Microsoft Word - 11549 NSB Bacila 2023.06.13.docx
Received: 13 Apr 2023. Received in revised form: 08 Jun 2023. Accepted: 13 Jun 2023. Published online: 19 Jun 2023.
From Volume 13, Issue 1, 2021, Notulae Scientia Biologicae journal uses article numbers in place of the traditional method of
continuous pagination through the volume. The journal will continue to appear quarterly, as before, with four annual numbers.
SHSTSHSTSHSTSHST
Horticulture and ForestryHorticulture and ForestryHorticulture and ForestryHorticulture and Forestry
Society of TransylvaniaSociety of TransylvaniaSociety of TransylvaniaSociety of Transylvania
Băcilă I et al. (2023)
Notulae Scientia BiologicaeNotulae Scientia BiologicaeNotulae Scientia BiologicaeNotulae Scientia Biologicae
Volume 15, Issue 2, Article number 11549
DOI:10.15835/nsb15211549
Research ArticleResearch ArticleResearch ArticleResearch Article....
NSBNSBNSBNSB
Notulae Scientia Notulae Scientia Notulae Scientia Notulae Scientia
BiologicaeBiologicaeBiologicaeBiologicae
Evaluation of crossEvaluation of crossEvaluation of crossEvaluation of cross----genus transferability of SSR markers from other genus transferability of SSR markers from other genus transferability of SSR markers from other genus transferability of SSR markers from other
legumes to two closely related legumes to two closely related legumes to two closely related legumes to two closely related OnobrychisOnobrychisOnobrychisOnobrychis (Fabaceae) taxa(Fabaceae) taxa(Fabaceae) taxa(Fabaceae) taxa
Ioan BĂCILĂ1, Dana ŞUTEU1,4*, Ana COSTE1, Zoltán R. BALÁZS2,3,4,
Gheorghe COLDEA1
1National Institute of Research and Development for Biological Sciences, Institute of Biological Research, Department of Experimental
Biology, 48 Republicii St., 400015 Cluj-Napoca, Romania; ioan.bacila@icbcluj.ro; dana.suteu@icbcluj.ro; ana.coste@icbcluj.ro;
gheorghe.coldea@icbcluj.ro
2Babeş-Bolyai University, Faculty of Biology and Geology, Department of Molecular Biology and Biotechnology, 1 Kogălniceanu St.,
400084 Cluj-Napoca, Romania; zoltan.balazs@ubbcluj.ro
3Babeș-Bolyai University, Faculty of Biology and Geology, Center for Systematic Biology, Biodiversity and
Bioresources - 3B, 1 Kogălniceanu St., 400084, Cluj-Napoca, Romania
4Babeș-Bolyai University, Doctoral School of Integrative Biology, 1 Kogălniceanu St., 400084 Cluj-Napoca,
Romania; dana.suteu@icbcluj.ro (*corresponding author)
AbstractAbstractAbstractAbstract
Microsatellite markers previously developed for other leguminous species were tested for cross-genus
transferability and evaluated for their potential usefulness in providing an improved assessment of the genetic
relationships between two closely related taxa belonging to Onobrychis genus (Fabaceae). Candidate
microsatellite markers were tested for polymorphism and replicability in sixteen populations of O. montana
DC. subsp. transsilvanica (Simonk.) Jáv. and O. montana. Out of the 23 SSRs, there were identified seven
polymorphic loci. In total 32 alleles were detected and the number of alleles per locus varied from two to six.
PIC values ranged from 0.375 to 0.6454, and four SSRs displayed a PIC > 0.5. Relative uniform rates of genetic
diversity were obtained. In case of O. montana DC. subsp. transsilvanica (Simonk.) Jáv. the observed and
expected heterozygosity ranged from 0.100 to 0.952 and from 0.219 to 0.525, respectively, while for O.
montana ranged from 0.166 to 0.750 and from 0.083 to 0.375, respectively. Seven polymorphic SSRs with clear
and reproducible amplification were identified. These markers proved to be very efficient for unambiguous
population discrimination based on both geographic and taxonomic criteria. Hereafter, these SSR markers can
be used as tools for evolutionary studies in Onobrychis genus, as well in providing knowledge on patterns of the
species phylogeography.
Keywords:Keywords:Keywords:Keywords: cross-genus transferability; leguminous; microsatellite; Onobrychis; polymorphism
https://www.notulaebiologicae.ro/index.php/nsb/index
Băcilă I et al. (2023). Not Sci Biol 15(2):11549
2
IntroductionIntroductionIntroductionIntroduction
The Onobrychis genus includes about 206 species (POWO, 2023), cross-pollinated, diploid (2n = 14,
16) or tetraploid (2n = 28) (Mohsen and Nasab, 2010), perennial or annual herbs or shrubs. The genus extends
throughout the Europe (excepting Scandinavia and the British Isles), Central and Eastern Asia, and North
Africa (POWO, 2023).
Within the genus, Onobrychis montana DC. subsp. transsilvanica (Simk.) Jáv. (Ciocârlan, 2009; Sârbu
et al., 2013) (≡ Onobrychis transsilvanica (Nyárády and Nyárády, 1957); ≡ Onobrychis montana DC. var.
transsilvanica (Simk.) Beck (Borza, 1949) is an endemic taxon in the Romanian Carpathian chain. It shares
close, yet controversial, taxonomic relationships and a strong morphological resemblance with the allopatric
species Onobrychis montana DC. Our previous study (Băcilă et al., 2015) represented the first attempt to
provide some molecular insights for this Carpathian endemic taxon with the use of AFLP and cpDNA markers.
Because these markers failed to clearly resolve the distinction between O. montana and O. montana DC. subsp.
transsilvanica (Simonk.) Jáv., other molecular markers, more informative ought to be identified.
Microsatellites (or Single Sequence Repeats - SSRs) are codominant markers characterized by high levels
of polymorphism, thus being widely recognized as very powerful and informative in both animal and plant
species (Ellegren, 2004). The hypervariable nature of SSRs produces allelic variations even among very closely
related varieties. Therefore, they are considered the markers of choice for the characterization of core
collections and for the management of germplasm collections (Kumar et al., 2023). One of the characteristics
that make these markers particularly interesting in genetic diversity studies is their high rate of transferability
to closely related species (Gupta et al., 2003; Simko, 2009). Nevertheless, significantly low values of cross-
transferability have been observed for genomic SSRs, which are known to be more polymorphic and located in
less conserved regions of the genome (Peakall et al., 1998; Sourdille et al., 2001).
We selected and tested for transferability and polymorphism 23 expressed sequence tag -EST-SSRs
originated from other leguminous species: Glycine max, Medicago sativa, Medicago trunculata, and Phaseolus
vulgaris (Peakall et al., 1998; Yu et al., 2000; Gaitán-Solís et al., 2002; Julier et al., 2003; Gutierrez et al., 2005;
Zhang et al., 2007). Previously, Demdoum et al. (2012) successfully cross-amplified 14 of these markers in O.
pyrenaica Sennen, O. argentea Boiss. and O. viciifolia Scop., while the remaining nine markers were noted by
Avcı et al. (2014) as polymorphic in 58 Onobrychis species from Turkish flora.
The main purpose of this study was to test the cross-genus transferability of several SSR markers into O.
montana DC. subsp. transsilvanica (Simonk.) Jáv. and O. montana and provide a preliminary evaluation of
their usefulness for assessing the genetic relationships between the two taxa.
Materials and MethodsMaterials and MethodsMaterials and MethodsMaterials and Methods
Sampling and DNA extraction
Ten populations belonging to O. montana DC. subsp. transsilvanica (Simonk.) Jáv. and six populations
of O. montana were sampled from the Alps and the Carpathians Mountains (Table 1). More details on the
sampling strategy, on the populations and on the DNA extraction can be found in Băcilă et al. (2015).
Băcilă I et al. (2023). Not Sci Biol 15(2):11549
3
TableTableTableTable 1111. Sampled populations of O. montana and O. montana DC. subsp. transsilvanica (Simonk.) Jáv.:
taxon, numbering, population code, country of origin (Ro – Romania; Fr – France; Po – Poland; Sk –
Slovakia; Mne – Montenegro), mountain range, sampling locality, geographic coordinates (partially
reproduced from Băcilă et al., 2015)
TaxonTaxonTaxonTaxon NoNoNoNo
Population Population Population Population
codecodecodecode
CountryCountryCountryCountry RangeRangeRangeRange Locality/MassifLocality/MassifLocality/MassifLocality/Massif
Coordinates Coordinates Coordinates Coordinates
(Longitude °E/ (Longitude °E/ (Longitude °E/ (Longitude °E/
Latitude °N)Latitude °N)Latitude °N)Latitude °N)
O. montana
DC. subsp.
transsilvanica
(Simonk.)
Jáv.
1 OTRM Ro
SW
Carpathians
Piatra Iorgovanului Peak,
Retezat Mts.
45°16’55.96”
22°50’45.09”
2 OTR Ro
SW
Carpathians
Piule Peak, Retezat Mts.
45°18’25.7”
22°54’31.4”
3 OTM Ro SE Carpathians
Cearcănu Peak,
Maramureşului Mts.
47°38’57.96”
24°49’54”
4 OTCh Ro SE Carpathians
Toaca Peak, Ceahlău
Mts.
46°59’35.3”
25°57’57.3”
5 OTGH Ro SE Carpathians
Ocsem Peak, Giurgeu-
Hăşmaş Mts.
46°40’41”
25°50’11”
6 OTC Ro SE Carpathians
Zăganu Peak, Ciucaş
Mts.
45°29’22”
25°58’39.1”
7 OTPC Ro SE Carpathians
Piatra Craiului Mică
Peak, Piatra Craiului
Mts.
45°33’10.3”
25°15’47.6”
8 OTB Ro SE Carpathians
Caraiman Peak, Bucegi
Mts.
45°24’56.7”
25°29’51.71”
9 OTBV Ro SE Carpathians
Postăvaru Peak, Bârsei
Mts.
45°33’58.88”
25°33’02.22”
10 OTF Ro SE Carpathians
Jgeabul Văros Peak,
Făgăraş Mts.
45°36’20.82”
24°35’37.68”
O. montana
11 OMAC Fr Alps
Col d’Izoard, Cottian
Alps
44°49’36”
6°43’48”
12 OMA Fr Alps
Col du Lautaret,
Dauphiné Alps
45°04’09.13”
6°24’05.23”
13 OMJ Fr Alps
Colomby de Gex, Jura
Mts.
46°19’38.75”
6°0’4.35”
14 OMAD Mne Dinaric Alps Durmitor, Dinaric Alps
43°06’26.75”
19°0.1’10.38”
15 OMTW Po W Carpathians
Wawoz Krakow, High
Tatras
49°10’27.24”
20°08’11.97”
16 OMBT Sk W Carpathians
Saddle between Mt.
Muran and Mt. Novy,
Belianske Tatras
49°14’55”
20°11’00”
SSR fingerprinting
23 microsatellites (original code names: MtBA01B04R2, MtBA27D09F1, MtBB36F05F1,
MtBA04C08R1, MtBB22G10F1, MtBC47B06F1, MtBB44F02R1, AG81, BI74, AL79, BG178, AL46,
AW265, AW567861, PV-at001, BM141, MTIC326, MTIC272, MTIC230, MTIC21, BM175, BM152,
BM137) developed by Peakall et al. (1998), Yu et al. (2000), Gaitán-Solís et al. (2002), Julier et al. (2003),
Gutierrez et al. (2005), and Zhang et al. (2007) for other leguminous species were tested for transferability in
O. montana DC. subsp. transsilvanica (Simonk.) Jáv. and O. montana.
Băcilă I et al. (2023). Not Sci Biol 15(2):11549
4
Each primer pair had to be optimized, as poor amplification or unspecific bands were otherwise present.
Following amplification and analysis of gel patterns, only seven SSR primer pairs were selected, fluorescently
dyed (6-FAM) and used in subsequent reactions. For the amplification of these seven microsatellites, four
different PCR programs were used in order to obtain a clear and reproductible amplification (Table 2).
Table 2Table 2Table 2Table 2. PCR programs used for SSR amplifications. PVat001, MtBB22G10, MtBA27D09, AG81, PVat001, MtBB22G10, MtBA27D09, AG81, PVat001, MtBB22G10, MtBA27D09, AG81, PVat001, MtBB22G10, MtBA27D09, AG81,
BG178, BM141, and MTIC272BG178, BM141, and MTIC272BG178, BM141, and MTIC272BG178, BM141, and MTIC272 represent the original names of the markers (see also Table 3 for
references)
PCR PCR PCR PCR stepsstepsstepssteps PVat001PVat001PVat001PVat001 MtBB22G10MtBB22G10MtBB22G10MtBB22G10
MtBA27D09, MtBA27D09, MtBA27D09, MtBA27D09,
AG81AG81AG81AG81
BG178, BM141, BG178, BM141, BG178, BM141, BG178, BM141,
MTIC272MTIC272MTIC272MTIC272
Initial denaturation 94 °C, 2 min 94 °C, 3 min 94 °C, 3 min 95 °C, 5 min
Denaturation 94 °C, 45 sec 94 °C, 45 sec 94 °C, 45 sec 94 °C, 30 sec
Annealing temperature 50 °C, 45 sec 50 °C, 1 min 51 °C, 1 min 50 °C, 30 sec
Elongation 72 °C, 1 min 72 °C, 1.5 min 72 °C, 1.5 min 72 °C, 1 min
Repet steps 2-4 35x 35x 40x 35x
Final elongation 72 °C, 5 min 72 °C, 10 min 72 °C, 10 min 72 °C, 10 min
The PCR products were purified with Sephadex - Sephacryl (1:1) (GE Healthcare Bio-Sciences AB,
USA) and then diluted 50 times. 1.5 μL of dilution were added to 10 μL mix of HiDi formamide and GeneScan
500 ROX Size Standard (Applied Biosystems, Thermo Fisher Scientific, USA) and subjected to capillary
electrophoresis on an ABI PRISM 3130 Genetic Analyzer (Applied Biosystems, Thermo Fisher Scientific,
USA). The characteristics of the seven primer pairs are presented in Table 3.
Table 3Table 3Table 3Table 3. Characteristics of seven microsatellite loci used for cross-transferability in Onobrychis sp.
LocusLocusLocusLocus Primer sequence (5’Primer sequence (5’Primer sequence (5’Primer sequence (5’----3’)3’)3’)3’)
Allele size Allele size Allele size Allele size
range (bp)range (bp)range (bp)range (bp)
ReferenceReferenceReferenceReference
MtBA27D09
F:GAAGAAGAAAAAGAGATAGATCTGTGG
R: GGCAGGAACAGATCCTTGAA
100-326 Gutierrez et al., 2005
MtBB22G10
F: CCAGTGGCAGCTACGGTACTA
R: GAGACGGAGGAGAAGTTGCTT
149-161 Gutierrez et al., 2005
AG81
F: ATTTTCCAACTCGAATTGACC
R: TCATCAATCTCGACAAAGAATG
134-184 Peakall et al., 1998
BG178
F: ACCCACTCAACTCAACACACAC
R: TTCTCCTTGACCAACCTTGATT
184-187 Zhang et al., 2007
PV-at001
F: GGGAGGGTAGGGAAGCAGTG
R: GCGAACCACGTTCATGAATGA
157-266 Yu et al., 2000
BM141
F: TGAGGAGGAACAATGGTGGC
R: CTCACAAACCACAACGCACC
103-487
Gaitán-Solís et al.,
2000
MTIC272
F: AGGTGGATGGAGAGAGTCA
R: TCATGAATAGTGGCACTCAA
132-210 Julier et al., 2003
Data analysis
Alleles scoring was performed with GeneMapper v.4.0 software (Applied Biosystems, Thermo Fisher
Scientific, USA).
PowerMarker v.3.25 (Liu and Muse, 2005) was used to calculate the total number of alleles, gene
diversity and polymorphism information content (PIC). Descriptive statistics as: number of alleles and
observed [Ho] and expected heterozygosities [He], were estimated per population using GenAlEx 6.5 (Peakall
and Smouse, 2006). A frequency matrix was generated and subsequently used within SplitsTree v.4.10 (Huson
and Bryant, 2006) to compute Unweighted Pair Group Method with Arithmetic Mean (UPGMA)
Băcilă I et al. (2023). Not Sci Biol 15(2):11549
5
phylogenetic tree based on the Shared Allele distance and the Neighbor-Net method. Bootstrap values were
calculated from 1000 replicates.
Results Results Results Results
23 SSRs were tested in O. montana DC. subsp. transsilvanica (Simonk.) Jáv. and O. montana and
consistent amplification was obtained for 18 of them (71.26%), while the rest provided multiple nonspecific
bands. However, due to lack of polymorphism and low reproductibility, only seven SSR (Table 3) were selected
for the subsequent characterization of the Onobrychis sp. populations. A total number of 32 alleles were
detected, each SSR amplified 2–6 alleles, and the average number of alleles per SSR was 4.571. PIC values
ranged from 0.375 to 0.6454, with an average of 0.5089 (Table 4). Only four SSRs (MtBA27D09,
MtBB22G10, PV-at001, and MTIC272) displayed a PIC > 0.5, and therefore were considered informative.
Relative uniform rates of genetic diversity were obtained, ranging from the lowest value of 0.5 (AG81, BG178,
and BM141) to the highest value of 0.7 (MTIC272). The gene diversity and PIC values pointed out that
MTIC272 represented the most informative locus in the two Onobrychis species analysed (Table 4).
TableTableTableTable 4444. Number of alleles, PIC, and gene diversity values for seven SSR loci analysed in Onobrychis sp.
SSR locusSSR locusSSR locusSSR locus No. of allelesNo. of allelesNo. of allelesNo. of alleles Gene diversityGene diversityGene diversityGene diversity PICPICPICPIC
MtBA27D09 6 0.6500 0.5957
MtBB22G10 4 0.6618 0.6033
AG81 4 0.5000 0.3750
BG178 2 0.5000 0.3750
PV-at001 6 0.6486 0.5931
BM141 6 0.5000 0.3750
MTIC272 4 0.7000 0.6454
MeanMeanMeanMean 4.5714.5714.5714.571 0.59430.59430.59430.5943 0.50890.50890.50890.5089
Ho and He ranged in case of O. montana DC. subsp. transsilvanica (Simonk.) Jáv. from 0.100 to 0.952,
and from 0.219 to 0.525, respectively, while for O. montana, they ranged from 0.166 to 0.750 and from 0.083
to 0.375 (Table 5).
Table 5Table 5Table 5Table 5. Genetic characterization of seven polymorphic microsatellite loci tested across sixteen
populations of Onobrychis sp. Ho = observed heterozygosity; He = expected heterozygosity.
LocusLocusLocusLocus
O. montana O. montana O. montana O. montana DC. subspDC. subspDC. subspDC. subsp. transsilvanica . transsilvanica . transsilvanica . transsilvanica
(Simonk.) (Simonk.) (Simonk.) (Simonk.) Jáv.Jáv.Jáv.Jáv.
Onobrychis montanaOnobrychis montanaOnobrychis montanaOnobrychis montana
HHHHoooo HHHHeeee HHHHoooo HHHHeeee
MtBA27D09 0.366 0.183 0.611 0.305
MtBB22G10 0.550 0.275 0.166 0.083
AG81 0.100 0.05 0.333 0.167
BG178 0.952 0.525 0.667 0.333
PV-at001 0.066 0.033 0.222 0.111
BM141 0.433 0.216 0.277 0.139
MTIC272 0.450 0.225 0.750 0.375
The UPGMA analysis (data not shown, manuscript in preparation) managed to clearly differentiate all
the 16 populations of Onobrychis, exhibiting taxonomic and geographic delineation.
Băcilă I et al. (2023). Not Sci Biol 15(2):11549
6
DiscussionDiscussionDiscussionDiscussion
The rate of SSR cross-genera transferability was 18 out of 23 tested markers (71.26%). This value was
lower than 81%, as previously reported by Demdoum et al. (2012), but higher than other related data (Eujayl
et al., 2004). The intra-genus amplification rate was considered to be around 50% (Peakall et al., 1998), but this
value quickly declined inter-genera. Zhang et al. (2007) found 18-22% transferability from Medicago to
Trifolium, while Peakall et al. (1998) reported only 1-3% transferability of Glycine’s SSR to other leguminous
genera.
However, a narrow proportion of microsatellites was found to be polymorphic in Onobrychis (38.8%
out of the 18 transferable SSRs). Several markers showed multiple bands that could not be eliminated by
calibrating the PCR conditions. The generation of multiple products during cross-species amplification may
occur by mutation, rearrangements and duplications in the flanking region and/or changes in the number of
repeats (Peakall et al., 1998), similar results being reported by Gutierrez et al. (2005) in their study of EST-SSR
in leguminous. Eventually, only seven SSR loci were selected on the base of polymorphism and reproducibility
and they were subsequently used for characterization and genetic diversity evaluation of 16 populations of O.
montana DC. subsp. transsilvanica (Simonk.) Jáv. and O. montana. These seven markers showed medium PIC
values (average 0.5089) (Table 3). The number of alleles per locus ranged from 2 to 6 (Table 3), lower than
previously reported by other studies (4-14) (Falahati-Anbaran et al., 2007). Since the studied Onobrychis species
are diploid or tetraploid species (O. montana DC. subsp. transsilvanica (Simonk.) Jáv. 2n=14, LÖve, 1975; and
respectively O. montana 2n=28; LÖve, 1984), the number of detected alleles seemed to be low. A possible
explanation is the PCR amplification bias, which could cause the loss of the less frequent alleles and
predominant detection of the most common alleles, therefore leading to an under estimation of the number of
alleles per loci in each population (Peakall et al., 1998). Although the level of polymorphism exhibited by the
seven employed microsatellites was relatively low and only four of them (MtBA27D09, MtBB22G10, PV-
at001, and MTIC272) were informative (PIC > 0.5), it was possible to differentiate all the analysed
populations by taxonomic and even geographic criteria.
ConclusionsConclusionsConclusionsConclusions
Within the studied group represented by 16 populations of O. montana DC. subsp. transsilvanica
(Simonk.) Jáv. and O. montana the rate of SSR cross-genera transferability was 18 out of 23 tested markers
(71.26%). Subsequently, only seven SSR loci were selected on the base of polymorphism and reproducibility. A
total number of 32 alleles were detected, the average number of alleles per SSR being 4.571. Relative uniform
rates for PIC and genetic diversity were obtained, pointing out that MTIC272 represented the most
informative microsatellite. Although the level of polymorphism of the seven analysed microsatellites was
relatively low, they managed to clearly differentiate all the analysed populations based on taxonomic and
geographic criteria.
Authors’ ContributionsAuthors’ ContributionsAuthors’ ContributionsAuthors’ Contributions
The contributions of authors to the manuscript are as follows: conceptualization: IB, GC; field work:
GC; data curation: IB, AC, ZRB, DȘ; formal analysis: IB and DȘ; funding acquisition: IB; investigation: IB;
methodology: IB; project administration: IB; writing - original draft: IB; writing - review and editing: IB, AC,
ZRB, GC and DȘ. All authors read and approved the final manuscript.
Băcilă I et al. (2023). Not Sci Biol 15(2):11549
7
Ethical approvalEthical approvalEthical approvalEthical approval (for researches involving animals or humans)
Not applicable.
AcknowledgementsAcknowledgementsAcknowledgementsAcknowledgements
We are grateful to Andreas Tribsch, Nadir Alvarez, Rolland Douzet, Zbigniew Mirek, Liviu Filipaș,
Mihai Puşcaş, Adrian Ilie Stoica, and Tudor Ursu for their valuable help in collecting the plant material.
This work was financially supported by a grant from the Romanian National Authority for Scientific
Research, CNDI–UEFISCDI, project number PN–II–RU–PD–2012–3–0005; 15/26.04.2013, as well as by
the Core Project BIORESGREEN, subproject BioClimpact no. 7N/03.01.2023, code 23020401.
Conflict of InterestsConflict of InterestsConflict of InterestsConflict of Interests
The authors declare that there are no conflicts of interest related to this article.
ReferencesReferencesReferencesReferences
Avcı S, Ilhan E, Erayman M, Sancak C (2014). Analysis of Onobrychis genetic diversity using SSR markers from related
legume species. Journal of Animal and Plant Sciences 24(2):556-566.
Băcilă I, Şuteu D, Coldea G (2015). Genetic divergence and phylogeography of the alpine plant taxon Onobrychis
transsilvanica (Fabaceae). Botany 93:257-266. https://doi.org/10.1139/cjb-2014-0175
Borza A (1949). Conspectus florae Romaniae regionumque affinium, Vol. II. Cartea Românească Press, Cluj.
Ciocârlan V (2009). Flora ilustrată a României – Pteridophyta et Spermatophyta. Ceres Press, Bucharest.
Demdoum S, Muñoz F, Delgado I, Valderrábano J, Wünsch A (2012). EST-SSR cross-amplification and genetic similarity
in Onobrychis genus. Genetic Resources and Crop Evolution 59:253-260. https://doi.org/10.1007/s10722-011-
9681-x
Ellegren H (2004). Microsatellites: Simple sequences with complex evolution. Nature Reviews Genetics 5:435-445.
https://doi.org/10.1038/nrg1348
Eujayl I, Sledge MK, Wang L, May GD, Chekhovskiy K, Zwonitzer JC, Mian MAR (2004) Medicago truncatula EST-
SSRs reveal cross-species genetic markers for Medicago spp. Theoretical and Applied Genetics 108:414-422.
https://doi.org/10.1007/s00122-003-1450-6
Falahati-Anbaran M, Habashi AA, Esfahany M, Mohammadi SA, Ghareyazie B (2007). Population genetic structure
based on SSR markers in alfalfa (Medicago sativa L.) from various regions contiguous to the centres of origin of the
species. Journal of Genetics 86(1):59-63. https://doi.org/10.1007/s12041-007-0008-9
Gaitán-Solís E, Duque MC, Edwards KJ, Tohme J (2002). Microsatellite repeats in common bean (Phaseolus vulgaris)
isolation, characterization, and cross-species amplification in Phaseolus ssp. Crop Science 42(6):2128-2136.
https://doi.org/10.2135/cropsci2002.2128
Gupta PK, Rustgi S, Sharma S, Singh R, Kumar N, Balyan HS (2003). Transferable EST-SSR markers for the study of
polymorphism and genetic diversity in bread wheat. Molecular Genetics and Genomics 270:315-323.
https://doi.org/10.1007/s00438-003-0921-4
Gutierrez MV, Vaz Patto MC, Huguet T, Cubero JI, Moreno MT, Torres AM (2005). Cross-species amplification of
Medicago truncatula microsatellites across three major pulse crops. Theoretical and Applied Genetics 110:1210-
1217. https://doi.org/10.1007/s00122-005-1951-6
Huson DH, Bryant D (2006). Application of phylogenetic networks in evolutionary studies. Molecular Biology and
Evolution 23(2):254-267. https://doi.org/10.1093/molbev/msj030
Băcilă I et al. (2023). Not Sci Biol 15(2):11549
8
Julier B, Flajoulot S, Barre P, Cardinet G, Santoni S, Huguet T, Huyghe C (2003). Construction of two genetic linkage
maps in cultivated tetraploid alfalfa (Medicago sativa) using microsatellite and AFLP markers. BMC Plant Biology
3:1-19. https://doi.org/10.1186/1471-2229-3-9
Kumar GP, Pathania P, Goyal N, Gupta N, Parimalan R, Radhamani J, … Rajkumar S (2023). Genetic diversity and
population structure analysis to construct a core collection from safflower (Carthamus tinctorius L.) germplasm
through SSR markers. Agriculture 13(4):836. https://doi.org/10.3390/agriculture13040836
Liu K, Muse SV (2005). PowerMarker: an integrated analysis environment for genetic marker analysis. Bioinformatics
21(9):2128-2129. https://doi.org/10.1093/bioinformatics/bti282
Löve Á (1975). IOPB chromosome number reports XLIX. Taxon 24(4):501-516. https://doi.org/10.1002/j.1996-
8175.1975.tb00341.x
Löve Á (1984). Chromosome number reports LXXXII. Taxon 33(1):126-134. https://doi.org/10.1002/j.1996-
8175.1984.tb02474.x
Mohsen HHS, Nasab MZ (2010). Cytotaxonomy of some Onobrychis (Fabaceae) species and populations in Iran.
Caryologia 63(1):8-31. https://doi.org/10.1080/00087114.2010.589705
Nyárády A, Nyárády EI (1957). Onobrychis. In: Săvulescu T (Ed). Flora Republicii Populare Române, Vol. V. Academiei
Republicii Populare Române Press, Bucharest pp 341-345.
Peakall R, Gilmore S, Keys W, Morgante M, Rafalski A (1998). Cross-species amplification of soybean (Glycine max)
simple sequence repeats (SSRs) within the genus and other legume genera: implications for the transferability of
SSRs in plants. Molecular Biology and Evolution 15(10):1275-1287.
https://doi.org/10.1093/oxfordjournals.molbev.a025856
Peakall ROD, Smouse PE (2006). GenAlEx 6: genetic analysis in Excel. Population genetic software for teaching and
research. Molecular Ecology Notes 6(1):288-295. https://doi.org/10.1093/bioinformatics/bts460
POWO (2023). Plants of the World Online. Retrieved 2023 May 31 from: http://www.plantsoftheworldonline.org/
Sârbu I, Ştefan N, Oprea A (2013). Plante vasculare din România, Determinator ilustrat de teren. Victor B. Victor Press,
Bucharest.
Simko I (2009). Development of EST-SSR markers for the study of population structure in lettuce (Lactuca sativa L.).
Journal of Heredity 100(2):256-262. https://doi.org/10.1093/jhered/esn072
Sourdille P, Tavaud M, Charmet G, Bernard M (2001). Transferability of wheat microsatellites to diploid Triticeae species
carrying the A., B and D genomes. Theoretical and Applied Genetics 103:346-352.
https://doi.org/10.1007/s00122-001-0542-4
Yu K, Park SJ, Poysa V, Gepts P (2000). Integration of simple sequence repeat (SSR) markers into a molecular linkage
map of common bean (Phaseolus vulgaris L.). Journal of Heredity 91(6):429-434.
https://doi.org/10.1093/jhered/91.6.429
Zhang Y, Sledge MK, Bouton JH (2007). Genome mapping of white clover (Trifolium repens L.) and comparative analysis
within the Trifolieae using cross-species SSR markers. Theoretical and Applied Genetics 114:1367-1378.
https://doi.org/10.1007/s00122-007-0523-3
The journal offers free, immediate, and unrestricted access to peer-reviewed research and scholarly work. Users are
allowed to read, download, copy, distribute, print, search, or link to the full texts of the articles, or use them for any
other lawful purpose, without asking prior permission from the publisher or the author.
License License License License ---- Articles published in Notulae Scientia BiologicaeNotulae Scientia BiologicaeNotulae Scientia BiologicaeNotulae Scientia Biologicae are Open-Access, distributed under the terms and
conditions of the Creative Commons Attribution (CC BY 4.0) License.
© Articles by the authors; Licensee SMTCT, Cluj-Napoca, Romania. The journal allows the author(s) to hold the
copyright/to retain publishing rights without restriction.
Notes:Notes:Notes:Notes:
Material disclaimer: The authors are fully responsible for their work and they hold sole responsibility for the articles published
in the journal.
Maps and affiliations: The publisher stay neutral with regard to jurisdictional claims in published maps and institutional
affiliations.
Băcilă I et al. (2023). Not Sci Biol 15(2):11549
9
Responsibilities: The editors, editorial board and publisher do not assume any responsibility for the article’s contents and for
the authors’ views expressed in their contributions. The statements and opinions published represent the views of the authors
or persons to whom they are credited. Publication of research information does not constitute a recommendation or
endorsement of products involved.