181

Veterinaria Italiana 2021, 57 (3), 181-188. doi: 10.12834/VetIt.2269.13773.1
Accepted: 25.09.2020  |  Available on line: 31.12.2021

1Department of Pathobiology, Faculty of Veterinary Medicine, Ferdowsi University of Mashhad, Mashhad, Iran.
2Department of Pathobiology, Faculty of Veterinary Medicine,

Islamic Azad University- Garmsar branch, Garmsar, Iran.
3Department of Microbiology and Immunology, Kashan University of Medical Sciences, Kashan, Iran.

4Department of Pathobiology, Faculty of Veterinary Medicine, Shahid Bahonar University of Kerman, Kerman, Iran.
5Department of Avian Diseases, Faculty of Veterinary Medicine, University of Tehran, Tehran, Iran.

*Corresponding author at: Department of Pathobiology, Faculty of Veterinary Medicine, Ferdowsi University of Mashhad, Mashhad, Iran.
Tel.: +98 51 3880 5642, e-mail: askari.m@um.ac.ir.

Mahdi Askari Badouei1*, Hossein Vaezi2, Ali Nemati1, Ehsan Ghorbanyoon2,
Farzaneh Firoozeh3, Maziar Jajarmi4 and Seyed Mostafa Peighambari5

Keywords
Salmonella Infantis,
Integron,
Broiler,
Resistance.

Summary
The poultry industry in Iran is the main supplier of protein in the food chain. In the present 
study, we showed the importance of the possible dissemination of clonally related multiple 
drug resistant (MDR) Salmonella Infantis in broiler farms in Iran. In total, 156 fecal samples 
belonging to 23 poultry farms in Razavi Khorasan province, northeast of Iran, were examined 
for the presence of Salmonella serovars. Molecular serotypes and serogroups, class 1 and 
2 integron types, colistin resistance genes (mcr-1 and mcr-2) and antimicrobial susceptibility 
patterns were determined on the recovered Salmonella isolates. Based on PCR analysis, 
30 recovered Salmonella isolates were identified as S. Infantis (23 isolates; 76.6%), S. Enteritidis 
(six isolates; 20%), and one isolate (3.3%) was not serotyped by the applied method. Class 1 
integrons were detected in 22 isolates (95.6%) and class 2 integrons were not detected in 
any of the isolates. Although colistin resistance was prevalent in disc diffusion test, mcr-1 
and mcr-2 genes were not detected. All class 1 integrons carried the cassette aadA1 gene. 
All Salmonella isolates were resistant to colistin and amoxicillin/clavulanic acid and MDR 
patterns were observed in most (96.6%) isolates. This study revealed a high prevalence 
rate of S. Infantis and the presence of class 1 integrons in broiler farms. The presence of the 
same integron cassettes in the sequenced isolates suggests that strains are clonally related. 
Stringent monitoring programs are required to prevent the spreading of MDR Salmonella 
serovars into food chain via poultry products. 

High prevalence of clonally related multiple resistant 
Salmonella Infantis carrying class 1 integrons

in broiler farms 

In these farms, antibiotics are used therapeutically, 
prophylactically or for growth promotion purposes 
(Mehdi et  al. 2018). The extensive use of these 
antibiotics has led to a significant increase in the 
distribution of multidrug-resistant (MDR) Salmonella 
strains in foods. Likewise, these MDR strains can be 
transmitted to humans through the food chain, 
or direct contact with poultry and their houses 
(Marshall and Levy 2011).

Salmonellosis is one of the most important bacterial 
foodborne diseases in both developed and 
developing countries such as Iran (Aziz et  al. 2018). 
Human salmonellosis is commonly associated with 

Introduction
Antimicrobial resistance has become a worldwide 
public health problem that has a direct impact 
on food safety (Shabana et  al. 2019). The use of 
antimicrobials has been beneficial for the producers 
to control and treat Salmonella in the food industry 
(Threlfall 2002). However, the overuse of antimicrobial 
agents, especially in the poultry farms, leads to the 
emergence and spread of antibiotic-resistant strains 
(Threlfall 2002, Irani et al. 2018).

In recent years, Salmonella species were recognized 
as a serious and problematic foodborne pathogen in 
poultry farms on a global level (Antunes et al. 2016). 



182 Veterinaria Italiana 2021, 57 (3), 181-188. doi: 10.12834/VetIt.2269.13773.1

MDR Salmonella Infantis in Iranian broiler farms Badouei et al.

Co., Germany) and incubated at 37  °C for 24-48  h. 
Suspected colonies were cultured into the TSI agar 
(Merck Co., Germany) and incubated at 37  °C for 
24  h. Finally, the lactose-negative and H

2
S positive 

isolates were examined using standard biochemical 
tests (Markey et al. 2013).

Salmonella serogrouping
Salmonella serogroups were determined by slide 
agglutination using antisera against O antigen 
according to the manufacturer's instructions (Bahar 
Afshan, Iran).

Molecular detection of Salmonella 
serovars
The DNA of Salmonella isolates was extracted by 
using the boiling method as described previously 
(Badouei et  al. 2015). Then, the polymerase chain 
reaction (PCR) was performed to confirm the 
biochemical identification of the isolates at the 
genus level using S139 and S141 primers which 
target invA gene (Zahraei Salehi et  al. 2013). A 
multiplex-PCR assay for molecular detection of 
five important Salmonella serovars including 
S. Infantis, S. Heidelberg, S. Gallinarum, S. Enteritidis, 
and S.  Kentucky was performed on all confirmed 
isolates as described previously (Kardos et  al. 2007, 
Zhu et  al. 2015). When Salmonella serovars was not 
identified in the multiplex-PCR, a two-step nested 
PCR approach was used for molecular identification 
of S.  Infantis (Kardos et  al. 2007). Twenty-five μl 
final reaction volume including 3 μl DNA extract, 
0.3 μM of each primer (Table I), 12.5 µl 2x Taq DNA 
Polymerase Master Mix RED (Ampliqon, Denmark) 
and distilled water up to volume of reaction was 
used in all PCR reactions. The PCR conditions were 
adjusted on the basis of cited references for each 
assay (Kardos et al. 2007, Zhu et al. 2015). For positive 
controls, S.  Infantis (Collection isolate, University of 
Tehran), and S. Enteritidis (ATCC: 13076) were used.

Detection of class 1 and 2 integrons and 
colistin resistance genes
The presence of gene cassettes containing class 1 
and 2 integrons were detected by two PCR assays 
(Table I). All Salmonella isolates were screened for 
the detection of most prevalent plasmid-mediated 
colistin resistance genes (mcr-1 and mcr-2) using 
two PCR assays with specific primers (Table I). 
This reaction was conducted in 25 μl volumes 
based on the protocol described by Barbieri and 
colleagues (Barbieri et  al. 2017). All PCR products 
were electrophoresed on 2% agarose gel at 100  V 
for 1  h with ethidium bromide and visualized by 
GelDoc 1000 (Vilber Lourmat, France). 

the consumption of contaminated poultry and its 
products. In most cases, the disease is caused by 
eating raw or undercooked poultry, eggs or egg 
products (El-Prince et al. 2019). Nowadays, high rates 
of MDR Salmonella strains are represented as a major 
threat to public health in Iran (Nirmala et al. 2018). 

In many countries, Salmonella Infantis has been 
mentioned as a cause of food-borne zoonotic 
pathogen among serovars of Salmonella enterica  
(Merino et  al. 2003, Zhao et  al. 2017, Borowiak 
et  al. 2018, Wajid et  al. 2019). In Iran, many studies 
show that Salmonella Infantis serovar is an 
important public health issue and has become a 
serious problem for the medical and veterinary 
communities (Firoozeh et  al. 2011, Firoozeh et  al. 
2014, Peighambari et  al. 2018). Poultry, especially 
broilers, are known as one of the main reservoirs for 
S. Infantis in Iran (Rahmani et al. 2013). 

Today, S.  Infantis like other Salmonella serovars is 
becoming resistant to key antimicrobials such as the 
fluoroquinolones and broad-spectrum β-lactams 
(Gupta et al. 2019). Antibiotic resistance genes, play a 
major role in the evolution of MDR Salmonella strains 
that can be located on chromosomes, plasmids, 
transposons or integrons (Almeida et  al. 2018). The 
distribution of MDR Salmonella strains is mainly 
related to integrons (Kaushik et  al. 2018). Integrons 
are genetic elements that are able to capture 
antibiotic resistance genes and spread them among 
sensitive strains, so they have a fundamental role in 
the emergence of MDR Salmonella strains (Gillings 
et al. 2008, Kaushik et al. 2018). Integrons consist of 
two major types including chromosomal integrons 
and mobile integrons (MIs). MIs are divided into 
five classes (Class 1 to 5) and class 1 integron has 
been the most commonly reported class in MDR 
Salmonella strains (Gillings et al. 2008, Kaushik et al. 
2018, Hossain et al. 2019).

The present study was conducted to investigate the 
prevalence, distribution, antimicrobial resistance 
patterns and recognition of class 1 and 2 integrons 
among Salmonella serovars from broiler chicken 
farms in Khorasan Razavi province, Iran.

Materials and methods

Isolation and identification of 
Salmonella
A total of 156 fecal samples were collected from 
23  poultry farms in Khorasan Razavi province, Iran, 
from September 2013 to October 2013. All samples 
were transferred to Selenite F broth (Merck Co., 
Germany) and incubated at 37 °C for 16 h. A loopful of 
the enriched samples were cultured on MacConkey 
agar (Merck Co., Germany) and XLD agar (Merck 



183Veterinaria Italiana 2021, 57 (3), 181-188. doi: 10.12834/VetIt.2269.13773.1

Badouei et al. MDR Salmonella Infantis in Iranian broiler farms

Sequencing of integron class 1
PCR products of class 1 integron of Salmonella strains 
belonging to eight geographically separated farms 
were sequenced by Sanger dideoxy sequencing 
(Seoul, South Korea) using the amplification primers. 
The sequences were compared and analyzed by 
Chromas Pro version 1.7.5 Technelysium as well as 
online BLAST software (http://www.ncbi.nlm.nih.
gov/BLAST/) and Integron Database INTEGRALL 
(http://integrall.bio.ua.pt/). To confirm the results of 
detection of class 1 integrons, all positive isolates 
(possess class 1 integrons) were compared to 
available whole genome sequencing data.

Antimicrobial susceptibility test
The susceptibility of 30 Salmonella isolates to a panel 
of 27 antimicrobial agents was determined by the 
agar disc diffusion method and the interpretation 
of results was carried out according to the Clinical 
and Laboratory Standards Institute (CLSI) guidelines 
(Jorgensen et al. 2007, Reller et al. 2009, CLSI 2018). The 
antimicrobial agents tested and their concentrations 
(μg) were: amoxicillin/clavulanic acid (AMC; 
20/10  µg), amoxicillin (AMX; 10  µg), cefixime (CFM; 

5 µg), ceftriaxone (CRO; 30 µg), cefazolin (CFZ; 30 µg), 
chloramphenicol (CHL; 30 µg), chlortetracycline (CTC; 
30 µg), ciprofloxacin (CIP; 5 µg), colistin (CST; 10 µg), 
difloxacin (DIFL; 10  µg), doxycycline (DOX; 30 µg), 
enrofloxacin (ENR; 5 µg), florfenicol (FLOR; 30 µg), 
flumequine (FLU; 30 µg), fosfomycin (FOF; 200 µg), 
furazolidone (FZD; 100 µg), gentamicin (GEN; 10 µg), 
kanamycin (KAN; 30 µg), linco-spectin (LP; 15/200 µg), 
nalidixic acid (NAL; 30 µg), neomycin (NEO; 30 µg), 
nitrofurantoin (NIT; 300 µg), norfloxacin (NOR; 10 µg), 
oxytetracycline (OTC; 30 µg), streptomycin (STR; 
10  µg), tetracycline (TET; 30 µg), and trimethoprim/
sulfamethoxazole (SXT; 1.25/23.75 µg). Each 
Salmonella isolate which were resistant to at least one 
antibiotic in three or more antimicrobial classes were 
designated as MDR isolates. 

Results

Prevalence of Salmonella spp. and 
serovars
In total, out of 156 fecal samples tested, 30 (19.2%) 
Salmonella isolates were recovered. In 23 broiler 
farms in Khorasan Razavi province Salmonella 

Table I. List of primers which were used in this study.

Target Primer Sequence (5´ to 3´) Size (bp) Reference

S. enterica
S139 GTGAAATTATCGCCACTGTCGGGCAA

218 Zahraei Salehi et al. 2013
S141 TCATCGCACCGTCAAAGGAACC

S. Infantis

558f AACAACGACAGCTTATGCCG

Variable Kardos et al. 2007878f TTGCTTCAGCAGATGCTAAG

1275r CCACCTGCGCCAACGCT

S. Heidelberg
heli-F ACAGCCCGCTGTTTAATGGTG

782 Zhu et al. 2015
heli-R CGCGTAATCGAGTAGTTGCC

S. Gallinarum biotype Gallinarum
steB-F TGTCGACTGGGACCCGCCCGCCCGC

636 Zhu et al. 2015
steB-R CCATCTTGTAGCGCACCAT

S. Gallinarum
rhs-F TCGTTTACGGCATTACACAAGTA

402 Zhu et al. 2015
rhs-R CAAACCCAGAGCCAATCTTATCT

S. Enteritidis
sdf-F TGTGTTTTATCTGATGCAAGAG

293 Zhu et al. 2015
sdf-R CGTTCTTCTGGTACTTCAGATGAC

S. Kentucky
gly- F TTCCAATTGAAACGAGTGCGG

170 Zhu et al. 2015
gly-R ACTAACCGCTTGGGTTGTTGCTGT

Class 1 integron
5´-CS GGCATCCAAGCAGCAAG

Variable Firoozeh et al. 2019
3´- CS AAGCAGACTTGACCTGA

Class 2 integron
hep74 CGGGATCCCGGACGGCATGCACGATTTGTA

Variable Firoozeh et al. 2019
hep51 GATGCCATCGCAAGTACGAG

mcr-1
CLR5-F CGGTCAGTCCGTTTGTTC

309 Barbieri et al. 2017
CLR5-R CTTGGTCGGTCTGTAGGG

mcr-2
MCR2-IF TGTTGCTTGTGCCGATTGGA

567 Barbieri et al. 2017
MCR2-IR AGATGGTATTGTTGGTTGCTG



184 Veterinaria Italiana 2021, 57 (3), 181-188. doi: 10.12834/VetIt.2269.13773.1

MDR Salmonella Infantis in Iranian broiler farms Badouei et al.

the main reservoirs for human salmonellosis. Our 
study showed that prevalence of Salmonella  spp. 
were increased dramatically in poultry farms during 
2013-2014 in Iran; S. Infantis had the most significant 
role in the contamination of broiler farms. Similarly, 
other studies from different regions of Iran have 

serovars were detected in nine farms (39.1%). 
The Kauffman-White group serotyping showed 
that 23  Salmonella isolates (76.6%) belonged to 
serogroup C (S. Infantis), six isolates (20%) belonged 
to serogroup D (S. Enteritidis), and one isolate (3.3%) 
belonged to serogroups other than A-D. Based on 
PCR analysis, among the 30 Salmonella isolates, 
23 isolates were identified as S. Infantis (76.6%) which 
belonged to six different farms, and six isolates were 
identified as S.  Enteritidis (20%) which belonged to 
five different farms, and one isolate (3.3%) was not 
serotyped by PCR.

Class 1 and 2 integrons and colistin 
resistance genes
The class 1 integron was detected in 22/23 (95.6%) 
S.  Infantis isolates. Among the seven S.  Enteritidis 
isolates, class 1 integrons were identified only in 
one isolate (14.2%). The Class 2 integrons were not 
detected in any of the obtained Salmonella isolates. 
Also, the mcr-1 and mcr-2 genes were not detected 
in any of the 30 Salmonella isolates.

Sequencing analysis
Analysis of DNA sequencing results revealed that 
all sequenced isolates harbored an integron class 1 
carrying one gene cassette including aadA1 gene.

Phenotypic antimicrobial resistance
Out of 30 Salmonella isolates, all (100%) of S. Infantis 
and S.  Enteritidis isolates were susceptible to 
cefixime, gentamicin, ceftriaxone, norfloxacin, and 
fosfomycin. Also, 96.6% of isolates were susceptible 
to amoxicillin and ciprofloxacin. All isolates (100%) 
were resistant to colistin and amoxicillin/clavulanic 
acid and 93.3% of isolates were resistant to 
nitrofurantoin and oxytetracycline. MDR patterns 
were observed in 29 isolates (96.6%). The details of 
phenotypic resistance to antimicrobials have been 
presented in Table II and Table III. 

Discussion
Poultry are one of the most important carriers 
of Salmonella, which carry the bacterium 
asymptomatically and shed it to the environment 
through their feces (Akbarian et  al. 2010, Jajere 
2019). This bacterium can survive for a long time 
in the environment and may be transmitted to 
human through the consumption of contaminated 
avian meat and egg products (VT Nair et  al. 2018); 
salmonellosis is one of the most common foodborne 
diseases in humans worldwide. 

In many countries, poultry and its products are 

Table II. Resistance (number and percentage) of recovered Salmonella 
isolates from broilers in Khorasan Razavi province, Iran.

Antimicrobial 
agent

S. Infantis
(n = 23)

S. Enteritidis
(n = 6)

Other 
serovars
(n = 1)

Total
(n = 30)

β- Lactams antibiotics:
Penam penicillins:
Amoxicillin/
clavulanic acid 23 (100.0) 6 (100.0) 1 (100.0) 30 (100.0)

Amoxicillin 0 (0.0) 1 (16.6) 0 (0.0) 1 (3.3)
Cephalosporins:
First generation:
Cefazolin 3 (13.0) 0 (0.0) 1 (100.0) 4 (13.3)

Third generation:
Cefixime 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0)
Ceftriaxone 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0)

Polymyxins:
Colistin 23 (100.0) 6 (100.0) 1 (100.0) 30 (100.0)

Aminoglysides:
Gentamicin 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0)
Kanamycin 13 (56.5) 0 (0.0) 1 (100.0) 14 (46.6)
Neomycin 14 (60.8) 0 (0.0) 1 (100.0) 15 (50.0)
Streptomycin 13 (56.5) 0 (0.0) 1 (100.0) 14 (46.6)

Phenicols:
Chloramphenicol 6 (26.0) 2 (33.3) 0 (0.0) 8 (26.6)
Florfenicol 7 (30.4) 1 (16.6) 0 (0.0) 8 (26.6)

Tetracyclines:
Tetracycline 22 (95.6) 2 (33.3) 0 (0.0) 24 (80.0)
Chlortetracycline 23 (100.0) 0 (0.0) 1 (100.0) 24 (80.0)
Doxycycline 23 (100.0) 3 (50.0) 0 (0.0) 26 (86.6)
Oxytetracycline 23 (100.0) 5 (83.3) 0 (0.0) 28 (93.3)

Sulfonamides:
Trimethoprim/
sulfamethoxazole 20 (86.9) 0 (0.0) 1 (100.0) 21 (70.0)

Quinolones:
Nalidixic acid 23 (100.0) 3 (50.0) 0 (0.0) 26 (86.6)

Fluoroquinolones:
Ciprofloxacin 1 (4.3) 0 (0.0) 0 (0.0) 1 (3.3)
Difloxacin 0 (0.0) 0 (0.0) 1 (100.0) 1 (3.3)
Enrofloxacin 0 (0.0) 0 (0.0) 1 (100.0) 1 (3.3)
Flumequine 15 (65.2) 0 (0.0) 1 (100.0) 16 (53.3)
Norfloxacin 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0)

Others:
Fosfomycin 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0)
Furazolidone 22 (95.6) 0 (0.0) 1 (100.0) 23 (76.6)
Linco-spectin 23 (100.0) 0 (0.0) 1 (100.0) 24 (80.0)
Nitrofurantoin 23 (100.0) 5 (83.3) 0 (0.0) 28 (93.3)

Total 23 (51.5) 6 (20.9) 1 (48.1) 30 (45.2)



185Veterinaria Italiana 2021, 57 (3), 181-188. doi: 10.12834/VetIt.2269.13773.1

Badouei et al. MDR Salmonella Infantis in Iranian broiler farms

Integrons are genetic elements that contain a 
site to integrate a segment of DNA that could be 
disseminated the antimicrobial-resistant genes using 
a mobile genetic element (MGE) such as plasmids 
and transposons among Salmonella spp. The class 
1 integron has been the most extensively reported 
class in the dissemination of resistance genes in 
Salmonella spp. (Kaushik et  al. 2018). Interestingly, 
class 1 integrons were detected in most of our 
S.  Infantis isolates and class 2 integrons were not 
detected in any of the studied isolates. These results 
are in accordance with a nother study conducted 
in Iran (Rahmani et  al. 2013). The class 1 integron 
seems to be an important player in dissemination 
of resistant factors among S.  Infantis strains in the 
broiler farms in Iran. Importantly, the carriage of the 
same cassette (aadA1) within the class 1 integron in 
eight isolates from different farms strongly suggests 
the presence of the clonally related S.  Infantis in 
poultry farms in northeast of Iran. 

Based on phenotypic antimicrobial susceptibility 
examination of Salmonella isolates in the present 
study, all S. Infantis isolates were resistant to colistin, 
amoxicillin/clavulanic acid, chlortetracycline, 
doxycycline, oxytetracycline, nalidixic acid, 
linco-spectin, and nitrofurantoin. Also, all of 
them were susceptible to amoxicillin, cefixime, 

reported that S. Infantis had the highest frequency of 
contamination in broiler farms in the same time frame 
(Fallah et  al. 2013, Rahmani et  al. 2013). In a study 
conducted in northern provinces of Iran, Rahmani 
and colleagues showed that out of 36  Salmonella 
isolates, 75% (n  =  27) and 25% (n  =  9) were 
identified as S. Infantis and S. Enteritidis, respectively 
(Rahmani et  al. 2013). Fallah and colleagues 
reported that out of 44 Salmonella isolates, 79.5% 
(n = 34) were identified as S. Infantis; the remaining 
18.2% (n  =  8) and 2.3% (one strain) belonged to 
serogroup D and serogroup  C, respectively (Fallah 
et  al. 2013). However, in other studies conducted 
by Ezzat Panah and colleagues and Asad Poor and 
colleagues in Iran, it was showed that S.  Enteritidis 
had the highest rate (45.3% and 75%, respectively) 
in broiler farms (Ezatpanah et  al. 2013, Asadpour 
et  al. 2014). Different results have been obtained in 
other countries; in Colombia, Canada, and Spain, 
S.  Paratyphi B variant Java (76%), Salmonella Hadar 
(40.4%), and S.  Enteritidis (79.6%) were the most 
prevalent serovars, respectively (Carramiñana et  al. 
2004, Donado-Godoy et al. 2012, Mainali et al. 2014). 
These differences with our study may be related 
to several factors such as geographical locations, 
sample selection criteria and hygiene level of broiler 
farms (Firouzabadi et al. 2020).

Table III. Resistance patterns of Salmonella serovars isolated from broilers in Khorasan Razavi province, Iran.

Resistance patternsa S. Infantis S. Enteritidis Other serovars Total
LP-C-TE-CP-K-NA-FR-FM300-SXT-N-CL-D-FM30-S-AMC-FF-CTE-T 1 -b - 1

LP-C-TE-K-NA-FR-FM300-SXT-N-CL-D-FM30-S-AMC-FF-CTE-T 2 - - 2

LP-C-TE-K-NA-FR-FM300-SXT-N-CL-D-S-AMC-FF-CTE-T 1 - - 1

LP-TE-NA-FR-FM300-CL-D-FM30-AMC-CTE-T 3 - - 3

LP-TE-NA-FR-FM300-CL-D-SXT-AMC-CTE-T 4 - - 4

CL-AMC - 1 - 1

TE-FM300-CL-D-AMC-T - 1 - 1

LP-C-TE-NFX-K-NA-FR-FM300-SXT-N-CL-D-FM30-S-AMC-DF-CTE-T - - 1 1

LP-TE-K-NA-FR-FM300-SXT-N-CL-D-S-AMC-CTE-T 2 - - 2

LP,-TE-K-NA-FR-FM300-SXT-N-CL-D-FM30-S-AMC-CTE-T 5 - - 5

LP-TE-K-NA-FR-FM300-SXT-N-CL-D-FM30-S-AMC-CTE-T 1 - - 1

LP-TE-K-NA-FR-FM300-SXT-N-CL-D-FF-S-AMC-CTE-T 1 - - 1

C-NA-CL-AMC-FF-T-AMX - 1 - 1

LP-TE-NA-FR-FM300-SXT-N-CL-D-FM30-AMC-CTE-T 1 - - 1

NA-FM300-CL-AMC - 1 - 1

LP-C-TE-NA-FR-FM300-SXT-CL-D-FM30-AMC-FF-CTE-T 1 - - 1

FM300-CL-AMC-T - 1 - 1

LP-C-NA-FR-FM300-SXT-CL-D-FM30-AMC-FF-CTE-T 1 - - 1

FM300-CL-D-AMC-T - 1 - 1

Total 23 6 1 30
aAntimicrobial agent tested were Amoxicillin/clavulanic acid (AMC), Amoxicillin (AMX), Cefazolin (CEZ), Chloramphenicol (C), Chlortetracycline (CTE), Ciprofloxacin (CP), Colistin (CL), 
Difloxacin (DF), Doxycycline (D), Enrofloxacin (NFX), Florfenicol (FF), Flumequine (FM30), Furazolidone (FR), Kanamycin (K), Linco-spectin (LP), Nalidixic acid (NA), Neomycin (N), 
Nitrofurantoin (FM300), Oxytetracycline (T), Streptomycin (S), Tetracycline (TE), Trimethoprim/sulfamethoxazole (SXT).
bNo resistance pattern detected.



186 Veterinaria Italiana 2021, 57 (3), 181-188. doi: 10.12834/VetIt.2269.13773.1

MDR Salmonella Infantis in Iranian broiler farms Badouei et al.

S.  Infantis and a strong association between MDR 
patterns and the presence of class 1 integrons in 
broiler farms by 2013-2014 in Khorasan Razavi 
Province, Iran. Colistin resistance is a major concern 
because it is the latest treatment of bacterial 
infection caused by gram-negative bacteria with 
MDR and carbapenem resistance in humans. All 
integrons carried the same gene cassette, which 
indicates that they were clonally related strains 
which spreaded via a possible common source. 
The results of the present research highlight the 
uncontrolled use of antibiotics in broiler farms that 
may cause the emergence of MDR Salmonella strains 
in broiler products. Therefore, there are an emerging 
need for systematic monitoring and characterizing 
MDR Salmonella serovars in poultry industry in order 
to prevent the spread to food chain and humans. 

Acknowledgments
The authors would like to express their gratitude 
to Dr. Adriana Cabal (VISAVET health surveillance 
center, Spain) who kindly provided the positive 
control strains for colistin resistance genes. 

ceftriaxone, gentamicin, difloxacin, enrofloxacin, 
norfloxacin, and fosfomycin. Besides, MDR patterns 
were observed in all of S. Infantis isolates (100%). In 
Rahmani and colleagues (Rahmani et  al. 2013), and 
Asadpour and colleagues (Asadpour et  al. 2014) 
studies, most of S.  Infantis strains were resistant 
to tetracycline, spectinomycin, streptomycin, 
sulfamethoxazole, nalidixic acid, and nitrofurantoin; 
also they observed MDR patterns in 92% of S. Infantis 
isolates which are similar to our findings. In total, our 
results and also studies of Ezatpanah and colleagues 
(Ezatpanah et  al. 2013), Asadpour and colleagues 
(Asadpour et  al. 2014), Chung and colleagues 
(Chung et al. 2003), and Carramiñana and colleagues 
(Carramiñana et  al. 2004), showed that Salmonella 
isolates are highly sensitive to gentamicin and 
highly resistant to tetracycline. Interestingly, in this 
study, despite observing a high level of phenotypic 
resistance to colistin, none of the isolates carried the 
studied resistance genes, mcr-1 and mcr-2. It seems 
that screening for other types of mcr genes should 
be considered for future studies on Salmonella 
strains in Iran. 

This study revealed a high prevalence rate of 



187Veterinaria Italiana 2021, 57 (3), 181-188. doi: 10.12834/VetIt.2269.13773.1

Badouei et al. MDR Salmonella Infantis in Iranian broiler farms

Akbarian R., Peighambari S.M., Morshed R. & Yazdani A. 
2010. Survey of Salmonella infection in Iranian poultry 
flocks. Int J Vet Res, 4, 273-276.

Almeida F., Seribelli A.A., Medeiros M.I.C., Rodrigues D.D.P., 
de MelloVarani A., Luo Y., Allard M.W. & Falcão J.P. 2018. 
Phylogenetic and antimicrobial resistance gene analysis 
of Salmonella Typhimurium strains isolated in Brazil by 
whole genome sequencing. PLoS One, 13, e0201882.

Antunes P., Mourão J., Campos J. & Peixe L. 2016. 
Salmonellosis: the role of poultry meat. Clin Microbiol 
Infect, 22, 110-121.

Asadpour Y., Mohammadi M., Pourbakhsh S.A. & Rasa M. 
2014. Isolation, serotyping and antibiotic resistance of 
Salmonella isolated from chicken carcasses in Guilan 
province. Iran Vet J, 9, 5-13.

Aziz S.A.A., Abdel-Latef G.K., Shany S.A.S. & Rouby 
S.R. 2018. Molecular detection of integron and 
antimicrobial resistance genes in multidrug resistant 
Salmonella isolated from poultry, calves and human 
in Beni-Suef governorate, Egypt. Beni-Suef Univ J basic 
Appl Sci, 7, 535-542.

Badouei M.A., Jajarmi M. & Mirsalehian A. 2015. 
Virulence profiling and genetic relatedness of Shiga 
toxin-producing Escherichia coli isolated from humans 
and ruminants. Comp Immunol Microbiol Infect Dis, 
38, 15-20.

Barbieri N.L., Nielsen D.W., Wannemuehler Y., Cavender 
T., Hussein A., Yan S.G., Nolan L.K. & Logue C.M. 2017. 
mcr-1 identified in avian pathogenic Escherichia coli 
(APEC). PLoS One, 12, e0172997.

Borowiak M., Fischer J., Baumann B., Hammerl J.A., Szabo 
I. & Malorny B. 2018. Complete genome sequence of 
a VIM-1-producing Salmonella enterica subsp. enterica 
serovar Infantis isolate derived from minced pork meat. 
Genome Announc, 6, e00327-18.

Carramiñana J.J., Rota C., Agustin I. & Herrera A. 2004. 
High prevalence of multiple resistance to antibiotics 
in Salmonella serovars isolated from a poultry 
slaughterhouse in Spain. Vet Microbiol, 104, 133-139.

Chung Y.H., Kim S.Y. & Chang Y.H. 2003. Prevalence 
and antibiotic susceptibility of Salmonella isolated 
from foods in Korea from 1993 to 2001. J Food Prot, 
66, 1154-1157.

Clinical and Laboratory Standards Institute (CLSI). 2018. 
Performance standards for antimicrobial disk and 
dilution susceptibility tests for bacteria isolated from 
animals (CLSI supplement VET08), 4th ed. PA, Clinical 
and Laboratory Standards Institute, Wayne.

Donado-Godoy P., Gardner I., Byrne B.A., Leon M., 
Perez-Gutierrez E., Ovalle M.V., Tafur M.A. & Miller 
W. 2012. Prevalence, risk factors, and antimicrobial 
resistance profiles of Salmonella from commercial 
broiler farms in two important poultry-producing 
regions of Colombia. J Food Prot, 75, 874-883.

El-Prince E., Hussein M.F. & El-Rahman A.M.A. 2019. 
Incidence of Salmonella species in table eggs and some 
egg-based products. J Adv Vet Res, 9, 1-7.

References

Ezatpanah E., Moradi Bidhendi S., Khaki P., Ghaderi R., 
Seyedan J.E. & Moghtadaee F.S. 2013. Detection, 
determination of serotypes and antibiotic resistance 
patterns of Salmonella strains isolated from Arak city 
poultry. Iran Vet J, 9, 88-96.

Fallah S.H., Asgharpour F., Naderian Z. & Moulana Z. 2013. 
Isolation and determination of antibiotic resistance 
patterns in nontyphoid Salmonella spp. isolated from 
chicken. Int J Enteric Pathog, 1, 17-21.

Firoozeh F., Mahluji Z., Khorshidi A. & Zibaei M. 2019. 
Molecular characterization of class 1, 2 and 3 integrons 
in clinical multi-drug resistant Klebsiella pneumoniae 
isolates. Antimicrob Resist Infect Control, 8, 59.

Firouzabadi A., Saadati D., Najimi M. & Jajarmi M. 2020. 
Prevalence and related factors of Salmonella spp. and 
Salmonella Typhimurium contamination among broiler 
farms in Kerman province, Iran. Prev Vet Med, 175, 
104838.

Firoozeh F., Shahcheraghi F., Zahraei Salehi T., Karimi V. 
& Aslani M.M. 2011. Antimicrobial resistance profile 
and presence of class I integrongs among Salmonella 
enterica serovars isolated from human clinical 
specimens in Tehran, Iran. Iran J Microbiol, 3, 112.

Firoozeh F., Zahraei-Salehi T. & Shahcheraghi F. 2014. 
Molecular clonality and detection of class 1 integron 
in multidrug-resistant Salmonella enterica isolates 
from animal and human in Iran. Microb Drug Resist, 20, 
517-524.

Gillings M., Boucher Y., Labbate M., Holmes A., Krishnan 
S., Holley M. & Stokes H.W. 2008. The evolution of 
class 1 integrons and the rise of antibiotic resistance. J 
Bacteriol, 190, 5095-5100.

Gupta R., Chauhan S.L., Kumar S., Jindal N., Mahajan 
N.K. & Joshi V.G. 2019. Carriage of Class 1 integrons 
and molecular characterization of intI1 gene in 
multidrug-resistant Salmonella spp. isolates from 
broilers. Vet World, 12, 609.

Hossain S., De Silva B.C.J., Dahanayake P.S., Shin G.-W. & 
Heo G.J. 2019. Molecular characterization of virulence, 
antimicrobial resistance genes, and class one integron 
gene cassettes in Salmonella enterica subsp. enterica 
isolated from pet turtles in Seoul, Korea. J Exot Pet Med, 
28, 209-217.

Irani M.D., Faghani M. & Doosti A. 2018. Study of class 1 to 
3 integrons in Salmonella and antimicrobial resistance 
pattern isolated from broiler chicks. Electron J Biol, 14, 
81-86.

Jajere S.M. 2019. A review of Salmonella enterica with 
particular focus on the pathogenicity and virulence 
factors, host specificity and antimicrobial resistance 
including multidrug resistance. Vet World, 12, 504.

Jorgensen J.H., Hindler J.F., Reller L.B. & Weinstein M.P. 
2007. New consensus guidelines from the Clinical 
and Laboratory Standards Institute for antimicrobial 
susceptibility testing of infrequently isolated or 
fastidious bacteria. Clin Infect Dis, 44, 280-286.

Kardos G., Farkas T. & Antal M. 2007. Novel PCR assay for 



188 Veterinaria Italiana 2021, 57 (3), 181-188. doi: 10.12834/VetIt.2269.13773.1

MDR Salmonella Infantis in Iranian broiler farms Badouei et al.

Reller L.B., Weinstein M., Jorgensen J.H. & Ferraro M.J. 2009. 
Antimicrobial susceptibility testing: a review of general 
principles and contemporary practices. Clin Infect Dis, 
49, 1749-1755.

Shabana S., Helmy S. & Hegazy A.E.-H. 2019. 
Characterization of class 1 integrons and some 
anti-microbial resistance genes in Salmonella 
species isolated from poultry in Egypt. Slov Vet Res, 
56, 725-734.

Threlfall E.J. 2002. Antimicrobial drug resistance in 
Salmonella: problems and perspectives in food-and 
water-borne infections. FEMS Microbiol Rev, 
26, 141-148.

VT Nair D., Venkitanarayanan K. & Kollanoor Johny A. 2018. 
Antibiotic-resistant Salmonella in the food supply and 
the potential role of antibiotic alternatives for control. 
Foods, 7,167.

Wajid M., Saleemi M.K., Sarwar Y. & Ali A. 2019. Detection 
and characterization of multidrug‐resistant Salmonella 
enterica serovar Infantis as an emerging threat in 
poultry farms of Faisalabad, Pakistan. J Appl Microbiol, 
127, 248-261.

Zahraei Salehi T., Badouei M.A. & Madadgar O. 2013. 
Shepherd dogs as a common source for Salmonella 
enterica serovar Reading in Garmsar, Iran. Turkish J Vet 
Anim Sci, 37, 102-105.

Zhao X., Ye C., Chang W. & Sun S. 2017. Serotype distribution, 
antimicrobial resistance, and class 1 integrons profiles 
of Salmonella from animals in slaughterhouses in 
Shandong province, China. Front Microbiol, 8, 1049.

Zhu C., Yue M. & Rankin S. 2015. One-step identification 
of five prominent chicken Salmonella serovars and 
biotypes. J Clin Microbiol, 53, 3881-3883.

identification of Salmonella enterica serovar Infantis. 
Lett Appl Microbiol, 45, 421-425.

Kaushik M., Kumar S. & Kapoor R.K. 2018. Integrons 
in Enterobacteriaceae: diversity, distribution and 
epidemiology. Int J Antimicrob Agents, 51, 167-176.

Mainali C., McFall M., King R. & Irwin R. 2014. Evaluation of 
antimicrobial resistance profiles of Salmonella isolates 
from broiler chickens at slaughter in Alberta, Canada. J 
Food Prot, 77, 485-492.

Markey B., Leonard F. & Archambault M. 2013. Clinical 
Veterinary Microbiology. E-Book, Elsevier Health Sciences.

Marshall B.M. & Levy S.B. 2011. Food animals and 
antimicrobials: impacts on human health. Clin Microbiol 
Rev, 24, 718-733.

Mehdi Y., Létourneau-Montminy M.P. & Gaucher M.L. 2018. 
Use of antibiotics in broiler production: global impacts 
and alternatives. Anim Nutr, 4, 170-178.

Merino L.A., Ronconi M.C. & Navia M.M. 2003. Analysis 
of the clonal relationship among clinical isolates of 
Salmonella enterica serovar Infantis by different typing 
methods. Rev Inst Med Trop Sao Paulo, 45, 119-123.

Nirmala T.V., Reddy A.D. & Karuna Sree E. 2018. 
Salmonellosis in poultry: a case report. Int J Curr 
Microbiol Appl Sci, 7, 2347-2349.

Peighambari S.M., Taheri H., Solgi H. & Shahcheraghi 
F. 2018. Pulse-field gel electrophoresis (PFGE) of 
Salmonella serovar Infantis isolates from poultry. Iran J 
Vet Med, 12, 197-198.

Rahmani M., Peighambari S.M. & Svendsen C.A. 2013. 
Molecular clonality and antimicrobial resistance in 
Salmonella enterica serovars Enteritidis and Infantis 
from broilers in three Northern regions of Iran. BMC Vet 
Res, 9, 66.