C:\Users\JURNAL FKUSAKTI\Docume 25 *Department of Medical Laboratory Science, School of Basic Medical Sciences, College of Medical Sciences, University of Benin, Benin City, Nigeria **Medical Laboratory Unit, Cottage Hospital, Auchi Polytechnic, Auchi, Edo State, Nigeria. Correspondence: Helen Oroboghae Ogefere Department of Medical Laboratory Science, School of Basic Medical Sciences, College of Medical Sciences, University of Benin, Benin City, Nigeria e-mail: helenogefere@yahoo.com phone number: +2348023509447 Date of first submission, September 17, 2 01 8 Date of final revised submission, March 19, 2019 Date of acceptance, March 20, 2019 This open access article is distributed under a Creative Commons Attribution- Non Commercial-Share Alike 4.0 International License ABSTRACT UNIVERSA MEDICINA Molecular characterization of methicillin-resistant staphylococci among apparently healthy students Helen Oroboghae Ogefere* and Lawrence Ayodele Ogunleye*,** BACKGROUND Staphylococcus aureus are widely considered a major factor of nosocomial and community-acquired infections. This work was aimed at determining the prevalence of methicillin-resistant S. aureus (MRSA) among apparently healthy students. METHODS A cross-sectional study was conducted involving 400 nasal swab samples randomly collected from students using sterile swab sticks and processed to recover S. aureus using standard microbiological techniques. Conventional methods were used to identify the isolates and antibiotic susceptibility tests were performed using Kirby-Bauer disc diffusion method according to performance standards of Clinical and Laboratory Standard Institute guidelines. Methicillin-resistance was detected phenotypically using cefoxitin 30µg discs. Bacterial deoxyribonucleic acid (DNA) extraction was done on cefoxitin-resistant staphylococci isolates only using ZymoResearch (ZR) fungal/bacterial DNA MiniPrepTM kit. A polymerase chain reaction assay targeting the 16S rRNA, nuc, and mecA genes on 1.0% agarose gel electrophoresis stained with ethidium bromide was used to identify S.aureus and detect methicillin resistance. RESULTS The overall prevalence of MRSA was 5.8% using phenotypic methods. PCR amplification of the 23 phenotypically confirmed MRSA using 16S rRNA and nuc genes identified staphylococci 23/23(100%) and S. aureus 23/23(100%) at band size 886bp and 225bp respectively. However, 16(69.6%) were positive for mecA gene at band size 532bp by PCR method. Poor level of susceptibility was recorded among the MRSA namely to erythromycin (26.6%), cloxacillin (0%), augmentin (0%), cefuroxime (0%), ceftriaxone (0%) and ceftazidime (0%). Ofloxacin was the most effective antibiotic (60.9%). CONCLUSION Active antimicrobial surveillance of pathogenic staphylococci is important to analyze the infections and transmission rate for possible control measures. Keywords: Methicillin-resistance, staphylococci, students, antibiotics, mecA, nuc. ORIGINAL ARTICLE pISSN: 1907-3062 / eISSN: 2407-2230 DOI: http://dx.doi.org/10.18051/UnivMed.2019.v38.25-32 January-April, 2019 Vol.38- No.1 Cit e th is a rtic le a s: Ogefere HO, Ogunleye LA. LMolecular character- ization of methicillin-resistant staphy- lococci among apparently healthy stu- dents. Univ Med 2019;38:25-32. doi: 10.18051/UnivMed.2019.v38.25-32 26 Ogefere, Ogunleye Methicillin-resistant staphylococci INTRODUCTION The widespread resistance across various species of staphylococci has been reported in recent years.(1) The most notable example is the e me r ge n c e o f me t h ic il l i n -r e s i s ta nt Staphylococcus aureus (MRSA), which was reported just one year after the launch of methicillin in the early 1960s and has now become a major public health concern with its prevalence increasing globally.(2) MRSA can cause the same types of infections as other S. aureus isolates such as: skin and soft tissue infections, including impetigo, folliculitis, furunculosis, abscesses, cellulitis, and wound infections.(2) The MRSA has also been reported to cause invasive infections such as: pneumonia, endocarditis, osteomyelitis, septic arthritis, meni n gi t i s, se pt i ce mia , tox i c sh oc k and staphylococcal scalded skin syndromes in both infants and adults.(2) The MRSA strains are resistant to nearly all beta-lactam antibiotics by producing an alternative penicillin-binding protein (PBP) known as PBP-2a.(3) This protein is encoded by the mecA gene and has a low affinity to many beta-lactam antibiotics. MRSA strains are not o nl y r e s ist a n t t o b e t a -l ac t a ms a nd cephalosporins, but also often show resistance to a wide range of antibiotics.(3) The mecA is p ar t o f a mo bi le ge n et i c e le me n t ca lle d s t a ph ylo co c c a l c a s s e t t e ch r o mo s ome (SCCmec). The SCCmec is flanked by cassette chromosome recombinase genes (ccrA or ccrB or ccrC) that permit intra- and interspecies horizontal transmission of SCCmec.(3, 4) S. aureus has four PBPs, (PBP1, PBP2, PBP3, and PBP4), with PBP2a/2' and PBP2 being responsible for peptidoglycan synthesis with transpeptidase and transglycosylase activities.(3) In Nigeria, the prevalence of hospital associated- MRSA in clinical samples also varies from one region to another; 19.2% in Ekiti, 28.6% in Kano, 12.5% in Maiduguri and 38.0% in Benin.(5-9) Several reports of studies on prevalence of community-associated MRSA (CA-MRSA) are also emerging in Nigeria; 10.8% in apparently healthy school children in Okada, Edo State, 41% and 56.7% in apparently healthy university students in Edo and Ogun states respectively, and 60.7% in otherwise healthy inhabitants of Uturu communities in Abia State.(10-12) Characterization of the 16S rRNA gene is now well-established as a standard method for identifying and classifying species, genera and families of bacteria including staphylococci.(13) The nuc gene, which encodes thermonuclease, is widely used as a specific target for the identification of S. aureus by polymerase chain reaction (PCR).(14) Numerous in-house PCR based assays targeting the nuc gene alone or in combination with the mecA gene have been designed for fast screening or identification of methicillin-resistant S. aureus (MRSA) and methicillin-susceptible S. aureus (MSSA).(14) In recent years, detection of mecA by PCR is also considered as the gold standard for identification of MRSA.(9, 14) Cefoxitin, being a cephamycin, is a stronger inducer of the mecA regulatory system than oxacillin. The cefoxitin disc test is easier to read than the oxacillin disc diffusion test and more accurate for detection of mecA mediated resistance.(15) Many PCR based molecular methods were developed as alternative ways for accurate identification of MRSA.(16) Most reports in our locality concentrate on phenotypic methods of identifying methicillin-resistant staphylococci especially among apparently healthy subjects and neglecting molecular characterization to identify the specific bacteria a n d ge ne s r e s p on si b l e f or a nti mic r ob i a l resistance. This study therefore aimed to use the PCR assay to target three genes: a genus- specific 16S rRNA to detect staphylococcal DNA; nuc, which encodes the S. aureus— specific region of the thermonuclease gene and mecA, a determinant of methicillin resistance among apparently healthy students of a tertiary institution in Auchi, Edo State, Nigeria. 27 METHODS Research design This study was of cross-sectional design and was conducted using 400 apparently healthy students (consisting of 167 males and 233 females) of Auchi Polytechnic, Auchi, Edo State, Nigeria. Informed consent was obtained from all participants prior to specimen collection. Institutional ethical approval was obtained before study commencement. The duration of the study was from July 2016 to November 2017. Specimen collection and processing A t o t a l of 4 0 0 a n t e r i o r na sa l s w a b specimens were collected from the participants. All samples were collected from the left anterior nares using sterile swab stick soaked in sterile saline, labelled, packaged and transported immediately to the Microbiology laboratory for analysis. Staphylococcus aureus isolates were identified using API-Staph system (API System; bioMerieux, Paris, France). Antimicrobial susceptibility testing Antimicrobial susceptibility testing was carried out following the recommendation of the British Society for Antimicrobial Chemotherapy (BSAC) method.(17) The test colonies were emulsified in sterile distilled water and the turbidity matched with 0.5 McFarland. Once matched, a sterile cotton wool swab was dipped in the organism suspension and excess liquid was removed by turning the swab on side of the test tube. The entire surface of Mueller–Hinton agar plate was seeded by swabbing in three directions with the swab. The antibiotic discs were placed on the plate with the use of a sterile forceps. The antimicrobial agents tested were ofloxacin ( 5 µg) , a mox i c i l li n -c l a vul a n at e ( 30 µg) , ceftazidime (30g), erythromycin (5µg), cloxacillin (5µg), ceftriaxone (30µg), cefuroxime (30µg) and gentamicin (10µg). The plates were incubated at 370C for 18 – 24 hours. Detection of cefoxitin resistance All Staphylococcus aureus isolated were screened for methicillin-resistance by following CLSI guidelines using 30 μg cefoxitin discs ( A bt e k U .K ) . ( 1 5 ) Pla te s we r e r e a d a f te r incubation at 35°C for 18 h. Zone diameter d” 21mm was dee me d to in di ca te c ef ox it in resistance. Bacterial DNA extraction Bacterial DNA extraction was done on the 23 cefoxitin-resistant staphylococci isolates only. The DNA of the representative bacterial isolates was extracted using ZR fungal/bacterial DNA Mini Prep TM kit (Zymo Research Corporation, USA) following the manufacturer’s instruction. PCR amplification of 16S rRNA, nuc and mecA genes The 23 cefoxitin-resistant staphylococci eluted DNA extracts were amplified for 16S rRNA, nuc and mecA genes by PCR using their respective primers as shown in Table 1. Briefly, a vol ume of 25μl PCR r ea c ti on mi xt ur e consisting of 12.5μl of PCR master mix, primers (1.25μl each), double distilled water (5μl), and DN A te mp la t e ( 5μl ) was us e d f or PCR. Univ Med Vol. 38 No.1 Primer Code Oligonucleotide Sequence (5‘- 3‘) Annealing Temp (OC) Expected Amplicon Size (bp) 16S rRNA 16S-1 (F) 5’GTGCCAGCAGCCGCGGTAA 3’ 16S-2 (R) 5’AGACCCGGGAACGTATTCAC 3’ 57 886 nuc (F) 5’TCAGCAAATGCATCACAAACAG3’ (R) 5’CGTAAATGCACTTGCTTCAGG 3’ 57 225 mecA mecA F 5’AAAATCGATGGTAAAGGTTGGC 3’ mecA R 5’AGTTCTGCAGTACCGGATTTGC 3’ 53 532 Table 1: List of primers amplified by PCR 28 Ogefere, Ogunleye Methicillin-resistant staphylococci Amp l if ic a t i on s w e r e pe r f o r me d u s in g GeneAmp* PCR system 9700 thermocycler (Applied Biosystems, USA) beginning with an initial denaturation at 94º C for 3 min followed by 30 cycles of 30 s denaturation step at 94ºC, annealing at 57º C for 30 s, extension at 72º C for 30 s, and a final 7 min extension at 72ºC followed by a hold at 4oC. The 10µl of PCR products was electrophoresed on 1% Tris- a c e ta te -EDTA a ga r os e ge l sta i n e d wi t h ethidium bromide for 60 min with 90V current and viewed under UV trans illuminator (Dolphin- DOC plus, Wealtec Corporation).(18) Statistical analysis Statistical analysis was by the Chi (X2) square test and Fischer ’s exact test where appropriate using INSTAT® software. A p value of <0.05 was deemed statistically significant. Ethical approval Ethical approval for this study was sought and obtained from Auchi Polytechnic Health Ethical Committee, Auchi with registration number: AP/HC.14/VOL.1/69. RESULTS Out of 400 apparently healthy students screened, 229 (57.3%) were culture positive for S. aureus. Twenty-three (7.7%) of these isolates were methicillin resistant using cefoxitin disc. This comprised 8 (8.1%) males and 15 (11.5%) females. Gender did not however significantly affect the distribution of MRSA (p=0.5219) (Table 2). The prevalence of specific genes 16S rRNA, nuc and mecA among cefoxitin-resistant S . a ure us wa s 10 0 % , 1 00 % , a nd 69 . 6% A B C Gender S. aureus (n,%) Cefoxitin resistance (n,%) positive negative p value positive Negative p value Gender Male Female 99 (59.3) 130 (55.8) 87 (40.7) 103 (44.2) 0.553 8 (8.1) 15 (11.5) 159 (91.9) 218 (87.5) 0.5219 Table 2. Prevalence rate of MRSA isolated from the nares of apparently healthy students using cefoxitin disc Figure 1. Polymerase chain reaction of 16S rRNA gene in cefoxitin-resistant staphylococci isolates using 1.0% agarose gel electrophoresis stained with ethidium bromide to identify staphylococci. Left-hand lane is 100bp- 1517bp DNA ladder (molecular marker) while NC is a no DNA template control 29 Univ Med Vol. 38 No.1 Figure 3.Polymerase chain reaction results for detection of mecA gene from confirmed cefoxitin-resistant Staphylococcus aureus isolates on 1.0% agarose gel electrophoresis stained with ethidium bromide. L is 100bp-1517bp DNA ladder (molecular marker) while NC is a no DNA template control Figure 2. Polymerase chain reaction of nuc gene in cefoxitin-resistant staphylococci isolates using 1.0% agarose gel electrophoresis stained with ethidium bromide to identify Staphylococcus aureus. L is 100bp- 1517bp DNA ladder (molecular marker) while NC is a no DNA template control respectively. Polymerase chain reaction results for detection of these genes can be seen in Figure 1, 2, and 3 respectively. Gender also did not significantly affect the distribution of mecA gene among cefoxitin-resistant S. aureus as 16 (69.6%) isolates harbored the gene, in a male- to-female ratio of 6:10 (p=0.975). Methicillin resistant S. aureus showed poor susceptibility to commonly available antibiotics a s 0% s u sc e pt i bi l i t y wa s o bs e r ve d f or ceftazidime, cefuroxime, ceftriaxone, cloxacillin and amoxicillin-clavulanate (augmentin). A poor level of susceptibility was recorded among the MRSA namely to erythromycin (26.6%), The most active antibiotic was ofloxacin (60.9%). DISCUSSION The prevalence rate of MRSA in this study was 5.8% (using cefoxitin disc). This finding is 30 Ogefere, Ogunleye Methicillin-resistant staphylococci in agreement with the work of Mahde et al.(19) which reported community-associated MRSA among healthy university students (4.2%). Also, Okwu et al.(10) reported a prevalence of 10.8% of community-associated MRSA in apparently healthy school children in Okada, Edo State, Nigeria. A study carried out in Colombia by Bettin et al. showed that the MRSA carriage status by medical students in their clinical rotations was 1.6%.(20) A study in Thailand reported 1% prevalence among university students while Shadi recorded 6.7% MRSA colonization of nares among medical students in Jeddah, Saudi Arabia.(21, 22) On the contrary, Eke et al.(11) reported 41% MRSA in apparently healthy university students in Ekpoma, Edo State, Nigeria. The difference in prevalence rates recorded could be attributed to method of identification of S. aureus isolates used to detect MRSA. Most other studies in Nigeria reported above used phenotypic identification as against the genotypic method used in this study. Ayeni and Odumosu had reported 85% misidentification rate of other microorganisms as Staphylococus aureus in Southern Nigeria when comparing phenotypic methods with genotypic (16S rRNA).(13) Po l yme r a s e c h a in r e a c t i o n ( PCR) amplification of 16S rRNA genes to identify staphylococci among the 23 MRSA of apparently healthy subjects was positive (100%). This is in line with work of Degaim et al.(23) where all isolates were positive for both 16S rRNA genes and mecA genes (100%). Ayeni and Odumosu similarly showed the reliability of this genotypic test when compared with phenotypic tests in identification of S. aureus.(13) This current study results agreed with Makgotlho,(24) who showed that all isolates 97/97 (100%) have 16S rRNA gene while mecA gene was detected in 96/97 (99%) of the MRSA isolates, the 1/97(1%) which did not show the presence of mecA gene was, however, phenotypically identified as MRSA. In this study, the PCR amplification of nuc gene to detect Staphylococcus aureus among MRSA showed 100% positive results. According to Vremera et al.(25) the nuc gene in S. aureus encodes the ther monuclease e nzyme and amplification of nuc gene is a potential method for rapid diagnosis of S. aureus infection. Theref ore, the primer used in this study confirmed the ability of PCR as a fast and reliable method for detection of the nuc gene to identify S. aureus strains. Also, of the 23 MRSA (using phenotypic method), 16 (69.6%) were confirmed to be mecA positive by the PCR method. This is also similar to the work of Ibadin et al. (9) where sensitivity and specificity of mecA gene in detection of MRSA was 89.5% and 90.3% respectively. Phenotypically methicillin-resistant strains without mecA gene and methicillin sensitive strains harboring mecA gene have been shown in previous studies.(13) In this study, phenotypic and genotypic methods for detection of MRSA were used. The results of this study showed that 5.8% and 4.0% of S. aureus isolates were recognized as MRSA by cefoxitin disc diffusion test and PCR method respectively. Considering that detection of the mecA gene by PCR method is a gold standard method for identifying methicillin-resistance in S. aureus isolates, therefore the prevalence of MRSA in this study was 4.0%. In this study, a poor level of susceptibility was recorded among the MRSA namely to er ythromycin (2 6.6 %), cl oxa cill in (0% ), augmentin (0%), cefuroxime (0%), ceftriaxone (0%) and ceftazidime (0%). This implies that MRSA isolates are generally resistant to beta- lactam antibiotics as previously reported.(9,10) However, some MRSA isolates were susceptible to gentamicin (47%) and ofloxacin (60.9%). The sensitivity to the non-beta-lactam antibiotics was also similar to previous findings and it is recommended that non-beta-lactam antibiotics should be the preferred drugs for the treatment o f c o mmu ni t y-a cq ui r e d ( CA) MRSA infections.(8, 9) The moderately high resistance (52.2%) recorded for gentamicin was similar to the report on S. aureus from clinical samples (44.4%).(9) Ofloxacin (with sensitivity of 60.9%) 31 appeared to be the best antibiotic of choice for the treatment of MRSA infections in Auchi, Edo State and its surrounding communities. A limitation of this study is hinged on the fact that only phenotypically identified MRSA strains were subjected to molecular analysis. More far reaching recommendations for routine microbiological practice may have been reached if all phenotypically identified S. aureus were screened for the nuc gene. The study however holds important clinical implications as the role of carriers of MRSA is continually being explored in op portun istic infec tions and nosocomial outbreaks. Further studies that explore nasal carriage of hospital-acquired and community-acquired MRSA strains among a ppa r e ntl y h ea l thy s u bj e ct s may de e pe n understanding of the superbug-MRSA in our region. CONCLUSIONS T hi s p r e se n t st u dy e s ta bli s he d t he phenotypic and genotypic prevalence rates of MRSA among apparently healthy subjects in the Auchi Polytechnic to be 5.8% and 4.0%, respectively. It showed that the PCR technique is a very useful tool in detecting and identifying MRSA using 16S rRNA, nuc and mecA genes. In comparison with conventional methods, genotypic analysis of these three genes is still t he go l d s t a nd a r d f o r d e t e ct i n g M RSA. Ofloxacin was found to be most effective antibiotic against MRSA. CONFLICT OF INTEREST The authors declare no conflicts of interest ACKNOWLEDGEMENT The author s are gratef ul to all study participants for their cooperation and to the management of Auchi Polytechnic, Auchi, for the approval to carry out this research. Univ Med Vol. 38 No.1 CONTRIBUTORS HOO took part in the conception and design of the study. LAO took part in data generation. HOO and LAO contributed to data analysis and interpretation. Both authors participated in writing and approving the final draft of the manuscript. REFERENCES 1. Peng Q, Hou B, Zhou S, et al. Staphylococcal cassette chromosome mec (SCCmec) analysis and antimicrobial susceptibility profiles of methicillin- resistant Staphylococcus aureus (MRSA) isolates in a teaching hospital, Shontou, China. Afr J Microbiol 2010;4:844-8. 2. Rongpharpi SR, Hazarika NK, Kalita H. The prevalence of nasal carriage of Staphylococcus aureus among healthcare workers at a tertiary care hospital in Assam with special reference to MRSA. J Clin Diagn Res 2013;7:257–60. doi: 10.7860/JCDR/2013/4320.2741. 3. Garza-González E, Morfin-Otero R, Llaca-Diaz JM, et al. Staphylococcal cassette chromosome (SCCmec) in methicillin-resistant coagulase negative staphylococci. A review and the experience in a tertiary-care setting. Epidemiol Infect 2010;138:645–54. DOI: https://doi.org/ 10.1017/S0950268809991361 4. Treesirichod A, Hantagoo S, Prommalikit O. Nasal carriage and antimicrobial susceptibility of Staphylococcus aureus among medical students at the HRH Princess Maha Chakri Sirindhorn Medical Center, Thailand: a follow-up study. J Infect Public Health 2014;7:205-9. doi: 10.1016/ j.jiph.2012.12.004. 5. Olowe OA, Kukoyi OO, Taiwo SS, et al. Phenotypic and molecular characteristics of methicillin-resistant Staphylococcus aureus isolates from Ekiti state, Nigeria. Infect Dr Resist 2013;6:87–92. DOI: http://dx.doi.org/10.2147/ IDR.S48809 6. Nwankwo BOK, Sale A, Magagi A, et al. Methicillin-resistant Staphylococcus aureus and their antibiotic susceptibility pattern in Kano, Nigeria. Afr J Clini Exper Microbiol 2010;11:1595– 689. DOI: http://dx.doi.org/10.4314/ajcem.v11i1. 44088. 7. Onemu OS, Ophori EA. Prevalence of multi-drug resistant Staphylococcus aureus in clinical specimens obtained from patients attending the 32 Ogefere, Ogunleye Methicillin-resistant staphylococci university of Benin teaching hospital, Benin City, Nigeria. J Nat Sci Res 2013;5:154-9. 8. Shittu AO, Usman H, Adamu N, et al. Epidemiology and antibiotic susceptibility pattern of methicillin-resistant Staphylococcus aureus recovered from tertiary hospitals in North-eastern, Nigeria. J Med Medic Sci 2013;4:214-20. 9. Ibadin EE, Enabulele IO, Muinah F. Prevalence of mecA gene among staphylococci from clinical samples of a tertiary hospital in Benin City, Nigeria. Afr Health Sci 2017;17:100-10. DOI: https:// dx.doi.org/10.4314/ahs.v17i4.7. 10. Okwu M, Bamgbala S, Aborisade W. Prevalence of nasal carriage of community-associated methicillin resistant Staphylococcus aureus (CA- MRSA) among healthy primary school children in Okada, Nigeria. J Natur Sci Res 2012;2:61-5. 11. Eke S, Abdulkadiri S, Okoro CJ, et al. The prevalence and resistivity pattern of Staphylococcus aureus isolates from apparently healthy university students in Ekpoma, Edo State, Nigeria. Inter J Bas Appl Innov Res 2012;1:183-7. 12. Ayepola, OO, Taiwo OS, Anifowose A, et al. Nasal carriage of Staphylococcus aureus and associated risk factors among students in a Nigerian University. Acta Sci Microbiol 2018;1:6- 8. doi: 10.31080/ASMI.2018.01.0010. 13. Ayeni FA, Odumosu BT. False identification of other microorganisms as Staphylococcus aureus in Southern Nigeria. Trop J Pharm Res 2016;15: 1941-5. DOI: http://dx.doi.org/10.4314/tjpr.v15i9.19 14. Liu Y, Zhang J, Ji Y. PCR-based PCR-based approaches for the detection of clinical methicillin- resistant Staphylococcus aureus. Open Microbiol J 2016;10:45-56. doi:10.2174/ 1874285801610010045. 15. Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing approved standard M100- S23. Clinical and Laboratory Standards Institute, Wayne, PA;2013. 16. Biswajit B, Shibendu B, Bappa M. Isolation of imipenem resistant Staphylococcus aureus from post-operation pus sample in oral and maxillofacial infections. Res J Pharm Bio Chem Sci 2012;3:896- 900. 17. Andrews JM. BSAC standardized disc susceptibility testing method (version 8). J Antimicrob Chemother 2009;64:454-89. 18. Kaya EG, Karakoc E, Yagci S, et al. Evaluation of phenotypic and genotypic methods for detection of methicillin resistance in Staphylococcus aureus. Afr J Microbiol Res 2009;3:925-9. 19. Mahde SA, Reem QM, Nawfal RH. Nasal carriage rates of Staphylococcus aureus and CA- methicillin resistant Staphylococcus aureus among university students. J Microbiol Res 2015;5:123-7. doi:10.5923/j.microbiology.20150504. 01 20. Bettin A, Causil C, Reyes N. Molecular identification and antimicrobial susceptibility of Staphylococcus aureus nasal isolates from medical students in Cartagena, Colombia. Brazil J Infect Dis 2012;16:329–34. doi: 10.1016/j.bjid.2012. 06.017. 21. Kitti T, Boonyonying K, Sitthisak S. Prevalence of methicillin-resistance Staphylococcus aureus among university students in T hailand. Southeast Asian J Trop Med Pub Hea 2011;42: 1498-504. 22. Zakai SA. Prevalence of methicillin-resistant Staphylococcus aureus nasal colonization among medical students in Jeddah, Saudi Arabia. Saud Med J 2015;36:807-12. https://doi.org/10.15537/ smj.2015.7.11609. 23. Degaim ZD, Shani WS, Hamim SS. In Virulence factors of Methicillin Resistant Staphylococcus aureus (MRSA) isolated from burn patients. Inter J Curr Microbiol Appl Sci 2015;4:898-906. 24. Makgotlho PE, Kock MM, Hoosen A, et al. Molecular identification and genotyping of MRSA isolates. FEMS Immun Med Microbiol 2009;57:104–15. 25. Vremera T, Iancu LS, Logigan C, et al. Optimization of triplex real time PCR for detecting Staphylococcus aureus mecA, pvl and nuc genes. Roman Arch Microbiol Immun 2011;70:69– 73.