups. at 6 months of follow-up, 22 (12.5 percent) group 1 patients and 27 (14.6 percent) group 11 patients had elschnigs pearls. in randomized trials from two eye hospitals (oxford and moor fields), the ratios of patients attaining vision correction of 6/9 or more were significantly greater in the phaco-group (69%) than those in ecce-group (57%).17 khan et al,18 also reported better visual outcomes in phaco-group (80%) than ecce-group (54%). similar findings were also reported by arriaga me and lozano j19 (76% cases in phaco-group and 66% cases in ecce-group). an observational, multicenter study of loo et al,20 conducted in three ophthalmology departments in malaysian hospitals (health ministry) reported that 3 months before surgical procedure, corrected vision acuity outcome was better in phaco-group (94%) than ecce-group (81%). while inconsistently quinlan m. et al21 reported no significant difference between phacoemulsification and ecce procedure on the nature and rate of in-vitro cell growth on posterior capsule. dowler jg et al22 concluded that phaco is superior than ecce in terms of postoperative vision acuity with less postoperative inflammatory response, and with reduced risk of capsulotomy surgical procedure. toyama t et al23 reported that phaco is safe and effective in enhancing vision acuity equally among both the younger patients and the patients with age range ≥90 years, at least if accomplished by skilled surgeons. ahmed am et al24 reported that phacotrabeculectomy provides early recovery of vision more sustained and effective iop control than extra capsular cataract extraction trabeculectomy. phaco has become a common procedure in cataract extraction within the developed countries, where rehabilitation of the patient is very fast, associated with good visual outcomes. phaco enables the quicker and more likely wound healing, less uncomfortable for the patient, fewer wound-associated complications, and lesser changes of postoperative astigmatism than conventional ecce.48 phaco also enables to achieve superior quantitative and qualitative iop control in terms of duration and range of iop control than extra capsular cataract extraction trabeculectomy yet following 12 months of surgical procedure.47 kalpadakis p et al25 observed that endophthalmitis develops significantly later among extra capsular cataract extraction cases than phaco cases. therefore hygiene conditions among extra capsular cataract extraction operated patients have a greater impact. phaco is proposed to be better than extra capsular cataract extraction in reducing the risk of endophthalmitis following cataract extraction among subjected living in under standard conditions. kara-junior n et al13 also reported that phaco is effective an costeffective intervention because of its impact on brazilian public healthcare system, since it improve the quality of life. the international community normally does not promote the usage of phaco procedure with foldable iol implant in underdeveloped nations ' public healthcare structures, given the general agreement throughout the literature regarding its clinical advantages and diminished individual costs.50 conclusion in the district hospital setting, phaco has been shown to have a better final visual outcome compared with ecce. yet ecce also delivers good results. the ecce preparation does not take long and can be performed by virtually all ophthalmologists. it can be achieved with the required instruments in a working operation theatre, which do not cost much. because of better outcomes with phaco, however, we suggest that district hospitals be supplied with the phaco system, instruments and appropriate facilities for intraocular surgery, and that doctors and paramedics be qualified so that improved eye care services can be offered to the general public. conflict of interest: there is no conflict of interest. funding: this study was not funded by any agency references 1. de almeida ferreira g, schaal lf, ferro md, rodrigues acl, khandekar r, schellini sa. outcomes of and barriers to cataract surgery in sao paulo state, brazil. bmc ophthalmol. 2017 dec;17(1):259. 2. flaxman sr, bourne rra, resnikoff s, ackland p, braithwaite t, cicinelli m v., et al. global causes of blindness and distance vision impairment 1990–2020: a systematic review and meta-analysis. lancet glob heal. 2017 dec;5(12):e1221–34. 3. ho vh, schwab ir. social economic development in the prevention of global blindness. br j ophthalmol. 2001;85(6):653–7. lmrj volume 3 issue 2 47 | p a g e 4. davey k, chang b, purslow c, clay e, vataire al. budget impact model of mydrane®, a new intracameral injectable used for intra-operative mydriasis, from a uk hospital perspective. bmc ophthalmol. 2018 dec 19;18(1):104. 5. jain s, rajshekar k, aggarwal a, chauhan a, gauba vk. effects of cataract surgery and intra-ocular lens implantation on visual function and quality of life in age-related cataract patients: a systematic review protocol. syst rev. 2019 dec;8(1):204. 6. singh k, misbah a, saluja p, singh a. review of manual small-incision cataract surgery. indian j ophthalmol. 2017;65(12):1281–8. 7. jin c, chen x, law a, kang y, wang x, xu w, et al. different-sized incisions for phacoemulsification in age-related cataract. cochrane database syst rev. 2017 sep;9(9):cd010510. 8. nigam i, keshari r, vatsa m, singh r, bowyer k. phacoemulsification cataract surgery affects the discriminative capacity of iris pattern recognition. sci rep. 2019 dec;9(1):11139. 9. mundy km, nichols e, lindsey j. socioeconomic disparities in cataract prevalence, characteristics, and management. semin ophthalmol. 2016;31(4):358–63. 10. thevi t, reddy sc, shantakumar c. outcome of phacoemulsification and extracapsular cataract extraction: a study in a district hospital in malaysia. malaysian fam physician. 2014;9(2):41–7. 11. naik mp, sethi hs, yadav a. topical vs peribulbar anesthesia: comparison of anterior chamber depth and the resultant visual outcome after phacoemulsification. clin ophthalmol. 2020;14:3775–80. 12. oderinlo o, hassan a, oluyadi f, ogunro a, okonkwo o, ulaikere m, et al. refractive aim and visual outcome after phacoemulsification: a 2-year review from a tertiary private eye hospital in sub-saharan africa. niger j clin pract. 2017;20(2):147–52. 13. sirtotoli mggm, santhiago mr, parede trr, de espíndola rf, carvalho r de s, kara n. phacoemulsification versus extracapsular extraction: governmental costs. clinics. 2010;65(4):357–61. 14. goh pp, salowi ma. the 5th report of the national eye database2011. 2013; 15. rajkarnikar s, shrestha db, dhakal s, shrestha r, thapa k, gurung a. comparative study of extra capsular cataract extraction (ecce) and small incision cataract surgery (sics): experience on cataract surgery in a tertiary center of army hospital, kathmandu. nepal j ophthalmol. 2018;10(2):162–7. 16. baig ma, anwar mi, ur rahman i. comparative analysis between small incision cataract surgery and extra capsular cataract extraction. pakistan j med heal sci. 2018;12(1):228–31. 17. minassian dc, dart jkg, rosen p, reidy a, desai p, sidhu m. extracapsular cataract extraction compared with small incision surgery by phacoemulsification: a randomised trial. br j ophthalmol. 2001 jul;85(7):822–9. 18. nangrejo km, sahto aa, pechuho ma, siddiqui sj, abbassi am. visual outcome, phacoemulsification versus extracapsular cataract extraction. med channel. 2011;17(3):29–31. 19. arriaga m, visual jl-io&, 2002 u. a comparative study of visual acuity outcomes: phacoemulsification vs extracapsular cataract extraction. iovsarvojournalsorg. 20. loo cy, kandiah m, arumugam g, goh pp, john e, gurusami b, et al. cost efficiency and cost effectiveness of cataract surgery at the malaysian ministry of health ophthalmic services. int ophthalmol. 2004;25(2):81–7. 21. quinlan m, wormstone im, duncan g, davies pd. phacoemulsification versus extracapsular cataract extraction: a comparative study of cell survival and growth on the human capsular bag in vitro. br j ophthalmol. 1997;81(10):907–10. 22. benson w. phacoemulsification versus extracapsular cataract extraction in patients with diabetes. evidence-based eye care. 2000;1(4):204–5. 23. toyama t, ueta t, yoshitani m, sakata r, numaga j. visual acuity improvement after phacoemulsification cataract surgery in patients aged ≥90 years. bmc ophthalmol. 2018;18(1). 24. ahmed am, mahmood t, pak ma, zayed s, lahore h. combined phaco trabeculectomy vs combined ecce trabeculectomy with iol implantation. vol. 25, j ophthalmol. 2009 mar. 25. kalpadakis p, tsinopoulos i, rudolph g, schebitz k, froehlich sj. a comparison of endophthalmitis after phacoemulsification or extracapsular cataract extraction in a socio-economically deprived environment: a retrospective analysis of 2446 patients. eur j ophthalmol. 2002;12(5):395–400. type of the paper (article lmrj volume 3 issue 4 107 | p a g e research article validation of onco-assist survival prediction tool in stage i, ii and iii colon cancer among asian patients fayaz hussain mangi1, jawaid naeem qureshi2 1nuclear institute of medicine & radiotherapy (nimra), jamsboro, sindh, pakistan, 2indus medical college, tando mohammad khan, sindh, pakistan abstract clinical calculators and predictors are now commonly used in clinical practice to predict most accurate clinical outcome and provide guidance for appropriate therapy. one of the most commonly used calculator is onco-assist. this study was conducted to compare onco-assist prediction of the patients diagnosed with colon cancer stage i, ii and iii. data was retrospectively collected from 88 patients of colon cancer diagnosed over the period of 11 years (2008 to 2018) and registered at nuclear institute of medicine and radiotherapy (nimra), hospital, jamshoro sindh. these patients received primary surgical therapy without any neo-adjuvant systemic chemotherapy. survival assessed on onco-assist prediction algorithm using the defined parameters and compared with the actual survival according to the grade of the tumour. the clinical calculator onco-assist incorporated seven variables: gender, age number of lymph nodes examined, number of tumor-involved lymph nodes, t = (1-4), grade (low / high), adjuvant chemo received (yes / no) if yes then only 5fu or 5fu plus oxaliplatin based. onco-assist predicted five-year survival rate in well differentiated tumours with and without chemotherapy as 84% and 80% respectively, in moderately differentiated tumour with and without chemotherapy as 78% and 76% respectively. for poorly differentiated tumours the predicted survival rate with and without chemotherapy was 73%. while actual achieved survival was 35%, 52% and 17% for well, moderately and poorly differentiated cancers. this clinical calculator onco-assist includes limited parameters and limited adjuvant therapy options thus the prediction of cancer survival following surgery in stage i –iii colon cancer does not appear to accurately predict outcome in asian population. key words: colon cancer; onco-assist, survival calculator, adjuvant chemotherapy. introduction colorectal cancer (crc) is one of the leading cancer throughout the world both in developed and developing countries. the primary curative treatment is surgical resection of the tumor followed by adjuvant therapy. the american joint committee on cancer (ajcc), has endorsed clinical calculators and nomograms for providing the most tailored treatment plan along with precise estimate of clinical outcome of cancer patients. using the clinico-pathological parameters, these nomograms predict chance of recurrence after surgery for operable colon cancer (ie stage i, ii and iii).(1) commonly used tools for survival prediction usually predict outcome of patients for five years relatively more accurately in patients of colon cancer after diagnosis and primary treatment.(2) the exact prediction of correspondence: dr. fayaz hussain mangi nuclear institute of medicine & radiotherapy (nimra), jamsboro, sindh, pakistan, email: drmangi25@gmail.com doi: 10.38106/lmrj.2021.3.0405 received: 03.08.2021 accepted: 25. 12.2021 published: 30. 12.2021 mailto:drmangi25@gmail.com lmrj volume 3 issue 4 108 | p a g e survival is a difficult undertaking for oncology team and also a prime concern of the patient and the family.(2-3). onco-assist is one of the prediction tools which provide survival rates for colon cancer, based upon biological markers and adjuvant treatment. the prediction of the risk recurrence in colon cancer is generally based upon the observations made according to the clinic-pathological factors and patients factors including performance status, weight loss and tumor grade while in recurrent and metastatic cases the anatomic sites of metastases and overall health status of the patient provide useful information which can help in prediction of clinical outcome including disease specific and overall survival(4). early operable cases undergoing complete resection of stage i or ii disease, the characteristics of a primary colon cancer, such as initial stage of tumor, and histological grade can provide valuable information regarding the clinical behavior of malignant tumor (5). not only tumour biological markers and patient characteristics but also genetic signature of the cancers can help in prediction of the recurrence and general clinical outcome. these prognostic factors provide precise guide for management and therapy(6). however, in any case a single factor cannot predict clinical outcome neither guide treatment. the prediction after primary surgery is a difficult task. combination of tumour and treatment factors can potentially predict it. there is data available suggesting usefulness of onco-assist in colorectal cancer. however, there is limited literature available on validating its usefulness in pakistani population. thus this study was conducted based on a retrospective review of the clinical data. methodology this was a retrospective observational study conducted at nuclear institute of medicine and radiotherapy (nimra), jamshoro, pakistan. data was retrospectively collected from case files. complete information of the variables for onco-assist including age, gender, grade, t (ie tumor size), n (ie number lymph nodes examined and number of lymph nodes positive) and adjuvant chemotherapy (only 5fu/ 5fu plus oxaliplatin) was available for 88 patients of colon cancer stage 1, ii and iii. these patients were registered and underwent treatment from 2008 till 2018. these patients received primary surgical therapy without any neo-adjuvant systemic chemotherapy. after their diagnosis, they received treatment as per hospital policy. then the survival assessed on onco-assist prediction algorithm for colon cancer on the defined parameters and the actual survival compared to onco-assist predicted survival, according to the histological grade of the tumour. patients of stage iv colon and recto-sigmoid tumors were excluded. data was collected and analyzed by using spss version 19.0. 5-year median survival was calculated by using kaplan meier method and compared with the median predicted survival. results the clinical calculator onco-assist incorporated seven variables including gender, age number of lymph nodes examined, number of tumor-involved lymph nodes, t = (1-4), grade (low / high), adjuvant chemo received (yes / no) if yes then only 5fu or 5fu plus oxaliplatin based. onco-assist predicted five-year survival rate according to grades, where well differentiated without having adjuvant chemotherapy was 80% and with chemotherapy was 84%, while moderately differentiated tumours lmrj volume 3 issue 4 109 | p a g e if without receiving chemotherapy predicted to have 76% 5-year survival and if receiving chemotherapy, it was 78%. poorly differentiated tumours on the other hand predicted to have 73% 5-year survival regardless of adjuvant chemotherapy. however actual 5year survival rate in well-differentiated (n = 27) tumours was 30.7%, moderately differentiated (n =46) was 52.3% and for poorly differentiated (n =15) was 17%. a summary of the comparison is given in figure 1. limitations of onco-assist clinical calculator:  the 5 year estimate of colon cancer specific survival without adjuvant chemotherapy calculated by using data derived from end results (seer) registry between 1988 and 1997 for surveillance, epidemiology(7). thus for the patients from the 1990s causing a stage shift in the modern days due to newer imaging modalities.  a number of factors considering the risks and benefits of adjuvant chemotherapy in colon cancer patients(8) according to esmo and nccn guidelines not considered i.e. lymph-vascular invasion, peri-neural invasion, perforation, obstruction, co-morbidities and surgical margin status all of which can influence the likelihood of recurrence were not included in the algorithm for prediction of survival outcome.  the calculator only colon cancer not considering rectum, however majority of patients with sigmoid colon also involve rectum this sigmoid colon had to be excluded. figure 1. onco-assist prediction of 5-year survival (%) in patients with colon cancer in pakistani population versus actual observed 5-year survival rate (%). discussion 0 10 20 30 40 50 60 70 80 90 well differentiated moderately differentiated poorly differentiated predicted with chemo predicted without chemo actual lmrj volume 3 issue 4 110 | p a g e survival outcome of crc has steadily improved from 1978 to 1999, this may be due to provision of modern surgical techniques and, the availability of modern chemotherapeutic drugs such as irinotecan and oxaliplatin for treatment of recurrent colon cancer in the most recent era.(4) the other factors such as improved screening facilities and diagnostic modalities including genomic testing has played important role.(9) in clinical practice role of adjuvant management is highly dependent on lymph node involvement age, gender, tumor size and grade of tumor. in addition, other high risk features including lymph vascular invasion, peri-neural invasion, perforation, obstruction, co-morbidities, tumor adherence and depth of invasion affect the decision of clinicians to treat patients with colon cancer and also remains a highly debated issue.(8) onco-assist is a well reputed and widely used online algorithm in breast cancer and validated by many studies(11). however, there is limited literature available validating it in colon cancer, which is a commonly found cancer globally. there is another tool with the title of oncology pro, which was derived from seven randomized controlled trials to predict survival outcome in patients receiving fluorouracil. the pooled analysis included 3302 patients. the review concluded that lymph node status, size of the tumour and the histological grades are the independent predictors of survival both disease specific and overall(5). however, there was no comparison was made with other tools. colorectal cancer generally shows poor survival in developing countries due to late diagnosis and also possible aggressive tumour biology. thus it is utmost important to develop such tools and validate them in populations independently so that the racial differences in clinical behavior of cancers can be addressed. in our study onco-assist over-estimated survival while the actual achieved outcome was much less as compared to the predicted. this probably indicates that asian population having aggressive tumor biology because in spite of getting standard treatment the overall survival is significantly different from onco-assist predicted. secondly this calculator incorporates seven variables needs to be revised with inclusion of more sophisticated predictors and more specific variables in onco-assist in order to make it useful for asian population. it is also recommended that emerging biomarkers need to be incorporated and validated for acceptance in the oncologic community. conclusion this clinical calculator onco-assist for predicting cancer survival following surgery in stage i –iii colon cancer is entirely different in case of asian population. larger studies with inclusion of more biomarkers are required to be conducted and also other algorithms need to be validated and compared in order to design a well fit model which can accurately predict clinical outcome in asian population. ethical consideration: the study was approved by the local research ethical committee conflict of interest: there is no conflict of interest. funding: no funding required references 1. weiser mr, hsu m, bauer ps, chapman wc, gonzález ia, chatterjee d, et al. clinical calculator based on molecular and clinicopathologic characteristics predicts recurrence following resection of stage i-iii colon cancer. j clin oncol. 2021 jan;jco.20.02553. lmrj volume 3 issue 4 111 | p a g e 2. silva a, oliveira t, julian v, neves j, novais p. a mobile and evolving tool to predict colorectal cancer survivability. 3. dienstmann r, mason mj, sinicrope fa, phipps ai, tejpar s, nesbakken a, et al. prediction of overall survival in stage ii and iii colon cancer beyond tnm system: a retrospective, pooled biomarker study. ann oncol off j eur soc med oncol. 2017 may;28(5):1023–31. 4. o’connell mj, campbell me, goldberg rm, grothey a, seitz jf, benedetti jk, et al. survival following recurrence in stage ii and iii colon cancer: findings from the accent data set. j clin oncol. 2008 may;26(14):2336–41. 5. gill s, loprinzi cl, sargent dj, thomé sd, alberts sr, haller dg, et al. pooled analysis of fluorouracil-based adjuvant therapy for stage ii and iii colon cancer: who benefits and by how much? j clin oncol. 2004;22(10):1797–806. 6. jorissen rn, croxford m, jones it, ward rl, hawkins nj, gibbs p, et al. evaluation of the transferability of survival calculators for stage ii/iii colon cancer across healthcare systems. int j cancer. 2019 jul;145(1):132–42. 7. early colon cancer treatment recommendations. 8. andré t, boni c, navarro m, tabernero j, hickish t, topham c, et al. improved overall survival with oxaliplatin, fluorouracil, and leucovorin as adjuvant treatment in stage ii or iii colon cancer in the mosaic trial. j clin oncol. 2009 jul;27(19):3109–16. 9. sanford nn, ahn c, beg ms, sanjeevaiah a, kazmi sa, folkert mr, et al. stage-specific conditional survival among young (age below 50 y) versus older (age 50 y and above) adults with colorectal cancer in the united states. am j clin oncol cancer clin trials. 2020 jul;43(7):526–30. 10. yang cc, tian yf, liu ws, chou cl, cheng lc, chu ss, et al. the association between the composite quality measure “textbook outcome” and long term survival in operated colon cancer. medicine (baltimore). 2020 oct;99(40):e22447. 11. mazo c, kearns c, mooney c, gallagher wm. clinical decision support systems in breast cancer: a systematic review. cancers (basel) [internet]. 2020 feb 6;12(2):369. lmrj volume 3 issue 1 13 | p a g e additional cytogenetic abnormalities in resource constraint countries; an additional burden on chronic myeloid leukemia patients ? nida anwar, naveena fatima, sana khurram, tahir shamsi national institute of blood diseases and bone marrow transplantation, karachi pakistan correspondence: dr. nida anwar email: drnidairfan@yahoo.com https://doi.org/10.38106/lmrj. 2021.3. 1-03 received: date: 16-03-2021 accepted: date 05-04-2021 published: date: 30-04-2021 abstract: the objective of this study was to analyze the additional cytogenetic abnormalities at baseline in chronic myeloid (cml) leukemia patients, compare its characteristics with patients having normal karyotype and to identify the rationale of performing cytogenetics in treatment naive cml patients. a case control study was conducted, 18 cases and 36 controls were recruited from 2010-2018. controls were diagnosed cml patients without additional cytogenetic abnormalities. spss was used to analyze the data, chi-square and independent sample ttest were applied to observe the association. kaplan -meier was used to observe the survival outcomes. at follow up, after the initiation of treatment, there was no differences in cases and controls with respect to the hemoglobin, total leucocyte and platelet count. molecular response at 06 month was similar between two groups while at 12 months there was a significant difference, where controls were found to have higher response rate. survival outcomes were also found comparable in cases and controls. our findings reflect negligible difference in clinical and molecular responses between cases and controls in cml patients. thus, performing cytogenetics at baseline might not be helpful to predict progression of disease and treatment outcome. keywords: additional cytogenetic abnormalities, case-control, chronic myeloid leukemia, pakistan introduction chronic myeloid leukemia (cml) is a myeloproliferative neoplasm distinguished by the existence of philadelphia chromosome (ph) resulting from a translocation between chromosome 9 and 22, i.e. t(9;22)(q34;q11) 1. the translocation causes the formation of a chimeric oncogene, breakpoint cluster region-abelson leukemia virus oncogene (bcr-abl) encoding the p210bcr-abl2. regardless of the distinguished cytogenetic and molecular features harbored by cml; the patients have a diverse clinical presentation, treatment responses, and survival 3. moreover, the heterogeneous characteristics of the disease are also evident at cytogenetic and molecular levels 4,5. depending upon the different breakpoints of the bcr gene, most cml cases possess a fusion oncogene comprising either the b3a2 or b2a2 transcripts5. moreover, 5% 10% of patients have variant translocations in which at least a third chromosome is involved in the rearrangement6 addressed as additional cytogenetic abnormalities (aca). the presence of these abnormalities is responsible for the prediction of adverse prognosis, disease progression, poor overall survival, and treatment outcome with conventional therapy being reported widely in the blast and accelerated phase as compared to the chronic phase7. the most common acas research article mailto:drnidairfan@yahoo.com lmrj volume 3 issue 1 14 | p a g e include trisomy8, a second ph chromosome, isochromosome (17)(q10), 1der(22) which are considered as “major route changes,” . however, the infrequent chromosomal aberrations such as trisomy 21, t(3;12), t(4;6), t(2;16), and t(1;21) are designated as minor acas8. the major route abnormalities have auxiliary negative prognosis as compared to minor route abnormalities9 and previous studies have reported a negative prognostic impact on treatment response and survival of patients particularly in patients who are treated by first-line tyrosine kinase inhibitors (tki). however, the findings are conflicting and ambiguous 7,8,10 and it might be due to the heterogeneous collection of cytogenetic abnormalities14. however, according to the eln recommendation 2013, it was proposed that it is not essential to perform cytogenetics at baseline. on contrary, it is also emphasized to conduct cytogenetic analysis until the achievement of complete cytogenetic response (ccyr) and major molecular response(mmr)11,12. european society of medical oncology (esmo) guidelines also suggest performing the cytogenetics at 3 and 6 months and every 06 months subsequently until the achievement of complete cytogenetic response13. majority of studies in the literature have discussed significance of assessment of cytogenetics during the treatment to rule out progression of the disease and to initiate a dose adjustment of tki. the existing guidelines reflect the international literature while local data is diminished and in fact none of the guidelines has been developed for developing countries so far. in this context, we aimed to conduct a case control study in which we recruited patients with additional cytogenetic abnormalities as cases and compared the clinical and molecular responses with control group in order to identify the rationale of conducting cytogenetic at baseline which is costly and putting more burden on patients when it is a prerequisite to perform bcr-abl by pcr at baseline as per the eln recommendations. materials and methods this study was approved by institutional review board (irb) in march 2018 and the data was recruited from the patients who visited the national institute of blood diseases and bone marrow transplant karachi pakistan during may 2010september 2018. in this case control study, 18 cml cases with aca were recruited retrospectively and for each case, 02 age, sex, and sokal score matched controls without aca were enrolled. baseline cytogenetic analysis was performed overnight, 24-hrs unstimulated, and 72-hrs stimulated bone marrow cultures using standard procedures. the gtg (g-bands via trypsin using giemsa) banding technique was applied, karyotypes were described according to the international system for human cytogenetic nomenclature (iscn) 2013, karyogram was made using metasystem®. bcr-abl1 by real-time quantitative pcr (rt-qpcr) was done by qiagen kits on rotor-gene q 5plex hrm instrument with 72-tubes rotor, performed on peripheral blood and bone marrow. response to treatment was assessed according to eln recommendations 201312. informed consent was obtained from all the participants included in the study. statistical package for social sciences (spss) version 23.0 was used to analyze the data. descriptive and inferential statistics including chi-square and independent t-test was applied to observe the association. p-value ≤0.05 was considered significant. statistically significant differences in complete hematological response (chr) at 03 months and molecular response at 06, 12, and at the end of study between cases and control were assessed by chi-square test. differences in hemoglobin (hb), total leucocyte count (tlc), and platelet counts at baseline and at the end of the study between cases and controls were assessed by independent t-test. progression-free survival (pfs) and overall survival (os) were estimated by the kaplan–meier method. progression-free survival was calculated from the first dose of tki to the first documentation of disease progression into accelerated or blast phase and os was calculated from the first dose of tki to the date of death or last follow-up. lmrj volume 3 issue 1 15 | p a g e results fifty-four participants were included in the study. of these, 18 were diagnosed cases of cml having aca, and 36 were taken as matched controls. baseline hemoglobin (p-value 0.293), tlc (p-value 0.607), and platelet counts (pvalue 0.698) were the same in both groups and were found to be non-significant. the complete hematological response was assessed at 03 months post-treatment and it was found that control group was greater in number achieving chr than cases (p-value 0.016). however, at the study's end, the normalization of hb (p-value 0.076), tlc (p-value 0.292), and platelet counts (p-value 0.655) were same in both groups.fifteen cases were evaluable for molecular response and survival outcome analysis for which 30 best matched controls were selected. it was found that achievement of molecular response at 06 months was similar in both groups. however, at 12 months controls were greater in number than cases in molecular response achievement. at the study's end as per eln recommendations, both the groups had a similar molecular responses. (table 01). estimated pfs and os for cases and controls were 80% and 96 % and 87% and 90% respectively. (table 02, figure 01 & 02). treatment response and survival of aca cases along with compare and contrast with international studies is depicted in table 03. 1,8,7,14-19 table : 01 molecular response between cases and controls table : 02 progression free survival and overall survival of cases and controls molecular response achieve (n) molecular response not achieved (n) p-value at 06 months cases 06 09 0.399 control 16 14 12 months cases 8 07 0.032 control 25 05 at the study's end cases 08 07 0.111 control 23 07 groups total number of cases and control number of events pfs /os (%) 95% confidence interval log rank (mantelcox) p-value lower bound upper bound progression free survival (pfs) cases 15 03 80 906.224 1443.376 0.066 control 30 01 96 3305.826 3772.174 overall survival (os) cases 15 02 87 1029.933 1489.622 0.597 control 30 03 90 2912.171 3685.132 lmrj volume 3 issue 1 16 | p a g e table: 03 treatment response and survival of aca cases: compare and contrast with international studies1,7,8,14-19. author, country year of publish hematological response molecular response progression free survival overall survival present study anwar et al. 2019 3months: significant overall: non significant overall: non significant 12 months: significant non significant non significant chandran et al india14 2019 non significant non significant non significant non significant safaei et al iran15 2018 not assessed significant not assessed significant millot, et al france 16 2017 not assessed non significant non significant non significant alhuraiji et al usa 7 2017 non significant non significant non significant non significant savasoglu et al turkey 17 2016 not assessed non significant not assessed non significant crisan et al romania18 2015 not assessed 10/11 achieved ccyr non significant non significant aissata et al cote d'ivoire19 2013 59% patients achieved chr major cytogenetic response in 52% patients , mmr in 3% patients not assessed not assessed luatti et al italy 8 2012 non significant 12 non significant overall significant non significant non significant hsiao et al taiwan1 2011 non significant † not assessed significant non significant † non significant: results in patients with and without acas were same, † evaluated in patients in chronic phase only lmrj volume 3 issue 1 17 | p a g e figure: 01 progression free survival in cases and controls nk= normal karyotypr abn cyto= abnormal cytogenetics figure: 02 overall survival in cases and controls nk= normal karyotype abn cyto= abnormal cytogenetics discussion: additional chromosomal abnormalities in cml at baseline and during treatment is a well-known phenomenon. there are some suggested mechanisms but the exact pathogenesis and underlying biology remain unclear and the adverse impact conferred by its presence has been controversial in the literature19,20. in our study we investigated the difference in post-treatment hematological and molecular response in patients with and without aca in order to omit cytogenetic analysis at baseline at least in old age and non-affordable patients. eln recommendations consider the presence of aca at diagnosis as a warning feature requiring close monitoring12 particularly the major-route abnormalities16 and this is in concordance with previous studies reporting low response rate and overall inferior survival of patients compared to those without aca7,8, 10. on the contrary some studies reported that aca at diagnosis could not be considered an adverse prognostic factor in the chronic phase under first-line tki treatment and the type of abnormality at baseline have a minimal role on the outcome, although the highest risk abnormalities (i.e., abnormalities in chromosomes 3 and i17q) are rarely if ever detected at diagnosis7, 16. in our study when we assessed hematological response, the normalization of hb, tlc, and platelets were identical in cases and controls but majority of patients in control group achieved chr at 03 months as compared to cases. however, alhuraji et al found similar median time of achievement of chr in patients with and without acas7. other regional and international studies also did not find significant difference in chr between cases and controls as depicted in table :021, 7,8, 14. one of the reasons in our cases for not achieving early chr could be the tlc outlier readings of 02 of the patients. one of them was non compliant and other patients had complex karyotype at baseline as some studies have reported an adverse outcome of patients having complex karyotype9. in molecular response assessment it was found that patients who were having aca had similar overall response as that of control in the study. at 06 months, the attainment of response was similar between cases and controls whereas another study reported a higher response rate at 06 months in patients without aca7. also the reverse pattern of response was observed at 12 months and we found higher rate of response at 12 months in controls whereas the study by alhuraji et al7 reported no significant difference between the two groups. studies were done in france, usa, romania, turkey, italy, and india also reported non significant difference in molecular response amongst patients with and without aca7,8,14,16-18. molecular response at the end of the study was also similar in patients with and without aca in our study which is in concordance with the findings reported in literature7. overall, there was no difference in os and pfs in the current study between the cases and controls and it is also in lmrj volume 3 issue 1 18 | p a g e concordance with other studies7,8,14,16-18 . it is reported in the literature that major route abnormalities are associated with early progression to advanced phase and a german study stated that pfs and os were shorter than in patients with standard t (9; 22)9, 18. however, in our study patients who were progressed to advanced phase had minor, major, and complex aca. in our cases, out of 15, 02 patients died and they were detected with minor and complex aca at diagnosis. hence the association of having major route abnormality and mortality that has been discussed in literature is unlike in our study and it is supported by another study done in turkey in which they did not find statistical correlation between patients with major and complex aca and without aca17. in this study they also investigated the association of bcr-abl kinase domain (kd) mutations and aca and didn't find a significant association17. in our study, we didn't identify aca in patients during treatment. one of the studies emphasized that the detection of acas during the tki treatment is a warning sign of disease progression and intermittent cytogenetic monitoring is mandatory as it is considered to be a form of treatment failure18. however some other studies did not describe the significant contribution of cytogenetic analysis in patients with molecular failures and also its impact on the course of the disease12. cytogenetics as compared to rt-qpcr have low sensitivity due to the low number of analyzed metaphases, the need for a bone marrow aspiration makes it a painful procedure for the patients11,20 particularly in the old age group. the option to exclude routine cytogenetic monitoring may not only prevent uncertain classifications complicating the analysis of response assessment11 but may also reduce the additional burden on non affordable patients in terms of cost when it is a prerequisite to get bcr-abl done for disease diagnosis and monitoring. thus it is still a matter of debate and we cannot predict the treatment outcome solely on the basis of presence of aca and it could be questionable whether cytogenetic evaluation at diagnosis carries value if regular molecular monitoring is available. cytogenetic assessment could however be worth performing in instances where a molecular warning or failure response is obtained. limitations of our study were that we didn't look for tki mutation analysis and its correlation with aca, hence the outcome in these patients could not be predicted in our study, also the sample size is less to conclude such findings assertively although we reduced this by adding controls studies with larger sample size are needed. conclusion: patients with additional cytogenetic abnormalities in our cohort showed similar hematological and molecular responses as controls. in developing countries with limited resources, financial constraints and scarce medical facilities, omission of cytogenetic analysis at baseline when molecular level tests are available may be considered except in instance where molecular warning or failure occurred. however, further prospective studies with a large sample size are needed in this regard. acknowledgement: none conflict of interests: none funding : none references: 1. hsiao, h. h., liu, y. c., tsai, h. j., hsu, j. f., yang, w. c., chang, c. s., & lin, s. f. (2011). additional chromosome abnormalities in chronic myeloid leukemia. the kaohsiung journal of medical sciences, 27(2), 49-54. 2. aplan, p. d. (2006). causes of oncogenic chromosomal translocation. trends in genetics, 22(1), 46-55. 3. 5pane, f., intrieri, m., quintarelli, c., izzo, b., muccioli, g. c., & salvatore, f. (2002). bcr/abl genes and leukemic phenotype: from molecular mechanisms to clinical correlations. oncogene, 21(56), 8652-8667. 4. reid, a. g., huntly, b. j., grace, c., green, a. r., & nacheva, e. p. (2003). survival implications of molecular heterogeneity in variant philadelphia‐positive chronic myeloid leukaemia. british journal of haematology, 121(3), 419-427. 5. deininger, m. w., goldman, j. m., & melo, j. v. (2000). the molecular biology of chronic myeloid leukemia. blood, the journal of the american society of hematology, 96(10), 3343-3356. 6. reddy, k. s., & sulcova, v. (2000). a fish study of variant philadelphia rearrangements. cancer genetics and cytogenetics, 118(2), 121-131. lmrj volume 3 issue 1 19 | p a g e 7. alhuraiji, a., kantarjian, h., boddu, p., ravandi, f., borthakur, g., dinardo, c., ... & cortes, j. (2018). prognostic significance of additional chromosomal abnormalities at the time of diagnosis in patients with chronic myeloid leukemia treated with frontline tyrosine kinase inhibitors. american journal of hematology, 93(1), 84-90. 8. luatti, s., castagnetti, f., marzocchi, g., baldazzi, c., gugliotta, g., iacobucci, i., ... & testoni, n. (2012). additional chromosomal abnormalities in philadelphia-positive clone: adverse prognostic influence on frontline imatinib therapy: a gimema working party on cml analysis. blood, 120(4), 761-767. 9. fabarius, a., leitner, a., hochhaus, a., müller, m. c., hanfstein, b., haferlach, c., ... & hehlmann, r. (2011). impact of additional cytogenetic aberrations at diagnosis on prognosis of cml: long-term observation of 1151 patients from the randomized cml study iv. blood, 118(26), 6760-6768. 10. cortes, j. e., talpaz, m., giles, f., o'brien, s., rios, m. b., shan, j., ... & kantarjian, h. m. (2003). prognostic significance of cytogenetic clonal evolution in patients with chronic myelogenous leukemia on imatinib mesylate therapy. blood, 101(10), 3794-3800. 11. geelen, i. g., thielen, n., janssen, j. j., hoogendoorn, m., roosma, t. j., valk, p. j., ... & westerweel, p. e. (2018). omitting cytogenetic assessment from routine treatment response monitoring in chronic myeloid leukemia is safe. european journal of haematology, 100(4), 367-371. 12. baccarani, m., deininger, m. w., rosti, g., hochhaus, a., soverini, s., apperley, j. f., ... & hehlmann, r. (2013). european leukemianet recommendations for the management of chronic myeloid leukemia: 2013. blood, 122(6), 872884. 13. hochhaus, a., saussele, s., rosti, g., mahon, f. x., janssen, j. j., hjorth-hansen, h., ... & buske, c. (2017). chronic myeloid leukaemia: esmo clinical practice guidelines for diagnosis, treatment and follow-up. annals of oncology, 28, iv41-iv51. 14. krishna chandran, r., geetha, n., sakthivel, k. m., suresh kumar, r., jagathnath krishna, k. m. n., & sreedharan, h. (2019). impact of additional chromosomal aberrations on the disease progression of chronic myelogenous leukemia. frontiers in oncology, 9, 88. 15. safaei, a., monabati, a., safavi, m., atashabparvar, a., & hosseini, m. (2018). additional cytogenetic aberrations in chronic myeloid leukemia: a single-center experience in the middle east. blood research, 53(1), 49. 16. millot, f., dupraz, c., guilhot, j., suttorp, m., brizard, f., leblanc, t., ... & guilhot, f. (2017). additional cytogenetic abnormalities and variant t (9; 22) at the diagnosis of childhood chronic myeloid leukemia: the experience of the i nternational r egistry for c hronic m yeloid l eukemia in c hildren and a dolescents. cancer, 123(18), 36093616. 17. savasoglu, k., payzin, k. b., ozdemirkiran, f., subasioglu, a., & yilmaz, a. f. (2017). the effect of the additional cytogenetic abnormalities on major molecular response and bcr-abl kinase domain mutations in long-term followup chronic myeloid leukemia patients, a cross sectional study. leukemia & lymphoma, 58(8), 1958-1962. 18. crisan, a. m., coriu, d., arion, c., colita, a., & jardan, c. (2015). the impact of additional cytogenetic abnormalities at diagnosis and during therapy with tyrosine kinase inhibitors in chronic myeloid leukaemia. journal of medicine and life, 8(4), 502. 19. aïssata, t. d., sawadogo, d., nanho, c., kouakou, b., emeuraude, n. d., roméo, a., ... & sanogo, i. (2013). imatinib mesylate effectiveness in chronic myeloid leukemia with additional cytogenetic abnormalities at diagnosis among black africans. advances in hematology, 2013. 20. verma, d., kantarjian, h., shan, j., o'brien, s., estrov, z., garcia‐manero, g., ... & cortes, j. (2010). survival outcomes for clonal evolution in chronic myeloid leukemia patients on second generation tyrosine kinase inhibitor therapy. cancer: interdisciplinary international journal of the american cancer society, 116(11), 2673-2681. type of the paper (article lmrj volume 3 issue 4 96 | p a g e research article psychological traumatic events in the recent past and association with diagnosis of cancer fasiha shah1, faisal hyder shah2 1 school of social work, faculty of social sciences, universiti sains malaysia, penang, malaysia, 2department of social work, university of sindh, pakistan abstract emotional stress due to psychological trauma causes immune system dysfunction resulting in high risk of development of cancer. the study aimed to correlate psychological trauma in the past five years of cancer diagnosis. this study was a community based survey including cancer patients diagnosed with different cancers undergoing treatment or follow-up by using snowball sampling and questionnaire based technique. the study was conducted during a period of one year from december 2019 till december 2020. all recruited patients were requested for an interview. the results of the study showed a high rate of major psychological trauma among cancer patients. sudden death of a close relative with and without trauma of natural disaster were most commonly reported events. the study concluded that the risk of cancer development rises with major emotional trauma specially death of a close relative. key words: emotional stress, psychological trauma, cancer introduction cancer is one of the oldest known diseases and currently leading cause of mortality around the globe. the rate of cancer is at rise and further increase is predicted by world health organization in its globocan project(1). cancer has demonstrated multifactorial causation and risk factors including endogenous factors such as chronic inflammation, environmental factors (ie exposure to carcinogens), drugs, compromised immunity and genetic mutations(2). emotional stress is known to affect intracellular mechanisms thereby disturbing immunity(3). it has also been suggested that inflammation results in depression and vice versa. the immune disruption has been associated with stressful events resulting in emotional disturbances(4). stress immune response relationship has been studied previously and a whole new science of psychoneuroimmunology has been established. the stress or emotional events trigger immune response by releasing cytokines including interleukins which activate vagus nerve response and to a lesser extent trigerminal nerve response causing feelings of sickness(5). acute stress response physiologically activates adrenal medulla which releases epinephrine and norepinephrine, which in turn activates hypothalamicpituitary axis thereby rising basal metabolic rate, resulting in rise in heart rate, respiratory rate and blood pressure. however, if the response remains there for a longer period, or if it becomes severe the autonomic nervous system become dysfunctional. autonomic nervous system also controls immune system causing chronic inflammatory response(6) as a result of continuous stress. chronic inflammation causes glucocorticoid resistance thus inflammatory response correspondence: fasiha shah school of social work, universiti sains malaysia penang, malaysia email: fasiha.sw@gmail.com faisal.shah@usindh.edu.pk doi: 10.38106/lmrj.2021.3.04-03 received: 29.09.2021 accepted: 15. 12.2021 published: 30. 12.2021 mailto:fasiha.sw@gmail.com mailto:faisal.shah@usindh.edu.pk lmrj volume 3 issue 4 97 | p a g e progresses further. chronic inflammation is also known to be linked with cancer development and also poor clinical outcome(7,8). recently (ie 2019) a systematic review of cohort studies was reported suggesting a rise in cancer incidence after depression and chromic emotional stress levels and also there was a link of poor prognosis in stressed patients(9). however, there is limited literature available suggesting association of stress induced chronic inflammation and cancer. also there is limited research available exploring association of acute severe psychological trauma and later development of cancer. thus this study was designed to explore cancer patients and correlate severe stressful event in the recent past and the diagnosis of cancer. methodology the study was a community based survey conducted at hyderabad. patients with confirmed diagnosis of cancer were identified from nimra hospital and informed consent was taken followed by questionnaire based interview. further samples were identified through snowball sampling. the patients identified through the patients treated at nimra were also included. those patients who refused to share information were excluded. there were 16 close ended questions (table 1) and responses were categorized into five categories ait happened to you personally, byou witnessed it happen to someone else, cyou learned about it happening to someone close to you, dyou’re not sure if it fits, e it doesn’t apply to you. all the patients who consented to be part of the study were asked these questions or in case of english literate patients were requested to go through questions and respond accordingly. statistical methods the data was analyzed by using statistical package for social sciences (spss) version 21 ibm. frequency distribution was reported for the events and mean time for the events was calculated along with standard deviation (sd). results a total of 428 patients were interviewed including 168 males (ie 39.3%) and 260 females (ie 60.7%). a total of 380 patients disclosed their site of cancer and 48 declined to inform about the site of the cancer. breast cancer patients were 151 (39.7%) followed by head and neck including oral cancers (n=94, 24.7%). gastrointestinal and reproductive cancers were 34 (7.9%) in each while 22 patients with lung cancer (5.8%) and remaining were diagnosed with liver, blood, bone and neuroendocrine cancers. natural disaster, death of the close relative and fire/ explosion were major psychological trauma they faced. natural disaster with death of the close relative was even higher. a summary of the responses is given table 1. mean time of event happened and diagnosis of cancer 3.49 (sd±3.726) years. table 1. list of the questions asked for life events from patients undergoing treatment/ follow-up of cancer and summary of their responses no event a b c d e 1 natural disaster (for example, flood, hurricane, tornado, earthquake) 316 (74.5) 0 0 0 108(25.5) lmrj volume 3 issue 4 98 | p a g e 2 fire or explosion 251 (58.6) 4(0.9) 0 0 173 (40.4) 3 transportation accident (for example, car accident, boat accident, train wreck, plane crash) 152(35.5) 13(3.0) 0 0 259(60.5) 4 serious accident at work, home, or during recreational activity 57(13.3) 12(2.8) 0 0 347(81.1) 5 exposure to toxic substance (for example, dangerous chemicals, radiation) 53(12.4) 17(4.0 ) 0 0 357(83.4) 6 physical assault (for example, being attacked, hit, slapped, kicked, beaten up) 35(8.2) 8(1.9) 0 0 384(89.7) 7 assault with a weapon (for example, being shot, stabbed, threatened with a knife, gun, bomb) 24(5.6) 8(1.9) 0 0 396(92.5) 8 sexual assault (rape, attempted rape, made to perform any type of sexual act through force or threat of harm) 14(3.3) 5(1.2) 0 0 409(95.6) 9 combat or exposure to a war-zone (in the military or as a civilian) 17(4.0) 4(0.9) 0 0 406(94.9) 10 captivity (for example, being kidnapped, abducted, held hostage, prisoner of war) 32(7.5) 8(1.9) 0 0 388(90.7) 11 life-threatening illness or injury 115(26.9) 4(0.9) 0 0 305(71.3) 12 severe human suffering 108(25.2) 4(0.9) 0 0 316(73.8) 13 sudden, violent death (for example, homicide, suicide) 132(30.8) 0 0 0 296(69.2) 14 sudden, unexpected death of someone close to you 221(51.6) 0 0 0 207(51.6) 15 serious injury, harm, or death you caused to someone else 182(42.5) 1(0.2) 0 0 245(57.2) 16 any other very stressful event or experience 149(34.8) 1(0.2) 0 0 278(65.0) lmrj volume 3 issue 4 99 | p a g e figure 1. most commonly reported traumatic events experienced by patients undergoing treatment or follow-up of cancer discussion psychological stress is one of the major causes associated with chronic illness including metabolic syndrome, hypertension, diabetes and even cardiac disease and stroke. wear and tear of cells is an ongoing process thus the dividing cells have strong system of dna repair mainly govern by p53 gene pathway while those cells which cross the boundaries of being repaired go through a clearance system of apoptosis (ie cell suicide) govern by bcl2 pathway(10). mitochondria is an important organelle for cell energy metabolism and normal cellular functions. stress response has been associated with mitochondrial dysfunction and at the same time mitochondrial dysfunction has been significantly linked with cancer(11). cancer cells tend to develop at all times in human body but the immune system has a mechanism to remove them. continuously dividing cells such as gastroenterological lining epithelium, oral mucosa, bone marrow cells and breast cells have a higher chance of being masked by immune system and escape destruction and develop into cancer. there is literature available suggesting freezing of immune system in response to acute psychological trauma. in our study natural disaster, fire, accident, death of a close relative and harm done by the patient to someone else were identified as the key events happened in the past. the mean time for the past event was three and half years in our study. further elaboration stated that this natural disaster, fire and accidents also resulted in death of family members. previously reported studies have suggested that natural disasters and death of close relatives have been associated with higher rate of cancer development. war situations raise the reported cases of cancer however it cannot be directly linked with stress but the environmental factors such radiations from ammunition may also play a role. a large study was conducted including 485864 adults from united states of america showed that psychological stress was associated with higher mortality. the study also demonstrated associated with the degree of 7 4 .5 5 8 .6 3 5 .5 5 1 .6 4 2 .5 n a t u r a l d i s a s t e r f i r e a c c i d e n t d e a t h o f c l o s e r e l a t i v e h a r m d o n e b y t h e p a t i e n t % o f pat i e n t s e x p e r i e n c e d lmrj volume 3 issue 4 100 | p a g e stress categorizing in mild moderate and severe, where higher the level of stress and more the relative risk of cancer mortality(12). a previously reported study was conducted through telephonic survey of newly diagnosed breast cancer patients to evaluate association of major life stressors within two years. a total of 222 patients were included and 51.3% reported stressors in the recent past. great majority had family related stressor while considerable number (ie 21%) had financial worries. this was an interesting study in a way supporting our study results where death of a close relative came up as one of the major trauma while financial stress was not included in our study(13). following houston hurricane a survey was conducted which explored allergy and stress in the affected population. results suggested that the affected population showed higher rate of allergies and high stress score(14). however association with cancer or longer follow-up of the population was not done as part of the study. a large number of studies have been conducted looking at the psychological stress among cancer survivors and those undergoing treatment of cancer (ie chemotherapy, radiotherapy). however, there is limited literature available looking at the association of major psychological trauma as a risk factor for development of cancer. on the other hand, post-traumatic stress disorder(ptsd) is one of the known psychological trauma response seen. even early life stresses have been linked with immunological and metabolic abnormalities later in life(15). meta-analysis and systematic review of 11 studies showed a moderate rise in breast cancer risk after going through a stressful life event(16). work stress is a form of chronic stress where colorectal cancer, lung cancer, esophageal cancer have been reported to be significantly associated. these results were concluded in a meta-analysis of observational studies with pooled analysis of 281,290 participants(17). another study not only confirmed association of stress with risk of breast cancer but also suggested a dose response fashion(18), higher the stress level higher the risk of breast cancer. however, work stress was not explored in our study but its seems like chronic stressful environment has strong association with development of cancer. another nested casecontrol study was conducted exploring association of post-traumatic stress disorder in different cancer groups but the results were not significant in correlating ptsd and cancers(19). the duration of the ptsd and coping strategies were not focused, which might have influenced these results. conclusion emotionally traumatic events specially death of a close relative appears to be associated with high risk of cancer development. it is therefore required to provide appropriate psychological support to high risk population. further studies with long term follow-up and interventional studies to minimize the risk and understanding of pathogenesis of the association of stress and psychological stress will be required. ethical consideration: informed consent was taken from all the patients, the codes were used for data collection. names of the patients or any kind of identity was not mentioned in questionnaire or any other form of data. conflict of interest: there is no conflict of interest. funding: no funds required for the study. lmrj volume 3 issue 4 101 | p a g e references 1. globocan [internet]. 2020. available from: https://www.uicc.org/news/globocan-2020-new-globalcancer-data#:~:text=globocan 2020 is an online,for all cancer sites combined. 2. kruk j, aboul-enein bh, bernstein j, gronostaj m. psychological stress and cellular aging in cancer: a meta-analysis. oxid med cell longev [internet]. 2019 nov 13;2019:1–23. 3. picard m, mcewen bs. psychological stress and mitochondria: a conceptual framework. psychosom med [internet]. 2018 feb;80(2):126–40. 4. maydych v. the interplay between stress, inflammation, and emotional attention: relevance for depression. front neurosci [internet]. 2019 apr 24;13. 5. pace-schott ef, amole mc, aue t, balconi m, bylsma lm, critchley h, et al. physiological feelings. neurosci biobehav rev [internet]. 2019;103(november 2018):267–304. 6. kalinichenko ls, kornhuber j, müller cp. individual differences in inflammatory and oxidative mechanisms of stress-related mood disorders. front neuroendocrinol [internet]. 2019 oct;55:100783. 7. zhang l, pan j, chen w, jiang j, huang j. chronic stress-induced immune dysregulation in cancer: implications for initiation, progression, metastasis, and treatment. am j cancer res [internet]. 2020;10(5):1294–307. 8. printz c. anxiety and depression may contribute to an increased risk of death in some cancers. cancer [internet]. 2017 jul 1;123(13):2389–2389. 9. wang y-h, li j-q, shi j-f, que j-y, liu j-j, lappin jm, et al. depression and anxiety in relation to cancer incidence and mortality: a systematic review and meta-analysis of cohort studies. mol psychiatry [internet]. 2020 jul 19;25(7):1487–99. 10. lacroix m, riscal r, arena g, linares lk, le cam l. metabolic functions of the tumor suppressor p53: implications in normal physiology, metabolic disorders, and cancer. mol metab [internet]. 2020 mar;33:2–22. 11. luo y, ma j, lu w. the significance of mitochondrial dysfunction in cancer. int j mol sci [internet]. 2020 aug 5;21(16):5598. 12. huang w, aune d, ferrari g, zhang l, lan y, nie j, et al. psychological distress and all-cause, cardiovascular disease, cancer mortality among adults with and without diabetes. clin epidemiol [internet]. 2021 jul;volume 13:555–65. 13. pai t, cornell l, seneviratne d, niazi s, mussallem d, vallow l. pre-diagnosis major life stressors and breast cancer outcomes. breast cancer res treat [internet]. 2021 jul 12;188(2):459–64. 14. oluyomi ao, panthagani k, sotelo j, gu x, armstrong g, luo dn, et al. houston hurricane harvey health (houston-3h) study: assessment of allergic symptoms and stress after hurricane harvey flooding. environ heal [internet]. 2021 dec 19;20(1):9. 15. agorastos a, pervanidou p, chrousos gp, baker dg. developmental trajectories of early life stress and trauma: a narrative review on neurobiological aspects beyond stress system dysregulation. front psychiatry [internet]. 2019 mar 11;10. 16. bahri n, fathi najafi t, homaei shandiz f, tohidinik hr, khajavi a. the relation between stressful life events and breast cancer: a systematic review and meta-analysis of cohort studies. breast cancer res treat [internet]. 2019 jul 19;176(1):53–61. 17. yang t, qiao y, xiang s, li w, gan y, chen y. work stress and the risk of cancer: a meta‐analysis of observational studies. int j cancer [internet]. 2019 may 15;144(10):2390–400. lmrj volume 3 issue 4 102 | p a g e 18. fischer a, ziogas a, anton-culver h. perception matters: stressful life events increase breast cancer risk. j psychosom res [internet]. 2018 jul;110:46–53. 19. cohn e, lurie i, yang y, bilker wb, haynes k, mamtani r, et al. posttraumatic stress disorder and cancer risk: a nested case‐control study. j trauma stress [internet]. 2018 dec 6;31(6):919–26. type of the paper (article lmrj volume 3 issue 4 90 | p a g e research article association of body weight on pulmonary function tests in young individuals (aged 1840 years)a cross-sectional study urooj bhatti1*, zulfiqar ali laghari2, suleman pirzado1 1department of physiology, liaquat university of medical & health sciences, jamshoro, pakistan, 2department of physiology, university of sindh, jamshoro, pakistan abstract this was a prospective cross-sectional study conducted to evaluate association of waist, hip and thigh circumferences on respiratory parameters among young healthy adults. a total of 180 volunteers of different weight categories; including underweight, normal weight, over weight and obese people were recruited by using non-probability convenient sampling technique. nonsmoker males and females (non-pregnant), aged between 18-40 years with no pulmonary and cardiac disease were included in the study. waist circumference, mid-thigh circumference, hip circumference and respiratory parameters were measured. the results showed a significant association between waist circumference with forced vital capacity (fvc) (r = 0.188, p = 0.011), average tidal volume (vt) (r = 0.160, p = 0.032), inspiratory reserve volume (irv) (r = 0.388,p<0.001), vital capacity (vc) (r = 0.312, p<0.001), total lung capacity (tlc) (r = 0.385, p<0.001), and functional residual capacity (frc) (r = 0.477, p<0.01), and a negative association with forced expiratory volume in 1 second (fev1) (r = -0.148, p = 0.048) and fev1/fvc ratio (r = -0.246, p<0.001). significant association was not observed between waist circumference and expiratory reserve volume (erv) (r = 0.071, p = 0.344). in the present study, increased waist, hip, and thigh circumferences were found to be negatively associated with fev1 and fev1/fvc ratio. spirometry should be performed in obese and overweight young healthy adults even if they are asymptomatic, as early preventive measures can be taken to reduce the resulting morbidity. key words: anthropometry, spirometry, obesity, healthy adults introduction the growing rate of obesity is a global public health issue, where prevalence of obesity in united states of america (usa) has been reported to be about 36% in adults while in children and adolescents it is reported to be 16.9%(1). data from the middle eastern countries shows obesity prevalence exceeding 40%(2). the rise of the rate of obesity was obvious in a pooled analysis, where in 2016 there were 124 million as compared to 11 million children and adolescents were falling in the obese category in 1975(3,4). according to a national health service survey conducted in 1990-94 the prevalence of obesity in pakistan was 1% while that of overweight was 5% in 15-24 years age group. this survey also showed that the prevalence of obesity in rural areas was 9% among adult males while it was 14% among adult females however in urban areas it was 22% among adult males and 37% among adult females (5). in correspondence: urooj bhatti mbbs, phd, department of physiology, liaquat university of medical & health sciences, jamshoro, pakistan email: uroojbhatti@yahoo.com doi: 10.38106/lmrj.2021.3.0402 received: 16.10.2021 accepted: 21. 12.2021 published: 30. 12.2021 mailto:uroojbhatti@yahoo.com mailto:uroojbhatti@yahoo.com lmrj volume 3 issue 4 91 | p a g e 2013 the prevalence of obesity in rural areas was found to be 11% among men and 23% in women, while in urban areas, it was found to be 23% in men and 40% in women(6). body mass index (bmi) is a standard to measure obesity more commonly than body fat percentage. waist and hip circumferences can be used to estimate the degree of obesity. regional fat distribution i.e. abdominal obesity appears to be more influencing associated with comorbidities showing strong association with metabolic syndrome and related consequences (7). waist circumference (wc) is a valuable tool for the detection of obesity and it is very simple to perform as it can be measured without taking height into account. the wc gives the idea about the fat stores in abdomen as well as total body fat (8). for the assessment of obesity, measurements of waist circumference or waist-to-hip ratio are valuable tools because, reducing central adiposity may be more difficult than just reducing overall body weight. more effort is needed to improve the diet and physical activity for the reduction of fatty tissue in persons having abnormal waist-to-hip ratio(9). as compared to bmi, wc predicts lung function well. the persons, who have normal wc, are found to have normal values of forced expiratory volume in 1 second (fev1) and forced vital capacity (fvc) (10). there is limited literature available to study the relationship of fat distribution of a body on respiratory parameters including healthy individuals or people with normal bmi. therefore, this study was conducted to evaluate the fat distribution influencing lung function among apparently healthy obese, normal weight, underweight and overweight population. methodology this was a cross-sectional study conducted in physiology department of liaquat university of medical and health sciences (lumhs), jamshoro, sindh. one hundred and eighty individuals, including males or non-pregnant females, aged between 18-40 years were recruited by using non probability convenient sampling technique. sample size was calculated by open epi version 3.01 software, with 95% confidence interval and 5% precision. all recruited volunteers were non-smokers and had no known pulmonary, chest or cardiac anomalies, and did not work in the dusty environment. invitation posters for volunteers were pasted at different locations in the premises of the university. age, gender, height and weight were recorded, after taking written informed consent. spirometry test was performed using power lab, model 15t (ad instrument-australia) to check respiratory parameters in standing position, wearing clip on nose to prevent air leakage. for accuracy three readings were taken and both static and dynamic lung volumes and capacities were recorded. the recorded parameters were forced vital capacity(fvc) (i.e., total exhaled air), tidal volume (vt) i.e., air inhaled and exhaled during normal inhalation, inspiratory reserve volume (irv) i.e., extra quantity of air inhaled till maximum inspiration, expiratory reserve volume (erv) i.e., extra quantity of air exhaled till maximum expiration, vital capacity (vc) i.e., maximum amount of air exhaled till maximum inspiration, forced expiratory volume in one second (fev1) i.e., breathe out in one second during enforced outbreath after forced inspiration, total lung capacity (tlc) i.e., one can inspire maximum amount of air, functional residual capacity (frc) i.e., amount of air exists in lungs till normal expiration and inspiratory capacity (ic) i.e; amount of air inhaled through a deep inhalation. all the parameters were calculated in liters and fev1/fvc ratio was calculated. waist circumference (wc) was measured around the belly at the level of the umbilicus. lmrj volume 3 issue 4 92 | p a g e hip circumference is the broadest circumference over the buttocks measured with measuring tape. these measurements were used to calculate the waist hip ratio (whr) also. then mid-thigh circumference was measured on the right side of body, midway between top of femur and top of the tibia. statistical methods statistical package for social sciences (spss version 22.0) was used to analyze the collected data. for anthropometric parameters such as waist circumstance (wc), thigh circumference (tc), and waist to hip ratio (whr) mean and standard deviation were calculated. to compare the mean of respiratory parameters; t-test was applied that includes fev1, fvc & tlc between higher and lower whr, wc, tc and hip circumference. analysis for correlation was done to observe the association between respiratory parameters and body fat-distribution (whr, tc, wc, and hc). p-value < 0.05 was taken as statistically significant level. results demographic characteristics out of 180 participants, 94 (52.2%) were males and 86 (47.8%) were females and their mean age was 21.83(sd±5.88) years, whereas their mean weight was 66.12 (sd± 21.30) kg, mean height was 2.85(sd±0.33) m2, and mean bmi was 25.10(sd±6.55)kg/m2,whereas majority of them were either overweight 58(32.2%) or obese 47(26.1%). 41(22.87%) participants had normal weight whereas 34(18.9%) were underweight. correlation of respiratory parameters and fat distribution the fvc was significantly correlated with waist circumference (r=0.188, p=0.011), hip circumference (r=0.169, p=0.024), thigh circumference (r=0.217, p=0.003) and waist-hip ratio (r=0.208, p=0.005). fev1 (l) was significantly correlated with waist circumference (r=-0.148, p=0.048), hip circumference (r=0.160, p=0.032), and thigh circumference (r=-0.166, p=0.026). fev1/fvc ratio was significantly correlated with waist circumference (r=-0.246, p=0.001), hip circumference (r=-0.242, p=0.001), thigh circumference (r=-0.279, p<0.001), and waist-hip ratio (r=-0.188, p=0.011). average vt (l) was significantly correlated with waist circumference (r=0.160, p=0.032), hip circumference (r=0.308, p<0.001), thigh circumference (r=0.268, p<0.001), and waist-hip ratio (r=-0.179, p=0.016). irv (l) was significantly correlated with waist circumference (r=0.388, p<0.001), hip circumference (r=0.459, p<0.001), and thigh circumference (r=0.384, p<0.001). erv (l) was significantly correlated with waist-hip ratio (r=0.191, p=0.01). ic was significantly correlated with waist circumference (r=0.310, p<0.001), hip circumference (r=0.455, p<0.001), and thigh circumference (r=0.371, p=<0.001). vc (l) was significantly correlated with waist circumference (r=0.312, p<0.001), hip circumference (r=0.431, p<0.001), and thigh circumference (r=0.370, p<0.001). tlc (l) was significantly correlated with waist circumference (r=0.385, p<0.001), hip circumference (r=0.514, p<0.001), and thigh circumference (r=0.443, p<0.001). frc was significantly correlated with waist circumference (r=0.477, p<0.01), hip circumference (r=0.521, p<0.01), thigh circumference (r=0.462, p<0.001), and waist-hip ratio (r=0.193, p=0.001) (table1). lmrj volume 3 issue 4 93 | p a g e table 1: impact of fat distribution on pulmonary function parameters pulmonary function parameters fat parameter (n=180) waist circumference (inch) hip circumference (inch) thigh circumference (inch) waist-hip ratio r p-value r p-value r p-value r p-value fvc (l) 0.188 0.011 0.169 0.024 0.217 0.003 0.208 0.005 fev1 (l) -0.148 0.048 -0.160 0.032 -0.166 0.026 0.041 0.580 fev1 / fvc (%) -0.246 0.001 -0.242 0.001 -0.279 <0.001 -0.188 0.011 average vt (l) 0.160 0.032 0.308 <0.001 0.268 <0.001 -0.179 0.016 irv (l) 0.388 <0.001 0.459 <0.001 0.384 <0.001 0.108 0.149 erv (l) 0.071 0.344 -0.027 0.716 0.018 0.811 0.191 0.01 ic (l) 0.310 <0.001 0.455 <0.001 0.371 <0.001 -0.090 0.230 vc (l) 0.312 <0.001 0.431 <0.001 0.370 <0.001 -0.043 0.569 tlc (l) 0.385 <0.001 0.514 <0.001 0.443 <0.001 -0.012 0.869 frc (l) 0.477 <0.01 0.521 <0.01 0.462 <0.001 0.193 <0.001 discussion our study showed that waist circumference had a significant positive association with fvc, average vt, irv, vc, and frc and had a significant negative association with fev1 and fev1/fvc ratio, while waist circumference was found to have no correlation with erv. our results were similar to an earlier study showing fev1 and fvc were negatively correlated with adiposity markers and among them wc was statistically significant (11), whereas in another study an inverse relationship between wc and lmrj volume 3 issue 4 94 | p a g e fev1 was reported, while forced vital capacity was also found to be negatively associated with waist circumference (12). the results of fvc were different from our study; this difference in findings may be attributed to older age criteria in the later study. the hip circumference was found to be significantly positively associated with fvc, average vt, ic, tlc, irv, frc, and vc; whereas significantly negative association was found with fev1 and fev1/fvc ratio, while association with erv was shown to be negative but was not statistically significant. thigh circumference was observed to have a significant negative association with fev1, fev1/fvc ratio, but there was no association was seen with erv; wherein all other parameters were shown to have had a significant positive association with thigh circumference. waist-hip ratio was found to be a significant positive association with fvc and frc though there was no association with fev1, irv, vc and tlc was found. various similar studies have reported whr to have a significant negative correlation with pulmonary function parameters (13), an earlier study showed vc, fev1, fvc and pef to have a negative correlation with high wc as compared to group having comparatively low wc (14). like our study findings, another study also reported a positive association of whr with forced vital capacity, total lung capacity, and frc (15), while unlike our study, fvc and fev1 have been reported to have a negative correlation with whr (16), this difference in findings may be due to inclusion of both younger and older adults in that study as opposed to our study. unlike our study, a study done in egyptian adolescents showed that waist circumference or whr had no significant correlation with pulmonary functions(17); these dissimilar results could be due to different age criteria of the study participants as children aged 6 to 16 years were included in that study. our study is novel for including healthy volunteers in order to portray true picture of the relationship. however, a small sample size and non-probability convenient sampling technique can be taken as limitations of the study. considering the views of our study and to what extend these correlations may be consistent with the gender variations would be revealing to uncover more facts about it. conclusion our study showed that increased waist, hip and thigh circumferences were had a negative association with fev1 and fev1/fvc ratio, indicating obstructive pattern in these young adults. it is thus recommended that spirometry should be performed in obese and overweight young adults even if they are asymptomatic, as measures can be taken to reduce the resulting morbidity. more researches with large number of sample size are recommended to look at the long term effects of body fat on pulmonary function. ethical consideration: the study was approved by the ethical committee of liaquat university of medical & health sciences, jamshoro, pakistan conflict of interest: there is no conflict of interest. funding: the study was conducted as part of phd project of dr. urooj bhatti funded by liaquat university of medical & health sciences jamshoro, pakistan. references 1. flegal km, carroll md, kit bk, ogden cl. prevalence of obesity and trends in the distribution of body mass index among us adults, 1999-2010. jama. 2012; 307(5):491-7. 2. molarius a, seidell jc, sans s, tuomilehto j, kuulasmaa k. varying sensitivity of waist action levels to identify subjects with overweight or obesity in 19 populations of the who monica project. j clinepidemiol. 1999; 52(12):1213-24. lmrj volume 3 issue 4 95 | p a g e 3. ncd risk factor collaboration. worldwide trends in body-mass index, underweight, overweight, and obesity from 1975 to 2016: a pooled analysis of 2416 population-based measurement studies in 128.9 million children, adolescents, and adults. lancet. 2017 oct 10. 4. mccall b. obesity soars 10-fold in kids; with underweight it's a 'double burden'. medscape medical news. oct 11, 2017. 5. pakistan medical research council. national health survey of pakistan. health profile of the people of pakistan 1990–94. islamabad: network publication service. 1998. 6. national institute of population studies (nips) [pakistan] and icf international. 2013. pakistan demographic and health survey 2012-13. islamabad, pakistan, and calverton, maryland, usa: nips and icf international. 7. wijga ah, scholtens s, bemelmans wj, de jongste jc, kerkhofmet al. comorbidities of obesity in school children: a cross-sectional study in the piama birth cohort. bmc public health. 2010 apr9;10:184. doi: 10.1186/1471-2458-10-184. 8. vazquez g, duval s, jacobs dr, jr, silventoinen k. comparison of body mass index, waist circumference, and waist/hip ratio in predicting incident diabetes: a meta-analysis. epidemiol rev. 2007;29:115–28. 9. miriam e. tucker. normal-weight central obesity more deadly than just high bmi medscape nov 09, 2015. 10. rehanarehman, s. a. "influence of relative and central adiposity on lung functions of young adult medical students." journal of international academic research. 2010; 10(3): 10-15. 11. sowmyatimmannakoraddi, shrilaxmibagali, manjunathaaithala. effect of body fat distribution on pulmonary functions in young healthy obese students. jkimsu. 2015; 4 (4): 18-26. 12. fernando césar wehrmeister, ana maria baptistamenezes, ludmila correa muniz, jeovanymartínez-mesa et al. waist circumference and pulmonary function: a systematic review and metaanalysis. 2012; 1: 55. 13. lynellc.collinsmd, fccp phillip d.hobertyedd, rrtbjeromef.walkeredd, rrtbeugenec.fletchermd et al.. the effect of body fat distribution on pulmonary function tests. chest. 1995; 107 (5): 1298-1302. 14. k soundariya, n. neelambikai. influence of anthropometric indices on pulmonary function tests in young individuals. world j. med. sci. 2013; 9 (3): 157-61. 15. ceylan e, cömlekçi a, akkoçlu a, ceylan c, itil o et al.. the effects of body fat distribution on pulmonary function tests in the overweight and obese. south med j. 2009; 102(1):30-5. doi: 10.1097/smj.0b013e31818c9585. 16. jung eun park, m.d., jin hong chung, m.d., kwan ho lee, m.d, kyeongcheol shin, m.d. the effect of body composition on pulmonary function. tubercrespir dis. 2012; 72(5): 433–40. 17. farida mohamed el baz, terez b kamel. impact of obesity and body fat distribution on pulmonary function of egyptian children. ejb. 2009; 3 (1): 49-58. type of the paper (article lmrj volume 4 issue 01 1 | p a g e editorial global disparity in breast cancer screening guidelinesis there a need for an individualized approach? almasuddin qazi barts healthcare nhs trust, london, united kingdom abstract breast cancer screening is the key to better clinical outcomes. cancer diagnosed at the stage where it is still within the ducts has the highest potential for best survival. a screening mammogram is a gold standard for early detection. however, there is variation in the age related guidelines for starting the screening and cessation. given the rate of breast cancer in the region, the government's economic resources and the priority of the screening service all play a role. developed countries have benefited from screening mammogram facilities and improved disease outcomes, but underdeveloped countries have not yet introduced national screening programs. thus nations must take the regional incidence and the biology of breast cancer into account and make evidencebased guidelines. key words: breast cancer, mammogram, screening introduction breast cancer is the most common cancer worldwide and the leading cause of death(1). past few decades, breast cancer mortality has declined to owe to the facility of screening and early detection. to some extent, national breast cancer awareness programs have also played a role. screening mammogram is the gold standard technique used globally. the mammogram was initially thought to be useful in 1913 but without any promising results; later, much research was conducted between the 1940s and 1970s. finally, in the 1970s, breast cancer screening using mammograms was introduced(2). breast cancer screening mammogram is now being used in many countries to detect breast cancer much earlier than it becomes symptomatic. recently presented data suggested a 40% reduction in mortality in women between 40-74 years of age by taking the benefit of screening mammograms (3). the time elapsed between the development of cancer and its stage is directly proportional; if left untreated for long, the stage of the disease will be advanced. if it is diagnosed at an advanced stage, the survival is poor. this has been observed that the incidence of breast cancer has racial and regional disparity. breast cancer has the highest incidence in american women, followed by europeans(4). though african women are at relatively lower risk of breast cancer, their tumors are highly aggressive, showing a poor prognosis(5,6). screening has multifactorial influences, mainly economic, the national incidence, and thus the screening mammogram has different guidelines in different regions. the critical factors that influence breast cancer screening include age at the start of the mammogram, frequency of the screening mammograms, and the x-ray mammograms' views. each aspect will be compared here, which is considered by international guidelines. correspondence: almas uddin qazi frcs barts healthcare nhs trust, london, united kingdom email: dralmasqazi@gmail.com doi: 10.38106/lmrj.2022.4.101 received: 20.01.2022 accepted: 25. 03..2022 published: 31. 03.2022 lmrj volume 4 issue 01 2 | p a g e starting age of screening mammogram the breast tissue is dense in young patients; thus, the sensitivity of the mammogram to detect tumors is less(7). in addition, the rate of breast cancer is also relatively lower in younger patients; thus, the screening mammograms start at the age of 40 years in most countries. in the united states of america (usa), women between 50 and 74 years are invited for screening, and between 40 to 50 years should be on an individual basis according to their risk assessment(8). however, national health service (nhs) covers mammograms at 47 years by invitation to all average-risk women. the nice guidelines suggest starting screening at the age of 20 years if there are p53 mutations, at 30 years if there is evidence of brca mutations. it is also interesting that the analysis of these mutations is not generally available. the upper age to cease screening mammograms varies from region to region, whereas in the usa, they have a consensus to stop screening at the age of 74 years. the woman will continue to have a screening mammogram if she has a 5-10 years life expectancy. at the same time, women with multiple diseases and a life expectancy of fewer than five years will not get a screening mammogram. the scientific logic to stop screening with less than five years of life expectancy concerns breast cancer biology, which becomes less aggressive with the advancing age. thus it is less likely that breast cancer becomes lethal in the elderly age group within that short span of time. the mammogram is less sensitive in women <40 years; therefore, alternatives like mri are advised annually. frequency of screening mammogram there is a consensus to have an annual mammogram in american societies for screening. while in countries with lower incidence and state-sponsored regions, it is advised to have a mammogram every two years or every three years. it is also recommended that if three consecutive annual mammograms are negative in an average-risk woman, she can have it every two or three years. countries with poor prognoses and a lower incidence with limited resources always find it challenging to decide about the frequency. it is not yet answered what the frequency of mammograms should be in average-risk women, living in a country with lower incidence of breast cancer. screening mammogram views there are three views of mammograms, including mediolateral (ml), cranio-caudal (cc), and oblique view. generally, for screening, two views are taken ml and cc. there is an overall consensus on two views. conclusion breast cancer shows regional variation in the incidence and prognosis, and thus screening guidelines should be made accordingly. the countries with high incidence would be safe to continue with more frequent screening tests, but those with lower incidence have not yet decided when to start and how frequently they should be getting their nation screened. the evidence-based approach is the best policy, with regular audits of the service to explore the age for cancer development. in addition, the aggressiveness of cancer will help in deciding the frequency. for the more aggressive cancer, the mammogram should be more frequent (i.e., annual); however, the risk of over-diagnosis should be considered. references 1. syed bm, green ar, paish ec, soria d, garibaldi j, morgan l, et al. biology of primary breast cancer in older women treated by surgery: with correlation with long-term clinical outcome and comparison with their younger counterparts. br j cancer. 2013; lmrj volume 4 issue 01 3 | p a g e 2. picard jd. [history of mammography]. bull acad natl med [internet]. 1998;182(8):1613–20. available from: http://www.ncbi.nlm.nih.gov/pubmed/10188307 3. seely jm, alhassan t. screening for breast cancer in 2018—what should we be doing today? curr oncol [internet]. 2018 jun 1;25(11):115–24. available from: https://www.mdpi.com/17187729/25/11/3770 4. lin ch, yap ys, lee kh, im sa, naito y, yeo w, et al. contrasting epidemiology and clinicopathology of female breast cancer in asians vs the us population. j natl cancer inst. 2019;111(12):1298–306. 5. globocan [internet]. 2020. available from: https://www.uicc.org/news/globocan-2020-newglobal-cancer-data#:~:text=globocan 2020 is an online,for all cancer sites combined. 6. registry pc. global cancer observatory. malaysia cancer statistics. 2019. 7. vourtsis a, berg wa. breast density implications and supplemental screening. eur radiol [internet]. 2019 apr 25;29(4):1762–77. available from: http://link.springer.com/10.1007/s00330018-5668-8 8. siu al. screening for breast cancer: u.s. preventive services task force recommendation statement. ann intern med [internet]. 2016 feb 16;164(4):279. available from: http://annals.org/article.aspx?doi=10.7326/m15-2886 type of the paper (article lmrj volume 3 issue 3 70 | p a g e research article rickettsial agents detection from blood of tick-infested animals in lower sindhcomparison of conventional and molecular approach iram shaikh1,*, naheed baloch1, abdullah g. arijo2, riffat sultana1 and saleem raza solangi1 1department of zoology, university of sindh, jamshoro-pakistan. 2department of veterinary parasitology, sindh agriculture university, tando jam-pakistan. abstract ticks are important vectors of human and animal pathogens. they are considered as main vectors for transmission of rickettsial agents affecting animal and human health. the study was designed to investigate district wise pattern and detection of rickettsial agents by using molecular and conventional techniques in blood samples of infected cattles, buffalos, sheep and goats. a survey study was carried out in lower sindh (tharparkar, badin, hyderabad, karachi, tando muhammad khan, thatta and mirpurkhas). blood samples were collected randomly from infected cattles, buffalos, sheep and goats and transported to the molecular parasitology laboratory, sindh agriculture university, tandojam, followed by examinations under stereomicroscope and polymerase chain reaction (pcr). the study showed that overall infection of rickettsial agents among infected animals was recorded following microscopy/ blood smear test in cattles, buffalos, sheep and goats was 41.79, 49.09, 46 and 41.66% respectively, whereas overall infection through pcr in cattle, buffalo, sheep and goat was 39.55, 43.55, 46 and 55.55% respectively. whereas animal-wise data through pcr indicates that in case of goats (55.55%) were more susceptible to rickettsial infection as compared to sheep (46%), buffaloes (43.55%) and cattle (39.55%). the highest rate of rickettsial agents was found in district tharparkar and lowest rate was found in district karachi. microscopy/blood smear method indicates that buffaloes were more susceptible for infection. whereas pcr indicates goats were more susceptible for infection. key words: ticks (vectors), rickettsial agents (pathogens), molecular and conventional techniques, lower sindh introduction ticks are potential vectors and reservoirs of many infectious agents such as. pasteurella multocida, brucella abortus and salmonella typhimurium in both humans as well as animals (1). ticks have enormous capability to adapt to changing geoclimatic conditions and can therefore expand their distribution range (2). they are known as main vectors for transmission of many pathogens such as viral, bacterial, rickettsial and parasitic infestations (3). till date 899 species of ticks are known which belong to three families, namely ixodidae, argasidae and nuttalliellidae (represented by a monotypic species restricted to south africa (4). after sucking blood, the outer surface of a tick grows to 200-600 times as compared to its unfed body weight (5). prevalence of tick-borne pathogens (tbps) and their occurrence in bovines have been found all over the pakistan (6). hyalomma anatolicum transmitted some of tick-borne pathogens (tbp) which have zoonotic importance (e.g. crimean congo haemorrhagic fever) (6). generally, rickettsioses is the term used for those diseases which have continuous spectrum of severity of illness and overlapping clinical manifestations. r. rickettsii, r. prowazekii, r. conorii, and r. typhi are rickettsial agents with a potential to cause life-threatening diseases (7). the main cause of granulocytic anaplasmosis is anaplasma phagocytophilum which is considered as one of the most important species from humans’ point of view because of its zoonotic potential. correspondence: iram shaikh, department of zoology, university of sindh, jamshoro, sindh, pakistan email: shaikhiram37@gmail.com doi: 10.38106/lmrj.2021.3.0305 received: 03.09.2021 accepted: 15. 09.2021 published: 30. 09.2021 lmrj volume 3 issue 3 71 | p a g e ticks are known as etiological agents of tick-borne fever in ruminants and equine, canine and human granulocytic anaplasmosis (ega, cga and hga, respectively) (8). genetic diversity has been recognized among various european strains of a. phagocytophilum shown through phylogenetically analysis of genes such as groel (chaperone protein encoding gene) (8) rickettsiae are commonly defined as genetically related, obligatory intracellular bacteria that reside in an arthropod host during a part of their zoonotic cycle. (9) ticks as parasites are vectors of many important human and animal pathogens such as q fever babesiosis, tick paralysis, haemorrhagic fever, lyme disease (ld), tick-borne encephalitis and tick-borne muscular fever. rocky mountain spotted fever, which is caused by rickettsia rickettsii, is a life-threatening, tick-borne disease that occurs throughout much of the united states (11). it has been estimated that 10% of the known tick species act as vectors of the pathogens of above mentioned diseases (12). they also pose a great threat to global animal production in terms of economic expenditure incurred through treatment of various inflammatory and hematologic conditions that occurred in humans and animals through these tick-borne diseases. it has further been suggested that around 80% of cattle production worldwide is at increased risk of tick-borne infections. (6) rickettsia have a comparatively small genome developed though reductive evolution because of their dependence on the host for survival and to carry out essential functions. (18) the genomes of various species of rickettsia have been sequenced such as rickettsia prowazekii and rickettsia conorii (19). there was limited literature available looking at the presence of rickettsial organisms in ticks in lower sindh. therefore, this study was aimed to investigate district wise pattern and compare detection of rickettsial agents by using molecular and conventional techniques in blood samples of infected cattles, buffalos, sheep and goats. methodology a survey was conducted in lower sindh including tharparkar, badin, hyderabad, karachi, tando muhammad khan, thatta and mirpurkhas districts. blood samples were collected randomly from infected cattle, buffalos, sheep and goats and transported to the molecular parasitology laboratory, sindh agriculture university, tandojam, followed by examinations under stereomicroscope and polymerase chain reaction (pcr)(24). blood collection host that carried ticks were selected for blood sampling, 5 ml blood from each infested host was collected from jugular vein or ear vein from large and small animals respectively. the blood transferred to ethylene diamine tetra acetic acid (edta) containing tubes and stored until further diagnosis of pathogen (viz. blood filming and dna extraction) was carried out. blood sampling procedure hairs from collection site were removed using automatic hair shaver. cotton swab soaked in the antiseptic (alcohol) was applied for disinfection to avoid any secondary contamination in the sample. ear vein was gently punctured with sterilized needle and blood was allowed to ooze out. a thin and thick blood smear was prepared fixed on spot in 70% alcohol to avoid rupturing of erythrocytes. in case of collection from jugular vein, syringe was gently used and 5ml of blood was drawn and preserved in edta tubes. the blood vials were soaked by rotating between palms of two hands for proper mixing of the anti-coagulant. the collection tubes were labelled with the name of owner, type of host and refrigerated at -20˚ c. relevant information on host, sex, age and date of collection was obtained and recorded on a proformma specifically designed for this project. blood smear method two methods were applied for blood examination viz. thin and thick blood smear(s). thin smear method for making thin blood smear, a glass slide was dipped in 95% alcohol. about 2ul of blood was placed on one end of the slide (called microscopic slide). another slide (called spreader slide) was placed on microscopic lmrj volume 3 issue 3 72 | p a g e slide containing the droplet of blood, positioning it about an inch in front of the droplet. the spreader slide was quickly run on the surface of microscopic slide at angle of 45 degrees. in a smooth motion, the spreader slide was pushed forward to spread the blood in a layer. prepared blood slide was allowed to air dry for one minute and fixed in absolute alcohol for 5 minutes. slides were removed from alcohol jars and air dried. dried slides were stained in freshly prepared romanowisky stain (commonly called giemsa’s stain) for 5 minutes. thick smear method procedure for making thick blood smear was same except that the spreader slide was moved slowly to make a thick film on microscopic slide. nucleic acid extraction from blood dna was extracted and obtained from collected blood by commercial kit (genejet genomic dna purification kit #k0722, thermo scientific, usa) as per manufacturer’s instructions. 20 µl of proteinase-k solution and 400 µl of lysis solution were added to 200 µl of whole blood. the mixture was mixed by vortexing in order to obtain a uniform suspension. it was then kept in incubation at 56˚ c for around 10 minutes or till the cells were completely hemolysed. afterwards, ethanol in a quantity of 200 µl was added and vortexed. the solution obtained was then transferred to genejet genomic purification column and was centrifuged at 6000xg for up to one minute. the flow through solution in the collection tube was discarded whereas purification column was transferred in a new collection tube. wash buffer (500 µl) was added to this collection tube which was then centrifuged at 8000xg for one minute. the flow through solution was again discarded while transferring the purification column to a new collection tube to which 500 µl of wash buffer 2 (with ethanol already added) was added and further centrifuged at 12000xg for three minutes. the purification column was transferred into 1.5ml micro tube whereas collection tube containing flow through solution was again discarded. 200 µl of elution buffer was added to 1.5 ml micro tube containing purification column and it was then incubated at room temperature for two minutes and then centrifuged at 8000xg for one minute. the dna thus extracted is obtained by discarding the supernatant and its concentration was evaluated by spectrophotometer (thermo scientific nano drop 1000). pcr process table-1 shows components and volume used in pcr process, the sample tubes were loaded in thermal cycles (applied biosystem, usa). the cycles were already set. the lid of machine was closed to start the operation. dna was denatured at 94oc for 5 min. annealing process took place at 550c for 1 min. two complementary copies of dna were obtained from one dna at 72⁰c for i min, the cycle again started from 940c. the pcr product was subjected to electrophoresis. table -1 components used in pcr process. components volume master mix 25 µl piro primer(f) 8 µl piro primer(r) 8 µl dna extract 2 µl distilled water 7 µl total 50 µl method all primers were diluted with 20ul of te buffer. piro primer (f) =8µl was added in 25 µl of master mix in a small tube (neptune company). piro primer (r) =8µl was added in 25 µl of master mix in a small tube (neptune company). 2µl of dna extract were added in piro (f) and (r) primers respectively. agarose gel (1%) lmrj volume 3 issue 3 73 | p a g e agarose gel powder was taken in a quantity of 0.5 grams in a conical flask. 50 ml of 0.5 tae buffer was then added to the agarose powder and microwaved for about one minute in order to dissolve the powder. it was then allowed to cool down to 60˚ c. afterwards, 2 µl of ethidium bromide was added to gel solution and it was then poured down slowly into the tank. comb was correctly positioned in the tank and it was then left for at least 30 minutes to solidify. before using the gel, it was submerged in 0.5 tae buffer in the tank. table-2 primers used primers nucleotides species references piro-f aatacccaatcctgacacaggg all piroplasms karimi et al.,2012 piro-r ttaaatacgaatgcccccaac all piroplasms karimi et al.,2012 bi-f aataacaatacagggctttcgtct babesia bigemina kim et al., 2007 bi-r acgcgaggctgaaatacaac babesia bigemina kim et al., 2007 t. annulata-f caccttcgacaagaaagaagtcgg theileria designed in mather lab, usa t.annulata-r tgagaagacgatgagtactgaggc theileria designed in mather lab, usa sample loading before loading the samples in the gel, dna ladder (fermantas eu) was loaded down in the very first well of agarose gel in order to quantify the size of the samples. afterwards, 4 µl of each sample was loaded in the subsequent wells. after all samples have been added, electrophoresis unit was allowed to run with 80 volts and 100 amperes for 30-45 minutes allowing samples to travel a sufficient distance. gel documentation after electrophoresing the samples, the gel was removed and put in gel documentation system (cleaver scientific, ltd, uk) in order to visualized the bands of samples and to determine their size by comparing them with the ladder. statistical methods statistical package for social sciences (spss version 21) was used for results analysis. frequencies and percentages were analysed and presented. results blood samples were collected from different districts of lower sindh, in order to compare sensitivity of polymerase chain reaction with that of blood smear method, table-3 and 4 reveals the detection of rickettsial agents through blood smear method then blood samples were subjected to pcr for detection of rickettsial infection. table-5,6 and 7 reveals that pcr is more sensitive diagnostic method as samples that were negative via blood smear method were found positive when diagnosed through pcr. presence of rickettsial agents through blood smear test was confirmed under high power magnification, whereas through pcr the detec lmrj volume 3 issue 3 74 | p a g e tion was confirmed by looking at the bands that appeared at 405, 150, 170 and 290 base pairs on gel documentation. (figure-1-3), table3 to 6 shows data on cattle, buffalo, sheep and goat that were diagnosed positive for rickettsial agents via blood smear test and pcr, the highest ratio of differences in districts was found in district tharparkar 83:83, 81:87, 66:66, 57:71 in cattle, buffalo, sheep and goat, whereas lowest ratio of differences is found in district karachi was 36:30, 45:41, 25:25, 28:42 in cattle, buffalo, sheep and goat respectively. table 3. detection of rickettsial agents in cattle and buffalo through blood smear method in lower sindh districts cattle buffalo observed infested random blood samples infected samples (%) observed infested random blood samples infected samples% karachi 96 33 12 36.36 117 24 11 45.83 hyderabad 27 20 8 40 67 33 14 42.42 badin 27 17 6 35.29 26 15 7 46.66 tharparkar 10 6 5 83.33 20 16 13 81.25 t.m khan 59 24 10 41.66 119 35 16 45.71 mirpurkhas 37 24 11 45.83 73 29 14 48.27 thatta 16 10 4 40.00 44 11 5 45.45 total 272 134 56 41.79 466 163 80 49.07 table 4. detection of rickettsial agents in sheep and goat through blood smear method in lower sindh districts sheep goat observed infested random blood samples infected samples % observed infested random blood samples infected samples % karachi 11 4 1 25 32 7 2 28.57 hyderabad 15 6 2 33.33 10 3 1 33.33 badin 18 14 5 35.71 16 5 2 40 tharparkar 12 3 2 66.66 13 7 4 57.14 t.m khan 15 5 2 40.00 16 5 2 40 mirpurkhas 9 3 1 33.33 12 4 2 50.00 thatta 14 4 2 50.00 10 5 2 40.00 total 94 39 15 38.46 109 36 15 41.66 lmrj volume 3 issue 3 75 | p a g e table 5. detection of rickettsial agents in cattle and buffalo through pcr in lower sindh districts cattle buffalo observed infested at random blood samples pcr detection(%) observed infested at random blood samples pcr detection% karachi 27 20 6 30 67 33 9 27.27 hyderabad 96 33 10 30.30 117 24 10 41.66 badin 27 17 7 41.17 26 15 6 40 tharparkar 10 6 5 83.33 20 16 14 87.5 t.m khan 59 24 9 37.5 119 35 13 37.14 mirpurkhas 37 24 10 41.66 73 29 12 41.37 thatta 16 10 6 60.00 44 11 7 63.63 total 272 134 53 39.55 466 163 71 43.55 table 6. detection of rickettsial agents in sheep and goat through pcr in lower sindh districts sheep goat observed infested at random blood samples pcr detection% observed infested at random blood samples pcr detection% karachi 11 4 1 25 10 3 1 33.33 hyderabad 15 6 2 33.33 32 7 3 42.85 badin 18 14 5 35.71 16 5 3 60 tharparkar 12 3 2 66.66 13 7 5 71.42 t.m khan 15 5 2 40.00 16 5 3 60 mirpurkhas 9 3 1 33.33 12 4 2 50.00 thatta 14 4 2 50.00 10 5 3 60.00 total 94 39 15 38.46 109 36 20 55.55 graph-1 showing the comparison between microscopy and pcr figure-1 gel electrophoresis of amplified pcr product of rickettsial agents of buffalo blood dna lmrj volume 3 issue 3 76 | p a g e table-7 shows the pooled data of all districts indicates that through blood smear test buffaloes were (49.09%) more susceptible to rickettsial infection as compared to sheep (46%), cattle (41.79%) and goats (41.66%), whereas through pcr, the data indicates that in case of goats 55.55% were more susceptible to rickettsial infection as compared to sheep (46%), buffaloes (43.55) and cattle (39.55%). table 7. pure and mixed infection of rickettsial agents in cattle, buffalo, sheep and goat figure-2 gel electrophoresis of amplified pcr product of rickettsial agents of cattle blood dna figure-3 gel electrophoresis of amplified pcr product of rickettsia agents of buffalo blood dna discussion the blood samples of tick-carrying cattle, buffalo, sheep and goat conventionally confirmed blood samples were subjected for pcr detection of piroplasms, for this purpose, dna was extracted from positive blood samples and quantified on nano-drop spectrophotometer. primers used for pcr reaction are described in table 2. different concentrations of mgcl2 were used for pcr reaction i.e. 5ul & 6 ul for t. annulata whereas for b. bovis and b. bigemina concentration of mgcl2 was 3ul. pcr was done for 30 cycles with following conditions: denaturation at 94˚ c for 5 min, 94˚ c for 30 sec. temperature was lowered for several minutes to allow both forward and backward (right or left) primers to anneal with the complementary sequences. at this stage three conditions 50˚ c, 55˚ c and 60˚ c for 30 secs s. no. name of animal microscopy pcr total no. of animals observed total no. of animals infested at random blood samples % of infected samples through smear method total no. of animals observed total no. of animals infested at random blood samples % of infected samples through pcr 01 cattle 272 134 56 41.79% 272 134 53 39.55% 02 buffalo 466 163 80 49.09% 466 163 71 43.55% 03 sheep 99 50 23 46% 99 50 23 46% 04 goat 109 36 15 41.66% 109 36 20 55.55% total 946 383 174 45.43% 946 383 167 43.60% lmrj volume 3 issue 3 77 | p a g e were checked for each primer set. finally, extension was carried out 72˚c for 45 secs. analysis of amplified product by electrophoresis was done with a 1% agarose gel. the results were photographed with gel documentation system (gel doc usa). in order to compare sensitivity of polymerase chain reaction, with that of blood smear method, blood samples were subjected to pcr detection of rickettsial infection. (2) gave findings take out at maharashtra (india) by (3) boophilus, haemaphysalis, hyalomma, amblyomma, nosoma and rhipicephalus were found tick infesting in subfamily bovinae animals, which includes cattle, buffalo, and kudus at 40, 16.96, 20.14, 10.22, 4.56, and 1.96 percent attentiveness, correspondingly. he discovered 8 different tick genera of ticks to be precise as boophilus, rhipicephalus, hyalomma, amblyomma, dermacentor, haemaphysalis, ixodes, and aponoma from many segments of pakistan. the lessen quantity of the genera perceived possibly would be the reason of looked-for the partial region stipulated for the present investigation, also in a partial investigation takeout by (4) and (5) stated 4 genera, even if dissimilar from every one, for the tick troublesome invasion resident of a tract of land on which crops and often livestock are raised for livelihood in their particular investigation. conclusion information regarding to cattle, buffalo, sheep and goat farms (946 observed animals out of which 383 were the infested animals and 45.43% were infected animals through microscopy and 43.60% were infected through pcr) according to microscopy buffaloes were more susceptible to rickettsial infection as compared to cattle, sheep and goat. according to pcr goats were more susceptible to rickettsial infection as compared to cattle, buffalo and sheep, highest rate of rickettsial infection is found in district tharparkar. lowest rate of rickettsial infection is found in district karachi. ethical consideration: the study was approved by the ethical committee of xxxx conflict of interest: there is no conflict of interest. funding: this study was not funded by any agency references 1. jongejan f, uilenberg g. the global importance of ticks. parasitology. 2004;129(suppl.):129. 2. buczek a, bartosik k, buczek am, buczek w, stanko m. conspecific hyperparasitism in the hyalomma excavatum tickand considerations on the biological and epidemiological implications of this phenomenon. ann agric environ med. 2019 aug 6;26(4):548–54. 3. ganjali m, dabirzadeh m, sargolzaie m. species diversity and distribution of ticks (acari: ixodidae) in zabol county, eastern iran. j arthropod borne dis [internet]. 2014 dec [cited 2020 jan 8];8(2):219–23. available from: http://www.ncbi.nlm.nih.gov/pubmed/26114136 4. yu z, wang h, wang t, sun w, yang x, liu j. tick-borne pathogens and the vector potential of ticks in china. vol. 8, parasites and vectors. biomed central ltd.; 2015. 5. d.e. s. biology of ticks. new york. oxford univ press. 1991; 1:1–449. 6. ghafar a, cabezas-cruz a, galon c, obregon d, gasser rb, moutailler s, et al. bovine ticks harbour a diverse array of microorganisms in pakistan. parasit vectors [internet]. 2020 jan 3 [cited 2020 jan 7];13(1):1. available from: http://www.ncbi.nlm.nih.gov/pubmed/31900233 7. dabaja mf, tempesta m, bayan a, vesco g, greco g, torina a, et al. varietà e distribuzione di zecche in ruminanti domestici in libano. vet ital. 2017 apr 1;53(2):147–55. 8. matei ia, estrada-peña a, cutler sj, vayssier-taussat m, varela-castro l, potkonjak a, et al. a review on the eco-epidemiology and clinical management of human granulocytic anaplasmosis and its agent in europe. parasites and vectors [internet]. 2019 dec 21 [cited 2020 jan 7];12(1):599. available from: http://www.ncbi.nlm.nih.gov/pubmed/31864403 lmrj volume 3 issue 3 78 | p a g e 9. sahni a, fang r, sahni sk, walker dh. pathogenesis of rickettsial diseases: pathogenic and immune mechanisms of an endotheliotropic infection. annu rev pathol mech dis [internet]. 2019 jan 24 [cited 2020 jan 22];14(1):127–52. available from: https://www.annualreviews.org/doi/10.1146/annurev-pathmechdis012418-012800 10. díaz-sánchez aa, meli ml, obregón álvarez d, fonseca-rodríguez o, cabezas-cruz a, hofmannlehmann r, et al. development and application of a multiplex taqman® real-time qpcr assay for the simultaneous detection of anaplasma marginale and theileria annulata and molecular characterization of anaplasma marginale from cattle in western cuba. ticks tick borne dis. 2020;11(2). 11. demma lj, traeger ms, nicholson wl, paddock cd, blau dm, eremeeva me, et al. rocky mountain spotted fever from an unexpected tick vector in arizona. n engl j med. 2005 aug 11;353(6):587–94. 12. zhang g, zheng d, tian y, li s. a dataset of distribution and diversity of ticks in china. sci data. 2019 jul 1;6(1):105. 13. richards al. worldwide detection and identification of new and old rickettsiae and rickettsial diseases. fems immunol med microbiol. 2012 feb;64(1):107–10. 14. labruna mb, whitworth t, bouyer dh, mcbride j, camargo lma, camargo ep, et al. <i>rickettsia bellii</i> and <i>rickettsia amblyommii</i> in <i>amblyomma</i> ticks from the state of rondônia, western amazon, brazil. j med entomol. 2009 oct 29;41(6):1073–81. 15. la scola b, raoult d. laboratory diagnosis of rickettsioses: current approaches to diagnosis of old and new rickettsial diseases. vol. 35, journal of clinical microbiology. 1997. p. 2715–27. 16. petri a.w. overview of rickettsial infections infections msd manual consumer version [internet]. 2018 [cited 2020 feb 11]. available from: https://www.msdmanuals.com/home/infections/rickettsial-and-related-infections/overview-of-rickettsial-infections 17. venzal jm, portillo a, estrada-peña a, castro o, cabrera pa, oteo ja. rickettsia parkeri in amblyomma triste from uruguay. emerg infect dis. 2004;10(8):1493–5. 18. mcleod mp, qin x, karpathy se, gioia j, highlander sk, fox ge, et al. complete genome sequence of rickettsia typhi and comparison with sequences of other rickettsiae. j bacteriol. 2004 sep;186(17):5842–55. 19. martinez jj, seveau s, veiga e, matsuyama s, cossart p. ku70, a component of dna-dependent protein kinase, is a mammalian receptor for rickettsia conorii. cell. 2005 dec 16;123(6):1013–23. 20. mc carthy vg. ixodid ticks (acarina: ixodidae) of west pakistan. phd thesis univ maryl. 1967;1–533. 21. hines, s.a., g.h. palmer, d.p., jasmer wlg and tfm. immunization of cattle with recombinant babesia bovis merozoite surface antigen-1 infection and immunity. 1998; 63:349-52. 22. hussain s. studies on ectoparasites of livestock of sindh. final tech report, univ sindh, pakistan. 23. khan mi. taxonomical study of ticks of genus rhipicephalus and their relation to the incidence of haemoparasites and comparative efficacy of different acaricides on ticks in sheep and goats in kaghan valley. msc thesis, coll vet sci lahore, pakistan. 1993; 24. shaikh. i, a. g arijo, n. akhter, saud farooque, comparing blood smear test and pcr on detection of babesia in tick-infested cattle and buffalo. proceedings of parasitology, dec.2012;54; 83-91. type of the paper (article lmrj volume 4 issue 01 49 | p a g e letter to editor artificial intelligence in aid efficient mental healthcare in context of state-of-the -art sir cowasjee mental health institute at hyderabad sindh pakistan dr. aijaz patoli1 (global health specialist), shehram syed2 (ph.d. scholar), abbas syed3 (ph.d. scholar), dr. zafi sherhan syed4 (ph.d.) 1sir c.j. institute of psychiatry & behavioral sciences hyderabad pakistan, 2 rmit university, australia, 3 university of louiseville, usa. 4 mehran university of engineering & technology, pakistan abstract artificial intelligence (ai), often described, as the machine simulation of human intelligence, is a branch of computer science that solves problems automatically using computational algorithms. ai systems work by first consuming massive volumes of labeled training data, analyzing it for patterns, and finally using these patterns to make predictions. on the other hand mental health issues are increasing in human thus use ai in provision of mental health aid would be a novel approach. key words: artificial intelligence, mental health, machine simulation introduction globally, over 70% of adults and younger population live with mental illness without receiving any treatment or approaching mental health care facility(1). there are a number of societal barriers and taboos in receiving mental health care as compared to physical health. thus there is a huge difference in true prevalence and treated prevalence of mental health (ie treatment gap)(2). among many reasons for this include stigma, discrimination, capacity & minimal investment in mental health. historical lunatic asylums journey tertiary level mental facilities like sir c.j. institute of psychiatry (cjip) hyderabad sindh pakistan, which was established as an asylum in 1865., could not had an impact until year 2000, with the publishing of world health report which estimated the burden of disease–disability weights. there was a shock for the world to mental health disorders were included in top five diseases causing disabilities. artificial intelligence (ai), often described, as the machine simulation of human intelligence, is a branch of computer science that solves problems automatically using computational algorithms. ai systems work by first consuming massive volumes of labeled training data, analyzing it for patterns, and finally using these patterns to make predictions(3). ai in mental healthcare has the great potential. it is used to identify behavioral traits of individuals with mental illness and to improve the management of mental healthcare interventions. in fact, mental healthcare is one of the domains in which telehealth and ai can be integrated seamlessly(4). academics from the fields of psychology and computer science have collaborated to use artificial intelligence to gain a better understanding of mental illnesses in order to develop systems that can detect the disease using computational machines(5). correspondence: dr. aijaz patoli founding c.e.o of sir c.j. institute of psychiatry & behavioral sciences hyderabad pakistan email: draijazq@gmail.com doi: 10.38106/lmrj.2022.4.1-09 received: 03.01.2022 accepted: 02. 03..2022 published: 31. 03.2022 lmrj volume 4 issue 01 50 | p a g e this letter briefly describes the use of four modalities namely audio, visual, text, and physiological signals in conjunction with ai-powered machine learning systems to spot signs of mental illness. we cite research studies that have demonstrated the efficacy of such solutions. our focus in the letter shall be on the ai-based automated recognition of depression since according to who [5], depression is the most common type of disability worldwide, affecting more than 5% of the global adult population. it is also well-known that untreated depression may lead to suicide(6). human speech consists of linguistic and paralinguistic parts. it has been shown already that aibased systems can leverage paralinguistic characteristics of speech to recognize human emotions, trustworthiness, and sincerity(7). there is an emphasis on investigating how speech can be used as a biomarker of diseases that affect speech production, such as depression.(8) the aim is to use the information contained in a paralinguistic speech to build and subsequently deploy ai-based systems to identify depression from everyday conversations. key studies in this regard are the works from alghowinem et al.(9) and williamson et al.(10) who highlighted that computational speech analysis may yield biomarkers for depression. we refer the reader to the survey from cummins et al.(11) for a detailed review of speech-based screening for depression and suicide risk. natural-language processing (nlp) is a sub-field of ai that is used to evaluate textual documents automatically to infer meanings. nlp deals with the linguistic aspects of human communication. it has received a lot of attention recently for its potential in mental healthcare(12). bathina et al.(13) reported that individuals with depression express atypical and distorted language on social media. jain et al.(14) demonstrated that nlp can be used to identify social media posts related to depression and suicidal intent, whereas, rinaldi et al.(15) proposed a novel approach to interview transcripts of depressed individuals to provide psycholinguistic insights about the disease. these are encouraging signs that show that nlp holds great potential to support the mental healthcare of patients and may be integrated into the ai-based system for automated depression screening. facial expressions provide the most powerful, natural, and straightforward way to communicate emotion. human beings perceive emotional feedback and reciprocate behavior based on recognizing others’ facial expressions. however, it is well known that individuals’ mental illnesses have atypical facial behavior that can provide cues to mental state. to this end, girard et al. hypothesize automated systems can be trained to recognize traits of depression from the facial expressions of individuals.(16) in, we showed that cues of psychomotor retardation can be used to build domainknowledge-based handcrafted features to screen for depression. stratou et al.(17) reported that as the severity of depression increased, subjects in their experiment showed reduced facial activity in terms of facial muscle movement and head movement. they also had reduced eye gaze variations such that they appeared passive and disinterested. based on their experiments, they also reported that individuals with depression demonstrated facial expressions of hostility, grief, and diminished signs of joy. these studies suggest that it is possible to screen for individuals with depression based on their facial appearance and movement, and that is the rationale for integrating visual modality for automated depression screening. amongst other modalities, multiple studies have shown that physiological signals such as heart rate, blood pressure, electrodermal activity, and electroencephalogram offer an alternate way to recognize stress, anxiety, and depression.(18) similarly, body movement information can be used to gauge for psychomotor activities of patients with depression. it should be mentioned here that an automated system to recognize depression can also work by ingesting information from multiple modalities, learning from it, and making predictions of the patient’s mental state. in fact, several lmrj volume 4 issue 01 51 | p a g e studies, have shown that integrating multiple modalities can help improve the systems performance. thus, there is ample evidence to investigate the use of ai-based automated systems for screening depression. now we shall discuss the experimental methodology for automated depression screening based on conversations that include a clinician and the patients with depression in a hypothetical clinical setup. the setup consists of hardware and software parts. the hardware part includes electronic sensors to acquire audio, visual, physiological and body movement data. the software part consists of algorithms that implement the ai-based system featuring engineering and machine learning parts. figure 1: conceptual setup for data collection where audio, visual, and physiological signals data is acquired from both, the subject and the clinician figure 1 illustrates the data collection setup for the task of automated depression screening. this hardware setup is placed in a hospital environment where patients typically meet the clinician to seek medical and/or therapeutic support. the communication between the two is required in the form of video recordings through a video camera and microphone facing the patient – these provide necessary data for audio and visual modalities. a suitable speech transcription tool can be used to generate transcripts for conversation between the clinician and patients. this modality can subsequently be used for nlp, as discussed earlier. physiological signals such as temperature, blood pressure, heart rate, and electro-dermal activity are recorded through the empatica e4 band. the efficacy of this module has already been demonstrated with tasks related to stress detection. in addition to physiological signals, the e4 band also records body movement data through the built-in imu. thus, the recording setup enables the recording of multimodal signals that can be leveraged for automated depression recognition. figure 2: conceptual framework for signal processing and machine learning pipeline lmrj volume 4 issue 01 52 | p a g e the conceptual process flow diagram for the signal processing and machine learning pipeline is illustrated in figure 2. it starts with data preprocessing and cleansing which ensures that the acquired data is of sufficiently good quality for training ai-based systems. the data so far does not contain ground-truth labels regarding the psychiatric state of subjects, for example, whether the patient is healthy or has depression. labels can also include depression severity, for example, in terms of the patient health questionnaire-9 score.(19) at the annotation and labeling stage of this framework, labels will be assigned to each recording based on the input from clinicians. these labels are provided by the clinician after assessing the patient. the feature engineering and machine learning pipeline consist of feature computation, feature selection, and classification based on cross-validation. at the feature computation stage, audio, visual, and physiological signals data is transformed into representations that are meaningful for the classifier. for example, prosody, voice quality, and spectral features are more meaningful for classifiers than raw audio waveforms. similar transformations are also required for visual and physiological signals data. at the machine learning stage, the dataset is divided into three parts, training, validation, and test. the sub-datasets are used to train the machine learning model, validate its performance for different hyperparameters, and finally test its performance on a previously unseen part of data. the choice of a machine learning algorithm depends on the type of labels. if the dataset has been labeled for binary classes of depressed and not-depressed, then a classifier will be used. on the other hand, if the dataset has been labeled for depression severity, then a regressor will be used. once the machine learning model has been trained, it can be used to recognize the existence of depression as well as its severity in a real-world environment. the world health report 2000 was alarming to developed world even. the stigma, discrimination, capacity & low investment in low middle income countries (lmics) like pakistan face great challenges specially in backdrop of pandemic effects of social psychology.(20) wave of change of policies towards mental health, set in by the world health report, can be seen in form of transformation of cjip hyderabad into an autonomous multidisciplinary mental health facility. still the technology has fill the gaps in our context specially “the 10/90 gap”35 and the treatment gap.(20) the 10/90 discovers that between 2002-4, only 3.7% of research on psychiatry in leading journals was from the least developed countries, whereas they represent >80% of the world population. this means we are relyging on the western sociocultural context for our knowledge to address our own mental challenges. this category fallacy (kleinman, 1987): applying a category that makes sense for a particular cultural group in another group, for whom this category may not make sense, creates treatment gap. so we need to adopt leapfrog strategy to include artificial intelligence in planning and development of state-of-the-art sir c.j institute of psychiatry & behavioral sciences hyderabad for diagnosis, treatment , monitoring & evaluation and recovery. to conclude, in this letter, we provided a brief overview of multiple modalities through which behavioral cues for mental illness can be recognized. we also discussed the steps of data collection, data annotation, feature engineering, and machine learning for the ai-based system for automated depression screening. we hope this letter encourages collaboration between psychologists, computer scientists, and engineers to begin research into automated depression screening systems in pakistan. lmrj volume 4 issue 01 53 | p a g e references 1. wainberg ml, scorza p, shultz jm, helpman l, mootz jj, johnson ka, et al. challenges and opportunities in global mental health: a research-to-practice perspective. curr psychiatry rep. 2017 may 19;19(5):28. 2. subramaniam m, abdin e, vaingankar ja, shafie s, chua hc, tan wm, et al. minding the treatment gap: results of the singapore mental health study. soc psychiatry psychiatr epidemiol. 2020 nov 17;55(11):1415–24. 3. hassani h, silva es, unger s, tajmazinani m, mac feely s. artificial intelligence (ai) or intelligence augmentation (ia): what is the future? ai. 2020 apr 12;1(2):143–55. 4. bickman l. improving mental health services: a 50-year journey from randomized experiments to artificial intelligence and precision mental health. adm policy ment heal ment heal serv res. 2020 sep 26;47(5):795–843. 5. dong y, hou j, zhang n, zhang m. research on how human intelligence, consciousness, and cognitive computing affect the development of artificial intelligence. rao r, editor. complexity. 2020 oct 28;2020:1–10. 6. stuckey hl, nobel j. the connection between art, healing, and public health: a review of current literature. am j public health. 2010 feb;100(2):254–63. 7. schuller bw, zhang y, weninger f. three recent trends in paralinguistics on the way to omniscient machine intelligence. j multimodal user interfaces. 2018;12(4):273–83. 8. koops s, brederoo sg, de boer jn, nadema fg, voppel ae, sommer ie. speech as a biomarker for depression. cns neurol disord drug targets. 2021 dec 13;20. 9. jiang h, hu b, liu z, yan l, wang t, liu f, et al. investigation of different speech types and emotions for detecting depression using different classifiers. speech commun. 2017 jun;90:39–46. 10. cummins n. automatic assessment of depression from speech: paralinguistic analysis, modelling and machine learning. 2016; 11. cummins n, scherer s, krajewski j, schnieder s, epps j, quatieri tf. a review of depression and suicide risk assessment using speech analysis. speech commun. 2015;71:10–49. 12. kaddari z, mellah y, berrich j, belkasmi mg, bouchentouf t. natural language processing: challenges and future directions. lect notes networks syst. 2021;144:236–46. 13. bathina kc, ten thij m, lorenzo-luaces l, rutter la, bollen j. individuals with depression express more distorted thinking on social media. nat hum behav. 2021 apr 11;5(4):458–66. 14. jain p, srinivas kr, vichare a. depression and suicide analysis using machine learning and nlp. j phys conf ser. 2022;2161(1). 15. rinaldi a, fox tree j, chaturvedi s. predicting depression in screening interviews from latent categorization of interview prompts. 2020;7–18. 16. girard jm, cohn jf, mahoor mh, mavadati s, rosenwald dp. social risk and depression: evidence from manual and automatic facial expression analysis. in: 2013 10th ieee international conference and workshops on automatic face and gesture recognition, fg 2013. ieee; 2013. p. 1–8. 17. gehricke jg, shapiro d. reduced facial expression and social context in major depression: discrepancies between facial muscle activity and self-reported emotion. psychiatry res. 2000 aug;95(2):157–67. lmrj volume 4 issue 01 54 | p a g e 18. vavrinsky e, stopjakova v, kopani m, kosnacova h. the concept of advanced multi-sensor monitoring of human stress. sensors. 2021 may 17;21(10):3499. 19. kroenke k, spitzer rl, williams jbw. the phq-9: validity of a brief depression severity measure. j gen intern med. 2001 sep;16(9):606–13. 20. ladiwala zfr, dhillon ra, zahid i, irfan o, khan ms, awan s, et al. knowledge, attitude and perception of pakistanis towards covid-19; a large cross-sectional survey. bmc public health. 2021;21(1). type of the paper (article lmrj volume 4 issue 01 42 | p a g e research article frequency of different indications and findings for colonoscopy in a tertiary care hospital jalpa devi, nandlal seerani, amerta bai, rabia farooque, hira laghari, riaz hussain awan, akram bajwa, komal kumari, seema nayab department of gatroentrology, liaquat university of medical and health sciences jamshoro, pakistan abstract colonoscopy is one of the most important diagnostic tools to assess the structural abnormalities of the large intestine and distal ileum. to date, there is a paucity of data in pakistan on indications and findings of colonoscopy. therefore, our study aimed to evaluate the indications and endoscopic findings of patients who underwent colonoscopy at a tertiary care hospital in interior sindh, pakistan. this prospective cross-sectional study of 125 patients who underwent lower gastrointestinal endoscopy was conducted in the endoscopy unit of lumhs civil hospital hyderabad / jamshoro from april 2020 to september 2020. to be eligible participants had to be 14 years or older, of either gender and giving informed consent. data regarding demographic characteristics, indications, and endoscopic findings were gathered on a pre-designed proforma. a total of 125 participants were recruited with a mean age of 39 ± 20, out of which 60% were males. rectal bleeding was the most common indication (70.4%) followed by abdominal pain (9.6%), chronic diarrhea (8%), altered bowel habits (6.4%), constipation (2.4%), post-cancer surveillance (1.6%), weight loss, and anemia (0.8%) each. the most common colonoscopy findings were hemorrhoids (29.6%), and suspected tumor/growth (14.4%), while 22.4% were normal. the most common indication in our study was per rectal bleeding with hemorrhoids as the most common endoscopic finding on colonoscopy. key words: colonoscopy, hemorrhoids, rectal bleeding introduction colonoscopy is one of the most important tools to assess the structural abnormalities of the large intestine and distal ileum. it is a safe and effective procedure and plays a pivotal role in the diagnosis of myriads of large intestinal disorders such as infective colitis, colonic adenomas, polyps, inflammatory bowel disease, and carcinomas. nevertheless, it is an essential tool in therapeutic intervention including polypectomy, electrocoagulation, stricture dilation and stent placement(1-3). it is a gold standard screening tool for early detection of colorectal carcinoma which has been shown to improve disease outcomes (3-5). although it's a relatively safe procedure, some complications have been noted in rare instances. the post colonoscopy complications like perforation, bleeding and mortality rate range from 0 to 1.7/ 1000, 0 to 22.3/1000, and 0 to 2 /1000 colonoscopies respectively. globally, different gastrointestinal correspondence: jalpa devi, department of gastroentrology, liaquat university of medical & health sciences, jamshoro, pakistan email: devijalpadj@gmail.com doi: 10.38106/lmrj.2022.4 .1-08 received: 01.02.2022 accepted: 21. 03..2022 published: 31. 03.2022 mailto:devijalpadj@gmail.com mailto:devijalpadj@gmail.com lmrj volume 4 issue 01 43 | p a g e professional societies have adopted the safety standards for colonoscopy practice to minimize post colonoscopy complications (6-10). throughout the world, there is a high demand for colonoscopy services (11). in a resource-poor and highly populated countries, there is an utmost need to identify colonic disease burden and to ascertain that colonoscopies are performed only in appropriately indicated cases such as suspicious malignancy and other high-risk abnormalities (12). to date, there is a paucity of data in pakistan on indications and findings of colonoscopy. therefore, we aimed to evaluate the indications and endoscopic findings of patients who underwent colonoscopy at a tertiary care hospital in interior sindh, pakistan. methods this was a prospective cross-sectional study, carried out at the endoscopy unit of liaquat university of medical and health sciences, hyderabad / jamshoro from april 2020 to september 2020. one hundred and twenty-five patients were included, which were referred from inpatient, outpatient, and emergency department. it was carried out after approval by the institutional ethical review committee. the patients of either gender, who gave informed consent were included in the study while nonconsenting patients were excluded. data regarding demographic characteristics including age, gender, indications, colonoscopy findings, and the type of therapeutic intervention was recorded on a predesigned proforma. all the colonoscopies were performed without sedation. as per indications, colonoscopy was performed to observe abnormalities and to send biopsy samples for histopathology. the preparation for the procedure included a digital rectal examination to rule out any contraindication and bowel preparation. for bowel preparation, patients were kept on a liquid diet, bisacodyl 5 mg tablets, 6-10 tablets of sodium docusate 100 mg per-oral, and sodium phosphate (kleen enema) 24 hours before the procedure. all patients were kept under observation for 2 hours after the procedure, and discharged with counseling on restarting normal diet and reporting any complication immediately. the histopathological findings were not included as the objective of this study was to document indications and colono-scopic findings only. statistical analysis was done with ibm spss software (version 22 for windows inc., chicago, il, usa). a descriptive analysis was done for demographic features, which were presented as mean ± the standard deviation for quantitative variables and number (percentage) for qualitative variables. results there were 75 (60%) males out of 125 patients. the mean age of patients was 39 (standard deviation (sd) ± 20) years. seventy-six (60.8%) patients were in the age group 20-50 while 33 (26.4%) were greater than 50 years of age. the demographics for age, gender, and ethnicity are described in table 1. eighty-one (64.8%) patients were referred from the outpatient department while the rest were from different inpatient departments. per rectal bleeding (hematochezia) was the commonest indication (n=88; 70.4%) followed by abdominal pain representing 12 (9.6%) patients. other common colonoscopy indications are shown in table 1. colonoscopy findings showed that 28 (22.4 %) of the patients had normal colonoscopy while many different abnormalities were detected in the 97 (77.6%) patients. the most common findings were lmrj volume 4 issue 01 44 | p a g e hemorrhoids (32.2 %), and suspected tumor/growth (14.4%), followed by other findings which are shown in table 2. table 1. summary of the primary characteristics and indication of colonoscopy age group (years) frequency (%) <20 15 (12%) 20-50 76 (60.8%) >50 34 (27.2%) total 125 (100%) gender frequency (%) male 75 (60%) female 50 (40%) ethnicity frequency (%) sindhi 85 (67.5%) urdu 15 (11.9%) punjabi 9 (7.1%) balochi 8 (6.3%) pathan 5(4%) siraiki 4 (3.2%) indication frequency (%) hematochezia 88 (70.4%) abdominal pain 12 (9.6%) chronic diarrhea 10 (8%) altered bowel habits 8 (6.4%) constipation 3 (2.4%) postcancer survelliance 2 (1.6%) anemia 1 (0.8%) weight loss 1 (0.8%) in patients that presented with hematochezia (rectal bleed), the most frequent colonoscopic abnormalities were hemorrhoids in 31 (35.2%), suspected colorectal tumor/growth in 12 (13.6%), normal in 10 (11.4%), and rectal polyps also in 9 (10.2%) patients. among patients with abdominal pain as their indication, the findings were normal in 7 (58.3%), hemorrhoids in 4 (33.3%), and stricture in 1 (8.3%) patients. the colonoscopy findings found in patients that presented with chronic diarrhea were normal and ulcers in 4 (40%) patients each, suspected colorectal tumor/growth, and hemorrhoids in 1(10%) patient each. the colonoscopy was diagnostic in 118 (94.4%) patients and therapeutic interventions were carried out in 7 (5.6%) patients. therapeutic procedures included polypectomy. lmrj volume 4 issue 01 45 | p a g e table 2. summary of the diagnosis made on colonoscopy findings frequency (%) hemmorhoids 37 (29.6%) normal 28 (22.4%) suspected growth 18 (14.4%) ulcers 10 (8%) rectal polyp 9 (7.2%) polyp at other location 4 ulcer + hemmorhoids 4 loss of vascularity+erythema 3 fissure in ano + hemmorhoids 3 stricture 2 anal fissure 1 colopathy 1 hard impacted stool 1 growth + hemmorhoids 1 ulcers + loss of vascularity+pseudopolyps 1 discussion colonoscopy is frequently used for diagnostic, and therapeutic purposes, and as well as the screening tool for colorectal carcinoma in patients older than 50 years as recommended by guidelines (5). our study had a majority of male patients (60%) which was consistent with the finding of olokoba et al. (1), mohammad et al. (3), akere et al. (4), betes m et al. (13), imperial t et al. (14), salamat et al.(15) and mudawi et al. (16) shrestha et al. (17) while joukar f et al. (18) and manzoor et al. (19) had more female patients compared to men. furthermore, the mean age of participants was observed to be 39 (± 20) years, in which the majority were in the 21-50 years age group, while in other studies the mean age is quite variable. in a study conducted at ghulam muhammad mahar medical college and teaching hospital, sukkur, pakistan in 2019, the mean age was found to be 56 (± 17) years, majority proportion was above 50 years (3), while another study conducted at military hospital, rawalpindi, pakistan in 2007 had a mean age of 50 years (15). rehman et al. (20) and farhan et al. (21) had mean age of 44.86 (±16.22) and 43.7 years. in this study, we found 28 (22.4 %) of the patients had a normal colonoscopy. in literature, we observed a higher rate of normal colonoscopy findings as compared to our study except for a study done in nepal by shrestha et al. (17) which found normal findings in 19.3%. farhan et al. (21) salamat et al. (15) and joukar f et al. (18), akere et al. (4) reported normal colonoscopy in 40%, 38%, 35.5%, and 26% respectively. the normal colonoscopic findings were as significant as abnormal results since they are reassuring for patients and physician. efforts should be made to properly screen and weigh the risks and benefits of colonoscopy to reduce unnecessary discomfort, complications, and overutilization of already scarce resources. our study showed rectal bleeding as the most common indication for colonoscopy accounting for 70.4 %. salamat et al. (15), akere et al. (4), and olokoba et al. (1) had similar observations. however, lmrj volume 4 issue 01 46 | p a g e in the study by farhan et al.in lahore pakistan, the most common indication was altered bowel habits whereas, elbatea et al. (2) in egypt, mudawi et al. (16) in sudan found abdominal pain to be the most common indication of colonoscopy. in the study by wang et al. in chinese and american hospital (22), screening for colorectal carcinoma was the most common indication which showed how much developing country like ours is still far from preventive medicine. hemorrhoids (29.6%) accounted for the majority of cases of colonoscopy findings in our study which is consistent with mohammad et al. (3), joukar f et al. (18), rehman et al. (20), nazish et al. (23). whereas, another study conducted by salamat et al. (15) farhan et al. (21), mudawi et al. (16) found hemorrhoids in only 10%, 10 %, 6.4% respectively. in our study, we found 14.4 % had suspected tumor/ growth whereas, salamat et al. (15), mudawi et al. (16), shrestha et al. (17), akere et al. (4), and elbatea et al. observed 10 %, 11%, 11%,12%, 15% respectively. the third most common finding was ulcers (8%) in this study. the range of various findings on colonoscopy can be explained by variations based on lifestyle, ethnicity, geography, diet, socio-economic factors, and expertise and experience of the gastroenterologist. the gender discrepancy in terms of male preponderance could be attributed to the lesser tendency of women to undergo such procedures in developing countries with conservative culture, social inhibition, and lack of awareness. this could lead to the underestimation of the actual risk that colonic diseases would be posing on the females. this warrants community interventions to spread awareness and mitigate the risk of colonic cancer and other diseases in womenfolk. this study, to the best of our knowledge, is one of the few studies from interior sindh to delineate the indications and findings of colonoscopy. however, it can’t provide the prevalence and incidence in the population since it’s a single hospital-based study. several such large-scale multi-center studies and population-based registries are required to identify the actual burden of the colonic diseases in the country, which would help to direct the health care services and calculated allocation of limited resources. conclusion per rectal bleeding constituted the most common indication of colonoscopy followed by abdominal pain and chronic diarrhea. hemorrhoids, suspected growth/tumor, and ulcers were the most frequent pathology in patients who underwent colonoscopy. approximately, one-quarter of patients had a normal examination of colonoscopy. conflict of interest all authors declare no conflict of interest funding no funding was acquired for this study references 1. olokoba ab, obateru oa, bojuwoye mo, olatoke sa, bolarinwa oa, olokoba lb. indications and findings at colonoscopy in ilorin, nigeria. nigerian medical journal: journal of the nigeria medical association [internet]. 2013; 54(2):[111 p.]. 2. elbatea h, enaba m, elkassas g, el-kalla f, elfert aa. indications and outcome of colonoscopy in the middle of nile delta of egypt. digestive diseases and sciences [internet]. 2011; 56(7):[2120-3 pp.]. lmrj volume 4 issue 01 47 | p a g e 3. mohammad s, channa ghr, shah ia, baloch i, shah aa, lakho s, et al. colonoscopy findings: a single institution study from pakistan. cureus [internet]. 2019; 11(11). 4. akere a, oke to, otegbayo ja. colonoscopy at a tertiary healthcare facility in southwest nigeria: spectrum of indications and colonic abnormalities. annals of african medicine [internet]. 2016; 15(3):[109 p.]. 5. rex dk, boland cr, dominitz ja, giardiello fm, johnson da, kaltenbach t, et al. colorectal cancer screening: recommendations for physicians and patients from the us multi-society task force on colorectal cancer. gastroenterology [internet]. 2017; 153(1):[307-23 pp.]. 6. reumkens a, rondagh ej, bakker mc, winkens b, masclee aa, sanduleanu s. post-colonoscopy complications: a systematic review, time trends, and meta-analysis of population-based studies. american journal of gastroenterology [internet]. 2016; 111(8):[1092-101 pp.]. 7. rex dk, schoenfeld ps, cohen j, pike im, adler dg, fennerty mb, et al. quality indicators for colonoscopy. gastrointestinal endoscopy [internet]. 2015; 81(1):[31-53 pp.]. 8. rex dk, petrini jl, baron th, chak a, cohen j, deal se, et al. quality indicators for colonoscopy. gastrointestinal endoscopy [internet]. 2006; 63(4):[s16-s28 pp.]. 9. rembacken b, hassan c, riemann j, chilton a, rutter m, dumonceau j-m, et al. quality in screening colonoscopy: position statement of the european society of gastrointestinal endoscopy (esge). endoscopy. 2012;44(10):957-68. 10. bowles c, leicester r, romaya c, swarbrick e, williams c, epstein o. a prospective study of colonoscopy practice in the uk today: are we adequately prepared for national colorectal cancer screening tomorrow? gut [internet]. 2004; 53(2):[277-83 pp.]. 11. mysliwiec pa, brown ml, klabunde cn, ransohoff df. are physicians doing too much colonoscopy? a national survey of colorectal surveillance after polypectomy. annals of internal medicine [internet]. 2004; 141(4):[264-71 pp.]. 12. edwards jk, norris te. colonoscopy in rural communities: can family physicians perform the procedure with safe and efficacious results? the journal of the american board of family practice [internet]. 2004; 17(5):[353-8 pp.]. 13. betés m, munoz-navas ma, duque jm, angós r, macías e, súbtil jc, et al. use of colonoscopy as a primary screening test for colorectal cancer in average risk people. the american journal of gastroenterology [internet]. 2003; 98(12):[2648-54 pp.]. 14. imperiale tf, wagner dr, lin cy, larkin gn, rogge jd, ransohoff df. results of screening colonoscopy among persons 40 to 49 years of age. new england journal of medicine [internet]. 2002; 346(23):[1781-5 pp.]. 15. ehsan a. colonoscopy: analysis of indications and diagnoses at a specialist unit. ann pak inst med sci [internet]. 2010; 6(1):[15-9 pp.]. 16. mudawi hm, nanakaly sm, el tahir ma, suliman sh, ibrahim sz. indications and findings of colonoscopy in patients presenting to the endoscopy unit at soba university hospital in khartoum, sudan. arab journal of gastroenterology [internet]. 2010; 11(2):[101-4 pp.]. 17. shrestha r, rajbhandari a, chhetri g, regmi rs, chaudhary p. clinical profiles and endoscopic findings of patients undergoing colonoscopy in nobel medical college. journal of nobel medical college. 2019;8(1):3-7. lmrj volume 4 issue 01 48 | p a g e 18. joukar f, majd sk, fani a, nazari n, mansour-ghanaei f. colonoscopy outcome in north of iran (guilan): 2006-2009. international journal of clinical and experimental medicine [internet]. 2012; 5(4):[321 p.]. 19. manzoor a, shah s, inam a. etiologic spectrum of bleeding per rectum in surgical outpatient department of a tertiary care hospital. ann pak inst med sci [internet]. 2011; 7(4):[180-5 pp.]. 20. rehman ku, qureshi mo, khokhar n, shafqat f, salih m. quality of colonoscopy and spectrum of lower gastrointestinal disease as determined by colonoscopy. j coll physicians surg pak [internet]. 2015; 25(7):[478-81 pp.]. 21. abbas ib. colonsoscopy-an annual audit of cases at medical unit iii services hospital lahore. 22. wang h, cai q, zhu ht, lv nh, zhu x. a comparative analysis of colonoscopy findings in a chinese and american tertiary hospital. turk j gastroenterol [internet]. 2015; 26:[263-9 pp.]. 23. zahra n, muhammad i, muhammad younus k. lower gasrtointestinal bleeding; etiologic spectrum in nishtar hospital multan. 2015. type of the paper (article lmrj volume 4 issue 01 28 | p a g e research article long term recovery assessment of post-covid-19 loss of taste and smell a population-based survey sana shahzad1, faisal jamil2 1st. helen’s and knowsley nhs trust, united kingdom, 2medway maritime hospital, gillingham, united kingdom abstract coronavirus disease (covid-2019) has remained a pandemic for more than two years and has badly affected human lives. it was a novel disease without even knowledge of its symptoms. it has caused millions of deaths all around the world. it involves multiple organ system with a variety of symptoms but sense of taste, smell, were commonly affected. this was a prospective population-based survey conducted by using a pre-defined questionnaire. about 218 covid -19 rt-pcr positive patients were treated at home without any significant illness. there were 141 and 125 patients who recovered completely with return sense of smell and taste respectively, while 11 patients had both dysfunctional senses. females had a significantly higher rate of complete recovery of sense of taste but smell had no association with gender. our study showed a significant proportion of patients showing incomplete recovery of the taste and smell. further studies on the neurological pathways are recommended to explore it in depth and develop interventions to cure the disability. key words: covid-19, long covid, sense of smell and taste introduction coronavirus disease (covid-2019) is a viral infection caused by an rna virus named sars-cov2. the infection was first reported in wuhan city of china in 2019; it causes mild symptoms to severe respiratory illness and causes death. according to a world health organization (who) report, since its discovery in 2019, it accounts for more than 6 million deaths worldwide. many patients develop the infection without showing any symptoms, while others develop debilitating disease causing hospitalization and even respiratory failure. following complete recovery, some patients have mild symptoms ranging from mild myalgia to severe dyspnea. more than half of the patients reported a loss of taste and smell as the most common symptoms (1). later, long covid was reported initially from the support groups then confirmed by the scientific community(2). nevertheless, mechanism and pathogenesis of development of long covid are not yet understood. still, it is precisely reported to be with the persistence of the virus for a long time and damage to the nervous and respiratory systems (2). further reports suggest the involvement of all body systems in long covid (3), including the immune, musculoskeletal, nervous, gastrointestinal, cardiovascular and renal systems. thus no system is spared. altered taste and smell are the most commonly reported symptoms of long covid (4). a previously reported study suggested a loss of taste and smell in 28% of cases six months post-covid(5). another study from faroe island included non-hospitalized, pcr positive covid 19 patients (n=180). over 53% of participants reported having at least one symptom after 125 days of recovery. out of these,>20% of participants reported having a persistent loss of taste and smell (6). in another study, 25.5% of covid recovered patients reported to have smell and taste disorders more than six months after recovery from the correspondence: faisal jamil consultant physician medway maritime hospital, windmill road, gillingham, united kingdom me7 5ny email: faisal.jamil@nhs.net doi: 10.38106/lmrj.2022.4.1-05 received: 03.02.2022 accepted: 26. 03..2022 published: 31. 03.2022 mailto:faisal.jamil@nhs.net mailto:faisal.jamil@nhs.net lmrj volume 4 issue 01 29 | p a g e acute phase(7). initial reports also suggested up to 30% prevalence of smell and taste dysfunction after one-year post-covid recovery (8). the available literature includes all patients with covid-19. there is limited literature available on patients of all levels of severity. there is little literature on patients who had mild symptoms and did not receive aggressive therapy for covid symptoms. therefore, this study was designed to evaluate smell and taste dysfunction persistence in patients with mild symptoms. methods this questionnaire-based survey, including rt-pcr nasal swab confirmed covid-positive patients diagnosed between 1st april 2020 and 30th april 2021. all patients self-reported having mild symptoms, and no hospitalization was required. the patients who had a loss of smell and taste at the first diagnosis were included in this study, and they were requested to participate. those who consented after informed consent were included. the self-administered structured questionnaire was designed and requested from the patients who came in contact at least one year after recovery(n=455), and 218 questionnaires were returned filled with informed consent. the questions were asked regarding smell and taste recovery. the questions included recovery of both the senses as complete, incomplete, and dysfunctional. both senses were questioned separately, and also loss of both senses together. the data was entered and analyzed using the statistical package for social sciences (spss version 21.0). the questions were reported as categorical variables and presented as frequency distribution in numbers and percentages. gender was correlated with recovery of both senses by using chsquared test, and a p-value <0.05 was considered significant. results a total of 218 participants consented to be part of our study, including 54.1% (n=118) males and 45.9% (n=100) females. the mean age of the participants was 38.73 years (range 21 to 65 years ±sd= 11.01). all of these patients had pcr positive covid-19, and the median duration of diagnosis was 18.6 months. all of these patients had experienced a loss of taste and smell, out of which 97 patients had complete recovery and return of both senses. 141 (64.7%) had complete recovery of the sense of smell, and 125(57.3%) had complete recovery of taste. 55 (25.2%) had incomplete recovery of smell sense, and 70 (32.1%) had incomplete recovery of taste. 11 (5.0) had both senses dysfunctional. among dysfunctional senses, patients mentioned cacosmia in the majority of cases. gender did not show a significant association with the recovery of the sense of smell. still, the taste was significantly influenced by gender, where female patients had a significantly higher recovery rate (p-value=0.03) (figures 1 and 2). figure 1. association of gender with recovery of sense of smell figure 2. association of gender with recovery of sense of taste lmrj volume 4 issue 01 30 | p a g e discussion covid-19 has developed into a systemic problem with some lethal complications resulting in millions of deaths. however, a significant majority recovered completely without any devastating effects on health. loss of taste and smell were the most commonly reported symptoms in earlier days of the diagnosis. this study focused on the long-term recovery of the taste and smell senses. though a significant majority in our sample had complete recovery. a considerable number is still suffering from the incomplete return of these senses, and a small number had dysfunction. previously reported studies focused on short-term recovery, where 38% and 41% lost taste and smell, respectively, out of which 74% had severe symptoms (9). a large study on the impact of olfactory sense loss on respiratory recovery should show a strong association between the two. around fifty percent of patients showed recovery of the sense of smell within 40 days of onset(10). another retrospective study conducted using a questionnaire reported complete recovery of the sense of smell in 85.71% of participants within 3-61 days while around 8% reported persistent hyposmia. another small study, including 61 patients, reported that 28% of patients continued to have a loss of taste and smell after six months of recovery(5). a cohort study conducted in melbourne focused on the recovery of taste and smell after covid showed that 74% of covid-19 positive patients complained of loss of taste and smell, out of which 34% had a persistent loss of smell after recovery and 28% had complaints of loss of taste(11). another study reported that around 17% of patients reported having a loss of smell and taste even after nine months of recovery(12). yet another study reported complete recovery of smell and taste functions in 52% and 61.5%, respectively, after 229 days (13). our findings of recovery and persistent symptoms post-covid are consistent with the existing literature. loss of smell is widespread during viral infection involving the respiratory system. however, the recovery from the loss of smell corresponds to the recovery of the respiratory symptoms. however, the case was different in covid patients, where many recovered patients continue to have these symptoms even after biologically confirmed recovery. the exact cause of the loss is not yet understood. still, specific mechanisms are thought to be involved, such as inflammatory response damaging mucosa or neuronal pathways of smell and taste(14). however, patients with no or minimal stress or depression, or cognitive dysfunction post-covid are less likely to have a central nervous system problem. theoretically, it is more likely to be the response at the organ/ mucosal level at the nose and tongue where there is damage to the nerve ending as part of the inflammatory response. though it is not yet understood. an electrophysiological study was done on the sensory system and suggested no metabolic activation of the brain after an olfactory stimulus. thus further detailed analysis would be helpful in exploring the cause and find out the cure of the disability. conclusion our study suggests a considerable chance of having loss of smell and taste even after one year of complete recovery from covid-19 viral infection. the exact mechanism of the loss is not yet fully understood, and further studies to explore the pathophysiology of the long-term effects of covid19 are essential to make it understood. references 1. najafloo r, majidi j, asghari a, aleemardani m, kamrava sk, simorgh s, et al. mechanism of anosmia caused by symptoms of covid-19 and emerging treatments. acs chem neurosci lmrj volume 4 issue 01 31 | p a g e [internet]. 2021 oct 20;12(20):3795–805. available from: https://pubs.acs.org/doi/10.1021/acschemneuro.1c00477 2. yong sj. long covid or post-covid-19 syndrome: putative pathophysiology, risk factors, and treatments. infect dis (auckl) [internet]. 2021 oct 3;53(10):737–54. available from: https://www.tandfonline.com/doi/full/10.1080/23744235.2021.1924397 3. silva andrade b, siqueira s, de assis soares wr, de souza rangel f, santos no, dos santos freitas a, et al. long-covid and post-covid health complications: an up-to-date review on clinical conditions and their possible molecular mechanisms. viruses [internet]. 2021 apr 18;13(4):700. available from: https://www.mdpi.com/1999-4915/13/4/700 4. aiyegbusi ol, hughes se, turner g, rivera sc, mcmullan c, chandan js, et al. symptoms, complications and management of long covid: a review. j r soc med [internet]. 2021 sep 15;114(9):428–42. available from: http://journals.sagepub.com/doi/10.1177/01410768211032850 5. blomberg b, mohn kg-i, brokstad ka, zhou f, linchausen dw, hansen b-a, et al. long covid in a prospective cohort of home-isolated patients. nat med [internet]. 2021 sep 23;27(9):1607–13. available from: https://www.nature.com/articles/s41591-021-01433-3 6. petersen ms, kristiansen mf, hanusson kd, danielsen me, á steig b, gaini s, et al. long covid in the faroe islands: a longitudinal study among nonhospitalized patients. clin infect dis [internet]. 2021 dec 6;73(11):e4058–63. available from: https://academic.oup.com/cid/article/73/11/e4058/6012625 7. nguyen nn, hoang vt, dao tl, meddeb l, cortaredona s, lagier j-c, et al. long-term persistence of olfactory and gustatory disorders in covid-19 patients. front med [internet]. 2022 feb 25;9. available from: https://www.frontiersin.org/articles/10.3389/fmed.2022.794550/full 8. fortunato f, martinelli d, iannelli g, milazzo m, farina u, di matteo g, et al. self-reported olfactory and gustatory dysfunctions in covid-19 patients: a 1-year follow-up study in foggia district, italy. bmc infect dis [internet]. 2022 dec 22;22(1):77. available from: https://bmcinfectdis.biomedcentral.com/articles/10.1186/s12879-022-07052-8 9. printza a, katotomichelakis m, valsamidis k, metallidis s, panagopoulos p, panopoulou m, et al. smell and taste loss recovery time in covid-19 patients and disease severity. j clin med [internet]. 2021 mar 2;10(5):966. available from: https://www.mdpi.com/20770383/10/5/966 10. gerkin rc, ohla k, veldhuizen mg, joseph p v, kelly ce, bakke aj, et al. recent smell loss is the best predictor of covid-19 among individuals with recent respiratory symptoms. chem senses [internet]. 2021 jan 1;46. available from: https://academic.oup.com/chemse/article/doi/10.1093/chemse/bjaa081/6048917 11. horvath l, lim jwj, taylor jw, saief t, stuart r, rimmer j, et al. smell and taste loss in covid-19 patients: assessment outcomes in a victorian population. acta otolaryngol [internet]. 2021 mar 1;141(3):299–302. available from: https://www.tandfonline.com/doi/full/10.1080/00016489.2020.1855366 12. nehme m, braillard o, chappuis f, courvoisier ds, guessous i. prevalence of symptoms more than seven months after diagnosis of symptomatic covid-19 in an outpatient setting. ann intern med [internet]. 2021 sep;174(9):1252–60. available from: https://www.acpjournals.org/doi/10.7326/m21-0878 lmrj volume 4 issue 01 32 | p a g e 13. biadsee a, dagan o, ormianer z, kassem f, masarwa s, biadsee a. eight-month follow-up of olfactory and gustatory dysfunctions in recovered covid-19 patients. am j otolaryngol [internet]. 2021 jul;42(4):103065. available from: https://linkinghub.elsevier.com/retrieve/pii/s0196070921001666 14. kavaz e, tahir e, bilek hc, kemal ö, deveci a, aksakal tanyel e. clinical significance of smell and taste dysfunction and other related factors in covid-19. eur arch oto-rhino-laryngology [internet]. 2021 jul 1;278(7):2327–36. available from: https://link.springer.com/10.1007/s00405-020-06503-9 type of the paper (article lmrj volume 4 issue 02 84 | p a g e case report posterior reversible encephalopathy syndrome with blood transfusion? mukesh kumar, pooran mal, sunil, aqsa zohaib department of nephrology, liaquat university of medical and health sciences, jamshoro, pakistan abstract posterior reverse encephalopathy syndrome (pres) is a clinico-neuroradiologic entity with various neurological manifestations, including headaches, vision problems, and altered mental status. oedema has been observed in a generally symmetrical fashion in mri studies, most often in the subcortical white matter and rarely in the cortex of the occipital and parietal lobes. when properly treated, this condition is usually reversible; however, failure to make a timely diagnosis may result in cerebral infarction and even death. this case report presents a 30-year-old woman with a history of postpartum bleeding and anuria, later diagnosed with pres syndrome. this rare case is reported here for information of neurology clinicians to keep the features in mind if any such case comes up in future. key words: acute kidney injury, posterior reversible encephalopathy syndrome (pres), blood transfusion introduction posterior reversible encephalopathy syndrome (pres), also called reversible posterior leukoencephalopathy syndrome (rpls), was initially described by hinchey in 1996(1). it is characterized by several symptoms, including headache, vision change, paresis, nausea, and altered mental status(2). the pathogenesis of pres syndrome is still not clear. however, hypertension and endothelial injury tend to be present in almost all cases. here we are presenting a 30-year-old woman, gravida 3 and para 4 came to the emergency department with complaints of anuria, loss of appetite and vomiting a day after delivering an intrauterine death (iud) baby at home and a history of postpartum bleeding. at the time of arrival in the emergency department, the patient was fully conscious and oriented to time, place and person. she had a pulse of 98 bpm, blood pressure of 170/100 mmhg, respiratory rate of 24breaths/minute and body temperature of 98.6°f. all systemic examinations, including the abdominal, respiratory, cardiovascular, and central nervous systems, were unremarkable. baseline investigations including hemoglobin were 4.3 g/dl with mean corpuscular volume was 54/fl, total leukocyte count was 7.2 x 109 and platelets count was 150 000. sodium was 135; potassium was 4.7mmol/l, chloride was 103mmol/l, and bicarbonate was 17mmol/l. urea was 97 mg/dl, and creatinine was 6.1 mg/dl. on ultrasound, no retained part of conception was found, and kidney size and echogenicity were within normal limits. correspondence: dr. mukesh kumar department of nephrology, liaquat university hospital, jamshoro email: mk8035804@gmail.com doi: 10.38106/lmrj.2022.4.2-07 received: 03.04.2022 accepted: 25. 06..2022 published: 30. 06.2022 mailto:mk8035804@gmail.com lmrj volume 4 issue 02 85 | p a g e our impression was acute kidney injury due to postpartum haemorrhage. the treatment was started with amlodipine 10 per day, omeprazole 40mg, metoclopramide, iron therapy, and 4 pints of packed cell volumes were transfused. on day 4th, her urea and creatinine were in a declining pattern, and her urine output was also improved, but the patient suddenly developed a loss of vision bilaterally. her fundoscopic examination was normal at that time, and the other examination was unremarkable. her mri brain shows t2 high signal noted b/l symmetrically within the cortex and subcortical region of both parietal and occipital lobes, which was associated with gyral swelling. these appeared low on t1w and high on flair and t2w. these findings are suggestive of pres syndrome (figure 1). on day 8th, she recovered her vision gradually, and 2 days later, after clinical improvement, the patient was discharged with medication and followed up in the outpatient department. figure 1a. mri scan of the patient diagnosed with pres syndrome figure 1b. mri scan of the patient diagnosed with pres syndrome discussion hypertension, uncomplicated and complicated pregnancies, immunosuppressive medications such as steroids, cyclosporin and tacrolimus (3), hemolytic uremic syndrome, hepatic syndrome, acute lmrj volume 4 issue 02 86 | p a g e intermittent porphyria, hiv, and blood transfusion are also contributing factors for pres syndrome. a clear female preponderance of cases exists. the failure of autoregulation and the blood-brain barrier in the pathogenesis of brain oedema in pres. as this posterior circulation has less sympathetic innervation than the internal carotid artery territory, it may be more vulnerable to autoregulation failure(4). the parieto-occipital area was involved in 98.7% of cases, the posterior frontal region was involved in 78.9% of cases, and according to the mckinney study, the temporal region was involved in 68.4% of patients (5). blood transfusions can dramatically increase overall blood volume, which can induce brain blood flow pressure. vasogenic oedema in pres is thought to be caused by a sudden increase in perfusion that leads to a rise in cerebral capillary perfusion pressure, ultimately exceeding the ability of the autoregulation mechanism(6). our patient was severely anaemic, so four pints of packed cell volume were transfused during her hospital stay. she acquired pres syndrome a couple of days later, implying that she developed pres syndrome due to blood transfusions. it is suspected that pres may be a significant issue in massive blood transfusions. a high index of suspicion and timely care will help minimize morbidity and mortality and pave the way for a quick recovery. this should be borne in mind when dealing with patients needing emergency blood transfusions. conclusion pres syndrome was suspected in a woman presenting with postpartum haemorrhage, and four pints of blood were transfused. therefore, it is essential to keep in mind that such cases can be suspected after transfusion. references 1. j hinchey 1, c chaves, b appignani, j breen, l pao, a wang, m s pessin, c lamy, j l mas, l r caplan. a reversible posterior leukoencephalopathy syndrome. n engl j med 1996; 334 (8):494500. 2. c roth , a ferbert. the posterior reversible encephalopathy syndrome: what's certain, what's new?. practical neurology 2011; 11(3):136-44. 3. susmitha apuri , kristin carlin , edward bass , phuong thuy nguyen , john n greene . tacrolimus associated posterior reversible encephalopathy syndrome a case series and review. mediterranean journal of hematology and infectious diseases 2014; 6(1) 4. ayoub mirza. posterior reversible encephalopathy syndrome: a variant of hypertensive encephalopathy. journal of clinical neuroscience 2006; 13(5): 590-5. 5. alexander m. mckinney, james short, charles l. truwit, zeke j. mckinney. posterior reversible encephalopathy syndrome: incidence of atypical regions of involvement and imaging findings. american journal of roentgenology 2007; 189(4): 904-12. lmrj volume 4 issue 02 87 | p a g e 6. kei-ichiro wada, masayoshi kano, yutaka machida, nobutaka hattori, hideto miwa. posterior reversible encephalopathy syndrome induced after blood transfusion for severe anemia. case reports in clinical medicine 2013; 2(5):. type of the paper (article lmrj volume 4 issue 01 15 | p a g e research article impact of intellectual disabilities of children on mental health of parents zahoor ahmad, kinza anwar, hafsah gul, nadia ishtiaq, hafsah arshad university institute of physical therapy, department of allied health sciences, university of lahore, pakistan abstract parents of disabled children face unique challenges in their daily lives resulting in stress. this study was conducted focusing on the parents of children living with intellectual disability to evaluate the rate of anxiety and depression. this cross-sectional study included the parents of children who attend the health and wellness physiotherapy rehabilitation center and physiotherapy rehabilitation center of ncs university. there were 290 parents who consented and participated in the study. the participants were given a questionnaire with pre-designed questions about the socio-demographic characteristics of the family. furthermore, the beck's depression inventory (bdi) scale and state trait anxiety inventory were used to assess the level of depression and anxiety in our study population. data was analyzed through statistical package for social sciences (spssversion 22.0). out of 290 participants, 179 (61.7%) were males and 111 (38.7%) were females. with respect to bdi the number of mild mood disturbance was reported in 20 (6.9%), borderline clinical depression in 50 (17.2%), moderate depression in 82 (28.3%), severe depression were 113 (39%) and extreme depression was seen in 25 (8.6%). likewise, 21 (7.2%) participants denied any anxiety, 32 (11%) were in mild anxiety level, 114 (39.3%) were in somewhat anxiety level but 123 (42.4%) were in high anxiety level of state trail anxiety inventory scale. according to the study's findings, parents of disabled children were considerably affected by anxiety and depression. key words: bdi scale, birth disables, depression, district mardan, stai scale introduction intellectual disabilities are extremely common in children around the world, and rates are expected to rise in the upcoming years due to advanced medical facilities and improved infant survival rate (1, 2). the rate of intellectual disability in children is reported to be particularly high in developing countries and late diagnosis is reported from less developed regions of the world. in kenyan children, rates of neurological disability are estimated to be as high as 9.3%, which also includes intellectual disability (3). raising a child with such a disability is a challenge for parents at times giving them anxiety and depression. the association of caring for a child with intellectual disability and development of anxiety and depression in parents has been explored mostly in the developed-countries with social support systems (4). according to the studies conducted in less developed countries such as kenya, kuwait, qatar, pakistan, and india, the parents of such children have shown 47% to 50% prevalence of psychological disorders (5-7). raising and caring for a child having intellectual disability may result in challenges in family bonding, stress, and warrant a need to adopt a different correspondence: zahoor ahmed university institute of physical therapy, department of allied health sciences, university of lahore, pakistan email: zahoor_riphah@hotmail.com doi: 10.38106/lmrj.2022.4.1-03 received: 29.11.2021 accepted: 21. 03..2022 published: 31. 03.2022 lmrj volume 4 issue 01 16 | p a g e parenting style as compared to parenting a normal child(8). stress has been linked to negative couple attributions about marital satisfaction, as well as the impact of stress on family functioning (9). there are reports suggesting that these challenges can also result in divorce and financial constraints (10). the experts in the field believe that the stress level which arises from a situation; comes with caring a disabled child due to lack of the knowledge and experience of dealing with the situation and understanding the child’s needs. there are a number of studies looking at factors influencing parents of intellectually disabled children and causing psychological distress. these factors include but not limited to lower socioeconomic status with compromised financial support(11), single parent(mostly mother)(12, 13), feminine gender(14), perceived burden of care(13), lack of psychosocial support system(15) and inadequate knowledge of the child's disability(16). in case of familial problems when there are multiple disabled children in the family, it also raises the risk of depression in parents. in situations when the younger child is having disability and certain disorders, such as autism, are reportedly associated with high stress levels in parents (11). most of the literature focusing on the subject is reported from developed countries, while there is limited literature available from under-developed countries. on the other hand, less developed area estimates are relatively higher and limited services are available. it is therefore crucial to explore the level of the problem in less developed countries with limited social support. thus, this study was designed to explore anxiety and depression levels among parents of disabled children living in mardan district of pakistan. methods this was a prospective cross-sectional study approved by institutional review board, and ethical committee of ncs university swabi campus. this was a questionnaire-based survey and data was collected on a pre-designed questionnaire to find out the rate of depression and anxiety among parents of children with intellectual disabilities. a non-probability convenient sampling technique was adopted in the study. both parents of children with intellectual disabilities, attending services at health and wellness physiotherapy rehabilitation center, ncs physiotherapy rehabilitation center and private clinic of district mardan pakistan, were invited to take part in the study. a total of 290 parents consented to participate in this study. the data was collected for a period of 6 months, from 1st february 2021 till 30th august of 2021. beck’s depression inventory (bdi) questionnaires, stai and written informed consent were provided to parents of children with intellectual disabilities. those parents who agreed to provide the information and signed the consent form were invited to provide information in the questionnaire. the parents with limited literacy were provided assistance in filling up the responses. beck et al. (1) created and revised the bdi; the test–retest reliability of bdi was 0.86. this mental health tool consists of 21 items, each of which describes depressive symptoms and asks the respondent to rate their relevance to the symptom and how much it bothered them in the previous week. the response was recorded on a four-point scale. the sum of the total responses ranging from 0 to 63. the higher scores suggest a higher level of depression. spielberger et al. created the stai inventory, which is used to assess predisposition to anxiety (trait) and existing levels of apprehension in the respondents. it has 40 items that need to be reported by the respondent where 20 items assess state anxiety and 20 items evaluate anxiety predisposition. the score for each item rated from one to four. the response score of each item is added together to get the total score. the higher the score, the higher the level of anxiety. lmrj volume 4 issue 01 17 | p a g e all the parents of children with intellectual disabilities were briefed about the study along with harms and benefits and were explained about the confidentiality of the data they will be providing. they were also assured that they are free to leave the study if they wanted to leave the study at any time without any legal bonding. statistical analysis data was analyzed using statistical package for social sciences (spss version 22.0). the responses were recorded and presented in the scores. frequency distribution was presented in graphs. results the total participants were 290; including 179 (61.7%), males and female participants were 111 (38.7%). age was distributed in three categories; the participants between the age of 21 to 30 years were 28.3 % (n=82), between the age of 31 to 40 years were 44.1 % (n=128) and above the age of 40 years were 80 (27.6%). around 31 (10.7%) single parents were living without a partner (i.e. divorced). majority of the families belonged to the middle socio-economic class (n=93, 32.1), while 66 families were poor (i.e. 22.8%) and 50 parents reported to be from a strong financial background. majority of the participants had 1 child (n=270, 93.1%) in their families and while 6.9% had 2 children in their families. the mean and sd in bdi was 3.97± 0.99; the mean and sd of bdi in male was 4.38 ±1.19 and in female was 4.03 ±0.76, but the mean and sd of bdi in participants living with partner was 4.17± 1.08 and in divorced participant living without partner was 4.87± 0.42. although, the mean and sd was in stai was 3.16±0.89; the mean and sd of stai in male was 3.49± 0.50 and in females was 2.64±1.11 but the mean and sd of stai in participants living with partner was 3.15±0.93 and participant living without partner (divorced) was 3.25± 0.44. (figure1 and 2) with respect to bdi the number of mild mood disturbance were n=20 (6.9%), borderline clinical depression were 50 (17.2%), moderate depression were n=82 (28.3%), severe depression were n=113 (39%) and extreme depression were n=25 (8.6%). therefore, the majority of participants were in a severe depression level of the bdi scale. likewise, the n=21 (7.2%) were in not at all anxiety level, n=32 (11%) were in little anxiety level, n=114 (39.3%) were in somewhat anxiety level but n=123 (42.4%) were in very much anxiety level of state trail anxiety inventory scale. figure 1: showing the frequency of beck's depression inventory scale 20 50 82 113 25 290 6.9% 17.2% 28.3% 39% 8.6% 100% 0 50 100 150 200 250 300 350 mild mood disturbance borderline clinical depression moderate depression severe depression extreme depression total frequency of bdi scale frequency percent lmrj volume 4 issue 01 18 | p a g e figure 2: showing the frequency of sati scale discussion the results of our study showed a considerable level of anxiety and depression in parents raising children with intellectual disability and more than 40% showed a level of distress higher than the normal level. the results of the study demonstrates that a considerable number of parents of such children suffer from undiagnosed and untreated mental illnesses. according to previous research, the rate of mental health issues among disabled children's parents range from 32 to 89 percent (18, 19). our study's high prevalence rate is consistent with the previously reported undiagnosed distress and mental health issues of parents. the situation gets even worse due to the lack of emotional and technical support provided by health facilities in pakistan. especially given the scarcity of trained mental health care providers in this country. the importance of health care providers addressing mental health issues of parents having intellectually compromised children is highlighted by this finding. the high prevalence found in this study is consistent with existing literature. our findings are lower than those reported in kenya, where a prevalence rate of 79 percent has been reported (20). differences in data collection instruments could be a reason for this discrepancy. the bdi was used in our study, which is a self-report proforma with a chance of misinterpretation of the feelings and a risk of reporting bias. in terms of social demographics, many of the study participants were in their thirties. this is primarily due to the family system in our country where people normally get married in their twenties or early thirties and have children during the respective age range; similar findings in relation to age have been previously reported (17, 21). there were far more women in this study than men. it is again related to the family unit design in our country where women generally take a role as primary caregivers for children and in case of separation and divorce mothers continue to take charge of the growing child(22). husbands may distance themselves from the disabled child in some cases, and in certain situations mothers may be blamed for having the disabled child (23). even if other caregivers from the extended family support in child care, the mother is the one with highest responsibility. it is unquestionably critical to implement programs that benefit women in particular and train them to care for their children appropriately. designing 7% 11% 39% 43% frequency of sati not at all little anxiety somewhat anxiety very much anxiety lmrj volume 4 issue 01 19 | p a g e and facilitating psychological interventions that address issues focusing mothers of such children particularly. a considerable number of participants in this study were jobless, and a high proportion belonged to a low socioeconomic class. there has been a well-established association reported between a child's disability and social status of the parents (24). it is also seen in our sample too. this said relationship has multiple factors in relation to joblessness and poverty. this can jeopardize mothers' health and also related to late provision of perinatal services. the poverty has association with low birth weight and birth asphyxia, which in turn have established causal relationships with intellectual disability in children. among families living with a disabled child, up to 88 percent of caregivers find it difficult to meet the basic needs of their disabled child (25). families in mardan who were from a higher socioeconomic class, with educated parents, and received social support had less psychological distress, according to our research. these factors are associated with the economic situation of parents included in our study. despite being somewhat rural, the population of mardan is more educated, and as a result, people in mardan will have better livelihoods because of better employment. people with a higher socioeconomic status and educated parents are more likely to seek and receive better material and psychological support, according to studies (26, 27). in this study, a high perceived responsibility of care for the child was linked to a higher level of stress and anxiety, most likely as a result of being a single parent. this may be due to reduced informal sources of support (i.e., friends, relatives and social support groups), which have shown to reduce stress in caregivers of disabled children (28-31). high stress level has been shown to be inversely proportional to the level of confidence in managing such a child. this is in line with previous reported literature, which has found that less confidence level reduces parental self-efficacy in child management, putting parents and their families under stress (32, 33). conclusion parents raising intellectually disabled children in mardan face a significant psychological burden. residence in mardan city, low socioeconomic status, understanding of a child's disability, lack of confidence and training, burden of care, and limited social and psychological support are all associated with this high stress level. in mardan, parents of children with intellectual disabilities require contextualized psychosocial interventions. financial difficulties had an effect on the level of depression and anxiety as well. depression and anxiety levels were found to be higher in facing negative societal attitudes. references 1. dave d ms, tiwari d, parmar m, gedan s, patel v. study of anxiety and, dent dicoidcjrm, 2017;2(1):8–13 s. 2. schalock rl lr, shogren ka. the renaming of mental, disability. rutcttti, 2007;45(2):116–24. idd. 3. mung'ala-odera v mr, njuguna p, mturi n, alcock kj, newton cr., in parfondai, 2006;35(3):683–8. clirkije. 4. dykens em fm, taylor j, lambert w, miodrag n. reducing distress in, trial. mocwaaodar, 2014;134(2):54–63 p. 5. mbugua mn km, ndetei dm. the prevalence of depression among, in fcocwidiars, 2011;2011 kijfm. lmrj volume 4 issue 01 20 | p a g e 6. fido, a. and saad, s. (2013) psychological effects of parenting children with autism prospective study in kuwait. open journal of psychiatry, 3, 5-10. doi: 10.4236/ojpsych.2013.32a002.7. disabled a-kmphomcfm, 2007;12(4):312–7. ciqn. 8. cuzzocrea f lr, westh f. family and parental functioning in parents, 2013;65(3):271–87. odcnp. 9. santamaria f cf, gugliandolo m, larcan r. marital satisfaction and, attribution style in parents of children with autism spectrum disorder d, 2012;15(1):19–37 san-dclsd. 10. green, s.e., darling, r.b. and wilbers, l. (2013), "has the parent experience changed over time? a meta-analysis of qualitative studies of parents of children with disabilities from 1960 to 2012", disability and intersecting statuses (research in social science and disability, vol. 7), emerald group publishing limited, bingley, pp. 97-168. https://doi.org/10.1108/s14793547(2013)0000007007. 11. zare, najmeh and ravanipour, maryam and bahreini, masoud and motamed, niloofar and hatami, gissoo and nemati, hamid (2017) effect of a self-management empowerment program on anger and social isolation of mothers of children with cerebral palsy: a randomized controlled clinical trial. evidence based care, 7 (3). pp. 35-44. 12. fido, a. and saad, s. (2013) psychological effects of parenting children with autism prospective study in kuwait. open journal of psychiatry, 3, 5-10. doi: 10.4236/ojpsych.2013.32a002.7. disabled a-kmphomcfm, 2007;12(4):312–7. ciqn. 13. nora choque olsson, pernilla juth, emma högberg ragnarsson, tobias lundgren, markus jansson-fröjmark, thomas parling, treatment satisfaction with cognitive-behavioral therapy among children and adolescents with anxiety and depression: a systematic review and metasynthesis, journal of behavioral and cognitive therapy, volume 31, issue 2, 2021, pages 147191,issn 2589-9791, https://doi.org/10.1016/j.jbct.2020.10.006. 14. merkaj v km, simaku a. symptoms of stress, depression and anxiety, developing bpoacapot, 2013;2(2):345 ca. 15. zeng y zy, lin j. perceived burden and quality of life in chinese, j copwsmiapai, 2016;111 prv. 16. baker bl, blacher j, crnic ka, edelbrock c. behavior problems and parenting stress in families of three-year-old children with and without developmental delays. am j ment retard 2002;107:433–444. 17. omran ar. the epidemiologic transition: a theory of the epidemiology of population change. milbank q. 2005;83(4):731–57. 18. mbugua mn km, ndetei dm. the prevalence of depression among family caregivers of children with intellectual disability in a rural setting in kenya. int j fam med. 2011;2011. 19. azeem mw di, shah s, cheema ma, asmat a, akbar m, et al. anxiety and depression among parents of children with intellectual disability in pakistan. j can acad child adolesc psychiatry. 2013;22(4):290. 20. dave d ms, tiwari d, parmar m, gedan s, patel v. study of anxiety and depression in caregivers of intellectually disabled children. j res med den sci. 2014;2(1):8–13. 21. sanders jl, morgan sb. family stress and adjustment as perceived by parents of children with autism or down syndrome: implications for intervention. child family behav ther. 1997;19(4):15–32. http://dx.doi.org/10.4236/ojpsych.2013.32a002 https://www.emerald.com/insight/search?q=sara%20e.%20green https://www.emerald.com/insight/search?q=rosalyn%20benjamin%20darling https://www.emerald.com/insight/search?q=loren%20wilbers https://doi.org/10.1108/s1479-3547(2013)0000007007 https://doi.org/10.1108/s1479-3547(2013)0000007007 http://dx.doi.org/10.4236/ojpsych.2013.32a002 lmrj volume 4 issue 01 21 | p a g e 22. hartley op ba, ddamulira m, chavuta a. how do carers of disabled children cope? the ugandan perspective. child care health dev. 2005;31(2):167 –80. 23. lwanga-ntale c. chronic poverty and disability in uganda. ithaca: cornell university ilr school; 2003. 33. groce n km, lang r, train j. disability and poverty: the need for a more nuanced understanding of implications for development policy and practice. third world q. 2011;32(8):1493 –513. . 24. groce n km, lang r, train j. disability and poverty: the need for a more, and nuoifdp, 2011;32(8):1493 ptwq, –513. 25. acpf. the african report on children with disabilities: promising starts and persisting challenges. addis ababa: the african child policy forum (acpf); 2014. 26. sharby n. health and behavior, the interplay of biological, behavioral and societal influences. j phys ther educ. 2005;19(2):71. 27. pellmar tc bej, baird ma. health and behavior: the interplay of, biological b, and social influences: summary of an institute of, 2002;16(4):206 mrajhp, –19. 28. teri l. the use of the beck depression inventory with adolescents. j abnorm child psychol. 1982;10(2):277–84. 29. hastings r, beck a. practitioner review: stress intervention for parents of children with intellectual disabilities. j child psychol psychiatry. 2004:1338 –49. 30. weiss ja sa, diamond t. parent stress adaptive functioning of, 2003;10:129 iwddjdd, –35. 31. webster-stratton c hmcpalos, competence in head start children: prevalence p, and, 1998;1:101 arfccfpr, –24. 32. pakenham ki sk, samios c. finding meaning in parenting a child, finding. wascosmab, 2004;25(3):245 rdd, –64. 33. sofronoff k, farbotko m. the effectiveness of parent management training to increase selfefficacy in parents of children with asperger syndrome. autism. 2002;6(3):271 –86. type of the paper (article lmrj volume 4 issue 01 33 | p a g e research article right versus left colon cancerare they distinct entities? fayaz hussain mangi1, jawaid naeem qureshi2 1department of oncology, nimra cancer hospital jamshoro, pakistan, 2department of surgery, indus medical college, tando mohammad khan, sindh, pakistan abstract colon cancer is among the most commonly occurring cancers globally and is linked with a poor prognosis. the incidence and prevalence of cancer is expected to rise more in the upcoming years. right-sided colon cancer reportedly related with poorer survival as compared to the left-sided cancer. this study was conducted to compare both-sided cancers in the pakistani population. a retrospective analysis of the case files was conducted, including 119 colon cancer patients (i.e. right colon cancer=41, left colon cancer=78). left-sided colon cancer showed a lower grade and less rate of metastases. the results showed no significant influence of sidedness on survival outcome, though there was a non-significance difference in favor of right colon cancer. further studies are required to explore biological differences in cancers arising from both sides of colon. key words: colon cancer, clinical outcome, right side versus left side introduction colon cancer is among the most commonly occurring cancers around the globe, with a poor prognosis in a majority of patients (1). anatomically colon and rectum are designed in such a pattern that a large mass can be accommodated for a long time without presenting any specific symptoms. thus, colon cancer patients are likely to be diagnosed at a late stage. the adult colon is 5 feet long, divided into different sections. the right colon starts with the cecum as first part, then ascending colon, hepatic flexure (under liver where colon makes a turn), then continues as the transverse colon. the middle of the transverse colon demarcates the right and left colon. therefore, the left half of the transverse colon, splenic flexure, descending colon, and sigmoid colon make the right colon. the rectum is the last part in continuation with the sigmoid colon and ends up with the anal canal. it is suggested that the prevalence of the colon cancer is higher on the left side as compared to the right side (2). the available literature suggests the influence of colon cancer on clinical outcomes where colon cancer on left side demonstrates better overall survival. in advanced disease, the survival was not influenced by the side of the tumor (3). similarly, results from the aio krk-0104 trial suggested that the left-sided colon was associated with more favorable survival. however, the influence was associated with kras mutations, while no influence was seen without taking kras into account (4). the ncic co.17 trial included metastatic colon cancer and reported that survival in metastatic colon cancer is not influenced by the side of the primary tumor (5). data also suggested variation in the biological characteristics of colon cancer depending on the location of cancer (6). thus the survival difference might have multifactorial influencers from essential characteristics to more complex molecular mechanisms. correspondence: jawaid naeem qureshi department of surgery indus medical college, tando mohammad khan, pakistan email: drjnq@hotmail.com doi: 10.38106/lmrj.2022.4.106 received: 14.01.2022 accepted: 15. 03..2022 published: 31. 03.2022 lmrj volume 4 issue 1 34 | p a g e the right-sided colon cancer presents with advanced stage, thus being associated with poorer survival than the left colon (7). there has been a consideration that the right and left colon might be separate entities. therefore, this study was conducted to compare basic characteristics of the colon cancer developing on right and left sides of the colon. methods a total of 119 colon cancer patients were diagnosed and treated during ten years (between 20082018) at nimra hospital, and their complete clinical information was available. out of these, 41 were right-sided colon (i.e, cecum, ascending colon, and right half of the transverse colon and 78 were left-sided colon (i.e, left half of transverse colon, descending colon, and sigmoid colon) were identified from database in recruited in this study. all the patients had surgery after diagnosis or underwent emergency surgery, or in some inoperable cases, only a biopsy was taken. the data were retrospectively collected from case files. basic histopathological parameters, including primary site, tumor size, metastases status, and histological grades, were recorded. histological grade was defined as well-differentiated as grade i, intermediately differentiated as grade ii, and poorly differentiated as grade iii tumors. demographic characteristics and basic histological characteristics of right sided colon cancer were compared with that of the left-sided colon cancer. survival was calculated as the time from date of diagnosis to the date of the last follow-up or death and both sides were compared. statistical package for social sciences (spss version 24.0) was used for data collection and analysis. a comparison was made using the chi-squared test, and the kaplanmeier method was used to compare survival between right and left colon cancer. a p-value <0.05 was considered significant. results the patients (n=119) with complete clinical information available from case files, including 41 right colon and 78 from the left colon were analyzed in this study. out of which 30.8% of males while 38.9% were females had right-sided colon cancer. similarly, among left-sided colon cancer, 69.2% were males, and 61.1% were females (figure 1). on right-sided colon cancer, 19.1% were negative for lymph node metastasis, and 30.8% of left sided had lymph node metastases. five patients (14.3%) and two (2.6%) were presented with systemic metastases on the right and left-sided colon cancer respectively. histological grade distribution among right and left colon are shown in figure 2. median survival for right-sided colon cancer was 30 months, while 25 months for the left-sided colon. there was no significant difference in the survival of both sides (figure 3). figure 1. association of sidedness of colon cancer with gender figuer2. association of sidedness of colon cancer with histological grade lmrj volume 4 issue 1 35 | p a g e figure 3: colon cancer specific survivalright sided versus left sided discussion the study showed higher rate of left-sided colon cancer in males and presented with a more favorable histological grade. however, the survival difference did not reach a significant level. left-sided colon cancer reportedly shows better survival in the previously conducted studies. the difference in survival appears to be influenced by biology, which differs according to the location. previously reported data suggest that colon cancer in the pakistani population is associated with a poor prognosis showing shorter survival(8). biology is also aggressive in the pakistani population(8). previously reported studies have suggested that left-sided colon cancer enjoyed better survival, however, this may not be entirely related to the side, but this might influence the development of symptoms. the left-sided colon cancer is nearer to the anal canal; thus, the passing of bloody stool and change in bowl habits develop earlier than the right-sided colon. obstruction and metastases were more common on the right side, which is most likely attributed to the delay in diagnosis. cecum has the largest diameter in the entire colon; thus, it can accommodate a large tumor; therefore, the changes of advanced stage at diagnosis are highest. john m creasy et al. studied 907(3) colorectal cancer patients. they followed them up for 11 years left-sided colon cancer patients showed better overall survival, but there was no significant difference in the disease-specific outcomes. a previously reported study showed that the right-sided colon cancers were significantly more extensive and poorly differentiated than the left colon cancer(9). the same study said that right-sided colon cancer had poor overall and colorectal cancer-specific survival(9). in our study, the survival of both sides was poor, and the sample was even smaller in right-sided colon cancer; thus, it could not reach a significant level. a randomized controlled trial was conducted, including 69 patients, out of which 52 proved to have ras wild-type metastatic cancer; out of these 84% had left sided disease(10). though the trial concluded that the sidedness was influencing the disease outcome, actually the mutation was influencing, and wild-type ras was more prominent on left-sided cancer and showed earlier shrinkage of the tumor and better progression-free survival. in contrast, post-hoc analysis of the optimox3 dream phase iii study showed better survival in left-sided metastatic colorectal cancer irrespective of kras status (11). lmrj volume 4 issue 1 36 | p a g e the results of the aio krk-0104 trial were suggestive of the same finding as reported in other studies where left-sided colon cancer achieved a favorable survival outcome compared to rightsided colon cancer. kras mutation and the sidedness of colon cancer were significant factors influencing survival outcomes (12). yet another study looked at the influence of the primary tumor resection and compared both sides of the colon, and showed no significant difference in survival if the primary tumor was resected (13). the spanish ttd trial compared kras wild type right-sided colon demonstrated lower efficacy than the left-sided colon cancer (14). this was a single center-based study where pathological reports were retrieved from the same laboratory using the same definitions of the parameters. all patients were treated using the same guidelines at any given time. however, the study's retrospective nature and a small sample size are considered as the study's limitation. conclusion this study showed a non-significant difference in the pathological parameters and survival of colon cancer arising from right and left sides. however, cancer arising from right side of the colon showed a lower rate of occurrence, more undifferentiated tumours and inferior survival as compared to the left-sided colon cancer. further large-scale prospective studies are required to explore the biological differences in the sidedness of the colon cancers. conflict of interest all the authors declared no conflict of interest. funding no funding was received for this project references 1. globocan [internet]. 2020. available from: https://www.uicc.org/news/globocan-2020-newglobal-cancer-data#:~:text=globocan 2020 is an online,for all cancer sites combined. 2. logan rfa, patnick j, nickerson c, coleman l, rutter md, von wagner c. outcomes of the bowel cancer screening programme (bcsp) in england after the first 1 million tests. gut [internet]. 2012 oct;61(10):1439–46. available from: https://gut.bmj.com/lookup/doi/10.1136/gutjnl-2011-300843 3. creasy jm, sadot e, koerkamp bg, chou jf, gonen m, kemeny ne, et al. the impact of primary tumor location on long-term survival in patients undergoing hepatic resection for metastatic colon cancer. ann surg oncol [internet]. 2018 feb 27;25(2):431–8. available from: http://link.springer.com/10.1245/s10434-017-6264-x 4. hegewisch-becker s, nöpel-dünnebacke s, hinke a, graeven u, reinacher-schick a, hertel j, et al. impact of primary tumour location and ras/braf mutational status in metastatic colorectal cancer treated with first-line regimens containing oxaliplatin and bevacizumab: prognostic factors from the aio krk0207 first-line and maintenance therapy trial. eur j cancer [internet]. 2018 sep;101:105–13. available from: https://linkinghub.elsevier.com/retrieve/pii/s0959804918309092 5. brulé sy, jonker dj, karapetis cs, o’callaghan cj, moore mj, wong r, et al. location of colon cancer (right-sided versus left-sided) as a prognostic factor and a predictor of benefit from lmrj volume 4 issue 1 37 | p a g e cetuximab in ncic co.17. eur j cancer [internet]. 2015 jul;51(11):1405–14. available from: https://linkinghub.elsevier.com/retrieve/pii/s0959804915002622 6. seligmann jf, elliott f, richman s, hemmings g, brown s, jacobs b, et al. clinical and molecular characteristics and treatment outcomes of advanced right-colon, left-colon and rectal cancers: data from 1180 patients in a phase iii trial of panitumumab with an extended biomarker panel. ann oncol [internet]. 2020 aug;31(8):1021–9. available from: https://linkinghub.elsevier.com/retrieve/pii/s0923753420397945 7. meguid ra, slidell mb, wolfgang cl, chang dc, ahuja n. is there a difference in survival between rightversus left-sided colon cancers? ann surg oncol [internet]. 2008 sep 12;15(9):2388–94. available from: http://link.springer.com/10.1245/s10434-008-0015-y 8. mangi fh, shaikh ta, soria d, waryah am, ujjan id, qureshi jn, et al. novel molecular classification of colorectal cancer and correlation with survival. saudi j biol sci [internet]. 2022 mar; available from: https://linkinghub.elsevier.com/retrieve/pii/s1319562x22001607 9. huang c-w, tsai h-l, huang m-y, huang c-m, yeh y-s, ma c-j, et al. different clinicopathologic features and favorable outcomes of patients with stage iii left-sided colon cancer. world j surg oncol [internet]. 2015 dec 28;13(1):257. available from: http://www.wjso.com/content/13/1/257 10. köhne c-h, karthaus m, mineur l, thaler j, van den eynde m, gallego j, et al. impact of primary tumour location and early tumour shrinkage on outcomes in patients with ras wild-type metastatic colorectal cancer following first-line folfiri plus panitumumab. drugs r d [internet]. 2019 sep 12;19(3):267–75. available from: https://link.springer.com/10.1007/s40268-019-0278-8 11. chibaudel b, andré t, tournigand c, louvet c, benetkiewicz m, larsen ak, et al. understanding the prognostic value of primary tumor location and kras in metastatic colorectal cancer: a post hoc analysis of the optimox3 dream phase iii study. clin colorectal cancer [internet]. 2020 sep;19(3):200-208.e1. available from: https://linkinghub.elsevier.com/retrieve/pii/s1533002820300359 12. von einem jc, heinemann v, von weikersthal lf, vehling-kaiser u, stauch m, hass hg, et al. left-sided primary tumors are associated with favorable prognosis in patients with kras codon 12/13 wild-type metastatic colorectal cancer treated with cetuximab plus chemotherapy: an analysis of the aio krk-0104 trial. j cancer res clin oncol [internet]. 2014 sep 10;140(9):1607–14. available from: http://link.springer.com/10.1007/s00432-014-1678-3 13. van der kruijssen dew, van rooijen kl, kurk sa, de wilt jhw, punt cja, vink gr, et al. role of up-front primary tumor resection and tumor sidedness in the survival of synchronous metastatic colon cancer patients. dig surg [internet]. 2021;38(4):283–9. available from: https://www.karger.com/article/fulltext/517477 14. benavides m, díaz-rubio e, carrato a, abad a, guillén c, garcia-alfonso p, et al. tumour location and efficacy of first-line egfr inhibitors in kras/ras wild-type metastatic colorectal cancer: retrospective analyses of two phase ii randomised spanish ttd trials. esmo open [internet]. 2019;4(6):e000599. available from: http://www.ncbi.nlm.nih.gov/pubmed/31803504 type of the paper (article lmrj volume 4 issue 02 55 | p a g e editorial induced pluripotent stem cells for development of cancer immunotherapya viable idea for less toxic treatment binafsha manzoor syed, phd liaquat university of medical & health sciences, jamshoro, pakistan, editor in chiefliaquat medical research journal (lmrj) abstract induced pluripotent stem cells were introduced by prof. yamanaka and now being studied in all stem cells related treatment methods. cancer immunotherapy is now part of targeted therapy and showing promising results, however the cost of treatment and tagged risk of side effects making it difficult for patients. thus use of induced pluripotent stem cells to grow into plasma cells and produce antibodies against cancer targets will be a breakthrough in cancer management key words: cancer immunotherapy, induced pluripotent stem cells, stem cell research introduction cancer has remained a deadly disease from the ancient period. the earliest reported information dates back to 3000 b.c. when edwin smith pyparus reported eight breast cancer cases and defined them as an ailment for which there was no treatment(1). following the establishment of first cancer hospital in france and second in great britain in 18th century, paved a way for organized data collection(1). during early 19th century the clinicians and scientists discovered that there are a number of factors which control the prognosis of the cancer (2–4). this discovery then resulted in exploration of treatment options including local therapy (ie surgery and radiotherapy) and systemic therapy (ie chemotherapy, endocrine therapy and immunotherapy). the developed countries have now moved towards the translational research where the treatment targets are discovered in the laboratory and are utilized in clinical practice to predict fate of the disease. as a result, cancer is now more manageable in the developed countries with much better prognosis. since the inception of the concept of precision medicine now more discoveries in the field of cancer sciences are also expected. cancer research in pakistan pakistan is still at the primitive stage of cancer research. according to the cancer statistics reported by world health organization project golobocon 2020 pakistan is having the highest incidence of breast cancer among asian countries same is the prevalence of some other forms of cancer too(5). our local data suggest very high prevalence of oral cancers in interior sindh contributing to 27% of all cancer reported in the region. although the incidence of many cancers is lower in pakistan as compared to the developed countries but the mortality is high(5). the major reason for the high mortality appears to be the lack of any national guidelines based on evidence based local research correspondence: prof. binafsha manzoor syed, medical research center, liaquat university of medical & health sciences, jamshoro, pakistan email: binafsha.syed@lumhs.edu.pk doi: 10.38106/lmrj.2022.4.2-01 received: 10.06.2022 accepted: 26. 06.2022 published: 30. 06.2022 mailto:binafsha.syed@lumhs.edu.pk lmrj volume 4 issue 02 56 | p a g e conducted on our own patients. it is essentially important to understand the genetics and molecular attributes of cancer cell/ tissues in our own society so that locally appropriate tailored treatment policies can be adopted. with the same token it would also be possible to produce medicines in pakistan well according to dominant cancer pattern. in future this will not only improve cancer management but will surely help in introducing more effective and economical cancer treatment options. cancer immunotherapy the immunotherapy (ie monoclonal antibodies) widely used in cancer therapeutics and showing great success in controlling the disease even at advance stage. first of its kind medicine in breast cancer was trastuzumab. however, the cost involved is too much on the family as well as pose great economic burden on the country. currently available immunotherapeutic drugs are being used not only in cancers but other diseases such as autoimmune disorders as well. anti-cancer vaccine development from induced pluripotent stem cells cancer antibodies are being produced against the identified targets in the cancer cells such as her2 receptor, egfr, vegf etc. these are being developed from animal sources, with chances of toxic effects and less efficacy. the stem cells on the other hand, have been used for organ generation and showing promising potential of great success in future. thus production of blood cells from stem cells will be an important landmark. these are re-programed adult cells to go into pluripotent stage and become plasma cells to produce antibodies(6). the technique was developed by prof. yamanaka, who won nobile prize for this achievement. this technique is absolutely amazing to revolutionize cancer treatment. the work is also underway to look at the potential of induced pluripotent stem cells in hematological disorders(7). there is limited work done on use of induced pluripotent cells to produce antibodies. though it is a novel idea of developing vaccine from induced pluripotent stem cells where adult b cells will be treated to go into pluripotent stage and then transform into plasma cells having potential of production of specific antibodies targeting cancer proteins. the research is needed for specific methods to develop these human monoclonal antibodies. this will provide precision medicine in its true sense and also reduce the number of side effects produced by humanized antibodies which are actually animal origin. figure 1: proposed plan for production of anti-cancer anti-bodies from induced pluripotent stem cells lmrj volume 4 issue 02 57 | p a g e references 1. bloom hjg, richardson ww, harries ej. natural history of untreated breast cancer (18051933). br med j. 1962;2(5299):213–21. 2. kwon j, eom ky, koo tr, kim bh, kang e, kim sw, et al. a prognostic model for patients with triple-negative breast cancer: importance of the modified nottingham prognostic index and age. j breast cancer. 2017;20(1):65–73. 3. syed bm, green ar, paish ec, soria d, garibaldi j, morgan l, et al. biology of primary breast cancer in older women treated by surgery: with correlation with long-term clinical outcome and comparison with their younger counterparts. br j cancer. 2013; 4. fayaz hussain mangi, jawaid naeem qureshi. validation of onco-assist survival prediction tool in stage i, ii and iiicolon cancer among asian patients. liaquat med res j [internet]. 2021 dec 31;3(4):107–11. available from: http://121.52.154.205/index.php/lmrj/article/view/808 5. globocan 2020: new global cancer data | uicc. 6. aboul-soud mam, alzahrani aj, mahmoud a. induced pluripotent stem cells (ipscs)—roles in regenerative therapies, disease modelling and drug screening. cells [internet]. 2021 sep 5;10(9):2319. available from: https://www.mdpi.com/2073-4409/10/9/2319 7. georgomanoli m, papapetrou ep. modeling blood diseases with human induced pluripotent stem cells. dis model mech [internet]. 2019 jun 1;12(6). available from: https://journals.biologists.com/dmm/article/12/6/dmm039321/3333/modeling-blood-diseases-with-human-induced type of the paper (article lmrj volume 4 issue 02 80 | p a g e original article analysis of pattern of abo blood groups in pediatric diabetic patients – an observational study nimra javed1, shazia yasin1, javeria fatima1, tehmina nafees sonia khan2, tooba fateen1, nazish saqlain1, saima farhan1 1university of child health sciences and the children’s’ hospital, lahore, pakistan, 2sir syed college of medical sciences for girls, karachi, pakistan abstract diabetes mellitus (dm) is the most frequently occurring metabolic disorder, caused by inadequacy in secretion of insulin or malfunction leading to chronic hyperglycemia. well-established corroborations have been reported in the literature suggesting association of abo blood group with dm. the available literature focuses on adult population, with limited information of said association in children. thus this study was aimed to determine the association of abo blood group with diabetes in pediatric patients having confirmed diagnosis. this was a comparative cross sectional study conducted from october 2021-january 2022 at endocrinology ward, children hospital lahore (chl), pakistan. the study was approved by the local research ethics committee of chl and conducted according to the declaration of helsinki 2000. blood grouping was done by forward and reverse methods. a total of 25 patients, including 18 males and 7 females were included. frequency of blood group b (n=10;40%) was highest followed by blood group o (n=4;16%), a blood group (n=3;12%), and ab (n=1;4%) in males. in females, the blood group ab (n=3;12%) has the highest frequency followed by o (n=2;8%). blood group a (n=1;4%) and b (n=1;4%) had the same frequency among female diabetic patients. key words: diabetes mellitus, abo blood groups, endocrinology, type i diabetes, pediatric age group. introduction diabetes mellitus (dm) is a chronic disorder characterized by hyperglycemias as a result of insulin dysfunction or reduced release or development of insulin resistance at cellular level. diabetes mellitus may occur due to disturbed metabolism of carbohydrates, protein and fat which as a result of deficiency in insulin secretion or insulin malfunction or in combination (1). pathogenesis of diabetes mellitus has a very wide range from pancreatic cell destruction due to autoimmune disorder (2). diabetes mellitus is comprised of two types including insulin-dependent diabetes mellitus (iddm or type i), which results from the reduced insulin production, and non-insulin-dependent diabetes mellitus (niddm or type 2) related to the insulin resistance at the peripheral level, where insulin level remains normal or sometimes even enhanced but unable to maintain blood glucose levels (3). in type 1 diabetes mellitus the insulin-making cells in the pancreas are destroyed by the immune system. the cell of the pancreas which produce insulin are called beta cells (4). this type of diabetes correspondence: dr. tehmina nafees, sonia khan assistant professor department of pathology sir syed college of medical sciences, karachi email: dr_tehmina@yahoo.com doi: 10.38106/lmrj.2022.4.2-06 received: 29.03.2022 accepted: 26. 06.2022 published: 30. 06.2022 mailto:dr_tehmina@yahoo.com mailto:dr_tehmina@yahoo.com lmrj volume 4 issue 02 81 | p a g e mellitus is more common in children and young people so it has another name called juvenile diabetes mellitus (5). type 2 dm is the most frequently reported type accounting for ~95% of all diabetic cases (6). while dm type i is commonly seen in pediatric population. on the other hand blood grouping is determined by the presence of genetic pattern inherited from mother and father. there are two fundamental systems used for blood grouping, that is abo system based on a and b antigen i.e. a blood group: having a antigen on red blood cells (rbc), b blood group suggest b antigen on rbc, ab blood group having both a and b antigen while o blood group have none. it is interesting that the blood group having a antigen will have anti-b antibodies and vice versa. the rh grouping determines the presence of rh antigen and divides each blood group of abo system into two groups; positive and negative. blood grouping is a genetic determination, thus there is some disease preponderance, where some diseases are found more in one blood group than the other. given the nature of dm in children this study was conducted to evaluated the pattern of abo blood grouping pediatric children. methods this was a comparative cross-sectional study, conducted from october 2021 to january 2022 at endocrinology ward, children hospital lahore (chl), pakistan. the study was approved by the ethical committee of chl and performed according to the declaration of helsinki 2000. total 25 diagnosed cases of diabetes mellitus and same number for healthy (non diabetic) controls with age range 1 to 18years were included. the samples were collected through convenient sampling from the endocrinology ward of children hospital lahore. for assessment of blood group whole blood was drawn in an edta vial (lavender top) and a heparinized serum vial (yellow top). both forward and reverse grouping was performed in the blood bank following standard procedure (7). statistical package for the social sciences (spss) version 23 was used for the analysis of the data. frequencies were evaluated and chi-square test was used for the association between variables. a pvalue was set at 0.05, and <0.05 was considered significant. results total 25 patients and equal number of healthy controls’ samples were analyzed including 7 females in the study group and 18 males, while in control group 16 were males and 9 were females. the blood group b (n=11; 44%) followed by blood group o (n=6; 24%) were high in patients with diabetes mellitus. while blood group a and ab were shown to have equal frequencies (n=4; 16%). among the healthy controls, the frequency of blood group b (11; 44%) was the highest followed by blood group a (9; 36%) and o (5; 20%). the least frequency among all the healthy control showed by blood group ab (0; 0%), as shown in table 1. there was a significant difference in the distribution of a and o groups (p-value <0.001). table 1. comparison of abo blood groups in diabetic pediatric patients and healthy controls blood group controls n(%) cases n(%) p-value a 9(36) 4(16) <0.001 b 11(44) 11(44) 0.42 ab 0 4(16) 0.09 o 5(20) 6(24) <0.001 lmrj volume 4 issue 02 82 | p a g e discussion populations showing genetic association with diabetes mellitus are crossbreed populations comprised of the recent parenteral populations mixing in addition to the ancestral mixing. the available literature has conflicting data regarding association of blood grouping and dm, showing positive association in some studies and no significant in others. b blood group has shown more association among all blood groups. the study on the association of the abo blood group with diabetes mellitus in bangladesh shows that there is no significant association between blood group distribution and diabetes mellitus, in which they studied 2,312 patient samples and 8,936 control samples (8). on the contrary, this study has shown the frequency of blood group b is highest among all, and o and ab blood groups are least. further investigation and confirmation of my studies can be done by using a larger sample size. in india, the study on the association of the abo blood group has also been carried out on 511 patients with different racial distribution and 475 healthy control samples from the same geographical and socioeconomic status with the patients provided the exclusion of diseased condition (9). another research study demonstrated that the frequency of a and o blood group is higher in healthy controls than in diabetic patients but statistical significance was still absent. for controls, the statistical significance was present in terms of racial distribution but still absent in diabetic patients (10). in current study, the prevalent blood group was b (44%) both among diabetic patients and healthy controls even having the same frequencies but there was no statistical significance pvalue <0.05. ab blood group had the least frequency both in patients and healthy controls. however, the blood group a and o have shown lower frequencies among diabetic patients 16% and 24% respectively, and the same for ab which might be protective against dm. in this study the association of gender and blood groups of both patients and control samples have also been studied, which shown a significant association in chi-square test. the frequency of male (18;72%) among 25 diabetic patients is higher than females (7;28%) so, male are at higher risk of acquiring diabetes mellitus then females. further, among males, those having blood group b (10;40%) are at risk because its frequency is highest among all others. among female patients ab blood group has highest percentage (3;12%) so, in females the ab blood group is at higher risk than others. in normal control sample the frequency of male (16;64%) is higher than female (9;36%) but still lower than in patients which is 72%. these results confirm the higher association of male with diabetes mellitus. however, due to limitations of time and resources and small sample size this study has not been conducted at broader level. further investigation on this association should be done. conclusion the results obtained from this study have shown that there is no significant association of abo blood groups with diabetes mellitus but the frequency of blood group b is highest among all and lowest frequency of o and ab shown the lower risk of diabetes mellitus among these blood groups. other results have shown the significant association of gender with diabetes mellitus the higher percentage of male in diabetic patients than females. references 1. association ad. diagnosis and classification of diabetes mellitus. diabetes care. 2009;32(supplement_1):s62-s7. 2. kadhem rc, farawn kd, al-baaj mla. association of abo blood groups with diabetes mellitus. journal of global pharma technology. 2018;10:192-5. lmrj volume 4 issue 02 83 | p a g e 3. ozougwu j, obimba k, belonwu c, unakalamba c. the pathogenesis and pathophysiology of type 1 and type 2 diabetes mellitus. j physiol pathophysiol. 2013;4(4):46-57. 4. dave sd, trivedi hl, chooramani sg, chandra t. management of type 1 diabetes mellitus using in vitro autologous adipose tissue trans-differentiated insulin-making cells. case reports. 2013;2013:bcr2013200226. 5. dimeglio la, evans-molina c, oram ra. type 1 diabetes. the lancet. 2018;391(10138):2449-62. 6. kamil m, al-jamal han, yusoff nm. association of abo blood groups with diabetes mellitus. libyan journal of medicine. 2010;5(1). 7. rudmann sv. textbook of blood banking and transfusion medicine: elsevier health sciences; 2005. 8. rahman m. non-association of abo blood groups with diabetes mellitus in bangladesh. bangladesh medical research council bulletin. 1976;2(2):144-6. 9. koley s. the distribution of the abo blood types in patients with diabetes mellitus. the anthropologist. 2008;10(2):129-32. 10. qureshi ma, bhatti r. frequency of abo blood groups among the diabetes mellitus type 2 patients. journal of the college of physicians and surgeons--pakistan: jcpsp. 2003;13(8):453-5. type of the paper (article lmrj volume 4 issue 02 58 | p a g e original article hyperprolactinemia in newly diagnosed breast cancer in younger (under 50 years) women jawaid naeem qureshi, k. altaf hussain talpur department of surgery, indus medical college, tando mohammad khan, pakistan abstract breast cancer is a common malignancy among women. there are a number of established risk factors for breast cancer in younger population. hyperprolactinemia is observed to be higher in breast cancer patients. however its presentation in younger (<50 years) women is not well understood. this study was conducted to describe serum prolactin level in newly diagnosed breast cancer patients presented with nipple discharge without any apparent other cause of hyperprolactinemia. the results showed high serum prolactin levels in all these patients. there was no significant correlation observed between serum prolactin and the age of the patients. it was concluded that breast cancer patients presenting with nipple discharge show varying degree of hyperprolactinemia. it requires further studies to explore if it has a causal relationship or it is a feature of breast cancer. key words: breast cancer, prolactin, hyperprolactinemia introduction. prolactin is an important hormone released from the pituitary gland and responsible for breast development, milk production and lactation. the hormone plays an important role in the breast development even in utero(1). on the other hand, breast cancer is the leading cancer in women and the rate is expected to rise more in future(2). pakistan has a rising trend of breast cancer in the younger population and associated with high mortality. the primary site of prolactin production is pituitary gland but breast tissue has also capability to produce prolactin locally. normal/ physiological rise in prolactin is seen in pregnant women and during lactation, advancing age also showed higher prolactin levels. hyperprolectinemia is reported to occur more commonly in females with a reported rate of 1% of population(3). most common cause of hyperprolectenemia is pituitary adenoma, additionally certain drugs and systemic diseases can also cause hyperprolectinemia(4). since, breast tissue has capability of local production of prolactin, thus rise in breast cancer could be local production with normal pituitary gland. there is an evidence of rise in prolactin levels in patients taking antipsychotic drugs, which in turn causes rise in the rate of pre-cancerous lesions(5). on the other hand there is an evidence that prolactin signaling pathway plays a role in breast cancer, thus paved a way for development of anti-prolactin anti-body(6). the prolactin receptor is reported to be overexpressed in breast cancers(7). however, prolactin pathway blockers couldn’t show promising results in controlling disease progression in metastatic breast cancers. previously reported studies correspondence: jawaid naeem qureshi, department of surgery, indus medical college, tando mohammad khan, pakistan email: drjnq@hotmail.com doi: 10.38106/lmrj.2022.4.2-02 received: 05.05.2022 accepted: 24. 06.2022 published: 30. 06.2022 lmrj volume 4 issue 02 59 | p a g e have shown association of raised serum prolactin level with advanced and metastatic breast cancer(8). given the rise in breast cancer incidence in pakistan and higher rate in younger patients it can be suspected that there are risk factors which need to be explored. from the available literature serum prolactin level in breast cancer in pre-menopausal women is least studied. thus this study was conducted to describe range of serum prolactin in newly diagnosed breast cancer patients presenting with nipple discharge. methods this was a descriptive cross-sectional study conducted from 20th july 2016 to 30th march 2022. during this period women under 50 years of age, diagnosed with breast cancer at the department of surgery, indus medical college, tando mohammad khan, pakistan were included. the study includes the women who presented with breast discharge with and without a clinically palpable lump in the breast. all these women had triple assessment for their discharge and serum prolactin levels were also assessed as a routine practice due to nipple discharge. these all patients were found to have a suspicious lump on ultrasound or mammogram and underwent biopsy to confirm the diagnosis of breast cancer. they all had mri done to rule out pituitary adenoma. pregnant and lactating mothers were excluded. women who were on any kind of medication were excluded. women with pituitary adenoma on mri were also excluded (n=3). the serum prolactin level was assessed from venous blood, within 4 hours of waking up by using immunoassay. the reference range of the laboratory was followed and females having serum prolactin level >30 ng/ml were considered as having hyperprolactinemia. they all had normal liver function test, urea and creatinine. data was collected and analysed by using statistical package for social sciences version 28.0. mean and standard deviation of the continuous variables were given. categorical data has been presented as frequency distribution. spearman correlation was applied to analyze association between age and serum prolactin levels. results a total of 27 women presented with nipple discharge and normal brain mri and underwent triple assessment to have a diagnosis of breast cancer. mean age of the patients was 40 years (range 29 to 50 years ±sd 4.81). five patients had a complaint of pain, 10 had discomfort and remaining (n=12) had no pain or discomfort. great majority (n=22) had green or red blood discharge from nipple (figure 1). underlying breast lump was present in all patients. nine patients did not complaint of any irregularity in their menstrual cycle and 15 patients reported delayed cycle. serum prolactin level was above normal reference range in all of these patients with mean levels at 276.67 (range 35.2570ng/ml, ±sd 163.93) ng/ml. there was no significant association of age and serum prolactin level found (p-value=0.57) (figure 2). lmrj volume 4 issue 02 60 | p a g e figure 1. pattern of color of discharge in women having hyperprolactinemia figure 2. scatter plot presenting correlation of age and serum prolactin levels discussion the study has shown raised serum prolactin level in women presenting with nipple discharge without having any obvious reason of hyperprolactinemia in pre-manopausal women. this is a complex pathway to understand as the raised prolactin is a cause of breast cancer or it’s a feature. both are equally possible. as there is evidence of local production of prolactin in breast tissue thus breast cancer might start producing more prolactin which in turn causes more progression thus a vicious circle of cancer cells and prolactin starts. however there is no evidence till date to comment on this theory. though there is evidence available suggesting association of raised serum prolactin levels in women with advanced breast cancer(8). on the other hand when it was reported to be associated with disease progression but the drugs (i.e. raloxifene) which controlled other hormones did not affect prolactin in pre-manopausal women(9). similar other studies have reported that prolactin is raised but not associated with disease specific clinical outcome neither it is associated with basic prognostic factors in breast cancer i.e. oestrogen and progesteron. these findings were interestingly reported after 10 years long term in naples lmrj volume 4 issue 02 61 | p a g e adjuvant (gun) study(10). another study was conducted to see the predictive significance of prolactin in breast cancer and bromocriptin was given but did not show any significant influence on disease outcome(11). the high serum level of prolactin has been reported to be linked with resistance to chemotherapy in advanced breast cancer(12). with the same reference, it was thought that the use of a combination of chemotherapy with anti-prolactin therapy with be beneficial and improves response. but the studies have shown contradicting results. some reported benefits of adding anti-prolactanemic therapy and others have shown no added benefit(11,13,14). the study has a small sample size is considered as a limitation. however study from a single centre is the strength of the study. conclusion the study concludes that the younger women presenting with breast cancer has shown high serum prolactin level. the serum prolactin is an important novel factor can be added to breast cancer risk assessment and early detection system. further large scale cohort studies are required to confirm these findings and established a role of serum prolactin in breast cancer. ethical consideration the data was collected as part of the routine departmental data collection. confidentiality of the patients was maintained. funding the study was conducted was part of routine data collection within the department, no additional funds required. references 1. bonneterre j, peyrat jp, beuscart r, demaille a. biological and clinical aspects of prolactin receptors (prl-r) in human breast cancer. j steroid biochem mol biol [internet]. 1990 dec;37(6):977–81. available from: https://linkinghub.elsevier.com/retrieve/pii/096007609090453r 2. globocan 2020: new global cancer data | uicc. 3. vilar l, vilar cf, lyra r, freitas m da c. pitfalls in the diagnostic evaluation of hyperprolactinemia. neuroendocrinology [internet]. 2019;109(1):7–19. available from: https://www.karger.com/article/fulltext/499694 4. thapa s, bhusal k. hyperprolactinemia [internet]. statpearls. 2022. available from: http://www.ncbi.nlm.nih.gov/pubmed/30726016 5. rahman t, patrick c, ma c, nicol ge, reynolds cf, mulsant bh, et al. prolactin and estrogen levels in postmenopausal women receiving aripiprazole augmentation treatment for depression. j clin psychopharmacol [internet]. 2021 jan;41(1):31–5. available from: https://journals.lww.com/10.1097/jcp.0000000000001335 6. agarwal n, machiels j-p, suárez c, lewis n, higgins m, wisinski k, et al. phase i study of the prolactin receptor antagonist lfa102 in metastatic breast and castration-resistant prostate cancer. oncologist [internet]. 2016 may 1;21(5):535-536i. available from: lmrj volume 4 issue 02 62 | p a g e https://academic.oup.com/oncolo/article/21/5/535/6401576 7. costa r, santa-maria ca, scholtens dm, jain s, flaum l, gradishar wj, et al. a pilot study of cabergoline for the treatment of metastatic breast cancer. breast cancer res treat [internet]. 2017 oct 3;165(3):585–92. available from: http://link.springer.com/10.1007/s10549-017-4370-x 8. mujagić z, mujagić h. importance of serum prolactin determination in metastatic breast cancer patients. croat med j [internet]. 2004 apr;45(2):176–80. available from: http://www.ncbi.nlm.nih.gov/pubmed/15103755 9. faupel-badger jm, prindiville sa, venzon d, vonderhaar bk, zujewski ja, eng-wong j. effects of raloxifene on circulating prolactin and estradiol levels in premenopausal women at high risk for developing breast cancer. cancer epidemiol biomarkers prev [internet]. 2006 jun 1;15(6):1153–8. available from: https://aacrjournals.org/cebp/article/15/6/1153/284580/effects-of-raloxifene-on-circulatingprolactin-and 10. de placido s, gallo c, perrone f, marinelli a, pagliarulo c, carlomagno c, et al. prolactin receptor does not correlate with oestrogen and progesterone receptors in primary breast cancer and lacks prognostic significance. ten year results of the naples adjuvant (gun) study. br j cancer [internet]. 1990 oct;62(4):643–6. available from: http://www.nature.com/articles/bjc1990346 11. peyrat j., vennin p, bonneterre j, hecquet b, vandewalle b, kelly p., et al. effect of bromocriptin treatment on prolactin and steroid receptor levels in human breast cancer. eur j cancer clin oncol [internet]. 1984 nov;20(11):1363–7. available from: https://linkinghub.elsevier.com/retrieve/pii/0277537984900543 12. lissoni p, vaghi m, ardizzoia a, fumagalli e, tancini g, gardani g, et al. efficacy of monochemotherapy with docetaxel (taxotere) in relation to prolactin secretion in heavily pretreated metastatic breast cancer. neuro endocrinol lett [internet]. 2001;22(1):27–9. available from: http://www.ncbi.nlm.nih.gov/pubmed/11335876 13. frontini l, lissoni p, vaghi m, perego ms, pescia s, ardizzoia a, et al. enhancement of the efficacy of weekly low-dose taxotere by the long acting anti-prolactinemic drug cabergoline in pretreated metastatic breast cancer. anticancer res [internet]. 24(6):4223–6. available from: http://www.ncbi.nlm.nih.gov/pubmed/15736476 14. fentiman is, chaudary ma, wang dy, brame k, camplhjohn rs, millis rr. perioperative bromocriptine adjuvant treatment for operable breast cancer. lancet [internet]. 1988 mar;331(8586):609–10. available from: https://linkinghub.elsevier.com/retrieve/pii/s0140673688914134 type of the paper (article lmrj volume 4 issue 02 71 | p a g e original article night time splinting without surgery for dupuytren’s contracture – a successful case series of elderly diabetic patients asim niaz channa1, sana shahzad2, faisal jamil3 1sindh employee’s social security institute, sindh, pakistan, 2st.helen’s and knowsley nhs trust, united kingdom, 3medway maritime hospital, gillingham, united kingdom abstract dupuytren’s contracture is a musculoskeletal deformity mainly involves fingers of the hands. elderly diabetic patients more frequently suffer from the problem. currently available options of treatment include needling, clostridium histolyticum injection and surgery. following surgery patients are supposed to apply splint to correct the contracture. this study was conducted on early stage contracture, including 18 patients. all were advised to massage the area of contracture in the morning and at night followed by application of splint at night time. 16 patients showed complete recovery with average duration of 3.5 weeks. none of them has recurrence after three weeks of follow-up. the study concludes that the early stage contracture can be successfully treated by conservative measures. key words: dupuytren’s contracture, elderly diabetics, hand deformity introduction dupuytren’s contracture is a musculoskeletal deformity affecting hands. most commonly involving ring and little fingers(1). the contracture occurs in the palmer tendons causing contracture with presence of thickening and nodule(2). it does not cause pain and it is reported to be slow progressive. since it commonly involves ring and little fingers thus it does not cause a major deformity and patients continue to do their routine chores. the disease risk increases with advancing age and has significant association with diabetes. as reported the incidence under 50 years is around 7% which approaches 40% at the age of 70 years(3). it is clinically diagnosed on examination of the affected hand, where there is a nodule in the ligament causing contracture of the fingers(4). the treatment currently offered includes needling, where cord is punctured with the help of needle, enzyme injection with collagenase i.e. clostridium histolyticum to break the cord, then there is option of surgery(5). all of these are invasive options, thus patients had to wait to develop the disease at the stage where they accept invasive procedures. the patients coming at initial stage (without fixed contracture) of the disease are left with just management of the hand with physical therapy without any scientific evidence of its effectiveness. on the other hand with ageing population and improvement in health care facilities with development of orthopedic sub-specialty more people are coming with early disease where there is still need for non-invasive procedures and needling and surgery is not justified. therefore a pilot study was conducted on three patients initially where they were advised to have massage of warm oil and bed time splint application on the affected fingers. these patients showed complete reversal of the problem and the nodule dissolved. correspondence: asim niaz channa, sindh employee’s social security institute, pakistan email: niazasim@hotmail.com doi: 10.38106/lmrj.2022.4.204 received: 10.02.2022 accepted: 26. 06.2022 published: 30. 06.2022 lmrj volume 4 issue 02 72 | p a g e based on these preliminary findings this prospective study was conducted to see the effectiveness of bed time splinting to cure initial stage dupuytren’s contracture in elderly diabetic population. methods this is a prospective experimental study including 18 patients with early stage dupuytren’s contracture. the patients included were over 60 years of age with diabetes. the early stage dupuytren’s contracture was defined as deformity which has not become fixed, patient can straighten fingers with pressure, and there was no pain. figure 1 shows hand of an elderly women presented with contracture and included in this study. they presented to the sindh employees social security institution, hyderabad during the period between january 2015 and december 2021. they all were advised to have massage, mainly putting pressure (mild to moderate) on the site of the nodule, twice a day with warm oil. at night after massage they were advised to apply metal extension splint. they were asked to remove the splint in the morning, and massage as soon as the splint was removed. patients were followed up for two months on weekly basis. the data was collected on spss version 22. the time of the success of therapy was evaluated in weeks. the results were analysed as frequency distribution for categorical variables and mean and standard deviation for continuous variables. figure 1. image of dupuytren’s contracture in a female diabetic patient having ring finger contracture (image presented with permission and signed consent of the patient). results there were 18 patients presented with early stage dupuytyren’s contracture. mean age of the patients was 66.83 years (range 6177, ±sd =5.03). there were 12 females and 6 males. majority of the patients noticed the contracture within three months. initially was on and off and more recently it become constant. however they were able to straighten with pressure. ten patients ring finger involved, 2 had little finger and 6 had both ring and little fingers involved. lmrj volume 4 issue 02 73 | p a g e out of these patients 16 (88.9%) had reversed the contracture, while two patients required needling. mean duration of the successful recovery was 3.5 weeks (range 2-5 weeks). there was no recurrence reported after three months. discussion the study showed almost 90% success rate of non-invasive method of reversal of early stage dupuytren’s contracture in elderly diabetic population. the response to non invasive therapy was remarkable without any recurrence at short term. the dupuytren’s contracture is a fibroproliferative disease, commonly seen in the elderly people and diabetes is one of its risk factors(6). the treatment has options with needle injections, and surgery. all are reported to be associated with varying degree of complications(7). though percutaneous needle fasciotomy reported to be the safest and well tolerated but procedure is invasive in nature and reportedly 86% of recurrence with procedure repeated(7). the clostridium histolyticum treatment was associated with skin tearing in 11% of patients undergoing treatment had skin tearing(8). the risk of recurrence and repeated procedure was high with required repeated procedure or surgery within 6 weeks(9). though there is evidence of good response for `4-weeks intervention and maintenance of the response for more than 12 weeks has also been reported in studies exploring efficacy of clostridium histolyticum(10). another study which used collagenase injection followed by finger exercise and splint wearing at night showed promising results(10). however with this treatment bruising and edema was the most frequently observed complications(11). there was a randomized controlled trial dupuytren treatment effectiveness trial (effect) comparing three arms of treatment including clostridium histolyticum injection and limited fasciectomy in non-responsive cases, percutaneous needle fasciotomy and primary limited fasciotomy. the trail was planned and approved in 2018 and followed of 10 years is awaited(12). the study has small sample size and the selection criteria based on clinical assessment only. thus we consider this as a limitation. however the study opens up an era of first line conservative management for dupuytren’s contracture. conclusion this small scale prospective study presented high rate of success of massage with night time extension splint application with 88% cure rate. there was no recurrence during the period of study. further large scale randomized controlled trials are recommended for robust clinical guidelines. ethical consideration this was an institutional study approved by local ethics committee, all patients signed and informed consent. conflict of interest authors declare no conflict of interest funding no funding required lmrj volume 4 issue 02 74 | p a g e references 1. benson ls, williams cs, kahle m. dupuytren’s contracture. j am acad orthop surg. 1998;6(1). 2. trojian th, chu sm. dupuytren’s disease: diagnosis and treatment. am fam physician. 2007;76(1):86–9. 3. gudmundsson kg, arngrı́msson r, sigfússon n, björnsson á, jónsson t. epidemiology of dupuytren’s disease. j clin epidemiol [internet]. 2000 mar;53(3):291–6. available from: https://linkinghub.elsevier.com/retrieve/pii/s0895435699001456 4. woodruff mj, waldram ma. a clinical grading system for dupuytren’s contracture. j hand surg am [internet]. 1998 jun 29;23(3):303–5. available from: http://journals.sagepub.com/doi/10.1016/s0266-7681%2898%2980045-4 5. yoon ap, kane rl, hutton dw, chung kc. cost-effectiveness of recurrent dupuytren contracture treatment. jama netw open [internet]. 2020;3(10):e2019861. available from: http://www.ncbi.nlm.nih.gov/pubmed/33030553 6. samulėnas g, rimdeika r, braziulis k, fomkinas m, paškevičius r. dupuytren’s contracture: incidence of injury-induced cases and specific clinical expression. medicina (kaunas) [internet]. 2020 jun 30;56(7). available from: http://www.ncbi.nlm.nih.gov/pubmed/32629785 7. moog p, buchner l, cerny mk, schmauss d, megerle k, erne h. analysis of recurrence and complications after percutaneous needle fasciotomy in dupuytren’s disease. arch orthop trauma surg [internet]. 2019 oct;139(10):1471–7. available from: http://www.ncbi.nlm.nih.gov/pubmed/31367843 8. zhang d, blazar p, benavent ka, earp be. long-term effects of skin tearing on outcomes after collagenase treatment of dupuytren contractures. hand (n y) [internet]. 2021;16(6):792–6. available from: http://www.ncbi.nlm.nih.gov/pubmed/31941375 9. nayar sk, pfisterer d, ingari j v. collagenase clostridium histolyticum injection for dupuytren contracture: 2-year follow-up. clin orthop surg [internet]. 2019 sep;11(3):332–6. available from: http://www.ncbi.nlm.nih.gov/pubmed/31475055 10. sakai a, zenke y, menuki k, yamanaka y, tajima t, tsukamoto m, et al. short-term efficacy and safety of collagenase injection for dupuytren’s contracture: therapy protocol for successful outcomes in a clinical setting. j orthop sci [internet]. 2019 may;24(3):434–40. available from: http://www.ncbi.nlm.nih.gov/pubmed/30392714 11. fei tt, chernoff e, monacco na, komatsu de, muhlrad s, sampson sp, et al. collagenase clostridium histolyticum for the treatment of distal interphalangeal joint contractures in dupuytren disease. j hand surg am [internet]. 2019 may;44(5):417.e1-417.e4. available from: http://www.ncbi.nlm.nih.gov/pubmed/30146387 12. räisänen mp, karjalainen t, göransson h, reito a, kautiainen h, malmivaara a, et al. dupuytren treatment effectiveness trial (detect): a protocol for prospective, randomised, controlled, outcome assessor-blinded, three-armed parallel 1:1:1, multicentre trial comparing the effectiveness and cost of collagenase clostridium histolyticum, per. bmj open [internet]. 2018;8(3):e019054. available from: http://www.ncbi.nlm.nih.gov/pubmed/29599391 type of the paper (article lmrj volume 4 issue 03 131 | p a g e case report primary enterolith and jejunal diverticula causing small bowel obstructiona case report almas u qazi, ajay tokala, ikhlas u qazi salford royal hospital nhs foundation trust, kings, st. thomas’ and guy’s medical school, london, united kingdom abstract small bowel obstruction secondary to gallstone ileus accounts for about 0.3% to 0.5 % of all patients with gallstone disease. formation of primary intestinal stones causing obstruction and requiring laparotomy is very rare, and the presence of the diverticula adjacent to the stone precipitating in the stone formation is a rare phenomenon. a rare case of primary enterolith and jejunal diverticula is presented here. an older women presented with small bowel obstruction found to have dual pathology; operated for removal of stone and had uneventful recovery. key words: primary enterolith, jejunal diverticula, small bowel obstruction introduction gallstone ileus, most commonly caused by fistulation of the gallstone through duodenum or stomach, accounts for 0.3% to 0.5 % of all cases with known gallstone disease(1). the syndromes, which are well known to cause gallstone ileus, are either bouveret’s syndrome (i.e. seen in 0.5%) or mirizzi’s syndrome (i.e. reported in 1%). de novo formation of an enterolith is a rare phenomenon(2). one of precipitating factors could be small bowel diverticula which can act as a nidus. case report an elderly female patient aged 83 years was brought to the accident and emergency department with a history of severe colicky abdominal pain and bilious vomiting for 24 hours. the patient mentioned having intermittent lower abdominal crampy pain and a reduced appetite for the last three weeks. she was a known case of diabetes, hypertension, back pain and gastroesophageal reflux disease (gord), for which she was on various medications. she had a laparoscopic cholecystectomy 30 years ago and an open appendicectomy 60 years ago. on examination, she was dehydrated. her other general physical findings were within normal limits. her cardiovascular and respiratory examination was unremarkable. her abdomen was soft with mild distension and tenderness in the lower abdomen with guarding. she had normal bowel sounds on auscultation. her blood tests were within normal limits, c-reactive protein level was mildly elevated white cell count was 13,000. urea and creatinine were slightly elevated at 10.8mmol/l and 96µmol/l respectively. a computed tomography (ct) scan of abdomen with contrast was performed to detect the cause of small bowel obstruction (figure 1a and 1b). the ct scan demonstrated a few scattered small bowel diverticula especially in the jejunum. it also showed fluid-filled dilated small bowel loops, more prominent in the lower abdomen where there correspondence: almas u qazi , consultant general and upper gi surgeon, salford royal hospital nhs foundation trust kings, st. thomas’ and guy’s medical school, london, united kingdom email: dralmasqazi@gmail.com doi: 10.38106/lmrj.2022.4.3-08 received: 01.08.2022 accepted: 29. 08.2022 published: 30. 09.2022 mailto:dralmasqazi@gmail.com lmrj volume 4 issue 03 132 | p a g e was some mesenteric fat stranding. within the mid ileum an intraluminal gas surrounding the structures was seen, resulting in the mechanical small bowel obstruction, and this was found to be a primary enterolith. scattered colonic diverticula were seen on the ct, but no sign of acute diverticulitis was observed. figure 1a. coronal view of computerised tomography of abdomen showing enterolith causing obstruction figure 1b. sagittal view of computerised tomography of abdomen showing small bowel obstruction the patient was admitted and initially treated conservatively with intravenous fluids, adequate pain management and a nasogastric (ng) intubation and nil by mouth. the ng tube drained bilious fluid of around 1.5l in the first 24 hours. however, the patient’s symptoms failed to settle with conservative management as large amounts of bilious fluid continued to be draining through the ng tube. the patient was discussed, consented and prepared for a laparotomy, enterotomy and removal of enterolith. her preoperative morbidity risk was 48.8%, with a mortality risk of around 2.9%. with a lower midline incision, laparotomy was performed. laparotomy findings were consistent with ct scan findings, and multiple diverticula on the mesenteric border of the jejunum were confirmed. more importantly, a 4 cm enterolith was palpable at the mid-ileum, causing small bowel obstruction. the bowel proximal to enterolith was dilated and thickened. there were minimal omental adhesions to the site of the obstruction and to the caecum and the lateral abdominal wall, which were divided. transverse enterotomy was performed in the mid ileum over the mass and the enterolith was extracted (figure 2a, 2b, 2c and 2d). the enterotomy was closed in 2 layers with 3.0 pds (interrupted and then burying continuous sutures). the remaining bowel lumen was inspected to ensure no strictures or other pathology. lmrj volume 4 issue 03 133 | p a g e the patient was managed in the surgical high dependency unit post-operatively for a day, then stepped down to the ward. the patient made an uneventful recovery apart from the ileus for short period of time. figure 2a. intraoperative handling of enterolith figure 2b. enterotomy for enterolith delivery figure 2c. dimensions of delivered enterolith figure 2d. jejunal diverticula found preoperatively discussion a diverticulum is a weakness or out pouching of wall of any portion of the gastrointestinal tract involving all layers. diverticulosis (the presence of diverticula) typically affects the large intestine. these classically form where the mucosa and submucosa herniate into the muscle layer at junctions where mesenteric vessels penetrate the muscularis layer exposing an area of weakness. small intestine diverticular disease is relatively less common as compared to the diverticular disease in the colon(3). these diverticula are believed to develop as a result of abnormalities in intestinal peristalsis, intestinal dyskinesis and high intraluminal pressure. unlike meckel’s diverticula, small intestinal diverticula are acquired and they become more common with advancing age. diverticula of the small intestine are usually asymptomatic with the exception of meckel’s diverticula. however, they sometimes do have major complications. these include repeated lmrj volume 4 issue 03 134 | p a g e episodes of diverticulitis, gastrointestinal haemorrhage or obstruction, perforation, pancreatic or biliary (in the case of duodenal diverticula) disease, localised abscess, volvulus and bacterial overgrowth(4). the duodenum is the most frequent site of small bowel diverticulosis, followed by the jejunum and the ileum, with an incidence of 60–70%, 20–25% and 5–10%, respectively(5). most duodenal diverticula are found in patients aged >50 years whereas jejuno-ileal diverticula seem more prevalent in male patients aged 60-70 years(2). enteroliths are hard solid masses of mixed constitution formed in the gastrointestinal tract. chomelin j, a french physician, first described these back in the early 18th century as a peculiar case of stone formation in a duodenal diverticulum discovered at autopsy. enteroliths are classified into true (formed within the gastrointestinal tract) and false (formed outside the gastrointestinal tract e.g. gallstone ileus)(6). stasis within the bowel is believed to be the most important factor contributing to their growth. hypomotility of the bowel and an acidic ph shift due to chyme produce a microenvironment within a diverticulum, allowing conjugation and aggregation of bile salts to form stones. enteroliths can also be formed due to other causes including meckel’s diverticulum, intussusception, gastrointestinal strictures, small bowel anastomosis, inflammatory bowel disease or even certain metabolic conditions. small stones typically would pass down but large ones may cause obstruction. this is called ‘enterolith ileus’ and is similar to gallstone ileus (4,6–8). this phenomenon has only occasionally been reported in the surgical, gastroenterology or radiology literature, given that many clinicians/ surgeons are still unaware of this condition resulting in delayed diagnosis. therefore, it is of utmost importance to consider this in patients presenting with intestinal obstruction. conclusion jejunal diverticula leading to primary enterolith ileus is an extraordinary and rare diagnosis, which is usually indistinguishable from other causes of mechanical small bowel obstruction. however, acquiring knowledge about the complications of small bowel diverticula can assist in diagnosis. enterolith ileus could be expected in the elderly population where common causes of intestinal obstruction have already been ruled out. it requires surgical management as enterolith ileus rarely responds to conservative management. ethical consideration the patient consented for this case report conflict of interest authors declare no conflict of interest funding no funding required references 1. uppara m, rasheed a. management options of bouveret’s syndrome. j case reports. 2015 feb;5(1):61–7. 2. aispuro io, yazzie np. diverticulitis of isolated jejunal diverticulum complicated by small lmrj volume 4 issue 03 135 | p a g e bowel obstruction secondary to de novo enterolith formation. j surg case reports. 2019 may;2019(5). 3. ferreira-aparicio fe, gutiérrez-vega r, gálvez-molina y, ontiveros-nevares p, athiegútierrez c, montalvo-javé ee. diverticular disease of the small bowel. case rep gastroenterol [internet]. 2012;6(3):668–76. available from: https://www.karger.com/article/fulltext/343598 4. monchal t, hornez e, bourgouin s, sbardella f, baudoin y, butin c, et al. enterolith ileus due to jejunal diverticulosis. am j surg [internet]. 2010 apr;199(4):e45–7. available from: https://linkinghub.elsevier.com/retrieve/pii/s0002961009006709 5. kassahun wt. complicated small-bowel diverticulosis: a case report and review of the literature. world j gastroenterol [internet]. 2007;13(15):2240. available from: http://www.wjgnet.com/1007-9327/13/2240.asp 6. garnet dj, scalcione lr, barkan a, katz ds. enterolith ileus: liberated large jejunal diverticulum enterolith causing small bowel obstruction in the setting of jejunal diverticulitis. br j radiol [internet]. 2011 aug;84(1004):e154–7. available from: http://www.birpublications.org/doi/10.1259/bjr/16007764 7. efremidou ei, liratzopoulos n, papageorgiou ms, kouklakis g, minopoulos gj, manolas kj. enterolith small-bowel obstruction caused by jejunal diverticulosis: report of a case. surg today [internet]. 2006 oct 27;36(11):1003–6. available from: http://link.springer.com/10.1007/s00595-006-3283-9 8. malghan l, uttley a, scullion d. small bowel obstruction due to a jejunal enterolith: an unusual complication of jejunal diverticulitis. bmj case rep [internet]. 2017 oct 4;bcr-2017221514. available from: https://casereports.bmj.com/lookup/doi/10.1136/bcr-2017-221514 type of the paper (article lmrj volume 4 issue 03 115 | p a g e original article evaluation of pattern of computer vision syndrome disorders in young adults – a cross-sectional study izmal urooj 1 , muhammad asif 1 , mehak nazir 1 , azma azher 2 , sanjha memon 2 , dur bibi 2 , sadama sheikh 2 , kibria awan 2 , uzma baloch 2 1isra school of optometry, al-ibrahim eye hospital, karachi, pakistan, 2 male and female refraction department, al-ibrahim eye hospital, karachi, pakistan abstract the study was designed to evaluate the pattern of computer vision syndrome disorders in young adults. all patients (n= 138, 74 males and 64 females) coming with complains of dry eyes, eye strain, burning eyes, redness, blurring and headache were included. these patients were aged between 18 to 35 years with at least 2 hours’ exposure to any type of visual display terminal (vdt). the mean age of the study population was 20.4 years. the majority of the study subjects were males, i.e. 74 (53.6%). around 78.2% of study populations had refractive errors. myopia was the most significant refractive error found in 53.6% of the study population. the prevalence of cvs in our study group was 89.1%, with headache as the most common symptom reported in 68.8%. furthermore, 94.9% of participants were viewing the screen from a distance of 30 to 40cm and 81.9% of subjects were using vdts at night in bad ergonomic conditions. these findings point to the height of the health issue, which needs to be addressed with clear instruction for the use of proper screen protections and safety time cut-offs for the use of computer screens key words: computer vision syndrome, ergonomics, visual display units, ocular complaints introduction since the introduction of computers, several screen-related effects have been reported among longterm users and professionals. the group of these symptoms and signs is now termed as “computer vision syndrome” (cvs) or digital eye strain. the american optometric association defines it as a collection of eye and vision-related issues that emerge from extended computer, tablet, e-reader, and mobile phone use(1). the syndrome is comprised of complaints including dry eyes, irritation causing redness, strain/fatigue in the eyes, blurring of vision, burning sensation, excessive tearing and double vision. some patients also report having light sensitivity and headaches with digital eye strain. it is also reported that cvs is commonly occurs due to prolonged exposure to computer screen without proper light and in appropriate screen brightness. the suitability of the workstation layout is also important along with any pre-existing eye condition(2). computer vision syndrome reportedly became the most common occupational hazard of this century resulting from technology development, affecting over two thirds of all the smart device users globally making it one of the most common public health issues in the world(3). the symptoms associated with cvs also cause decline in productivity at work, rise in human errors, reduction in quality of work satisfaction, and decline in visual ability(4). global statistics suggest around 60 million people are suffering from cvs, with a rise of one million new cases each year (5). the prevalence of vdt-related eye disorders varies greatly among studies, due to variation in the selection criteria, methodologies adopted for sample correspondence: izmal urooj isra school of optometry, al-ibrahim eye hospital, karachi, sindh, pakistan email: izmalurooj@gmail.com doi: 10.38106/lmrj.2022.4. 3-05 received: 28.06.2022 accepted: 13. 09.2022 published: 30. 09.2022 mailto:izmalurooj@gmail.com mailto:izmalurooj@gmail.com lmrj volume 4 issue 03 116 | p a g e collection and research instrument used(6,7). in a review by thomson et als stated that ~90% of computer users may have symptoms associated with cvs after prolonged screen exposure. another study reported from abuja, nigeria, had 40% of vdt users experiencing at least one symptom of cvs(8). while in sri lanka two-thirds of computer office workers suffer from cvs, according to the national research(9). a couple of studies were reported from gondar, ethiopia, where more than 70% of secretaries, data processors, and bankers, who mainly work on computers, are presenting with cvs(10,11). according to other studies, the frequency of cvs ranging from 75% to 90% among workers exposed to vdt during most of their working hours (12). the reported rate from italy was 31% (n = 212), india 46% (n = 400), australia 63% (n = 1000), and spain 68% (n = 35) of computer use related visual symptoms(13–15). according to these studies, almost 75% of participants spending six to nine hours per day in front of screen, experience some degree of ocular discomfort. the difference in the rate of development of visual symptoms largely depends upon the number of samples they have included. there is little evidence showing that cvs symptoms cause lasting eye damage and vision impairment. there is also limited literature available from pakistan. given the rising use rate of computers in all offices, it is important to explore the rate of cvs in our population. this study aimed to discover the pattern of computer vision syndrome disorders in young adults, presenting at a single centre. methods this was a cross-sectional study conducted at al-ibrahim eye hospital, karachi, pakistan, for 6 months (april to december 2020). the patients presenting with complaints of eye strain, dry eyes, blurred vision, burning eyes, and headache, aged between 18 to 35 years, and at least 2 hours of exposure to any sort of vdt, were included using a non-probability convenient sampling technique. patients with uncorrected refractive errors, convergence insufficiency, fundus pathology, medication effects, and mentally retarded patients were excluded. informed consent was taken from all patients, when they agreed to be part of the study data was collected using a pre-designed questionnaire. statistical analysis was done by using statistical package for social science (ibm spss statistics for windows, version 20.0. armonk, ny: ibm corp). all the continuous variables were presented as mean and standard deviation (± sd) and all categorical variables were presented as frequency and percentage. results mean age of the patients was 20.4 years. gender wise distribution showed that 74 (53.6%) were males and 64 (46.4%) were females. around 78.2% of study populations had refractive errors. myopia was the most significant refractive error in 53.6% of the study population. among study population, 34.8% were using electronic gadgets for 3 to 5 hours. the prevalence of cvs was found to be 89.1%. headache was the most prevalent symptom (68.8%). the screen was viewed by 94.9 % of participants at a distance of 30 to 40cm. in poor ergonomic settings, 81.9 % of the subjects used vdts at night. a summary of the types of refractive errors reported in the study is given in table 1. table 1. distribution of type of refractive error reported in the study population refractive error frequency percent myope 74 53.6 hypermetropia 7 5.1 astigmatism 27 19.6 emmetropia 30 21.7 total 138 100.0 discussion lmrj volume 4 issue 03 117 | p a g e the mean age of our study sample was 20 years, and most males were reported to have cvs symptoms. the findings of our study were consistent with a study reported from saudi arabia including students and stated 21.4±1.9 years mean age and that three-fourth population suffering from cvs were males. it is though interesting that younger males are complaining of the screen related issues. it is also in line with the pattern of social system where males work more in offices and in front of computer screens than females. in our study, a higher rate of refractive errors were observed (i.e. 78.2%) compared to the previously reported study by margareta c et al where it was reported to be 55.6%. this might have influence of the sample type included in the study. this might also have an association with the make-up and quality of screens used(16). as we did not include the type of monitors of computer screens thus it is difficult to make exact correlation. our study reported that a considerable number of participants use electronic devices around five hours a day for a minimum of three hours. these findings are in line with the previously reported study by zairina et al where 42.9% of the study population was using computer around 5 hours per day. while these findings contradict a report from delhi, india where great majority was using screens six to nine hours a day, 26% of the study population stated to spend more than nine hours a day on the computer(17). overall it was found that 89% of patients reported in our centre had computer related ocular issues which fall under computer vision syndrome among young adults. the rate reported in our study was a little higher than the number seen in a study by pulla a et al, where it was reported to be 60.3%. again, this seems to be influenced by the type of sample selected for the study and the way of data collection and also here is also a chance of recall bias from the participants. the most common symptom reported in our study was headache (68.8%), then eye strain or fatigue (i.e. 46.2%), while half of the study population had watery eyes, another 15% and 20% had redness and blurring respectively. these findings are comparable to the study by talwar et al where 76% of the study population had visual symptoms with computer use and most common was watering of eyes, pain and irritation, burning and redness, blurred vision and headache. there was another study reported from malaysia, which also reported headache and eye strain as the most frequently presenting features after use of computer screens. the study has highlighted an important occupational and general heath issue in public, particularly working class of our population. where the use of computers resulting in ocular problems. the study has not explored the exact duration of the used of screens also the use mobile phone screen was not particularly individualized, are the limitation of the study. the make of computer monitors is also an important aspect that was not included in this study, as it was beyond the project's scope. conclusion the majority of young adults using computers at the workplace nowadays, thus, this study has reported a considerable number of young adults suffering from computer vision syndrome. further studies are required to find significantly influencing factors and develop strategies to control this major ocular problem. ethical approval the study was approved by the institutional review board/ethical review board. (rec/ipio/2020/008) conflict of interest authors declared no conflicts of interest funding source lmrj volume 4 issue 03 118 | p a g e no funding required. references 1. chawla a, lim tc, shikhare sn, munk pl, peh wcg. computer vision syndrome: darkness under the shadow of light. can assoc radiol j [internet]. 2019 feb 1;70(1):5–9. available from: http://journals.sagepub.com/doi/10.1016/j.carj.2018.10.005 2. dessie a, adane f, nega a, wami sd, chercos dh. computer vision syndrome and associated factors among computer users in debre tabor town, northwest ethiopia. j environ public health [internet]. 2018 sep 16;2018:1–8. available from: https://www.hindawi.com/journals/jeph/2018/4107590/ 3. charpe na, kaushik v. computer vision syndrome (cvs): recognition and control in software professionals. j hum ecol [internet]. 2009 oct 24;28(1):67–9. available from: https://www.tandfonline.com/doi/full/10.1080/09709274.2009.11906219 4. wimalasundera s. computer vision syndrome. gall med j [internet]. 2009 sep 28;11(1):25. available from: https://gmj.sljol.info/article/10.4038/gmj.v11i1.1115/ 5. sen a, richardson s. a study of computer-related upper limb discomfort and computer vision syndrome. j hum ergol (tokyo) [internet]. 2007 dec;36(2):45–50. available from: http://www.ncbi.nlm.nih.gov/pubmed/18572794 6. thomson wd. eye problems and visual display terminals--the facts and the fallacies. ophthalmic physiol opt [internet]. 1998 mar;18(2):111–9. available from: http://www.ncbi.nlm.nih.gov/pubmed/9692030 7. klamm j, tarnow kg. computer vision syndrome: a review of literature. medsurg nurs [internet]. 24(2):89–93. available from: http://www.ncbi.nlm.nih.gov/pubmed/26306366 8. akinbinu r. knowledge of computer vision syndrome among computer users in the workplace in abuja, nigeria. j physiol pathophysiol [internet]. 2013 sep 30;4(4):58–63. available from: http://academicjournals.org/journal/jpap/article-abstract/497cabc15892 9. ranasinghe p, wathurapatha ws, perera ys, lamabadusuriya da, kulatunga s, jayawardana n, et al. computer vision syndrome among computer office workers in a developing country: an evaluation of prevalence and risk factors. bmc res notes [internet]. 2016 dec 9;9(1):150. available from: http://www.biomedcentral.com/1756-0500/9/150 10. zenbaba d, sahiledengle b, bonsa m, tekalegn y, azanaw j, kumar chattu v. prevalence of computer vision syndrome and associated factors among instructors in ethiopian universities: a web-based cross-sectional study. mansour a, editor. sci world j [internet]. 2021 oct 5;2021:1–8. available from: https://www.hindawi.com/journals/tswj/2021/3384332/ 11. assefa nl, weldemichael d, alemu h woretaw, anbesse dh. prevalence and associated factors of computer vision syndrome among bank workers in gondar city, northwest ethiopia, 2015. clin optom [internet]. 2017 apr;volume 9:67–76. available from: https://www.dovepress.com/prevalence-and-associated-factors-of-computer-visionsyndrome-among-ba-peer-reviewed-article-opto 12. hayes jr, sheedy je, stelmack ja, heaney ca. computer use, symptoms, and quality of life. optom vis sci [internet]. 2007 aug;84(8):e738–55. available from: https://journals.lww.com/00006324-200708000-00013 13. mocci f. psychological factors and visual fatigue in working with video display terminals. occup environ med [internet]. 2001 apr 1;58(4):267–71. available from: lmrj volume 4 issue 03 119 | p a g e https://oem.bmj.com/lookup/doi/10.1136/oem.58.4.267 14. bhanderi d, choudhary s, doshi v. a community-based study of asthenopia in computer operators. indian j ophthalmol [internet]. 2008;56(1):51. available from: https://journals.lww.com/10.4103/0301-4738.37596 15. sánchez-román fr, pérez-lucio c, juárez-ruíz c, vélez-zamora nm, jiménez-villarruel m. [risk factors for asthenopia among computer terminal operators]. salud publica mex [internet]. 38(3):189–96. available from: http://www.ncbi.nlm.nih.gov/pubmed/8757544 16. rafeeq u, omear m, chauhan l, maan v, agarwal p. computer vision syndrome among individuals using visual display terminals for more than two hours. delta j ophthalmol [internet]. 2020;21(3):139. available from: http://www.djo.eg.net/text.asp?2020/21/3/139/295885 17. talwar r, kapoor r, puri k, bansal k, singh s. a study of visual and musculoskeletal health disorders among computer professionals in ncr delhi. indian j community med [internet]. 2009;34(4):326. available from: http://www.ijcm.org.in/text.asp?2009/34/4/326/58392 type of the paper (article lmrj volume 4 issue 03 125 | p a g e original article use of rigid, fixed brain retactors is harmful for the brain naveed khan1, muhammad saad usmani 2, shua nasir3, lal shehbaz 4, alvia saad 5 1department of neurosurgery, ziauddin university & hospital & consultant neurosurgeon national medical center karachi, pakistan, 2deptartment of anatomy, liaquat college of medicine & dentistry & darul sehat hospital, karachi, pakistan, ,3,4department of emergency medicine, ziauddin university & hospital, karachi pakistan, 5department of medicine,registrar, patel hospital emergency, karachi, pakistan abstract while operating upon the brain, deep seated lesions need to be approached by using retractor’s system, due to the soft and gelatinous nature of the brain. using a conventional rigid, fixed retractor system for brain retraction appears harmful. as an alternative thudicam nasal speculum (tns) retractors can be used. this study was aimed to explore the outcome of tns retractors in brain surgery. the cross-sectional study was conducted at ziauddin university hospital north campus and national medical center defense, karachi, pakistan, during a period between august 2019 to march 2020. a total of 60 patients were included (42 males and 18 females), with a median age of 25 years. in all these cases intra-cranial hematoma were removed with unremarkable damage, in aneurysm clipping it was found useful, without damaging adjacent areas and extraction of brain tumors was found to be very easy and nondamaging to the surrounding brain tissue. patients had a follow-up period of about 03 months and contusion, ischemia or brain edema was not present in any patient. only one patient died during second month after surgery due to ischemic stroke of contra-lateral mca. the study concludes that using tns retractors was very helpful and non-damaging to the brain. key words: brain retractors, brain injury, neurosurgical procedures introduction the iatrogenic injuries caused by brain retractors are consequences of neurosurgical procedures, however, the advent of newer retractors has improved surgeons comfort in the visibility of the lesions, procedural ease and minimal brain injury (1-5). deep brain lesions such as tumors, aneurysms, intra-cranial hematoma and intraventricular tumors, are difficult to approach without retraction, and at the same time if microscope or endoscope is to be used it becomes even tougher to avoid any damage to the falling brain( 1,5, 6). a study by butt et al has found a 33.33% to 66.66% rate of brain edema observed in excision to debulking procedures of brain tumors (7) causing further hindrance in approaching the operating field(3) . in situations like these, use of rigid, fixed retractor can cause brain contusion or ischemia to the brain, sometimes postoperative bleeding and hematoma (6.7%) may occur under the retracted area of the brain (8). moreover, glare of light from the rigid fixed retractor while using headlight is another disadvantage which one has to overcome by certain adaptations (4). correspondence: dr alvia saad department of medicine,registrar, patel hospital emergency, karachi, pakistan email: alviasaad@gmail.com doi: 10.38106/lmrj.2022.4.307 received: 28.06.2022 accepted: 13. 09.2022 published: 30. 09.2022 mailto:alviasaad@gmail.com mailto:alviasaad@gmail.com lmrj volume 4 issue 03 126 | p a g e fixed rigid retractor systems are very expensive leading to further rise in the surgery cost. in contrast, the use of thudicam nasal speculum (tns) retractors is far safer, due to its low weight, soft prongs and malleable blades, which reduces the risk of post-operative bleeding, infarct, contusion or edema. the tns retractors are available in different sizes. due to these sizes, lesions at different depths become easily accessible without any harm to the brain and with a smaller cortisectomy (10). shiparo et al in a review of current studies, found that evacuation of hematoma and total resections and subtotal resections of tumors, the rate of complications was 2.8% at short term postoperative period(6). another study by lim et al has found good surgical outcomes with using brain retractors in tumor removal (10-12). however, there was limited literature available for different procedures. therefore, this study was conducted to explore post-operative outcome following use of tns retractors for different brain procedures. methods this cross-sectional study was conducted on 60 patients without any age or gender restriction. the cases were prospectively studied and followed-up. the study was conducted at zia ud din university hospital north campus and national medical center defense, karachi, pakistan during a period of eight months from august 2019 to march 2020. before surgery, a written informed consent was taken regarding surgical technique from patients (gcs 15/15) or their relatives. different types of tns retractors were used for different depths of lesions, for deep lesions small modifications were made in the soft and malleable long blades of tns retractors, the lower ends were bent so the blades became more widened for the extractions of lesions, without causing any damage to the normal surrounding brain tissue. all patients had computed tomography (ct) scan of the head postoperatively (figure 1). figure 1. computed tomography scan of the patient after surgery lmrj volume 4 issue 03 127 | p a g e technique: all surgical procedures were performed under general anesthesia using standard sterilization techniques, skin incisions were marked using standard brain mapping technique and linear, rounded or horse shoe-shaped incisions were made according to the needs. osteoblastic or osteoclastic bone flaps raised, dura was opened by linear incision, after a small cortisectomy lesion was identified and depth was measured with the help of codman dandy ventricular needle. depending on the depths of the lesions, different sizes of tns retractors were used. tns retractors were very helpful using headlight, microscope, or endoscope. no glare of light, no brain trauma, even at edematous brain were observed. figure 2. surgical procedure showing use of retractors lmrj volume 4 issue 03 128 | p a g e results there were 60 patients with a median age of 25 years, where 17.5% were below or equal to 10 years of age, 47.5% were between 11 to 30 years, and 35% were above 30 years of age. there were 42 males and 18 females. all surgical procedures were performed without any immediate complications. in cases of intra-cranial bleeding almost 100% of hematoma were removed, aneurysm clipping was done without any event per operatively, extraction of brain tumors was also done without causing any damage to the surrounding normal brain tissue. median follow-up of the patients was three months, no remarkable post-operative contusion, ischemia or brain edema were reported. one patient died of ischemic stroke of contralateral mca second month post-operatively. discussion iatrogenic brain retraction injuries occur in around 10% of major procedures of cranial tumors and 5% of intracerebral aneurysms as previously reported (11-15). these injuries may range from mild edema to severe edema even contributing to mortality. however, with advent of newer techniques and modern retractors this can be minimized (16-20). in our study, with the use of tns retractors there were almost no postoperative complications. in some difficult surgical lesions there is a need of rigid retractors i.e. 5.7% in the study reported by nazim et al (15). rigid fixed retractors hide the normal anatomy, moreover in longer procedures like resection of brain tumors or clipping an aneurysm, prolonged application of rigid fixed brain retractors can cause contusion, ischemia or edema to the surrounding brain tissue that may result in irreversible brain damage. the cochrane systematic review however, has concluded that there is no significant difference in the complications rate by using different types of retractors(3). on the contrary, the use of tns retractors was found to be very helpful and non-damaging to the brain. tns retractors can be applied in all those procedures involving headlight, microscope or telescope. safronova et al found favourable postoperative results in deep brain injuries and tumor excision by combining microsurgical technique, craniotomy and retractors of tubular variety (11). deep or shallow lesions are easily resectable. a small incision of 2 to 3 mm is needed on the cortex of the normal brain to reach the deep lesions. according to the depth of the lesions, different sizes of tns retractors were available, the prongs and blades of tns retractors were found pulsating with the brain leaving no contusion, edema or ischemia to the surrounding normal brain tissue. the simple tns retractors have made the surgical approach to deep brain lesions of the brain, very safe, cheap and time-saving. the study has shown remarkable results with almost no complications. however, small sample size and short follow-up of the patients are considered as the limitations of the study. surgical expertise of the operating team can also influence results in this kind of studies. neverthless prospective nature of ths study is considered as the strength of the study. conclusion in our study tns retractors were found to be very helpful and non-damaging to the brain and can be applied in all those procedures involving headlight, microscope or telescope. deep or shallow lesions are easily resectable. however, large cohort studies are required to confirm long-term effects. ethical consideration the study was approved by local ethics committee, all patients or their relatives provided informed consent before the surgical procedure. the identity of the patients was not disclosed. conflict of interest authors declare no conflict of interest funding this was an observational study, no funding required. lmrj volume 4 issue 03 129 | p a g e references 1. rao d, le rt, fiester p, patel j, rahmathulla g. an illustrative review of common modern craniotomies 2020 dec 10. j clin imaging sci. 2020 dec 10;10:81. doi: 10.25259/jcis_176_2020. ecollection 2020. 2. zammar sg, cappelli j, zacharia be. utility of tubular retractors augmented with intraoperative ultrasound in the resection of deep-seated brain lesions: technical note. cureus. 2019:19;11(3):e4272. doi: 10.7759/cureus.4272. 3. echeverry n, mansour s, mackinnon g, jaraki j, shapiro s, snelling b. intracranial tubular retractor systems: a comparison and review of the literature of the brainpath, vycor, and metrx tubular retractors in the management of deep brain lesions. world neurosurg 2020:143:134-146. 4. zagzoog n, reddy k. use of minimally invasive tubular retractors for foramen magnum decompression of chiari malformation: a technical note and case series. world neurosurg 2019;128:248-53. 5. mampre d, bechtle a, chaichana kl. minimally invasive resection of intra-axial posterior fossa tumors using tubular retractors. world neurosurgery 2018;119:e1016-e1020. 6. shapiro sz, sabacinski ka, mansour sa, echeverry nb, shah ss, stein aa, snelling bm. use of vycor tubular retractors in the management of deep brain lesions: a review of current studies. world neurosurg. 2020;133:283-290. doi: 10.1016/j.wneu.2019.08.217. epub 2019 sep 7. 7. butt b, shiekh mm, nabila, anwar h, chudary ma, butt rm. six months analysis of posterior fossa surgery in neurosurgery unit-i, punjab institute of neurosciences (pins). pak j neuro surg 2018;22(1):7-16. 8. sharafat s, khan z, brohi sr, ali m, azam f. spectrum of posterior fossa lesions: experience at tertiary care unit. pak j neuro surg 2019;23(1):2-6 9. lim j, sung ks, hwang sj, chun dh, cho kg. tumor retractor: a simple and novel instrument for brain tumor surgery. world j surg oncol. 2020;13;18(1):37. doi: 10.1186/s12957-020-1800-8. 10. eichberg dg, buttrick s, brusko gd, ivan m, starke rm, komotar rj. use of tubular retractor for resection of deep-seated cerebral tumors and colloid cysts: single surgeon experience and review of the literature. world neurosurg. 2018;112:e50–60. 11. safronova e.i., kushel yu.v. experience in the use of tubular retractors in transcranial surgery of intraaxial brain tumors in children. journal "issues of neurosurgery" named after n.n. burdenko. 2022;86(2):15-24. 12. mansour s, echeverry n, shapiro s, snelling b. literature review the use of brainpath tubular retractors in the management of deep brain lesions: a review of current studies. world neurosurgery. 2020;134:155-163. https://doi.org/10.1016/j.wneu.2019.08.218 13. almubarak ao, alobaid a, qoqandi o, bafaquh m. minimally invasive brain port approach for accessing deep-seated lesions using simple syringe. world neurosurgery. 2018;117:54-61. https://doi.org/10.1016/j.wneu.2018.05.236 14. jackson c, ehresman j, vivas-buitrago t, bettegowda c, olivi a, quinoneshinojosa a, et al. retractorless surgery: strokes, edema, and gliosis outcomes following skull base surgery. j neurol surg b skull base. 2018;79(s 01):s1–s188. https://doi.org/10.1055/s-0038-1633350. 15. nazim wm, elborady ma. retractorless brain surgery:technical considerations. the egyptian j neurolog psyc neurosurg 2021;57:98 https://doi.org/10.1186/s41983-021-00329-w. https://doi.org/10.1016/j.wneu.2019.08.218 https://doi.org/10.1016/j.wneu.2018.05.236 https://doi.org/10.1055/s-0038-1633350 https://doi.org/10.1186/s41983-021-00329-w lmrj volume 4 issue 03 130 | p a g e 16. kretschmer t, heinen c, schmidt t. retractorless surgery of vascular lesions. in: july j, wahjoepramono ej, editors. neurovascular surgery: surgical approaches for neurvascular diseases. springer open; 2019. p.255–267. 17. piazza a, ricciardi l, trungu s, forcato s, alessandro di bartolomeo, scerrati a, et al. the lone star retractor system in neurosurgery. world neurosurg 2021;153:36-40. 18. prajapati ak, vilanilam gc, vayalappil mc. development and evaluation of expandable brain retractor with tunable expansion ratio. trends in biomaterials and artificial organs 2022;36(1):21-26. 19. toyota s, kumagai t, goto t, mori k, taki t. utility of the lone star retractor system in microsurgical carotid endarterectomy. world neurosurg. 2017;101:509–13. 20. uluc k, cikla u, morkan db, sirin a, ahmed as, swanson k, baskaya mk. minimizing retraction by pia-arachnoidal 10-0 sutures in intrasulcal dissection. oper neurosurg (hagerstown). 2018;15:10–4. https://www.sciencedirect.com/science/article/pii/s1878875021009384 https://www.sciencedirect.com/science/article/pii/s1878875021009384 type of the paper (article lmrj volume 4 issue 01 4 | p a g e research article covid-19 and humoral immune response in convalescent plasma donors in pakistani cohort – analysis from convelecence plasma trial jawad hassan1, shahtaj masood2, naveen fatima1, tehmina nafees1, sonia khan1, javed akram3,fridoon jawad ahmad3, lubna meraj4, ayesha mahesar5, zaratul ain malik1, nadeem samad shaikh6, anwar alam7, irfan ghafoor baig1, muhammad adil1, muhammad asif1, sidra maqsood1, mehjabeen imam1, durenaz jamal8, dilnasheen safdar1, tahir sultan shamsi1* 1national institute of blood disease and bone marrow transplant, karachi; 2hayatabad medical complex peshawar khyber pakhtunkhwa; 3university of health sciences, lahore; 4rawalpindi medical university rawalpindi; 5regional blood center, sukkur; 6regional blood center, quetta; 7alkhidmat foundation blood bank lahore; 8sindh blood transfusion authority, sialkot, pakistan abstract current covid-19 pandemic has affected the entire globe. while there was no vaccine neither any specific treatment, investigational use of convalescent plasma has been explored in clinical trials. a prospective multicenter study of convalescent plasma was conducted. donors were tested for total anti-sars-cov-2 antibodies by electrochemiluminescence (eclia) and rt-pcr for covid-19. enzyme linked immunosorbent assay (elisa) was used to detect semi-quantitative and quantitative igg anti-sars-cov-2 antibodies. igg immunofluorescence-based lateral flow immunoassay (lfia) was used to recheck seronegative donors. a total of 400 donors were enrolled. twelve donors were sars-cov-2 positive by rt-pcr. nine of 12 donors had developed sars-cov-2 igg antibodies, while in 3 donors antibodies were not developed. a total of 70 donors (17.5%) were deferred due to seronegative status; 64 (16%) of them did not develop antibodies when plasma collection was planned. the igg semiquantitative elisa was positive in 282 and quantitative in 284 of 330 donors with a mean value of >1:160 and 44.10±39.22 iu/ml respectively. a total of 116 (29%) donors did not show igg humoral response to covid-19 even 28 days from the onset of illness. subsequently, lfia method was able to detect igg antibodies in 20 of 48 (41.6%) seronegative donors and in 20 of 34 (58.8%) eclia positive elisa negative donors. viral rna detection in recovered asymptomatic patients with concomitant igg antibodies indicates recovery. inability to detect antibodies by different testing kits may be due to their different antigenic targets or sensitivity. significance of a positive covid-19 rt-pcr in asymptomatic recovered patients is yet to be determined. key words: anti-sars-cov-2, convalescent plasma, covid-19 pandemic, passive immunization introduction world health organization (who) declared covid-19 as a pandemic and as of 29th june 2020, with 10,004,707confirmed cases and 500,000 deaths reported in 216 countries around the world (1). in pakistan, around 206,512 people have been diagnosed with covid‐19 and 4,167 deaths have been correspondence: jawad kazmi national institute of blood diseases & bmt, karachi, pakistan email: jawadkazmi2003@gmail.com doi: 10.38106/lmrj.2022.4.1-02 received: 19.02.2022 accepted: 21. 03..2022 published: 31. 03.2022 mailto:jawadkazmi2003@gmail.com mailto:jawadkazmi2003@gmail.com lmrj volume 4 issue 1 5 | p a g e reported as of now, with the mortality rate of around 2.0%(2). given the absence of any approved treatment for covid-19 and vaccine, investigational treatment regimens have emerged as therapeutic options to be considered as a cure. passive immunization refers to a process of transferring antibody preparations derived from sera or secretions of immunized donors via systemic or mucosal route to non-immune individuals. plasma collected from recovered patients of a given infectious illness during convalescence period is referred to as convalescent plasma. it has been used over many decades for a variety of different infectious agents such as pneumococcal pneumonia(3), poliomyelitis(4), measles, influenza(5) in the past century, and h1n1 influenza(6), ebola(7), sars(8)and mers(9) in this century. in the current sars-cov-2 pandemic, anecdotal reports have shown efficacy of convalescent plasma(10-12). a number of published studies have reported the detection of viral rna of sars-cov-2 many weeks after documented recovery(13-18,19-22). clinical significance of persistence or re-emergence of virus is not well understood. utilization of convalescent plasma, as a way of providing neutralizing antibodies to severely ill patients, has been approved by regulatory authorities in many countries including pakistan in a setting of clinical trial or as expanded access program. seronegativity of recovered covid-19 patients have also been reported in different studies; its clinical significance remains to be seen. this may be due to lower sensitivity of the testing kits, different antigenic targets used or different techniques used. with this background, this study was designed to find out the rate of anti covid-19 antibodies and to check seroconversion in recovered covid-19 patients after convalescence period and compare different antibody detection methods in seronegative patients. methods the trial was approved by national bioethics committee (nbc) and drug regulatory authority of pakistan (drap). it was conducted in accordance with ich-gcp guidelines. this trial protocol was registered at www.clinicaltrials.gov (trial number: nct04352751) as experimental use of covid-19 convalescent plasma for the purpose of passive immunization in current covid-19 pandemic in pakistan 2020. convalescent plasma donors were selected according to who criteria as given in figure 1. covid-19 recovered patients who volunteered to donate convalescent plasma were selected. the patients had a history of covid-19 during last 4-8 weeks, followed by negative rt-pcr for sars-cov-2 rna on 2 consecutive samples 24 hours apart. they had recovery at least 2-weeks before they donate. the participants were between 18-60 years of age weighing >50kg for men and > 45kg for women. at least a week been passed since last use of glucocorticoids. they all must met all the criteria for a regular blood donor (i.e. negative for hepatitis b, c, hiv, syphilis and rt-pcr negative for sars-cov-2). once they fulfill all the criteria informed consent was signed before donation. moreover, multiparous female donors were excluded from the study. the flow-chart of the patients selection is given in figure 1. specimen collection and transportation: a. blood collection: whole blood (10 ml) was collected in lavender top (containing k3edta for plasma) and gel tube and plain tube (for serum). serum or plasma was separated by centrifugation of respective tubes and distributed to 2 to 3 aliquots and sent to respective departments. http://www.clinicaltrials.gov/ lmrj volume 4 issue 1 6 | p a g e figure 1: flow process for convalescent plasma donors b. respiratory specimens collection for rt-pcr nasopharyngeal swab was collected as per cdc guideline; specimens were sent in viral transport media sealed in zip lock bags to the molecular department. all specimens were transported through maintenance of cold chain in reference center for qualitative testing of antibodies against sars-cov-2. lmrj volume 4 issue 1 7 | p a g e lab investigations: complete blood count (cbc) and routine biochemistry investigations were performed as per institutional standard laboratory protocol. serum samples were tested for qualitative detection of antibodies against sarscov-2, using elecsys® assay kits using eclia immunoassay on cobas e411 immunoassay analyzer by roche diagnostics international ltd, (ch – 6343 rotkreuz, switzerland). qualitative elisa for igg antibodies against sars-cov-2 was done using omega diagnostics ivd, (genesis diagnostics ltd, cambridgeshire, uk). for quantification, first quantitative kit is developed by aeskulisa sars-cov-2 np igg (aesku diagnostics gmbh & co., wendelsheim, germany), and ce marked. it was used for quantitative measurement of antibodies against sars-cov-2. it detects nucleo-capsid protein. elisa tests were performed as per suppliers’ instructions. briefly, controls and diluted patient plasma/serum were incubated into individual microplate wells. in a positive test, the specific igg will bind to the recombinant antigen. addition of enzyme linked conjugate (anti human igg) bound the antigen-antibody complex. chromogen/substrate solution was added in each well for catalyzing a colored reaction. stop solution was added into each well to inhibit the enzymatic catalyzation. photometric measurement of the color intensity was made after adding stop solution. lateral flow immuno-fluorescent assay kit detects anti-sars-cov-2 igg and igm (lateral flow immunoassay) (shenzhen lifotronic technology co., ltd, shenzhen, china). lfia was used later when the kit became available. eclia positive and quantitative elisa negative as well as both negative donors with lfia method were tested. rna extraction was done using dry swab rna kit favorprep viral nucleic acid extraction kit-1 (favorgen biothech corps, ping-tung, taiwan). amplification was carried out using manufacturer’s instruc‐ tions (bosphore, novel coronavirus (2019-ncov) detection kit v2, anatolia geneworks, istanbul, turkey). the kit employed multiplex pcr targeting two regions i.e. orf1ab (acquired through fam filter) and e gene (acquired through hex filter). for amplification and acquisition of fluorescence rotorgene –q (qaigen) was used. statistical analysis data was analyzed using spss version 21.0. descriptive statistics including mean and sd were computed for continuous variables. frequency and percentages were evaluated for categorical variables. independent t-test was applied to identify the difference between the means in two unrelated groups and chi-square test was used to test a relationship between categorical variables. results a total of 400 donors were enrolled for convalescent plasma donation. there were 304 (76%) males (male to female ratio was 3.1:1), mean age of donors was 36.4±11.3 years. 332 (83%) of them remained home quarantine for a mean duration of 17.7±6.4 days. follow up covid-19 rt-pcr was done on a mean of 16.3±6.4day after their first rt-pcr positive test. viral rna was not detected on this testing. plasma collection was done on day 15±14.2 after last negative rt-pcr. table 1 shows the demographic details of these donors. of 400 donors, 70 (17.5%) had a travel history abroad as shown in figure 2. their laboratory investigations were within normal range as shown in table 1. after all screening and baseline testing 200 patients were excluded and finally 200 donors were recruited for antibody analysis. all selected donors were negative for transfusion transmitted infections such as hepatitis b, c, hiv, syphilis and malaria parasite. at the time of donation, 376 out of 400 donors were negative for sars-cov-2 by rt-pcr. however, out of remaining 12, rt-pcr detected the presence of viral rna, they were all male. two of these 12 were hospitalized for a week when covid-19 was diagnosed while 10 of these 12 were home quarantined. none of these 12 had any associated comorbid. nine of these 12 showed seroconversion i.e., presence of concomitant antisars-cov-2igg antibodies. a total of 70 (17.5%) donors were deferred due to absence of anti-sars-cov-2 antibodies in 64 (16%) and detection of viral rna in 3 (0.75%) without any evidence of seroconversion. in 60 lmrj volume 4 issue 1 8 | p a g e seronegative cases, there were 52 males. eight of these 60 needed hospitalization while 52 were quarantined at home. table 1: demography & laboratory parameters demographic data n(%) male female 152 (76%) 48 (24%) low medium high 8 (4%) 188 (94%) 4 (2%) age (years) 36.42 ± 11.34 hematological parameters (mean±s.d) 1hemoglobin (g/dl) 14.0 ± 1.5 2hematocrit (%) 40.3 ± 4.6 3red blood cell count (x1012/l) 4.9 ± 0.54 4white blood cell count (x109/l) 7.6 ± 1.5 5alc* (x109/l) 2.6 ± 0.76 6anc*(x109/l) 3.9 ± 1.1 7reticulocyte count (109/l) 56.2 ±32.3 8platelets (109/l) 267 ±65.4 9ipf® (%) 6.0 ±3.2 biochemical parameters (mean±s.d) 10albumin (g/dl) 4.5 ± 0.27 11calcium (mg/dl) 9.7 ± 0.40 12lactate dehydrogenase (u/l) 167 ± 32.0 13urea (mg/dl) 24.3 ± 8.3 14creatinine (mg/dl) 0.87 ± 0.16 15sodium (meq/l) 138.8 ± 2.6 16potassium (meq/l) 4.1 ± 0.3 17bicarbonate (meq/l) 25.2 ± 2.52 18chloride (meq/l) 101.0 ±13.9 19bilirubin total (mg/dl) 0.56 ± 0.34 20bilirubin direct (mg/dl) 0.25 ± 0.63 21alkaline phosphatase (u/l) 47.06 ± 18.8 22sgptº (u/l) 23.2 ± 9.1 23random blood sugar (mg/dl) 103 ± 21.7 molecular assay sars-cov-2 rt-pcr not detected : 188 anti-sars-cov-2 immunological assays (mean ± s.d) in covid-19 recovered patients *absolute neutrophil counts, absolute lymphocyt e counts,®im mature platelet fractions,ºs erum glutamate pyruvate transamina se ¥electroche miluminese nce ≠enzyme linked immunosor bent assay reference ranges:1(m: 13.0-16.5, f:11.5-15.4), 2(m:40-52, f:36-48), 3(m:4.5-6.5, f:4.55.6),4(411),5(27),6(411),7(29.587.3),8(150400),9(1-7), 10(3.84.4),11(8.610.2),12(230460),13(1050),14(0.61.2),15(134144), lmrj volume 4 issue 1 9 | p a g e 24 eclia¥ 35.93 ± 31.4 (165/200) sensitivity: 82.5% specificity: 100% 25elisa≠ qualitative / semi-quantitative 142/165 (86%) mean: >1:160 fold serum dilution. range: >1:180 >1:320. sensitivity: 71% specificity: 100% 26elisa quantitative 141/165 (85.4%) 59.74 ± 35.90 sensitivity: 70.5% specificity: 100% figure1: exposure history table 2: recurrence of sars-cov-2 in published studies, worldwide studies diagnostic tools covid-19 recurrence chan d et al(13) rt-pcr 1 patient zhang j fen et al(14) rt-pcr 1 patient huang p et al(15) rt-pcr 1 patient xiao at, tong x, zhang s et al(17) rt-pcr 15/70patients jian m, li y, han m et al(18) rt-pcr 6/29 patients lan l, xu d, ye g et al(16) rt-pcr 4 patients li et al(21) rt-pcr 18/610 patients zhou l, liu q et al(22) rt-pcr 14% patients current study rt-pcr 12* mean value of anti-sars-cov-2 immunoassay by eclia was 35.93±31.4 (this is a qualitative test; significance of this numerical value is not known). qualitative elisa for igg antibodies were positive in 284 out of 330 donors (86%). mean igg antibody titer was >1:160-fold serum dilution (range >1:80 >1:320). quantitative elisa for igg was detected in 282 donors (85.4%) with a mean 59.74 ± 35.90 (cut off: 8.0 u/ml) and range (9.98 100 u/ml). this means that further 46 donors did not develop igg anti-sars-cov-2 antibodies. subsequently, lfia method was able to detect igg antibodies in 20 of 48 (41.6%) seronegative donors and in 20 of 35 (58.8%) eclia positive elisa negative donors. table 3: comparison of covid-19 seropositive and seronegative donors elecys results positive negative p value age(mean± sd) 36.43 ± 10.7 34.10 ± 12.3 0.266a 20 (55%) 3 (9%) 3 (9%) 3 (9%) 2 (6%) 2 (6%) 2 (6%) 0 5 10 15 20 25 london usa turkey dubai china europe south africa exposure history: present-35 (travel), absent-165 1 donor has contact history with a relative with travel history. lmrj volume 4 issue 1 10 | p a g e sex male (n) female(n) 126 25 26 04 0.660b facility where admitted/quarantine hospital (n) home(n) 17 134 4 26 0.746b days of quarantine (mean± sd) 16.05 ± 6.3 15.50 ± 4.4 0.236a comorbids yes no 13 138 3 27 0.806 b a = independent ttest, b= chisquare test table 4: performance of lfia technique in seropositive and seronegative covid-19 patients eclia positive & igg negative (n=17) igg +ve& igm –ve (n=14) igg -ve& igm –ve (n=3) eclia positive & igg positive (n=4) all 4 were igg +ve and igm -ve eclia negative & igg negative (n=24) igg -ve& igm –ve (n=12) igg +ve& igm –ve (n=10) igg -ve& igm +ve (n=2) sars-cov-2 assay kit (lateral flow immunoassay), shenzhen lifotronic technology co., ltd, shenzhen, china discussion convalescent plasma donation is one of the experimental treatment options for covid-19 and has been approved as a trial in a number of countries like united states of america and britain. the therapeutic benefits of convalescent plasma were studied formally in animal models in early 20th century. in 1916, convalescent plasma from polio survivors was administered to poliomyelitis patients(27) to determine its efficacy followed by influenza(31)and measles(28, 29) and recently in sars(34), mers(35), and ebola virus diseases(33). in pakistan, this trial for experimental use of covid-19 convalescent plasma for the purpose of passive immunization was approved by national bioethics committee on april 4 and by drug regulatory authority of pakistan (drap) on april 9th, 2020 and the first donation was taken on april 15th. detection of covid-19 rna was found in a number of published studies, in which after rt-pcr negativity on 2 consecutive samples (table 2), subsequent rt-pcr testing showed viral rna again. our study was designed to make sure that at the time of plasma donation, all the donors should not have any evidence of the presence of covid-19 rna and there should be documented evidence of the presence of anti-sars-cov2 antibodies in their serum. plasma donations were acceptable from the donors who have at least 2 negative pcr reports 24 to 48 hours apart almost 2 weeks prior to donation, as per fda guidelines(6) . total antibodies are considered to be the most sensitive and earliest serological markers and increment in their levels start to appear after the first week of symptoms onset(8). test using nucleocapsid antigens and receptor binding domain combined are the most sensitive(12). seventy of our 400 donors did not show igg antibodies after≥2 weeks of pcr negative results, which is in contrast to the findings in others studies which state that higher levels of igg and igm elisa occur in the second and third week(9,10), and may persist for lmrj volume 4 issue 1 11 | p a g e 2 years(11), however they can be positive as early as on fourth day after onset of symptoms. in contrast, according to cdc’s (center for disease control) current guidelines, some patient’s body’s immune response may take longer time to develop immunity(23), resulting in a negative antibody result. another interesting finding was when subsequently, lfia kit became available, seronegative donors’ sam‐ ples were analyzed who were either seronegative with eclia and elisa kits or showed a positive reaction to eclia but no evidence of igg on elisa, a good number of them detected presence of igg in those sera. this may be due to different sensitivity of these kits, a false positive/negative result or their differing target antigens in the testing system. in our study, viral rna for sars-cov-2 was detected in 12 donors. out of these, 9 had concomitant quantitative igg antibodies (elisa) for sars-cov-2 and 3 showed negative antibody results. according to a study rt-pcr has been detected even beyond week 6 following the first positive test(7). our results showed a lower number of seroconversions (82.5%) as compared to chinese studies. if we add up lfia detected igg results in the initial cohort, then igg positivity has risen to 89%. this may be due to the fact that most of our donors (89%) had milder disease and did not require hospitalization. in contrast, chen d et al(13), zhang j fen et al(14), huang p et al(15) reported recurrence of rt-pcr positivity on oropharyngeal swab specimen in one patient each, after 2 consecutive negative pcr results. another study reported 4 patients with covid-19, who met criteria for hospital discharge or discontinuation of quarantine, to be positive on rt-pcr, 5 to 13 days later(16). other studies, however reported a higher trend of recurrence, as 21.4% (15/70) and 20% (6/29) by xiao at (17)and jiang m (18), respectively. all these studies suggested that initial negative results may be due to various reasons such as variable viral load, sample site, technical expertise, effect of antiviral drugs, hormonal therapy taken, sensitivity of nucleic acid detection kit, false negative results or prolonged nucleic acid conversion. given the chance of recurrent positive sars-cov-2 rna in the clinical course and to minimize the risk of spread in other covid-19 cases, together they suggested that different specimen types to be analyzed at a time, such as oropharyngeal/nasopharyngeal, etc, larger samples to be taken, more than one method like serology testing should be considered combined with rna testing. the patients in recovery phase should also be regularly tested for assessment of infectivity, all discharged patients should be ensured for at least 14 days home quarantine and rt-pcr test results of pharyngeal swab specimens should not be considered as the only one indicator for diagnosis, treatment, isolation, recovery or discharge and transferring for hospitalized patients. rtpcr detection of viral traces cannot always be correlated with the ability of transmission (13,14,18,21,22). in a report on 9 patients, viral isolation attempts in culture were un-successful beyond day 8 of onset of illness , which points towards decline of infectivity beyond the first week(24). that is why the “symptombased strategy” of the centers for disease control and prevention (cdc) indicates that health care workers can return to work, if “at least 3 days (72 hours) have passed since recovery defined as resolution of fever without the use of fever-reducing medications and improvement in respiratory symptoms (e.g., cough, shortness of breath); and, at least 10 days have passed since symptoms first appeared”.(25) this is a large scale study with concomitant antibody testing with rt-pcr, use of 2 different assays for the detection of anti-sars-cov-2 antibodies, selection of patients at least 14 days after last pcr negative or 28 days from start of symptoms. however, use of single nasopharyngeal/oropharyngeal swab sample only in each patient, current rt-pcr techniques for sars-cov-2 detection has almost 25-30% chance of false negative results were the limitations of the study. inability to check for neutralizing antibodies at the time of this paper submission and a possible patient selection bias cannot be completed excluded, as all the donors were healthy volunteers recovered from covid-19. conclusion we conclude that 29% recovered covid-19 patients did not show igg humoral immune response at least 2 weeks after negative rt-pcr result in our cohort. although, additional testing with lfia kit reduced it to lmrj volume 4 issue 1 12 | p a g e 11% only. however, a majority of them had concomitant igg antibodies and only 0.75% had isolated pcr positivity in asymptomatic recovered patients from covid-19 donors. current serological diagnostic kits have limitations as they are first generation kits. covid-19 is a novel disease and scientific data is adding up on daily basis. better kits are needed to accurately diagnose seroconversion status for covid-19 in general population. conflict of interest statement all the authors declared no conflict of interest. trial registration: drap registration no: f.no.17-8/2020 dd (ps), nbc registration no: nbc-472 covid19-03, nih id: nct04352751 acknowledgement we acknowledge the humanitarian support by convalescent plasma donors and well-wishers who motivated the donors. sindh blood transfusion authority and dr mesum abbas for their technical support. we are also thankful to staff of passive immunization , nibd especially: waqas javed, asif samad, abdul wahab, nazim hussain, neha, faraz ali, urooba aslam, aimen muzammil, shakir ahmed, anila ali and all supporting staff from across the country sites for untiring work for this project. hilton pharma provided an unrestricted research grant for this clinical trial in this testing time of pandemic. special thanks to dr ahsonqavi and dr neeta maheshwari of hilton pharma medical department for providing technical support in this trial. references 1. https://www.who.int/emergencies/diseases/novel-coronavirus-2019 2. http://covid.gov.pk/ 3. garraud o. use of convalescent plasma in ebola virus infection. transfusaphersci.2017;56:31-4. 4. zhou g, zhao q. perspectives on therapeutic neutralizing antibodies against the novel coronavirus sars-cov2. int j biol sci 2020; 16:1718-23. 5. cunningham ac, goh hp, koh d. treatment of covid-19: old tricks for new challenges. crit care. 2020;24-91. 6. j epstein, t burnouf. points to consider in the preparation and transfusion of covid-19 convalescent plasma. vox sang. 2020 may 14 : 10.1111/vox.12939 7. sethuraman n, jeremiah ss, ryo a. interpreting diagnostic tests for sars-cov-2. jama. published online may 06, 2020. doi:10.1001/jama.2020.8259 8. lou b, li t, zheng s, et al serology characteristics of sars-cov-2 infection since the exposure and post symptoms onset.preprint posted march 27, 2020. https://www.medrxiv.org/content/10.1101/2020.03.23.20041707v1.full.pdf 9. to kk-w, tsang ot-y, leungw-s, et al. temporal profiles of viral load in posterior oropharyngeal saliva samples and serum antibody responses during infection by sars-cov-2: an observational cohort study. lancet infect dis. 2020;20(5):565-574. 10. xiang f,wang x, he x, et al. antibody detection and dynamic characteristics in patients with covid-19. clin infect dis. 2020;ciaa461. published online april 19, 2020. 11. lin q. duration of serum neutralizing antibodies for sars-cov-2: lessons from sars-covinfection.jmicrobiol immunol and infect.doi: 10.1016/j.jmii.2020.03.015 https://www.who.int/emergencies/diseases/novel-coronavirus-2019 http://covid.gov.pk/ https://www.medrxiv.org/content/10.1101/2020.03.23.20041707v1.full.pdf https://dx.doi.org/10.1016%2fj.jmii.2020.03.015 lmrj volume 4 issue 1 13 | p a g e 12. to kk-w, tsang ot-y, leungw-s, et al. temporal profiles of viral load in posterior oropharyngeal saliva samples and serum antibody responses during infection by sars-cov-2: an observational cohort study. lancet infect dis. 2020;20(5):565-574. 13. chen d, xu w, lei z, et al. recurrence of positive sars-cov-2 rna in covid-19: a case report. int j inf dis. 2020;93:297–299. 14. zhang j-feng, yan k, ye h-hua, et al. sars-cov-2 turned positive in a discharged patient with covid-19 arouses concern regarding the present standard for discharge, int j inf dis (2020).https://doi.org/10.1016/j.ijid.2020.03.007 15. huang p, liu t, huang l, et al. use of chest ct in combination withnegative rt‐pcr assay for the 2019 novel coronavirus but highclinical suspicion. radiology. 2020:200330‐200332. 16. lan l, xu d, ye g, et al. positive rt-pcr test results in patients recovered from covid-19. jama. 2020 apr 21;323(15):1502-3. 17. xiao at, tong yx, zhang s. false‐negative of rt‐pcr and prolonged nucleic acid conversion in covid‐19: rather than recurrence. j med virol.2020 apr 9;10.1002/jmv.25855. 18. minlin jiang,a,b,1 ya li,c,1 mingli han, et al. recurrent pcr positivity after hospital discharge of people with coronavirus disease 2019 (covid-19). j infect. 2020 jul; 81(1): 147–178 19. xu kaijin, cai hongliu, shen yihong, et al. management of corona virus disease-19 (covid-19): the zhejiang experience. journal of zhejiang university (medical sciences). 2020, 49(1): 1-12. 20. laboratory testing for 2019 novel coronavirus (2019-ncov) in suspected human cases interim guidance. 17 january 2020. https://www.who.int/emergencies/diseases/novel-coronavirus-2019/technicalguidance/ laboratory-guidance. 21. li y, yao l, li j, et al. stability issues of rt‐pcr testing of sars‐cov‐2 for hospitalized patients clinically diagnosed with covid‐19. j med virol. 2020;1–6. 22. zhao j, yuan q, wang h, et al. antibody responses to sars-cov-2 in patients of novel coronavirus disease 2019. clin infect dis2020 mar 28;ciaa344. 23. https://www.cdc.gov/coronavirus/2019-ncov/covid-data/serology-surveillance/ 24. wölfel r, corman vm, guggemosw, et al. virological assessment of hospitalized patients withcovid-2019. nature. 2020. published online april 1, 2020. doi:10.1038/s41586-020-2196 25. cdc. return-to-work criteria for healthcare workers. updated april 30, 2020. accessed may 3,2020. https://www.cdc.gov/coronavirus/2019-ncov/hcp/return-to-work.html 26. casadevall a, scharff md. serum therapy revisted:animal models of infection and developmentof passive antibody therapy. antimicrob agentschemother. 1994; 38(8):1695–1702. 27. park wh. therapeutic use of antipoliomyelititsserum in preparalytic cases of poliomyelitis.jama. 1932;99:1050–1053. 28. park wh, freeman rg. the prophylacticuse of measles convalescent serum. jama.1926;87(8):556–558. 29. gallagher jr. use of convalescent measlesserum to control measles in a preparatoryschool. am j public health nations health.1935;25(5):595–598. 30. rambar ac. mumps; use of convalescent serumin the treatment and prophylaxis of orchitis. amj dis child. 1946;71:1–13. 31. luke tc, casadevall a, watowich sj, et al. passive immunotherapy for influenza andother serious infections. crit care med.2010;38(4 suppl):e66–e73. 32. hung if,kkw to, c-k lee,et al. convalescent plasma treatmentreduced mortality in patients with severe pandemicinfluenza a (h1n1) 2009 virus infection.clin infect dis. 2011;52(4):447–456. https://www.who.int/emergencies/diseases/novel-coronavirus-2019/technicalguidance/ https://www.cdc.gov/coronavirus/2019-ncov/covid-data/serology-surveillance/ https://www.cdc.gov/coronavirus/2019-ncov/hcp/return-to-work.html lmrj volume 4 issue 1 14 | p a g e 33. sahr f,ansumana r, t.a. massaquoi ta et al.evaluation of convalescent wholeblood for treating ebola virus disease in freetown,sierra leone. j infect. 2017;74(3):302–309 34. cheng y,wong r, soo y, et al. use of convalescent plasma therapy in sars patients in hong kong. eur j clin microbiol infect dis. 2005;24(1):44–46. 35. ko jh, seok h, cho syet al.challenges of convalescent plasma infusion therapy in middle east respiratory coronavirus infection: a single centre experience. antivirther (lond). 2018;23(7):617–622. type of the paper (article lmrj volume 4 issue 02 63 | p a g e original article hemostatic and thrombotic parameters in acute leukemia– a comparison of pre and post remission induction phase tehmina nafees sonia khan 1, mohammad tariq masood2, zara tul ain bashir1, tasneem farzana1, abdul sattar 1, tahir shamsi3 1sir syed college of medical sciences, karachi, pakistan, 2northwestern medical college, peshawar 3 national institute of blood diseases and bone marrow transplantation, karachi, pakistan abstract this study was aimed to compare hemostatic, fibrinolytic and thrombotic parameters in pre and post induction chemotherapy in acute myeloid leukemia (aml) and acute lymphoid leukemia (all). a total of 110 diagnosed acute leukemia patients and 40 normal individuals were enrolled in the study. questionnaire were filled and patients’ blood specimens were collected before the commencement and post induction chemotherapy. prothrombin time (pt), activated partial thromboplastin time (aptt), von willebrand factor antigen (vwf ag), fibrinogen level, factor viiic (fviiic), d-dimers, fibrinogen degradation products (fdps), anti-thrombin iii (at), lupus anticoagulant (la), protein c (pc), protein s and diluted russel viper venom test (drvvt) were conducted in all the participants. a significant rise was identified in post-induction levels of pt, aptt, vwf ag, fibrinogen and factor viii in acute leukemia patients. analysis of fibrinolytic markers indicated increased d-dimers and plasminogen levels while the levels of alpha 2 anti-plasmin were reduced in pretreated patients. thrombotic markers’ assessment showed increased levels of at and la while decreased level of pc in pretreated acute leukemia patients. it was concluded that remission induction chemotherapy, in acute leukemia patients, significantly affects the coagulation, fibrinolytic and thrombotic parameters key words: hemostasis, thrombotic markers , fibrinolysis, pre and post induction chemotherapy, leukemia introduction impairment of hemostatic, fibrinolytic and thrombotic activities are frequently associated with hematological malignancies (1). thrombosis was reported in patients with acute lymphoblastic leukemia on l-asparaginase therapy (2, 3). thrombosis in these patients usually occurs as a result of disturbances in the anticoagulant and fibrinolytic systems (4). hemostatic manifestations are not solely due to anticoagulant and fibrinolytic system disturbances; it is also associated with prolonged thrombocytopenia in these patients after the administration of chemotherapeutic drugs (5). it was noted that risk of bleeding was reduced in patients with acute leukemia receiving platelet transfusions prophylactically and therapeutically (6). acute promyelocytic leukemia is associated with life threatening condition of disseminated intravascular coagulation. coagulopathy in apl has been studied extensively but several reports on all, especially in children, noticed that occurrence of dic in adult all was 10% before treatment and 78% during remission induction therapy (7, 8). correspondence: dr. tehmina nafees assistant professor department of pathology sir syed college of medical sciences, karachi, pakistan email: dr_tehmina@yahoo.com doi: 10.38106/lmrj.2022.4.2-03 received: 10.05.2022 accepted: 26. 06.2022 published: 30. 06.2022 mailto:dr_tehmina@yahoo.com mailto:dr_tehmina@yahoo.com lmrj volume 4 issue 02 64 | p a g e clinically non-significant bleeding manifestations were observed in patients with all (9). primary activation of inflammatory mediators and proteases by severe infection, chemotherapeutic agents and secondary activation of fibrinolysis may play a role in compensation of activated coagulation in patients with leukemia (10). formation of thrombin-antithrombin complex due to activation of prothrombin fragment 1+2 and as well as generation of thrombin increment produces pre-thrombotic state which can be identified by a thrombotic marker (f1+2) (11). strandberg et al 2001 indicated von willebrand factor defects in patients with acute leukemia (12). leukemic cells produce procoagulants, plasminogen activators, proteinase in blood circulation resulting in proteolytic degradation of vwf (13). however, there is limited local data available on this aspect of acute leukemia. identification of changes in hemostatic parameters in acute leukemia in pretreatment, post remission induction may help in reducing the morbidity and mortality rate by initiating early intervention for management of thrombosis and bleeding complications. therefore, this study was designed to evaluate the hemostatic, fibrinolytic and thrombotic changes in patients with de novo aml and all prior to start of induction treatment and after the therapy. methods the study was an observational study conducted at the department of biochemistry, university of karachi, pakistan and the department of hematology, national institute of blood disease and bone marrow transplantation (nibd), karachi, pakistan from may 2011 to march 2012. patients with confirmed diagnosis of acute leukemia were recruited into including newly diagnosed and those in remission phase (n=110). a total of 40 age matched controls were included. those with ambiguous diagnosis, history of hereditary bleeding disorder, or thromboembolic disease were excluded. diagnosis of acute leukemia was established by a hemato-pathologist and verified by a panel of hematologists, according to the who classification. study individuals were divided according to the following schema. controls age matched control n=40 aml day 0 newly diagnosed cases of acute myeloid leukemia n=27 aml day 28 remission induction in acute myeloid leukemia n=16 all day 0 newly diagnosed cases of acute lymphoblastic leukemia n=38 all day 28 remission induction in acute lymphoblastic leukemia n=29 laboratory methods the hemostatic, fibrinolytic and thrombotic markers were analyzed at day 0 and 28 of treatment in patients as well as in controls. 65 patients including 27 of aml and 38 of all were newly diagnosed (at day 0) while 45 patients including 16 of aml and 29 of all received remission inductions. six ml venous blood sample was collected from controls and patients at the time of diagnosis and at day 28 post chemotherapy. blood sample was collected in 3.2% trisodium citrate with a ratio of 9:1. platelet free plasma was separated after centrifugation at 2000 x g for 20 minutes within 2 hours of blood collection and stored in blue coded cryo vials at -80c till analysis. lmrj volume 4 issue 02 65 | p a g e complete blood counts including platelet count were performed on automated hematology analyzer sysmex xe-2100® (sysmex kobe, japan). peripheral blood smears were stained with romanowsky’s stain and observed under microscope. prothrombin time (pt), activated partial thromboplastin time (aptt), quantitative determination of fibrinogen and determination of factor viii activity (fviiic) was done by clotting method. quantitative determination of von willebrand factor antigen (vwf ag), d-dimers and free protein s (ps) was carried out by immunoturbidimetric method. qualitative and semi-quantitative determination of fibrinogen degradation products (fdps) was carried out by latex agglutination method. determination of plasminogen, antiplasmin and antithrombin iii (at) activity was performed by synthetic chromogenic substrate. quantitative determination of functionally active protein c (pc) was done by chromogenic method. screening of factor v leiden was performed by coagulometric method based on modified aptt with pre-dilution in factor v deficient plasma. screening of lupus anticoagulant sensitive aptt was conducted by clotting methods. detection of lupus anticoagulant was carried out by simplified diluted russel viper venom test (drvvt) method in one stage clotting test. statistical methods for quantitative analysis meansd, minimum and maximum range, 95% confidence were calculated, while frequency and percentages were calculated for qualitative variables. independent sample t-test was used to evaluate mean differences between control and cases of both types of acute leukemia. a p-value of <0.05 was considered significant. results total 110 diagnosed acute leukemia patients, including 75 males and 45 females were included in this study along with 40 healthy controls for comparison. mean age of patients was 25.313.8 (range 1 to 65years). mean leukemic cell counts were high at day 0 as compared to day 28 patients while platelet counts were reduced at day 0 as compared to control group. however, leukemic cells decreased, and platelet count increased at day 28 than day 0. mortality rate was higher in aml at day 28 than all whereas equal incidence of death was found in both type of leukemia at day 0 of treatment. the hemostatic, fibrinolytic, and thrombotic markers were analyzed in plasma of aml and all patients at day 0 and 28 of treatment. prothrombin time significantly increased in aml and all patients at day 0 as compared to control as well as in pretreated than treated cases of aml (p<0.05), whereas no difference was observed in case of all (p>0.05). the aptt was significantly increased in aml and all at day 0 and 28 but no statistically significant difference found in between the both type of acute leukemia in pre and post treatment phases. plasma levels of fibrinogen were higher as compared to controls in both types of acute leukemia in pre and post treatment phase(p<0.05) while at day 28 markedly increased in aml and all as compared to day 0(<0.01). factor viii level showing increased pattern at day 0 and 28 in both type of acute leukemia as compared to control (p<0.01). von willebrand antigen levels were significantly higher in both phases of aml and all (p<0.01) whereas no difference was noticed in between at day 0 and 28 in cases of aml. lmrj volume 4 issue 02 66 | p a g e table 1. a summary of the comparison of controls and acute myeloid leukemia and acute lymphoid leukemia markedly elevated levels of d-dimer in aml and all at day 0 and 28 compared to control(p<0.01) was observed but showed significant reduction at day 0 in aml and all as compared to day 0 (p<0.01). alpha 2 anti-plasmin significantly reduced as compared to control (p<0.01) in aml and all at day 0 but at day 28 significantly higher whereas no difference was observed in between day 0 and 28 of aml and all cases. levels of plasminogen were higher at day 28 but not significantly reduced as compared to controls. protein c significantly reduced in aml and all in both phases as compared to control except in cases of all at day 28. free protein s and factor v leiden did not show any significant association with acute leukemia. antithrombin iii was raised significantly in aml at day 0 and in all at day 28 although no statistical difference was observed in all. lupus anticoagulant was higher in acute leukemia in both phases (p<0.01) while at day 28 more increased as compared to pretreatment which was statistically significant (p<0.01). findings in table no.2 describes non overt dic <5 score and overt dic >5 in acute leukemia at day 0 and 28. strong association of dic was found in aml and study population variable healthy individuals aml all groups c= 40 ndm= 20 rim=16 ndl=25 ril=25 age (years) 29.5±4.5 (24-38) 30.8±13 (15-65) 29.0±18 (4-50) 21.6 ± 11.1 (1– 38) 19.9 ± 13.3 (1 – 59) male 20 (50%) 10 (50%) 09 (56.2%) 19 (76%) 18(72%) female 20 (50%) 10 (50%) 07 (43.7%) 06(24%) 07(28%) hb (g/dl) 14.6±0.8 (12.4-16.7) 9.1±1.7 (6.2-12) 10.3±0.8 (9.2-11.9) 9.2 ± 1.7 (5.9 – 12.7) 10.7 ± 2.2 ( 7.6 – 16.1 ) white cells x109/l 7.2±1.35 (4.5-11.8) 48.6±40.6 (0.38-121.7) 2.3±4.4 (0.2±16.8) 48.6±40.6 (0.3-121.7) 6.9 ± 7.6 (0.08 – 27.0 ) platelet x109/l 255.7±43.1 (142-360) 24.5±15.8 (3-59) 76.2±72.7 (10-253) 33.9 ± 38.9 (5-183) 181 ± 156 ( 7573 ) blast % np 72.5±32.6 (7-100) 1.2±2.6 (007) 51.2 ± 29.6 ( 8 – 96 ) 1.2±2.6 (007) lmrj volume 4 issue 02 67 | p a g e all at day 0. non overt dic did not show any significant association with specific type of acute leukemia and it was equally expressed in both type of acute leukemia at day 0 and 28. (table:2) frequency of gum bleeding (21%) and bruises (12%) was observed marked in aml patients. epistaxis (12%) was observed more in all patients. table 2. dic score and association with leukemia’s aml n(%) all n(%) dic score day 0 day 28 day 0 day 28 < 5 15 (55.56%) 16 (100%) 30 (78.94%) 27 (93.1%) > 5 12 (44.44%) 0 (0.0%) 8 (21.06%) 2 (6.9%) discussion the patients with acute leukemias are at high risk of both hemorrhage and thrombosis. coagulation parameters have been studied and found that in both aml and all cases pt and aptt were significantly prolonged indicating coagulation factors derangement. post chemotherapy results indicated the improvement of pt and aptt in aml while no significant results observed in all. kwaan et al found that chemotherapy decreases the blast cell may be helpful in decreasing the pt, aptt levels. chemotherapy l –asparginase is used to treat all patients, decreases the hepatic production in clotting factors, results no change of pt level was observed (14). cysteine proteinease is a cancer procoagulant is present in aml and all patients. this proteinase activates the factor x, increased generation of thrombi and utilized the coagulation factors, aggravate thrombotic complications. increased production of thrombin by factor x, further acts to convert fibrinogen to fibrin and results prolonged pt and aptt (15). acute liver failure is reported in course of acute leukemia which further affects the cascade of coagulation and deranged the clotting factors (16). factors viii demands vwf for transportation. factors viii and vwf was increased in aml and all patients. after chemotherapy, these factors reduced indicated as cancer cells decreased, they tend to decrease the factor viii production by decreasing the procoagulants (17). the derangements of thrombotic markers were also observed in present investigation. low level of protein c was found in aml and all pretreated patients. while increased antithrombin iii and lupus was found significantly in both leukemias. this may predispose to venous thrombosis as described by dixit and troy (18, 19). the investigation of fibrinolytic factors also showed the derangements in both leukemias. an increased generation of fdpss was found due to an increases degradation of fibrin as described by ketsueki et al. at day 28, both aml and all showed improved status of fdpss. while decreased plasminogen was observed in both pre and post treated leukemic patients. ketsueki et al, was found in their investigation that in leukemic patients the tissue plasminogen activator level was increased which tends to convert the plasminogen into plasmin. this plasmin acts on fibrin and formed more fdpss. increased generation of plasmin increases cross linked fibrin that lmrj volume 4 issue 02 68 | p a g e leads to the formation of linked oligomers called d-dimers. d-dimers were also increased in patients with all and aml and decreased post chemotherapy due to the reduced formation of fibrin (20). alpha 2 antiplasmin usually binds with plasmin and inactivating it for downstream events. we investigated the increased level of alpha 2 antiplasmin in pre and post chemotherapy. increased generation of plasmin is the evidence of increased consumption of plasminogen. and plasmin acts on fibrin to form fdpss and nothing available to binds with a2ap, thus increases its level. lupus anticoagulant is serving as prothrombotic agent and initially is thought to be present in lupus erythematosus but now found to be present in leukemias as well. it is anti-lipid antibody and interferes both intrinsic and extrinsic coagulation cascades thus help in increasing the pt, aptt level which is found in present investigation as well. leukemic cells trigger the b cells to produce more antibodies abnormally, lupus anticoagulant is one of them. leukemic cells via cytokines activate b cell to produced antiphospholipid antibodies including lupus anticoagulant. we also investigated the increased level of lupus anticoagulant in aml and all patients significantly (21). global parameters like platelet count, pt, fibrinogen and d-dimer were used to score the level of dic. fdpss are valuable diagnostic tool for monitoring the dic. elevated level of fdpss indicates the persistence of dic while low level indicates decline of intravascular clotting. at day 0 in patients with aml 44% cases had underlying overt dic (>5.0) but 0% cases after induction of chemotherapy whereas in all no statistically significant difference was noted. this finding is consistent with other studies (23, 24). conclusion in conclusion, the leukemia patients are at high risk of bleeding, therefore supportive blood products should be administered, and serial laboratory monitoring of bleeding and thrombotic manifestations are required by using global hemostatic parameters in untreated patients, during and after the treatment. early detection of thrombotic and hemostatic defects and active intervention will help in reducing the morbidity and mortality due to hemorrhage and thrombotic complications and provide better survival with good quality of life. acknowledgement we would like to thank all technical staff at the diagnostic lab and outpatient department for their contribution in collection and processing of samples, patients and their attendants for their participation and cooperation in this study. conflict of interest authors declare no conflict of interest. ethical consideration for ethical issue, all participants and their legal guardians gave informed consent, and their confidentiality and anonymity were protected. funding the study was conducted from departments own resources no additional funds required. lmrj volume 4 issue 02 69 | p a g e references 1. speiser w, pabinger-fasching i, kyrle pa, kapiotis s, kottas-heldenberg a, bettelheim p, lechner k. hemostatic and fibrinolytic parameters in patients with acute myeloid leukemia; activation of blood coagulation, fibrinolysis and unspecific proteolysis. blut 1990; 61: 298-302. 2. frantzeskaki f, rizos m, papathanassiou m, nikitas n, lerikou m, armaganidis a, dimopoulos g. am j case rep. 2013 aug 14;14:311-4. 3. hongo t, okada s, ohzeki t, ohta h, nishimura s, hamamoto k, yagi k, misu h, eguchin, suzuki n, horibe k, ueda k. low plasma levels of hemostatic proteins during the induction phase in children with acute lymphoblastic leukemia: a retrospective study by the jacls. japan association of childhood leukemia study. pediatr int 2002; 44: 2939. 4. toft n, birgens h, abrahamsson j, griskevicius l, hallbook h, heyman m, klausen tw, jonsson og, palk k, pruunsild k, quist-paulsen p, vaitkeviciene g, vettenranta k, asberg a, helt lr, frandsen t, schmiegelow k. eur j haematol. 2016;96(2):160-9. 5. webert k, cook rj, sigouin cs, rebulla p, heddle nm. the risk of bleeding in thrombocytopenic patients with acute myeloid leukemia. haematologica 2006; 91: 1530-7. 6. dayama a, dass j, seth t, mahapatra m, mishra pc, saxena r. indian j cancer. 2015 julsep;52(3):309-12. 7. tallman ms, kwaan hc. reassessing the hemostatic disorder associated with acute promyelocytic leukemia. blood 1992; 79: 54353. 8. solano c, lópez j, gómez n, fernandez-rañada jm. acute lymphoblastic leukemia: hypofibrinogenemia with a low incidence of clinical complications is often found during induction remission therapy. blood 1992; 80:1366-8. 9. sarris a, cortes j, kantarjian h, pierce s, smith t, keating m, koller c, kornblau s, o'brien s, andreeff m. disseminated intravascular coagulation in adult acute lymphoblastic leukemia: frequent complications with fibrinogen levels less than 100 mg/dl. leuk lymphoma 1996; 21: 85-92. 10. martí-carvajal aj, anand v, sola i. the cochrane database of systematic reviews. 2015 24;6: 11. brummel-ziedins ke, vossen cy, butenas s, mann kg, rosendaal fr. thrombin generation profiles in deep venous thrombosis. j thromb haemost 2005; 3: 2497-505. 12. strandberg k, bhiladvala p, holm j, stenflo j. a new method to measure plasma levels of activated protein c in complex with protein c inhibitor in patients with acute coronary syndromes. blood coag fibrinolysis 2001; 12: 503-10. 13. federici ab, d'amico ea. the role of von willebrand factor in the hemostatic defect of acute promyelocytic leukemia. leuk lymphoma 1998; 31: 491-9. 14. kwaan hc. double hazard of thrombophilia and bleeding in leukemia. hematol am soc hematol educ prog 2007:151-7. 15. zaki s, burney ia, khurshid m. acute myeloid leukemia in children in pakistan. j pak med assoc 2002; 52: 247-9. 16. cesur s, topuoulu p, apik o, burengel s, zcan m. acute hepatic failure in a case of acute lymphoblastic leukemia. turk j med sci 2004; 34: 275-9. lmrj volume 4 issue 02 70 | p a g e 17. klingemann hg, kosukavak m, höfeler h, havemann k, hoppe seylers z. fibronectin and factor viii-related antigen in acute leukaemia. physiol chem 1983; 364: 269-77. 18. dixit a, kannan m, mahapatra m, choudhry vp, saxena r. roles of protein c, protein s, and antithrombin iii in acute leukemia. am j hematol 2006; 81: 171-4. 19. troy k, essex d, rand j, lema m, cuttner j. protein c and s levels in acute leukemia. am j hematol 1991; 37: 160. 20. ketsueki r. persistent discrepancy between fdps and d-dimer in a patient with acute leukemia. rinsho ketsueki 1995; 36: 212-7. 21. ediriwickrema ls, zaheer w. diffuse large cell lymphoma presenting as a sacral mass and lupus anticoagulant. yale j biol med 2011; 84: 4338. 22. toh ch, hoots wk. the scoring system of the scientific and standardisation committee on disseminated intravascular coagulation of the international society on thrombosis and haemostasis: a 5-year overview. j thromb haemost 2007; 5: 604-6. 23. falanga a, rickles fr. pathogenesis and management of the bleeding diathesis in acute promyelocyticleukaemia. best pract res clin haematol 2003; 16: 463-82. 24. wilde jt, kitchen s, kinsey s, greaves m, preston fe. plasma d-dimer levels and their relationship to serum fibrinogen/fibrin degradation products in hypercoagulable states. br j haematol 1989; 71: 65-70. type of the paper (article lmrj volume 4 issue 03 108 | p a g e original article mini-pcnl in pediatric patients with large renal stones a safety data kashif ahmed khan1, waqar ahmed memon1, javed altaf jat1, ali raza jaffery1, adeel hyder arain1, salman el khalid2 1department of urology, liaquat university of medical & health sciences jamshoro, pakistan, 2kidney centre karachi, pakistan abstract percutaneous nephrolithotomy (pcnl) is a recent advancement in the management of urolithiasis, it has now become the gold standard. this study aimed to assess the safety of mini pcnl in pediatric patients with large renal stones. this cross-sectional study included pediatric patients (n=12) who underwent mini-pcnl. age, gender, number of stones, size of stones, and position in the renal system were documented. the mean age of the patients in the study was 7.67 years. the stones ranged from 10 mm to 20 mm with a mean size of 10 mm. complete clearance of stones was achieved in 83.7%. 16.7% had incomplete clearance with clinically insignificant residual stones (i.e. < 4mm) requiring no further treatment except follow-up. the major complication in our series was hydroperitoneum in one patient, which was identified and managed by placing the intraperitoneal drain. patients were discharged from the hospital on or before 3rd postoperative day. the study concludes that mini-pcnl method is effective, safe, and economical for the removal of renal calculi in the paediatric age group. further large scale studies exploring methods to lessen its morbidity would be recommended specially in patients with renal stone complications like hydroperitoneum. key words: minipcnl, urolithiasis, renal stone pediatric patients introduction urolithiasis are defined as the stones in the renal system / kidney. regardless of age strandarization, the incidence of urolithiasis has increased during the past few years with the recent rate of almost 9% per annum (1). the preventive measures and advancement in the management have not yet reduced incidence, neither related complication appears to be declined. the resultant complications of morbidity in all age groups and carries a significant economic burden as when they produce pain its an acute emergency and patients are devastated. thus the cost of surgery and the days out of work produce both direct and indirect burden over economy(2, 3). urolithiasis in children is also common, but the new surgical techniques are mainly directed to explore the outcome in adults. percutaneous nephrolithotomy (pcnl) has been introduced for large kidney stones and now being used as the gold standard treatment. the tools utilised have been miniaturised during the last 20 years to reduce surgical procedure-related morbidity such as standard pcnl and boost the effectiveness of removal of the stone. mini‐percutaneous nephrolithotomy (mpcnl) was introduced to treat children with the added benefit of reduced blood loss. given the low blood volume in children blood loss is the major and potentially lethal complication. depending upon correspondence: dr. waqar memon department of urology, liaquat university of medical & health sciences, jamshoro, pakistan. email: drwaqarmemon@yahoo.com doi: 10.38106/lmrj.2022.4.304 received: 02.06.2022 accepted: 21. 09.2022 published: 30. 09.2022 mailto:drwaqarmemon@yahoo.com mailto:drwaqarmemon@yahoo.com lmrj volume 4 issue 03 109 | p a g e the track size i.e. 14fr and 22fr the procedure is termed as mini-perc, or mini-pcnl (mpcnl). however, clear demarcation of the size and names still not exist (4). the primary purpose of the procedure is to remove the stone with minimal complications, where removal of stone capacity should be similar to conventional pcnl, but the rate of complications per operative or postoperative must be inferior to the conventional procedure. the size of the tract has significant influence on the rate of complications both during surgery and post-operatively (5). on the other hand, small tract size may make the stone removal difficult and prolonged surgical procedure causing anaesthesia-related complications(6). the increasing rate of paediatric patients with urolithiasis has diversified the management. thus this study was conducted to evaluate the safety during procedure and immediate post-operative period to make clear guidelines and design signposts for surgeons so that morbidity and mortality can be reduced and patients with clear indications and minimal risk can be identified. methods a total of 12 pediatric patients were recruited in this study, their per-operative and post-operative data were collected and analyzed. these all patients underwent mpcnl at the department of urology, liaquat university of medical and health sciences jamshoro, pakistan between july 2018 to october 2018. patients included in the study were seen at urology clinic and planned for mpcnl. they were aged between 4 to13 years with normal renal function and mean stone size was 10 mm. the patients were thoroughly examined with detailed history, physical examination and basic laboratory investigations, including complete blood count, blood urea and creatinine levels, serum electrolytes, urinary analysis including culture & sensitivity, ultrasound abdomen and pelvis, x-ray kidney, ureter, and bladder (kub), and computed tomography (ct) scan-kub (figure 1 and 2). figure 1. computed tomography (ct): kidney ureters and bladder (kub) lmrj volume 4 issue 03 110 | p a g e the patients' age and gender were documented, as well as the size of stone was measured in mm, the number of stones were recorded as dichotomized variable i.e. single or multiple, hydronephrosis was looked at, site of stones in the kidney, (i.e. renal pelvis and different calyceal stones) was also documented. tract access such as upper, middle or lower pole calyx puncture were also documented. the outcome of the procedure was measured in terms of stone clearance, weither it was complete or incomplete, and the decision was made on the basis of stone fragments seen on table fluoroscopy and post-operative x-ray kub. incomplete clearance was defined as any clinically inconsequential stone whereas, no residual stone were considered as complete clearance. on 1st postoperative day complications such as significant bleeding in foley’s catheter or nephrostomy tube requiring blood transfusion, rise in temperature more than 99 °f or pain requiring more than three doses of injectable pain killers were recorded. figure 2. computed tomography (ct) kidney ureter and bladder showing left renal stone the procedure was performed under general anesthesia in all patients. 10fr pediatric cystoscope was used to get retrograde urography under the fluoroscope in lithotomy position and open ended 3-5fr ureteric catheter were placed and secured to a foley’s catheter. mini-pcnl was done in prone position. punctures were made under fluoroscopic guidance where ureteric catheters used to fill the system with contrast material. the contrast material is used for opacification of the system and lmrj volume 4 issue 03 111 | p a g e distention of the collecting system (figure 3). the urinary collecting system was accessed through lower calyx. through out the procedure patients were maintained in prone position. the track was dilated over a suitable guide wire of up to 21fr than the amplatz sheath of 22fr was inserted through which storz rigid nephroscope 18fr was passed (figure 4). pneumatic probe was used for stone fragmentations, in all patients except one 16fr nephrostomy catheters were used. only one patient required to be double punctured. ante grade double j stenting was also done in selected patients at the end of the procedure. the nephrostomy tube was left until the second postoperative day then it was removed, while the dj stent was removed after two weeks, as per standard protocol. procedure was successfully carried out in all patients with complete clearance of the calculi. figure 3. left retrograde pyelography (rgp) figure 4. 22 fr amplatz sheath is being placed all patients were monitored for complications such as fever, pain and bleeding on the first postoperative day. all patients were healthy enough to be discharged on or before the third postoperative day. the study's data was collected using statistical package for social sciences (spss version 22.0). continues variables were summarized as mean and standard deviation (sd); i.e. age (in years) and stone size (in mm). frequency distribution with percentages were calculated for categorical variables; i.e. gender, stone site, number of stones, presence of hydronephrosis, calyx puncture, clearance status of the stone and complications. results twelve patients underwent mini percutaneous nephrolithotomy, the mean age of the patients was 7.67 years. mean size of the renal stones was 10 mm with a range of 10–20 mm. out of 12 patients, 7 (58.7%) were males and 5 (41.7.3%) were females. all patients had pelvic stones, in addition to pelvic stones 3 patients had lower pole stones. different degree of hydronephrosis was observed, where five (41.7%) patients had mild and seven (58.3%) patients had moderate hydronephrosis. a preoperative antibiotic regimen was prescribed for five patients with positive urine cultures. complete clearance of stone was achieved in 10 patients (83.7%) and 2 patients (16.7 %) had incomplete clearance, with clinically insignificant residual stones which were <4mm and were not required any auxillary procedure. all patients had lower pole punctures to gain access to pelvi-calyxeal system, for which bull’s eye technique was applied in 11 (97.7 %) patients and the triangulation technique in one (8.3%) patient. only two patients had nephrostomies implanted; the others remained tubeless. ante-grade dj placement was done on 2 patients. the mean operative duration of the procedure was < 1.1hr. lmrj volume 4 issue 03 112 | p a g e the major complication was hydro-peritoneum in one patient who was recognized immediately in the operation room and managed by placing the intra-peritoneal drain. the haemoglobin level of one patient dropped as a result of intraoperative bleeding, requiring a blood transfusion, but the other patients experienced no serious complications. three patients (25%) experienced moderate pain in the first 24 hours following surgery and needed injectable analgesics. vomiting occurred in 8 patients (67%) and was treated with antiemetics. discussion patients with renal stones treated with mpcnl and traditional pcnl experienced similar stonefree rates. however, with the small tracts, the risk of blood is significantly lower and the need for blood transfusion reduced to nominal or insignificant. though it substantially raises the time duration of the procedure (7). on the other hand, there are reports presenting significantly shorter duration of the hospital stay with mpcnl compared to the conventional procedure (7). in the study published by misra et al., they found that mean hospital stay after mpcnl was 1.5 days, but in this study we have found that most of the patients were discharged from the hospital within two days of the procedure. only one patient required a longer hospital stay for more than 3 days secondary to complication of hydroperitoneum. thus, it is suggested that mpcnl safe from a complication point of view, so it can be considered an effective evolution of the cpcnl technique. there are limited high level evidence which compares two procedures using same indications in children such as large randomised clinical trials (rcts), preferably multi-center trials. the carefully designed rcts will certainly wash out selection bias and operating surgeon introduced bias. because high level expertise in surgical procedures reduce the risk of complications anyway. the shorter hospital stay was previously reported in another series by jackman et al, this has strongly supported our results (6). the stone clearance rate in children or adults as has been reported to be comparable at 85% when the stone size is measured between 12 to15 mm. there were a few studies which however have shown inferior stone fragmentation in children with smaller instrument such as the series reported by giusti et al (7). in our study complete stone clearance was achieved in 83.7 % of patients and 16.3 % of patients had incomplete clearance with clinically insignificant residual stones of < 4mm. this can attributed to the size of the stone being removed. though the small instrument has a limitation of removing very small stone, fragments must be made into very small pieces to fit in the narrower sheaths. this significantly raises the operating times, whereas during standard pcnl, relatively larger fragments can fit in the sheaths thus crushing into tiny bits is not essentially required allowing removal of large stone fragments by using forceps and baskets. minimizing invasiveness of the pcnl was driven from the concept of lower morbidity as compared to the conventional pcnl. the robust data in support of lower morbidity is still controversial, in order to confirm the findings li et al (8) compared mpcnl and conventional protocol and measured acute-phase proteins. the study found no significant difference. another experimental study was conducted using pigs and compared renal parenchymal damage with the use of 11fr versus 30 fr nephrosotomy tubes (9). the study showed no significant difference in the resultant were no detectable differences in the degree of damage and the resultant scar volumes. there are other studies which confirmed small amount of blood loss in cases of mpcnl as compared to the conventional pcnl. a similar study by mishra et al (10) reported a clinically significant advantage for using 18 fr as compared to the 26 fr. the size of the stone as one of the indications of mpcnl and this is the crucial point. however, the data reported till date remains inconsistent regarding the indications thus the resultant stone fragmentation rate and the rate of complications among studies also differ. though for small stones lmrj volume 4 issue 03 113 | p a g e mpcnl has shown high effectiveness has been reported as compared to relatively larger renal stones i.e. 20 mm or bigger (9,11,12). according to the clavien-dindo classification, the rate of complications ranges from 11.9% to 37.7% (11), out of which majority of complications were of low grade. these findings are consistent with our results where only one patient developed major complication of hydroperitoneum which was recognized immediately and managed conservatively. there was a prospective study to explore the hemodynamic, electrolytes, and metabolic changes and compared conventional versus mpcnl (12) and there was a trend of metabolic acidosis in patients undergoing mpcnl. these findings can be biologically explained by prolonged operating time associated with longer duration of anesthesia and given the smaller track size higher pressure intra renal irrigation is used. this a small scale study from a single centre confirming safety of the procedure in children with minimal complications and there was low morbidity. the smaller sample size and non-randomized/ convenient sampling technique are considered the study's limitations. however large scale multicenter randomized controlled trials comparing conventional versus mpcnl in children need to be established to produce robust scientific evidence. conclusion this small study indicates that mini pcnl may be an effective and safe procedure for removing renal calculi in the pediatric age group with less morbidity; however, there is a slight increased risk of longer intraoperative duration. ethical consideration the study was approved by local ethics committee; informed consent was taken from all the patients. conflict of interest authors declare no conflict of interest funding source no funding was received for this project. references 1. hesse, a., et al., study on the prevalence and incidence of urolithiasis in germany comparing the years 1979 vs. 2000. eur urol, 2003. 44(6): p. 709-13. 2. lotan, y., et al., primary prevention of nephrolithiasis is cost-effective for a national healthcare system. bju int, 2012. 110(11 pt c): p. e1060-7. 3. scales, c.d., jr., et al., prevalence of kidney stones in the united states. eur urol, 2012. 62(1): p. 160-5. 4. turk c, k.t., petrık a, et al. eau guidelines on urolithiasis 2014. arnhem, the netherlands: european association of urology. 2014 [cited. 5. kukreja, r., et al., factors affecting blood loss during percutaneous nephrolithotomy: prospective study. j endourol, 2004. 18(8): p. 715-22. 6. jackman, s.v., et al., the "mini-perc" technique: a less invasive alternative to percutaneous nephrolithotomy. world j urol, 1998. 16(6): p. 371-4. 7. giusti, g., et al., miniperc? no, thank you! eur urol, 2007. 51(3): p. 810-4; discussion 815. lmrj volume 4 issue 03 114 | p a g e 8. li, l.y., et al., does a smaller tract in percutaneous nephrolithotomy contribute to less invasiveness? a prospective comparative study. urology, 2009. 75(1): p. 56-61. 9. traxer, o., et al., renal parenchymal injury after standard and mini percutaneous nephrostolithotomy. j urol, 2001. 165(5): p. 1693-5. 10. mishra, s., et al., prospective comparative study of miniperc and standard pnl for treatment of 1 to 2 cm size renal stone. bju int, 2011. 108(6): p. 896-9; discussion 899-900. 11. abdelhafez, m.f., et al., minimally invasive percutaneous nephrolithotomy: a comparative study of the management of small and large renal stones. urology, 2013. 81(2): p. 241-5. 12. nagele, u., et al., management of lower-pole stones of 0.8 to 1.5 cm maximal diameter by the minimally invasive percutaneous approach. j endourol, 2008. 22(9): p. 1851-3; discussion 1857. type of the paper (article lmrj volume 4 issue 03 100 | p a g e original article clinico-epidemiological evaluation of chronic folliculitis of lega single study from southern india manasi mishra1, surajit nayak2, prasanna kumar rathor3, maheswar samanta3, satyadarsi pattnaik1, prasenjeet mohanty1 1department of skin & veneral diseases, fakir mohan medical college & hospital, balasore, odisha, india, 2department of skin & veneral diseases, govt. medical college & hospital, sundergarh, odisha, india, 3department of medicine, p.r.m. medical college& hospital, mayurbhanj, odisha, india abstract this study was conducted to determine the clinico-epidemiological evaluation of chronic folliculitis of the leg in the southern indian population. this was a prospective observational study, undertaken over a period of two years. all patients attending the outpatient department southern indian tertiary care hospital's dermatology department (m.k.c.g.medical college & hospital, odisha) were recruited. a total of 100 patients were enrolled, aged between 12 to 70 years with a m: f ratio of 10.1: 1. eighty per cent of the population in the study were rural, and 20% belonged to the urban area. clinical characteristics and demographic data of the patients were collected in a pre-designed proforma. those patients who had pustules on the leg underwent pus culture and sensitivity test. majority of the patients presented with papules and pustules (96%cases) and bilateral symmetrical leg involvement (98% cases). pruritus was the most common clinical presentation ( 90% cases). staphylococcus was isolated in the majority of cases (80%) and was sensitive to amikacin (73%), linezolid (70%), vancomycin (68%), and gentamycin (65%). chronic folliculitis of the leg is mainly a disease of young adult males of low socioeconomic status. avoiding aggravating factors and cautious use of sensitive antibiotics may achieve treatment goals and decrease recurrence. key words: chronic folliculitis, leg infection, staphylococcus aureus introduction chronic superficial folliculitis of the leg (cfl), resulting from inflammation of terminal parts or ostium of the hair follicle having either infective or non-infective aetiology. historically this disease was described under various names like nigerian shin disease (1), chronic folliculitis of the leg (2), therapy-resistant pyogenic folliculitis of the leg (3), epilating folliculitis of glabrous skin, lupoid sycosis of the legs (4), and, more recently, chronic superficial folliculitis of the leg (5). the clinical characteristics of the disease include recurrent, symmetrical, itchy eruptions of papules or pustules of both lower legs with skin oedema and erythema that upon healing, results in alopecia, atrophy and scarring. the disease course in tropical countries is either self-limiting or prolonged, remitting and relapsing (6). occupations prone to repeated minor trauma such as agricultural correspondence: dr maheswar samanta department of medicine, p.r.m.medical college & hospital, mayurbhanj, odisha, india email: dp02433@yahoo.com doi: 10.38106/lmrj.2022.4.303 received: 29.07.2022 accepted: 09. 08.2022 published: 30. 09.2022 mailto:dp02433@yahoo.com mailto:dp02433@yahoo.com lmrj volume 4 issue 03 101 | p a g e workers, cement workers, having history of application of oil over the body, contact with seawater, and cow dung are documented exacerbating and precipitating factors (1,6,7). pruritus is the most common symptom of cfl, followed by pain, bleeding, hair loss, and eczema. a similar condition affecting both lower legs symmetrically with or without extension to the thigh or forearm was found in lagos in west africa named pustular dermatitis atrophicans (8). this disease was thought to be uncommon in india and associated with recurrence and unsatisfactory treatment outcome. thus this study was conducted to evaluate clinical profile and demography of all cfl cases attending our centre and to explore bacteriological profile and antibiotic sensitivity. methods this was a prospective observational study, conducted at the department of dermatology, maharaja krushna chandra gajapati (m.k.c.g.) medical college & hospital, odisha, india from january 2009 to january 2011. the college's ethical committee permitted the study. all patients with chronic folliculitis of legs for more than six months duration diagnosed clinically and did not receive any treatment for a minimum of three months before recruitment in the study. the patients consented to be part of the study and underwent study procedure of pus culture & sensitivity were included. however, patients with acute folliculitis of leg less than six months or chronic folliculitis or those on medications for three months were excluded. all immunocompromised patients or those on immunosuppressant treatment were also excluded. those patients who refused to consent or did not show willingness for follow-up were not included. a detailed history was taken from all the patients recruited in this study, including age, sex, occupation, socioeconomic status, significant past and family history, previous dermatological diseases, predisposing and seasonal factors, onset, duration, evolution of the lesion, and type of lesion, distribution of lesion and clinical features. finally, a thorough examination was done to find distribution, lesion morphology, and any evidence of pre-existing dermatological disorder. all patients underwent routine blood investigations, including complete blood count, random blood sugar, renal function test, liver function test, hiv test, detailed urine report, gram staining of pus, and culture and sensitivity were performed. after stopping topical and systemic medications for a week, pus culture and sensitivity were done. then, the lesion was swabbed with alcohol, and pus was collected using a sterile swab. in crusted lesion, parts were partly lifted with a sterile needle and material underneath was taken. after collection, pus was sent to the microbiology department, where gram staining and pus culture were done in blood agar/mac conkey agar with incubation aerobically at 37˚c 24hr. organisms were grown and identified by their morphology, cultural characteristics and biochemical reactions. antibiotic sensitivity was tested on nutrient agar using bio-dis (hi-media)r disc diffuse techniques. statistical methods all the data were entered and analysed into microsoft excel sheet. descriptive statistics were done for demographic variables and presented in charts and tables with number, ranges and percentages. results a total of 100 patients with a confirmed diagnosis of cfl were enrolled, aged between 11years to 70years, most were in the age group between 21 to 30 years (45%), followed by 11 to 20 years (23%). a summary is given in table 1. the majority of the patients were males with a male: female ratio of 10.1:1. a considerable proportion of the study population reported from lower socioeconomic groups (77%) and rural areas (80%). table 1 presents a summary of the demographic characteristics of the study population. lmrj volume 4 issue 03 102 | p a g e table 1. summary of chronic superficial folliculitis of leg cases demographic characteristics age group(years) male female total (%) socio-economic status habitat middle low urban rural 0-10 0 0 0 11-20 19 4 23 m(4) l (19) 7 16 21-30 42 3 45 m(8) l (37) 10 35 31-40 19 2 21 m(5) l (16) 2 19 41-50 8 0 8 m(2) l (5) 8 51-60 1 0 1 l (1) 1 61-70 2 0 2 l (2) 2 total 91 9 100 100 20 80 analysis of the distribution of the occupation it was found that, highest number of farmers (n=45, 45%) was presented followed by students (n=14, 14%) and cement workers (n-13, 13%). figure 1 presents occupations of the patients. in 70 patients, lesions appeared, or pre-existing lesions aggravated in summer and rainy sessions, while in the remaining 30 cases, no definite relationship with season was found. seborrheic manifestations of variable degree (10%), positive hiv serology (4%), psoriasis (2%), sycosis barbae (2%) and lichen planes lesion (1%) were found in the present study(figure-2). figure 1 occupation-wise distribution of of chronic superficial folliculitis of leg cases figure 2 association of chronic superficial folliculitis of leg to other diseases the disease duration varied from a minimum of 6 months to a maximum of 14 years, with 78(78%) patients attending hospital within one year of onset (table-2). in almost all cases (n=96, 96%), the lesions appeared as multiple, small, closely set follicular pustules with papules, some intact and some crusted. isolated papules (3%) and pustules(1%) though found, were rare in our study(table 2). it was observed that, folliculitis was distributed in all cases, chiefly over the pretibial region of one (2%) or both legs (98%) between the knee and ankle (table-2, figure 3). the dorsal skin and other areas of glabrous skin were not affected. lesions extending to thigh and thigh + forearm found in 24% and 1% cases respectively (figures 4 and 5). pruritus was the predominant symptom (90%) followed by burning sensation (25%), pain (9%) & bleeding (2%) (table-2). on the resolution of lesion, loss of hair was found in 78% of cases (figure 6). lmrj volume 4 issue 03 103 | p a g e table 2. summary of clinical characteristics of the patients presenting with chronic superficial folliculitis of leg (cfl) duration of cfl no of patients % of total <1 year 1 year to 10 year >10 year 78 20 2 78 20 2 types of lesions no of patients % of total papules only pustules only both 3 1 96 3 1 96 distribution of lesions no of patients % of total both legs one leg leg and thigh leg and forearm 98 2 24 1 98 2 24 1 clinical features no of patients % of total pruritus burning sensation pain bleeding scaling eczematisation loss of hair on the resolution mild atrophy of skin 90 25 9 2 20 4 78 30 90 25 9 2 20 4 78 30 figure 3: chronic superficial folliculitis of leg case showing both papules and pustules figure 4: chronic superficial folliculitis of leg case extending towards the thigh figure 5: chronic superficial folliculitis of leg case extending towards the forearm figure 6: chronic superficial folliculitis of leg case showing scaling, hair loss and mild skin atrophy lmrj volume 4 issue 03 104 | p a g e direct smear examination after gram stain showed clusters of staphylococci with plenty of pus cells in 80% of cases, while in remaining 20% of cases; pus cells were only seen, which may be due to technical error. pus culture was done in 97% of cases, and staphylococcus was the commonest organism found, isolated in 80% of total cases (table-3). sensitivity to various antibiotics was described in table 4. though all cases respond to treatment within two months of therapy, 10% of cases had a recurrence of lesions within one year, and 30% of cases had recurrence within two years of the beginning of treatment. table-3: organisms isolated from pus culture table -4: antibiotic sensitivity of organisms organisms isolated no of patients % of total staph. aureus 80 80 coagulase –ve staph. 2 2 pseudomonas spp 7 7 klebsiella spp. 3 3 beta haemolytic strepts 2 2 e coli 1 1 pus not collected 3 3 pus was sterile 2 2 total 100 100 antibiotics no of patients % of total amikacin 73 73 linezolid 70 70 vancomycin 68 68 gentamycin 65 65 gatifloxacin 30 30 discussion chronic folliculitis of the leg runs a chronic course; it hardly melts or burns; it simply smoulders. cfl is predominantly a disease in the second and third decades, as reported from various kinds of research literature (1,6,7,8,9,10), which coincides with the present study, where 45% and 23% of cases were in the third and second decades. however, recent literature by saranya tm et; claimed a little higher age of onset of cfl (5). this disease has been reported to occur up to the sixth decade (6), like our study, where only (2 patients, 2%) were more than 60 years. on the contrary nigerian study shown none of the parents was more than 30 years (11). the pasha s.k.j. et al. study documented that only 24% of patients were over 30 years (12). it shows the existence of age variation among patients of cfl. in our study cohort, male dominance was found with m: f ratio of 10.1:1, comparable to many other studies(3,6,7,9,10,13,14). however, harman rr et al. recorded equal sex distribution which is in contrast to our study(1). more manual labour and risk factors explain this high predisposition of males to cfl. the majority of patients in this study were agricultural laborers (45%), which is almost the same as that was reported by prasad p et al. (44%)(2). the high incidence of cfl among farmers may be due to frequent minor trauma to the leg during working in the field and exposure to mud, pesticides & allergens. students(14%), business personnel(5%) and office workers (5%) in our study constituted less number of cases, mostly belonging to the urban population. the excessive friction from clothing, use of tight-fitting long trousers, high external humidity, excessive sweating, and application of vegetable oil may be possible causes of c.f.l. in the above cases, even though no type of occupational trauma could be found. cement workers constituted 13% of our study population, comparable to construction workers (7,17.9%) to saranya tm et al.(5) and discordant with to study by rama r et al. (8%) (8). moreover no previous studies had reported that cement being an irritant affects quite a good population. though our patients hail from coastal villages, there were only six fishermen (6%) cases which was similar to other studies(2,8); on the contrary, only one case was a fisherman reported by saranya tm et al. (5). though there are discrepancies among various study groups, it may be suggested that seawater exposure is a risk factor for cfl. lmrj volume 4 issue 03 105 | p a g e our study showed that most patients were from rural areas (80%) and a low socioeconomic group(77%). most of our patients ( reported exacerbations during the summer and rainy season70%), similar to summer exacerbations by various studies reported in the literature (1,5,6,8,10,14). the role of humidity in exacerbations may be a postulation. few previous literatures reported vitiligo (2%),leprosy(4%) and psoriasis(2%) as co-existing diseases in chronic folliculitis(1,2). one recent study by sanaya tm et al. showed no other skin diseases, psoriasis and contact dermatitis in 44 (88%), 3(6%), and 3(6%)cases, respectively, this was comparable to our study. any common pathological mechanism between cfl and other associations, if present, need to be clarified by further studies. the disease duration in our study varied from 6 months to 14years was discordant with certain previous studies (5,6,10). in contrast, a short duration of disease onset (8 weeks to 2 years) was reported by tiwari v. et al. in his study of 15 patients(15). furthermore, most patients in our study (78%) were attending hospitals within 1 yearr of the onset of the disease, which is discordant with certain previous studies(2,5). on the other hand, a study by sugathan p et al. (6) reported that 4% of patients had a disease of more than 10 years, which is nearer to our study. familial affection for cfl was not documented in our patients, while some previous studies reported conflicting results (6,13,15). bilateral symmetrical affection of the lower leg was seen in most cases(98%) in our study. similar affection was also documented by various authors previously(6,14,15). most of the literature demonstrated the anterior and lateral aspect of the leg being the most common site of the lesion (1,5, 6, 10), like ours. no posterior affection of the leg was found in our study in contradiction to saranya tm et al., where 2(4%) patients had follicles on the back of the leg. the dorsal feet and other areas of glabrous skin were not affected in our cohort like others (2,3,5,6,8). few studies reported affection for the face & axilla (6,10), contrary to our study. follicles were present in lower leg in all cases with extension to thigh(24%) and forearm(1%) in present study, which is different from the study by rama r. et al where extensions to thigh(22%),forearm(12%),beard area(7%),anterior chest(2%) were noted. the interval between onset of leg lesion and thigh is ranged from 6 months to 3 years. the presence of follicles with both papules and pustules (96%) were common findings in the present study, although solo presentation (papules-3% and pustules-1%) was rare. this study is consistent with prasad p et (2) and kaimal s. et al. (10), where follicules with both papules and pustules were present in 86% and 100% of cases, respectively. saranya tm et al recorded presence of papules andpustules(n=38,76%), papules(n=8,16%), pustules(n=4,8%) in contrast to our study. however, all the studies agreed that the most common presentation is with papules and pustules. nearly all the follicules in the affected area contain pustules, from the centre of which single hair could be seen to be emerging. pruritus(90%) was the most distressing symptom reported in the present study, which is nearly the same as that of other studies (2,8). another indian literature documented pruritus as a universal symptom (5). severe burning sensation (25%), pain (9%), bleeding (2%), and eczematisation (4%) were other features in our study, which is comparable to the study by prasad et al. (2), whereas scaling was seen in 20% of cases, much higher than in other studies (2, 10). loss of hair following resolution of the lesion and mild atrophy of skin were seen in 78% and 30% of cases in this study which is at par with other literature (2,6,9). pus culture and sensitivity were done in 97 (97%) patients out of 100. staphylococcus was the commonest organism isolated (80%-staph.aureus, 2%-coagulase–ve staphylococcus) in our study, similar to other studies(1,2,3,6,7,8,12,15,16). beta-haemolytic streptococcus (2%), pseudomonas spp. (7%), klebsiella (3%) were organisms isolated from pustules comparable to other studies(2,10). lmrj volume 4 issue 03 106 | p a g e organisms isolated from pustules were sensitive to amikacin(73%), linezolid (70%), and vancomycin (68%). gentamycin (65%), gatifloxacillin (30%) and showed variable sensitivity to erythromycin, ciprofloxcillin, imipenem and cephalosporin. this study is dissimilar to the study by parikh et al., where staphylococcus showed the highest sensitivity to erythromycin (97%), followed by gentamycin (92%). saranya tm et al., in their study, isolated staphylococcus aureus in 58.3% of cases and documented sensitivity to commonly prescribed all above antibiotics with resistance to penicillin(5). recurrence was noted in 10% of cases within 1 year. and 30% within two years. at the beginning of treatment. unavoidance of risk factors, humid tropical climate, and sticking to professions may be causes of recurrence. tertiary centre data do not precisely reflect the disease profile of the community. admittedly, the present study is based on a limited number of cases and is inadequate to provide conclusive data. therefore, it is considered as the limitation of the study. conclusion though a ubiquitous entity in tropical countries, chronic folliculitis of the leg has drawn very little attention from dermatologists, research articles on this entity are limited. in addition, uncertain etiopathogenesis & confusing treatment protocol provides a broad scope for further study of this disease to reach a clear consensus regarding effective protocol. hence in our opinion, a multicentric trial with a large sample size will throw more light on its distribution &geographical variation. ethical consideration the study was approved by the instituional research ethics committee, all recruited patients provided informed consent. the identity of the patients was coded. conflict of interest authors declare no conflict of interest funding this was an observational study, no funding required. references 1. harman rr. dermatitis cruris pustulosa et atrophicans. br j dermatol 1968;80:97-107. 2. prasad p, anandhi v, jaya m. chronic folliculitis a clinicoepidemiological study. indian j dermatol venereol leprol 1997:63:304-6. 3. desai sc, shah bh, modi pj, sethi nc. therapy resistant pyogenic folliculitis on legs in adult males with hypergammaglobulinemia. indian j dermatol venereol 1964; 30:89-97. 4. miller rf. epilating folliculitis of the glabrous skin. report of a case, histopathologic and nosologic study. arch dermatol 1961:83:777-84 5. saranya tm, sashidharanpillai s, ajith kumar k. descriptive study on clinical profile and demography of patients with chronic folliculitis of leg attending a tertiary referral centre. journal of skin and sexual transmitted diseases. vol. 2 issue 2, july-december 2020. 6. sugathan p, jacob z, joy mi. folliculitis cruris pustulosa et atrophicans. indian j dermatol venereol 1973:39:35-40. 7. jacyk wk. clinical and pathologic observations in dermatitis cruris pustulosa et atrophicans. int j dermatol 1978:17:802-7. lmrj volume 4 issue 03 107 | p a g e 8. rama, r, guruprasad p., lakshmi p., anand rook etal. a clinical an epidemiological study of superrficial folliculitis of legs. j. evolution med. dent. sci/eissn-2278-4802, pissn 22784748/vol. 5/issue 65/aug.15,2016 9. kumarasinghe sp, kumarasinghe mp. chronic folliculitis in sri lanka. indian j dermatol venereol leprol 1996;62:79-82. 10. kaimal s, d'souza m, kumari r, parija sc, sistla s, badhe ba. dermatitis cruris pustulosa et atrophicans revisited: our experience with 37 patients in south india. int j dermatol 2009;48:1082-90. 11. clarke gh. a note on dermatitis cruris pustulosa et atrophicans. trans r soc trop med hyg 1952;46:558-9. 12. pasha sk, gunda p.k. clinico-etiological profile and antibiotic sensitivity pattern of chronic folliculitis: a common but less focused disease of tropics. int j res dermatol 2018;4:16-22. 13. kunjukunju bp, subramoniam l. chronic folliculitis a clinicoepidemiological study. j evid based med health, 2017:4:2104-7. 14. wright rc, traumatic folliculitis of the leg. a persistent case associated with use of a home epilating device. j am acad dermatol 1992;27 : 771-2. 15. tiwari v, ramji c, tutakne m. dermatitis cruris pustulosa et atrophicans. indian j dermatol venereol leprol 1987; 53:116-7. 16. parikh da, thatte um, fernandez rj, shroff ps, wagle ud, lyer ee. clinical, bacteriological and immunological profile of 20 patients with dermatitis cruris pustulosa et atrophicans. indian j dermatol venereol leprorl 1989;55:237-40 type of the paper (article lmrj volume 4 issue 03 91 | p a g e original article histopathological changes in the placentas of mothers with a history of coronavirus disease 2019 infection in pregnancy: a comparative cross-sectional study hunaina al kindi, nada al muqimi, samah al abri, mina george, rahma al kindi department of histopathology, directorate general of khoula hospital, sultanate of oman abstract this study aimed to evaluate histopathological changes in the placentas of mothers who had contracted covid-19 during pregnancy. this prospective study involved the histopathological assessment of two groups of placentas submitted for evaluation to the department of histopathology at khoula hospital, oman. the first group consisted of 48 placentas derived from covid19-positive pregnant women delivered at the centre between march 2020 and march 2021. the control group consisted of an additional 48 placentas derived from asymptomatic mothers who were not tested for covid-19 but were assumed to be negative. all placentas underwent gross and microscopic histopathologic examination. placental lesions were classified according to the amsterdam system. there was a significantly higher frequency of fibrin thrombi at the terminal villi in placentas derived from the covid-19-positive group compared to the control group (72.9% versus 0%; p-value = 0.001). also, villous hypoperfusion was significantly more common in covid-19-positive placentas than in controls (16.7% versus 0%; p-value = 0.006). however, no significant differences between the two groups were noted with regards to the frequency of other histopathologic features, including decidual vasculopathy, chorioamnionitis, funisitis, intervillositis, perivillous fibrin deposition, and infarction. key words: placenta, covid-19, sars-cov-2, maternal infection, histopathology. introduction coronavirus disease 2019 (covid-19) is a viral infection caused by a new strain of coronavirus belonging to the severe acute respiratory syndrome (sars) family, known as sars-cov-2. the virus was previously unreported in humans and genetically similar to the strain responsible for causing the sars outbreak in 2003 (1). patients infected with covid-19 may present with a wide range of symptoms from fever, fatigue, and cough to severe complications such as shortness of breath and chest pain or even acute respiratory distress syndrome, septic shock, multiorgan failure, coagulopathy, and death (2). transmission occurs by inhaling contaminated droplets and close contact with infected persons and contaminated surfaces (3). the initial outbreak of covid-19 was first reported in wuhan, china, in december 2019, and has since spread rapidly over the last two years into a global pandemic with millions of confirmed cases and deaths worldwide (1, 2). however, inconsistent findings have been reported in the literature with regards to the possibility of transplacental transmission and placental changes as a result of correspondence: rahma al kindi department of family medicine and public health, sultan qaboos university hospital, sultanate of oman email: alrahma23@gmail.com doi: 10.38106/lmrj.2022.4. 3-02 received: 31.08.2022 accepted: 19. 09.2022 published: 30. 09.2022 lmrj volume 4 issue 03 92 | p a g e covid-19 infection during pregnancy. several studies and case reports have suggested the possibility of transplacental transmission, of which some have reported fetal deaths attributed to covid19 (4-11). on the other hand, other researchers have suggested that transmission of the infection is not possible during pregnancy due to the placental fetomaternal barrier (12-15). moreover, conflicting data and differing histological findings have been noted in placentas derived from cases of positive covid-19 infections (16-18). some studies have demonstrated that covid19 infection is associated with significant placental hypoperfusion, decidual vasculopathy, and other features of maternal vascular malperfusion (19-23). another study also described elements of fibrin deposition, chronic intervillositis, and trophoblast necrosis (24). in general, there is limited information available regarding the effect of sars-cov-2 infection on the placenta overall, and no previous research has yet been conducted to assess this topic in oman. therefore, the objective of the this study was to evaluate histopathological changes in the placentas of women in oman who had contracted covid-19 during pregnancy. methods this prospective comparative cross-sectional study was conducted at the department of histopathology of khoula hospital, a tertiary reference hospital that receives cases from all wilayats (counties) of muscat governorate, oman. all placentas submitted for histopathological evaluation to the department were included in this study. placentas in the case group were derived from covid-19-positive pregnant women who had delivered at the hospital between march 2020 and march 2021, during the peak of the pandemic in oman. eligible cases included placentas derived from pregnant women with laboratory-confirmed diagnoses of covid-19 infection with polymerase chain reaction (pcr) testing for sars-cov-2 using nasopharyngeal swabs collected during their antenatal check-ups or at the time of delivery. only the placentas of those who had delivered at 26– 40 gestational weeks were sent for gross and microscopic histopathological examination. placentas derived from women who had delivered at ≤25 gestational weeks were excluded from the analysis. for comparison, an equal number of placentas were derived from asymptomatic women with no significant close contact with covid-19-positive cases and had not undergone pcr testing for covid-19 during pregnancy or at the time of delivery were included. as per the hospital’s institutional policy, patients were tested for covid-19 only if they were symptomatic or reported having had close contact with positive cases. however, as placentas from healthy patients are not routinely sent for histopathological examination, placentas in the control group included those submitted for evaluation due to specific indications such as poor fetal outcome or concerning obstetric history, including intrauterine growth restriction (iugr), oligohydramnios, chronic hypertension, pregnancy-induced hypertension (i.e., gestational hypertension as well as preor postpartum pre-eclampsia), pre-existing or gestational diabetes, and coagulopathy. placentas for both cases and controls underwent gross and microscopic histopathological examination. placental lesions were identified according to the amsterdam classification system (25). the placentas were fixed in 10% buffered formalin for 72 hours or longer. the gross examination included recording the placental weight, placental disc dimensions, and a description of the umbilical cord, membranes, and any lesions. sections submitted for analysis included 3-mm-thick tissue sectioned at 5-mm intervals of various parts of the placenta, including the membrane rolls, two crosssections from the umbilical cord, two full-thickness sections of the placental disc, and representative sections of any lesions. all sections underwent routine processing and were embedded in paraffin lmrj volume 4 issue 03 93 | p a g e blocks; subsequently, the cut tissue (4-µm) was placed on glass slides and stained using hematoxylin and eosin (h&e) before being submitted for microscopic examination. two experienced pathologists reviewed histologic findings using the amsterdam classification system (25). statistical methods the covid-19 infection status of the cases and controls was determined from information gathered using the electronic medical record system and information regarding obstetric and fetal outcomes. data analysis was carried out using the statistical package for the social sciences (spss), version 23.0 (ibm corp., armonk, new york). descriptive statistics were used to describe the characteristics of the sample. frequencies and percentages were reported for categorical variables, whereas means and standard deviations were used to present continuous variables. pearson’s chi-squared (χ2) test or fisher’s exact test (for low cell frequencies) was used to assess significance as appropriate, with a p-value of ≤0.05 considered statistically significant. results a total of 96 placentas submitted for evaluation to the histopathology department were included in the study, out of which 48 were cases (i.e. covid-19-positive), and there was an equal number controls (i.e. covid-19-negative) (n = 48 each). the mean gestational age of the infected and control groups was 37.5 ± 2.5 weeks (range: 26-40 weeks) and 35.25 ± 5.2 weeks (range: 15-41 weeks), respectively. in the case group, the timing of covid-19 testing varied, with 16 cases (33%) testing positive on the day of delivery, 16 (33%) within the week prior to delivery, 12 (25%) two weeks before delivery, and four (8%) more than two weeks before delivery. figure. 1. bar chart comparing the frequency of microscopic histopathological findings between control placentas and those derived from mothers with a history of covid-19 infection in pregnancy 72.9% 14.6% 4.2% 2.1% 35.4% 4.2% 16.7% 4.2% 4.2% 0% 16.7% 0% 2.1% 18.8% 0% 0% 0% 0% 0% 20% 40% 60% 80% fibrin thrombi at the terminal villi chorioamnionitis funisitis intervillositis perivillous fibrin deposition decidual vasculopathy villous hypoperfusion chronic deciduitis villous dysmaturity microscopic histopathologic features infected group control group lmrj volume 4 issue 03 94 | p a g e the h&e-stained slides of placentas in both the control and case groups were examined. figure 1 illustrates the frequency of microscopic findings recorded in both groups, including fibrin thrombi at the terminal villi, perivillous fibrin deposition, decidual vasculopathy, chorioamnionitis, villous hypoperfusion, funisitis, and intervillositis. two statistically significant differences between the groups were observed. first, there was a significantly higher frequency of fibrin thrombi at the terminal villi in placentas derived from covid-19-positive cases compared to controls (72.9% versus 0%; p-value = 0.001) (figure 2a). second, villous hypoperfusion was significantly more common in covid-19-positive placentas compared to controls (16.7% versus 0%; p-value = 0.006) (figure 2b). figure. 2. (a) h&e-stained slide of placental tissue derived from a covid-19-positive pregnant woman showing fibrin thrombi at the terminal villi. (b) h&e-stained slide of placental tissue derived from a covid-19-positive pregnant woman showing villous hypoperfusion in contrast, no significant differences were noted between cases and controls with regards to the frequency of other histopathological features, including decidual vasculopathy, chorioamnionitis, funisitis, intervillositis, perivillous fibrin deposition, and infarction (figure 3a-d). with regards to neonatal outcomes, there was a higher frequency of intrauterine fetal death (iufd) (31.3% versus 10.4%; p-value = 0.023) and prematurity (22.9% versus 6.3%; p-value = 0.023) in the control group compared to the case group (table 1). however, no significant association was found between covid-19 infection status and low-birth-weight (<2.5 kg) infants (6.3% versus 4.2%; p-value = 0.87). table 1. comparison of pregnancy outcomes in mothers with and without a history of covid-19 infection in pregnancy (n = 96). outcome, n (%) total healthy intrauterine fetal death anomaly premature birth group infected 40 (83.3) 5 (10.4) 0 (0) 3 (6.3) 48 control 20 (41.6) 15 (31.3) 2 (4.2) 11 (22.9) 48 a b lmrj volume 4 issue 03 95 | p a g e figure. 3. hematoxyline and eosin slides of placental tissue derived from covid-19-positive pregnanct woman (a) showing thrombi within decidual blood vessels in a case of maternal vasculopathy. (b) showing chronic intervillositis. (c) showing intervillous fibrin deposition. (d) showing infarction of villi discussion to date, limited information is known regarding the effect of covid-19 on the human placenta and whether vertical transmission of the infection from mother to infant is possible. several studies have sought to assess the pathology of the placenta in covid-19-positive mothers, with varying results (16-24). in the current study, a statistically significant relationship was observed between covid19 infection status and the presence of fibrin thrombi within the terminal villi blood vessels (72.9% versus 0%; p-value = 0.001). this finding may represent underlying pregnancy-specific sequelae of covid-19-associated coagulopathy. similar findings have been reported by menter et al. (21). our study further demonstrated a significant relationship between covid-19 infection status and the frequency of villous hypoperfusion (16.7% versus 0%; p-value = 0.006). villous hypoperfusion is primarily caused by the narrowing and reduction of the number of terminal villi blood vessels; specifically, 25% of cases of villous hypoperfusion in the present study demonstrated terminal vila b c d lmrj volume 4 issue 03 96 | p a g e lous thrombi. fetal vascular narrowing is usually diagnosed via the morphometric analysis of placental material in the clinical context of marked iugr and abnormal pulsed flow doppler results. however, in our study, information regarding history of iugr was not available and doppler studies were not performed. nevertheless, several previous studies have shown significant findings of fetal vascular malperfusion. glynn et al. found that fetal vascular malperfusion lesions were significantly more frequent among pregnant patients with a history of acute sars-cov-2 infection (26). similarly, baergen and heller demonstrated that 50% of covid-19-positive mothers in their study showed some evidence of fetal vascular malperfusion, including intramural vascular thrombosis, villous stromal-vascular karyorrhexis, and intramural non-occlusive thrombi (27). no statistically significant differences in the frequency of other microscopic findings were observed in the present study, including perivillous fibrin deposition, maternal vasculopathy, chorioamnionitis, funisitis, intervillositis, and villous dysmaturity. similar histological findings were also observed in other studies without statistical significance (9, 11, 28, 29). in particular, perivillous fibrin deposition was apparent in 17 (35.4%) of the placentas derived from covid-19-infected patients; however, this feature was also present in 11 (22.9%) placentas in the control group. singh et al. reported that the main placental histopathologic findings in a series of covid-19-infected patients were increased fibrin in addition to microcalcifications, syncytial knotting, and villous agglutination (30). other case reports have found the main histological findings to be intervillositis (24, 31, 32) and infarction (22). such features were not observed in the present study. in addition, several researchers have indicated that the frequency of maternal vascular malperfusion is significantly higher in placentas derived from sars-cov-2-positive pregnancies (13, 20-23, 33). however, this finding was not statistically significant in our study, with only two covid-19-positive cases (4.2%) showing maternal vasculopathy. moreover, there was no statistical difference in terms of gestational age between cases and controls in our study, with 40 (83.3%) patients in the covid-19 positive group having full-term normal deliveries and only three (6.3%) going into premature labor at 26–36 gestational weeks. this finding was also noted in other studies (6, 25). on the other hand, the control group showed a high proportion of premature births (n = 11; 22.9%). moreover, there was a significantly increased frequency of iufd among control cases (31.3% versus 10.4%; p = 0.023). this was likely because only the placentas of mothers with a concerning obstetric history are usually submitted for histopathological evaluation. of the five cases of iufd in covid-19-positive mothers, three (60%) were born premature and one was full term. the causes of both the prematurity and iufd varied, including maternal hypertension, polyhydramnios, and severe symptomatic maternal covid-19 infection. in the existing literature, cases of fetal death have been reported in women with confirmed covid-19 infection, severe clinical symptoms, and premature delivery (12), as well as those with confirmed covid-19 infection without any significant clinical or obstetric disorders, thereby suggesting that fetal demise may be a possible outcome of covid-19 infection in pregnancy (6, 34). two studies involving 106 and 50 cases of sars-cov-2 infection in pregnancy, respectively, did not show any iufd (23, 26). in addition, no statistically significant relationship between covid-19 infection and low birth weight was found in the current study (6.3% versus 4.2%; p = 0.87). similar observations have been made in other studies (22, 27). while the findings of our study can be considered reliable, generalizability is limited due to the sampling procedure, given that the samples were collected from a single center. in addition, it is important to note that the placentas in the control group were derived from mothers with poor or concerning obstetric histories since healthy placentas are not routinely sent for histopathological lmrj volume 4 issue 03 97 | p a g e examination. moreover, women in the control group were not tested for covid-19 infection and were presumed to be covid-19-negative because they were asymptomatic or had had no close contact with covid-19-positive cases, as per hospital protocol. finally, since the duration of infection in some cases was short or the infection was only diagnosed on the day of delivery, some infected cases might not yet have shown any histological changes at the time of analysis. conclusion in summary, placentas derived from covid-19-positive mothers showed a significantly increased prevalence of terminal villous thrombi and fetal vascular malperfusion relative to the controls. the findings of this research are important as covid-19 is still an emerging disease, and such results may help clinicians and obstetricians in their future decision-making. ethical consideration ethical approval for this study was obtained from the research ethics committee of the directorate general of khoula hospital, ministry of health, oman (pro022021077). this study was conducted in compliance with the ethical standards of the responsible institution on human subjects as well as with the helsinki declaration. this study involved no direct contact with patients, as all placentas were submitted directly to the histopathology department for evaluation. consent to evaluate the placentas utilized in this study was granted by the research ethics committee of the directorate general of khoula hospital, ministry of health, oman. conflict of interest the authors declare no conflicts of interest. funding none to declare. authors’ contributions h.k conceived the presented research idea and went through literature review. n.m and s.a under the supervision of h.k. designed the research methodology and have reviewed the slides. n.m and s.a. were involved in the data collection and date entry. n.m, s.a, m.g and h.k analyzed and interpreted the results. h.k. was a major contributor in writing the manuscript in consultation with m.g. and r.k. h.k was the research supervisor who guided n.m and s.a throughout the project. all authors read and approved the final manuscript. references 1. world health organization: who coronavirus (covid-19) dashboard. 2021. https://covid19.who.int. accessed may 18, 2021. 2. huang c, wang y, li x, ren l, zhao j, hu y, zhang l, et al. clinical features of patients infected with 2019 novel coronavirus in wuhan, china. lancet. 2020;395(10223):497-506. 3. liu y, ning z, chen y, guo m, liu y, gali nk, sun l, et al. aerodynamic analysis of sarscov-2 in two wuhan hospitals. nature. 2020;582(7813):557-560. 4. richtmann r, torloni mr, oyamada otani ar, levi je, crema tobara m, de almeida silva c, dias l, et al. fetal deaths in pregnancies with sars-cov-2 infection in brazil: a case series. case rep womens health. 2020;27:e00243. https://covid19.who.int/ lmrj volume 4 issue 03 98 | p a g e 5. valdespino-vázquez my, helguera-repetto ca, león-juárez m, villavicencio-carrisoza o, flores-pliego a, moreno-verduzco er, díaz-pérez dl, et al. fetal and placental infection with sars-cov-2 in early pregnancy. j med virol. 2021;93(7):4480-4487. 6. sukhikh g, petrova u, prikhodko a, starodubtseva n, chingin k, chen h, bugrova a, et al. vertical transmission of sars-cov-2 in second trimester associated with severe neonatal pathology. viruses. 2021;13(3):447. 7. patanè l, morotti d, giunta mr, sigismondi c, piccoli mg, frigerio l, mangili g, et al. vertical transmission of coronavirus disease 2019: severe acute respiratory syndrome coronavirus 2 rna on the fetal side of the placenta in pregnancies with coronavirus disease 2019-positive mothers and neonates at birth. am j obstet gynecol mfm. 2020;2(3):100145. 8. facchetti f, bugatti m, drera e, tripodo c, sartori e, cancila v, papaccio m, et al. sars-cov2 vertical transmission with adverse effects on the newborn revealed through integrated immunohistochemical, electron microscopy and molecular analyses of placenta. ebiomedicine. 2020;59:102951. 9. colson a, depoix cl, dessilly g, baldin p, danhaive o, hubinont c, sonveaux p, et al. clinical and in vitro evidence against placenta infection at term by severe acute respiratory syndrome coronavirus 2. am j pathol. 2021;191(9):1610-1623. 10. zadorosnei rebutini p, zanchettin ac, schueda stonoga et, marani prá dm, parmegiani de oliveira al, da silva dezidério f, simoneti fonseca a, et al. association between covid-19 pregnant women symptoms severity and placental morphologic features. front immunol. 2021;12:685919. 11. bouachba a, allias f, nadaud b, massardier j, mekki y, bouscambert duchamp m, de la fourniere b, et al. placental lesions and sars-cov-2 infection: diffuse placenta damage associated to poor fetal outcome. placenta. 2021;112:97-104. 12. dong l, pei s, ren q, fu s, yu l, chen h, chen x, et al. evaluation of vertical transmission of sars-cov-2 in utero: nine pregnant women and their newborns. placenta. 2021;111:91-96. 13. gao l, ren j, xu l, ke x, xiong l, tian x, fan c, et al. placental pathology of the third trimester pregnant women from covid-19. diagn pathol. 2021;16(1):8. 14. giordano g, petrolini c, corradini e, campanini n, esposito s, perrone s. covid-19 in pregnancy: placental pathological patterns and effect on perinatal outcome in five cases. diagn pathol. 2021;16(1):88. 15. jani s, jacques sm, qureshi f, natarajan g, bajaj s, velumula p, agu c, et al. clinical characteristics of mother-infant dyad and placental pathology in covid-19 cases in predominantly african american population. ajp rep. 2021;11(1):e15-e20. 16. patberg et, adams t, rekawek p, vahanian sa, akerman m, hernandez a, rapkieqicz av, et al. coronavirus disease 2019 infection and placental histopathology in women delivering at term. am j obstet gynecol. 2021;224(4):382.e1-382.e18. 17. gulersen m, prasannan l, tam tam h, metz cn, rochelson b, meirowitz n, shan w, et al. histopathologic evaluation of placentas after diagnosis of maternal severe acute respiratory syndrome coronavirus 2 infection. am j obstet gynecol mfm. 2020;2(4):100211. 18. tasca c, rossi rs, corti s, anelli gm, savasi v, brunetti f, cardellicchio m, et al. placental pathology in covid-19 affected pregnant women: a prospective case-control study. placenta. 2021;110:9-15. 19. di girolamo r, khalil a, alameddine s, d’angelo e, galliani c, matarrelli b, buca d, et al. placental histopathology after sars-cov-2 infection in pregnancy: a systematic review and meta-analysis. am j obstet gynecol mfm. 2021;3(6):100468. lmrj volume 4 issue 03 99 | p a g e 20. shanes ed, mithal lb, otero s, azad ha, miller es, goldstein ja. placental pathology in covid-19. am j clin pathol. 2020;154(1):23-32. 21. menter t, mertz kd, jiang s, chen h, monod c, tzankov a, waldvogel s, et al. placental pathology findings during and after sars-cov-2 infection: features of villitis and malperfusion. pathobiology. 2021;88(1):69-77. 22. resta l, vimercati a, cazzato g, mazzia g, cicinelli e, colagrande a, fanelli m, et al. sarscov-2 and placenta: new insights and perspectives. viruses. 2021;13(5):723. 23. moresi s, dell’aquila m, salvi s, rullo r, fruci s, stollagli f, arena v, et al. sars-cov-2 infection in pregnancy: clinical signs, placental pathology, and neonatal outcome implications for clinical care. front med (lausanne). 2021;8:676870. 24. watkins jc, torous vf, roberts dj. defining severe acute respiratory syndrome coronavirus 2 (sars-cov-2) placentitis: a report of 7 cases with confirmatory in situ hybridization, distinct histomorphologic features, and evidence of complement deposition. arch pathol lab med. 2021;145(11):1341-1349. 25. khong ty, mooney ee, ariel i, balmus ncm, boyd tk, brundler ma, derricott h, et al. sampling and definitions of placental lesions: amsterdam placental workshop group consensus statement. arch pathol lab med. 2016;140(7):698-713. 26. glynn sm, yang yj, thomas c, friedlander rl, cagino ka, matthews kc, riley le, et al. sarscov-2 and placental pathology: malperfusion patterns are dependent on timing of infection during pregnancy. am j surg pathol. 2022;46(1):51-57. 27. baergen rn, heller ds. placental pathology in covid-19 positive mothers: preliminary findings. pediatr dev pathol. 2020;23(3):177-180. 28. hecht jl, quade b, deshpande v, mino-kenudson m, ting dt, desai n, dygulska b, et al. sars-cov-2 can infect the placenta and is not associated with specific placental histopathology: a series of 19 placentas from covid-19-positive mothers. mod pathol. 2020;33(11):2092-2103. 29. husen mf, van der meeren le, verdijk rm, fraaij pla, van der eijk aa, koopmans mpg, freeman l, et al. unique severe covid-19 placental signature independent of severity of clinical maternal symptoms. viruses. 2021;13(8):1670. 30. singh n, buckley t, shertz w. placental pathology in covid-19: case series in a community hospital setting. cureus. 2021;13(1):e12522. 31. hosier h, farhadian sf, morotti ra, deshmukh u, lu-culligan a, campbell kh, yasumoto y, et al. sars-cov-2 infection of the placenta. j clin invest. 2020;130(9):4947-4953. 32. linehan l, o’donoghue k, dineen s, white j, higgins jr, fitzgerald b. sars-cov-2 placentitis: an uncommon complication of maternal covid-19. placenta. 2021;104:261-266. 33. jaiswal n, puri m, agarwal k, singh s, yadav r, tiwary n, tayal p, et al. covid-19 as an independent risk factor for subclinical placental dysfunction. eur j obstet gynecol reprod biol. 2021;259:7-11. 34. poisson tm, pierone g jr. placental pathology and fetal demise at 35 weeks of gestation in a woman with sars-cov-2 infection: a case report. case rep womens health. 2021;30:e00289.