5chua-fontanilla.pmd Genetic Comparison of Oncomelania hupensis quadrasi 32 SCIENCE DILIMAN (JULY-DECEMBER 2017) 29:2, 32-50 Genetic Comparison of Oncomelania hupensis quad rasi (Möllendorf, 1895) (Gastropoda: Pomatiopsidae), the Intermediate Host of Schistosoma japonicum in the Phil ippines, Based on 16S Ribosomal RNA Sequence James Christopher C. Chua* Ian Kim B. Tabios Pebbles Grayle P. Tamayo Lyd ia R. Leonardo University of the Philippines Manila Ian Kendrich C. Fontanilla Raffy Jay C. Fornillos University of the Philippines Diliman Emmanuel Ryan C. De Chavez University of the Philippines Los Baños Takeshi Agatsuma Kochi Medical School Mihoko Kikuchi Nagasaki University Naoko Kato-Hayashi Yuichi Chigusa Dokkyo Medical University ABSTRACT Schistosomiasis japonica is a water-borne trematode infection transmitted by different subspecies of Oncomelania hupensis. As parasites may either co-evolve or locally adapt with their hosts, snail diversity, as revealed by morphometric and genetic studies, may reflect parasite diversity and elucidate snail susceptibility and transmission patterns. This study aimed t o c o m p a r e i s o l a t e s o f O . h . q u a d r a s i b a s e d o n a 3 4 2 - b p f r a g m e n t o f _______________ *Corresponding Author ISSN 0115-7809 Print / ISSN 2012-0818 Online J.C. C. Chua et al. 33 the 16S ribosomal RNA gene. O. h. quadrasi isolates were collected from nine provinces known to have S. japonicum in the Philippines, namely Cagayan Valley, Bohol, Negros Occidental, Leyte, Davao, Davao del Sur, Mindoro Oriental, Nor thern Samar, and Sorsogon. O. h. hupensis and O. h. nosophora isolates were also collected from China and Japan, respectively. T h e 1 6 S r i b o s o m a l R N A g e n e o f e a c h s p e c i m e n w a s a m p l i f i e d a n d sequenced. Phylogenetic and network analyses based on the 221 16S rRNA gene sequences revealed that O. h. quadrasi clustered as a distinct clade from the two other subspecies. Of the four identif ied haplotypes for O. h. quadrasi, two haplotypes were from Negros Oriental (Ohq2 and Ohq3), and one haplotype was from Bohol (Ohq4). The isolates from the r e m a i n i n g s e v e n p r o v i n c e s s h a r e d a c o m m o n h a p l o t y p e ( O h q 1 ) . T h e c u r r e n t s t u d y w a s a b l e t o s h o w t h e r e l a t i o n s h i p a m o n g O . h u p e n s i s s u b s p e c i e s a n d d e m o n s t r a t e t h e l i m i t e d a b i l i t y o f m i t o c h o n d r i a l 1 6 S ribosomal molecular marker in differentiating O. h. quadrasi geographic strains in the Philippines. K e y w o r d s : O n c o m e l a n i a h u p e n s i s q u a d r a s i , S c h i s t o s o m a j a p o n i c u m , Schistosomiasis japonica, Snail Intermediate Host, Haplotype, 16S R i bo s o mal RNA Gene INTRODUCTION Oncomelania hupensis (Gastropoda: Pomatiopsidae) is an amphibious freshwater snail that acts as the intermediate host of Schistosoma japonicum, a parasitic worm of great public health concern. Nine geographical subspecies found throughout Asia have been recognized for the O. hupensis species complex (WHO 1993). The four subspecies in China are O. h. hupensis (Yangtze Basin), O. h. robertsoni (Sichuan and Yunnan), O. h. tangi (Fujian), and O. h. guangxiensis (Guangxi). In other Asian countries, the subspecies present are O. h. nosophora in Japan, O. h. lindoensis in Indonesia, O. h. chiui and O. h. formosana in Taiwan, and O. h. quad rasi in the Philippines (Davis et al. 1995a). The subspecies mainly differ in shell dimensions, electromorphic and antigenic patterns, reproductive potential, growth rate, and compatibility with various geographic strains of S. japonicum (Davis et al. 1995b; Zhao et al. 2010). Oncomelania hupensis quad rasi in the Philippines was f irst recognized as the intermediate host of S. japonicum by Tubangui, based on observations made in Palo, Leyte (Blas 1988; Leonardo et al. 2016). An adult O. h. quadrasi shell is Genetic Comparison of Oncomelania hupensis quadrasi 34 colored light brown to black, usually measures 3 to 5 mm, and has 5 to 7 whorls (Figure 1). These snails are dioecious and thrive in many different kinds of wet shaded environments. These habitats include flood plains, swampy areas, and grass lands. Although considered transient, rice f ields and other man-made habitats, such as irrigation canals and burrow pits, also support these snails. They prefer areas with dense vegetation where flow of water is sluggish, and rivers that are not very deep or too wide. O. h. quadrasi colonies have been known to occur over most of Mindanao and Samar, eastern Leyte, Bohol, in small areas in southeastern Luzon, and eastern Mindoro (Pesigan et al. 1958). O. h. quadrasi colonies have been recently discovered in Cagayan Valley in northern Luzon and in Negros Occidental (Leonardo et al. 2015). Figure 1. Oncomelania hupensis quadrasi (Mollendorf 1895) collected from the province of Leyte in eastern Philippines. Juvenile (right) snails measure a maximum of 3 mm while adult snails reach more than 3 mm in size. 3 mm Genetic studies on the intermediate host are important in determining the relationship of the intermediate host with the parasite, as the presence or absence of co-evolution may signif icantly affect transmission patterns. Co-evolution implies the restriction of the parasite to certain snail hosts, limiting transmission to areas where snails are compatible with the parasite (Davis et al. 1999), whereas the absence of co-evolution, as evidenced by recent studies, may result in host-switching or acquisition, making it possible for the parasite to spread in other areas (Attwood et al. 2015). Previous studies have reported the different compatibilities of snail populations from different geographic locations with strains of S. japonicum, and variation in susceptibility to sodium pentachlorophenate (NaPCP), a molluscicidal agent (Cross et al. 1984; Hong et al. 1995; Rachford 1997). Determination of genetic variants within geographical isolates of O. h. quadrasi is necessary for the evaluation of their potential in transmitting S. japonicum. Past research revealed only minor variation among geographic isolates of O. h. quad rasi in the Philippines (Viyanant et al. 1987; Woodruff et al. 1988); however, J.C. C. Chua et al. 35 these studies only involved techniques that tested phenotypic characters, which are subject to environmental influences. Some enzyme-coding genes are only expressed under certain environmental conditions (Davis et al. 1995a). Hope and McManus (1994) used polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) to directly examine the internal transcribed spacer (ITS) gene, and found minor variation among Philippine snails. A recent paper of Saijuntha et al. (2014) studied 12S ribosomal RNA gene sequences of O. h. quadrasi from three provinces with S. japonicum, and they were able to show population substructuring associated with geographical origin. To further investigate the phylogeography of O. h. quadrasi in the Philippines, this study examined genetic variation among snail populations collected from 12 localities in seven islands based on the 16S rRNA gene. Snail samples from two newly identif ied endemic foci for S. japonicum in Cagayan Valley and Negros Occidental were included in the analysis. The 16S rRNA gene was selected since previous studies have demonstrated its utility to assess genetic variation in populations in the aquatic snail Potamopyrgus antipodorum (Stadler et al. 2005), the slug Arion subfucus (Pinceel et al. 2005), the giant African snail Achatina fulica (Fontanilla et al. 2014), and the pomatiopsid snail Neotricula aperta (Attwood et al. 2008). MATERIALS AND METHODS Snail Collection Geographic isolates of O. h. quadrasi were collected from nine provinces across seven islands of the Philippines: Cagayan and Sorsogon on Luzon island; Mindoro Oriental on Mindoro island; Negros Occidental on Negros island; Bohol on Bohol island; Leyte on Leyte island; Samar on Samar island, and Davao and Davao del Sur on Mindanao island (Table 1). Thirty individual snails from each locality were examined. Snails collected were identif ied as O. h. quadrasi by comparison with previously identif ied voucher specimens archived in the Department of Parasitology, College of Public Health, University of the Philippines Manila. Samples of O. h. hupensis from China and O. h. nosophora from Japan were also included in the study. Snails were washed with 0.9% NaCl and placed in a vial with 70% ethanol before being transported to the laboratory. The head-foot muscle was dissected under the microscope, and this was used in the DNA extraction. Genetic Comparison of Oncomelania hupensis quadrasi 36 MCag Magraf il Cagayan Valley Luzon Philippines O. h. quadrasi 27 TCag Tapel Cagayan Valley Luzon Philippines O. h. quadrasi 3 TSor Tulay Sorsogon Luzon Philippines O. h. quadrasi 30 BDMin Batong Dalig Mindoro Oriental Mindoro Philippines O. h. quadrasi 30 BNeg Bonbon Negros Occidental Negros Philippines O. h. quadrasi 22 HNeg Hinag-ongan Negros Occidental Negros Philippines O. h. quadrasi 6 MBoh Magsaysay Bohol Bohol Philippines O. h. quadrasi 30 PLey Palo Leyte Leyte Philippines O. h. quadrasi 13 DLey Dagami Leyte Leyte Philippines O. h. quadrasi 11 Sam Catarman Northern Samar Samar Philippines O. h. quadrasi 18 Dav Compostela Valley Davao Mindanao Philippines O. h. quadrasi 29 Das Davao del Sur Mindanao Philippines O. h. quadrasi 2 WAnh Wuwei Anhui Mainland China China O. h. hupensis 4 TAnh Tongling Anhui Mainland China China O. h. hupensis 4 HAnh Hexian Anhui Mainland China China O. h. hupensis 4 XAnh Xiuzhou Anhui Mainland China China O. h. hupensis 4 Lanh Lingjiang Anhui Mainland China China O. h. hupensis 4 DAnh Dongzhi Anhui Mainland China China O. h. hupensis 4 SAnh Shitai Anhui Mainland China China O. h. hupensis 4 JHun Jiangshan Hunan Mainland China China O. h. hupensis 4 CZhe Chizhou Zhejiang Mainland China China O. h. hupensis 4 NYam Nirasaki Yamanashi Honshu Japan O. h. nosophora 5 KYam Kofu Yamanashi Honshu Japan O. h. nosophora 2 Table 1. Source organisms, local ities, and sample sizes of 16S sequences analysed Sample Code Local ity Province Island Country Subspecies No. J.C. C. Chua et al. 37 DNA extraction, PCR ampl if ication, and DNA sequencing DNA extraction was carried out using the Qiagen® Genomic DNA Extraction KitTM (USA) following the manufacturer’s protocol. DNA was quantif ied using Thermo Scientif ic®NanoDrop TM 2000c (USA). PCR amplif ication of the 16S rRNA gene was performed in a total volume of 50 μL containing 20mM buffer (Tris-HCl, MgCl 2 , and KCl), 10 pmol each of forward and reverse primers, 2.5 mM dNTP, 1.25 units Roche® Taq DNA polymerase, and 8.0 μL DNA template. The forward and reverse primers used were 16S1ionco5 5’–TGACCGTGCGAAGGTAGCAT–3’, which was designed for this study, and 16SSCP2i 5’– CCTAGTCCAACATCGAGGTC–3’, which was obtained from Fontanilla et al. (2010). This primer pair amplif ies a 342-bp fragment of the 16S rRNA gene that corresponds to its secondary structure’s domain IV (Lydeard et al. 2000), which is also the same fragment used in other previous studies (Stadler et al. 2005; Pinceel et al. 2005; Attwood et al. 2008; Fontanilla et al. 2014). Initial denaturation temperature was 94°C for 3 minutes succeeded by 43 cycles of denaturation at 94°C for 30 seconds, annealing at 45°C for 30 seconds, and extension at 65°C for 1 minute, which was followed by one f inal extension step at 72°C for 5 minutes. PCR products were purif ied from agarose using Qiagen® QIAquick Gel Extraction Kit TM (USA) following the manufacturer’s protocol. Purif ied PCR products were sent to 1st BASE Pte. Ltd. in Malaysia for DNA sequencing. DNA Sequence Analysis Sequences were aligned using BioEdit Version 7.0.9.0 (Hall 2008). Aligned sequences were inspected manually and distinct haplotypes were identif ied using the Data Analysis in Molecular Biology and Evolution (DAMBE) Version 5.2.79 software (Xia and Xie 2001). Consensus sequences were submitted to NCBI’s G e n B a n k ( N a t i o n a l C e n t e r f o r B i o t e c h n o l o g y I n f o r m a t i o n ; h t t p s : / / www.ncbi.nlm.nih.gov/) for the assignment of accession numbers (Table 2). For the phylogenetic analyses, three methods of tree construction, two requiring a model of DNA substitution and one method that did not, were employed. For the model-based methods, the best model with optimized parameters was determined using the Bayesian inference criterion (BIC) in jModel Test Version 0.1.1 (Posada 2008). Once the optimal model was identif ied, the maximum likelihood (ML) tree (Cavalli-Sfroza and Edwards 1967; Felsenstein 1981) and neighbor joining tree (Saitou and Nei 1987) were constructed using PHYML Version 2.4.4 (Guindon and Gascuel 2003) and PAUP Version 4.0b10 package (Swofford 2002), respectively. Genetic Comparison of Oncomelania hupensis quadrasi 38 For the non-model based method, the maximum parsimony (MP) tree (Eck and Dayhoff 1966; Fitch 1977) was constructed using MEGA6 (Tamura et al. 2013). All three methods rooted the trees on O. minima, and bootstrap resampling (Felsenstein 1985) with 1000 replicates was also undertaken. An ML tree that includes the bootstrap supports for the clades based on the ML, NJ, and MP analyses was consequently generated. Ohq1 Philippines: Palo, Leyte L6 KY432666 O. h. quadasi Ohq2 Philippines: Calatrava, Negros Occidental N28 KY432668 O. h. quadrasi Ohq3 Philippines: Calatrava, Negros Occidental N15 KY432667 O. h. quadrasi Ohq4 Philippines: Magsaysay, Bohol B1 KY432669 O. h. quadrasi Ohh1 China: Wuwei, Anhui 1AHwuwei KY432670 O. h. hupensis Ohh2 China: Lingjiang, Anhui 1AHlingjiang KY432671 O. h. hupensis Ohh3 China: Hexian, Anhui 1AHhexian KY432673 O. h. hupensis Ohh4 China: Xiuzhou, Anhui 1AHxiuzhou KY432674 O. h. hupensis Ohh5 China: Shitai, Anhui 1AHshitai KY432675 O. h. hupensis Ohh6 China: Chizhou, Zhejiang 1ZJchizhou KY432676 O. h. hupensis Ohh7 China: Jiangshan Hunan 1HNjiangshan KY432672 O. h. hupensis Ohn1 Japan: Kofu, Yamanashi 1Kofu KY432677 O. h. nosophora Sequence ID Country Isolate GenBank Accession Subspecies Table 2. Genbank accessions of 12 haplotypes of the 16S rRNA gene of various Oncomelania spp. A median joining network of the distinct haplotypes was also constructed using the Network Version 4.502 program (Bandelt et al. 1999), in order to elucidate the relationships of the different O. hupensis subspecies, and in particular, the Philippine O. hupensis quadrasi haplotypes. DNAsp5 was utilized to compute for the haplotype number (Slatkin and Hudson, 1991; Librado and Rozas, 2009). RESULTS Analysis of O. hupensis subspecies A total of 221 16S rRNA sequences were obtained for O. h. quadrasi, 36 for O. h. hupensis, and seven for O. h. nosophora (Table 1). Alignment revealed 20 polymorphic sites consisting of 19 transitions and one insertion/deletion (Table 3). The variable J.C. C. Chua et al. 39 sites yielded 12 haplotypes: four haplotypes of O. h. quadrasi, seven haplotypes of O. h. hupensis, and a single haplotype of O. h. nosophora (Tables 2, 3, and 5). The HKY85+G model was identif ied to be the best model for sequence evolution with optimized parameters using the Bayesian inference criterion (BIC). Median-joining network analysis supports the ML tree f indings as four similarly distributed clusters were identif ied. The O. h. quadrasi haplotypes clustered in one group and were assigned to be closely related to an O. h. robertsoni haplotype (Figure 2). The Haplotype network analysis suggests that Philippine haplotypes share one, or possibly two putative haplotype ancestors (mv5 and mv6; Figure 3), which split into two lineages. The f irst lineage includes the common haplotype (Ohq1) found in majority of the sampled areas, which in turn gave rise to the Bohol haplotype (Ohq4). The other lineage gave rise to the two haplotypes in Negros Occidental, the Hinabo (or Hinab-ongan) haplotype (Ohq2) and the Bonbon haplotype (Ohq3). There were no common or shared haplotypes among the three subspecies. The ML tree also showed that O. h. quadrasi formed a highly supported (92% ML, 95% MP, and 90% NJ bootstraps) cluster that was distinct from the other subspecies (Figure 3). The phylogenetic tree contradicts current subspecies classif ication based on Haplotype Nucleotide Position 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 9 9 9 9 9 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 3 5 5 9 0 0 0 1 2 2 2 2 3 4 4 4 5 9 9 1 5 1 5 2 0 2 6 9 1 2 4 8 5 3 5 6 8 7 8 Ohq1 G A A T G C C G G C A T A G A A - A T A Ohq2 . . . . . . . . A . . . . . . . T . . . Ohq3 . . . . . . . . A . . . . . . . T . C . Ohq4 . . . . . . T . . . . . . . . . - . . . Ohh1 A . . C . T T . A . . . G A . G - G . G Ohh2 A . . C . T T . A . . . G A . G - . . G Ohh3 A . . C . T T . A . . . G A G . - . . G Ohh4 A . . C . T T A A . . . G A . G - . . G Ohh5 A . . C . T T . . . . . G A . G - . . G Ohh6 A . . C . T T . A . G C G A . G - . . G Ohh7 A G . C . T T . A . . . G A . G - . . G Ohn1 A . G C A T T . A T . . G A . G - G . G Table 3. Variable positions of the 16S rRNA gene sequences of O. h. quad rasi (Ohq), O. h. hupensis (Ohh), and O. h. nosophora (Ohn) haplotypes. Nucleotide position number is based on O. h. hupensis isolate SCMS complete mitochondrial genome sequence [GenBank: NC_012899] Genetic Comparison of Oncomelania hupensis quadrasi 40 geographic origin as O. h. hupensis subspecies clustered with O. h. formosana from Taiwan and O. h. nosophora from Japan. O. h. robertsoni and O. h. quad rasi were observed to be monophyletic. Figure 2. Maximum likelihood tree of O. hupensis based on 342 nucleotides of the 16S rRNA gene and using the HKY85+G model of DNA substitution. Haplotypes with (*) represent samples from this study while the rest were obtained from GenBank. The tree was rooted on O. minima. Values on nodes represent bootstrap support percentage (out of 1000 bootstrap samples) for ML/MP/NJ; values less than 50% are not shown. Bootstraps for NJ were likewise based on the HKY85+Γ model. Bootstraps for MP were based on six equally parsimonious trees. Scale bar represents one nucleotide substitution for every 100 nucleotides. J.C. C. Chua et al. 41 Genetic Diversity of O. h. quad rasi Genetic distance ranged from 0.30 to 7.69% among subspecies haplotypes, and 0.30 to 0.95% among O. h. quadrasi haplotypes (Table 4). Of the four haplotypes of O. h. quadrasi, two haplotypes were from Bonbon and Hinab-ongan in Negros Occidental (Ohq2 and Ohq3), and a single haplotype was from Magsaysay, Bohol (Ohq4). The isolates from the remaining seven provinces formed a single shared haplotype (Ohq1) (Table 5). The haplotype and nucleotide diversities for the Philippine population were 0.429 ± 0.037 and 0.00230 ± 0.00024, respectively (Table 4). There was no substantial genetic subdivision formed among the nine provinces, suggesting that high rates of gene flow occur among these regions. Figure 3. Median-joining haplotype network of three subspecies of O. hupensis based on 16S rRNA gene sequences. The size of the circles represents the frequency of each haplotype (found inside parenthesis) among the isolates. Red dots represent putative haplotypes. Ohq = O. h. quadrasi; Ohh = O. h. hupensis; Ohn = O. h. nosophora. Table 4. Molecular variations of the O. h. quadrasi from the Phil ippines grouped accord ing to island of origin. n = number of samples; h = number of haplotype; μμμμμ = number of non-overlapping haplotype; hd = haplotype d iversity; ΠΠΠΠΠ = nucleotide d iversity Population n h μμμμμ hd ± SD πππππ ± SD Luzon 60 1 0 0.000 ± 0.000 NA Mindoro 30 1 0 0.000 ± 0.000 NA Leyte 24 1 0 0.000 ± 0.000 NA Samar 18 1 0 0.000 ± 0.000 NA Negros 28 2 2 0.349 ± 0.090 0.00125 ± 0.00001 Bohol 30 1 1 0.000 ± 0.000 NA Mindanao 31 1 0 0.000 ± 0.000 NA All populations 226 4 4 0.429 ± 0.037 0.00230 ± 0.00024 Genetic Comparison of Oncomelania hupensis quadrasi 42 DISCUSSION The study was able to show that O. h. quadrasi is genetically different from the other subspecies of O. hupensis found in other Asian countries based on the 16S rRNA sequences. However, only limited genetic substructuring existed among the geographical isolates of O. h. quadrasi in the nine provinces of the Philippines. Two major clades were observed in the ML tree. O. h. hupensis, O. h. tangi, O. h. formosana, and O. h. nosophora formed clade 1. O. h. robertsoni isolates grouped with O. h. quadrasi in clade 2. The four haplotypes of O. h. quadrasi clustered together to form a distinct subclade. These results agree with those of a recent comparative phylogenetic study of Oncomelania hupensis and Schistosoma japonicum using mitochondrial genes, in which O. h. tangi and O. h. formosana also clustered with O. h. hupensis, suggesting that they are not valid subspecies but rather are O. h. hupensis variants (Attwood et al. 2015). The same study likewise found O. h. robertsoni to be not monophyletic (Attwood et al. 2015). The phylogenetic tree in this study closely resembles the trees previously constructed using the mitochondrial 12S ribosomal gene (Okamoto et al. 2003), and combined mitochondrial COI and 16S genes (Wilke et al. 2006). In the 12S tree, O. h. hupensis also clustered with O. h. nosophora and O. h. formosana, while O. h. quad rasi also formed a monophyletic clade. Similarly, they identif ied a Bohol haplotype and a shared haplotype from Mindoro and Sorsogon. The previous study also identif ied two haplotypes from different sampled areas in Davao, Digos, and Asuncion, while the current study using the 16S genetic marker identif ied the Davao representative from Compostela Valley to be identical with the common haplotype from the remaining provinces. It is therefore possible that increased sampling effort from other areas in Davao could lead to the discovery of other 16S rRNA gene haplotypes; this may also be the case for the other provinces. Cagayan Valley and Negros Occidental have only been recently identif ied as endemic for schistosomiasis in 2002 and 2005, respectively (Leonardo et al. 2015). The current hypothesis for these two areas is that O. h. quadrasi had always been present in these places, and recent migration of schistosome-infected human and/ or animal hosts resulted in sustained transmission. However, results of the network analysis suggest the possibility of Negros Occidental snail isolates evolving independently from other geographic isolates. Therefore, the same apparent barriers to dispersal that led to the snails from Negros Occidental being genetically distinct from the other populations could lead to similar isolation and divergence of the schistosomes present there. This may likely have been the result of allopatric J.C. C. Chua et al. 43 speciation, in which new strains arise in non-overlapping geographic locations. This suggests that Negros Occidental had always been endemic for schistosomiasis but clinical cases were unreported or misdiagnosed. For Cagayan Valley, the founder effect seems more likely as the local snails were discovered to be identical with the isolates from other schistosomiasis-positive provinces, which also raises the possible endemicity of the O. h. quadrasi haplotypes in other Luzon provinces. Performing a molecular clock analysis could be applied to conf irm either hypothesis. This type of analysis has been successfully accomplished for O. h. robertsoni (Hauswald et al. 2011) and Japanese pomatiopsids (Kameda and Kato 2001). The presence of fewer O. h. quadrasi haplotypes compared to the Chinese populations may be explained by isolation by distance, or either founder effect or population bottlenecking. Genetic differentiation among individuals increases as geographical distance increases, which is brought about by isolated populations being prevented from mating with other populations (Wright 1943). This could explain why China, which is much larger than the Philippines, has more snail haplotypes. Founder effect occurs when populations originate from only a few individuals (Freeman and Herron 2004), such as in Achatina fulica populations (Fontanilla et al. 2014). This may be the case if O. h. quadrasi were introduced by migratory birds from Chinese O. hupensis ancestors. Population bottlenecking, the other possibility, may have been the result of early schistosomiasis control efforts, wherein the use of molluscicides successfully reduced snail populations. However, when the use of molluscicides was halted due to adverse environmental effects, the surviving snail populations repopulated the affected areas, resulting in reduced genetic variation among progenies. The use of molluscicides could also have acted as a selection pressure that caused the appearance of new strains, which is a possible explanation of the emergence of the Bohol haplotype from the shared haplotype. The founder effect seems to be more likely since Negros Occidental and Cagayan Valley were recently discovered to be schistosomiasis endemic areas and were previously not subjected to control efforts. However, O. h. quadrasi populations in these two areas may have been unintentionally reduced together with crop pests as they co-inhabit rice f ields (Freeman and Herron 2004). With most isolates under a common haplotype, effects of existing snail control measures (e.g. , clearing of vegetation and exposure of habitats to direct sunlight) on these haplotypes would unlikely vary and are expected to have the same impact as in previous instances. However, more detailed studies on tolerance ranges, habitat preferences, and molluscicide susceptibility, particularly on other haplotypes, are needed to ascertain this assumption. Genetic Comparison of Oncomelania hupensis quadrasi 44 T ab le 5 . D is tr ib u ti o n o f 1 6 S r R N A g e n e h ap lo ty p e s at v ar io u s lo ca li ti e s sa m p le d f o r O . h . q u a d ra si , O . h . h u p en si s an d O . h . n os op h or a. O h q 1 O h q 2 O h q 3 O h q 4 O h h 1 O h h 2 O h h 3 O h h 4 O h h 5 O h h 6 O h h 7 O h n 1 M C a g 2 7 2 7 - - - - - - - - - - - TC ag 3 3 - - - - - - - - - - - T S o r 3 0 3 0 - - - - - - - - - - - B D M in 3 0 3 0 - - - - - - - - - - - B N eg 2 2 - 2 2 - - - - - - - - - - H N eg 6 - - 6 - - - - - - - - - M B o h 3 0 - - - 3 0 - - - - - - - - P Le y 1 3 1 3 - - - - - - - - - - - D Le y 1 1 1 1 - - - - - - - - - - - S a m 1 8 1 8 - - - - - - - - - - - D av 2 9 2 9 - - - - - - - - - - - D a s 2 2 - - - - - - - - - - - W A n h 4 - - - - 4 - - - - - - - TA n h 4 - - - - 2 2 - - - - - - H A n h 4 - - - - - - 4 - - - - - X A n h 4 - - - - - - - 4 - - - - LA n h 4 - - - - - 4 - - - - - - D A n h 4 - - - - - - - - 2 2 - - S A n h 4 - - - - - - - - 4 - - - JH u n 4 - - - - - 2 - - - - 2 - C Z h e 4 - - - - - - - - - 4 - - K o fu 7 - - - - - - - - - - - 7 1 6 3 2 2 6 3 0 6 8 4 4 6 6 2 7 TO TA L : 2 6 4 2 2 1 3 6 7 Lo ca li ty n N u m b er o f sa m p le s in e ac h h ap lo ty p e o f O . h . qu ad ra si N u m b er o f sa m p le s in e ac h h ap lo ty p e o f O . h. h up en si s N u m b e r o f sa m p le s in e ac h h ap lo ty p e o f O . h . no so ph or a J.C. C. Chua et al. 45 The use of additional markers as concatenated sequences is recommended to further characterize the different haplotypes present in the Philippines. The lack of genetic substructuring among the O. h. quadrasi isolates based on the 16S gene in this study is in contrast to what Saijuntha et al. (2014) observed. Combining the markers may provide greater phylogenetic signal and more variable positions. It should be noted that the evolutionary histories of taxa are reflected by the evolutionary histories of their genomes rather than by single genes, which may have different evolutionary histories that interact with each other and with the environment (Morrison 2006). CONCLUSIONS The current study was able to demonstrate O. h. quadrasi’s genetic diversity using the 16S rRNA gene. O. h. quadrasi is a distinct subspecies with four haplotypes, two from Negros Occidental (Ohq2 and Ohq3), a single haplotype in Bohol (Ohq4), and one from the remaining provinces in the study (Ohq1). There might be a need for the re-evaluation of the O. hupensis subspecies classif ication as Chinese isolates spread into the two clades. COMPETING INTERESTS The authors do not have any competing interests. AUTHORS’ CONTRIBUTIONS JC, IF, MK, NH, YC, and LL conceptualized the project. JC, PT, IT, and LL performed snail collection in the Philippines, while TA provided samples from China and Japan. JC, IF, ERDC, PT, IT, RJF, and TA performed PCR, sequence alignment, and data analysis. JC, IF, LL, IT, and RJF wrote the manuscript with the suggestions of all the other authors. ACKNOWLEDGMENTS We thank the f ield and technical staff of the municipal health off ice and barangay health units in the provinces where we collected the samples. This research was supported by the Philippine Council for Health Research and Development (PCHRD) of the Department of Science and Technology (DOST) and the Natural Sciences Research Institute of the University of the Philippines, Diliman. Genetic Comparison of Oncomelania hupensis quadrasi 46 REFERENCES Attwood SW, Faith FA , Campbell I, Upar tham ES. 2008. The distribution of Mekong schistosomiasis, past and future: preliminary indications from an analysis of genetic evolution in the intermediate host. Parasitology International. 57(3):256-270. Attwood SW, Ibaraki M, Saitoh Y, Nihei N, Janies DA . 2015. Comparative phylogenetic studies on Schistosoma japonicum and its snail intermediate host Oncomelania hupensis: origins, dispersal and coevolution. PLOS Neglected Tropical Diseases. 9(7):e0003935. Bandelt HJ, Forster P, Röhl A . 1999. Median-joining networks for inferring intraspecif ic phylogenies. Molecular Biology and Evolution. 16:37-48. Blas B. 1988. Historical review. In: Handbook for the control of Schistosomiasis japonica in the Philippines I. A monograph on Schistosoma japonicum infection in the Philippines. Manila: Department of Health. Cavalli-Sforza LL, Edwards AWF. 1967. Phylogenetic analysis: models of estimation procedures. The American Journal of Human Genetics. 19:233-257. Cross JH, Zaraspe G, Lu SK, Chiu KM, Hung HK. 1984. Susceptibility of Oncomelania hupensis subspecies to infection with geographic strains of Schistosoma japonicum. The Southeast Asian Journal of Tropical Medicine and Public Health. 15(2):155-160. Davis G, Spolsky C, Zhang Y. 1995a. Malacology, biotechnology and snail-borne diseases. Acta Medica Philippina. 31(2):45-60. Davis GM, Zhang Y, Guo YH, Spolsky CM. 1995b. Population genetics and systematic s t a t u s o f O n c o m e l a n i a h u p e n s i s ( G a s t r o p o d a : P o m a t i o p s i d a e ) t h r o u g h o u t C h i n a . Malacologia. 37:133-156. Davis GM, Wilke T, Zhang Y, Xu XJ, Qui CP, Spolsky CM, Qui DC, Li Y, Xia MY, Feng Z. 1999. Snail-Schistosoma, Paragonimus interaction in China: population ecology, genetic diversity, coevolution and emerging diseases. Malacologia. 41(2):355–377. Eck RV, Dayhoff MO. 1966. Atlas of protein sequence and structure. Waltham (MA): National Biomedical Research Foundation. Felsenstein J. 1981. Evolutionary trees from DNA sequences: A maximum likelihood approach. Journal of Molecular Evolution. 17:368-376. Felsenstein J. 1985. Conf idence limits on phylogenies: An approach using the bootstrap. Evolution. 39:783-791. F i tc h W M . 1 9 7 7. O n t h e p r o b l e m of d i s cove r i n g t h e m o s t p a r s i m o n i o u s t r ee . T h e American Naturalist . 111(978):223-257. Fontanilla IKC. 2010. Achatina (Lissachatina) fulica Bowdich: Its molecular phylogeny, genetic variation in global populations, and its possible role in the spread of the rat l u n g w o r m A n g i o s t r o n g y l u s c a n t o n e n s i s [ d i s s e r t a t i o n ] . N o t t i n g h a m : U n i v e r s i t y o f Nottingham. J.C. C. Chua et al. 47 Fontanilla IKC, Sta. Maria IMP, Garcia JRM, Ghate H, Naggs F, Wade CM. 2014. Restricted genetic variation in populations of Achatina (Lissachatina) fulica outside of East Africa and the Indian Ocean islands points to the Indian Ocean islands as the earliest known common source. PLOS One. 9(9):e105151. Freeman S, Herron J. 2004. Evolutionary analysis. 3rd ed. Upper Saddle River (NJ): Prentice Hall. Guindon S, Gascuel O. 2003. A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Systematic Biology. 52:696-704. Hall B. 2008. Phylogenetic trees made easy: A how to manual. 3rd ed. Sunderland (MA): Sinauer Associates. Hauswald AK, Remais JN, Xiao N, Davis GM, Lu D, Bale MJ, Wilke T. 2011. Stirred, not shaken: Genetic structure of the intermediate snail host Oncomelania hupensis robertsoni in a historically endemic schistosomiasis area. Parasites and Vectors. 4:206. Hong QB, Zhou XN, Sun LP. 1995. The sensitivities of Oncomelania snails from different endemic areas to the molluscicide NaPCP. Chinese Journal of Zoonoses. 11:39-41. Hope M, McManus DP. 1994. Genetic variation in geographically isolated populations and subspecies of Oncomelania hupensis determined by a PCR-based RFLP method. Acta Tropica. 57(1):75-82. Kameda Y, Kato M. 2011. Terrestrial invasion of pomatiopsid gastropods in the heavy- snow region of the Japanese Archipelago. BMC Evolutionary Biology. 11:118. Leonardo LR, Rivera P, Saniel O, Solon JA , Chigusa Y, Villacor te E, Chua J, Moendeg K, Manalo D, Crisostomo B, Sunico L, Boldero N, Payne L, Hernandez L, Velayudhan R. 2015. New endemic foci of schistosomiasis infections in the Philippines. Acta Tropica. 141:354-360. Leonardo L, Chigusa Y, Kikuchi M, Kato-Hayashi N, Kawazu S, Angeles JM, Fontanilla IK, Tabios IK, Moendeg K, Goto Y, Fornillos RJ, Tamayo PG, Chua JC. 2016. Schistosomiasis in the Philippines: Challenges and some successes in control. The Southeast Asian Journal of Tropical Medicine and Public Health. 47(4):651-666. Librado P, Rozas J. 2009. DnaSP v5: A software for comprehensive analysis of DNA polymorphism data. Bioinformatics. 25:1451-1452. Lyd e a r d C , H o l z n a g e l W E , S c h n a r e M N , G u te l l R R . 2 0 0 0 . P h y l o g e n e t i c a n a l y s i s o f molluscan mitochondrial LSU rDNA sequences and secondary structures. Molecular Phylogenetics and Evolution. 15:83-102. Morrison DA. 2006. Phylogenetic analysis of parasites in the new millennium. Advances in Parasitology. 63:1-124. Okamoto M, Lo CT, T iu WU, Qui D, Hadidjaja P, Upatham S, Sugiyama H, Taguchi T, Hirai H, Saitoh Y, Habe S, Kawanaka M, Hirata M, Agatsuma T. 2003. Phylogenetic relationships of snails of the genera Oncomelania and Tricula inferred from the mitochondrial 12S RNA gene. Japanese Journal of Tropical Medicine and Hygiene. 31(1):5-10. Genetic Comparison of Oncomelania hupensis quadrasi 48 Pesigan TP, Hairston NG, Jauregui JJ, Garcia EG, Santos AT, Santos BC, Besa AA. 1958. Studies on Schistosoma japonicum infection in the Philippines. 2. The molluscan host. Bulletin of the World Health Organization. 18(4):481-578. Pinceel J, Jordeans K, Van Houtte N, Bernon G, Backeljau T. 2005. Population genetics and identity of an introduced terrestrial slug: Arion subfuscus s.l. in the north-east USA (Gastropoda, Pulmonata, Arionidae). Genetica. 125:155-217. Posada D. 2008. jModelTest: Phylogenetic model averaging. Molecular Biology and Evolution. 25:1253-1256. Rachford FW. 1977. Oncomelania hupensis quadrasi from Mindoro (Victoria), Leyte (Palo), and Mindanao (Davao del Norte) of the Philippines: susceptibility to infection with Philippine isolates of Schistosoma japonicum. Journal of Parasitology. 63(6):1129-1130. Saijuntha W, Jarilla B, Leonardo A , Sunico L, Leonardo L, Andrews R, Sithithaworn P, Petney T, Kirinoki M, Kato-Hayashi N, Kikuchi M,Chigusa Y, Agatsuma T. 2014. Genetic structure inferred from mitochondrial 12S ribosomal RNA sequence of Oncomelania quadrasi, the intermediate snail host of Schistosoma japonicum in the Philippines. The American Journal of Tropical Medicine and Hygiene. 90(6):1140-1145. Saitou N, Nei M. 1987. The neighbor-joining method: A new method for reconstructing evolutionary trees. Molecular Biology and Evolution. 4:406-425. Slatkin M, Hudson RR. 1991. Pairwise comparisons of mitochondrial DNA sequences in stable and exponentially growing populations. Genetics. 129:555-562. Stadler T, Frye M, Neiman M, Lively CM. 2005. Mitochondrial haplotypes and the New Zealand origin of clonal European Potamopyrgus, an invasive aquatic snail. Molecular Ecology. 14(8):2465-2473. Swofford, DL. 2002. PAUP* 4.0b10. Sunderland (MA): Sinauer Associates. Ta m u r a K , S t ec h e r G , Pe t e r s o n D, F i l i p s k i A , Ku m a r S . 2 0 1 3 . M E G A 6 : M o l e c u l a r Evolutionary Genetics Analysis version 6.0. Molecular Biology and Evolution. 30:2725- 2729. V iyanant V, Upatham ES, Blas BL, Yuan HC. 1987. Analysis of allozymes by electrofocusing in schistosome snail hosts (Oncomelania hupensis) from China and the Philippines. Malacological Review. 20:91-96. [WHO] World Health Organization. 1993. WHO Technical Report Series. The control of s c h i s t o s o m i a s i s : 2 n d r e p o r t o f t h e W H O e x p e r t c o m m i t t e e . G e n e v a : W o r l d H e a l t h Organization. W ilke T, Davis GM, Dongchuan Q, Spear RC. 2006. Extreme mitochondrial sequence diversity in the intermediate schistosomiasis host Oncomelania hupensis robertsoni: Another case of ancestral polymorphism? Malacologia. 48:143-157. J.C. C. Chua et al. 49 _____________ James Christopher C. Chua is a full time faculty at the College of Medical Technology of the Chinese General Hospital in Manila. He obtained his BS Medical Technology at Far Eastern University and MS Public Health at the College of Public Health, UP Manila. He specializes in Medical Laboratory Science, Public Health and Parasitology. Ian Kim B. Tabios is a medical student at the College of Medicine, UP Manila under the MD-Ph.D. (Molecular Medicine) Program. He obtained his BS. Biology at the Institute of Biology, UP Diliman. He specializes in Parasitology and Molecular Medicine. Pebbles Grayle P. Tamayo is a Science Research Specialist at the Research Institute for Tropical Medicine, Department of Health and an MS Public Health student at the College of Public Health, UP Manila. She obtained her BS Biological Sciences at West Visayas State University, Iloilo City. She specializes in Public Health and Parasitology. Lydia R. Leonardo is a Professor of Parasitology at the Department of Parasitology, College of Public Health, UP Manila. She is a recognized expert in schistosomiasis research in the Philippines. She obtained her BS Zoology at UP Diliman, MS Marine Biology at the Marine Science Institute, UP Diliman, and Doctor of Public Health at the College of Public Health, UP Manila. She specializes in Marine Biology, Public Health and Parasitology. Ian Kendrich C. Fontanilla is an Associate Professor and head of the DNA Barcoding Laboratory at the Institute of Biology, UP Diliman. He received his Ph.D. in Genetics from the University of Nottingham, United Kingdom. He specializes in Malacology, Molecular Genetics and Phylogenetics. Woodruff DS, Staub KC, Upatham ES, Viyanant V,Yuan, HC. 1988. Genetic variation in Oncomelania hupensis: Schistosoma japonicum transmitting snails in China and the Philippines are distinct species. Malacologia. 29:347-361. Wright S. 1943. Isolation by Distance. Genetics. 28(2): 114-138. Xia X, Xie Z. 2001. DAMBE: software package for data analysis in molecular biology and evolution. Journal of Heredity. 92(4):371-373. Zhao PZ, Jiang MS, Littlewood DTJ & Nie P. 2010. Distinct genetic diversity of Oncomelania hupensis, intermediate host of Schistosoma japonicum in mainland China as revealed by ITS Sequences. PLOS Neglected Tropical Diseases. 4(3):e611. Genetic Comparison of Oncomelania hupensis quadrasi 50 Raffy Jay C. Fornillos is a University Research Associate at the Natural Science Research Institute, UP Diliman and a MScience Biology (Genetics) student at the Institute of Biology, UP Diliman. He obtained his BS Biology at Leyte Normal University, Tacloban City. He specializes in Molecular Genetics, Phylogenetics and Parasitology. Emmanuel Ryan C. De Chavez is an Assistant Professor and Research Coordinator at the Institute of Biological Sciences, UP Los Baños. He obtained his Ph.D. in Life Sciences at the Graduate of School of Life Sciences, Tohoku University in Tohoku, Japan. He specializes in Malacology, Community Ecology and Evolutionary Biology. Takeshi Agatsuma is a Special Assistant Professor at Kochi University School of Medicine and a former Professor at the Department of Medicine, Kochi Medical School in Kochi, Japan. He specializes in Parasitology, including Sanitary Zoology. Mihoko Kikuchi is a Senior Assistant Professor at the Department of Immunogenetics, Institute of Tropical Medicine (NEKKEN), Nagasaki University, Nagasaki, Japan. She specializes in Immunogenetics and Infectious Diseases. Naoko Kato-Kayashi is an Assistant Professor at the School of Medicine, Dokkyo Medical University, Tochigi, Japan. She specializes in Public Health, Health Science, and Parasitology. Yuichi Chigusa is a Professor at the School of Medicine of Dokkyo Medical University, Tochigi, Japan. He specializes in Public Health, Sociology and History of Science and Technology, and Parasitology, including Sanitary Zoology.