141

Urology Journal

UNRC/IUA

Vol. 2, No. 3, 141-147 Summer 2005

Printed in IRAN

Evaluating Expression and Potential Diagnostic and

Prognostic Values of Survivin in Bladder Tumors:

A Preliminary Report

Seyed Javad Mowla,1* Mojtaba Emadi Bayegi,1 Seyed Amirmohsen Ziaee,2

Parvaneh Nikpoor1

1Department of Genetics, Faculty of Basic Sciences, Tarbiat Modarres University, Tehran, Iran

2Urology and Nephrology Research Center, Shaheed Labbafinejad Medical Center,

Shaheed Beheshti University of Medical Sciences, Tehran, Iran

ABSTRACT

Introduction: Survivin, an inhibitor of apoptosis (IAP), has been reported to be

capable of regulating both cellular proliferation and apoptotic cell death. Survivin

expression has been described during embryonic development and in adult cancerous

tissues, with greatly reduced expression in adult normal differentiated tissues,

particularly if their proliferation index is low. In the present study, the expression and

potential diagnostic and prognostic value of survivin in bladder tumors was evaluated.

Materials and Methods: Primary and recurrent bladder tumor specimens were

obtained from patients referred to the Shaheed Labbafinejad Medical Center in

Tehran, Iran. Total RNA was isolated from frozen tissues, reverse transcribed and

amplified by means of a nested polymerase chain reaction technique. 

Results: Survivin was detected in 3 cases of primary tumors (42.8%) and 6 cases of

recurrent tumors of bladder (60%). Survivin-∆Ex3 expression was seen in 41.2% of the

17 cases with bladder cancer. 

Conclusion: Our findings suggest that the expression of survivin and survivin-∆Ex3

is well associated with invasive and more-aggressive forms of bladder cancer. Our data

also indicate that the presence of survivin-∆Ex3 is better correlated with

tumorigenesis of bladder cancer compared with survivin expression.

KEY WORDS: survivin, apoptosis, bladder cancer, polymerase chain reaction

Introduction

Bladder cancer is one of the most common

malignant tumors worldwide. It is the fourth

most-common type of cancer in men and the

eighth most-common type in women. The

incidence of bladder cancer increases with age,

where people older than 70 years develop the

disease 2 to 3 times more often than do those

aged 55 to 69 years, and 15 to 20 times more

often than those aged 30 to 54 years.(1) Despite

the fact that there is no comprehensive statistical

report on the incidence rate of bladder cancer in

Iran, according to clinical reports it has a very

high incidence rate, and most cases are

transitional cell carcinoma (TCC), similar to that

in Europe and North America.

Tumor growth depends on 2 main factors: cell

proliferation and cell death by apoptosis.(2)

Apoptosis is a form of programmed cell death

characterized by morphologic, biologic, and

genetic features. Abnormalities of apoptosis may

lead to uncontrolled cellular proliferation and

ultimately carcinogenesis. Several studies have

Received April 2004

Accepted April 2005

*Corresponding author: Department of Genetics,

Faculty of Basic Sciences, Tarbiat Modarres

University, Al-e-Ahmad Hwy, Tehran, Iran.

PO Box: 14115-175, Tel: ++98 21 8801 1001-3464

E-mail: sjmowla@modares.ac.ir



Expression of Survivin in Bladder Tumors142

reported significant correlations between

apoptosis and prognosis in malignant tumors

such as lung, breast, and esophageal cancer. 

Two protein families are responsible for

controlling apoptosis: BcL-2 and the inhibitors of

apoptosis proteins (IAP). Inhibitors of apoptosis

proteins are a group of evolutionary conserved

proteins characterized by the presence of 1 to 3

domains known as baculoviral IAP repeat (BIR)

domains, which is necessary for the antiapoptotic

property of IAPs.(3,4)

Survivin, a new member of IAPs, is structurally

unique, because it has only a single BIR domain

and lacks the COOH-terminal RING finger

domain.(5) Survivin also plays critical roles in

regulating the cell cycle and mitosis. Its primary

expression in most human malignancies and its

low or absence of expression in normal tissues

suggest that it would be a good diagnostic and

prognostic marker as well as an ideal target for

cancer-directed therapy.(5,6) Extensive studies

have been carried out to elucidate the mechanism

of its function; however, its role in regulating cell

survival and cell cycle is poorly understood.(7)

Mahotka and colleagues(8) have cloned and

characterized 2 novel splice variants of survivin,

lacking exon 3 (survivin-∆Ex3) or retaining a part

of intron 2, as a cryptic exon (survivin-2B). Both

sequence alterations cause marked changes in the

structure of the corresponding proteins,

including structural modifications of the BIR

domain. They also have reported a conservation

of antiapoptotic properties for survivin-∆Ex3 and

a markedly reduced antiapoptotic potential for

survivin-2B. The reduced antiapoptotic activity of

survivin-2B is possibly due to a dominant-

negative mechanism of competitive binding to the

interactive partners of surviving.(9)

Using molecular markers for diagnosing and

determining the prognosis of bladder tumors can

be of great value. Considering the potential

application of survivin as a specific tumor marker

for cancers, we decided to evaluate the expression

of survivin in bladder tumors using reverse

transcription-polymerase chain reaction (RT-PCR)

to determine the potential association of its

variants with the malignant behavior of the

tumor.

Materials and Methods

Specimen Preparation 

Tissue specimens were obtained from patients

with bladder cancer who had been referred to the

Shaheed Labbafinejad Medical Center in Tehran,

Iran, from December 2002 to July 2003. The

specimens were obtained under the supervision

of a urologist and categorized into 2 groups

according to their clinical criteria: group 1

consisted of the specimens from patients with

newly diagnosed bladder cancer via conventional

diagnostic methods such as cystoscopy and urine

cytology. Group 2 was composed of known

bladder cancer cases that were on follow-up

(Table 1). 

Tumoral specimens were collected in 2 ways; if

the tumor was in stage Ta or T1, low-grade, and

noninvasive, the tissue was removed from the

suspected area by cystoscopic biopsy. A piece of

unused tissue was then put into an RNase-free,

1.5-mL tube, immediately snap frozen in nitrogen

vapor, and kept at -80°C until RNA extraction.

For the tumors in stages T2-T4, that is, those

invading the muscular layer, the whole bladder

was removed by radical cystoscopy. A piece of

tumoral specimen was then removed and put in

an RNase-free tube, snap frozen, and kept at -

80°C for later use.

RNA Extraction

Total RNA was isolated from frozen tissues

using the RNX-Plus solution (Cinnagen, Tehran,

Iran) according to the manufacturer's

instructions and as previously described.(10) The

purity and integrity of the extracted RNA were

evaluated by optical density measurements

(260:280 nm ratios) and by visual observation of

specimens electrophoresed on agarose gels. Both

methods confirmed the integrity of the extracted

RNA with little or no protein contamination.

After extraction, the isolated RNA was treated

with DNase to eliminate a probable genomic DNA

contamination.

RT-PCR Reaction

Specific primers of human B2M

(β2-microglobulin as an internal control;

accession number: NM-004048) and human

survivin (accession number: U75285) were

designed by using GeneRunner software

(Hastings Software, Inc, Hastings, NY, USA). The

sequences of the designed primers are as follow: 

External, forward primer:

5'- TGGCAGCCCTTTCTCAAG -3'

External, reverse primer:

5'-GAGAGAGAGAAGCAGCCAC - 3'

These primers amplified a 632 bp segment of



Mowla et al 143

human survivin cDNA located between

nucleotides 77 and 708.

Internal, forward primer:

5'- ACCACCGCATCTCTACATTC -3'

Internal, reverse primer:

5'- CTGGTGCCACTTTCAAGAC -3'

These primers amplified a 556 bp segment from

human survivin cDNA located between

nucleotides 96 and 651.

B2M forward primer:

5' TCG CGC TAC TCT CTC TTT CTG 3'

B2M reverse primers:

5' GCT TAC ATG TCT CGA TCC CAC 3'

These primers amplified a 334 bp segment from

human B2M cDNA located between nucleotides

41 and 374.

Complementary DNA (cDNA) synthesis

reactions were performed using 5 µg RNA and

MMLV reverse transcriptase (Gibco BRL,

Germany) with oligo (dT)18 priming in a 20 µL

reaction as described elsewhere.(11)

The designed primers as well as the oligo

(dT)18 primer were synthesized by MWG Biotech

Company (Ebersberg, Germany) as highly

purified salt-free grade. All designed primers

were BLAST(12) compared against the human

TABLE 1. Patients' characteristics and their clinicopathological conditions

M: male, F: female, NA: not available, TCC: transitional cell carcinoma, SCC: squamous cell carcinoma, N/C ratio: nucleus-

cytoplasm ratio

Groups Specimens 
Age 

(year) 
Sex Stage Grade Pathological diagnosis Description 

1 47 M A/pT1 2 papillary TCC 
High mitotic activity, high 

N/C ratio 

2 68 M NA NA papillary TCC 
Multiple nodular mass in 

bladder 

3 67 F A/pT1 
Low/ small foci of 

high grade 
Carcinoma in situ 

High mitotic activity, high 

N/C ratio 

4 72 M A/pT1 2 papillary TCC 
Primary biopsy diagnosis 

as carcinoma in situ 

5 59 M NA NA papillary TCC - 

5 67 F A NA papillary TCC 

Rapid recurrent after 4 

months of primary 

diagnosis 

Group 1 

7 60 M A 2 papillary TCC 

Rapid recurrent after 3 

months of primary 

diagnosis 

1 76 M NA NA papillary TCC 
Under follow-up for a long 

period of time, small tumor 

2 56 M B2/pT3a High/3 papillary TCC High mitotic activity 

3 62 M NA 
Poorly 

differentiated 

Undifferentiated 

carcinoma 
High level of necrosis 

4 46 M A Low/2 papillary TCC Radical cystectomy 

5 67 M B2/pT3a 
Poorly 

differentiated 
SCC 

Invading carcinoma with 

extensive necrosis 

6 67 M 
PT2 Nx 

Mx/B1 
High 

High-grade invasive 

urothelial carcinoma 

Transition from TCC to 

SCC 

7 81 M NA NA TCC - 

8 83 M pT3b Low /2 papillary TCC 
Invasion to surrounding 

soft tissues 

9 71 M 
pT3b Nx 

Mx 
High /3 TCC 

Necrotic tumoral tissue 

invading lamina propria 

Group 2 

10 81 F NA 
Poorly 

differentiated 

Undifferentiated 

carcinoma 

Presence of diffuse 

necrosis 



Expression of Survivin in Bladder Tumors144

genome to make sure they are not

complementary with other regions of genome.

PCR was performed using 5 µL of synthesized

cDNA with 1.25 U of Taq polymerase (Roche,

Germany), as described elsewhere.(10,11) The PCR

amplification was performed for 25 to 35 cycles.

The cycling conditions were as follows: 94°C for

30 seconds, 55°C for 30 seconds, 72°C for 1

minutes, and a final extension at 72°C for 10

minutes. PCR products were then separated on a

1.5% agarose gel and visualized by ethidium

bromide staining.

Restriction Enzyme Digestion

To confirm the identity of PCR products of

survivin variants, we determined the restriction

size pattern of all amplified products digested

with MboI restriction enzyme (MBI Fermentas,

Hanover, Germany). The enzyme cuts survivin

cDNA at nucleotide 588 generating 2 shorter

bands that are detected on 8% polyacrylamide gel

electrophoresis. 

Results

RT-PCR Optimization

To find the optimal number of amplification

cycles, external primers were first used to

amplify a piece of survivin, which generates a

632-bp segment. A band corresponding to the

expected size appeared in the first round of PCR

at cycles 35 and 40 (data not shown). Owing to

the weak intensity of the signal, nested PCR was

performed on the product during the first round

of PCR, using internal primers for 25 to 35

cycles. The results showed 2 bands with sizes of

556 and 438 bp, as expected from the sizes

previously reported for different variants of the

gene (data not shown). For the rest of the

experiments, all PCR reactions were performed at

30 cycles for B2M and 35 cycles, first round, and

30 cycles, second round, for survivin.

Evaluating the Expression of Survivin and

Its Splice Variants 

Overall, 17 tumoral specimens were studied.

The ages of the patients were between 46 and 83

years. Demographic and clinicopathological

characteristics of all patients are listed in Table

1. To be sure equal amounts of RNA were used in

all reactions, we used B2M as an internal control.

For each specimen, the RT-PCR was performed

under similar conditions (except for the number

of cycles) in 2 separate tubes, 1 for B2M and 1

for survivin. B2M was expressed in all tumoral

specimens (Figure 1). Nested RT-PCR results on

the same specimens revealed an expected band

for survivin with a size of 556 bp, as well as

another band with the approximate size of 438 bp

(Figure 1). 

The experiment was repeated at least twice for

all specimens. The reappearance of the smaller

band in the same specimens points to the

potential detection of a survivin splice variant.

Changing the PCR conditions (ie, increasing the

FIG. 1. RT-PCR analysis of the expression of B2M and survivin in tumoral specimens, A. Patients with no previous

incidence of bladder cancer, B. Patients with recurrence of bladder cancer.



Mowla et al 145

annealing temperature and/or decreasing the

concentrations of the primers) did not affect the

intensity of the bands.

In group 1 (specimens from patients with no

previous history of bladder cancer), 4 out of 7

cases (specimens 3, 4 , 6, and 7) showed no

detectable signal for survivin, while 2 cases

(specimens 1 and 2) showed 2 bands with the

sizes of 438 and 556 bp, and 1 (specimen 5) had

a single 556 bp band (Figure 1A). In group 2

(specimens from patients with previous diagnoses

of bladder tumors, currently under follow-up

surveillance), 4 out of 10 cases (specimens 3, 6,

9, and 10) showed no signal for survivin. Five

cases (specimens 2, 4, 5, 7, and 8) showed 2

bands of 438 and 556 bp, and 1 (specimen 1) had

a single 556-bp band (Figure 1B). Overall,

survivin was detected in 3 cases of primary

tumors (42.8%) and 6 cases of recurrent bladder

tumors (60%). Survivin-∆Ex3 expression was seen

in 41.2% of the 17 cases with bladder cancer.

Survivin-2B was not detected in any of our cases.

Confirming the Identity of Survivin

Variants 

The identity of the amplified bands in PCR,

which are the bands corresponding to the

survivin splice variants, was confirmed by means

of restriction enzyme digestion. For this purpose,

MboI enzyme was applied, which cuts survivin

cDNA at nucleotide 588 to generate 2 shorter

segments (64 and 492 bp for surviving, and 64

and 374 bp for survivin-∆Ex3; Figure 2).

Discussion

In the present study, we determined the

expression pattern of survivin splice variants in

patients diagnosed with bladder cancer. The main

aim of the study was then to examine any

potential correlation of gene expression with

degree of malignancy, pathological behavior, and

the recurrence of bladder cancer. 

Our results revealed that survivin and/or

survivin-∆Ex3 were expressed in 42.8% of cases

in group 1 (primarily detected tumors) and 60%

of cases in group 2 (recurrent tumors). In the

original report by Swana and coworkers,(13) where

expression of survivin was determined by

immunohistochemistry, no detectable survivin

was reported in normal transitional cells, but it

was present in 78% of tumoral specimens. In

contrast, Lehner and colleagues have reported

that survivin is not only detectable in tumoral

specimens, but also is present in some

nontumoral specimens of the bladder.(14) Also

recently, Gazzaniga and colleagues have reported

that they were able to detect survivin expression

by RT-PCR technique only in 9 out of 30

specimens (< 30%) of superficial bladder

cancer.(15) Accordingly, in another report by

Nakanishi and colleagues, survivin protein was

detected by immunohistochemistry in only 12.7%

of TCC specimens.(16)

The high expression of survivin in specimens 1

and 2 in group 1 as well as a moderate

expression of the gene in specimen 2 of group 2

(which had a high mitotic activity and nucleus-

plasma ratio) is in complete agreement with the

role of survivin in regulating cell proliferation

and its upregulation in the G2/M phase.(17) In

other words, because of the increased rate of cell

division in these specimens, the expression of

survivin is high.

What differentiates specimen 3 in group 1 from

other cases, despite having high mitotic activity

and high nucleus-plasma ratio, was the presence

of the cells with a big granulated nucleus, a

characteristic of necrotic cells. There was also a

significant amount of necrosis in specimens 3, 9,

and 10 in group 2. Since there is a continuous

spectrum of cell death by necrosis or

apoptosis,(18) the lack of survivin gene expression

in these cases is predictable. 

Specimen 5 in group 2, which was survivin

positive, had some degree of necrosis, and it was

expected to be survivin negative. From a closer

look at the pathological and microscopic report

FIG. 2. Electrophoresis of digested products of amplified

survivin segments by MboI on 8% polyacrylamide gel. The

enzyme cleaves the PCR products at nucleotides 588 of

survivin cDNA and generated 2 smaller pieces (64 and 492

bp for survivin and 64 and 374 bp for survivin-∆Ex3).



Expression of Survivin in Bladder Tumors146

and from the fact that the tumor was

heterogeneous in nature, we speculated that the

sampling might have been taken from parts of

the tumor lacking obvious necrosis. What makes

this case more complicated is a transformation of

the tumor from TCC to SCC (which is more

aggressive); since there is little information about

the nature of this transformation, a reliable

interpretation of the case is difficult.

Specimen 1 in group 2 was from a 76-year-old

man being followed up for bladder cancer, and

after a long period from primary tumor

diagnosis, a small tumor of low stage with a

negative urine cytology result had been found. All

of these data suggest an appropriate biological

behavior of the tumor, and the sole expression of

survivin (but not survivin-∆Ex3-which has poorer

prognosis) could have been anticipated. The

absence of survivin-∆Ex3 variant in this case and

in specimen 5 in group 1 makes them different

from other survivin-positive cases. 

Despite previous reports on the presence of

survivin-∆Ex3 and survivin-2B in a variety of

tumoral tissues and cell lines, there are no

reports on the involvement of the same variants

in bladder tumors. Mohatka and colleagues

detected these alternatively spliced variants for

the first time in renal cell carcinoma cell lines.(8)

The variants differ from each other, not only

because of having different sizes, but also because

of their different antiapoptotic activities.(19)

Primers were BLAST compared against the

human genome to make sure they do not have

nonspecific complementary sequences on the

genome. Also, we used nested RT-PCR to increase

the specificity and sensitivity of the reaction.

Thus, we can conclude that the 2 amplified bands

are indeed different variants of survivin.

However, we failed to detect one of the previously

reported variants of survivin, survivin-2B, in the

examined specimens. This might be due to the

low number of tumors with low stages in the

current study. A reduced expression of survivin-

2B variant has been shown to be correlated with

a poor prognosis of gastric carcinoma.(20) Also, it

is claimed that expression of these variants might

have a role in tumor progression and clinical

behavior of soft tissue sarcomas,(21) colorectal

carcinomas,(22) medulloblastoma,(23) breast

cancer,(24) and other cancers. To examine this

hypothesis, we reviewed the patients' archival

records and found that patients who were positive

for survivin-∆Ex3 had either been operated on by

cystectomy or had recently been a candidate for

cystectomy. In other words, the presence of the

variant is correlated with a poor diagnosis and a

more rapid disease recurrence. 

Conclusion

In conclusion, it seems that under various

physiological and pathological conditions,

apoptosis regulation depends not only on the

extent of survivin gene expression, but also on

how its primary transcript is processed to

produce different splice variants. Therefore,

determining the generation of different variants

of the gene in different tumors and normal

tissues would provide valuable diagnostic and

prognostic information.

Acknowledgement

We are grateful to Dr Daryoush Eskandari and

Mahmoud Faraz for their excellent technical

assistance. This research was supported, in part,

by a grant from the Urology and Nephrology

Research Center, Shaheed Beheshti University of

Medical Sciences and Health Services.

References

1. Landis SH, Murray T, Bolden S, Wingo PA. Cancer

statistics, 1998.CA Cancer J Clin. 1998;48:6-29. 

2. Guo M, Hay BA. Cell proliferation and apoptosis. Curr

Opin Cell Biol. 1999;11:745-52. 

3. LaCasse EC, Baird S, Korneluk RG, MacKenzie AE. The

inhibitors of apoptosis (IAPs) and their emerging role in

cancer. Oncogene. 1998;17:3247-59. 

4. Adams JM, Cory S. The Bcl-2 protein family: arbiters of

cell survival. Science. 1998;281:1322-6. Review. 

5. O'Driscoll L, Linehan R, Clynes M. Survivin: role in

normal cells and in pathological conditions. Curr Cancer

Drug Targets. 2003;3:131-52. 

6. Velculescu VE, Madden SL, Zhang L, et al. Analysis of

human transcriptomes. Nat Genet. 1999;23:387-8. 

7. Altieri DC, Marchisio PC. Survivin apoptosis: an

interloper between cell death and cell proliferation in

cancer. Lab Invest. 1999;79:1327-33. 

8. Mahotka C, Wenzel M, Springer E, Gabbert HE, Gerharz

CD. Survivin-deltaEx3 and survivin-2B: two novel splice

variants of the apoptosis inhibitor survivin with different

antiapoptotic properties. Cancer Res. 1999;59:6097-102. 

9. Islam A, Kageyama H, Hashizume K, Kaneko Y,

Nakagawara A. Role of survivin, whose gene is mapped

to 17q25, in human neuroblastoma and identification of

a novel dominant-negative isoform, survivin-beta/2B.

Med Pediatr Oncol. 2000;35:550-3. 

10. Nikpoor P, Mowla SJ, Movahedin M, Ziaee SA, Tiraihi T.



Mowla et al 147

CatSper gene expression in postnatal development of

mouse testis and in subfertile men with deficient sperm

motility. Hum Reprod. 2004;19:124-8. 

11. Sambrook J, Russel DW. Molecular cloning: a laboratory

manual. 3rd ed. New York: Cold Spring Harbor

Laboratory Press; 2001.

12. BLAST genome [database on the Internet]. Bethesda

(MD): National Library of Medicine (US). Available from:

http://www.ncbi.nlm.nih.gov/genome/seq/HsBlast.html

13. Swana HS, Grossman D, Anthony JN, Weiss RM, Altieri

DC. Tumor content of the antiapoptosis molecule

survivin and recurrence of bladder cancer. N Engl J

Med. 1999;341:452-3. 

14. Lehner R, Lucia MS, Jarboe EA, et al.

Immunohistochemical localization of the IAP protein

survivin in bladder mucosa and transitional cell

carcinoma. Appl Immunohistochem Mol Morphol.

2002;10:134-8. 

15. Gazzaniga P, Gradilone A, Giuliani L, et al. Expression

and prognostic significance of LIVIN, SURVIVIN and

other apoptosis-related genes in the progression of

superficial bladder cancer. Ann Oncol. 2003;14:85-90. 

16. Nakanishi K, Tominaga S, Hiroi S, et al. Expression of

survivin does not predict survival in patients with

transitional cell carcinoma of the upper urinary tract.

Virchows Arch. 2002;441:559-63. 

17. Altieri DC. Survivin, versatile modulation of cell division

and apoptosis in cancer. Oncogene. 2003;22:8581-9.

18. Jaattela M. Escaping cell death: survival proteins in

cancer. Exp Cell Res. 1999;248:30-43. 

19. Li F. Role of survivin and its splice variants in

tumorigenesis. Br J Cancer. 2005;92:212-6.

20. Krieg A, Mahotka C, Krieg T, et al. Expression of

different survivin variants in gastric carcinomas: first

clues to a role of survivin-2B in tumour progression. Br

J Cancer. 2002;86:737-43. 

21. Taubert H, Kappler M, Bache M, et al. Elevated

expression of survivin-splice variants predicts a poor

outcome for soft-tissue sarcomas patients. Oncogene.

2005;24:5258-61. 

22. Suga K, Yamamoto T, Yamada Y, Miyatake S, Nakagawa

T, Tanigawa N. Correlation between transcriptional

expression of survivin isoforms and clinicopathological

findings in human colorectal carcinomas. Oncol Rep.

2005;13:891-7. 

23. Fangusaro JR, Jiang Y, Holloway MP, et al. Survivin,

Survivin-2B, and Survivin-deItaEx3 expression in

medulloblastoma: biologic markers of tumour

morphology and clinical outcome. Br J Cancer. 2005

;92:359-65. 

24. Ryan B, O'Donovan N, Browne B, et al. Expression of

survivin and its splice variants survivin-2B and survivin-

DeltaEx3 in breast cancer. Br J Cancer. 2005;92:120-4.