1.MI-Dessy Natalia

Available online at
http://jurnal.permi.or.id/index.php/mionline

DOI: 10.5454/mi.10.4.1ISSN 1978-3477, eISSN 2087-8575
Vol 10, No 4, December 2016, p 119-124

*Corresponding author; Phone: +62-22-2502103,
Email:dessy@chem.itb.ac.id

Hepatitis B virus infection can cause a chronic liver

disease. It is estimated that 240 million people are

chronically infected with hepatitis B and more than 786

000 people die every year due to complication of

hepatitis B, including cirrhosis and liver cancer (World

Health Organization c2015). In Indonesia, there are

about 28 million people infected with hepatitis B and

14 million people are potentially becoming chronic

with 10% progress into hepatocellular carcinoma

(Kementerian Kesehatan Republik Indonesia 2013).

The most effective approach to control and prevent

the spreading of hepatitis B is by vaccination (WHO

2010). In Indonesia, hepatitis B vaccine has been

integrated into national immunization programmes

since 1997 (Kementerian Kesehatan Republik Indonesia

2013). Therefore, in order to fulfill the need of hepatitis

B antigen, here we report the production of local

recombinant small hepatitis B surface antigen (sHBsAg)

using Hansenula polymorpha expression system.

H. polymorpha expression system offers more

advantages than non-methylotrophic yeast expression

system, such as Saccharomyces cerevisiae. H.

polymorpha expression system has a strong and

tightly-regulated alcohol oxidase (AOX) inducible

promoter, and a high-frequency of non-homologous

recombination (Kang and Gelissen 2005). Moreover,

H. polymorpha does not hyperglycosylate protein, is

able to grow in simple medium, and has thermotolerant

property (Kang and Gelissen 2005; Reinders et al.

1999).

Recombinant small hepatitis B surface antigen (sHBsAg) is used as a vaccine component to prevent hepatitis
B virus infection. As an attempt to produce local recombinant sHBsAg, a PCR-amplified DNA fragment
encoding Indonesia sHBsAg which belongs to B genotype and adw2 subtype was cloned into Hansenula
polymorpha expression vector pHIPX4 by using recombination method. The resulted pHIPX4-sHBsAg was
integrated into the alcohol oxidase locus of H. polymorpha NCYC495 genome and the sHBsAg expression was
regulated under the control of H. polymorpha AOX promoter. H. polymorpha NCYC495 carrying the sHBsAg
coding sequence was grown in mineral medium and methanol 0.5% (v/v) was added to induce the expression of
recombinant sHBsAg. The expression of sHBsAg was detected by HBsAg diagnostic kit test, ELISA, and
Western blot analysis.

Key words: AOX promoter, Hansenula polymorpha, hepatitis B, sHBsAg

Antigen permukaan virus hepatitis B berukuran kecil (sHBsAg) rekombinan digunakan sebagai komponen
vaksin untuk mencegah infeksi virus hepatitis B. Sebagai upaya untuk memproduksi sHBsAg rekombinan lokal,
fragmen DNA amplifikasi PCR yang mengkode sHBsAg Indonesia yang tergolong ke dalam genotipe B dan
subtipe adw2 diklon ke dalam vektor ekspresi Hansenula polymorpha pHIPX4 dengan menggunakan metode
rekombinasi. Plasmid rekombinan pHIPX4-sHBsAg terintegrasi ke dalam lokus alkohol oksidase (AOX) dari
genom H. polymorpha NCYC495 dan ekspresi sHBsAg diregulasi di bawah kendali promotor AOX H.
polymorpha. H. polymorpha NCYC495 yang membawa urutan kode sHBsAg ditumbuhkan di dalam medium
mineral dan metanol 0,5% (v/v) ditambahkan untuk menginduksi ekspresi sHBsAg rekombinan. Ekspresi
sHBsAg dideteksi melalui uji kit diagnostik HBsAg, ELISA, dan Western blot.

Kata kunci: promotor AOX, Hansenula polymorpha, hepatitis B, sHBsAg

Cloning and Expression of Small Hepatitis B Surface
Antigen (sHBsAg) In Hansenula polymorpha

1 1 1
CHRISTIAN HERYAKUSUMA , FERNITA PUSPASARI , IHSANAWATI , ERNAWATI ARIFIN

2,3 3 4
GIRI-RACHMAN , MARSELINA IRASONIA TAN , EKAPUTRA RAMADHANI ,

4 1,3
NENI NURAINY , AND DESSY NATALIA *

1
Biochemistry Research Group, Faculty of Mathematics and Natural Sciences,

Institut Teknologi Bandung, Bandung 40132, Indonesia;
2
Genetics and Molecular Biotechnology Research Group, School of Life Sciences

and Technology, Institut Teknologi Bandung, Bandung 40132, Indonesia;
3
Physiology, Animal Development, and Biomedical Sciences Research Group,

4
School of Life Sciences and Technology, Institut Teknologi Bandung, Bandung 40132, Indonesia;

5
PT Bio Farma (Persero), Bandung 40161, Indonesia

This paper described cloning of sHBsAg coding

sequence into H. polymorpha expression vector

pHIPX4 and expression of the sHBsAg in H.

polymorpha NCYC495. The sHBsAg expression was

analysed with HBsAg diagnostic kit test, ELISA, and

Western blot.

MATERIALS AND METHODS

Construction of pHIPX4-sHBsAg. The

sHBsAg coding sequence of hepatitis B virus was

amplified by PCR method using pPICZα-A-HBsAg

(Nurfitriani 2012) as a template and a set of primers SF

(CTAAAGTACAAAAACAAGCTTATGGAGAAC

ACGCATCAGG) and SR (GATCGATCCTCTAGAG

TCGACTTAAATGTATACCCAAAGAC). The

amplified sHBsAg DNA fragment and pHIPX4

previously digested with HindIII/SalI were
®

homologously recombined according to CloneEZ

PCR Cloning Kit procedure (GenScript, USA). The

resulted recombinant plasmid was designated as

pHIPX4-sHBsAg. The nucleotide sequence of

sHBsAg in pHIPX4-sHBsAg was determined by

dideoxy-chain termination method (Macrogen,

Korea).

Transformation of H. polymorpha NCYC495

and Recombinant sHBsAg Expression. H.

polymorpha NCYC495 leu1.1 was transformed with

recombinant plasmid pHIPX4-sHBsAg, which had

been linearized with ScaI, according to the method

described by Faber et al. (Faber et al. 1994). H.

polymorpha NCYC495 transformants were grown on

YND medium, which composed of 0.67% (w/v) yeast

nitrogen base without amino acids, 1% (w/v)

dextrose, and 1.6% (w/v) bacto agar. PCR colony was

performed using primers SF (CTAAAGTACAAAAA

CAAGCTTATGGAGAACACGCATCAGG) and SR

(GATCGATCC TCTAGAGTCGACTTAAATGTATA

CCCAAGAC) to verify plasmid integration into the H.

polymorpha NCYC495 genome.

The transformants were precultured in 5 mL

mineral medium (van Dijken et al. 1976) containing

0.25% (w/v) glucose and incubated with shaking at 200

rpm for 18 h at 37 °C. The culture was then centrifuged

at 2,900 g and the whole pellet cell were inoculated in

50 mL fresh mineral medium containing 0.5% (v/v)

methanol as the sole carbon source. The culture was

incubated with shaking at 200 rpm, 37 °C. To induce

recombinant sHBsAg expression, 0.5% (v/v) methanol

was added to the culture medium every 22 h for 66 h.

The yeast cells were harvested by centrifugation at

120 HERYAKUSUMA ET AL. Microbiol Indones

2900 g, 4 °C, and the cell pellet was resuspended in

lysis buffer which contained 10 mM potassium

phosphate pH 8, 500 mM NaCl, 5 mM EDTA, 8% (v/v)

glycerol, 1% (v/v) Triton X-100, and 1% (v/v)
-1

leupeptin 2.5 μg mL . g, The cells were lysed by

manual grinding in liquid nitrogen. The protein was

collected by centrifugation at 7200 g, 4 °C for 10 min.

HBsAg Diagnostic Kit Test. Recombinant

sHBsAg was analysed with HBsAg diagnostic kit test,

Uji Hepatitis BsAg (Pakar Biomedika Indonesia,

Indonesia). The test was conducted using 50 μL protein

samples.

ELISA. Recombinant sHBsAg was examined with

commercial ELISA kit, Murex HBsAg Version 3

(DiaSorin, Italy). ELISA was performed using 1 μg

protein samples and 75 μL of ELISA negative and

positive control. All protein samples and controls were

analysed in duplicate.

The negative and positive controls were provided

by the kit manufacturer. The negative control was a

normal human serum diluted in a buffer containing

protein of bovine origin and 0.05% (w/v) Bronidox®

preservative, while the positive control was an

inactivated human serum diluted in a buffer containing

protein of bovine origin and 0.05% (w/v) Bronidox®

preservative. The ELISA threshold value was

calculated according to the instruction of ELISA kit

manufacturer by adding a value of 0.050 to the A of 450
negative control provided in the ELISA kit.

Western Blot. 10 μg protein samples were first

separated on a 12% SDS-polyacrylamide gel

electrophoresis. The proteins were then transferred

onto nitrocellulose membrane and then blocked with

Roti Block (Carl Roth, Germany) for 2 h at room

temperature.

The sHBsAg protein was detected using

monoclonal anti-HBsAg (Virostat, USA), goat anti-

mouse antibody-alkaline phosphatase conjugate

(Biorad, USA), and visualized with NBT/BCIP.

Purified recombinant sHBsAg, produced in-house by

PT. Bio Farma (Persero), was used as a positive

control.

RESULTS

Integration of Linearized pHIPX4-sHBsAg into

H. polymorpha NCYC495 Genome. The sHBsAg

coding sequence was subcloned into H. polymorpha

expression vector pHIPX4 which has Saccharomyces

cerevisiae LEU2 gene under its endogenous promoter.

The resulted recombinant plasmid pHIPX4-sHBsAg

(Fig 1) was verified by restriction enzyme analysis

using HindIII and SalI (Fig 2A). The digested pHIPX4-

sHBsAg gave two DNA fragments with the size of 7.0

kb and 0.7 kb which represented the pHIPX4 vector

and sHBsAg insert, respectively. The recombinant

plasmid pHIPX4-sHBsAg was linearized in the

promoter AOX region to allow its integration in the

AOX locus of H. polymorpha NCYC495 genome

which enabled the transformants to grow on minimal

medium without leucine. PCR colony of H.

polymorpha NCYC495 transformants gave a 0.7 kb

DNA fragment which confirmed the presence of

sHBsAg coding sequence in the H. polymorpha

NCYC495 genome (Fig 2B).

Identification of Recombinant sHBsAg. Crude

protein extracts from two H. polymorpha NCYC495

transformants (designated as S1 and S2) were

evaluated using commercial HBsAg diagnostic kit.

The S1 and S2 crude protein extracts gave positive

interaction with HBsAg antibody, whereas the

interaction was negative for crude protein extract from

H. polymorpha NCYC495 (Table 1). This result

indicated that crude protein extracts of S1 and S2

contained recombinant sHBsAg.

Further identification of the expression of

recombinant sHBsAg in S1 and S2 was conducted

using ELISA. The crude protein extracts from S1 and

S2 gave the value of A that was higher than ELISA 450
threshold value (Fig 3A). In contrast, the crude protein

extract from H. polymorpha NCYC495 had lower A 450
value than that of the threshold value (Fig 3A). This

ELISA result suggested the presence of recombinant

sHBsAg in S1 and S2.

Western blot analysis was performed to demonstrate

Volume 10, 2016 Microbiol Indones 121

1 2 3bp

8000
6000

750

1 2 3bp

750

Fig 1 pHIPX4-sHBsAg recombinant plasmid. The plasmid map was generated using SnapGene® Viewer 3.0.1.

Fig 2 Restriction enzyme analysis of pHIPX4-sHBsAg recombinant plasmid with its uncut control (A) and colony PCR of H.
polymorpha NCYC495-pHIPX4-sHBsAg (B). (A) Lane 1, DNA ladder; 2, pHIPX4-sHBsAg digested with HindIII and
SalI; 3, uncut pHIPX4-sHBsAg. (B) Lane 1, DNA ladder; 2-3, positive transformant.

Microbiol Indones122 HERYAKUSUMA ET AL.

subtype. To determine the immunogenicity of “a”

determinant of recombinant sHBsAg, the sHBsAg

sequence in the research was also examined for

possibility of immune-escape mutant. The immune-

escape mutant of HBV was known to have some rare

substitution in amino acids residues in the “a”

determinant region, such as G145R (Purdy et al. 2007),

Q129R, and G145A (Koyanagi et al. 2000).

Interestingly, one study also found a rare amino acid

substitution Y161S located outside the “a” determinant

region was an immune-escape mutant (Jinata et al.

2012). Based on multiple amino acid sequence

alignment in the “a” determinant region of sHBsAg,

the sequence used in this research was not identified as

an immune-escape mutant (Fig 4).

The recombinant plasmid pHIPX4-sHBsAg was

linearized in the AOX promoter region to facilitate its

integration in the AOX locus of H. polymorpha

NCYC495 (Saraya et al. 2012). Several papers have

reported that the integration of sHBsAg in the H.

polymorpha genome by the use of autonomously

replicating sequence (HARS1) allowed higher

integration frequency (Diminsky et al. 1997; Heijtink

the expression of sHBsAg in H. polymorpha NCYC495

pHIPX4-sHBsAg. A protein band at molecular weight

of 19.8 kDa appeared in the crude protein extracts from

S1 and S2, as well as in the purified sHBsAg (Fig 3B).

As expected, there was no protein band detected in the

H. polymorpha NCYC495 crude protein. Taken

together, this result confirmed that S1 and S2 produced

recombinant sHBsAg.

The negative control of ELISA is a normal human

serum, while the positive control is an inactivated

human serum. The positive control of Western blot is

purified recombinant sHBsAg from PT. Bio Farma

(Persero).

DISCUSSION

The Indonesia sHBsAg sequence used in this work

was derived from local clinical isolates of Hasan

Sadikin Hospital Bandung in which the virus has B

genotype and adw2 subtype (Suhandono et al. 2007).

Amino acid sequence alignment of the “a” determinant

region of several sHBsAgs showed some amino acid

variations due to differences in virus genotype and

Sample NCYC495

Interaction – + +

3.20

2.80

2.40

2.00

1.60

A
4
5
0

0.40

0.00
NCYC495 S1 S2 + -

19.80 kDa

NCYC
495

S1 S2 +

A
Theshold

0.301.903.120.23 3.06

Table 1. HBsAg diagnostic kit test of crude protein extracts

Fig 3 ELISA (A) and Western blot analysis (B) of crude protein extracts from H. polymorpha NCYC495-pHIPX4-sHBsAg (S1
and S2) and H. polymorpha NCYC495. All ELISA value bar represent an average value of two repeated assay.

Volume 10, 2016 Microbiol Indones 123

Dunker AK, Kenyon AJ. 1976. Mobility of Sodium Dodecyl
Sulphate-Protein Complexes. Biochem J. 153(2):191-
197. doi:10.1042/bj1530191.

Faber KN, Haima P, Harder W, Veenhuis M, AB G. 1994.
Highly-efficient electrotransformation of the yeast
Hansenula polymorpha. Curr Genet. 25(4): 305-310.
doi:10.1007/BF00351482.

Gasteiger E, Gattiker A, Hoogland C, Ivanyi I, Appel RD,
Bairoch A. 2003. ExPASy: the proteomics server for in-
depth protein knowledge and analysis. Nucleic Acids
Res. 31(13): 3784-3788. doi:10.1093/nar/gkg563.

Heijtink RA, van Bergen P, Melber K, Janowicz ZA,
Osterhaus ADME. 2002. Hepatitis B Surface Antigen
(HBsAg) Derived from Yeast Cells (Hansenula
polymorpha) Used to Establish an Influence of
Antigenic Subtype (adw2, adr, ayw3) in Measuring the
Immune Response After Vaccination. Vaccine. 20(17-
18):2191-2196. doi:10.1016/S0264-410X(02)00145-7.

Jinata C, Giri-Rachman EA, Retnoningrum DS. 2012.
Molecular Analysis of Immune-Escape Mutants of
Hepatitis B Virus from Local Clinical Samples.
Microbiol Indones. 6(1): 9-14. doi:10.5454/mi.6.1.2.

Kang HA, Gellissen G. 2005. Hansenula polymorpha. In:
Gelissen G, editor. Production of Recombinant
Proteins: Novel Microbial and Eukaryotic Expression
Systems. Weinheim (DE): WILEY-VCH Verlag GmbH
& Co. KGaA. p. 111-142.

Kementerian Kesehatan Republik Indonesia. c2013. Jakarta
(ID): Pusat Data dan Informasi Kementerian Kesehatan
RI; [accessed 2015 Feb 15, 2016 Jan 12].
http://www.depkes.go.id/folder/view/01/structure-pub
likasi-pusdatin-info-datin.html.

Koyanagi T, Sakai H, Sugimoto R, Enjoji M, Koto K,
Iwamoto H, Kumazawa T, Mukaide M, Nawata H,
Nakamuta M. 2000. Analysis of HBs Antigen Negative
Variant of Hepatitis B Virus: Unique Substitutions,

129 145
Glu to Asp and Gly to Ala in The Surface Antigen
Gene. Med Sci Monit. 6(6):1165-1169.

Nurfitriani. 2012. Construction of Recombinant Vector
pPICZα-A-HBsAg for Expression of Hepatitis B
Surface Antigen (HBsAg) Extracellular in Pichia
pastoris [thesis]. Bandung (ID): Institut Teknologi
Bandung.

Ottone S, Nguyen X, Bazin J, Berard C, Jimenez S,
Letourneur O. 2007. Expression of hepatitis B surface
antigen major subtypes in Pichia pastoris and
purification for in vitro diagnosis. Protein Expres Purif.
6(2):177-188. doi:10.1016/j.pep.2007.07.008.

Purdy MA. 2007. Hepatitis B Virus S Gene Escape Mutants.
Asian J Transfus Sci. 1(2):62-70. doi:10.4103/0973-

et al. 2002; Bian et al. 2009).

The expression of sHBsAg in H. polymorpha

NCYC495 transformants (S1 and S2) has been verified

by diagnostic kit test and ELISA. Further analysis

using Western blot showed that the recombinant

sHBsAg appeared as a protein band at 19.8 kDa, which

is similar with the purified sHBsAg used as a control

(Fig 3B). The predicted molecular weight of sHBsAg

calculated using ExPASy (Gasteiger et al. 2003) was

25.3 kDa. This molecular weight difference could be

due to incomplete reduction of disulfide bonds in

recombinant sHBsAg (Ottone et al. 2007). The

presence of disulfide bonds will introduce a more

compact shape of the proteins (Dunker and Kenyon

1976), hence faster migration rates of recombinant

sHBsAg would be expected (Rath et al. 2009). Taken

together, the H. polymorpha capable of expressing

Indonesian sHBsAg developed in this work is an

alternative source of recombinant HBsAg vaccine

production.

ACKNOWLEDGMENT

We thank Ida Van der Klei from University of

Groningen for providing Hansenula polymorpha strain

and expression vector. This research was partially

funded by Ministry of Research, Technology and

Higher Education for the National Hepatitis B

Consortium.

REFERENCES

Bian G, Cheng Y, Wang Z, Hu Y, Zhang X, Wu M, Chen Z,
Shi B, Sun S, Shen Y, Chen EJ, Yao X, Wen Y, Yuan Z.
2009. Whole Recombinant Hansenula polymorpha
Expressing Hepatitis B Virus Surface Antigen (Yeast-
HBsAg) Induces Potent HBsAg-Specific Th1 and Th2
Immune Responses. Vaccine. 28(1):187-194. doi:10.10
16/j.vaccine.2009.09.101.

Diminsky D, Schirmbeck R, Reimann J, Barenholz Y. 1997.
Comparison Between Hepatitis B Surface Antigen
(HBsAg) Particles Derived From Mammalian Cells
(CHO) and Yeast Cells (Hansenula polymorpha):
Composition, Structure and Immunogenicity. Vaccine.
15(6/7): 637-647. doi:10.1016/S0264-410X(96)00239-
3.

Fig 4 Multiple amino acid sequence alignment in the “a” determinant region of sHBsAg.

Microbiol Indones124 HERYAKUSUMA ET AL.

Saraya R, Krikken AM, Kiel JAKW, Baerends RJS, Veenhuis
M, Van der Klei IJ. 2012. Novel Genetic Tools for
Hansenula polymorpha. FEMS Yeast Res. 12(3):271-
278. doi:10.1111/j.1567-1364.2011.00772.x.

Van Dijken JP, Otto R, Harder W. 1976. Growth of
Hansenula polymorpha in a methanol-limited chemo-
stat:Physiological responses due to the involvement of
methanol oxidase as a key enzyme in methanol
metabolism. Arch Microbiol. 111(1):137-144.
doi:10.1007/bf00446560.

World Health Organization. c2015. [accessed 2015 Feb 25].
http://www.who.int/mediacentre/factsheets/fs204/.

[WHO] World Health Organization. 2010. Sixty-Third
World Health Assembly: Resolutions and Decisions
Annexes. Geneva (CH): WHO; [accessed 2015 Feb
25]. http://apps.who.int/gb/ebwha/pdf_files/WHA63-
REC1/WHA63_REC1-en.pdf

6247.33445.

Rath A, Glibowicka M, Nadeau VG, Chen G, Deber CM.
2009. Detergent Binding Explains Anomalous SDS-
PAGE Migration of Membrane Proteins. Proc Natl
Acad Sci USA. 106(6):1760-1765. doi:10.1073/pnas.0

813167106.

Reinders A, Romano I, Wiemken A, De Virgilio C. 1999. The
Thermophilic Yeast Hansenula polymorpha Does Not
Require Trehalose Synthesis for Growth at High
Temperature but Does for Normal Acquisition of
Thermotolerance. J Bacteriol. 181(15):4665-4668.

Suhandono S, Giri-Rachman EA, Zainuddin IM, Utari PD,
Supraba A, Estiati A. 2007. Construction of Binary
Vector with Wound Inducible Promoter for HBsAg
Expression: Development of Plant-Based Edible
Hepatitis B Vaccine from Indonesian Isolate. Ann
Bogor. 11(1):7-14.

1: 119
2: 120
3: 121
4: 122
5: 123
6: 124