PEDIATRIC UROLOGY
Further Evidence of the Association of the Diacylglycerol Kinase Kappa (DGKK) Gene With Hypospadias
Kamil K. Hozyasz,1* Adrianna Mostowska,2 Andrzej Kowal,3 Dariusz Mydlak,3 Alexander Tsibulski2, Paweł P.
Jagodziński2
Purpose: Hypospadias is a common developmental anomaly of the male external genitalia. In previous studies
conducted on West European, Californian, and Han Chinese populations the relationship between polymorphic
variants of the diacylglycerol kinase kappa (DGKK) gene and hypospadias have been reported. The aim was to
study the possible associations between polymorphic variants of the DGKK gene and hypospadias using an inde-
pendent sample of the Polish population.
Materials and Methods: Ten single nucleotide polymorphisms in DGKK, which were reported to have an impact
on the risk of hypospadias in other populations, were genotyped using high-resolution melting curve analysis in a
group of 166 boys with isolated anterior (66%) and middle (34%) forms of hypospadias and 285 properly matched
controls without congenital anomalies.
Results: Two DGKK variants rs11091748 and rs12171755 were associated with increased risk of hypospadias in
the Polish population. These results were statistically significant, even after applying the Bonferroni correction for
multiple comparisons (P < .005). All the tested nucleotide variants were involved in haplotype combinations as-
sociated with hypospadias. The global p-values for haplotypes comprising of rs4143304-rs11091748, rs11091748-
rs17328236, rs1934179-rs4554617, rs1934183-rs1934179-rs4554617 and rs12171755-rs1934183-rs1934179-
rs4554617 were statistically significant, even after the permutation test correction.
Conclusion: Our study provides strong evidence of an association between DGKK nucleotide variants, haplotypes
and hypospadias susceptibility.
Keywords: DGKK; diacylglycerol kinase kappa; haplotypes; hypospadias; polymorphism.
INTRODUCTION
In hypospadias, the external urethral opening is po-sitioned abnormally between the glans and the per-
ineum, thus allowing the classification of hypospadias
as anterior (distal), middle (midshaft) and posterior
(proximal). Anterior hypospadias is described as glan-
dular (the meatus on the ventral surface of glans pe-
nis), coronal, or subcoronal. In middle hypospadias the
urethra opens into ventral surface of penis. In posterior
hypospadias the urethral opening is located in the peno-
scrotal junction, scrotum, or perineum(1). The majority
of cases are isolated, i.e. individuals are not affected by
other congenital anomalies. Hypospadias is the second
most common human birth defect with an incidence of
1 in 250 live male births and its pathogenesis is com-
plex, multifactorial, and determined by genetic, endo-
crine, and environmental causes(1-5). Previous studies
demonstrated familial reoccurrence for the anterior
and middle forms of those malformations but not for
posterior types, displaying the importance of genetic
predisposition for hypospadias(5). Many linkage analy-
ses, aiming to elucidate the molecular genetic basis of
hypospadias were performed in the past, but they have
met with only limited success. In part, this limited suc-
1Department of Paediatrics, Institute of Mother and Child, Warsaw, Poland.
2Department of Biochemistry and Molecular Biology, Poznan University of Medical Sciences, Poznan, Poland.
3Department of Paediatric Surgery, Institute of Mother and Child, Warsaw, Poland.
*Correspondence: Department of Paediatrics Institute of Mother and Child, 17a Kasprzaka Str. 01-211 Warsaw, Poland.
Tel. +48223277190. Fax +48223277043. E-mail: khozyasz@verco.com.pl; kamil.hozyasz@imid.med.pl.
Received July 2017 & Accepted November 2017
cess can be attributed to the complexity of the disease,
as well as to the selection of not homogenous popula-
tions for investigations(4). Recently, two genome-wide
association studies based on DNA samples from West
European cases(5,6), as well as two case-control studies
conducted in the California population composed pri-
marily of Hispanic and Caucasian individuals(7) and in
the Han Chinese population(8), showed that common
polymorphic variants of the DGKK gene can increase
the risk of hypospadias.
The DGKK gene (OMIM *300837) located on chro-
mosome Xp11.22 encodes the diacylglycerol kinase
kappa. This enzyme is involved in the down-regulation
of diacylglycerol signalling since it phosphorylates
diacylglycerol, converting it to phosphatidic acid(9).
Determination of the exact associations between poly-
morphic variants of candidate genes and hypospadias
risk might provide very important insight into the cause
of hypospadias(4,10-12). Expression of DGKK in preputial
tissue is lower in boys with the hypospadias risk allele
of rs1934179(5). Recently, Shen et al.(13) reported that the
enzyme Dgkk appears to be a mediator during develop-
ment of mouse external genitalia.
The global burden incurred from hypospadias in terms
of physical morbidity, health care expenses, emotional
Pediatric Urology 272
Vol 15 No 05 September-October 2018 273
distress, and social dysfunction is significant for affect-
ed individuals, their families, and the health care sys-
tem overall(2,11,14). Hypospadiology remains a constantly
evolving discipline with plenty of discrepancies among
epidemiologic studies(1,11). Identifying the underlying
aetiology of this condition is crucial for improving
prevention strategies and genetic risk counselling. The
primary aim of our case-control study was to investi-
gate the contribution of previously reported cases of
polymorphic variants of the candidate DGKK gene to
the incidence of hypospadias in a homogenous Polish
population. This study is the first to represent patients
with hypospadias of East European origin as part of a
replicate sample to the previously described studies.
The secondary aim was to test the association between
common DGKK haplotypes and hypospadias suscepti-
bility using different risk models.
METHODS
Patients and controls
Considering apparent etiologic heterogeneity of hypo-
spadias, only isolated anterior and middle cases were
included in the current case-control study(5). A total of
166 unrelated boys (13 months to 10 years old) present-
ing with non-syndromic hypospadias and 285 unrelat-
ed healthy boys (13 months to 10 years old) with no
family history of hypospadias or other structural anom-
alies were recruited from the Institute of Mother and
Child in Warsaw. The control group was matched by
age and place of birth. Case eligibility to the study was
ascertained using the detailed medical records of each
patient. The non-syndromic designation was based on
diagnosis of isolated hypospadias with no other appar-
ent cognitive and structural anomalies. Of the 166 boys
ultimately enrolled, there were 110 (66%) anterior and
66 (34%) middle forms of hypospadias. The ancestry
contributions were estimated to be 100% of Caucasian,
Polish descent in both the hypospadias cases and the
control group. Samples were obtained between January
2013 and June 2015. DNA was isolated from peripher-
al blood lymphocytes using the salting-out extraction
procedure. The study was approved by the local Eth-
ics Committee. Written and oral consent was obtained
from the legal guardians of all the participants.
Single nucleotide polymorphism selection and
genotyping
Single nucleotide polymorphisms (SNPs) are defined
as loci with alleles that differ at a single base, with the
rarer allele having a frequency of at least 1% in a ran-
dom set of individuals in a population(15,16). Ten SNPs in
DGKK gene, previously detected to be associated with
hypospadias(5-8), were evaluated in this study (Table 1).
Table 1. Characteristics of polymorphisms genotyped in the DGKK gene.
Gene rs no. Locationa Allelesb SNP functionc Protein effect MAFd
DGKK rs4074320 chrX:50119085 A / G (REV) missense p.Asp1118Asn 0.29
rs4143304 chrX:50146570 C / T (FWD) cds-synon p.Leu368Leu 0.39
rs11091748 chrX:50157984 A / G (FWD) intron 0.39
rs17328236 chrX:50168209 A / G (FWD) intron 0.28
rs12171755 chrX:50179749 C / T (FWD) intron 0.35
rs1934183 chrX:50181014 G / T (REV) intron 0.39
rs1934179 chrX:50182184 C / T (REV) intron 0.36
rs4554617 chrX:50203402 A / C (FWD) intron 0.37
rs4826634 chrX:50208239 G / T (FWD) intron 0.37
rs7063116 chrX:50235002 A / G (FWD) N/A (upstream) 0.37
aNCBI build 37 / hg19.
bUnderline denotes the minor allele (based on whole sample).
cAccording to the Single Nucleotide Polymorphism database (dbSNP)
dMAF, minor allele frequency calculated from the control samples
Abbreviations: FWD, forward; REV, reverse strand.
Gene rs no. Alleles2 Primers for PCR amplification (5’ – 3’) Annealing temp. (°C) PCR product length (bp) Melt. temp. range (°C)
DGKK1 rs4074320 A / G F: GGGAATACAGGAAGCTGCAC 55 128 80 - 95
R: ACCTGAGCAAGATCCACCAG
rs4143304 C / T F: TGCAGTCTTTGCTTGCTCTC 55 96 78 - 93
R: TCACCAGATTCACACCCATC
rs11091748 A / G F: ACCCTACAGGACTGGACCATAG 58 147 80 - 95
R: GAGACAGCCTTGTCACCTAGAAC
rs17328236 A / G F: TCACCACATCAAGGCTCTACC 55 62 70 - 85
R: GCCACCCAATGGTGAATG
rs12171755 C / T F: GGGGTAGGCCAGGTAAGTAATG 58 122 75 - 90
R: GGAAGTCAGAAGGCCAGAACA
rs1934183 G / T F: CTGGGAAGAGGCAGTAGTGG 61 135 80 - 95
R: GTTCTTCTCCCCCACAGGA
rs1934179 C / T F: CATTTTTCTATCAATTGGCTCCT 55 136 75 - 90
R: TCCAAATCTACACTCCTTTTTGC
rs4554617 A / C F: TTCATTCCCCTCTACTCTTGGA 61 149 80 - 95
R: CCCTCAAGCACGTGTAGGAT
rs4826634 G / T F: CCATGGGCTTTGATGAGG 58 111 74 - 89
R: GGACAGTGACCCCAGATAATG
rs7063116 A / G F: TGGACCTTGGTTGTTGATG 55 169 71 - 86
R: CACAGTTGAAATCTGTTTTAGGAAC
1Genomic DNA for molecular analyses was isolated from peripheral blood lymphocytes by a standard salt-out extraction procedure.
2Underline denotes the minor allele (based on whole sample).
Table 2. High-resolution melting curve analysis (HRM) conditions for the identification of polymorphisms genotyped in the data set .
Association of the DGKK gene with hypospadias–Hozyasz et al.
The genotyping was carried out by high-resolution
melting curve analysis (HRM) on the LightCycler 480
system (Table 2). For quality control, approximately
10% of randomly selected samples were re-genotyped.
Samples that failed genotyping were not repeated and
were removed from statistical calculations.
Statistical methods
For each SNP, the Hardy-Weinberg (HW) equilibri-
um was evaluated in both patients and controls using
Chi-square (χ2) test. Statistically significant deviation
from HW expectations was interpreted as p-value <
.05. The differences in allele frequencies between cas-
es and controls were determined using standard χ2 test.
The strength of association was estimated by Odds Ra-
tio (OR) and corresponding 95% confidence intervals
(95% CIs). The Bonferroni correction was applied to
account for multiple comparisons, and p-values < .005
(.05 / 10 SNPs) were interpreted as statistically signif-
icant.
The haplotype-based association analysis was per-
formed using PLINK v1.07 (http://pngu.mgh.harvard.
edu/~purcell/plink/). The omnibus haplotype test (joint-
ly estimating all haplotype effects at a given location)
for sliding windows of 2 to 4 SNPs across the gene was
conducted using logistic regression. Significant p-val-
ues were corrected using the 1,000-fold permutation
test. The detailed haplotype analysis was conducted for
SNP combinations with statistically significant Omni-
bus test p-values. Haplotype-specific odds ratios (ORs)
were calculated and the most common haplotypes were
used as the reference. Only haplotypes with frequencies
≥ 0.01 in either cases or controls were tested.
RESULTS
First, we analyzed the DGKK SNPs independently.
None of the tested SNPs showed evidence of deviation
from Hardy-Weinberg equilibrium in neither the cases
nor the controls. After correction for multiple testing,
statistically significant results of increased risk for hy-
pospadias were observed only for carriers of the DGKK
rs11091748 and rs12171755 variants (Table 3). The
OR for individuals with the rs11091748 G allele com-
pared to A allele carriers was 1.87 (95% CI = 1.27 -
2.76, P = .0015). Six other SNPs showed a trend toward
association with hypospadias. The DGKK nucleotide
variants demonstrated moderate linkage disequilibrium
(LD). D’ and r2 values, calculated from the genotype
data of the control samples, ranged from 0.607 to 1.000
and 0.131 to 0.984, respectively (Figure 1 and Table 4).
Subsequently, we tested the common DGKK haplo-
types for their association with the risk of hypospadias.
The global p-values for the two two-markers haplotypes
(rs11091748_rs17328236, rs1934179_rs4554617), the
one three-markers haplotype (rs1934183_rs1934179_
rs4554617), and the one four-markers haplotype
(rs12171755_rs1934183_rs1934179_rs4554617) were
statistically significant even after permutation correc-
tion. Detailed analysis of those haplotypes is presented
in Table 5. All tested SNPs were involved in haplotype
combinations associated with hypospadias. However,
the haplotype combination (rs1934179_rs4554617)
with the best global p-value (pcorr = .007, Table 5) does
not include the two SNPs (rs11091748 and rs12171755)
highly linked with hypospadias in the single markers
analysis (Table 3).
Table 3. Association of DGKK gene SNPs with the risk of hypospadias.
rs no. Allelesa Allele counts in casesb MAF in cases Allele counts in controlsb MAF in controls OR (95% CI)c p value
rs4074320 A / G 63 / 103 0.38 (A) 82 / 196 0.29 (A) 1.46 (0.97 - 2.19) .0660
rs4143304 C / T 85 / 79 0.48 (C) 108 / 171 0.39 (T) 1.70 (1.15 - 2.52) .0072
rs11091748 A / G 89 / 76 0.46 (A) 109 / 174 0.39 (G) 1.87 (1.27 - 2.76) .0015
rs17328236 A / G 63 / 99 0.39 (G) 78 / 201 0.28 (G) 1.64 (1.09 - 2.47) .0176
rs12171755 C / T 79 / 82 0.49 (T) 98 / 182 0.35 (T) 1.79 (1.21 - 2.66) .0037
rs1934183 G / T 86 / 78 0.48 (T) 112 / 173 0.39 (G) 1.70 (1.15 - 2.51) .0069
rs1934179 C / T 79 / 86 0.48 (T) 102 / 178 0.36 (T) 1.60 (1.08 - 2.37) .0175
rs4554617 A / C 77 / 81 0.49 (C) 103 / 176 0.37 (C) 1.63 (1.10 - 2.43) .0147
rs4826634 G / T 50 / 115 0.30 (T) 106 / 178 0.37 (T) 0.73 (0.48 - 1.10) .1320
rs7063116 A / G 73 / 91 0.45 (A) 105 / 180 0.37 (A) 1.37 (0.93 - 2.03) .1096
Statistically significant results (p-value < 0.005) are highlighted in bold font.
aUnderline denotes the risk allele.
bThe order of alleles d / D (d is the minor allele in the control samples).
cAllelic model: d vs D (d is the risk allele).
Abbreviations: MAF, minor allele frequency; OR, Odds Ratio; CI, confidence interval.
D' above diagonal
r2 below diagonal
rs4074320 rs4143304 rs11091748 rs17328236 rs12171755 rs1934183 rs1934179 rs4554617 rs4826634 rs7063116
rs4074320 0.861 0.849 0.963 0.757 0.766 0.752 0.750 0.746 0.607
rs4143304 0.489 1.000 1.000 0.983 0.889 0.984 0.952 0.891 0.763
rs11091748 0.469 0.984 1.000 0.982 0.869 0.983 0.948 0.917 0.757
rs17328236 0.850 0.604 0.594 0.882 0.889 0.879 0.878 0.962 0.730
rs12171755 0.448 0.816 0.792 0.558 0.982 1.000 0.984 0.909 0.818
rs1934183 0.372 0.777 0.756 0.468 0.796 0.983 0.966 0.892 0.758
rs1934179 0.415 0.870 0.848 0.521 0.940 0.851 0.984 0.913 0.774
rs4554617 0.406 0.827 0.802 0.512 0.896 0.835 0.954 0.942 0.805
rs4826634 0.131 0.283 0.300 0.203 0.247 0.295 0.266 0.291 0.740
rs7063116 0.276 0.513 0.503 0.366 0.638 0.498 0.590 0.627 0.178
Table 4. Linkage disequilibrium between markers of the DGKK gene in the control samples.
Association of the DGKK gene with hypospadias–Hozyasz et al.
Pediatric Urology 274
Vol 15 No 05 September-October 2018 275
DISCUSSION
Identifying the major genetic alternations leading to
hypospadias will have an impact on genetic counsel-
ling and will lead to a greater understanding of the male
urinary tract development. Our study builds on previ-
ous publications which have reported that the genetic
susceptibility of hypospadias may be associated with
common variants of the DGKK gene(5-8). In our mo-
no-ethnic sample, the DGKK haplotypes were found
to be strongly associated with hypospadias and provid-
ed further evidence that DGKK may be an important
disease-promoting gene(10,11,15,16). The high odds ratios
and level of significance provide compelling support
for the observed haplotypes associations, despite the
small numbers of participants. For the two investigat-
ed SNPs (rs4826634 and rs7063116), in the presented
Polish sample of patients, evidence of association with
hypospadias was found only using haplotypes testing.
The lack of association in the single marker analysis
may be attributed to a lack of power, secondary to small
sample size. An alternative explanation might be that
the analyzed variants do not target the causal variant in
the Polish population adequately, due to the presence
of differing haplotypic structures in specific mono-eth-
nic populations(4,10,15). In accordance with our study,
Carmichael et al.(7) have previously found evidence of
association between two blocks of DGKK haplotypes
and the hypospadias risk in Californian population. In
their study, an 8-SNPs block contained rs12171755,
rs19341179 and rs19341179, which were also associat-
ed with increased risk of being born with hypospadias
in the Polish population. In contrast to our results, Ma
et al.(8) did not observe the association between DGKK
haplotypes and hypospadias susceptibility in the Han
Chinese population. However, a very recent study by
Xie et al.(17) from China, similarly to our results, showed
strong association of haplotypes including rs4554617
with the susceptibility to hypospadias. These findings
support the assumption that the functional variants as-
sociated with these risky SNPs of DGKK are likely to
be regulatory in nature. More in-depth investigations
are necessary to explore the functional and mechanistic
Table 5. Haplotype analysis of SNPs genotyped in the DGKK gene.
Omnibus haplotype test Frequency
Polymorphisms p-value Corrected p-valuea Haplotype Cases Controls Odds Ratiob p-valuec
2-marker window
rs4074320_rs4143304 .0561 .2777
rs4143304_rs11091748 .0017 .0150 C-A 0.466 0.620 Referent
T-G 0.522 0.376 1.84 (1.39 - 2.44) < 0.0001
C-G 0.012 0.004 4.29 (0.78 - 23.68) .0883d
rs11091748_rs17328236 .0084 .0440 A-A 0.466 0.616 Referent
G-G 0.391 0.270 1.92 (1.41 - 2.61) < 0.0001
G-A 0.143 0.114 1.66 (1.08 - 2.55) .0208
rs17328236_rs12171755 .0134 .0719
rs12171755_rs1934183 .0210 .1089
rs1934183_rs1934179 .0142 .0749
rs1934179_rs4554617 .0004 .0070 C-A 0.459 0.627 Referent
T-C 0.446 0.362 1.68 (1.26 - 2.25) .0004
C-C 0.044 0.007 8.507 (2.75 - 26.29) < 0.0001d
T-A 0.051 0.004 19.444 (4.41 - 85.68) < 0.0001d
rs4554617_rs4826634 .0502 .2418
rs4826634_rs7063116 .0568 .2867
3-marker window
rs4074320_rs4143304_rs11091748 .0241 .1149
rs4143304_rs11091748_rs17328236 .0104 .0559
rs11091748_rs17328236_rs12171755 .0130 .0709
rs17328236_rs12171755_rs1934183 .0201 .1019
rs12171755_rs1934183_rs1934179 .0290 .1469
rs1934183_rs1934179_rs4554617 .0023 .0180 T-C-A 0.442 0.591 Referent
G-T-C 0.430 0.364 1.58 (1.17 - 2.13) .0026
G-C-A 0.019 0.030 0.85 (0.32 - 2.21) .7357
G-T-A 0.051 0.004 18.09 (4.10 - 79.77) < 0.0001d
G-C-C 0.039 0.004 13.56 (2.99 - 61.45) < 0.0001d
T-T-C 0.013 0.004 4.52 (0.82 0 24.99) .0785d
rs1934179_rs4554617_rs4826634 .0397 .1928
rs4554617_rs4826634_rs7063116 .1930 .7243
4-marker window
rs4074320_rs4143304_rs11091748_rs17328236 .0394 .1928
rs4143304_rs11091748_rs17328236_rs12171755 .0187 .0959
rs11091748_rs17328236_rs12171755_rs1934183 .0741 .3526
rs17328236_rs12171755_rs1934183_rs1934179 .0377 .1808
rs12171755_rs1934183_rs1934179_rs4554617 .0076 .0430 C-T-C-A 0.438 0.591 Referent
T-G-T-C 0.431 0.349 1.67 (1.23 - 2.26) .0008
C-G-C-A 0.020 0.030 0.87 (0.33 - 2.28) .7816
C-G-T-C 0.007 0.015 0.58 (0.12 - 2.78) .7302d
T-G-T-A 0.046 0.004 16.30 (3.65 - 72.73) < 0.0001d
C-G-C-C 0.013 0.004 4.66 (0.84 - 25.74) .0734d
T-T-T-C 0.013 0.004 4.66 (0.84 - 25.74) .0734d
T-G-C-C 0.020 0.000 20.91 (1.12 - 391.39) .0086d
rs1934183_rs1934179_rs4554617_rs4826634 .0985 .4555
rs1934179_rs4554617_rs4826634_rs7063116 .0509 .2428
Detailed haplotype analysis was presented only for SNP combinations with statistically significant Omnibus test p-values.
ap-value calculated using permutation test and a total of 1,000 permutations.
bThe most common haplotype was used as the reference.
cChi-square test.
dFisher exact test.
Association of the DGKK gene with hypospadias–Hozyasz et al.
role of DGKK in the male urinary system. Rigorously
establishing the genetic risk for any multifactorial dis-
order is important but inherently difficult(4,10).
CONCLUSIONS
Our study represents a step forward in understanding
the genetic basis of isolated hypospadias. The study pro-
vides strong evidence of an association of DGKK hap-
lotypes with the susceptibility to hypospadias. Further
testing in independent populations and meta-analyses
are needed to clarify the role of nominally significant
polymorphic variants of the DGKK gene association
with hypospadias.
ACKNOWLEDGMENTS
We want to thank numerous families for their generous
participation in our study that made this research possi-
ble. This work was supported by grant No. 510-06-53
from Institute of Mother and Child, Warsaw, Poland.
CONFLICT OF INTEREST
The authors state that there are no conflicts of interest
regarding the publication of this article.
REFERENCES
1. George M, Schneuer FJ, Jamieson SE, Holland
AJ. Genetic and environmental factors in the
aetiology of hypospadias. Pediatr Surg Int.
2015; 31: 519-27.
2. Gite VA, Nikose JV, Bote SM, Patil SR.
Anterior urethral advancement as a single-
stage technique for repair of anterior
hypospadias: our experience. Urol J. 2017;14:
4034-37.
3. Kalfa N, Paris F, Philibert P, et al. Is
hypospadias associated with prenatal
exposure to endocrine disruptors? A French
collaborative controlled study of a cohort of
300 consecutive children without genetic
defect. Eur Urol. 2015; 68:1023-30.
4. Choudhry S, Baskin LS, Lammer EJ, et al.
Genetic polymorphisms in ESR1 and ESR2
genes and risk of hypospadias in a multiethnic
study population. J Urol. 2015;193:1625-31.
5. van der Zanden LF, van Rooij IA, Feitz WF,
et al. Common variants in DGKK are strongly
associated with risk of hypospadias. Nat
Genet. 2011;43: 48-50.
6. Geller F, Feenstra B, Carstensen L, et al.
Genome-wide association analyses identify
variants in developmental genes associated
with hypospadias. Nat Genet. 2014;46:957-
63.
7. Carmichael SL, Mohammed N, Ma C, et
al. Diacylglycerol kinase k variants impact
hypospadias in a California study population.
J Urol. 2013;189: 305-11.
8. Ma Q, Tang Y, Lin H, et al. Diacylglycerol
kinase k (DGKK) variants and hypospadias in
Han Chineses: association and meta-analysis.
BJU Int. 2015;116: 634-640.
9. Shionoya T, Usuki T, Komenoi S, Isozaki
T, Sakai H, Sakane F. Distinct expression
and localization of the type II diacylglycerol
kinase isozymes δ, η and κ in the mouse
reproductive organs. BMC Dev Biol. 2015;15:
6.
10. Wu C, Li S, Cui Y. Genetic association
studies: an information content perspective.
Curr Genom. 2012;13: 566-73.
11. Palmsten K, Chambers CD. Hypospadias: one
defect, multiple causes, acting through shared
pathways. Curr Epidemiol Rep. 2015; 2: 13-
22.
12. Polat H, Gulacti U. The ideal use of catheters
in hypospadias repair: An experimental study.
Urol J. 2016; 13: 2856-9.
13. Shen J, Liu B, Sinclair A, Cunha G, Baskin
LS, Choudhry S. Expression analysis of
DGKK during external genitalia formation. J
Urol. 2015; 194:1728-36.
14. Snodgrass WT, Bush NC. Hypospadias. In:
Snodgrass WT, editor. Pediatric Urology.
Evidence for Optimal Patient Management.
New York: Springer; 2013. p.117-52.
15. Liu N, Zhang K, Zhao H. Haplotype-
association analysis. Adv Genet. 2008; 60:
335-405.
16. Clark AG. The role of haplotypes in candidate
gene studies. Genet Epidemiol. 2004; 27: 321-
33.
17. Xie H, Lin X-L, Zhang S, et al. Asssociation
between diacylglycerol kinase kappa variants
and hypospadias susceptibility in a Han
Chinese population. Asian J Androl. 2017;
doi: 10.4103/aja.aja_13_17.
Association of the DGKK gene with hypospadias–Hozyasz et al.
Pediatric Urology 276