C:\Users\UNIVERSA MEDICINA\Docu

*Department of Molecular Biology,
Faculty of Medicine Universitas
Jenderal Soedirman, Purwokerto
**Department of Paediatrics, Faculty
of Medicine Universitas Jenderal
Soedirman, Purwokerto

Correspondence:
Lantip Rujito
Department of Molecular Biology,
Faculty of Medicine Universitas
Jenderal Soedirman
Jl Gumbreg no 1 Purwokerto 53112,
Jawa Tengah, Indonesia
Email : l.rujito@unsoed.ac.id
ORCID ID : 0000-0001-6595-3265

Date of first submission, July19, 2018
Date of final revised submission,
February 1, 2020
Date of acceptance, February 4, 2020

This open access article is distributed
under a Creative Commons Attribution-
Non Commercial-Share Alike 4.0
International License

ABSTRACT

UNIVERSA MEDICINA

Glutathione S transferase and catalase gene
polymorphisms did not tend to influence the severity of

hemoglobin E/-thalassemia

Lantip Rujito*, Yundandhika Rizki Widodo*, Ghaida Sakina*, Qodri Santosa**,
and Ariadne Tiara Hapsari**

BACKGROUND
Thalassemia, a monogenic genetic disease of red blood cells, is spread
widely throughout the world. Glutathione S transferase (GST) enzymes
have an antioxidant role in detoxification processes of toxic substances
This study aimed to determine the role of the genetic modifier genes GSTT1
and GSTM1, and the catalase (CAT) gene in clinical degrees of hemoglobin
(Hb)E/β thalassemia.

METHODS
Sixty HbE/β Thalassemia patients were examined to determine their clinical
pictures. Clinical score was based on age when thalassemia symptoms
appeared, time of diagnosis, time of first blood transfusion, pre-transfusion
hemoglobin concentration, frequency of transfusions, and enlargement of
spleen. Ferritin concentration was also obtained from medical records.
Gene polymorphisms of GSTT1, GSTM1, and CAT were measured using
PCR and PCR-RFLP methods. Clinical scores were categorized into mild (0-
3.5), moderate (4-7), and severe (7.5-10) degrees, while ferritin level was
expressed in mg/dL. One way Anova was used to analyze the data.

RESULTS
The clinical appearance showed that severe, moderate, and mild degrees
accounted for 42%, 45%, and 13%, respectively. The majority had a high
ferritin level of more than 5000 mg/dL (67%). GSTT1 null, GSTM1 null, and
CAT minor allele genotypes were 21.7%, 33.3%, and 12.1%, respectively.
GSTT1, GSTM1, and CAT genotypes had no impact on the severity of
thalassemia patients (p=0.091, p=0.082, and p=0.141, respectively).

CONCLUSION
GSTT1, GSTM1, CAT gene polymorphisms tend to be a minor aspect of
severity of clinical outcome for HbE/β thalassemia patients and should be
not considered a routine laboratory check.

Keywords: GSTT1, GSTM1, CAT, HbE/β thalassemia, clinical score

ORIGINAL ARTICLE
pISSN: 1907-3062 / eISSN: 2407-2230

DOI: http://dx.doi.org/10.18051/UnivMed.2020.v39.19-26

January-April, 2020 Vol.39- No.1

Cite this article as: Rujito L, Widodo
YR, Sakina G, Santosa Q, Hapsari AT.
Glutathione S transferase and catalase
gene polymorphisms did not tend to
influence the severity of hemoglobin
E/b-thalassemia. Univ Med 2020;39:
19-26. doi: 10.18051/UnivMed.2020.
v39.19-26

Rujito, Widodo, Sakina GSTT1, GSTM1, and CAT in HbE/ β-Thalassemia

INTRODUCTION

Clinical pictures of hemoglobin E (HbE)/β
thalassemia have been reported widely, ranging
from the type with a healthy appearance needing
no transfusion to the regular transfusion-
dependent type. The phenotype modification of
HbE/ β th a l a s s e mia h as be e n de sc r i be d
extensively concerning the types of beta gene
mutations, and the presence of the secondary
modifiers XMN1, BCL11A, and HBS1L-Myb.(1)

The other findings reported that genes in the
redox system are thought to play a role in the
clinical conditions of thalassemia patients. It
relates to the system that regulates the oxidant-
antioxidant reaction especially against free
radicals from routine transfusions and lack of
iron chelation. Glutathione-S-transferase mu
(GSTM1) and glutathione-S-transferase theta
( G ST T 1) , t he ge ne s r e s p on s ib l e f or t h e
production of glutathione S-transferase, affect
the degree of cardiac siderosis as one of the
factors related to the death of thalassemia
patients.(2)

On the other hand, GSTT1 and GSTM1
a l so h ave an e f f e c t on ir on o ve rl oa d in
thalassemia patients.(3) The genotypes of GSTM1
and GSTT 1 are polymorphic. The “null”
genotype of the GST genes results in increased
susceptibility to oxidative reactions, with the
increased risk of tumors of the prostate and
cardiac disorders.(4) Likewise, with catalase
(CAT) genes, the polymorphism of exon nine at
the rs769217 locus was allegedly related to low
catalase activity resulting in reducing the effect
of the catalase enzyme.(5) Research on GSTM
and GSTT1 against many antioxidant factors
has been widely reviewed in various articles. In
general, the data shows that GSTM and GSTT1
affect the molecular level. However, there is
less knowledge in the literature on the internet
especially on the clinical aspects of thalassemia.
The present study was intended to add data
about the effect of GSTM, GSTT1 and CAT
gene polymorphisms in clinical issues, especially
HbE/thalassemia.

METHODS

Research design
The study was of cross-sectional design and

used secondary clinical data from a previous study
that were retrieved through the medical records
of Banyumas Hospital.(1) Genotyping was carried
out in the Research Laboratory of the Faculty of
Medicine, Universitas Jenderal Soedirman, in the
2017-2018 period.

Research subjects
Using the formula of Slovin for a total

population of 350, 60 patients aged 10-12 years
were recruited to participate in this study. The
subjects who came from the three categories of
mild, moderate, and severe types, underwent
genotyping for the genes of interest. HbE/β
thalassemia status was acquired from the previous
genotyping study.(1)

Genotyping
Genotyping for each gene was carried out

according to the following description: GSTT1 and
GSTM1 were obtained by the polymerase chain
reaction (PCR) technique, whereas CAT was
determined using the polymerase chain reaction-
restriction fragment length polymorphism (PCR-
RFLP) method. Table 1 contains the details of
primers and enzymes used in this study.

The PCR cocktails containing 50 ng template
DNA, PCR mix Kit (Invitrogen Corp., Carlsbad,
CA, USA), H

2
O, and primers were subjected to

a cycle at 94°C for 10 minutes, then to 30 cycles
each at 9°C for 55 seconds, 69.5°C for 55
seconds, and 72°C for 90 seconds. Ten IU of
restriction enzyme in RFLP application was
incubated overnight at 37°C with 15 μl of PCR
product. We then used gel documentation
procedure for band visualization.

Clinical score
The Mahidol score was used to determine

the clinical appearances of the HbE/β thalassemia
patients as described elsewhere.(6) This score
included the age at which thalassemia symptoms

The gel documentation system showed PCR
and RFLP visualization. Bands were presenting
the genotyping of GSTT, GSTM1, and CAT genes
on the agarose gel labeled with ethidium bromide
(Figure 1).

The genotype distribution of the GSTT,
GSTM1, and CAT gene polymorphisms and the
correlation picture for clinical scores are depicted
in Tables 3 and 4. The normal GSTM1 and the
GSTM1 null alleles both had a frequency of 33.3%
(20/60), which was higher than that of GSTT1
null( (21.7%)(13/60)), while in the CAT gene, the
T/T minor genotype accounted for 12.1%.

DISCUSSION

HbE/β-Thala ssemia is a variant of
thalassemia which has a phenotype spread from
mild to severe. Mild conditions, in general, are
manifestations of the mild combination of HbE
and Beta thalassemia genotypes.(7) Hemoglobin
E itself in the heterozygous and homozygous states
gives rise to mild clinical conditions, and generally
without the need for transfusion. However, some
patients may require transfusion since HbE
mutations are a kind of cryptic mutations.(8)

Clinical symptoms in HbE/β-Thalassemia
patients appear in extensive variations, stretching
in the age range 1-15 years.(9) Similar to the data
in the present study, generally, transfusion in HbE/
β-Thalassemia patients follows the type of mutant
in β-Thalassemia. The more severe the mutant
type, the more frequent transfusions must be
carried out, varying from 2 weeks to sporadic in
months. The present study obtained the same data

Table 1. Primers and enzymes used for genotyping the genes

*CYP gene was used as a control of multiplex PCR

appeared, time of diagnosis, the time of first
transfusion, pre-transfusion hemoglobin, the
frequency of transfusion, and enlargement of the
spleen. Iron level represented by ferritin was also
obtained from the medical records. In brief, the
score represents mild (0-3.5), moderate (4-7), and
severe (7.5-10) types. The present study included
the three types of patients (mild, moderate, and
severe) in equal proportions.

Statistical analysis
One way Anova was used to determine the

differences in mean clinical score for each
genotype. A p<0.05 was considered to indicate
statistical significance.

Ethical clearance
The Medical Ethi cs Committee of

Universitas Jenderal Soedirman approved the
ethics of the study protocol for the research, under
registry number 1328/KEPK/III/2018.

RESULTS

The majority of the severe patients were
diagnosed with anemia at the age of 1-5 years.
In the less severe types, usually the symptoms
appeared at an older age. Because of the
limitations of the previously documented data, we
obtained data for pre-transfusion hemoglobin for
three months, where the concentration was
between 7 to 9 g/dL. Some patients had been
splenectomized, but most of the spleens were only
mildly enlarged. Ferritin level was also higher in
the severe type of patients (Table 2).

Rujito, Widodo, Sakina GSTT1, GSTM1, and CAT in HbE/ β-Thalassemia

Gene Primers
Enzymes
(RFLP)

PCR
Product

interpretation

GSTM1 5’ AGGAACTCCCTGAAAAGCTAAA 3’ - 215 bp + =presence
- =null 5’ TGGGCTCAAATATACGGTGGAG 3’ -

GSTT1 5’ CTTACTGGTCCTCACATCTCCTT 3’ 480 bp
5’AGC TCA CCGGAT CATGGC 3’

CAT 5'-GCCGCCTTTTTGCCTATCCT-3 ' BstXI 202 bp C=remaining 202 bp
T=digested 108, 94 bp 5'-TCCCGCCCATCTGCTCCAC-3'

CYP* 5’-GAACTGCCACTTCAGCTGTCT-3’ - 312 bp
5‘-TCACCGGATCATGGCCAGCA-3’

Rujito, Widodo, Sakina GSTT1, GSTM1, and CAT in HbE/ β-Thalassemia

as the previous study. There are patients with
moderate and severe symptoms with initial
transfusions occurring at the age of 10 years,
which may possibly be due to delayed diagnosis
or inc rease d blood needs such as during
menstruation in female patients.(10) The iron levels
represented by ferritin also showed significant
differences between groups of patients. The
number of transfusions in each group correlated
with iron levels stored in the body. In general,
there were clear differences in the time of clinical
appearance between groups (Table 2).

Genetic modification is one of the essential
topics to be studied considering the diversity of
clinical symptoms that appear in patients. The
primary modifier is a mutation in the beta genes,

whereas the subsequent modification is the
involvement of hemoglobin F coding genes and
co-inheritance with alpha genes mutations.(11)

Repeated transfusion has been known as the
cause of redox reaction disturbance due to iron
overload. GSTM1 and GSTT1 genes are among
the possible factors that play a role in the clinical
modification process of thalassemia patients.

This study revealed that the genotype of
GSTM1 null had the highest percentage of
patients with thalassemia major, as high as 33.3%,
while the frequency of GSTT1 null was 21.7%
(Table 4). It was in an equilibrium state according
to previous data on the SNP database. According
to the liter ature review, the GSTM1 null
frequency reaches a range of 23-62% in different

A B C

Figure 1. Genotyping of GSTM1, GSTT1, and CAT genes
Lane 2 is GSTT1 and GSTM1 positive (480 bp and 215 bp). Lane 3 and Lane 4 are GSTT1+/GSTM- and GSTT-/

GSTM1+ respectively. Lanes 5 and 7 are the CC genotype in the CAT gene (uncut 202 bp), whereas lane 6
depicts the CT heterozygote (202, 108, 94 bp). The TT alleles of the CAT gene are depicted in lane 8 (108, 94

bp), while the 312 bp lane is a control for the PCR process

Table 2. Clinical appearance of HbE/β thalassemia

*CYP gene was used as a control of multiplex PCR

Clinical parameters Mild (n=20) Moderate (n=20) Severe (n=20) p value

First diagnosis (age in years) 15.50±3.25 5.25±4.75 1.50±1.50 0.032

First transfusion (age in years) 17.25±2.05 6.50±2.05 1.25±1.50 0.026

Pretransfusion Hb (g/dL) 9.15±0.25 8±1.45 7±1.75 0.052

Splenomegaly (cm) No 4.68±3.25 10.75±4.25
Splenectomized : 2

0.001

Ferritin (mg/dL) 358.75±153.50 5752.00±134.75 9370.75±1250.50 0.024

Clinical score 3.05±0.25 7.25±1.65 8.75±1.00 0.042

populations worldwide. Meanwhile, GSTT1 null
has been found to be 15-30% in Caucasians and
more than 50% in Mongoloid races.(12) The
present study also showed that GSTT1 and
GSTM1 alleles did not determine the clinical
severity of the groups. Each group has this type
of allele gene polymorphism. This demographic
distribution, combined with the previous spreading
data illustrate that GSTM1 and GSTT1 alleles are
types of genes that have uniform distribution
among world popula tions so that the
polymorphisms of these genes become random
and cannot be a reference for the determination
of certain ethnic groups.

Our study indicated that there was no
significant relationship between GSTT1 and

GSTM1 gene polymorphisms against the clinical
de gree of HbE/Thalassemia β patients in
Indonesia (Table 3). The data has used both
comprehensive outcome data, namely Mahidol
score and using ferritin levels only. Ferritin is used
as a protein marker of iron in thalassemia patients
who undergo regular transfusions. The ferritin
level increases with the number of transfusions
and lack of compliance with iron chelation
medications.(13) Ferritin in the GSTT1 and GSTM1
null groups showed higher mean levels than the
normal group, but this difference was not
significant. Likewise in the CAT gene, groups
containing allele mutants also showed higher
values than those in the wild-type group, but did
not show data significance (Table 4). Differing

Genotype
Disease severity

p value
Mild (n=20) Moderate (n=20) Severe (n=20)

GSTT1
Null
Non-null

GSTM1
Null
Non-null

GSTT1+GSTM1
Null
Non-null

CAT genes
C/C
C/T
T/T

4
16

7
13

2
18

13
4
3

8
12

15
3
2

5
15

13
5
2

0.906

0.591

0.850

0.912

Table 3. Frequency distribution of GST gene polymorphisms among HbE/β thalassemia patients

Table 4. Genotype frequencies of GSTT, GSTM1, and CAT genes and the genotype-
phenotype relationship with severity of disease and the ferritin level

Genotype
Frequency Clinical Score Ferritin level (mg/dL)

Mild Moderate Severe Total (%) (X±SD) p value (X±SD) p value

GSTT and GSTM
genes

Normal 7 6 7 20 (33.3) 6.27±1.19

0.09

4726.42±71.67

0.08
GSTT1 null and
GSTM1 null

2 2 3 7 (11.7) 5.14±1.31 5954.57±54.46

GSTM1 null 7 8 5 20 (33.3) 6.15±0.74 5723.50±140.72

GSTT1 null 4 4 5 13 (21.7) 5.8±1.52 5224.85±98.24

CAT gene

C/C 13 15 13 41 (70.7) 5.4±1.40

0.08

5473±102.92

0.10 C/T 4 3 5 12 (17.21) 5.9±0.6 5002±48.38

T/T 3 2 2 7 (12.1) 8.5±1.15 5974±218.46

Univ Med Vol. 39 No.1

Rujito, Widodo, Sakina GSTT1, GSTM1, and CAT in HbE/ β-Thalassemia

data were reported previously by Sharma and
colleagues who concluded that GSTT1 and
GSTM1 genotype deletions worsened the clinical
outcome in maj or th alassemia patie nts
characterized by elevated serum iron and serum
ferritin levels compared with major thalassemia
patients with normal GST genotypes.(14) For major
thalassemia, these data did not explain in detail
the type of mutation involved. Differences in
primary mutants may cause different results
considering that there are mor e than 300
variations recorded in the human beta gene
variation database.(15) This fact may explain why
there are differences between studies.

Observation of ferritin levels in these patients
showed no different levels in various types of
genotypes. This indicates that ferritin iron levels
are not affected by GSTT1 and GSTM1 alleles,
although on average the minor allele group shows
an increase over other groups. The Sharma (14)

study was based on iron parameters only whereas
the present study used the general clinical
outcome and also the serum ferritin level. In some
hematological diseases, these genes may
constitute independent risk factors, such as in
acute myeloid leukemia (AML), with no impact
on prognosis.(16) The GSTT and GSTM1 null also
have an impact on the pro-hepcidin level on iron
overload and organ dysfunction. However, these
mutants were not as good a biomarker as ferritin
for the iron stores. Another report in sickle cell
patients was also following this issue, especially
in iron overload status.(17,18) Glutathione S
transferase expression levels are an essential
factor in determining the sensitivity of cells to a
broad spectrum of toxic chemicals, but it does
not appear to be a vital element in influencing the
clinical state of thalassemia patients.(19) However,
comparison of GSTM1 and GSTT1 in healthy and
affected individuals shows that deletion in both
GST genes influences GST enzyme activity which
was demonstrated by low GST levels in the group
of individuals with double deletions in both genes.
The results is a deficiency of the enzyme in favor
of free radical reduction processes due to
excessive iron deposits.(3,20)

Studies of polymorphisms in exon nine at
the locus rs769217 CAT genes in thalassemia are
limited. However, in some other chronic diseases
such as diabetes mellitus, it is reported that the
minor alleles CC and C have decreased activity
of catalase and hemoglobin A1c and allow the
risk of complications to increase.(21) In other
chronic diseases such as chronic hepatitis and
hepatocarcinoma, the polymorphism of the CAT
gene was also reported to influence disease
severity.(22) We found a report in the PubMed
database that was allegedly associated with low
catalase activity and reduced catalase protection
against free radicals in the body.(5,23) However,
the data of the present study did not show a
significant association between the CAT gene and
the clinical condition of the HbE/thalassemia β
patients. In the case of minor thalassemia, there
is also a change in oxidative reactions, which are
thought to be associated with hypochromic
microcytic anemia, similar to iron deficiency
anemia. However, other previous findings of
catalase activity in hypochromic microcytic
anemia reported conflicting results.(24,25)

Many factors influence the resulting non-
significant relationship in the present study. The
type of mutation in the globin gene may play a
role in the clinical state of major thalassemia
patients. Additionally, the presence of XmnI+ site
polymorphisms in the β globin gene cluster, and
the secondary modifier BCL11A and HBS1L-
MYB in patients with thalassemia major has been
reported to be advantageous since it may reduce
clinical manifestations although belonging to
thalassemia major.(1,26)

This study used HbE/-T hala ssemia
patients with a long transfusion history. Routine
transfusion bias can obscure the patient’s clinical
history. It is necessary to use patients who are in
an early stage of diagnosis and follow the next
clinical developments to ensure a causative
relationship. The study showed that the GSTT1,
GSTM1, and CAT genes were not important
modifiers of HbE/Thalassemia, so that they
cannot be a routine checking procedure. This
study needs further exploration to find modifiers

related to clinical variation, other than primary
mutations of beta genes.

CONCLUSION

Polymorphisms of GSTT 1, GST M1,
COLIA1, and CAT genes did not modify outcome
pictures of HbE/Thalassemia β.

ACKNOWLEDGMENTS

The authors thank Shinta Prima and Eli
Yuliya for technical help of laboratory and data
management. This research was supported by
the Ministry of Research, Technology, and Higher
Education of Indonesia through the Hibah
Unggulan Universitas Jenderal Soedirman.

CONFLICT OF INTEREST

The authors declare no conûict of interest.

CONTRIBUTORS

LR contributed to the research design,
conceptual framework, laboratory experiment,
data analysis, and manuscript development. YRW
and GS contributed to laboratory experiment and
data analysis. QS and ATH contributed to the
research design, data analysis, and manuscript
development. All authors have read and approved
the final manuscript.

REFERENCES

1. Rujito L, Basalamah M, Siswandari W, et al.
Modifying effect of XmnI, BCL11A, and HBS1L-
MYB on clinical appearances: a study on β-
thalassemia and hemoglobin E/β-thalassemia
patients in Indonesia. Hematol Oncol Stem Cell
Ther 2016;9:55-63. doi: 10.1016/j.hemonc.2016.02.
003.

2. Hahn T, Zhelnova E, Sucheston L, et al. A deletion
polymorphism in glutathione-S-transferase mu
(GSTM1) and/or theta (GSTT1) is associated with
an increased risk of toxicity after autologous
blood and marrow transplantation. Biol Blood

Marrow Transpl 2010;16:801–8. doi: 10.1016/
j.bbmt.2010.01.001.

3. Sclafani S, Calvaruso G, Agrigento V, Maggio A,
Lo Nigro V, D’Alcamo E. Glutathione S transferase
polymorphisms influence on iron overload in β-
thalassemia patients. Thalass Reports 2013;3:e6.
DOI: https://doi.org/10.4081/thal.2013.e6.

4. Origa R, Satta S, Matta G, Galanello R. Glutathione
S-transferase gene polymorphism and cardiac
iron overload in thalassaemia major. Br J Haematol
2008;142:143–5. doi: 10.1111/j.1365-2141.2008.
07175.x.

5. Nagy T, Csordás M, Kósa Z, Góth L. A simple
method for examination of polymorphisms of
catalase exon 9: rs769217 in Hungarian microcytic
anemia and beta-thalassemia patients. Arch
Biochem Biophys 2012;525:201–6.

6. Sripichai O, Makarasara W, Munkongdee T, et al.
A scoring system for the classification of beta-
thalassemia/Hb E disease severity. Am J Hematol
2008;83:482–4.

7. Traivaree C, Monsereenusorn C, Rujkijyanont P,
Prasertsin W, Boonyawat B. Genotype -
phenotype correlation among beta-thalassemia
and beta-thalassemia/HbE disease in Thai
children: predictable clinical spectrum using
genotypic analysis. J Blood Med 2018;9:35-41.
doi: 10.2147/jbm.s159295.

8. Ruangrai W, Jindadamrongwech S. Genetic
factors influencing hemoglobin F level in Beta-
thalassenia/HbE disease. Southeast Asian J Trop
Med Public Health 2016;47:84–91.

9. Cao A, Galanello R, Origa R. Beta-thalassemia.
Genet Med 2010;12:61-76. doi: 10.1097/GIM.
0b013e3181cd68ed.

10. Thein SL. Molecular basis of β thalassemia and
potential therapeutic targets. Blood Cells Mol Dis
2018;70:54-65. doi: 10.1016/j.bcmd.2017.06.001.

11. Rujito L, Sasongko T. Genetic background of β
thalassemia modifier: recent update. J Biomed
Translational Res 2018;4:12-21. https://doi.org/
10.14710/jbtr.v4i1.2541

12. Kasthurinaidu SP, Ramasamy T, Ayyavoo J, Dave
DK, Adroja DA GST M1-T1 null allele frequency
patterns in geographically assorted human
populations: a phylogenetic approach. PLoS One
2015;10:e0118660. doi: 10.1371/journal.pone.
0118660.10:e0118660.

13. Dou H, Qin Y, Chen G, Zhao Y. Effectiveness and
safety of deferasirox in thalassemia with iron
overload: a meta-analysis. Acta Haematol
2019;141:32-42. doi: 10.1159/000494487.

14. Sharma V, Kumar B, Saxena R. Glutathione S-
transferase gene deletions and their effect on iron

Univ Med Vol. 39 No.1

Rujito, Widodo, Sakina GSTT1, GSTM1, and CAT in HbE/ β-Thalassemia

status in HbE/β thalassemia patients. Ann
Hematol 2010;89:411–4.

15. Cao A, Moi P, Galanello R. Recent advances in
beta-thalassemias. Pediatr Rep 2011;3:e17. doi:
10.4081/pr.2011.e17.

16. Nasr A, Sami R, Ibrahim N, Darwish D. Glutathione
S transferase (GSTP 1, GSTM 1, and GSTT 1) gene
polymorphisms in Egyptian patients with acute
myeloid leukemia. Indian J Cancer 2015;52:490–5.

17. Sanjay P, Mani MR, Sweta P, Vineet S, Kumar AR,
Renu S.Prevalence of glutathione S-transferase
gene deletions and their effect on sickle cell
patients. Rev Bras Hematol Hemoter 2012;34:100–
2.

18. Meloni A, Puliyel M, Pepe A, Berdoukas V, Coates
TD, Wood JC. Cardiac iron overload in sickle-cell
disease. Am J Hematol 2014;89:678-83. doi:
10.1002/ajh.23721.

19. Ozturk Z, Genc GE, Kupesiz A, Kurtoglu E,
Gumuslu S. Thalassemia major patients using iron
chelators showed a reduced plasma thioredoxin
level and reduced thioredoxin reductase activity,
despite elevated oxidative stress. Free Radic Res
2015;49:309-16. doi: 10.3109/10715762.2015.
1004327.

20. Van Zwieten R, Verhoeven AJ, Roos D. Inborn
defects in the antioxidant systems of human red
blood cells. Free Radic Biol Med 2014;67:377-86.
doi: 10.1016/j.freeradbiomed.2013.11.022.

21. Góth L, Nagy T, Kósa Z, et al. Effects of rs769217
and rs1001179 polymorphisms of catalase gene

on blood catalase, carbohydrate and lipid
biomarkers in diabetes mellitus. Free Radic Res
2012;46:1249–57.

22. Liu Y, Xie L, Zhao J, et al. Association between
catalase gene polymorphisms and risk of chronic
hepatitis B, hepatitis B virus-related liver cirrhosis
and hepatocellular carcinoma in Guangxi
population: a case-control study. Medicine
(Baltimore) 2015;94:e702. doi: 10.1097/MD.
0000000000000702.

23. Chioti V, Zervoudakis G. Is root catalase a
bifunctional catalase-peroxidase? Antioxidants
2017;6:39. doi: 10.3390/antiox6020039.

24. Lazarte SS, Mónaco ME, Jimenez CL, Achem MEL,
Terán MM, Issé BA. Erythrocyte catalase activity
in more frequent microcytic hypochromic anemia:
Beta-thalassemia trait and iron deficiency anemia.
Adv Hematol 2015;2015. Article ID 343571. doi:
10.1155/2015/343571.

25. Madhikarmi NL, Rudraiah K, Murthy S.
Antioxidant enzymes and oxidative stress in the
erythrocytes of iron deficiency anemic patients
supplemented with vitamins. Iran Biomed J Iran
Biomed J 2014;18:82-7. doi: 10.6091/ibj.12282.2013

26. Yamsri S, Singha K, Prajantasen T, et al. A large
cohort of beta(+)-thalassemia in Thailand:
Molecular, hematological and diagnostic
considerations. Blood Cells Mol Dis 2015;54:164-
9. doi: 10.1016/j.bcmd.2014.11.008.