Peruvian Journal of Agronomy
http://revistas.lamolina.edu.pe/index.php/jpagronomy/index

RESEARCH ARTICLE
https://doi.org/10.21704/pja.v6i1.1733

Received for publication: 02 August 2021
Accepted for publication: 02 March 2022

Published: 30 April 2022
ISSN: 2616-4477

Incidence of leaf diseases in the agroforestry systems at Yurimaguas,
Peru

Incidencia de las enfermedades foliares en los sistemas agroforestales de
Yurimaguas, Perú

L. Aragón1*; H. Huarhua1; M. Cerna1; J. Flores1; F. Dueñas2; C.P. Lao3; R. Solis4; J. Alegre5

*Corresponding author: lili@lamolina.edu.pe

Abstract

An agroforestry system (SAF) is characterized by having a diversity of components, such as timber and non-
timber forest species and crops, pastures, or a livestock production system. This diversity of components
in the system reduces the intensity of diseases, e.g. foliar diseases. This study aimed to detect the fungal
microorganisms associated with the leaf spots of plant species that are part of the agroforestry production
systems of the Peruvian farmers from Yurimaguas and to determine the level of incidence of the leaf spots
in the systems of agroforestry production. Different land cropping systems were implemented in the farms,
such as palm (Bactris gasipaes) to produce palm hearts, cocoa (Theobroma cacao), and plantain (Mussa
sp.). Also, silvopastoral systems with fast and slow growing timber species and cattle with pastures for
grazing and reforestation in areas of secondary forests in a state of degradation. Prospecting, collecting,
and determining the incidence of diseases in each farm were carried out and later they were identified with
molecular methods using the primers ITS 1 and ITS 4. The symptoms predominantly observed were, leaf
spots in cocoa (rootstock), palm, and plantain. Symptoms like wilting, decline, or rot were not observed. The
incidence was evaluated in two collection periods (2018 and 2019). The fungi isolated from the leaf spots
were Pestalotiopsis sydowiana and Colletotrichum siamense as causative agents of leaf spots on palm and
cocoa, and Mycosphaerella fijiensis on plantain. When determining the incidence from April 2018 to October
2019, a decrease in this parameter (incidence) was observed for farms with palm, especially in those where
the production system was improved by the use of fertilizants as a requirement of the crop. It was concluded
that the highest intensity of foliar diseases occurred in agricultural systems with monoculture of palm with 100
% at the beginning of the evaluation, and for agroforestry systems in the silvopastoral prototype, it was only
detected in a range of 0 % to 25 %.

Keywords: Agroforestry Systems, Leaf spots, palm

PERI

Resumen

Un sistema agroforestal (SAF) se caracteriza por tener una diversidad de componentes como especies
forestales maderables y no maderables, así como cultivos, pastos o un sistema de producción ganadera. Esta
diversidad de componentes en el sistema reduce la intensidad de las enfermedades, por ejemplo, las foliares.

1 Universidad Nacional Agraria La Molina, Facultad de Agronomía, Departamento Académico de Fitopatología, Lima, Peru.
2 Universidad Nacional Agraria La Molina, Facultad de Agronomía, Departamento Académico de Horticultura, Docente, Lima, Perú.
3 Universidad Nacional Agraria de la Selva, área de suelos, Facultad de Agronomía, Tingo María. Huánuco, Perú.
4 Instituto de Investigación Peruano de la Amazonía, Iquitos, Perú.
5 Universidad Nacional Agraria La Molina, Facultad de Agronomía, Departamento Académico de Suelos, Docente, Lima, Perú.

How to cite this article:

Aragón, L, Huarhua, H., Cerna, M., Flores, J., Dueñas, F., Lao, C., Solis, R., Alegre, J.
(2022). Incidence of leaf diseases in the agroforestry systems at Yurimaguas, Peru.
Peruvian Journal of Agronomy, 6(1), 93-102. https://doi.org/10.21704/pja.v6i1.1733

Incidence of leaf diseases in the agroforestry systems at Yurimaguas, Peru

January - April 2022

Los objetivos fueron detectar los microorganismos
fúngicos asociados a las manchas foliares de las
especies vegetales que forman parte de los sistemas
de producción agroforestal de los agricultores de
Yurimaguas (Loreto) que participaron en el SLA
y determinar el nivel de incidencia de las manchas
foliares en los sistemas de producción agroforestal. En
estas fincas se implementaron diferentes sistemas de
cultivo de la tierra, como la palma (Bactris gasipaes)
para producir palmitos y cacao (Theobroma cacao),
incluyendo el plátano (Mussa sp.). También, sistemas
silvopastoriles con especies maderables de crecimiento
rápido y lento y ganado con pastos para el pastoreo y
la reforestación en áreas de bosques secundarios en
estado de degradación. Se realizó la prospección,
recolección y determinación de la incidencia de las
enfermedades en cada finca, y posteriormente se
identificaron con métodos moleculares utilizando
los cebadores ITS 1 e ITS 4. Los síntomas que se
observaron, predominantemente, fueron manchas
foliares en cacao (patrón), palma y plátano. No se
observaron síntomas de marchitamiento, decaimiento
o podredumbre. La incidencia se evaluó en dos
periodos de recolección (2018 y 2019). Los hongos
aislados de las manchas foliares fueron Pestalotiopsis
sydowiana y Colletotrichum siamense como agentes
causantes de las manchas foliares en palma y cacao, y
Mycosphaerella fijiensis en plátano. Al determinar la
incidencia desde abril de 2018 hasta octubre de 2019,
se observó una disminución de este parámetro para
las fincas con palma, especialmente en aquellas donde
la implementación consistió en mejorar el sistema de
producción a través de la fertilización con base en los
requerimientos del cultivo. Se concluyó que la mayor
intensidad de enfermedades foliares se presentó en
los sistemas agrícolas con monocultivo de palma
con un 100 % al inicio de la evaluación, y para los
sistemas agroforestales en el prototipo silvopastoril,
solo se detectó en un rango de 0 % a 25 %.

Palabras clave: Sistemas agroforestales, manchas
foliares, palma

1. Introduction
An agroforestry system is production in which,
unlike a monoculture, at least two or more plant
species coexist; or plants and animals; but one
of them must be a perennial tree species (Nair,
2014). This greater diversity of species makes
the existing ecology more complex than if it
were a monoculture.

From a phytopathological point of view,
their development and productivity can affect
commercial production fields. In addition,
phytopathogens can affect the quality of
the harvested product generating economic
losses. These phytopathogens can be fungi,
bacteria, viruses, or nematodes, among
others. Favorable conditions for the pathogen
growth, such as temperature, relative humidity,
optimal rainfall, etc. Together with the host
susceptibility reaction, produce high levels of
disease intensity, generating epidemics (Agrios
2005). Greater activity of these behaviors is
observed in intensive monoculture systems.
But, under an agroforestry system, in which
there are different plant species, the behavior
of phytopathogens is expected to be different
because of the coexistence of a greater diversity
of plant species. Banerjee et al (2015) found
that agroforestry systems were characterized
by having a greater diversity of bacterial
communities in their biofilm, such as bacteria of
the genera Arthrobacter, Acidobacteria_Gp16,
Burkholderia, Rhodanobacter, and Rhizobium
at the level of the rhizosphere. Müller et al
(2006) reported the role of microorganisms in
the phyllosphere of plant species in forests, a
role related to nutrient transformation processes.
Additionally, the action of these microorganisms
is attributed to changes in environmental biotic
behavior, such as the increase in the population
density of certain groups of microorganisms,
which would impact their metabolic activity.
Díddier and Castro (2017) reported that, in the
experience of the organic banana agroforestry
system in Costa Rica, there is coexistence with
Sigatoka (whose causal agent is Mycosphaerella
fijiensis); under a condition of enough leaves
and clusters; with fruits that satisfy the
quality standards for the national and export
markets. They also showed that nematicide
applications were not carried out because the
nematode populations were below the damage
thresholds, and the increase in biodiversity in
the system explained this. Mosquera-Mena
(2013) mentioned that small producers in
the Urabá region from Antioquia, Colombia,
reported a favorable phytosanitary balance in
agroforestry systems because these systems
favored a greater diversity of microorganisms.

Aragón, L, Huarhua, H., Cerna, M., Flores, J., Dueñas, F., Lao, C., Solis, R., Alegre, J.

Peruvian Journal of Agronomy 6(1): 93-102 (2022)
https://doi.org/10.21704/pja.v6i1.1733

According to the experience of the Project to
Recover Natural Ecosystems in the Caquetaño
Foothills in Ecuador (1998), one advantage of
agroforestry systems was the reduction of pest
and disease problems through sanitary pruning
practices. Montagnini et al. (2015) analyzed the
effect of output under shade in the decrease or
increase of pests and diseases in the agroforestry
system of coffee production. For example, in
Colletotrichum kahawai, the presence of trees
reduced the spread of pathogen propagules
by reducing the impact of rain. Under a shady
environment, the activity of biocontrol fungi,
such as Beauveria bassiana and Lecanicillium
lecanii on CBB and rust, respectively, were
favored. Based on these behaviors in the different
multifunctional systems, the following objectives
were proposed in the present work; detect fungal
microorganisms associated with leaf diseases
such as leaf spots of plant species that are part of
the agroforestry production systems of farmers
from Yurimaguas (Loreto) who participated in
the Sustainable Landscapes for the Amazon
Project, and determine the level of incidence of
leaf diseases in agroforestry production systems
as a comparative parameter between the different
multifunctional systems.

2. Material and Methods
Location

The study was carried out at the Yurimaguas
district, Alto Amazonas province, Loreto Region,
Perú (Figure 1). This zone was the development
area of the “Sustainable Landscapes for the
Amazon project” funded by CIAT (Centro
Internacional de Agricultura Tropical) – UNALM
(Universidad Nacional Agraria La Molina).
Eighteen farmers participated in the project
committed certain areas for implementation or
conservation purposes (Table 1). In this study,
the farmers expressed their interest in two types
of strategies for the sustainable use of the forest.
On the one hand, there is the implementation
of systems with different components, among
which the Agro-Forestry Systems (SAF) stand
out, followed by the Silvopastoral Systems

(SSP) with natural pastures or paddocks;
Forest Enrichment Systems (SEF), and
finally Reforestation (R). There are different
SAF´s: Palm Heart Implementation, Cocoa
Implementation, Palm crop Improvement, and
Cocoa crop Improvement. Forest enrichment
(SEF) corresponds to forest areas with more tree
species installed. In Reforestation (R), there are
pasture areas with tree species established (Table
1).

Detection of fungal microorganisms
associated with leaf spots of plant species in
the agroforestry production systems

Phytopathological sampling

A disease evaluation was made for each
agroforestry system (18 in total), after the diseased
plants be collected, following the methodology
reported by French & Hebert (1982). Plant organs
showing any disease symptom were collected in
propylene plastic bags, at least ten units per type
of symptom, and were kept under refrigeration
conditions, because of the high temperatures
in Yurimaguas, to later be transported to the
UNALM plant pathology laboratory (French &
Herbert 1982).

Isolation and maintenance

The samples were analyzed at the Plant
Pathology Laboratory from the UNALM. The
collected samples were washed with plain water
to remove traces of soil or dust. They were then
disinfected with ethanol (70%) for one minute
and finally rinsed with sterilized distilled water
for the same period. The diseased tissue sections
of the disinfected samples were placed in Petri
dishes containing PDAA (Acidified Potato
Dextrose Agar) culture medium. The plates were
incubated at 25 °C in the dark. After five days,
the developed cultures were checked (French
& Hebert, 1982). The purified isolates were
kept in tubes containing PDA medium under
refrigeration (10 °C).

Incidence of leaf diseases in the agroforestry systems at Yurimaguas, Peru

January - April 2022

LOCATION OF SOIL MONITORING
POINT MAP

Figure 1. Location map of the farms in the district of Yurimaguas (Loreto) that participated in the Sustainable
Landscapes for the Amazon project, according to geo-referencing (elaboration: Bach. André Mauricio Valderrama
Espinoza).

Identification of isolates

Morphological identification. The preparations
of the fungal structures were made on slides
and coverslips. The propagative structures were
visualized through the compound microscope.
Barnett’s (1999) identification key was used for
identification at the gender level.

Molecular identification. The fungi were
cultivated in PDA for 3 to 5 days at 25 °C
to obtain the extraction material. The DNA
extraction methodology was carried out from
agar described by Saitoh et al. (2006) modified
by Huarhua et al. (2020). A 5 to 10 mm
mycelium block was used with agar, which was
placed in a 1.5 ml Eppendorf tube to which 500
microliters of lysis buffer (100 mM Tris HCl, 10
mM ethylene diamine tetraacetic acid [EDTA],
1M KCl; pH 8.0). The mixture was kept at room
temperature for 10 minutes, then it was triturated
with micropistils, then phenol-chloroform iso-
amyl-alcohol (24: 24: 1) was applied, and it was
centrifuged for 10 minutes at 12000 rpm, it was

recovered the upper aqueous phase, and a similar
volume was added to the iso-propanol collection
to be incubated at -20 °C for 15 minutes. After
this time, it was centrifuged at 12000 rpm for 10
minutes at room temperature, and the supernatant
was discarded; then, a wash was carried out with 1
ml of 70% ethanol and centrifuged for 5 minutes.
After that time, the ethanol was removed, and
it was left to dry for 2 hours. Finally, the DNA
was resuspended in 30 µl of ultra-pure water
and stored at -20 °C. The concentration and
quality of DNA were determined using the
Nanodrop 2000 spectrophotometer and by 1%
agarose gel electrophoresis, which was stained
with hydragreen and run at 90 V for 30 minutes.
Genomic DNA was used as the template strand
for PCR to amplify the internal transcribed space
(ITS) of the ribosomal DNA region, including
5.8S rDNA and partial regions of the 18S and 25S
ribosomal subunits for which the primers were
used. ITS 1 (TCCGTAGGTGAACCTGCGG)
and ITS 4 (TCCTCCGCTTATTGATATGC) as
described by White et al. (1990).

Aragón, L, Huarhua, H., Cerna, M., Flores, J., Dueñas, F., Lao, C., Solis, R., Alegre, J.

Peruvian Journal of Agronomy 6(1): 93-102 (2022)
https://doi.org/10.21704/pja.v6i1.1733

Table 1. Result of the phytopathological analyzes and molecular identification, as well as the incidence observed in the
2018 and 2019 sampling of the Farms (each one corresponds to a farmer) of Yurimaguas (Loreto) of the Sustainable
Landscapes Project for the Amazon.
ID_Soils Implementation of:

Area
(ha)

Symptons Pathogen
Incidence

(April, 2018)
Incidence

(October, 2019)

Y04 Palm heart Improvement 0.6 Leaf spots Colletotrichum siamense, Neopestalotiopsis foedans 100% 60%
Implementation of Cocoa in
Agroforestry

2.1 Leaf spots Cercospora sp 20% no

Y07 Palm heart Implementation 1 Leaf spots Neopestalotiopsis foedans Colletotrichum siamense 100% 90%

Reforestation 1 Without leaf spots no no

Y08 Improvement Palm heart 2.9 Leaf spots Colletotrichum siamense, Neopestalotiopsis foedans 50% 10%

Y13 Reforestation 2.7 without symptons no no
Y19 Silvopastoral Systems 3 without symptons no no

Reforestation 1.9 without symptons no no

Y26 Cocoa Improvement in Agroforesty 1.4 Sigatoka Paracercospora fijiensis 80% 70%
Reforestation 2.3 without leaf spots no no

Y36 Silvopastoral Systems 2.6 without symptons no no
Reforestation 2.7 without symptons no no

Y37 Silvopastoral Systems 4.2 Leaf spots in Paliperro Cercospora sp 10% 5%

Y38 Implementation of Cocoa in Agroforestry 0.9 without symptons no no

Reforestation 1.3 without symptons no no

Y39 Silvopastoral Systems 3 without symptons no no
Y40 Reforestation 2.5 without symptons no no

Y41 Implementation of Cocoa in Agroforestry 1.8
sigatoka (banano);
leaf spot (Cocoa)

Paracercospora
fijiensis (banano);

Colletotrichum siamense
(Cacao)

80%
25%

Forest Enrichment 2 without symptons no no

Y43 Cocoa Improvement in Agroforesty 1.5 die-back Lasiodiplodia theobromae 20% 20%
Implementation of Cocoa in
Agroforestry

2 without symptons no no

Y45 Implementation of Cocoa in Agroforestry 1
Poor development
(cocoa)
Sigatoka (plantain)

abiotic, unsuitable
weather (cocoa)

Paracercospora fijiensis

100%
100%

Silvopastoral Systems 2.7 without symptons no no

Y47 Implementation of Cocoa in Agroforestry 1.25 without symptons no no

Reforestation 0.8 without symptons no no

Y48 Palm heart Implementation 1.4 Leaf spots Colletotrichum siamense, Neopestalotiopsis foedans 60% 40%
Implementation of Cocoa in
Agroforestry

0.9 without symptons no no

Reforestation 2.2 without symptons no no

Y50 Silvopastoral Systems 2.8 without symptons no no
Forest Enrichment 3 without symptons no no

Y51 Silvopastoral Systems 3.6 without symptons no no

The total PCR reaction mix (25 µl) contained
1 µl of genomic DNA (50 to 100 ng / µl), 4 µl
of 10X PCR Buffer (ACTaq ™), 2 out of 2.5
mM dNTPs (ACTaq ™), 0.125 µl (5 U) of the
enzyme Taq DNA polymerase (ACTaqTM) and
0.5 µl of each primer at a concentration of 20

Mm. The amplification was carried out with a
thermal cycler (Thermo Scientific), following
the next reaction cycles: initial denaturation of
94 °C for 2 minutes; followed by 35 cycles of
denaturation at 98 °C for 1 min, a hybridization
temperature at 58 °C for 1 min, elongation of 72

Incidence of leaf diseases in the agroforestry systems at Yurimaguas, Peru

January - April 2022

Figure 2. Leaf spots on palm heart. The small,
blackish spots correspond to Colletotrichum
siamense and the straw-colored spots to
Neopestalotiopsis foedans.

Figure 3. Banana leaf spots caused by Mycosphaerella
fijiensis; the causative agent of black leaf streak
disease.

°C for 2 min, and final elongation temperature of
72 °C for 10 min (Ferrer et al., 2001; Kumar &
Shukla, 2005; Huarhua et al., 2018; Rep et al.,
2004; Inami et al., 2014). The PCR products were
separated by 2% agarose gel electrophoresis (0.5
X TAE buffer) containing Hidragreen and run at
90V for 30 minutes. For the visualization of the
fragments, the ultraviolet light transilluminator
(UVP brand) was used, the 100bp Ladder
(PROMEGA) was used as a marker. The PCR
amplified fragments were sequenced in both
directions. For sequencing, the eluted products
were sent to MACROGEN Korea for processing
and delivery of the chromatograms, and these
were “cleaned” of indeterminacies with the
MEGA 7 program (Kumar et al., 2016), thus
obtaining the sequences that were compared
using BLAST (Basic Local Alignment Search
Tool; https://blast.ncbi.nlm.nih.gov/Blast.cgi) to
determine similarities in GenBank.

Determination of the level of incidence of leaf
spots in agroforestry production systems

Incidence assessment

Two visits were made to assess the incidence
of diseases in the plant species in each of the
agroforestry systems. Incidence assessment was
calculated by the percentage of affected plants
concerning the total, one for each year during the

duration of the project (2018, 2019) (French &
Hebert, 1982). It should be noted that in 2016
a preliminary survey trip was made and in 2017
the evaluation of diseases in each agroforestry
production system was done.

3. Results and Discussion

Between 2018 and 2019, the fields of the 18
farmers who participated in the Sustainable
Landscapes for the Amazon Project (CIAT
- UNALM) were visited. The production
systems were characterized by having different
agroforestry systems: cocoa implementation
systems, palm implementation to produce palm
heart, cocoa maintenance, palm maintenance,
silvopastoral design, forest enrichment, and
reforestation (Table 1). Symptoms of leaf spots
were observed predominantly in systems with
less diversity of species such as those for the
implementation or maintenance of palm, and
only in an agroforestry system for implementing
cocoa (it was found in the installation of the
rootstocks): as well as in plantain as part of the
cocoa implementation system. Lasiodiplodia
theobromae, which was causing regressive
death in a cocoa holding system, was isolated
but it was a rare case. This fungus behaves as
an endophyte, and under stress conditions, its
behavior turns as a phytopathogen; therefore, it

Aragón, L, Huarhua, H., Cerna, M., Flores, J., Dueñas, F., Lao, C., Solis, R., Alegre, J.

Peruvian Journal of Agronomy 6(1): 93-102 (2022)
https://doi.org/10.21704/pja.v6i1.1733

is an indicator of a stress condition in plants. The
farmer reported that the focus of plants in which
this phytopathogen was detected corresponded
to a flood zone accentuated with problems in
fertilization.

Detection of fungal microorganisms
associated with leaf spots of plant species in
the agroforestry production systems

Table 1 shows the results of the phytopathological
analyzes of each of the farms in which leaf
spots were detected. The species identified
morphologically and molecularly corresponded
to the species Pestalotiopsis sydowiana and
Colletotrichum siamense as causal agents of leaf
spots in palm and cocoa; and Mycosphaerella
fijiensis on plantain. Figures 2 and 3 show the
characteristic symptoms and those caused by
the isolated pathogens. No necrotic lesions
were detected in pastures or tree species located
between farms, nor in the forest species situated
in the reforestation or forest strengthening
systems in the silvopastoral systems.

Molecular identification

The method used to get the genomic DNA of the
leaf spot isolates from the farms is described by
Saitoh et al. (2006). Genomic DNA was evaluated
to determine purity and sufficient concentration
to perform the polymerase chain reaction (PCR).
The concentration of the evaluated samples was
found between 90.1 ng / µL and 428 ng / µL.

The samples’ PCR amplification for the ITS
region of rDNA, generated products of 500 to 600
base pairs (bp) with the primers ITS 1 and ITS
4. The analysis of the sequences compared with
the NCBI database -BLAST showed a percent
identity of 100%. The identification results
were: Pestalotiopsis sydowiana (Y04, Y07,
Y08, Y41, and Y48), Lasiodiplodia theobromae
(Y43). In the case of other isolates from the same
farms Y04, Y07, Y08, Y41, and Y48, it was
possible to determine based on the ITS region
of the isolates that the Colletotrichum species
had 100% similarity of their sequences with
the Colletotrichum siamense, Colletotrichum
gloesporioides, Colletotrichum karsti (Table 2).

Belisário et al. (2020) reported N. foedans as
a causal agent of leaf spots in Licuala grandis
(totuma, ornamental palm). Maharachchikumbura
et al. (2016) identified the new genera
Neopestalotiopsis and Pseudopestalotiopsis
(from the genus Pestalotiopsis) based on the
regions of the genome that encode the internal
transcribed space (ITS), partial β-tubulin (TUB
), and partial translation of elongation factor
1 alpha (TEF); such new genera do not show
differences with the morphological structures
of the genus Pestalotiopsis; this is also reported
by Norphanphoun et al. (2019) for which
Pestalotiopsis sp is recognized as a cryptic species.
Morsbach et al. (1998) said Colletotrichum is a
causal agent of necrotic lesions in the nursery
stage or the first phenological stages of the
palm crop. Arroyo et al. (2004) and Peña (1996)
reported Colletotrichum sp as a causal agent of
leaf spots, which they call black leaf spot; which
appear as small black spots surrounded by a

Table 2. Results of molecular ID of the isolates (from the plant samples with symptoms
of leaf spots and regressive death) compared with the NCBI.
MU Species Max

score
Query
cover

% Identity ID NCBI

Y48 Pestalotiopsis sydowiana 963 100% 100% MN856236.1
Y04 Pestalotiopsis sydowiana 965 100% 100% MN856236.1
Y48 Colletotrichum siamense /

Colletotrichum gloeosporioides
961 100% 100% MK184442.1

MN548460.1
Y04 Colletotrichum siamense/

Colletotrichum karsti /
Colletotrichum gloeosporioides

1007 100% 100% MN635698.1
MN486559.1
MH700456.1

Y43 Lasiodiplodia theobromae 950 100% 100% MT103324.1

Incidence of leaf diseases in the agroforestry systems at Yurimaguas, Peru

January - April 2022

100

small chlorotic circular halo; as it was observed
in the palm plants of the farms of Yurimaguas.
Weir et al. (2012) determined Colletotrichum
gloeosporioides as a species complex and,
due to the identification of ITS genes, several
species of Colletotrichum (such as C. siamense)
are included. James et al. (2014) reported
Colletotrichum siamense in cacao, as it was
found in the molecular identification of isolates
from cacao from the Yurimaguas farms.

Determination of the incidence of leaf spots in
agroforestry production systems

Table 1 also shows the incidence percentages
determined during the visits to the farms. A
decrease in the incidence from 2018 to 2019
is distinguished for the improvement of cocoa,
cocoa implementation, implementation of palm,
and improvement of palm plantations. In plantain,
that were part of the cocoa implementation
and improvement systems, the reduction was
minimal, or there was no incidence decrease.

The causative agents of leaf spots have a
necrotrophic behavior; this means that, according
to their physiology of parasitism, they cause
the death of plant living tissue mainly through
toxins. The pathogen feeds on dead tissue as a
consequence of the action of these metabolites.
With plants stressed by low fertilization levels
or extreme cases of fertilizer deficiencies,
they become more susceptible to the action
of necrotrophic pathogens. This is supported
by Pornsuriya et al (2020), who showed that
Neopestalotiopsis species (Pestalotiopsis)
are weak and secondary pathogens. Alfenas
et al., 2009, also mentioned the opportunistic
behavior of Pestalotiopsis spp agent, the causant
of Eucalyptus leaf spots, as well as the fact of
infecting physiologically weak plants. When
determining the incidence from April 2018 to
October 2019, a decrease in this parameter could
be observed for farms with palm, especially in
those which the typology of the palm trees was
improved through an increase in the fertilization
of the farms according to the crop. By having
plants with adequate nutrient requirements,
susceptibility to necrotrophs was reduced. Bovi

(1993), cited by Morsbach et al. (1998), also
refers to the fact that the action of Colletotrichum
can be minimized with good nutrition. Arroyo et
al. (2004) show that Colletotrichum sp occurs
mainly during the first six months of the crop or in
the first two-thirds of the leaves that differentiate
leaflets; as it could be seen in the plantations of
the Yurimaguas farms, especially those in which
the fertilization levels were not adequate.

A constant harvest characterized the palm heart
crop, therefore fertilization of macroelements
and microelements is highly required. In the case
of banana, based on the concept of the disease
triangle; the banana variety was susceptible
to Sigatoka, the environmental conditions
favored that pathogen, and the inoculum source
existed in the production system, so the disease
development was clear. In this case, no incidence
reduction was observed, because no palliative
measurements had been implemented, since the
aim of the plantain installation was to generate
shade for the Cacao rootstocks that were later
grafted with a commercial variety, so there was
no requirement for the bananas crop fertilization.
Although the fertilization practice was improved
by reducing susceptibility of the palm trees in
the systems implementation and maintenance,
the influence of the diversity of microorganisms
action, existing in the biofilm of the phyllosphere,
was not ruled out (Müller et al, 2006). It could
be corroborated through the microbiome study
which it was not considered as part of the CIAT
project. This reduction can also be explained by
the induction of systemic resistance generated
by the microbial load existing in the rhizosphere
(Banerjee et al, 2015).

4. Conclusions
The fungi Pestalotiopsis sydowiana,
Colletotrichum siamense, and Mycosphaerella
fijiensis were isolated and identified as the
causative agents of leaf spots on palm, cocoa,
and plantain leaves, respectively.

They reported the lowest diseases incidence
in the silvopastoral systems, and the highest
occurred in monocultures. Therefore, a greater
diversity of plant species within a production

Aragón, L, Huarhua, H., Cerna, M., Flores, J., Dueñas, F., Lao, C., Solis, R., Alegre, J.

Peruvian Journal of Agronomy 6(1): 93-102 (2022)
https://doi.org/10.21704/pja.v6i1.1733

101

system under the Yurimaguas’ farms conditions
leads to a reduce development of leaf diseases.

Acknowledgments
The development of this research was possible
thanks to the funds granted by the CIAT-UNALM
Project, VLIR - UNALM, and the Diagnosis of
Phytopathology Clinic Laboratory.

Conflicts of interest
The signing authors of this research work
declare that they have no potential conflict of
personal or economic interest with other people
or organizations that could unduly influence this
manuscript.

Author contributions
Elaboration and execution, Development of
methodology, Conception and design; Editing
of articles and supervision of the study have
involved all authors.

ORCID and e-mail

L. Aragón lili@lamolina.edu.pe

0000-0003-0312-5020

H. Huarhua medalihuarhua@lamolina.edu.pe

0000-0002-1482-8170

M. Cerna mcerna@lamolina.edu.pe

0000 - 0003 - 1182 - 872X

J. Flores gerardo@lamolina.edu.pe

0000 - 002 - 2651 - 5446

F. Dueñas fduenas@lamolina.edu.pe

0000-0002-6149-3334

C.P. Lao ceila.lao@unas.edu.pe

0000-0002-0125-2133

R. Solis reynaldosolisleyva@gmail.com

0000-0002-5905-4922

J. Alegre jalegre@lamolina.edu.pe

0000-0002-7282-045X

5. References
Agrios, G. 1995. Fitopatología. Editorial Limusa S.A.

México. 838 p.

Alfenas, A. C., Zauza, E. A. V., Mafia, R. G., & Assis, T.
F. (2009) Clonagem e Doenças do Eucalipto. 2ª Ed.
Viçosa, MG. Editora UFV.

Arroyo, C., Arauz, L. F. & Mora, J. (2004). Incidencia de
enfermedades en pejibaye (Bactris gasipaes kunth)
para palmito. Agronomía mesoamericana, 15, 61–
68.

Banerjee, S., Baah-Acheamfour, M., Carlyle, C. N.,
Bissett, A., Richardson, A. E., Siddique, T., Bork,
E.W., & Chang, S. X. (2015). Determinants of
bacterial communities in Canadian agroforestry
systems. Environmental Microbiology, 18(6), 1805–
1816. https://doi.org/10.1111/1462-2920.12986

Barnett, H. (1999). Illustrated Genera of Imperfect Fungi.
American Phytopathology Society. Fifth ed. USA.
389 p.

Belisário, R., Aucique-Pérez, C. E., Abreu, L. M., Salcedo,
S. S., de Oliveira, W. M., & Furtado, G. Q. (2020).
Infection by Neopestalotiopsis spp. occurs on
unwounded eucalyptus leaves and is favoured by
long periods of leaf wetness. Plant Pathology, 69,
194–204.

Díddier, M., & Castro, C. (2017). Sistemas agroforestales.
Adaptación y mitigación en la producción de
banano y cacao. Boletín N° 07. Un día en la Finca.
Proyecto EUROCLIMA-IICA. San José de Costa
Rica. 12 pp.

Ferrer, C., Colom, F., Frasés, S., Mulet, E., Abad, J. L.,
& Alió, J. L. (2001). Detection and identification
of fungal pathogens by PCR and by ITS2 and 5.8S
ribosomal DNA typing in ocular infections. Journal
of Clinical Microbiology, 39(8), 2873–2879. https://
doi.org/10.1128/JCM.39.8.2873-2879.2001

French, E. & Hebert, T. (1982). Métodos de Investigación
Fitopatológica. Número 43 de Serie de libros y
materiales educativos. IICA. Costa Rica. 289p.

Huarhua, M., Flores, J., Acuña, R., & Apaza, W. (2018).
Morphological and molecular identification of
Phytophthora cinnamomi Rands as a causal agent
of Crown and root rot in Blueberry (Vaccinium
corymbosum ) in Peru. Peruvian Journal of
Agronomy, 2(2), 14–21. https://doi.org/10.21704/
pja.v2i2.1202

Huarhua, M., Aragón, L., Flores, J., Tsuzuki, R., & Arie,
T. (2020). Primer reporte de Fusarium oxysporum
f. sp. lycopersici raza 1 aislada de tomate (Solanum
lycopersicum) de la Costa central del Perú. Scientia
fungorum, 50, 1–12.

Incidence of leaf diseases in the agroforestry systems at Yurimaguas, Peru

January - April 2022

102

Inami, K., Kashiwa, T., Kawabe, M., Ishikawa, N.,
Rodriguez, E., Hozumi, T., Aragón, L., Cáceres De
Baldarrago, F., Jiménez, M., Madadi, K., Peever,
T., Teraoka, T., Kodama, M., & Arie, T. (2014).
The tomato wilt fungus Fusarium oxysporum f.
sp. lycopersici shares common ancestors with
nonpathogenic F. oxysporum isolated from
wild tomatoes in the Peruvian Andes. Microbes
and Environments, 29(2), 200–210. https://doi.
org/10.1264/jsme2.ME13184

James, R. S., Ray, J., Tan, Y. P., & Shivas, R. G. (2014).
Colletotrichum siamense, C. theobromicola and
C. queenslandicum from several plant species and
the identification of C. asianum in the Northern
Territory, Australia. Australasian Plant Dis. Notes,
9, 138. https://doi.org/10.1007/s13314-014-0138-x

Kumar, M., & Shukla, P. K. (2005). Use of PCR Targeting
of Internal Transcribed Spacer Regions and Single-
Stranded Conformation Polymorphism Analysis of
Sequence Variation in Different Regions of rRNA
Genes in Fungi for Rapid Diagnosis of Mycotic
Keratitis. American Society for Microbiology,
43(2), 662–668.

Kumar, S., Stecher, G., & Tamura, K. (2016). MEGA7:
Análisis genético evolutivo molecular versión 7.0
para conjuntos de datos más grandes. Molecular
Biology and Evolution, 33, 1870–1874.

Maharachchikumbura, S. S. N., Larignon, P., Hyde, K. D.,
Al-Sadi, A. M., & Liu, Z. Y. (2016). Characterization
of Neopestalotiopsis, Pestalotiopsis and Truncatella
species associated with grapevine trunk diseases
in France. Phytopathologia Mediterranea, 55,
380−390.

Montagnini, F., Somarriba, E., Murgueitio, E., Fassola,
H., & Eibl, B. (2015). Sistemas agroforestales.
Funciones productivas, socioeconómicas y
ambientales. Serie técnica. Informe técnico No.
402. CATIE. Turrialba, Costa Rica. 461pp.

Morsbach, N., Rodrigues, A., Chaimsohn, F. P., & Treitny,
M. R. (1998). Pupunha para palmito, Cultivo no
Paraná. Instituto Agronómico do Paraná. Paraná,
Brasil. 56p.

Mosquera-Mena, R. (2013). Relación de la asistencia
técnica agropecuaria brindada a los pequeños
productores con el estado fitosanitario de los huertos
habitacionales de la zona de Urabá – Antioquia-
Colombia. Entramado, 18, 224−230.

Müller, T., K. Strobel & A. Ulrich. (2006). Microorganisms
in the Phyllosphere of Temperate Forest Ecosystems
in a Changing Enviroment. In M. J. Bailey, A. K.
Lilley, T. M. Timms-Wilson, & P. T. N. Spencer-
Phillips (Eds.), Microbial Ecology of Aerial Plant
Surfaces. (pp. 51–64). CABI.

Nair, P. K. (2014). Agroforestry : Practices and Systems. In
N. K. Van Alfen (Ed.), Encyclopedia of Agriculture
and Food Systems (pp. 270–282). https://doi.
org/10.1016/B978-0-444-52512-3.00021-8

Norphanphoun, C., Jayawardena, R. S., Chen, Y.,
Wen, T. C., Meepol, W. & Hyde, K. D. (2019).
Morphological and phylogenetic characterization
of novel pestalotioid species associated with
mangroves in Thailand. Mycosphere, 10(1), 531–
578. https://doi.org/10.5943/mycosphere/10/1/9

Peña, R. E. (1996). Plagas y enfermedades del chontaduro
(Bactris gasipaes K). In R. Reyes., E. Peña., & J.
Gómez (Eds.), Curso Cultivo e Investigación del
chontaduro. Tumaco - Nariño, Colombia. Manual
técnico Nº 5 (pp. 63–68). CORPOICA.

Pornsuriya, C., Chairin, T., Thaochan, N. & Sunpapao,
A. (2020). Identification and characterization of
Neopestalotiopsis fungi associated with a novel leaf
fall disease of rubber trees (Hevea brasiliensis) in
Thailand. Journal of Phytopathology, 1–12.

Proyecto de Recuperación de Ecosistemas Naturales
en el Piedemonte Caqueteño. (1998). Sistemas
Agroforestales. Convenio MINAMBIENTE –
OIMT – CEUDE. Florencia, Caquetá. Información
Técnica. 20pp.

Rep, M., Van Der Does, H. C., Meijer, M., Van Wijk, R.,
Houterman, P. M., Dekker, H. L., De Koster, C. G.,
& Cornelissen, B. J. C. (2004). A small, cysteine-
rich protein secreted by Fusarium oxysporum
during colonization of xylem vessels is required
for I-3-mediated resistance in tomato. Molecular
Microbiology, 53(5), 1373–1383. https://doi.
org/10.1111/j.1365-2958.2004.04177.x

Saitoh K., Togashi K., Arie T., & Teraoka, T. (2006). A
simple method for a mini- preparation of fungal
DNA. Journal of General Plant Pathology, 72,
348–350. https://doi.org/10.1007/s10327-006-
0300-1

Weir, B. S., Johnston, P. R., & Damm, U. (2012). The
Colletotrichum gloeosporioides species complex.
Studies in Mycology, 73, 115–180. https://doi.
org/10.3114/sim0011

White, T. J., Bruns, T., Lee, S., & Taylor, J. W. (1990).
Amplification and direct sequencing of fungal
ribosomal RNA genes for phylogenetics. In M. A.
Innis, D. H. Gelfand, J. J. Sninsky, & T. J. White
(Eds.), PCR protocols: a guide to methods and
applications. (pp. 315–322). Academic, New York,