water sa 49(1) 92–95 / jan 2023 https://doi.org/10.17159/wsa/2023.v49.i1.3984 technical note issn (online) 1816-7950 available on website https://www.watersa.net 92 correspondence m gomo email gomom@ufs.ac.za dates received: 23 february 2022 accepted: 21 november 2022 key words aquifer pumping test heterogeneous aquifers cooper and jacob method groundwater late-time drawdown copyright © the author(s) published under a creative commons attribution 4.0 international licence (cc by 4.0) the review aims to provide a common understanding of the use of late-time drawdown to interpret aquifer pumping tests. the first part of the review provides an overview of the use of the late-time drawdown in literature to illustrate where and how the term is being used. a discussion on the practical implications of using the term and its significance is then presented. the review shows the use of the late-time drawdown in three main ways: the application of the cooper and jacob time-drawdown method, the description of the third segment of the unconfined aquifer drawdown-time curve, and when trying to estimate representative/ effective transmissivity parameters in heterogeneous aquifers. unlike the other two situations, the use of late-time data in typical unconfined aquifers is supported by the groundwater flow principles and hence has a meaningful application. the aspects highlighted in this review are important to improve the theoretical and practical knowledge required for analysing and interpreting aquifer pumping test data. on the use of late-time drawdown in interpreting aquifer pumping test m gomo1 1institute for groundwater studies, faculty of natural and agricultural sciences, university of the free state, po box 339, bloemfontein 9300, south africa introduction over the past 10 decades, late-time drawdown has featured consistently in the groundwater science literature of aquifer pumping tests analysis (tóth, 1966; neuman, 1972; lachassagne, 1989; butler, 1991; copty, 2004; tumlinson, 2006; neuman et al., 2007; çimen, 2009; pechstein et al., 2016; kahuda and pech, 2020). however, a review of the use of the late-time drawdown in pumping test analysis is yet to been done. this has resulted in it being used without discretion and in some cases inappropriately. in simple terms, one can define ‘late-time drawdown’ as the drawdown towards the end of an aquifer pumping test activity. this implies that there must be a clearly defined end for any aquifer pumping test activity. with this definition in mind, a few aspects which need explanation and rationalization for the meaningful and generalized practical application of the late-time drawdown need to be highlighted. firstly, it is the appropriate duration of an aquifer pumping test activity which can enable the observation of this late-time drawdown data phenomenon during a pumping test. secondly, how late should it be during that pumping test duration for the late-time drawdown phenomenon to occur? this is very important because it involves time, which is also a very relative parameter. thirdly, it is also not clear how to assess and evaluate the appropriateness of late-time drawdown data for parameter estimation. these are some of the aspects which make the practical use of the term very challenging. this paper provides a technical review of the use of the late-time drawdown, which is of paramount importance to provide clarity among groundwater practitioners who are normally faced with the very daunting task of frequently interpreting aquifer pumping test data. the work complements recent studies aimed at improving the practical understanding of the classical methods of analysing aquifer pumping test data. flores  and bailey (2019) revisited the theis solution derivation to enhance its understanding and application. gomo (2019 and 2020) illustrated the use of infinite acting radial flow (iarf) as an objective criterion to determine the applicability of the cooper and jacob time-drawdown (1946) and distance-drawdown methods. qiwen et al. (2022) recently showed that the generalized radial flow model better characterises groundwater flow regimes of heterogeneous pore aquifers from pumping test data. the review is motivated by the need to continuously improve the theoretical and practical knowledge of analysing aquifer pumping test data among groundwater practitioners. the first component of this paper gives an outline to illustrate how the term is being used in literature and is followed by a discussion of the implications of the use of the term and an evaluation of its practical significance. use of late-time drawdown in literature this section is aimed at showing the where and how the term late-time drawdown data has been used in literature. the author does not claim to have covered all uses of the term in literature but does believe the examples given will help to improve the understanding and create a basis for further discussion and knowledge improvement. the use of late-time drawdown data in aquifer pumping test analysis can be tracked back to tóth (1966). in this study, tóth (1966) indicated to have used late-time drawdown data on the semi-log plots to estimate well yield in typically heterogeneous aquifers. further along the years, neuman (1972) developed the theory of groundwater flow in an unconfined aquifer under the influence of gravity where the time-drawdown curve is divided into three segments: early-time, middle-time, and late-time. the late-time drawdown where the flow becomes entirely horizontal and water is released https://www.watersa.net https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://orcid.org/0000-0003-3205-3097 93water sa 49(1) 92–95 / jan 2023 https://doi.org/10.17159/wsa/2023.v49.i1.3984 from storage only by gravity drainage converge on the theis solution. studies such as lachassagne et al. (1989) and butler (1991) suggested that the transmissivity parameter estimated from late-time drawdown data through the use of classical methods such as the cooper and jacob (1946) time-drawdown method approximate the geometric mean of the regional transmissivity. the basis for this suggestion was that after a relatively long time of pumping the regional groundwater system would be influencing the flow towards a pumping well, hence the use of late-time drawdown data. however, the limitation of this lies in defining what is a relatively long time pumping time. van tonder et al. (2000) use the terms early-time and latetime transmissivity calculated using drawdown derivatives (eq. 1) (spane, 1963; renard, 2008) for estimating borehole sustainable yield. the early-time transmissivity is calculated using the derivative of drawdown at radial flow while the latetime transmissivity is calculated using the maximum derivative of drawdown. the maximum derivative of drawdown occurs at the end of a pumping test. the late-time transmissivity therefore reflects the last observed flow conditions during a test and as such can be used to extrapolate the drawdown to estimate the borehole sustainable yield. � � � s t q tlog .2 3 4� (1) where s is the drawdown measured in a pumping well (l); q is the constant pumping rate (l3/t); t is aquifer transmissivity (l2/t) and t is the time for which the transmissivity is calculated (t). copty and findikakis (2004) concluded that the transmissivity estimates made using the cooper and jacob (1946) late-time drawdown data represent the geometric mean of the parameter for a heterogeneous system. tumlinson et al. (2006) concluded that using the method of cooper and jacob (1946) to interpret late-time drawdown data from a pumping well in a heterogeneous aquifer resulted in large-scale representative transmissivity. on the contrary, neuman (2007) suggested that the use of the cooper and jacob (1946) method to estimate transmissivities using latetime drawdown does not provide good estimates of geometric mean transmissivity of heterogeneous aquifers. later, çimen (2008) proposed a procedure based on the principles of the cooper and jacob (1946) time-drawdown method to estimate aquifer parameters using the late-time drawdown data in multi-well pumping tests performed in confined aquifers. pechstein et al. (2016) suggested that the cooper and jacob (1946) method and the continuous-derivation method estimate equal transmissivity and storativity when applied to analyse late-time drawdown data. recently, kahuda and pech (2020) developed a method for determining the need for well rehabilitation using the early-time aquifer pumping test data. this approach they suggested can be utilised when the late-time data are missing, making it impossible to apply the cooper and jacob (1946) method. in proposing a methodology for the interpretation of aquifer tests in relation to co2 residual trapping experiments, martinez-landa et al. (2021) concluded that the late-time drawdown data is nonunique, but its analysis with different models did not significantly affect the estimation of trapped co2. a summary of the use of late-time drawdown in literature is presented in table 1. discussion the author does not claim that the literature outline provided above is exhaustive, but it does give a good reflection of how the late-time drawdown has been used in various ways from 1966 to 2021. from the literature review, three main aspects about the use of late-time drawdown can be summarised and discussed: • late-time drawdown data use with the cooper and jacob (1946) time-drawdown method to analyse the aquifer pumping test data • use in description of the third segment of the unconfined aquifer drawdown-time curve • use in attempting to estimate representative/effective transmissivity parameters in heterogeneous aquifers the late-time drawdown has been used when the drawdown data are plotted on a semi-log graph of drawdown against time, typically referred as the ‘cooper and jacob plot’. the use of the cooper and jacob (1946) method is traditionally evaluated on basis the of u values (eq. 2), which become smaller as the pumping time increases. u r stt= 2 4 (2) where: t is transmissivity of the aquifer (l2/day), r is distance of the observation well from the pumping well (l), s is storativity of the aquifer (no unit), and t is duration of the pumping (l). the guidance from literature provides different threshold values of u making it difficult to objectively evaluate the method’s applicability (gomo, 2019), but it is a fact that u values tend to be smaller after a long pumping time. this probably brought the notion that the cooper and jacob (1946) method can generally be applicable at late-time drawdown, yet this is not always the case. recently, gomo (2019, 2020) illustrated how the iarf condition (spane, 1993 and renard et al. 2008) is a more objective evaluation criterion for the application of the cooper and jacob (1946) method. table 1. summary of the use of late-time drawdown in literature author and year of publication title of paper tóth (1966) groundwater, geology, movement, chemistry and resources, near olds, alberta neuman (1972) theory of flow in unconfined aquifers considering delayed response of the water table lachassagne et al. (1989) evaluation of hydrogeological parameters heterogeneous porous media butler (1991) a stochastic analysis of pumping tests in laterally non-uniform media van tonder et al. (2000) estimation of the sustainable yields of boreholes in fractured rock formations copty and findikakis (2004) stochastic analysis of pumping test drawdown data in heterogeneous geologic formations tumlinson et al. (2006) numerical evaluation of pumping well transmissivity estimates in laterally heterogeneous formations çimen (2008) effective procedure for determination of aquifer parameters from late time-drawdown data pechstein et al. (2016) estimating transmissivity from single-well pumping tests in heterogeneous aquifers kahuda and pech (2020) a new method for the evaluation of well rehabilitation from the early portion of a pumping test martinez-landa et al. (2021) application to co2 residual trapping experiments at the heletz site. 94water sa 49(1) 92–95 / jan 2023 https://doi.org/10.17159/wsa/2023.v49.i1.3984 the cooper and jacob (1946) method should be applied to the drawdown data under the influence of iarf conditions and these do not necessarily apply to the late-time drawdown data. it is also possible to have iarf conditions followed by other flow regimes, such as a low permeable boundary influencing the latetime drawdown data. figure 1 illustrates an example where a low permeable boundary influences the late-time drawdown after the iarf. the occurrence of iarf can be identified when derivative values of drawdown become constant (spane, 1993; renard et al., 2008; gomo, 2019; gomo, 2020) and the cooper and jacob (1946) method is applicable during the raf period. in this example, iarf occurs before the late-time drawdown which is then affected by the low permeable boundary. with this case, estimating parameters on the basis of the late-time drawdown data using the cooper and jacob (1946) method would principally give incorrect results. while the cooper and jacob (1946) straight line can perfectly fit this late-time drawdown data, the meaning of the results is not supported by the principles underlying the method. in contrast, the use of the late-time drawdown in a typical unconfined aquifer to describe the last segment of the drawdowntime curve (neuman, 1972) is objective and rationalized. the typical drawdown curve for the unconfined aquifer is clearly defined and the meaning of each segment is explained. it is therefore clear how the late-time drawdown should look and the circumstances under which it occurs in a typical unconfined aquifer. this makes it possible to use the late-time drawdown data meaningfully and with the same basis of understanding across groundwater practitioners. another important aspect to discuss is that late-time drawdown has been used when estimating representative/effective transmissivity from aquifer pumping tests conducted in heterogeneous aquifers. logically, estimating transmissivity with the late-time drawdown data would seem to make sense because it is reflective of effective transmissivity for the whole system, considering that the cone of depression would have passed through different formations up to the late time. but again, late-time is relative in that it is bound to change with duration of the pumping test activity, hence the meaning of what the representative transmissivity is would also vary. from the literature outline, the late-time drawdown in heterogeneous aquifers appears to have been analysed with the cooper and jacob (1946) method, implying that it was forming a straight-line at late-time. it does appear that the use of the latetime drawdown data is an attempt to justify the use of the cooper and jacob method to estimate the transmissivity in heterogeneous aquifers. it is well known that the cooper and jacob (1946) method is not applicable for heterogeneous aquifers and the presence of data matching a straight line at late-time seems to have been used as the basis for using the method. in cases where the late-time drawdown data does not form a straight-line, then the cooper and jacob (1946) method could not be used and for that reason the late-time drawdown data were not used in those instances. however, as illustrated by gomo (2020), the applicability of the cooper and jacob (1946) method should be objectively evaluated based on the iarf and not the occurrence of data in a straight line. neither does the occurrence of a straight line indicate acceptable u-values. in a practical sense, this will depend on the nature of heterogeneities and the characteristics of hydraulic features influencing drawdown at late-time. for example, the late-time data could be affected by a limiting flow boundary, more permeable formation or even impermeable formation, as determined by the nature of field heterogeneities. these hydraulic features can induce different flow characteristics on late-time drawdown data which would make it difficult to analyse it with the cooper and jacob (1946) distance-drawdown methods or any other method. conclusions the article provided a technical review of the use of the late-time drawdown to analyse and interpret aquifer pumping test data. the late-time drawdown is mainly used in three ways: • application of the cooper and jacob (1946) time-drawdown method • description of the third segment of the unconfined aquifer drawdown-time curve • estimation of the representative/effective transmissivity parameters in heterogeneous aquifers in the application of the cooper and jacob (1946) method, the use of the late-time drawdown does not give an assurance of the validity of using the method, because the late-time data are not always characterised by infinite radial acting flow conditions. the use of late-time data in typical unconfined aquifers is supported by the groundwater flow principles developed by neuman (1972), hence has a meaningful application. the meaning of aquifer parameters estimated in heterogeneous aquifers using the latetime drawdown remains unclear. figure 1. graph showing drawdown (s) on primary vertical axis against time on a semi-log axis and derivative of drawdown (s') on secondary axis against time on a log-log axis 95water sa 49(1) 92–95 / jan 2023 https://doi.org/10.17159/wsa/2023.v49.i1.3984 orcid m gomo https://orcid.org/0000-0003-3205-3097 references butler jj jr (1991) a stochastic analysis of pumping tests in laterally non-uniform media. water resour. res. 7 (9) 2401–2414. çimen m (2009) effective procedure for determination of aquifer parameters from late time-drawdown data. j. hydrogeol. 14  446–452. https://doi.org/10.1061/(asce)he.1943-5584.0000012 cooper hh jr and jacob ce (1946) a generalized graphical method for evaluating formation constants and summarizing well field history. trans. am. geophys. union 27 (4) 526–534. https://doi. org/10.1029/tr027i004p00526 copty nk and findikakis an (2004) stochastic analysis of pumping test drawdown data in heterogeneous geologic formations. j. hydraul. res. 42 (s1) 59–67. https://doi.org/10.1080/0022 1680409500048 flores  l and bailey tr (2019) revisiting the theis solution derivation to enhance understanding and application. hydrogeol. j. 27 55–60. https://doi.org/10.1007/s10040-018-1843-x gomo m (2019) on the interpretation of multi-well aquifer pumping tests in confined porous aquifers using the cooper and jacob (1946) method. sustainable water resour. manage. 5 (2) 935–946. https:// doi.org/10.1007/s40899-018-0259-z gomo m (2020) on the practical application of the cooper and jacob distance-drawdown method to analyse aquifer-pumping test data. groundwater sustainable dev. 5 11100478. https://doi.org/10.1016/j. gsd.2020.100478 kahuda d and pech p (2020) a new method for the evaluation of well rehabilitation from the early portion of a pumping test. water 12 744. https://doi.org/10.3390/w12030744 lachassagne p, ledoux e and de marsily g (1989) evaluation of hydrogeological parameters heterogeneous porous media. in: groundwater management: quantity and quality (proceedings of the benidorm symposium, october 1989). iahs publ. no 188. 3–18. martinez-landa l, carrera j, niemi a and bensabat j (2021) a methodology for the interpretation of aquifer tests: application to co2 residual trapping experiments at the heletz site. int. j. greenhouse gas contr. 112 103366. https://doi.org/10.1016/j. ijggc.2021.103366 neuman ps (1972) theory of flow in unconfined aquifers considering delayed response of the water table. water resour. res. 8 (4) 1031–1045. https://doi.org/10.1029/wr008i004p01031 neuman ps, blattstein a, riva m, daniel m, tartakovsky dm, guadagnini a and ptak t (2007) type curve interpretation of late-time pumping test data in randomly heterogeneous aquifers. water resour. res. 43 w10421. https://doi. org/10.1029/2007wr005871 qiwen d, gang c, ke z, wen s, and cheng h (2022). pumping tests analyses of a heterogeneous pore aquifer based on the generalized radial flow model. hydrogeol. eng. geol.  49 (2) 17–23. https://doi.org/10.16030/j.cnki.issn.1000-3665.202106029 pechstein a, attinger a, krieg r and copty nk (2016) estimating transmissivity from single-well pumping tests in heterogeneous aquifers. water resour. res. 52 495–510. https://doi. org/10.1002/2015wr017845 renard p, glenz d and mejias m (2008) understanding diagnostic plots for well-test interpretation. hydrogeol. j. 17  589–600. https:// doi.org/10.1007/s10040-008-0392-0 spane fa jr (1993) selected hydraulic test analysis techniques for constant-rate discharge tests. pnl-8539. technical report. pacific northwest laboratory richland, washington 99352. https://doi.org/ 10.2172/6585821 tóth j (1966) groundwater, geology, movement, chemistry and resources, near olds, alberta. research council of alberta bulletin 17. tumlinson lg, osiensky jl and fairley jp (2006) numerical evaluation of pumping well transmissivity estimates in laterally heterogeneous formations. hydrogeol. j. 14 (1) 21–30. https://doi. org/10.1007/s10040-004-0386-5 van tonder gj, botha jf, chiang wh, kunstmannb h and xu y (2001) estimation of the sustainable yields of boreholes in fractured rock formations. j. hydrol. 241 (1–2) 70–90. https://doi. org/10.1016/s0022-1694(00)00369-3 https://orcid.org/0000-0003-3205-3097 https://doi.org/10.1061/(asce)he.1943-5584.0000012 https://doi.org/10.1029/tr027i004p00526 https://doi.org/10.1029/tr027i004p00526 https://doi.org/10.1080/00221680409500048 https://doi.org/10.1080/00221680409500048 https://doi.org/10.1007/s10040-018-1843-x https://doi.org/10.1007/s40899-018-0259-z https://doi.org/10.1007/s40899-018-0259-z https://doi.org/10.1016/j.gsd.2020.100478 https://doi.org/10.1016/j.gsd.2020.100478 https://doi.org/10.3390/w12030744 https://doi.org/10.1016/j.ijggc.2021.103366 https://doi.org/10.1016/j.ijggc.2021.103366 https://doi.org/10.1029/wr008i004p01031 https://doi.org/10.1029/2007wr005871 https://doi.org/10.1029/2007wr005871 https://doi.org/10.16030/j.cnki.issn.1000-3665.202106029 https://doi.org/10.1002/2015wr017845 https://doi.org/10.1002/2015wr017845 https://doi.org/10.1007/s10040-008-0392-0 https://doi.org/10.1007/s10040-008-0392-0 https://doi.org/10.2172/6585821 https://doi.org/10.2172/6585821 https://doi.org/10.1007/s10040-004-0386-5 https://doi.org/10.1007/s10040-004-0386-5 https://doi.org/10.1016/s0022-1694(00)00369-3 https://doi.org/10.1016/s0022-1694(00)00369-3 water sa 49(1) 1–7 / jan 2023 https://doi.org/10.17159/wsa/2023.v49.i1.3947 research paper issn (online) 1816-7950 available on website https://www.watersa.net 1 correspondence sj moodley email makardsj@eskom.co.za dates received: 8 october 2021 accepted: 14 november 2022 key words free-living amoeba hot water systems legionella pneumophila acanthamoeba pseudomonas aeruginosa nontuberculous mycobacteria copyright © the author(s) published under a creative commons attribution 4.0 international licence (cc by 4.0) as part of the eskom rebate programme, energy-efficient hot water systems such as solar water heaters (low pressure), heat pumps and energy-efficient showerheads were rolled out to the public as a measure to conserve and save energy. there has been a concern that these systems may not reach the required high temperatures, especially during winter, and, as a result of this, acanthamoeba and its associated bacteria such as legionella pneumophila, pseudomonas aeruginosa and nontuberculous mycobacteria could flourish within these systems causing a potential health risk to consumers. this study examined the relationship between acanthamoeba and its associated bacteria at different temperature ranges. a total of 156 water (69) and biofilm samples (87) were collected from a solar water heater, heat pump, geyser and showerheads and examined for these organisms using amoebal enrichment and molecular techniques. amoeba could be cultivated from 45 (65.2%) of the water samples and 56 (64.4%) of the biofilm samples. the study confirmed the presence of legionella pneumophila, pseudomonas aeruginosa and nontuberculous mycobacteria in the hot water systems at both of the simulated winter (20°c to 30°c) and higher summer (40°c to 55°c) temperatures as well as the control system. there was a significant positive correlation between the presence of acanthamoeba and the presence of pseudomonas. based on this association it is suggested that pseudomonas aeruginosa could be investigated as an indicator organism for the presence of acanthamoeba and opportunistic pathogens. prevalence of free-living acanthamoeba and its associated bacteria in energy-efficient hot water systems in south africa sj moodley1,2 , p muchesa3,4 , c bartie5 , tg barnard3 , r clarke1, a masenge6 and sn venter2 1eskom research, testing & development, private bag 40175, cleveland, johannesburg, south africa 2department of biochemistry, genetics and microbiology, university of pretoria, south africa 3water and health research centre, university of johannesburg, south africa 4biotechnology and biochemistry department, university of zimbabwe, zimbabwe 5cb scientific, roodepoort, gauteng, south africa 6internal statistical consultation services, department of statistics, university of pretoria, south africa introduction the provision of safe and clean water to communities is an important step for improving the general health of people. proper treatment steps, and management of water distribution systems which supply buildings, are important steps to provide and maintain microbial drinking water quality. household water systems must protect consumers from any potential health risks that may be associated with water supply (who, 2011). this is of paramount importance in a country like south africa where water is a scarce resource. these water systems have a distinct microbial ecology, which consists of bacteria, viruses, fungi, algae and protozoa (douterelo et al., 2019). among these organisms, the growth of opportunistic pathogens in household water systems is an increasing public health threat which needs to be addressed to prevent outbreaks. these opportunistic pathogens include free-living amoebae (fla) and their associated bacteria. freeliving amoeba, such as acanthamoeba, naegleria, balamuthia and sappinia, have been identified as potential risks for causing opportunistic eye, skin and central nervous system infections (scheid, 2018). in addition to causing infections, these organisms can also interact and act as reservoirs for other bacterial opportunistic pathogens, such as nontuberculous mycobacteria (ntm), legionella pneumophila and pseudomonas aeruginosa, in water systems. these bacteria can coexist and are often able to infect, survive and multiply in fla as they have the ability to digest fla (greub and raoult, 2004; shaheen et al., 2019). bacteria in this category are referred to as amoeba-resistant bacteria. a review by thomas et al. (2010) reported that, of the 539 bacterial species listed as pathogenic to humans and/or animals (taylor et al., 2001), 102 species were known as amoeba-resistant bacteria, and 27 species were suspected to resist digestion and survive or grow within fla. despite the worldwide occurrence of fla and their associated bacteria, to date few studies have been done in africa, particularly for the warm, stagnant conditions in building plumbing which usually create ideal conditions for regrowth for a number of opportunistic pathogens and their associated fla. these hot water systems are characterized by different conditions, such as increased organic matter, temperature stratifications, flow rates and residence times in the hot water tank and the distribution system (falkinham et al., 2015). these conditions may also influence the distribution of opportunistic pathogens in the hws and favour a great diversity of microorganisms. the south african national standard drinking water specifications, sans 241:2015 (sabs 2015), state the numerical limits for physical, chemical and microbial quality parameters for potable water, with the main focus on indicator organisms such as e. coli, total coliforms, coliphages and heterotrophic plate counts, as well as pathogens such as protozoan parasites and enteric viruses. however, fla and their associated opportunistic pathogens, such as nontuberculous mycobacteria, https://www.watersa.net https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://orcid.org/0000-0003-1091-0051 https://orcid.org/0000-0003-1670-4777 https://orcid.org/0000-0002-7505-8122 https://orcid.org/0000-0002-6831-1361 https://orcid.org/0000-0001-8372-2356 https://orcid.org/0000-0002-5726-4918 2water sa 49(1) 1–7 / jan 2023 https://doi.org/10.17159/wsa/2023.v49.i1.3947 legionella pneumophila and pseudomonas aeruginosa are not included in the drinking water specifications. these organisms can grow and thrive as part of complex microbial communities inhabiting building plumbing supplied by water considered safe for drinking, and therefore do not necessarily respond to traditional approaches for pathogen control geared towards indicator organisms (berry et al., 2006). these organisms can become the leading source of waterborne disease in countries like south africa. the current study focused on domestic energy-efficient hot water systems (hws) such as solar water heaters, heat pumps and energy-efficient showerheads which were rolled out by eskom with the objective to save and conserve energy. this residential mass roll-out rebate programme formed part of eskom’s integrated demand management initiative (begemann and lipchin, 2012). as these water heating systems are dependent on the temperature of the environment, water temperatures may fluctuate and create conditions that could enable the growth, proliferation and spread of fla and its associated opportunistic pathogens. this study investigated the presence of acanthamoeba and its associated bacteria within a laboratory setting. the aim of this study was to test the impact of temperature (20°c to 30°c and 40°c to 55°c) on the presence acanthamoeba and its associated bacteria, to establish whether there will be greater exposure risk to selected opportunistic pathogens associated with these energy-efficient systems. methods and materials sampling protocol the sampling focused on the presence of acanthamoeba and its associated bacteria within 4 separate laboratory-based systems: a low-pressure solar water heater, a heat pump, a geyser (control) and energy-efficient showerheads. the pilot hot water systems were not connected to each other and operated independently from each other. all systems obtained their water supply from the same municipal connection. figure 1 shows the hot water systems as well as the layout and sampling points for each individual system. the solar water heater (swh) is a low-pressure system which does not have a back-up element and mimics systems used in low-income communities. three probes were installed inside the unit to measure the temperature of the water. the first temperature probe was installed at the bottom of the tank, the second temperature probe was installed at the top of the tank and the third temperature probe was installed where the water exits the system. the temperature of the unit was carefully controlled to obtain the desired temperatures. the water samples were taken from the tap which was located close to the swh (fig. 1a). when the swh temperature increased above the set temperature, cold water was pumped into the system and hot water was pumped out into the dump tank, thus enabling the swh temperatures to remain at the set temperatures. the temperatures were set at 20°c to 30°c and 40°c to 55°c during the experimental period. this was done to test the impact of specific temperature ranges representing summer and winter conditions on the presence of acanthamoeba and its associated bacteria. the temperature of the heat pump (hp) was controlled by the control box. two probes were installed to measure the temperature of the water inside the hp as wells as the water exiting the hp. the temperature range was set for a period of 3 months between 40°c and 55°c and for the next 3 months to operate between 20°c and 30°c. a tap was used to sample the water from the hp (fig. 1b). figure 1. schematic of the hot water systems: (a) solar water heater, (b) heat pump, (c) geyser with biofilm coupons, (d) showerheads a and b 3water sa 49(1) 1–7 / jan 2023 https://doi.org/10.17159/wsa/2023.v49.i1.3947 as a control, a system simulating the operation of a normal electrical geyser was also included. a 3 kw heating element was inserted in a 100 l plastic tank so that the water could reach temperatures of 55°c during the experiment. geysers are typically operated at 55°c to 60°c. biofilm coupons in a casing were placed inside the tank under the water level. the water samples were taken from the tap and the biofilm coupons were swabbed (fig. 1c). the showerhead test unit had two perspex boxes; an energyefficient showerhead was housed in box b and a conventional showerhead was housed in box a (control). the plastic container was filled with approximately 20 l of water and the pressure was regulated to ensure that both the efficient and conventional showerhead were run at the same pressures while the water was run constantly through the system. the water samples were taken from each showerhead and, in addition to this, the showerheads were swabbed (fig. 1d). sample collection water and biofilm samples were collected for microbiological analysis every 2 weeks for a period of 6 months from march 2017 to august 2017. the samples were stored in a portable ice chest and processed on the same day. water samples were collected after running each system for approximately 1 to 2 min before collecting the sample in a 1 l sampling bottle. all bottles contained 5 mg/l of sodium thiosulphate to neutralize the chlorine or any oxidizing biocides which may be present at the time of sampling. taps connected to these systems were also swabbed on the inside to collect biofilms that may have formed. the swaps were placed into 20 ml of page’s modified neff ’s amoebae saline (pas) solution. at the same time water samples were also collected for the municipal connection feeding into all of the experimental systems. isolation of fla five hundred milliliters (500 ml) of water sample were concentrated by filtration using a nitrocellulose membrane (millipore, sa) with a pore size of 0.45 µm. swabs were vortexed at maximum speed for 30 s in 10 ml page’s amoebal saline buffer (pas) in individual sterile tubes and the suspension was concentrated by membrane filtration similarly to the water samples. each filter membrane was placed upside-down onto a non-nutrient agar (nna) plate overlaid with a suspension of heat-killed escherichia coli atcc 25922 (100 µl for each plate) (muchesa et al., 2014). the plates were incubated aerobically at 32°c and examined daily for 3 weeks under a light microscope (olympus, japan) with 10 x objective for the appearance of amoebal trophozoites and/or cysts. plates were recorded as negative if no amoebae were observed after 3 weeks. plates containing amoebae were sub-cultured by cutting small agar plugs, which were placed upside-down onto fresh nna-e. coli plates and incubated as before. sub-culturing was done 3 times to purify amoebae cells. once purified, amoebae cells were harvested by gently scraping the agar surface and re-suspending the cells in 1 ml pas. to further remove extracellular bacteria and debris, the suspension was centrifuged 3 times at 1 000 g for 20 min. the washed pellet was re-suspended in 1 ml pas. the suspension was inoculated into 24-well microtitre plate wells (nunc, usa) and incubated at 32°c. the plates were checked daily under an inverted microscope (leica, germany), with a 40 x objective, for the morphological appearance of free-living amoeba. isolated acanthamoeba and potentially associated legionella pneumophila, pseudomonas aeruginosa and nontuberculous mycobacteria were identified by pcr assays using specific primers for acanthamoeba and the different bacteria. dna extraction dna was extracted from amoeba-positive samples. briefly, the amoebae suspension was centrifuged for 2 min at 13 000 r/min to concentrate cells. the supernatant was discarded and the pellet kept for dna extraction. to the pellet, 700 µl of lysis buffer was added and incubated at 70°c for 10 min. a volume of 250 µl 100% ethanol was added to the mixture and further incubated at 56°c for 10 min. to this mixture 50 µl of celite was added and incubated at room temperature for 10 min. the mixture was then loaded onto a spin column containing a dna binding membrane and centrifuged. the column was washed in 2 steps with 700 µl wash buffer and centrifuged. final washing was done with 70% ethanol in 2 steps of 700 µl each. dna was eluted using 100 µl of a tris edta buffer (10mm tris-cl and 0.5 m edta; ph 9) after incubation at room temperature for 2 min and stored at −20°c. the extracted dna was used as a template in all pcr reactions. pcr analysis acanthamoeba was detected by amplification of the extracted dna using the primers targeting the 18s rdna of free-living amoeba and specific regions of the 16s rdna for legionella, mycobacteria or pseudomonas aeruginosa (table 1). the samples were amplified in a 20 µl reaction mixture containing 10 μl of the 2 x qiagen m-pcr master mix (hotstart taq dna polymerase, 10 x buffer, 2 mm mgcl2 and dntp mix), 1 μl 5 x q-solution, 1 μl of pcr grade water, 2 μl 25 mm mgcl2, 4 μl of template dna and 0.5 μl of primers. the pcrs were carried out with the listed forward and reverse primers. the cycling conditions were: an initial enzyme activation of 95°c for 15 min, followed by 30 cycles of denaturation at 94°c for 1 min, annealing at 62°c for 90 s and elongation at 72°c for 1 min with final extension of 72°c for 10 min. the primers yielded 750–1 000 bp fragments. all amplicons were separated on a 2% (w/v) agarose gel. statistical analysis the presence of acanthamoeba was used to compare the different experimental and control systems. the bonferroni method was performed to adjust the p-values for multiple comparisons of proportions. the spearman, non-parametric correlation test was table 1. primers used to detect acanthamoeba and its associated bacteria organisms primers sequence (5-3) reference acanthamoeba (750–1 000 bp) clfa-f cfla-r caggttaaggtctcgttcgttaac caggttaaggtctcgttcgttaac coskun et al., 2013 legionella (658 bp) leg225 leg 858 aagattagcctgcgtccgat gtcaacttatcgcgtttgct rafiee et al., 2014 mycobacterium (238 bp) myco66f myco300r catgcaagtcgaacggaaa ggccggacaccctctc thomas et al., 2006 pseudomonas (956 bp) pa-ss-f pa-ss-r gggggatcttcggacctca tccttagagtgcccacccg spilker et al., 2004 4water sa 49(1) 1–7 / jan 2023 https://doi.org/10.17159/wsa/2023.v49.i1.3947 conducted to test for associations between the acanthamoeba detection data and the presence of legionella pneumophila, pseudomonas aeruginosa or nontuberculous mycobacteria. the spearman correlations (r) range between −1 and 1, with 1 being a perfect positive correlation or relationship, i.e., the occurrence of acanthamoeba is associated with the occurrence of the bacterial group it was compared with. correlations were considered to highly significant at the 0.01 level (2-tailed). results this study investigated the presence of acanthamoeba and its associated bacteria in prototype energy-efficient hws systems and associated appliances within a laboratory setting. these results were compared with the municipal water supply that served as source water as well as a protype of a normal geyser operated at 55°c. a total of 156 water and biofilm samples were collected during the experimental process from march until august, of which 69 were water samples and 87 were biofilm samples. of the 69 water samples, growth of amoeba was observed for 45 samples (65.26%), and of the 87 biofilm samples, 56 showed positive growth (64.4%). nontuberculous mycobacteria had a rather low (11.4%) association with the acanthamoeba cultures, compared to pseudomonas aeruginosa at 93,2% and even legionella (33.0%). based on the pcr analysis, 88 of the 101 free-living amoeba cultures (87.1%) could be identified as acanthamoeba. when the different systems were compared with each other based on the presence of acanthamoeba, no significant differences at the 0.05 level were found. municipal source and geyser based on the pcr analysis, the municipal water supply (fig. 2a) showed acanthamoeba, legionella pneumophilia, pseudomonas aeruginosa and nontuberculous mycobacteria to be present within the distribution system during the period of 6 months within which samples were collected. acanthamoeba was present in 31.6%, legionella pneumophilia in 10.5%, nontuberculous mycobacteria in 5.3% and pseudomonas aeruginosa in 31.6% of municipal water and biofilm samples (31.6%). although the geyser (fig. 2b) was set at 55°c, acanthamoeba and pseudomonas could regularly be detected in both the water and biofilms in 68.8% and 62.5% of all the samples, respectively. the geyser system also had the highest percentage of samples positive for the presence of acanthamoeba for all the systems tested. legionella pneumophila was only detected in 10 (20.8%) of the samples in spite of the fact that it was run at an elevated temperature. mycobacterium was absent from the geyser, apart from one of the coupons (2.1%). solar water heater and heat pump acanthamoeba was present in around half of all the swh and hp samples during both of the experiments, with 43.5% of the samples collected from these two systems positive for pseudomonas (fig. 3). legionella pneumophilia was observed in the swh at 20°c to 30°c (41.7%) but at a lower percentage of 27.3% at 40°c to 55°c. for the hp the values were even lower, ranging between 16.7% (20°c to 30°c) and 9% (40°c to 55°c). nontuberculous mycobacteria were only present in 3 (13%) of the swh samples and 1 (4.3%) of the hp samples (fig. 3). showerhead results figure 4 shows the showerhead a (conventional) and showerhead b (energy-efficient) data. acanthamoeba was present in both the water and biofilm samples and the percentage of positive samples was 65% and 56.5% for the two showerheads, respectively. although showerhead b showed a slightly lower presence of acanthamoeba, higher levels of legionella pneumophilia (21.7%) were detected in this system compared to the absence of legionella in showerhead a samples. no major differences were observed for the nontuberculous mycobacteria with only one sample was positive for each of the systems. bacterial associations with acanthamoeba in this study there was a strong positive correlation between the presence of acanthamoeba and pseudomonas (table 2). for all systems apart from showerhead a there was a high correlation based on spearman’s rho at the level of 0.01 (2-tailed). the only other highly significant correlation was between acanthamoeba and legionella. a spearman’s rho of r = 0.699 (p < 0.001) was observed for the solar water heater. none of the other associations between acanthamoeba and legionella or the mycobacteria were significant at the 0.01 level. figure 2. presence of (a) acanthamoeba, legionella, mycobacteria and pseudomonas in the municipal water source, (b) acanthamoeba, legionella, mycobacteria and pseudomonas in the geyser water and biofilm samples table 2. correlation between acanthamoeba and pseudomonas per experimental system system correlation coefficient spearman’s rho p-value (2-tailed) municipal source 1.000** control geyser 0.778** <0.001 solar water heater 0.840** <0.001 heat pump 0.646** <0.001 showerhead a 0.435 0.055 showerhead b 0.840** <0.001 **correlation is significant at the 0.01 level (2-tailed) 5water sa 49(1) 1–7 / jan 2023 https://doi.org/10.17159/wsa/2023.v49.i1.3947 figure 3. presence of (a) acanthamoeba, legionella, mycobacteria and pseudomonas in the solar water heater system for the 20°c to 30°c range and 40°c to 55°c range, (b) acanthamoeba, legionella, mycobacteria and pseudomonas in the heat pump for the 20°c to 30°c range and 40°c to 55°c range figure 4. presence of acanthamoeba, legionella, mycobacteria and pseudomonas in the showerhead water and biofilm samples for (a) showerhead a, a conventional showerhead, and (b) showerhead b, an energy-efficient showerhead, run at lower temperatures discussion from our investigations, it was observed that acanthamoeba and pseudomonas aeruginosa were regularly detected in all heating systems tested as well as the municipal supply. legionella and nontuberculous mycobacteria, known to be associated with acanthamoeba, were also detected, but at lower levels compared to pseudomonas. these observations were in line with the findings of other investigations which showed that these opportunistic pathogens were present in electric water heaters (stone et al., 2019), premise plumbing (falkinham et al., 2015) and different hospital water systems (muchesa et al., 2016), and if not well managed could pose a risk to consumers. one of the concerns raised during the rollout of the energyefficient hot water systems was that these systems could pose a health risk when operated at sub-optimal temperatures, especially during winter. acanthamoeba is known to grow optimally at 30°c (lakhundi et al., 2014). muchesa et al. (2016) stated that the high prevalence of acanthamoeba in their study could be a result of the relatively lower temperatures of cold-water samples compared with the relatively high temperatures of hws analysed in other studies. in this study acanthamoeba was present in high numbers at both the high and lower temperatures. the results showed that this organism has a high temperature tolerance, as it was regularly detected in the control geyser operated at 55°c as well as the experiments conducted at around 40°c to 55°c. the results therefore did not indicate an increased risk associated with the operation of the energy-efficient systems at the lower temperature range of 20–30°c. legionella pneumophilia was intermittently detected in acanthamoeba cultures obtained from both water and biofilm samples of all the systems, apart from showerhead a. valcina et al. (2019) reported that for the samples collected during their study, legionella was always isolated along with fla. apart from the solar water heater there was no significant correlation between the presence of acanthamoeba and legionella. the association of legionella pneumophilia with acanthamoeba in the water systems may still indicate an increased health risk as acanthamoeba are able to provide long-term persistence and transmission of legionella pneumophilia. the low levels of nontuberculous mycobacteria (11.4%) associated with acanthamoeba isolated from water and biofilm samples were in line with other studies. thomas et al. (2006) detected them in 20.5% of the amoebal cultures obtained from water and biofilm samples in the water network of a hospital. a south african based study reported that nontuberculous mycobacteria could be cultured from 17.9% of the drinking water samples tested (september et al., 2004). in contrast to these studies, delafont et al. (2014) reported that nontuberculous mycobacteria could be recovered from nearly 88% of the amoebal cultures obtained from drinking water networks. the reasons for these differences would need to be investigated further. the interactions between fla and pseudomonas aeruginosa were previously studied and showed a frequent recovery of this bacterial genus. in this study pseudomonas aeruginosa was present in most of the acanthamoeba cultures isolated from the systems 6water sa 49(1) 1–7 / jan 2023 https://doi.org/10.17159/wsa/2023.v49.i1.3947 as well as the municipal source. this was supported by delafont et al. (2016) and reported that pseudomonas and burkholderi a significantly co-occurred with acanthamoeba in water samples. it is possible that intracellular multiplication of pseudomonas aeruginosa within acanthamoeba polyphaga could take place, as was reported in synthetic drinking water (bedard et al., 2016). this study showed that there was a clear correlation between acanthamoeba and pseudomonas aeruginosa, irrespective of the environmental temperature they were exposed to, as similar levels of acanthamoeba and pseudomonas aeruginosa were found at both the high and low temperatures. the presence of pseudomonas aeruginosa and acanthamoeba in both the water and biofilm samples at similar levels was also noted. highly significant correlations based on spearman’s rho supported this association which was independent of temperature or sample type. it can therefore be proposed that pseudomonas aeruginosa could be investigated as an indicator organism in order to establish the presence of fla in water systems. conclusions several studies have indicated the presence of acanthamoeba and its associated bacteria in hot water systems. this study confirmed the presence of acanthamoeba and its associated bacteria in both normal and energy-efficient hot water systems. acanthamoeba, pseudomonas aeruginosa and legionella pneumophilia were found to be temperature tolerant with the potential to survive at different temperatures. as these organisms are associated with both conventional electric geysers and efficient hot water systems, their potential health risk should be addressed. it is recommended that detailed studies should be conducted to understand the behaviour of these organisms within hot water distribution systems and how physical and biological parameters impact their dynamics. one of the important factors that still needs attention is the effect of temperature gradients on the survival of these heat-tolerant organisms. this will help us to balance our need for saving energy and at the same time reducing the risk to users. this study also confirmed that acanthamoeba, legionella pneumophilia, nontuberculous mycobacteria and pseudomonas aeruginosa were present in the municipal water. as such this water could act as a source of these organisms in domestic water supply and heating systems. currently, there are guidelines and risk assessments for the presence of legionella pneumophilia in water systems. however, there is a lack of risk management and intervention plans for hot water systems in south africa. we propose that pseudomonas aeruginosa, acanthamoeba and associated bacterial pathogens should also be considered as they could pose a potential risk in hot water systems as was shown by the experimental systems as well as the conventional geyser. it is therefore highly recommended that a risk management plan be developed for water heating systems in south africa in order to control the risk to water users. conflict of interest there was no conflict of interest for any party involved with this study. acknowledgements the author would like to acknowledge the eskom research, testing and development department for the research funding for this study and the university of johannesburg for providing technical assistance. author contributions sjm – conceptualisation of study, data collection and analysis, writing of manuscript; pm – data collection and analysis, writing of manuscript; cb – conceptualisation of study, data collection and analysis, writing of manuscript; tgb – conceptualisation of study, data collection and analysis, writing of manuscript; rc – conceptualisation of study, writing of manuscript; am – statistical analysis, writing of manuscript; snv – data analysis, writing of manuscript orcids sj moodley https://orcid.org/0000-0003-1091-0051 p muchesa https://orcid.org/0000-0003-1670-4777 c bartie https://orcid.org/0000-0002-7505-8122 tg barnard https://orcid.org/0000-0002-6831-1361 a masenge https://orcid.org/0000-0001-8372-2356 sn venter https://orcid.org/0000-0002-5726-4918 references bédard e, prévost m and dézie e (2016) pseudomonas aeruginosa in premise plumbing of large buildings. microbiol. open 5 (6) 937–956. https://doi.org/10.1002/mbo3.391 begemann m and lipchin b (2012) the eskom idm suite of solutions. mining and industrial energy optimisation (mieo), cape town. 28–30. url: https://www.ee.co.za/wpcontent/uploads/ legacy/vector%202012/eskom_the%20eskom%20idm%20suite%20 of%20solutions.pdf (accessed 17 july 2022). berry d, xi cw and raskin l (2006) microbial ecology of drinking water distribution systems. curr. opin. biotechnol. 17 (3) 297–302. https://doi.org/10.1016/j.copbio.2006.05.007 coskun ka, semra özçelik s, tutar l, elald n and tutar y (2013) isolation and identification of free-living amoebae from tap water in sivas, turkey. biomed res. int. 2013 675145. https://doi. org/10.1155/2013/675145 delafont v, bouchon d, hechard y and yann m (2016) environmental factors shaping cultured free-living amoebae and their associated bacterial community within drinking water network. water res. 100  382–392. https://doi.org/10.1016/j.watres. 2016.05.044 delafont v, mougari f, cambau e, joyeux m, bouchon d, hechard y and moulin l (2014) first evidence of amoebamycobacteria association in drinking water network. environ. sci. technol. 48 11872–11882. https://doi.org/10.1021/es5036255 douterelo i, sharpe rl, husband s, fish ke and boxall jb (2019) understanding microbial ecology to improve management of drinking water distribution systems. wiley interdisc. rev. water 6 e01325. https://doi.org/10.1002/wat2.1325 falkinham jo, ilborn ed, arduino mj, pruden a and edwards ma (2015) epidemiology and ecology of opportunistic premise plumbing pathogens: legionella pneumophila, mycobacterium avium, and pseudomonas aeruginosa. environ. health perspect. 123 749–758. https://doi.org/10.1289/ehp.1408692 falkinham jo, pruden  a and  edwards ma (2015) opportunistic premise plumbing pathogens: increasingly important pathogens in drinking water. pathogens  4 373–386. https://doi.org/10.3390/ pathogens4020373 greub g and raoult d (2004) microorganisms resistant to freeliving amoebae. clin. microbiol. rev. 17 413–433. https://doi.org/10. 1128/cmr.17.2.413-433.2004 lakundi s, khan na and siddiqui r (2014) the effect of environmental and physiological conditions on excystation of acanthamoeba castellanii belonging to the t4 genotype. parasitol. res. 113 2809–2816. https://doi.org/10.1007/s00436-014-3941-6 https://orcid.org/0000-0003-1091-0051 https://orcid.org/0000-0003-1670-4777 https://orcid.org/0000-0002-7505-8122 https://orcid.org/0000-0002-6831-1361 https://orcid.org/0000-0001-8372-2356 https://orcid.org/0000-0002-5726-4918 https://doi.org/10.1002/mbo3.391 https://www.ee.co.za/wpcontent/uploads/legacy/vector%202012/eskom_the%20eskom%20idm%20suite%20of%20solutions.pdf https://www.ee.co.za/wpcontent/uploads/legacy/vector%202012/eskom_the%20eskom%20idm%20suite%20of%20solutions.pdf https://www.ee.co.za/wpcontent/uploads/legacy/vector%202012/eskom_the%20eskom%20idm%20suite%20of%20solutions.pdf https://doi.org/10.1016/j.copbio.2006.05.007 https://doi.org/10.1155/2013/675145 https://doi.org/10.1155/2013/675145 https://doi.org/10.1016/j.watres.2016.05.044 https://doi.org/10.1016/j.watres.2016.05.044 https://doi.org/10.1021/es5036255 https://doi.org/10.1002/wat2.1325 https://doi.org/10.1289/ehp.1408692 https://www.ncbi.nlm.nih.gov/pubmed/?term=falkinham%20jo%5bauthor%5d&cauthor=true&cauthor_uid=26066311 https://www.ncbi.nlm.nih.gov/pmc/articles/pmc4493479/ https://doi.org/10.3390/pathogens4020373 https://doi.org/10.3390/pathogens4020373 https://doi.org/10.1128/cmr.17.2.413-433.2004 https://doi.org/10.1128/cmr.17.2.413-433.2004 https://doi.org/10.1007/s00436-014-3941-6 7water sa 49(1) 1–7 / jan 2023 https://doi.org/10.17159/wsa/2023.v49.i1.3947 muchesa p, leifels m, jurzik l, barnard tg and bartie c (2016) free-living amoebae isolated from a hospital water system in south africa: a potential source of nosocomial and occupational infection. water suppl. 16 70–78. https://doi.org/10.2166/ws.2015. 106 muchesa p, mwamba o, barnard tg and bartie c (2014) detection of free-living amoebae using amoebal enrichment in a wastewater treatment plant of gauteng province, south africa. biomed res. int. 2014 575297. https://doi.org/10.1155/2014/575297 rafiee m, jahangiri-rad m, hajjaran h, mesdaghinia a and hajaghazadeh m (2014) detection and identification of legionella species in hospital water supplies through polymerase chain reaction (16s rrna). j. environ. health sci. eng. 12 83. https:// doi.org/10.1186/2052-336x-12-83 sabs (2015) south african national standard 241-1: drinking water, part 1: microbiological, physical aesthetic and chemical determinants. south african bureau of standards, pretoria. scheid p (2018) free-living amoebae as human parasites and hosts for pathogenic microorganisms. multidisc. dig. publ. inst. proc. 2 692. https://doi.org/10.3390/proceedings2110692 september sm, brozel vs and venter sn (2004) diversity of nontuberculoid mycobacterium species in biofilms of urban and semiurban drinking water distribution systems. applied environ. microbiol. 70 7571–7573. https://doi.org/10.1128/aem.70.12.75717573.2004 shaheen m, scott c and ashbolt nj (2019) long-term persistence of infectious legionella with free-living amoebae in drinking water biofilms. int. j. hyg. environ. health 222  678–686. https://doi.org/10.1016/j.ijheh.2019.04.007 spilker t, coenye, t, vandamme p and lipuma jj (2004) pcr-based assay for differentiation of pseudomonas aeruginosa from other pseudomonas species recovered from cystic fibrosis patients. j. clin. microbiol. 42 2074–2079. https://doi.org/10.1128/ jcm.42.5.2074-2079.2004 stone w, louw tm, gakingo gk, nieuwoudt mj and booysen mj (2019) a potential source of undiagnosed legionellosis: legionella growth in domestic water heating systems in south africa. energ. sustain. dev. 48 130–138. https://doi.org/ 10.31224/osf.io/23fzc taylor lh, latham sm and woolhouse me (2001) risk factors for human disease emergence. philos. trans. r. soc. b 356 983–989. https://doi.org/10.1098/rstb.2001.0888 thomas v, herrera-rimann k, blancs ds and greub g (2006) biodiversity of amoebae and amoeba-resisting bacteria in a hospital water network. appl. environ. microbiol. 72 2428–2438. https://doi.org/10.1128/aem.72.4.2428-2438.2006 thomas v, mcdonell g, denyer s and maillard jy (2010) free-living amoebae and their intra-cellular pathogenic microorganisms: risks for water quality. fems microbiol. rev. 34 231–259. https://doi.org/10.1111/j.1574-6976.2009.00190.x valcina o, pule d, mališevs a, trofimova j, makarova s, konvisers g, berzin a and krumina a (2019) cooccurrence off free-living amoeba and legionella in drinking water supply systems. medicina 55  492. https://doi.org/10.3390/ medicina55080492 world health organization (2011) guidelines for drinkingwater quality, 4th edition. who press, geneva. 631 pp. url: www.who. int/publications/i/item/9789241549950 (accessed 14 september 2021). https://doi.org/10.2166/ws.2015.106 https://doi.org/10.2166/ws.2015.106 https://doi.org/10.1155/2014/575297 https://www.ncbi.nlm.nih.gov/pubmed/?term=rafiee%20m%5bauthor%5d&cauthor=true&cauthor_uid=24860661 https://www.ncbi.nlm.nih.gov/pubmed/?term=jahangiri-rad%20m%5bauthor%5d&cauthor=true&cauthor_uid=24860661 https://www.ncbi.nlm.nih.gov/pubmed/?term=hajjaran%20h%5bauthor%5d&cauthor=true&cauthor_uid=24860661 https://www.ncbi.nlm.nih.gov/pubmed/?term=mesdaghinia%20a%5bauthor%5d&cauthor=true&cauthor_uid=24860661 https://www.ncbi.nlm.nih.gov/pubmed/?term=hajaghazadeh%20m%5bauthor%5d&cauthor=true&cauthor_uid=24860661 https://doi.org/10.1186/2052-336x-12-83 https://doi.org/10.1186/2052-336x-12-83 https://doi.org/10.3390/proceedings2110692 https://doi.org/10.1128/aem.70.12.7571-7573.2004 https://doi.org/10.1128/aem.70.12.7571-7573.2004 https://doi.org/10.1016/j.ijheh.2019.04.007 https://doi.org/10.1128/jcm.42.5.2074-2079.2004 https://doi.org/10.1128/jcm.42.5.2074-2079.2004 https://doi.org/10.31224/osf.io/23fzc https://doi.org/10.31224/osf.io/23fzc https://doi.org/10.1098/rstb.2001.0888 https://doi.org/10.1128/aem.72.4.2428-2438.2006 https://doi.org/10.1111/j.1574-6976.2009.00190.x https://doi.org/10.3390/medicina55080492 https://doi.org/10.3390/medicina55080492 http://www.who.int/publications/i/item/9789241549950 http://www.who.int/publications/i/item/9789241549950 water sa 49(3) 192–198 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4058 research paper issn (online) 1816-7950 available on website https://www.watersa.net 192 correspondence willem a landman email willem.landman@up.ac.za dates received: 20 february 2023 accepted: 30 june 2023 key words forecast verification forecast skill forecast users relative operating characteristics copyright © the author(s) published under a creative commons attribution 4.0 international licence (cc by 4.0) owing to probabilistic uncertainties associated with seasonal forecasts, especially over areas such as southern africa where forecast skill is limited, non-climatologists and users of such forecasts frequently prefer them to be presented or distributed in terms of the likelihood (expressed as a probability) of certain categories occurring or thresholds being exceeded. probabilistic forecast verification is needed to verify such forecasts. whilst the resulting verification statistics can provide clear insights into forecast attributes, they are often difficult to understand, which might hinder forecast uptake and use. this problem can be addressed by issuing forecasts with some understandable evidence of skill, with the purpose of reflecting how similar forecasts may have performed in the past. in this paper, we present a range of different probabilistic forecast verification scores, and determine if these statistics can be readily compared to more commonly known and understood ‘ordinary’ correlations between forecasts and their associated observations – assuming that ordinary correlations are more intuitively understood and informative to seasonal forecast users. of the range of scores considered, the relative operating characteristics (roc) was found to be the most intrinsically similar to correlation. probabilistic vs deterministic forecasts – interpreting skill statistics for the benefit of users willem a landman1 , mark tadross2 , emma archer1 and peter johnston2 1department of geography, geoinformatics and meteorology, university of pretoria, pretoria, south africa 2climate system analysis group, university of cape town, cape town, south africa introduction there is a limit to the skill with which any forecasts are made. this statement is especially true for those seasonal forecasts that attempt to provide guidance regarding the chance of specific short-term climate changes occurring in the season ahead, owing to the inherent variability of the atmosphere (weather noise), as well as the inability to perfectly replicate all the earth system components in forecast climate models. even with improvements in numerical models (bauer et al., 2015), it is still not possible to predict the daily weather changes at a specific location months in advance, due to the chaotic nature of atmospheric circulation. there is, however, some skill in predicting anomalies (the difference between an observed value of a meteorological variable such as a mid-summer rainfall total for a particular year and its long-term average as calculated over many, typically 30, years) in the seasonal average of the weather, and there are many early documented examples that demonstrate this skill, also for south africa (e.g., bartman et al., 2003). the evolution of operational real-time seasonal forecasting in south africa has its origins in the 1990s, with the development of statistical models (jury et al., 1999; landman et al., 1999; mason, 1998). global climate models (gcms) were subsequently introduced (landman et al., 2001), followed by the combination of multiple model forecasts in the development of operational forecast systems (landman and beraki, 2012). modelling research subsequently showed that the use of fully coupled ocean–atmosphere models provides the best chance of making skillful seasonal forecasts for south africa, since these coupled models have particularly improved on models’ ability to discriminate extreme rainfall seasons from the rest of the seasons (landman et al., 2012). up to this point, a clear association with model complexity and forecast skill was demonstrated (see fig. 6 in landman 2014), because a fully coupled ocean–atmosphere model produced much higher seasonal forecast skill levels over south africa than that provided by a linear statistical seasonal forecast model. notwithstanding the modelling progress made and the testing of dynamical nesting models for higher horizontal resolution forecasts (landman et al., 2009), statistical correction methods applied to gcm output may still be recommended for contemporary coupled climate model forecasts (barnston and tippett, 2017). this multi-tiered process is still being applied at the south african weather service (saws) and the university of pretoria for operational seasonal forecasting, although forecast skill levels over south africa are limited (landman et al., 2019) and seem to have plateaued, with only incremental improvements in forecast performance (landman, 2014). notwithstanding the scientifically difficult and slow process of improving on the quality of the forecasts, significant work is being undertaken to improve the communication of forecasts and their current skill levels, in order to facilitate forecast uptake and subsequent gains in the value of the forecasts (the benefit that can be obtained based on decisions made in response to the forecasts) (vincent et al., 2020). for example, selected work has focused on providing forecast users with potential financial implications when forecasts are used in decision-making (landman et al., 2020a). whilst forecast skill levels over south africa are limited, forecasts may still be considered useful to users of such forecasts over certain regions and during certain times of the year. this realization has driven development of application forecast systems for southern africa, including for agriculture https://www.watersa.net https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://orcid.org/0000-0002-9475-6655 https://orcid.org/0000-0002-7018-404x https://orcid.org/0000-0002-5374-3866 https://orcid.org/0000-0003-3329-0334 193water sa 49(3) 192–198 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4058 (landman et al., 2020a; malherbe et al., 2014), hydrology (muchuru et al., 2016) and health (landman et al., 2020b). it should be noted that application forecasting is not the same as impact-based forecasting. the latter usually provides information required to act prior to an event occurrence (such as a drought) in order to minimize the socio-economic costs of such hazards (often used by those working in the humanitarian sector), while the former revolves around tailoring a forecast for a specific user, decision or management need. application-based forecasts are tailored seasonal forecasts developed to supplement the usual rainfall and temperature forecasts for the region. however, distributing any type of seasonal forecast data is not sufficient, and attention should also be given to producing estimates of forecast quality (stockdale et al., 2010). for example, any forecast should include a statement of the past performances of the model with which the real-time forecasts are made. seasonal forecasts are, however, most often expressed in terms of probabilities, and it is not possible to provide a simple answer to a typical question of how often in the past these forecasts have been found to be correct. this is because there are a number of attributes to consider with probability forecasts in order to ascertain their skill. the main attributes are: (i) discrimination (are the forecasts discernibly different given different outcomes?); (ii) reliability (is the confidence that is communicated in the forecast appropriate?); (iii) resolution (is there any usable information in the forecast?); and (iv) sharpness (what is the degree to which the forecasts depart from the climatology?) (trocolli et al., 2008). seasonal forecast system development and subsequent verification work in south africa has, traditionally, focused primarily on the various forecast systems’ discrimination and reliability attributes (landman, 2014; landman and beraki, 2012; landman et al., 2012, 2014, 2020b). both of these attributes are graphical procedures (as demonstrated for discrimination in the results section below and in the references listed here), and are the most commonly used procedures of this type for estimating forecast quality (trocolli et al., 2008). there is no formally recognised mathematical definition of sharpness, although good probability forecasts will have good reliability, as well as high resolution and, implicitly, high sharpness (trocolli et al., 2008). we need to also consider the notion that a forecast user struggles to distinguish between a 70% probability of a wet season and a 55% probability of a wet season (salsburg, 2001). thus sharpness as a forecast attribute may not be of much interest to such users and is subsequently not discussed further. moreover, the attributes of discrimination, reliability and resolution represent the most essential aspects of probabilistic forecast quality (jolliffe and stephenson, 2012). for discrimination, we want to measure the ability of the forecasts to distinguish an event from a non-event. in terms of reliability and resolution calculations, we will consider the algebraic decomposition of the brier score that includes reliability and resolution (mason, 2004). it is important here to note that reliability quantifies how well forecast probabilities match the corresponding observed frequencies in magnitude, and resolution measures how different these observed frequencies are from the climatological probability (which is 33.3% in this case of equi-probable categories) (wilks, 2019). the range of attributes of a forecast system suggests that there are a variety of ways for forecasts to be good or poor. there is, thus, no single answer to the question of which scoring method best measures each attribute. however, for the sake of non-scientists, it may be appropriate to see if there is a correspondence among the various scores and ‘ordinary’ correlation, since correlation is the simplest measure of skill, and the simplest and traditional method to seek associations between variables. this seems appropriate given that the most commonly used metric to calculate how well forecasts match observed values is the correlation coefficient (troccoli et al., 2008). moreover, even data analysts, among others, almost automatically, albeit somewhat uncritically, calculate a correlation coefficient when they want to obtain a measure of the linear association between two variables. further, many scientists and non-scientists frequently use the word correlation to describe how two things are linearly related, since this is quite a simple quantity to evaluate and understand; it has wide use and hence familiarity. since most people are familiar with the concept of correlation, linking correlations with probabilistic scores could provide users with a simple metric to understand whether a particular probabilistic score is high or low, as well as what that might approximately mean in terms of how well the forecast performs. the use of the term correlation coefficient in this paper refers to the pearson product-moment coefficient of linear correlation between two variables. it is essential to note here that there are other correlation coefficients (i.e., spearman rank correlation and kendall’s tau (wilks, 2019)), but the pearson correlation is by far the most widely used. the purpose of the study is to find if there may be statistical links between the more easily understandable pearson correlation and probabilistic scores that are more complicated to understand (e.g., barnston, 1992). data and method in order to establish a link between correlation and probabilistic verification scores, we first need to generate hindcasts (re-forecasts) over a long period spanning several decades from where the scores can be obtained. seasonal forecasts are not equally skillful everywhere, and southern africa’s seasonal rainfall predictability more or less ranks in the middle third of regions globally that are affected by the el niño–southern oscillation (enso) (landman et al., 2019). the central pacific ocean is one of the areas with the highest levels of seasonal predictability (latif et al., 1994). we therefore consider the predictability over three areas: (i) rainfall over the limpopo river basin (an area strongly linked with enso and associated with relatively high seasonal forecast skill); (ii) rainfall over the philippines (closer to and therefore more readily influenced by enso); and (iii) sea-surface temperatures (ssts) over the central pacific ocean (directly influenced by enso). of the three regions, the central pacific ocean has the highest predictability, followed by the philippines and the limpopo river basin (landman et al., 2019). by considering forecast skill levels over these three regions, we are thus able to cover a large range of forecast skill. our focus season is december, january and february (djf), which is a season associated with high predictability over all three regions (landman et al., 2019; trocolli et al., 2008). data two types of datasets are used. the first is archived seasonal rainfall forecast data produced by a gcm of the north american multi-model ensemble project (nmme; kirtman et al., 2014), and the second type are observed gridded datasets. the latter includes monthly rainfall totals as represented by the climatic research unit (cru; harris et al., 2021) dataset, as well as extended reconstructed sst data, version 5 (ersst.v5; huang et al. 2017). the gcm data are 12-member ensemble monthly hindcast data of the gfdl-cm2.5-flor-b01, available from the early 1980s to 2020 at a 1 × 1° latitude–longitude resolution. only 1-month leadtime hindcast data are considered. method we consider two types of forecast models – one that includes the statistical post-processing of gcm output by correcting the systematic biases in the mean and variance of the data (landman et al., 2019), and a second linear statistical model 194water sa 49(3) 192–198 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4058 for sst predictions (landman and mason, 2001). the gcm rainfall hindcasts are corrected with a regression-based algorithm from the climate predictability tool (cpt; mason et al., 2022). the bias adjustments are performed using a 5-year-out crossvalidation process applied to the hindcasts. the 3-month focus season is djf. for the 1-month lead-time considered here in predicting djf rainfall from the gcm, the model was initialized on 1 november. for djf sst hindcasts, the 1-month lead-time forecast use observed august, september and october (aso) sst fields as predictors since aso ssts only become available later in november. as mentioned earlier, seasonal forecasts should be expressed probabilistically due to weather noise and the fact that forecast models are imperfect. moreover, such probabilistic forecasts exhibit considerably higher reliability in comparison with those achieved by corresponding deterministic forecasts (murphy, 1998). here we create 30 years of probabilistic hindcasts (1990/91 to 2019/20) through a retro-active forecast process (landman et al., 2020). for both the gcm rainfall hindcast bias corrections and the statistical model for sst hindcasts, the initial training period for the retro-active process is 10 years (1980/81 to 1989/90) in order to create the 30 years of probabilistic forecasts. this 10-year period is used to predict the 1990/91 season. after this step, 11 years (1980/81 to 1990/91) are used to train the models to predict for the 1991/92 season, etc. the training period is thus updated by 1 year after each step and the process is continued until the 30 years of probabilistic hindcasts have been created. the number of grid-points involved with each region is 182 for the central pacific ocean, 181 for the philippines, and 180 for the limpopo river basin. the three areas are therefore of similar size, and the total number of grid-points considered is 543. each grid-point thus has reliability, resolution and roc values, as well as a pearson correlation value. the latter is simply the ordinary correlation between 30 years of hindcasts and the corresponding observations, and thus constitutes the deterministic correlation score at each grid-point. the probabilistic scores are calculated for three equi-probable categories of above-normal, near-normal, and below-normal values. results after the calculation of the probabilistic and deterministic scores for each grid-point is completed, all of the 543 grid-point values are plotted on scatterplots between different scores, as well as a best-fit straight line. an example of such a scatterplot is shown in fig. 1, which represents the association between two deterministic scores, i.e., the pearson and spearman rank correlation as determined over the 30 years. the correlation between these two sets of scores is 0.98. similar plots that represent the association between the probabilistic (x-axis) and deterministic (pearson correlation; y-axis) scores are constructed and the correlation between the probabilistic and deterministic scores are calculated. although the scatterplots are not shown here, table 1 is a summary of the correlations between each of the scores. the correlations in table 1 imply that the discrimination (roc) and resolution attributes of the probability forecasts are intrinsically most similar to deterministic skill values (as represented by ordinary and, by extension, ranked correlation), while reliability appears to be fundamentally different to deterministic assessments of forecast quality. there may, in fact, not be a relationship between probabilistic reliability and correlation skill (yang et al., 2018), and the correlations are seen in the table to be the highest for the outer two categories, i.e., above and below-normal values. near-normal is a category for which forecasts in general do not seem to work very well, especially when forecast skill is limited (mason et al., 2021), hence the low association of this category’s scores and deterministic skill. given that discrimination and resolution seem to be very similar attributes for determining skilful probabilistic forecasts using correlations, and that it is easier to measure discrimination than resolution in 3-category probabilistic systems (mason, 2018), we will continue our discussion by only considering discrimination. figure 1. scatterplot between pearson and spearman rank correlations (543 values). the correlation between these two variables is 0.98. the best linear fit between these two variables is shown as a straight line. also shown are density histograms of each score variable. table 1. pearson correlations between the deterministic and the listed probability scores over the 30-year test period. all positive correlations are statistically significant at 95%. categories roc reliability resolution above-normal 0.88 0.15 0.82 below-normal 0.91 −0.60 0.74 near-normal 0.24 −0.27 0.48 195water sa 49(3) 192–198 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4058 as stated above, discrimination is represented by relative operating characteristics (roc values). these values are calculated from the roc diagram. this diagram is a plot with the false alarm rate on the horizontal axis, and the hit rate on the vertical axis. a false alarm is when an event (such as a drier than normal period) was forecast to occur but did not. the false alarm rate represents the ratio of false alarms to the total number of times the event, such as a drier than normal period, did not occur. finally, the hit rate is the ratio of correct forecasts to the number of times this event occurred. a roc graph is constructed by plotting the hit rates against the false-alarm rates and is separately applied to abovenormal and below-normal probabilistic forecasts. by using this verification method, it can be shown that the forecast model has the ability to discriminate above-normal seasons from the rest of the seasons or below-normal seasons from the rest of the seasons (see fig. 2 that represents a fictitious example). the diagonal dashed line on the graph divides the graph into two equal parts, each with an area of 0.5, and indicates the line of no-skill. if the forecasts are good, the roc graph will curve towards the upper left. in the unlikely case of perfect discrimination, the curve will reach the top left corner, and the resulting area is equal to 1. in fig. 2, the area underneath the roc curve is equal to 0.73 – showing that the above-normal forecasts in this example have skill because of this high roc value. the real data results of least-squares regression analysis with roc and correlation values at all the grid-points, as obtained from the 30-years of verification, are shown in fig. 3. here we first discuss both the above-normal and below-normal categories as the ‘explanatory’ variables, and pearson correlations as the ‘target’ variable. regression analysis can quantify the nature and strength of the relationship between two variables, and in this case the linear relationship strength is reflected in the correlation between, respectively, the above-normal and below-normal roc scores, and the correlation scores as 0.88 and 0.91 (table 1). take note that the two least-square lines of fig. 3 do not precisely fall on top of each other, but differ in slope by a small amount (not significantly different). this difference in slope is likely to be attributed to the small sample of verification cases (only 30 years) typical of seasonal forecasting, so that the selection of verification period potentially influences perceived forecast skill (landman et al., 2020). figure 2. example of a roc diagram, a roc curve for the category of above-normal values, and a dashed line that represents the line of no-skill figure 3. least-squares regression lines representing the linear association between probabilistic (roc) and deterministic (pearson correlation) skill, for both the above-normal and below-normal categories. open circles are for above-normal, x’s for below-normal; blue represents nino3.4, green philippines, and red limpopo. 196water sa 49(3) 192–198 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4058 in fig. 4, the correlation value of 0.91 (also see table 1) shows that the two variables are strongly related. the red line on fig. 4 is a section of the ‘below-normal’ line of fig. 3. also shown on fig. 4 are pre-selected roc values and their corresponding pearson correlation values. the latter are calculated by using the least-squares regression equation that represents the red line obtained from the analysis. so, for a roc value greater than 0.5, the pearson correlation will be higher than 0.3; for a roc value of 0.7 the corresponding correlation value is about 0.5; and for a roc value of 0.9 the correlation is about 0.8. additional analysis involving the above-normal roc values produced similar results (not shown): for a roc value greater than 0.5, the pearson correlation will be higher than 0.23; for a roc value of 0.7 the corresponding correlation value is again at about 0.5; and for a roc value of 0.9 the correlation is 0.85. discussion the uptake and application of seasonal forecasts has been the subject of much research attention, and often concerns the salience, credibility, and legitimacy of seasonal climate forecasts (meinke et al., 2006). we agree that, aside from availability and access, comprehension and usefulness as well as trust in the forecast is of utmost importance. part of the trust issue for users, whether they are farmers, water sector practitioners or municipal decision makers, is understanding probability, which reveals an element of uncertainty, but a further element is that of being given an indication of skill, which conveys the likelihood the forecast has of being statistically correct in its probability distributions. globally there are multiple resources users can access, some of which can be applied at a regional scale, but in most cases, users rely on the regionally available forecasts that usually originate from the national ‘met’ services of their country. few of these have any skill scores attached to them. as forecasts are often interpreted and disseminated by ‘boundary organisations’ or intermediaries, or more recently used to trigger ‘anticipatory actions’ by humanitarian actors, the skill implications and probabilities are often lost, or overlooked, and the forecast is passed on as a deterministic prediction. this remains a concern. the science of seasonal forecasting has made significant advances in recent decades, including the development of sophisticated and skilful forecasting systems and the development of tailored forecasts. however, such advances remain insufficient for optimal forecast uptake and estimates of forecast quality are essential to build trust in the forecasts. this is challenging, given that forecasts are of a probabilistic nature and their quality needs to be judged accordingly, and there are a number of non-intuitive attributes that need to be considered in order to judge if probabilistic forecasts are useful. our analysis considers those attributes related to discrimination, reliability and resolution, and how they may be understood in terms of a more relatable and intuitive metric. these three attributes represent the most essential aspects of probabilistic forecast quality. in order to establish to which extent probabilistic scores can be considered high or low, we tried to demonstrate how that may correspond to more easily understood ‘ordinary’ correlation. our analyses show that the discrimination and resolution attributes of the probabilistic forecasts are similar to the deterministic assessment (i.e., correlations) of forecast quality. this similarity is mostly restricted to the outer two categories, namely, belowand above-normal. however, since discrimination is easier to measure, our focus turned to roc scores for the remainder of the work. for roc values at the lowest limit of skill (i.e., roc = 0.5), correlations are typically below 0.3; for high roc values of 0.9, correlations are near 0.8. although roc has thus been demonstrated here to be potentially very helpful to users in understanding forecast skill, the roc graph is ignoring the reliability of the forecasts. notwithstanding, the roc graph has an advantage over the reliability diagram in being less sensitive to the small sample sizes typical of seasonal forecasting. therefore, in terms of the results found here, as well as challenges faced in seasonal forecast verification, although roc values might seem like a fairly esoteric measure of forecast skill, there is often a close association with the more easily understood correlation measure. there is no single metric that can fully represent the quality of a set of forecasts – a notion also demonstrated in this paper, the result of forecast verification effectively being a multifaceted problem (troccoli et al., 2008). however, especially for areas such as southern africa where seasonal forecast skill is limited, such forecasts should be accompanied by an indication of how similar forecasts have performed in the past. here we argued that some probabilistic verification scores can be represented by a more commonly known metric such as ‘ordinary’ correlation, which may aid users of forecasts to better assimilate verification data into their decision-making processes. figure 4. least-squares regression between roc values for the below-normal category and pearson correlation. on the red line, 'x' represents the roc value, and 'y' the pearson correlation from the analysis. the 0.91 shows the association (correlation) between the roc and pearson correlation values (see table 1). 197water sa 49(3) 192–198 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4058 acknowledgments the work is supported by the national research foundation (nrf) of south africa through the apecx project funded by the nrf (grant no: 136477). we acknowledge the agencies that support the nmme-phase ii system, and we thank the climate modeling groups (environment canada, nasa, ncar, noaa/ gfdl, noaa/ncep, and university of miami) for producing and making available their model output. noaa/ncep, noaa/ ctb, and noaa/cpo jointly provided coordinating support and led development of the nmme-phase ii system. author contributions wl – statistical modelling, verification and writing of the initial draft; mt – writing and editing; ea – writing and editing; pj – writing and editing. orcids willem a landman https://orcid.org/0000-0002-9475-6655 mark tadross https://orcid.org/0000-0002-7018-404x emma archer https://orcid.org/0000-0002-5374-3866 peter johnston https://orcid.org/0000-0003-3329-0334 references barnston ag (1992) correspondence among the correlation, rmse, and heidke forecast verification measures; refinement of the heidke score. weath. forecast. 7 699–709. https://doi.org/10.1175/1520-0434 (1992)007<0699:catcra>2.0.co;2 barnston ag and tippett mk (2017) do statistical pattern corrections improve seasonal climate predictions in the north american multimodel ensemble models? j. clim. 30 8335–8355. https://doi.org/10.1175/jcli-d-17-0054.1 bartman ag, landman wa and rautenbach cjdew (2003) recalibration of general circulation model output to austral summer rainfall over southern africa. int. j. climatol. 23 1407–1419. https://doi.org/10.1002/joc.954 bauer p, thorpe a and brunet g (2015) the quiet revolution of numerical weather prediction. nature 525 (7567) 47–55. https://doi. org/10.1038/nature14956 coelho cas, stephenson db, balmaseda m, doblasreyes fj and van oldenborgh gj (2006) towards an integrated seasonal forecasting system for south america. j. clim. 19 3704–3721. https://doi.org/10.1175/jcli3801.1 harris ic, jones pd, osborn t (2021) cru ts4.05: climatic research unit (cru) time-series (ts) version 4.05 of highresolution gridded data of month-by-month variation in climate (jan. 1901 – dec. 2020). nerc eds centre for environmental data analysis. url: https://catalogue.ceda.ac.uk/uuid/c26a65020 a5e4b80b20018f148556681 (accessed 3 july, 2023). huang b, thorne pw, banzon vf, boyer t, chepurin g, lawrimore jh, menne mj, smith tm, vose rs and zhang h-m (2017) extended reconstructed sea surface temperature, version 5 (ersstv5): upgrades, validations, and intercomparisons. j. clim. 30 8179–8205. https://doi.org/10.1175/ jcli-d-16-0836.1 jolliffe it and stephenson db (2012) forecast verification: a practitioner’s guide in atmospheric science (2nd edn). wiley, new york. 274 pp. https://doi.org/10.1002/9781119960003 jury mr, mulenga hm and mason sj (1999) exploratory longrange models to estimate summer climate variability over southern africa. j. clim. 12 1892–1899. https://doi.org/10.1175/15200442(1999)012<1892:elrmte>2.0.co;2 kirtman bp, min d, infanti jm, kinter iii jl, paolino da, zhang q, van den dool h, saha s, pena mendez m, becker e and co-authors (2014) the north american multimodel ensemble: phase-1 seasonal to-interannual prediction; phase-2 toward developing intraseasonal prediction. bull. am. meteorol. soc. 95 585–601. https://doi.org/10.1175/bams-d-12-00050.1 landman wa (2014) how the international research institute for climate and society has contributed towards seasonal climate forecast modelling and operations in south africa. earth perspect. 1 22. https://doi.org/10.1186/2194-6434-1-22 landman wa and beraki a (2012) multi-model forecast skill for midsummer rainfall over southern africa. int. j. climatol. 32 303–314. https://doi.org/10.1002/joc.2273 landman wa and mason sj (2001) forecasts of near-global seasurface temperatures using canonical correlation analysis. j. clim. 14 3819–3833. https://doi.org/10.1175/1520-0442(2001)014<3819:fo ngss>2.0.co;2 landman wa, beraki a, dewitt d and lötter d (2014) sst prediction methodologies and verification considerations for dynamical mid-summer rainfall forecasts for south africa. water sa 40 (4) 615–622. https://doi.org/10.4314/wsa.v40i4.6 landman wa, barnston ag, vogel c and savy j (2019) use of el niño-southern oscillation related seasonal precipitation predictability in developing regions for potential societal benefit. int. j. climatol. 39 5327–5337. https://doi.org/10.1002/joc.6157 landman wa, archer erm and tadross ma (2020a) citizen science for the prediction of climate extremes in south africa and namibia. front. clim. 2 5. https://doi.org/10.3389/fclim.2020.00005 landman wa, sweijd n, masedi n and minakawa n (2020b) the development and prudent application of climatebased forecasts of seasonal malaria in the limpopo province in south africa. environ. dev. 35 100522. https://doi.org/10.1016/j.env dev.2020.100522 landman wa, dewitt d, lee d-e, beraki a. and lötter d (2012) seasonal rainfall prediction skill over south africa: 1vs. 2-tiered forecasting systems. weath. forecast. 27  489–501. https:// doi.org/10.1175/waf-d-11-00078.1 landman wa, kgatuke mm, mbedzi m, beraki a, bartman a and du piesanie a (2009) performance comparison of some dynamical and empirical downscaling methods for south africa from a seasonal climate modelling perspective. int. j. climatol. 29 1535–1549. https://doi.org/10.1002/ joc.1766 latif m, barnett ma, cane m, flügel m, graham ne, von storch h, xu j-s and zebiak se (1994) a review of enso prediction studies. clim. dyn. 9 167–179. https://doi.org/10. 1007/bf00208250. malherbe j, landman wa, olivier c, sakuma h and luo j-j (2014) seasonal forecasts of the sintex-f coupled model applied to maize yield and streamflow estimates over north-eastern south africa. meteorol. appl. 21 733–742. https://doi. org/10.1002/met.1402 mason sj (1998) seasonal forecasting of south african rainfall using a non-linear discriminant analysis model. int. j. climatol. 18 147–164. https://doi.org/10.1002/(sici)1097-0088(199802)18:2< 147::aid-joc229>3.0.co;2-6 mason sj (2004) on using ‘‘climatology’’ as a reference strategy in the brier and ranked probability skill scores. monthly weath. rev. 132 1891–1895. doi: https://doi.org/10.1175/1520-0493(2004)132 <1891:oucaar>2.0.co;2. mason sj (2018) guidance on verification of operational seasonal climate forecasts. world meteorological organization report no. 1220. wmo, geneva. 66 pp. mason sj, ferro cat and landman wa (2021) forecasts of “normal”. q. j. r. meteorol. soc. 147 (735) 1225–1236. https://doi. org/10.1002/qj.3968 mason sj, tippett mk, song l and muñoz ag (2022) climate predictability tool version 17.7.8. columbia university academic commons. https://doi.org/10.7916/r5bf-1x73 meinke h, nelson r, kokic p, stone r, selvaraju r and baethgen w (2006) actionable climate knowledge: from analysis to synthesis. clim. res. 33  101–110. https://doi.org/10. 3354/cr033101 https://orcid.org/0000-0002-9475-6655 https://orcid.org/0000-0002-7018-404x https://orcid.org/0000-0002-5374-3866 https://orcid.org/0000-0003-3329-0334 https://doi.org/10.1175/1520-0434(1992)007%3c0699:catcra%3e2.0.co;2 https://doi.org/10.1175/1520-0434(1992)007%3c0699:catcra%3e2.0.co;2 https://doi.org/10.1175/jcli-d-17-0054.1 https://doi.org/10.1002/joc.954 https://doi.org/10.1038/nature14956 https://doi.org/10.1038/nature14956 https://doi.org/10.1175/jcli3801.1 https://catalogue.ceda.ac.uk/uuid/c26a65020a5e4b80b20018f148556681 https://catalogue.ceda.ac.uk/uuid/c26a65020a5e4b80b20018f148556681 https://doi.org/10.1175/jcli-d-16-0836.1 https://doi.org/10.1175/jcli-d-16-0836.1 https://doi.org/10.1002/9781119960003 https://doi.org/10.1175/1520-0442(1999)012%3c1892:elrmte%3e2.0.co;2 https://doi.org/10.1175/1520-0442(1999)012%3c1892:elrmte%3e2.0.co;2 https://doi.org/10.1175/bams-d-12-00050.1 https://doi.org/10.1186/2194-6434-1-22 https://doi.org/10.1002/joc.2273 https://doi.org/10.1175/1520-0442(2001)014%3c3819:fongss%3e2.0.co;2 https://doi.org/10.1175/1520-0442(2001)014%3c3819:fongss%3e2.0.co;2 https://doi.org/10.4314/wsa.v40i4.6 https://doi.org/10.1002/joc.6157 https://doi.org/10.3389/fclim.2020.00005 https://doi.org/10.1016/j.envdev.2020.100522 https://doi.org/10.1016/j.envdev.2020.100522 https://doi.org/10.1175/waf-d-11-00078.1 https://doi.org/10.1175/waf-d-11-00078.1 https://doi.org/10.1002/joc.1766 https://doi.org/10.1002/joc.1766 https://doi.org/10.1007/bf00208250 https://doi.org/10.1007/bf00208250 https://doi.org/10.1002/met.1402 https://doi.org/10.1002/met.1402 https://doi.org/10.1002/(sici)1097-0088(199802)18:2%3c147::aid-joc229%3e3.0.co;2-6 https://doi.org/10.1002/(sici)1097-0088(199802)18:2%3c147::aid-joc229%3e3.0.co;2-6 https://doi.org/10.1175/1520-0493(2004)132%3c1891:oucaar%3e2.0.co;2 https://doi.org/10.1175/1520-0493(2004)132%3c1891:oucaar%3e2.0.co;2 https://doi.org/10.1002/qj.3968 https://doi.org/10.1002/qj.3968 https://doi.org/10.7916/r5bf-1x73 https://doi.org/10.3354/cr033101 https://doi.org/10.3354/cr033101 198water sa 49(3) 192–198 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4058 murphy ah (1998) the early history of probability forecasts: some extensions and clarification. weath. forecast. 13 5–15. https://doi. org/10.1175/1520-0434(1998)013<0005:tehopf>2.0.co;2 muchuru s, landman w and dewitt d (2016) prediction of inflows into lake kariba using a combination of physical and empirical models. int. j. climatol. 36 2570–2581. https://doi.org/ 10.1002/joc.4513 salsburg d (2001) the lady tasting tea: how statistics revolutionized science in the twentieth century. w.h. freeman and company, new york. 340 pp. stockdale tn, alves o, boer g, deque m, ding y, kumar a, landman w, mason sj, nobre p, scaife a, tomoaki o and yun wt (2010) understanding and predicting seasonal-to-interannual climate variability – the producer perspective. proced. environ. sci. 1 55–80. https://doi.org/10.1016/j. proenv.2010.09.006 troccoli a, harrison m, anderson dlt and mason sj (2008) seasonal climate: forecasting and managing risk. nato science series. earth and environmental sciences vol 82. springer, dordrecht. 467 pp. https://doi.org/10.1007/978-1-4020-6992-5 vincent k, archer e, henriksson r, pardoe j and mittal n (2020) reflections on a key component of co producing climate services: defining climate metrics from user needs. clim. serv. 20 100204. https://doi.org/10.1016/j.cliser.2020. 100204 wilks ds (2019) statistical methods in the atmospheric sciences (4th edn). academic press, amsterdam. 676 pp. yang d, yang x-q, ye d, sun x, fang j, chu c, feng t, jiang y, liang j, ren x, zhang y and tang y (2018) on the relationship between probabilistic and deterministic skills in dynamical seasonal climate prediction. j. geophys. res. atmos. 123 5261–5283. https://doi.org/10.1029/2017jd028002 https://doi.org/10.1175/1520-0434(1998)013%3c0005:tehopf%3e2.0.co;2 https://doi.org/10.1175/1520-0434(1998)013%3c0005:tehopf%3e2.0.co;2 https://doi.org/10.1002/joc.4513 https://doi.org/10.1002/joc.4513 https://doi.org/10.1016/j.proenv.2010.09.006 https://doi.org/10.1016/j.proenv.2010.09.006 https://doi.org/10.1007/978-1-4020-6992-5 https://doi.org/10.1016/j.cliser.2020.100204 https://doi.org/10.1016/j.cliser.2020.100204 https://doi.org/10.1029/2017jd028002 water sa 49(1) 19–25 / jan 2023 https://doi.org/10.17159/wsa/2023.v49.i1.3952 research paper issn (online) 1816-7950 available on website https://www.watersa.net 19 correspondence eyüp sabah email esabah@aku.edu.tr dates received: 14 october 2021 accepted: 14 november 2022 key words biopolymer central composite design travertine-processing wastewater sludge volume index turbidity copyright © the author(s) published under a creative commons attribution 4.0 international licence (cc by 4.0) a flocculation process was performed to treat travertine-processing effluents with a high concentration of suspended solids using an eco-friendly biopolymer. the experiments were conducted through a standard jar test procedure to optimize the process parameters for sludge volume index (svi) and turbidity removal. the effects of mixing time, suspension ph, and polymer dosage on treatment efficiency were investigated using central composite design, a standard technique in response surface methodology. the constructed response model was tested using the analysis of variance (anova). using the design-expert tool, the coefficients of regression models were computed. the fischer value (f-value) was used to evaluate the significance and validity of the predicted model, while the coefficient of determination (r2) was applied to estimate the model significance by comparing the predicted data with the measured data. the optimized parameters obtained were polymer dose of 276.20 mg/l, suspension ph of 8.60, and mixing time of 4.20 min. the optimal svi and turbidity values obtained were 1.36 ml/g and 2.99 ntu, respectively. additionally, r2 values for svi and turbidity were determined as 0.9337 and 0.8654, respectively. also, the difference between adjusted r2 values and predicted r2 was less than 0.2. validation tests showed that the response surface methodology is an effective method for optimizing the flocculation mechanism. application of biopolymer in turbidity removal and sludge settling behaviour of travertine-processing wastewater: performance optimization using response surface methodology (rsm) ebru taş1, emmanuel lkechukwu ugwu2, eyüp sabah1 and zeyni arsoy1 1department of mining engineering, faculty, faculty of engineering, afyon kocatepe university, 03200 afyonkarahisar, turkey 2department of civil engineering, college of engineering and engineering technology, michael okpara university of agriculture umudike, p.m.b. 7267, umuahia abia state, nigeria introduction natural stone processing/mining plants, such as for granite, travertine, marble, etc., generate a considerable amount of wastewater during cutting, washing, sizing, and polishing processes, which contains a high number of negatively charged colloidal-sized particles. such effluents of high turbidity and low solids content are not easily removed by the pre-treatment process, constituting a severe environmental issue. therefore, solid–liquid separation of wastewater across the natural stone processing industries is significant in terms of economic and ecological considerations. the machines used in the natural stone processing stages have different speeds and water consumption depending on the manufacturer and model. furthermore, the speeds at which the same machine is applied to stones with different physical properties vary. however, mutlutürk (2017) observed that the amount of water used is always approximately the same regardless of the size and properties of the stone. it was further reported by mutlutürk (2017) that the average amount of water consumed in gang saws used for cutting natural stones from dimension stone quarry is 2 650 l/m2. furthermore, s/t installed in tile lines, machines used for caliber, honing, polishing, plate and tile slim, splitting machines, bridge cutting and sizing machines, and alternative surface treatments (brushing, sandblasting, hammering, edge-corner breaking) consume approximately 875, 6 300, 480, 390, and 5 l/m2 of process water, respectively. that equates to 10 700 l of water per m2 of natural stone. the processed/treated water is used to provide this large volume of water consumed in stone processing plants. there are two output parameters used in evaluating the treatment of travertine-processing wastewater. the first output parameter is the turbidity of water obtained from the upper flow of a thickener. the removal of suspended colloidal particles from the recycled water is necessary to avert their possible detrimental effects on life as well as the efficiencies of cutting and polishing equipment in the production of tiles or slabs and to prevent clogging of water pipes and pumps, etc. (çelik and sabah, 2008). the second output parameter used is the settled sludge volume of flocculated particles. water content or solid concentration strongly affects the cost of sludge treatment (the filtration step followed by dewatering) and disposal operations. wastewater treatment is a process of treating sewage or wastewater to remove suspended solids and convert them into effluent that can be safely discharged into the environment. the coagulation/ flocculation process is a type of physicochemical wastewater treatment method to reduce colloidal turbidity and suspended solids. it is a simple, efficient, and cost-effective method for natural stone processing wastewater treatment where inorganic salts of multivalent metals are mainly used as coagulants. in contrast, anionic or long-chain nonionic polymers are commonly used as flocculants. however, applying metal coagulants could constitute some significant environmental issues, such as the production of toxic sludge (large volumes of metal hydroxide). this causes an increase in concentrations of metals such as aluminum in the treated water as well as disposal problems, which may pose adverse health effects to humans (rad et al., 2014; okolo et al., 2017; irfan et al., 2017). https://www.watersa.net https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ http://orcid.org/0000-0002-5225-0891 20water sa 49(1) 19–25 / jan 2023 https://doi.org/10.17159/wsa/2023.v49.i1.3952 the polymeric flocculants are non-biodegradable; thus, their degraded products are toxic due to the emission of minute concentrations of monomeric acrylamide in water, which could permeate the food chain, causing cancer (singh et al., 2010; huppertsberg et al., 2020). researchers worldwide are working toward developing biopolymer-based flocculants from natural sources that can substitute for synthetic polymeric flocculants, because of their accessibility, safety, and biodegradability, which have put them in high demand (lee et al., 2014). although there are many publications on coagulation/flocculation of travertine-processing wastewater using inorganic coagulants and polymeric flocculants such as polyaluminum chloride, iron salts, alum, and anionic polyacrylamides (alptekin, 2006; ersoy et al., 2009; sabah and acıksoz, 2012; taşdemir and kurama, 2013; onen et al., 2018) there is still a lack of data on the settling characteristics of the sludge of suspended travertine fines and the residual turbidity of water treated using environment-friendly biopolymers devoid of acrylamide monomers. this biopolymer is associated with an inorganic coagulant to form a new hybrid polymer that is non-toxic and biodegradable, making its application in wastewater treatment a promising possibility (lee et al., 2012). the main objective of the present study was to investigate the flocculation efficiency of an eco-friendly hybrid polymer consisting of biopolymer/inorganic metal salt, and the interactive effects of polymer dosage, mixing time, and ph, for minimizing sludge volume index (svi) and turbidity. central composite design (ccd), a response surface methodology (rsm)-based technique, was used to optimize the selected process parameters, which were aimed at obtaining the required responses. materials and methods sampling the travertine-processing wastewater was used as the effluent, and was collected in suspension form according to tse 5667–10 (2002). the effluent sample was collected from the outlet of the travertineprocessing wastewater plant located in afyonkarahisar, turkey. the sample was transported to the laboratory in 100 l barrels, stored in a 200 l capacity stirring tank, and analysed within 48 h of collection. the samples were mixed to obtain a homogenous mixture before the characterization/flocculation test was carried out. chemicals the biopolymer used in this study is a blended biopolymer and polyaluminum chloride formulation free of acrylamide monomer (bhr-p50), supplied by dober chemical company, usa. it is a whitish-yellowish-coloured opaque liquid with a viscosity and specific gravity of 500–1 300 cp and 0.95–1.15 cp, respectively. the suspension ph was adjusted using sodium hydroxide and hydrochloric acid (merck grade) solutions. preparation of solution one ml liquid biopolymer was dissolved in distilled water of 100 ml volume (ec 0.2 s/cm) to make a primary stock solution of the polymer with a concentration of 10 000 mg/l. before injecting the stock solution into the system for the flocculation tests, it was diluted with deionized water to achieve the desired concentrations of 50, 100, 200, and 400 mg/l standard biopolymer solutions. experimental procedure the flocculation experiments were carried out using a velp scientifica srl (velp jlt4) speed-controlled jar test. firstly, 500 ml of travertine suspension of 1.0% w/w solids was put in a 600 ml glass beaker, which was vigorously agitated at 300 r/min for a period of 3 min, to achieve maximum dispersion as well as to regulate the preset ph values of 6.0–10.0 by introducing sodium hydroxide/ hydrochloric acid as required. the required quantities of the flocculant were injected into the travertine suspension and subjected to agitation for an extra 1 to 5 min at 200 r/min before being reduced to 30 r/min to allow the floc to mature at 4 min preset time. after a 15 min settling period, 25 ml volume of supernatant sample was taken at 3 cm preset distance underneath the interface between air and liquid, using a unique framework consisting of a syringe with a pipe and a scale, which helped in preventing the turbidity measurements from being disrupted by the settled flocs. physical, mineralogical, and physicochemical analysis the travertine fines’ particle size distribution (psd) was determined using the malvern mastersizer 2000 laser diffraction technique. x-ray diffraction (xrd) was used to determine the mineral constituents of the travertine (shimadzu xrd-6000). the conductivity and ph of the effluent samples were determined with the aid of a ph meter (wtw inolab multi 720), whereas turbidity was determined using a turbidimeter (wtw turb 550) based on a nephelometric turbidity unit (ntu) for the supernatant of all samples, including samples with and without the biopolymer. total suspended solids (tss) and total solids (ts) concentrations were measured according to the standard methods for the examination of water and wastewater, 2540 (apha, 2005). the total dissolved solids (tds) were determined as the difference between the tss and ts. titration with a chelating agent, ethylene diamine tetraacetic acid (edta), was used to determine the ions and hardness in water mg2+(aq) and (ca2+(aq). svi is an indicator of the settling behaviour of sludge. to experimentally determine svi, 1 l of wastewater is poured into a graduated cylinder of 1 000 ml volume (imhoff cone); after waiting 30 min for settling of solids, the volume occupied by the sludge is reported in milliliters. the svi is calculated by dividing the result of the settling test in ml/l by the tss concentration in mg/l, as shown in eq. 1. svi settled sludge volume total suspended solids ml g ml l mgl 1000 (1) experimental design in optimizing process parameters for turbidity removal and sludge settling behaviour of travertine-processing wastewater, the central composite design (ccd), based on the conventional response surface methodology (rsm), was chosen. since various parameters are often represented in multiple units and also have different levels of variance, the relevance of their influence on responses could only be correlated after they had been coded. the parameters were coded, as can be seen in eq. 2, for statistical analysis. x x x xi i� � 0 � (2) where xi is the un-coded function of the ith variable, x0 is the xi value at the center of the field under investigation, while ∆x is the phase shift. three parameters in the optimization technique were selected as x1, x2, and x3 for polymer dosage, suspension ph, and mixing time, respectively. the range and levels of the coded and actual values are presented in table 1. table 1. the coded and actual values of the parameters analysed variables symbols coded and actual values 1 α 0 +α +1 polymer dosage, mg/l x1 20 50 100 200 400 suspension ph x2 6 7 8 9 10 mixing time, min x3 1 2 3 4 5 21water sa 49(1) 19–25 / jan 2023 https://doi.org/10.17159/wsa/2023.v49.i1.3952 the responses were identified as turbidity and svi. a polynomial function was used to connect the dependent with the independent variables, as seen in eq. 3. y x x x xi i i i i ii i i j i ij i j� �� �� �� � �� � � � �� � � � �0 1 5 1 5 2 1 5 1 5 (3) where y represents the dependent variable (turbidity and svi), xi and xj are the independent variables influencing y; and βo, βi, βii, and βij are the offset terms, the ith linear coefficient, the iith quadratic coefficient, the ijth interaction coefficient, and ε the error term, respectively (onukwuli et al., 2021; nnaji et al., 2022). the experimental design of this study and the responses are presented in table 2. using the design-expert tool 13 free trial version, the coefficients of regression models were computed. the fischer value (f-value) was used to evaluate the significance and validity of the predicted model (kumar et al., 2009), while the coefficient of determination (r2) was applied to estimate the model significance by comparing the predicted data with the measured data (anilkumar et al., 2016). results and discussion characterization of travertine fines and suspensions powder x-ray diffraction (xrd) of travertine fines in wastewater showed that they were composed of calcite. their particle size and distributions determined by laser light scattering are closely related to the settling characteristics of the travertine-processing wastewater. as table 3 indicates, almost 94% of travertine fines are less than 40 μm, with a mean particle size d50 of 9.32 μm. so travertine-processing wastewater has both the properties of a suspension and the nature of a colloid. therefore, it is challenging to clarify naturally. furthermore, brownian motion is significant to maintain the travertine fines in a dispersed phase because of high (to 94%) content of finely dispersed (less than 40 µm) fractions of travertine fines, fairly low (1.0%) solid ratio of the suspension, very high tss (9.722 mg/l) and turbidity (>1 085 ntu) at natural ph, and weak electronegativity on the surface of particles caused by high-valence cations like ca2+ and mg2+. this suggests that the effect of particle–particle interactions in travertine suspension was insignificant and. therefore, zeta potential would not be expected to influence sedimentation stability significantly. travertine-processing wastewater with an alkaline nature (8.24) contains high amounts of various inorganic substances such as mg2+ and ca2+, at 424 mg/l and 699 mg/l, respectively, which leads to high water hardness with 1 746 mg/l caco3 ( 175°f). this is well above the proposed limiting value and falls within the class of very hard waters. besides, the high bivalent ion concentration of the wastewater seems to decrease the specific resistance and increase the conductivity. the conductivity of the wastewater, which contained travertine fines and was measured at a natural ph, was high (2 360 µs/cm). changes in the composition and ionic strength of water, together with the colloidal behaviour of solid particles in wastewater, significantly affect the flocculation process and the floc structure. the presence of cationic compounds alters the interactions between the colloidal particles and the polymer molecules, which causes a more coiled form of the polymer chain. this implies that not only an inferior settling rate but also increased turbidity is observed (sabah and erkan, 2006). regression models for svi and turbidity statistical identification of the relationship between the operational and settling parameters and turbidity for the travertine-processing wastewater experiment is described in table 2. the regression equations for svi and turbidity are shown as eqs 4 and 5: svi = +3.85 + 1.30 x1 + 0.92 x2 – 0.52 x3 + 0.24 x1x2 – 0.09 x1x3 – 0.35 x2x3 (4) turbidity = −449.10 – 138.01 x1 – 163.85 x2 + 220.36 x3 – 28.48 x1x2 + 22.05 x1x3 + 26.25 x2x3 + 6.49 x12 −19.78 x22 – 29.89 x32 (5) where x1, x2, and x3 are polymer dosage, suspension ph, and mixing time, respectively. the effect of a single variable is defined by the coefficient of one factor, while the interaction between the two variables and the quadratic effect is defined by the coefficient of two factors and those with a second-order term. a positive sign before the words indicates a synergistic effect, while a negative sign indicates an antagonistic effect (kim, 2016). table 2. experimental design and responses std run x1 (mg/l) x2 x3 (min) turbidity (ntu) svi (ml/g) 22 1 20 6 1 21.6 1.34 8 2 20 7 2 40.4 1.54 19 3 20 8 3 74.8 1.77 6 4 20 9 4 77.5 1.85 17 5 20 10 5 41.6 1.95 21 6 50 7 1 11.8 2.06 18 7 50 8 2 20.5 2.26 10 8 50 9 3 25.4 2.37 16 9 50 10 4 13.1 2.08 23 10 50 6 5 17.2 1.85 7 11 100 8 1 8.71 2.28 11 12 100 9 2 14.4 2.35 13 13 100 10 3 7.25 2.67 15 14 100 6 4 11.7 1.65 24 15 100 7 5 19.9 2.16 14 16 200 9 1 8.36 2.67 2 17 200 10 2 4.78 2.88 3 18 200 6 3 7.38 2.06 25 19 200 7 4 11.2 2.47 4 20 200 8 5 19.1 2.57 5 21 400 10 1 2.95 3.29 12 22 400 6 2 3.68 2.26 9 23 400 7 3 4.68 2.88 1 24 400 8 4 6.37 2.98 20 25 400 9 5 13.1 3.09 table 3. characteristics of the travertine-processing wastewater and fines parameter value suspension natural ph 8.24 solid content (%) 1.0 total suspended solids (mg/l) 9 722 turbidity (ntu) >1 095 conductivity (µs/cm) 2 360 total hardness (mg/l caco3) 1 746 mg2+ concentration (mg/l) 424 ca2+ concentration (mg/l) 699 solid particle size less than 40 µm (%) 94 mean particle size, d50 (µm) 9.32 mineral component calcite 22water sa 49(1) 19–25 / jan 2023 https://doi.org/10.17159/wsa/2023.v49.i1.3952 fit statistics for svi and turbidity the fit statistics for svi are shown in table 4, while that for turbidity is shown in table 5. the values obtained for the coefficients of determination (r2 of 0.9337 and 0.8654 for svi and turbidity, respectively) are indications that the empirical model could only account for 10.2% of the overall variation (ahamad et al., 2005). moreover, the variation between the adjusted r2 values and the predicted r2 was less than 0.2 (tables 4 and 5). this confirms that the adjusted r2 values are consistent with the r2 values predicted. considering the two responses, the predicted values for svi are the nearest to the values observed in the experiment, with a coefficient of determination of 0.9337 and the lowest standard deviation of 0.1492 (table 4). this means that the experimental values are well-adjusted to the developed models. the model is best if the value of the coefficient of determination is close to 1. the standard deviation, as well as the coefficient of variation (cv) obtained, are both low, implying that the models could be replicated (tables 4 and 5). the results of adequate precision (tables 4 and 5) are much higher than the optimal value of 4, indicating that the model is well-fitted (das, 2017). the obtained values of adequate precision demonstrate an appropriate fit that shows the model’s ability to navigate the design space (design-expert, 2018). analysis of variance (anova) for svi and turbidity at 95% confidence level, the models for the responses were checked for validity, as presented in tables 6 and 7. in anova, the model and parameters are significant when p < 0.05; therefore, the models were statistically significant, as shown by p values of <0.05 (aravind et al., 2015). the findings also revealed f-values of 42.23 and 5.44 for svi and turbidity (tables 6 and 7). the f-value is a metric that indicates how well empirical models are suited to describing the statistical variance. the lower the value of p and the higher the value of f, the higher the level of significance of the coefficient terms and the model’s ability to explain data variation (chowdhury, 2013). all the individual terms for svi and turbidity were significant in the models. in the case of interaction terms, x1x2 and x2x3 were substantial in the models for svi and turbidity, while x1x3 was not important in the models (tables 6 and 7). the quadratic terms x22 (p = 0.0350) and x32 (p = 0.0032) for turbidity were significant in the model, whereas x12 (p = 0.4950) was not significant (significance is determined by comparing the f-value and p-value results) (table 7). the lack of fit was ineffective in any of the scenarios, confirming the accuracy of the developed models (mondal et al., 2020). the polymer dosage (x1) had the most significant impact on svi (table 6), whereas the mixing time (x3) had the most significant effect on turbidity removal (table 7), according to the f values. table 4. fit statistics for svi statistic value standard deviation 0.1492 mean 2.29 coefficient of variation (%) 6.50 coefficient of determination (r2) 0.9337 adjusted coefficient of determination 0.9116 predicted coefficient of determination 0.8626 adequate precision 23.9586 table 5. fit statistics for residual turbidity statistic value standard deviation 2.10 mean 9.50 coefficient of variation (%) 12.06 coefficient of determination (r²) 0.8654 adjusted coefficient of determination 0.7346 predicted coefficient of determination 0.7265 adequate precision 18.2066 table 6. analysis of variance for svi source sum of squares df mean squared f-value p-value lack-of-fit model 5.64 6 0.9396 42.23 < 0.0001 significant x1 0.4081 1 0.4081 18.34 0.0004 significant x2 0.4071 1 0.4071 18.30 0.0005 significant x3 0.1308 1 0.1308 5.88 0.0261 significant x1x2 0.2366 1 0.2366 10.63 0.0043 significant x1x3 0.0339 1 0.0339 1.52 0.2328 not significant x2 x3 0.4101 1 0.4101 18.43 0.0004 significant residual 0.4005 18 0.0223 corrected total 6.04 24 table 7. analysis of variance for residual turbidity source sum of squares df mean square f-value p-value lack-of-fit model 7 164.10 9 796.01 5.44 0.0021 significant x1 1 236.67 1 1 236.67 8.45 0.0109 significant x2 878.52 1 878.52 6.00 0.0271 significant x3 1 589.06 1 1 589.06 10.85 0.0049 significant x1x2 1 092.21 1 1 092.21 7.46 0.0155 significant x1x3 654.23 1 654.23 4.47 0.0517 not significant x2 x3 691.70 1 691.70 4.72 0.0462 significant x1² 71.61 1 71.61 0.4891 0.4950 not significant x2² 786.30 1 786.30 5.37 0.0350 significant x3² 1 796.23 1 1 796.23 12.27 0.0032 significant residual 2 196.35 15 146.42 corrected total 9 360.45 24 23water sa 49(1) 19–25 / jan 2023 https://doi.org/10.17159/wsa/2023.v49.i1.3952 effect of process parameters on svi and turbidity the plots showing the response surface for svi are presented in fig. 1. the result indicated that the svi increased as the suspension ph and polymer dosage increased (fig. 1a). fig. 1b shows that the svi is at the lowest when the polymer dosage decreases, irrespective of the mixing time value. in the case of mixing time and suspension ph, as the suspension ph increased and the mixing time decreased, svi increased (fig. 1c). svi is guided by three variables in the coagulation-flocculation technique, i.e, hydration, high polymer, and osmotic pressure effects (ives, 1978). the hybrid polymer used in this study was a blended biopolymer and polyaluminum chloride (pac) formulation carrying highly positive polymer charges. when the polymer was positively charged, the osmotic effect could be reduced, and the high polymer effect could be ignored (wang et al., 2007). therefore, a hybrid polymer with cationic nature was favourable for minimizing the svi under neutral and slightly acidic conditions. the plots showing the response surface for turbidity are presented in fig. 2. the significant decrease in the response surface plots suggests that the best conditions were precisely within the model boundaries (fig. 2). the effect of mixing time and suspension ph indicates that as the mixing time increased and the suspension ph decreased, the turbidity removal increased (fig. 2a). the optimal conditions were found in the region where the mixing time increased from 1 to 5 min while the polymer dosage decreased from 400 to 20 mg/l on the response surface plot for mixing time versus polymer dosage (fig. 2b). conversely, the polymer dosage, suspension ph, and mixing time all had noticeable interactive effects on residual turbidity. this is due to the internal interactions of the variables. the destabilization capacity of mono-component travertine-processing wastewater increases in alkaline and neutral media due to charge neutralization between al species contained in the hybrid polymer and negatively charged travertine-processing wastewater fines (sabah and acıksoz, 2012). also, more mixing time is required to ensure adequate contact between the polymer molecules and colloidal particles to create stable flocs, in the case of low polymer concentrations. the optimal conditions were found in the zone where the polymer dosage increased from 200 to 400 mg/l while the ph decreased from 10.0 to 6.0, according to the response surface plot for mixing time versus suspension ph (fig. 2c). the sphere-like shape, with the highest response at the central curvature (fig. 2c) implies that polymer dosage, as well as suspension ph, had a strong effect on turbidity removal (wang et al., 2007). optimization of svi and turbidity for model validation, the experiments were performed with the predicted values. the process optimization solution was chosen on the basis of its proximity to one of the highest desirability (araromi et al., 2017). the target for optimization of svi and turbidity was set at the minimum for all the operating conditions studied. the following were the optimal conditions for svi and turbidity: polymer dosage of 276.20 mg/l, suspension ph of 8.60, and mixing time of 4.20 min, with the minimum turbidity and svi determined to be 2.99 ntu and 1.36 ml/g, respectively, within the optimal conditions (table 8). based on the results obtained, the experimental values of turbidity, as well as svi, were very close to the predicted values. this implies that the rsm method was very efficient in optimizing the coagulation-flocculation technique (wang et al., 2007). figure 1. plots for svi: effects of (a) suspension ph and flocculant dosage ph, (b) mixing time and flocculant dosage, (c) mixing time and suspension ph 24water sa 49(1) 19–25 / jan 2023 https://doi.org/10.17159/wsa/2023.v49.i1.3952 conclusions considering the high volume of wastewater containing a large amount of suspended solids generated from natural stone mining/ processing plants (marble, travertine, granite, etc.), the practical and economical treatment of travertine-processing wastewater to meet water quality objectives for wastewater reclamation and reuse and to protect public health is an important topic. obtaining treated travertine-processing wastewater with low turbidity and low svi is the essential objective to be achieved through the flocculation process using an eco-friendly biopolymer derived from chitosan and plants. in this study, the flocculation technique was applied in turbidity removal and sludge settling behaviour of travertine-processing wastewater using a biopolymer as a flocculant. a total of 20 ccd-based experimental runs were generated to optimize the polymer dosage, suspension ph, and mixing time. a desirability function technique was used to obtain equilibrium between the different responses of svi and turbidity. the optimization study was aimed at minimizing svi and turbidity, and the results indicated that the optimum values of mixing time, suspension ph, and polymer dosage to achieve the minimum svi, as well as turbidity, were 276.20 mg/l, 8.60, and 4.20 min, respectively. the optimal svi and turbidity values obtained were 1.36 ml/g and 2.99 ntu. the rsm approach was found to be efficient in optimizing the flocculation process in validation experiments. author contributions mr sabah supervised the investigation; mrs taş applied the experiments; mr ugwu developed the methodology; mr arsoy prepared the tables; mrs taş, mr ugwu, mr sabah and mr arsoy discussed the method and the main text. orcid eyüp sabah http://orcid.org/0000-0002-5225-0891 references ahamad al, ismail s and bhatia s (2005) optimization of coagulation–flocculation process for palm oil mill effluent using response surface methodology. environ. sci. technol. 39 2828–2834. https://doi.org/10.1021/es0498080 figure 2. plots for turbidity: effects of (a) mixing time and suspension ph, (b) flocculant dosage and mixing time, (c) suspension ph and flocculant dosage table 8. optimization of svi and residual turbidity response flocculant dosage (mg/l) suspension ph mixing time (min) predicted values (%) experimental values (%) error (%) svi (ml/g) 276.20 8.61 4.20 1.34 1.36 0.02 turbidity (ntu) 276.20 8.61 4.20 2.95 2.99 0.04 http://orcid.org/0000-0002-5225-0891 https://doi.org/10.1021/es0498080 25water sa 49(1) 19–25 / jan 2023 https://doi.org/10.17159/wsa/2023.v49.i1.3952 alpteki̇n am (2006) purification of natural stone wastewaters with flocculation/coagulation method. master’ thesis, afyon kocatepe university (in turkish). anilkumar b, chitti nb and kavitha g (2016) biosorption of zinc on to gracilariacorticata (red algae) powder and optimization using central composite design. j. appl. sci. eng. method. 2 (3) 412–425. apha (2005) standard methods for the examination of water and wastewater. american public health association, american water works association, water environment federation, washington. araromi do, alade ao, bello mo, bakare t, akinwande ba, jameel at and adegbola sa (2017) optimization of oil extraction from pitanga (eugenia uniflora l) leaves using simplex centroid design (scd). sep. sci. technol. 52 (8) 341–1349. https://doi. org/10.1080/01496395.2017.1287199 aravind j, lenin c, nancyflavia c, rashika p and saravanan s (2015) response surface methodology optimization of nickel (ii) removal using pigeon pea pod biosorbent. int. j. environ. sci. technol. 12 105–114. https://doi.org/10.1007/s13762013-0391-0 chowdhury zc (2013) preparation, characterization and adsorption studies of heavy metals onto activated adsorbent materials derived from agricultural residues. phd thesis, university of malaya. çelik my and sabah e (2008) geological and technical characterization of iscehisar (afyon-turkey) marble deposits and the impact of marble waste on environmental pollution. j. environ. manage. 87 (1) 106–116. https://doi.org/10.1016/j.jenvman. 2007.01.004 das b (2017) response surface modeling of copper (ii) adsorption from aqueous solution onto neem (azadirachta indica) bark powder: central composite design approach. j. mater. environ. sci. 8 (7) 2442–2454. design-expert (2018) design-expert software. version 11.0.3, statease inc., minneapolis. ersoy b, tosun i, günay a and dikmen s (2009) turbidity removal from wastewaters of natural stone processing by coagulation/flocculation methods. clean soil air water 37 (3) 225–232. https://doi.org/10.1002/clen.200800209 huppertsberg s, zahn d, pauelsen f, reemtsma t and knepper tp (2020) making waves: water-soluble polymers in the aquatic environment: an overlooked class of synthetic polymers? water res. 181 115931. https://doi.org/10.1016/j.watres.2020.115931 irfan m, butt t, imtiaz n, abbas n, ahmad r and shafique a (2017) the removal of cod, tss and colour of black liquor by coagulation-flocculation process at optimized ph, settling and dosing rate. arab. j. chem. 10 2307–2318. https://doi.org/10.1016/j. arabjc.2013.08.007 ives kj (1978) rate theories. in: ives kj (ed.) the scientific basis of flocculation. springer, the netherlands. kim sc (2016) application of response surface method as an experimental design to optimize coagulation-flocculation process for pre-treating paper wastewater. j. ind. eng. chem. 38 93–102. https://doi.org/10.1016/j.jiec.2016.04.010 kumar r, singh r, kumar n, bishnoi k and bishnoi nr (2009) response surface methodology approach for optimization of biosorption process for removal of cr(vi), ni(ii) and zn(ii) ions by immobilized bacterial biomass sp. bacillus brevis. chem. eng. j. 146 401–407. https://doi.org/10.1016/j.cej.2008.06.020 lee cs, robinson j and chong mf (2014) a review on application of flocculants in wastewater treatment. process. saf. environ. 92 (6) 489–508. https://doi.org/10.1016/j.psep.2014.04.010 lee ke, morad n, teng tt and poh bt (2012) development, characterization and the application of hybrid materials in coagulation/flocculation of wastewater: a review. chem. eng. j. 203 370–386. https://doi.org/10.1016/j.cej.2012.06.109 mondal m and ray ak (2020) removal of as(v) using low cost adsorbents: aerocrete and vermiculite modified with iron oxy-hydroxide. adsorption 26 387–396. https://doi.org/10.1007/ s10450-020-00201-y mutlutürk m (2017) natural stone production and water interaction. in: 9th international marble and natural stones congress and exhibition of turkey, belek-antalya, turkey, 13–15 december 2017. 481–488. nnaji pc, anadebe vc, onukwull od, okoye cc and ude aj (2022) multifactor optimization for treatment of textile wastewater using complex salt–lufa cylindrical seed extract (cslcse) as coagulant: response surface methodology (rsm) and artificial intelligence algorithm (ann–anfis). chem. pap. 76 2125–2144. https://doi.org/10.1007/s11696-021-01971-7 onen v, beyazyuz p and yel e (2018) removal of turbidity from travertine processing wastewaters by coagulants, flocculants and natural materials. mine water environ. 37 (3) 482–492. https://doi. org/10.1007/s10230-017-0499-4 rad hd, atari l, babaei aa and goudarzi g (2014) analysis of heavy metal contents by using poly aluminum chloride water treatment residuals and their implications for land application. asian j. chem. 22 7651–7656. https://doi.org/10.14233/ajchem.2014.17483 okolo bi, nnaji pc, oke eo, adekunle kf, ume cs and onukwuli od (2017) optimizing bio-coagulants for brewery wastewater treatment using response surface methodology. niger. j. technol. 36 (4) 1104–1113. https://doi.org/10.4314/njt.v36i4.16 onukwuli od, nnaji̇ pc, menkiti mc, anadebe vc, oke eo, ude cn and ude cj (2021) dual-purpose optimization of dyepolluted wastewater decontamination using bio-coagulants from multiple processing techniques via neural intelligence algorithm and response surface methodology. j. taiwan inst. chem. eng. 125 372–386. https://doi.org/10.1016/j.jtice.2021.06.030 sabah e and aciksoz c (2012) flocculation performance of fine particles in travertine slime suspension. physicochem. probl. miner. process. 48 (2) 555–566. https://doi.org/10.5277/ppmp120219 singh rp, karmakar gp, rath sk, karmakar nc, pandey sr, tripathy t, panda j, kanan k, jain sk and lan nt (2000) biodegradable drag-reducing agents and flocculants based on polysaccharides: materials and applications. polym. eng. sci. 40 46–60. https://doi.org/10.1002/pen.11138 taşdemi̇r t and kurama h (2013) fine particle removal from natural stone processing effluent by flocculation. environ. prog. sustain. energ. 32 (2) 317–324. https://doi.org/10.1002/ep.11634 tse 5667-10 (2002) water quality – sampling – part 10: guidance on sampling of waste waters. turkish standards institution (tse), ankara wang j, chen y, ge x and yu h (2007) optimization of coagulation–flocculation process for a paper-recycling wastewater treatment using response surface methodology. colloids surf. a. 302 204–210. https://doi.org/10.1016/j.colsurfa.2007.02.023 zainudin nf, lee kt, kamaruddin kt, bhatia s and mohamed ar (2005) study of adsorbent prepared from oil palm ash (opa) for flue gas desulfurization. sep. purif. technol. 45 50-60. https://doi.org/10.1016/j.seppur.2005.02.008 https://doi.org/10.1080/01496395.2017.1287199 https://doi.org/10.1080/01496395.2017.1287199 https://doi.org/10.1007/s13762-013-0391-0 https://doi.org/10.1007/s13762-013-0391-0 https://doi.org/10.1016/j.jenvman.2007.01.004 https://doi.org/10.1016/j.jenvman.2007.01.004 https://doi.org/10.1002/clen.200800209 https://doi.org/10.1016/j.watres.2020.115931 https://doi.org/10.1016/j.arabjc.2013.08.007 https://doi.org/10.1016/j.arabjc.2013.08.007 https://doi.org/10.1016/j.jiec.2016.04.010 https://doi.org/10.1016/j.cej.2008.06.020 https://doi.org/10.1016/j.psep.2014.04.010 https://doi.org/10.1016/j.cej.2012.06.109 https://doi.org/10.1007/s10450-020-00201-y https://doi.org/10.1007/s10450-020-00201-y https://doi.org/10.1007/s11696-021-01971-7 https://doi.org/10.1007/s10230-017-0499-4 https://doi.org/10.1007/s10230-017-0499-4 https://doi.org/10.14233/ajchem.2014.17483 https://doi.org/10.4314/njt.v36i4.16 https://doi.org/10.1016/j.jtice.2021.06.030 https://doi.org/10.5277/ppmp120219 https://doi.org/10.1002/pen.11138 https://doi.org/10.1002/ep.11634 https://doi.org/10.1016/j.colsurfa.2007.02.023 https://doi.org/10.1016/j.seppur.2005.02.008 water sa 49(2) 96–102 / apr 2023 https://doi.org/10.17159/wsa/2023.v49.i2.3992 research paper issn (online) 1816-7950 available on website https://www.watersa.net 96 correspondence robin petersen email robin.petersen@sanparks.org current address scientific services, south african national parks, the royal hotel, knysna, south africa dates received: 25 april 2022 accepted: 18 april 2023 key words seasonal ephemeral perennial rivers recharge discharge conceptual model semi-arid copyright © the author(s) published under a creative commons attribution 4.0 international licence (cc by 4.0) the role of groundwater, in general, is often overlooked in freshwater ecosystem management policies and in the management of south africa’s flagship conservation area, the kruger national park (knp). to address this gap, a generalised conceptual model of surface water–ground water (sw–gw) interactions in the southern and central regions of the knp was developed. to do this, stable isotope ratios (δ18o and δ2h) of groundwater, rainfall and surface water were used to determine the extent to which the base flow of perennial, seasonal and ephemeral streams on different geologies (granite vs. basalt) is driven by rainfall or groundwater. these results show that the δ18o and δ2h ratios of perennial rivers are similar to that of groundwater, while seasonal and ephemeral rivers on basalts have values closer to rainfall. on granite substrates, however, the isotope ratios of the seasonal and ephemeral rivers have values closer to groundwater than rainfall. the larger seasonal mbyamiti river had similar isotope ratios to that of groundwater, and the highly ephemeral nwaswitsontso had episodic interaction with groundwater (i.e. isotopic ratios overlap occasionally). these results show that decisions necessary for the sustainable management of groundwater resources are better informed when the natural interaction, movement, and exchange between groundwater and rivers are understood. this has particular relevance for large conservation areas in southern africa that are expected to experience more variable climates in the future with both increases in drought and rainfall intensities. the use of stable isotopes to identify surface water–groundwater interaction in the kruger national park, south africa rm petersen1,2 , jm nel2, t strydom1, e riddell3,5, c coetsee1,6 and e february4 1scientific services, south african national parks, private bag x402, skukuza 1350, south africa 2environmental and water science unit, university of the western cape, private bag x17, bellville 7530, south africa 3conservation management services, south african national parks, private bag x402, skukuza 1350, south africa 4department of biological sciences, university of cape town, hw pearson building, university ave n, rondebosch, cape town 7701, south africa 5centre for water resources research, university of kwazulu-natal, private bag x01, scottsville, pietermaritzburg 3209, south africa 6school of natural resource management, nelson mandela university, george campus, george, 6530 introduction groundwater accounts for almost 90% of earth’s readily available freshwater yet, because it is out of sight, remains underappreciated and poorly managed (jakeman et al., 2016). while global climate change models for southern african savannas predict no change in the amount of total rainfall received (easterling et al., 2000; frich et al., 2002; pohl et al., 2017), the models also predict increases in rainfall intensity and increases in frequency and severity of droughts (spinoni et al., 2014). combined with these effects of more variable water supply are development pressures which are resulting in increased demands on previously unexploited aquifers (mussá et al., 2015; du plessis, 2019). increasing droughts and anthropogenic demands, paired with poor management of groundwater resources, have resulted in multiple problems across the globe. these include overexploitation which can result in land subsidence and declines in water table levels, with harmful effects on groundwaterdependent surface water systems (vegter and pitman, 2003; wada et al., 2010; wada et al., 2012; wada and heinrich, 2013). monitoring and management decisions necessary for the sustainable utilisation of groundwater resources are better informed when the natural interaction, movement, and exchange between groundwater and rivers are understood (glazer and likens, 2012; gleeson and richter, 2018). in semi-arid ecosystems such as the kruger national park (knp) (newman et al., 2006), groundwater plays an important role in sustaining river baseflows and pools (zektser and loaiciga, 1993; parsons, 2004; hughes et al., 2007; le maitre and colvin, 2008). given this context, large conservation areas such as the knp are important for understanding natural hydrogeological processes largely unaffected by anthropogenic activities. there is a total of 31 584 km of mostly secondor higher-order streams flowing across a west−east geological facies from granite to basalt in the park. these extensive drainage networks distribute water throughout the park and act as hotspots for biodiversity and productivity (mabunda et al., 2003; rogers and o’keeffe, 2003). the stable 18o and 2h isotopes in water are ideal tracers for catchment-scale studies on surface water−groundwater (sw−gw) interactions and have been applied in many systems around the world (gat, 1971; thomas and rose, 2003; gibson et al., 2005; kalbus et al., 2006; praamsma et al., 2009). these isotopes have been used to identify sources of groundwater recharge (praamsma et al., 2009; liu and yamanaka 2012), discharge locations (gleeson et al., 2009; praamsma et al., 2009), and to develop a conceptual understanding of sw−gw interaction at a landscape scale (riddell et al., 2016). as groundwater is dependent on the accumulation of rain through time, the stable isotope ratio of the groundwater will be a weighted average of rainwater inputs through time. as a result the isotope ratio of groundwater tends to be different from that of rain and surface water (gat, 1971). https://www.watersa.net https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://orcid.org/0000-0002-2770-9461 97water sa 49(2) 96–102 / apr 2023 https://doi.org/10.17159/wsa/2023.v49.i2.3992 here, a conceptual model was developed of the interactions between groundwater and perennial, seasonal and ephemeral streams in the southern and central regions of the knp. to do this, a comparison was made using stable isotope ratios of δ18o and δ2h belonging to groundwater, rainfall and surface water. it was anticipated that when there is extensive mixing of water among rainwater, surface water and groundwater, isotopic ratios will be very similar, while limited mixing of these waters will give rise to very distinct isotopic ratios (rozanski et al., 2001). depending on the size and main geologic substrate of the river or stream, the extent of interactions will differ. it was predicted on the basis of previous work (rozanski et al., 2001; xu et al., 2002; price, 2011) that larger perennial rivers will have extensive interactions with groundwater reflected in high overlap of isotopic ratios, while seasonal streams will have lower interactions with groundwater, and ephemeral streams should primarily be rainfall derived and have very limited interactions with groundwater. methods the knp extends across the mpumalanga and limpopo provinces in north-eastern south africa. it is one of the largest conservation areas in africa (du toit et al., 2003), covering almost 2 million hectares. it also forms part of the great limpopo transfrontier park, a 3.5 million hectare conservation estate shared with neighbouring zimbabwe and mozambique. besides the higher elevated areas of the park, i.e., the lebombo and malelane mountains (~500–800 m), the park is a gently undulating landscape between 200 m and 400 m above sea level with a gentle gradient to the east (schutte, 1986; venter, 1990). rainfall in the knp is concentrated in a wet season of around 5–8 months at the hottest time of the year, alternating with a dry season when there is little or no rain (gertenbach, 1980). mean monthly maximum and minimum temperatures are 26.3°c and 17.5°c, respectively, in southern kruger (i.e. pretoriuskop) and 29.8°c and 16°c, in central kruger (i.e. at satara). mean annual precipitation is 737 mm at pretoriuskop and 547 mm at satara (zambatis, 2003; macfadyen et al., 2018). potential evaporation for the kruger region is upwards of 2 000 mm/a (jovanovic et al., 2015) whilst modelled estimates of annual actual evapotranspiration have been determined at close to 800 mm/a on granite catchments and 600 mm/a on basalts (riddell et al., 2015) most of this rain occurs in the form of thunderstorms and frontal systems, associated with the inter-tropical convergence zone (itcz), between november and march with a peak in january and february (gertenbach, 1980). the storms are typically of short duration lasting just minutes or a few hours. as a result, the rainfall intensity is often high, leading to flash floods in the ephemeral drainage lines (venter et al., 2003). the long-term rainfall of the knp oscillates through periods of aboveand below-average rainfall with cycles lasting approximately 10 years (gertenbach, 1980). the most important lithostratigraphic units are the basement complex which consists of ancient granitoid rocks of swazian age (> 3 090 ma), sedimentary and volcanic rock of the soutpansberg group, and the volcanic rock of the karoo supergroup (venter, 1990). granitic rocks occur in the west and the basaltic and rhyolitic rocks in the east. a thin north−south strip of sedimentary rocks separates the granitic and basaltic rock formations (bristow and venter, 1986; schutte, 1986). the influence of geology and resulting soils creates a strong correlation with the structure of the terrestrial ecosystem (venter, 1986; venter et al., 2003). soil profiles generally become shallower as rainfall decreases towards the north. this is particularly noted for the coarse-grained soils derived from the granitic materials, where soil depths decrease from approximately 150 cm in the south near the pretoriuskop area. the karoo sequence (basalt), which is a predominantly flat landscape (low undulation), produces soils that have high clay content with olivine-rich clay soils in the northern plains and olivine-poor soils in the southern plains. alluvial soils occur along most of the drainage lines in the knp, the extent of which increases as the size of drainage lines increases (venter, 1986; venter et al., 2003). the park is drained by two major transboundary river systems, the limpopo system which forms the northern boundary of the park, and the incomati system, of which the crocodile river forms the southern boundary (venter and bristow, 1986). the park interior is drained by five perennial rivers (i.e., luvuvhu, letaba, olifants, crocodile, and sabie rivers), which flow west to east across the park before flowing into mozambique and the indian ocean. important seasonal and ephemeral rivers that originate in the park are the shingwedzi, phugwane, and mphongolo rivers in the north, the tsende, timbavati, nwaswitsontso, ripape, and sweni rivers in the central region, and the mbyamiti, nwaswitshaka and mlondozi rivers in the south. these rivers predominantly carry water following heavy rainfall during the summer months and, depending on the size of the catchment and geology, have flow durations that last from a couple of weeks to most of the wet season months (venter and bristow, 1986). crystalline basement aquifers dominate the park and are classified into three hydrogeological domains (fischer et al., 2009; du toit, 2017): (i) composite aquifers comprised of a variable thickness of regolith overlying bedrock with the upper part frequently fractured; (ii) deep fractured aquifers composed mainly of crystalline material (igneous and metamorphic rocks) characterized by a complex arrangement of interconnected fracture systems; and (iii) alluvial aquifers, where alluvial material overlies or replaces the weathered overburden which can be found along with river systems such as the sabie and sand rivers. the depths of groundwater vary from 1.2 m to 40 m and the aquifers are low-yielding at 1.5–3 l/s and rarely exceeding 5 l/s (vegter, 2003; du toit, 2017). the average groundwater recharge rate for the entire knp is estimated at 12 mm/a, 2.3% of the average rainfall (vegter, 2003; du toit, 2017). the groundwater flows from a regional perspective from west to east through the park, closely following the surface water drainage regions (du toit, 2017). study sites to describe the nature of sw−gw interaction, i.e., groundwater recharge by surface water, or discharge of groundwater into surface water, an existing classification system was used whereby streams are classified according to streamflow characteristics (xu et al., 2002; lerner, 2003; vegter and pitman, 2003): i.e., ephemeral, seasonal and perennial. this resulted in the following classifications: nwaswitsontso (ephemeral) and sweni (seasonal) rivers in the satara region, and the mbyamiti (seasonal) and mlondozi (ephemeral) rivers in the south. the sabie and sand rivers are two major perennial rivers flowing from west to east through the study area. five sites were selected, representative of the main geological units in the park. three boreholes, rietpan, mafutsu and sweni-hide, are located in the karoo sequence consisting of the letaba formation (basalts) and the intrusive jozini formation (rhyolite), while two boreholes, jock and msanimond, are located in the basement complex that consists of the nelspruit granite suite and orpen gneiss (granites). these boreholes are located between 200 m and 500 m from important seasonal and ephemeral rivers and between 30 and 60 km from the perennial sabie and sand rivers (see fig. 1). sampling and analytical procedures samples of groundwater, surface water and precipitation were collected at the end of each month for two dry seasons (may–oct 2010 and 2011) and one wet season (nov–apr 2011). cumulative 98water sa 49(2) 96–102 / apr 2023 https://doi.org/10.17159/wsa/2023.v49.i2.3992 monthly rainfall samples were obtained from permanent rainfall gauges installed close (10–50 m) to the boreholes. the rain gauges are standard polypropylene 100 mm gauges with 30 mm of paraffin oil to prevent evaporation, and thereby minimise the risk of enriching of the remaining water (february et al., 2007b). a total of 45 rainfall samples collected throughout the sampling period were used to develop a local meteoric water line (lmwl) with the equation for the best fit line using a regression analysis with an equation δ2h = 8.66 δ18o + 2.23 (r2 = 0.58). surface water samples were collected from the seasonal and ephemeral mbyamiti, sweni, mlondozi, and nwaswitsontso rivers, and sabie and sand perennial rivers. water samples collected from the associated rivers and streams were sampled directly (grab samples), about 10–15 cm below the water surface, either in pools or in-stream when rivers were flowing. groundwater samples were collected from the selected boreholes by purging the aquifer using a submersible pump powered by a small generator. the water samples were collected directly from the outlet pipe after the electrical conductivity (ec) stabilized, or three borehole volumes were abstracted to ensure that water representative of the aquifer was sampled. to avoid evaporation, all samples were stored in insulated bottles and followed the sampling protocol described by weaver et al. (2007). water samples (n = 176) were analysed for 18o/16o ratios using the co2 equilibrium method of socki et al. (1992), while 2h/h ratios were obtained through the closed tube zinc reduction method of coleman et al. (1982). isotopic ratios of both hydrogen and oxygen were determined using a thermofinnigan delta xp mass spectrometer (thermo fisher scientific, waltham, massachusetts, usa). internal standards were run to calibrate the results relative to vienna standard mean ocean water (v-smow) as well as to correct for drift in the reference gas. the analytical uncertainty is approximately 2‰ for δ2h and 0.2‰ for δ18o (february et al., 2007b). results rainfall and groundwater there were seasonal variations in 18o in rainfall as more depleted values were observed during the wet season (δ18o = −1.36 ‰) compared to that of rainfall occurring during the dry season table 1. borehole locations and their relative distance from the rivers sampled borehole latitude longitude river name distance from borehole (km) rietpan −24.8969 31.91421 mlondozi 1.398 mafutsu −25.0643 32.00947 mlondozi 3.538 sweni-hide −24.4736 31.97269 sweni 0.050 jock −25.2775 31.92509 mbyamiti 9.365 msanimond −24.6138 31.70972 nwatwitsontso 0.244 figure 1. map of the study area in the southern section of the kruger national park showing location of the boreholes (circles) and rivers (triangles) that were sampled 99water sa 49(2) 96–102 / apr 2023 https://doi.org/10.17159/wsa/2023.v49.i2.3992 (δ18o = −0.53‰). as most of the rain at the study site falls during the hottest time of the year, the resulting lmwl is composed of evaporatively enriched water and plots out below the global meteoric water line (gat, 1971). groundwater samples had the most negative isotope ratios of all the samples collected, with mean values of δ18o = −2.96‰ and δ2h = −31.67‰, std dev = 1.17 and 7.37, respectively. the low standard deviations among samples suggest that groundwater over the entire area exhibits similar values. surface water–groundwater (sw–gw) interaction in perennial rivers to evaluate sw–gw interactions and the temporal variability of these interactions, the isotopic values of the perennial rivers, sabie and sand, were compared with that of groundwater sampled from the paired boreholes and to that of rainwater collected at these boreholes. the mean isotopic ratios of the water from the sabie and sand rivers were δ18o = −2.55‰ ± 0.15‰ (mean ± standard error), n = 15; δ2h = −27.19‰ ± 1.07‰ for the sabie, and δ18o = −2.68‰ ± 0.09‰, n = 8; δ2h = −28.91‰ ± 1.09‰ for the sand. these values are very similar to that of the groundwater (δ18o = −2.96‰ ± 0.15‰, n = 42 and δ2h = −31.6‰ ± 0.92‰) and noticeably different from that of rainwater (δ18o = −0.60‰ ± 0.30‰, n = 38, δ2h = −4.54‰ ± 3.01‰; (fig. 2). surface water–groundwater interaction along seasonal and ephemeral streams on basalts the mean isotopic ratios of groundwater sampled at the boreholes of sweni-hide, mafutsu and rietpan (δ18o = −2.86‰ ± 0.02‰, n = 42, δ2h = −32.5‰ ± 9.05‰) were more depleted than that of the water from the mlondozi and sweni rivers (δ18o = −1.58‰ ± 3.5‰, n = 25, δ2h = -6.06‰ ± 9.7‰) as well as rainfall (δ18o = −0.41‰ ± 0.32‰, n = 26; δ2h = −2.75‰ ± 18.5‰,). river δ18o became increasingly enriched as the season progressed, with values above 5‰ at the end of the dry season in 2011 (fig. 3). surface water−groundwater interaction along seasonal and ephemeral streams on granites mean values for surface water in the mbyamiti river during the wet season when the river experienced high flows were δ18o = −1.26‰ ± 0.92‰, n = 8 and δ2h = −28.61‰ ± 6.81‰, and the groundwater (bh-jock) values were δ18o = −2.11‰ ± 0.58‰, n = 7 and δ2h = −29.81‰ ± 3.90‰ (fig. 4). during the dry season, when the river experienced low flows, mean values for surface water were δ18o = −2.50‰ ± 0.05‰, n = 8 and δ2h = −19.38‰ ± 5.81‰, while the groundwater values were δ18o = −4.15‰ ± 0.02‰, n = 4 and δ2h = −21.49‰ ± 1.44‰. along the ephemeral nwaswitsontso river, a high-rainfall event during figure 2. mean δ18o and δ2h values (± 1 se) of surface water values from the perennial sabie (diamonds) and sand (squares) rivers compared to groundwater (triangles) and rainfall (circles). open symbols are wet season and closed symbols dry season. figure 3. mean δ18o and δ2h values (± 1 se) of seasonal and ephemeral sweni (diamonds) and mlondozi (squares) rivers on the basalt substrate, relative to groundwater (triangles) and rainfall (circles) from the mafutsu, sweni-hide and rietpan boreholes and rain gauges. open symbols are wet season and closed symbols dry season. 100water sa 49(2) 96–102 / apr 2023 https://doi.org/10.17159/wsa/2023.v49.i2.3992 the wet season (january 2011) generated streamflow that lasted for about 1 month, then progressively receded to shallow pools, eventually drying up completely at the end of march 2011. surface water isotope ratios during the flow period were δ18o = −1.55‰ ± 1.61‰, n = 5 and δ2h = −21.64‰ ± 0.86‰ and the groundwater (bh-msanimond) values were δ18o = −2.48‰ ± 2.44‰, n = 4 and δ2h= −40.13‰ ± 0.66‰ (fig. 4). this river did not flow during the 2009–2011 drought. discussion the extensive similarity in δ2h and δ18o values between perennial rivers and groundwater indicate high interchange of water between these systems. perennial rivers, such as the sabie and sand within the knp, are always connected to the groundwater system. during the dry season when these rivers experience low flows and throughout the wet season during high-flow periods, groundwater is consistently discharged into these rivers. as a result, these two rivers act as catchment drains, intersecting the regional groundwater piezometric surface and maintaining baseflow conditions, as has been shown for perennial rivers in semi-arid ecosystems elsewhere (xu et al., 2002; lerner, 2003; vegter and pitman, 2003). the hydrological interaction and connectivity are critical in similar semi-arid systems where groundwater-dependent ecosystems are reliant on groundwater discharge during dry seasons (colvin et al., 2003; parsons, 2004). the geology of the catchment associated with the sweni and mlondozi rivers is primarily composed of basalts and rhyolite, which have high clay content (venter, 1986; venter et al., 2003). the permeability of the surface and subsurface materials can greatly affect recharge and discharge processes; recharge is less likely to occur in areas that have finer-grained, less permeable sediments (healy, 2010). therefore, in areas of finer-grained sediments there would be decreased infiltration and enhanced surface runoff. these processes are observed on the sweni and mlondozi rivers as rainfall−runoff during the wet season generates streamflow; however, as rainfall decreases, streamflow subsides, resulting in standing pools of water along certain reaches of the river. evaporation results in the water collected from these pools in the dry season having extremely enriched isotope ratios. these streams can be classified as detached or remote (xu et al., 2002; lerner, 2003; vegter and pitman, 2003), whereby the stream bed materials are impervious and the piezometric head is always below the stream bed material. the stream bed material of the seasonal mbyamiti and the ephemeral nwaswitsontso rivers on the granite substrate is underlain by alluvial deposits, weathered porous granite material (coarse river sand) and rock. this combination of material promotes recharge, as the resulting soils have relatively high permeability and are capable of transmitting water rapidly (healy, 2010). typically, in seasonal rivers, the piezometric surface of the groundwater fluctuates alternately above and below the stream stage (xu et al., 2002; lerner, 2003; vegter and pitman, 2003). as a result, when the mbyamiti river experiences peak flows during the wet season, groundwater is recharged from the river bed. conversely, during the dry season, groundwater is discharged into the river, maintaining low flows and pools. therefore, the mbyamiti river is alternately an influent and effluent (intermittent) stream. the nwaswitsontso river only flows after high-rainfall events. in typical ephemeral rivers, the groundwater piezometric surface is at all times below the stream bed level (xu et al., 2002; lerner, 2003; vegter and pitman, 2003). as a result, during the wet season, after significant rainfall events, groundwater experiences indirect recharge through the river bed which acts as a preferential pathway (recharge sink). this study has described the hydrogeological interactions between a range of river flow conditions and their geological setting, which should allow inferences to the region more broadly. whilst it would be speculative to ascribe climate change impacts on these processes in the absence of a detailed modelling study, our observations do support recent opinion on the resilience of groundwater systems under climate change in dry subtropical regions of africa (cuthbert et al., 2019), where the positive feedback of the spatialtemporal intensification of precipitation anomalies could lead to increased recharge, particularly through ephemeral drainages, thus being made available for discharge to perennial surface water systems, despite possible drying trends overall. due to the complexities associated with quantifying and conceptualising sw−gw interactions (sophocleous, 2002), particularly in semi-arid drainage regions where groundwater discharge into a river is not evenly distributed along its length but rather along discrete locations which include along fractures, faults and dykes, it is not uncommon to have different reaches gaining or losing water within a particular stream or river (newman et al., 2006). figure 4. mean δ18o and δ2h values (± 1 se) for water from the granite substrate, ephemeral nwatwitsontso (diamonds) and mbyamiti (squares) rivers relative to groundwater (triangles) and rainfall (circles) from the jock and msanimond boreholes and rain gauges. open symbols are wet season and closed symbols dry season. 101water sa 49(2) 96–102 / apr 2023 https://doi.org/10.17159/wsa/2023.v49.i2.3992 we, therefore, caution against the oversimplification of sw−gw interaction on a river or catchment scale. nonetheless, the findings presented in this paper contributes to the understanding of sw−gw interaction to aid in further development and refining of sustainable groundwater resource management in the knp. conclusion in semi-arid african savanna, surface water and groundwater resources are intrinsically linked. understanding these hydrological processes to manage the natural interaction, movement, and exchange between groundwater and rivers will be critical for the sustainable management of water resources within the knp, as well as extrapolating this to the broader lowveld catchments taking into account future climate change and accruing these benefits downstream of the protected area. acknowledgements the authors would like to acknowledge the mellon foundation for the funding provided as part of the junior scientist programme, sanparks, ms shamiela davids for her support and expertise at the university of cape town isotope lab, the field assistance provided by mr renson thethe and mr velly ndlovu from sanparks, ms chenay simms for producing the map and dr stefanie freitag-ronaldson, dr rina grant and dr izak smit for their guidance and mentorship during the project. orcid robin petersen https://orcid.org/0000-0002-2770-9461 references bristow j and venter f (1986) notes on the permian to recent geology of the kruger national park. koedoe 29 85–104. https://doi. org/10.4102/koedoe.v29i1.522 coleman ml, shepherd tj, durham jj, rouse je and moore gr (1982) reduction of water with zinc for hydrogen isotope analysis. anal. chem. 54  993–995. https://doi.org/10.1021/ ac00243a035 colvin c, le maitre d and hughes s (2003) assessing terrestrial groundwater dependent ecosystems in south africa. wrc report no. 1090-2/2/03. water research commission, pretoria. cuthbert m, gleeson t, moosdorf n, befus km, schneider a, hartmann j and lehner b (2019) global patterns and dynamics of climate-groundwater interactions. nat. clim. change 9 137–141. https://doi.org/10.1038/s41558-018-0386-4 du plessis a (2019) evaluation of southern and south africa’s freshwater resources. in: du plessis a (ed.) water as an inescapable risk. current global water availability, quality and risks with a specific focus on south africa. 147–172. springer link. https://doi. org/10.1007/978-3-030-03186-2_7 du toit j, rogers k and biggs h (2003) the kruger experience: ecology and management of savanna heterogeneity. island press, washington dc. du toit wh and verster h (2017) establishing a groundwater monitoring network in the kruger national park: monitoring the fluctuation of groundwater levels under un-impacted conditions to determine short, medium and long term trends and to estimate tpc levels for abstraction boreholes. dws report no. gh 4264. department of water and sanitation, pretoria. easterling dr, meehl ga, parmesan c, changnon sa, karl tr and mearns lo (2000) climate extremes: observations, modeling, and impacts. science 289 2068–2074. https://doi.org/ 10.1126/science.289.5487.2068 fischer s, witthüser k, birke m, leyland r and schneider m (2009) regional description of the groundwater chemistry of the kruger national park (knp) using multivariate statistics. in: groundwater conference of the geological society of south africa, 16–18 november 2009, somerset west, south africa. frich p, alexander lv, della-marta p, gleason b, haylock m, tank ak and peterson t (2002) observed coherent changes in climatic extremes during the second half of the twentieth century. clim. res. 19  193–212. https://doi.org/10.3354/ cr019193 gat jr (1971) comments on the stable isotope method in regional groundwater investigations. water resour. res. 7 980–993. https:// doi.org/10.1029/wr007i004p00980 gertenbach wd (1980) rainfall patterns in the kruger national park. koedoe 23 35–43. https://doi.org/10.4102/koedoe.v23i1.634 gibson j, edwards t, birks s, st amour n, buhay w, mceachern p, wolfe b and peters d (2005) progress in isotope tracer hydrology in canada. hydrol. process. 19  303–327. https://doi.org/10.1002/hyp.5766 glazer an and likens ge (2012) the water table: the shifting foundation of life on land. ambio 41  657–669. https://doi.org/ 10.1007/s13280-012-0328-8 gleeson t, novakowski k, cook pg and kyser tk (2009) constraining groundwater discharge in a large watershed: inte grated isotopic, hydraulic, and thermal data from the canadian shield. water resour. res. 45. https://doi.org/10.1029/2008wr007622 gleeson t and richter b (2018) how much groundwater can we pump and protect environmental flows through time? presumptive standards for conjunctive management of aquifers and rivers. river res. appl. 34 83–92. https://doi.org/10.1002/rra.3185 healy rw (2010) estimating groundwater recharge. cambridge university press, cambridge. https://doi.org/10.1017/cbo9780511 780745 hughes da, parsons r and conrad je (2007) quantification of the groundwater contribution to baseflow. wrc report no. 1498/1/07. water research commission, pretoria. jakeman aj, barreteau o, hunt rj, rinaudo j-d, ross a, arshad m and hamilton s (2016) integrated groundwater management: an overview of concepts and challenges. in: jakeman aj, barreteau o, hunt rj, rinaudo j-d and ross a (eds) integrated groundwater management. 3–20. springer link. https://doi.org/ 10.1007/978-3-319-23576-9_1 jovanovic n, mu q, bugan rdh and zhao m (2015) dynamics of modis evapotranspiration in south africa. water sa 41 (1) 79–90. https://doi.org/10.4314/wsa.v41i1.11 kalbus e, reinstorf f and schirmer m (2006) measuring methods for groundwater? surface water interactions: a review. hydrol. earth syst. sci. discuss. 10 873–887. https://doi.org/10.5194/ hess-10-873-2006 le maitre dc and colvin ca (2008) assessment of the contribution of groundwater discharges to rivers using monthly flow statistics and flow seasonality. water sa 34  549–564. https://doi. org/10.4314/wsa.v34i5.180652 lerner d (2003) surface water-groundwater interactions in the context of groundwater resources. in: xu y and beekman he (eds) groundwater recharge estimation in southern africa. ihp series no. 64. unesco, paris. liu y and yamanaka t (2012) tracing groundwater recharge sources in a mountain-plain transitional area using stable isotopes and hydrochemistry. j. hydrol. 464  116–126. https://doi. org/10.1016/j.jhydrol.2012.06.053 mabunda d, pienaar dj and verhoef j (2003) the kruger national park: a century of management and research. in: du toit j, rogers k and biggs h (2003) the kruger experience: ecology and management of savanna heterogeneity. island press, washington dc. 3–21. macfadyen s, zambatis n, van teeffelen aj and hui c (2018) long‐term rainfall regression surfaces for the kruger national park, south africa: a spatio‐temporal review of patterns from 1981 to 2015. int. j. climatol. 38 2506–2519. https://doi. org/10.1002/joc.5394 mussá f, zhou y, maskey s, masih i and uhlenbrook s (2015) groundwater as an emergency source for drought mitigation in the crocodile river catchment, south africa. hydrol. earth syst. sci. 19 1093–1106. https://doi.org/10.5194/hess-19-1093-2015 newman bd, vivoni er and groffman ar (2006) surface water-groundwater interactions in semiarid drainages of the american southwest. hydrol. process. 20 3371–3394. https://doi. org/10.1002/hyp.6336 https://orcid.org/0000-0002-2770-9461 https://doi.org/10.4102/koedoe.v29i1.522 https://doi.org/10.4102/koedoe.v29i1.522 https://doi.org/10.1021/ac00243a035 https://doi.org/10.1021/ac00243a035 https://doi.org/10.1038/s41558-018-0386-4 https://doi.org/10.1007/978-3-030-03186-2_7 https://doi.org/10.1007/978-3-030-03186-2_7 https://doi.org/10.1126/science.289.5487.2068 https://doi.org/10.1126/science.289.5487.2068 https://doi.org/10.3354/cr019193 https://doi.org/10.3354/cr019193 https://doi.org/10.1029/wr007i004p00980 https://doi.org/10.1029/wr007i004p00980 https://doi.org/10.4102/koedoe.v23i1.634 https://doi.org/10.1002/hyp.5766 https://doi.org/10.1007/s13280-012-0328-8 https://doi.org/10.1007/s13280-012-0328-8 https://doi.org/10.1029/2008wr007622 https://doi.org/10.1002/rra.3185 https://doi.org/10.1017/cbo9780511780745 https://doi.org/10.1017/cbo9780511780745 https://doi.org/10.1007/978-3-319-23576-9_1 https://doi.org/10.1007/978-3-319-23576-9_1 https://doi.org/10.4314/wsa.v41i1.11 https://doi.org/10.5194/hess-10-873-2006 https://doi.org/10.5194/hess-10-873-2006 https://doi.org/10.4314/wsa.v34i5.180652 https://doi.org/10.4314/wsa.v34i5.180652 https://doi.org/10.1016/j.jhydrol.2012.06.053 https://doi.org/10.1016/j.jhydrol.2012.06.053 https://doi.org/10.1002/joc.5394 https://doi.org/10.1002/joc.5394 https://doi.org/10.5194/hess-19-1093-2015 https://doi.org/10.1002/hyp.6336 https://doi.org/10.1002/hyp.6336 102water sa 49(2) 96–102 / apr 2023 https://doi.org/10.17159/wsa/2023.v49.i2.3992 parsons r (2004) surface water:groundwater interaction in a southern african context. wrc report no. tt 218/03. water research commission, pretoria. pohl b, macron c and monerie p-a (2017) fewer rainy days and more extreme rainfall by the end of the century in southern africa. sci. rep. 7 1–7. https://doi.org/10.1038/srep46466 praamsma t, novakowski k, kyser k and hall k (2009) using stable isotopes and hydraulic head data to investigate groundwater recharge and discharge in a fractured rock aquifer. j. hydrol. 366 35–45. https://doi.org/10.1016/j.jhydrol.2008.12.011 price k (2011) effects of watershed topography, soils, land use, and climate on baseflow hydrology in humid regions: a review. progr. phys. geogr. 35 465–492. https://doi.org/10.1177/0309133311402714 riddell es, nel j, fundisi d, jumbi f, van niekerk a and lorentz sa (2015). ephemeral hydrological processes in savannas. wrc report no. tt 619/14. water research commission, pretoria. riddell es, kilian w, versfeld w and kosoana m (2016) groundwater stable isotope profile of the etosha national park, namibia. koedoe 58 1–7. https://doi.org/10.4102/koedoe.v58i1.1329 rogers kh and o’keeffe j (2003) river heterogeneity: ecosystem structure, function and management. in: du toit j, rogers k and biggs h (2003) the kruger experience: ecology and management of savanna heterogeneity. island press, washington dc. 189–218. rozanski k, froehlich k and mook wg (2001) environmental isotopes in the hydrological cycle. principles and applications. surfacewater. ihp-v: technical documents in hydrology, vol. 3 (ed. wg mook), no. 39, unesco, paris. schutte i (1986) the general geology of the kruger national park. koedoe 29 (1) a517. https://doi.org/10.4102/koedoe.v29i1.517 socki ra, karlsson hr and gibson ek (1992) extraction technique for the determination of oxygen-18 in water using preevacuated glass vials. anal. chem. 64  829–831. https://doi.org/ 10.1021/ac00031a026 sophocleous m (2002) interactions between groundwater and surface water: the state of the science. hydrogeol. j. 10 52–67. https:// doi.org/10.1007/s10040-001-0170-8 spinoni j, naumann g, carrao h, barbosa p and vogt j (2014) world drought frequency, duration, and severity for 19512010. int. j. climatol. 34 2792–2804. https://doi.org/10.1002/joc.3875 thomas j and rose t (2003) environmental isotopes in hydrogeology. environ. geol. 43  532–532. https://doi.org/10.1007/s00254-002-06 77-x vegter j (2003) hydrogeology of groundwater: region 19: lowveld. wrc report no. tt 208. water research commission, pretoria. vegter j and pitman w (2003) recharge and stream flow. in: xu y and beekman he (eds) groundwater recharge estimation in southern africa. ihp series no. 64. unesco, paris. 109–123. venter f (1986) soil patterns associated with the major geological units of the kruger national park. koedoe 29  125–138. https://doi. org/10.4102/koedoe.v29i1.525 venter f (1990) a classification of land for management planning in the kruger national park. phd thesis, university of south africa, pretoria. venter f and bristow j (1986) an account of the geomorphology and drainage of the kruger national park. koedoe 29  117–124. https://doi.org/10.4102/koedoe.v29i1.524 venter fj, scholes rj and eckhardt hc (2003) the abiotic template and its associated vegetation pattern. in: du toit j, rogers k and biggs h (2003) the kruger experience: ecology and management of savanna heterogeneity. island press, washington dc. 83–129. wada y and heinrich l (2013) assessment of transboundary aquifers of the world-vulnerability arising from human water use. environ. res. lett. 8 024003. https://doi.org/10.1088/17489326/8/2/024003 wada y, van beek lp, sperna weiland fc, chao bf, wu yh and bierkens mf (2012) past and future contribution of global groundwater depletion to sea‐level rise. geophys. res. lett. 39. https://doi.org/10.1029/2012gl051230 wada y, van beek lp, van kempen cm, reckman jw, vasak s and bierkens mf (2010) global depletion of groundwater resources. geophys. res. lett. 37. https://doi.org/10. 1029/2010gl044571 weaver jm, cave l and talma as (2007) groundwater sampling. wrc report no. tt 303. water research commission, pretoria. xu y, titus r, holness s, zhang j and van tonder g (2002) a hydrogeomorphological approach to quantification of groundwater discharge to streams in south africa. water sa 28  375–380. https://doi.org/10.4314/wsa.v28i4.4910 zambatis n (2003) determinants of grass production and composition in the kruger national park. msc thesis, university of natal, pietermaritzburg. zektser i and loaiciga ha (1993) groundwater fluxes in the global hydrologic cycle: past, present and future. j. hydrol. 144 405–427. https://doi.org/10.1016/0022-1694(93)90182-9 https://doi.org/10.1038/srep46466 https://doi.org/10.1016/j.jhydrol.2008.12.011 https://doi.org/10.1177/0309133311402714 https://doi.org/10.4102/koedoe.v58i1.1329 https://doi.org/10.4102/koedoe.v29i1.517 https://doi.org/10.1021/ac00031a026 https://doi.org/10.1021/ac00031a026 https://doi.org/10.1007/s10040-001-0170-8 https://doi.org/10.1007/s10040-001-0170-8 https://doi.org/10.1002/joc.3875 https://doi.org/10.1007/s00254-002-0677-x https://doi.org/10.1007/s00254-002-0677-x https://doi.org/10.4102/koedoe.v29i1.525 https://doi.org/10.4102/koedoe.v29i1.525 https://doi.org/10.4102/koedoe.v29i1.524 https://doi.org/10.1088/1748-9326/8/2/024003 https://doi.org/10.1088/1748-9326/8/2/024003 https://doi.org/10.1029/2012gl051230 https://doi.org/10.1029/2010gl044571 https://doi.org/10.1029/2010gl044571 https://doi.org/10.4314/wsa.v28i4.4910 https://doi.org/10.1016/0022-1694(93)90182-9 water sa 49(2) 155–163 / apr 2023 https://doi.org/10.17159/wsa/2023.v49.i2.3965 research paper issn (online) 1816-7950 available on website https://www.watersa.net 155 correspondence cc du preez email dpreezcc@ufs.ac.za dates received: 10 november 2021 accepted: 8 march 2023 key words biomass yield crop factor evapotranspiration seed yield semi-arid copyright © the author(s) published under a creative commons attribution 4.0 international licence (cc by 4.0) in south africa canola (brassica napus l.) is cultivated in rotation with wheat under winter rainfall in the western cape province, primarily for seed to make oil. expansion of the crop to the other 8 provinces is proposed to reduce shortages of locally produced plant oils. at the same time, canola can serve as a rotational crop for wheat in these summer rainfall provinces. in central free state, information on evapotranspiration and various water use indicators for canola as influenced by sustained deficit irrigation and plant density is lacking. an experiment with a line source sprinkler irrigation system was therefore conducted, comprising of full irrigation as a control with 4 sustained deficit irrigation levels (mean reduction in irrigation depth per event of 67%, 52%, 34% and 19%) and 5 plant densities (25, 50, 75, 100 and 125 plants·m−2). mean seasonal maximum evapotranspiration amounted to 429 mm across plant densities. plant density did not significantly influence seasonal evapotranspiration. reducing the irrigation depth per event by more than 20% decreased seasonal evapotranspiration by a mean 3.5 mm per percentage increase in irrigation depth. a maximum biomass water productivity of 22 kg·ha−1·mm−1 was measured with full irrigation and a plant density of 75 plants·m−2. seed water productivity amounted to a high of 11 kg·ha−1·mm−1 with full irrigation and a plant density of 25 plants·m−2. a percentage reduction in irrigation depth and increase in plant density above 25 plants·m−2 will reduce seed water productivity by 0.071 and 0.033 kg·ha−1·mm−1, respectively. sustained deficit irrigation increased water use efficiency by a mean 0.5% per percentage reduction in irrigation depth per event. canola (brassica napus l.) water use indicators as affected by sustained deficit irrigation and plant density in central free state, south africa ka seetseng1, jh barnard1, ld van rensburg1 and cc du preez1 1department of soil, crop and climate sciences, university of the free state, bloemfontein 9300, south africa introduction canola (brassica napus l.) is primarily cultivated to produce seed to make edible oil (przybylski and eskin, 2011). canola oil is generally blended with oil from crops like soybean and sunflower. canola, soybean, and sunflower oils are widely used in the food industry either in the pure or blended form, despite some diversity among their properties (zhou et al., 2020). the food industry in south africa is no exception with respect to the usage of these three edible plant oils (usda, 2021). compared to soybean and sunflower oils, the local production of canola oil is the least (daff, 2020). the demand (approx. 720 000 tonnes annually) for edible plant oils in south africa exceeds the production (approx. 325 000 t annually) thereof. as a result of this shortage, the south african protein research foundation advocated the expansion of canola production, particularly in the summer rainfall region under irrigation (de kock, 2018). this is because the rainfall during canola’s growth period from june to november is insufficient (< 100 mm; arc-scw, 2020) for dryland production of canola in semi-arid climates. production of dryland canola in this region is only possible when water is stored in soil during a preceding fallow period from december to may when rainfall occurs more frequently (beukes et al., 2004). currently, production of canola is largely restricted to the western cape province, mainly under rainfed conditions (daff, 2019; galal, 2021). in this province, 195 000 t of canola was produced on 100 000 ha in 2020/21, contributing 99% of south africa’s canola production (crop estimates committee, 2022). this dryland production is possible because of the winter rain during canola’s growth period. canola also serves as a rotational crop for wheat, which is the major field crop produced in the province (agenbag and de kock, 2009; hardy and wallace, 2013). in this regard canola is an important crop for conservation agriculture in the western cape province. for the successful expansion of canola production to the summer rainfall provinces in south africa, proper guidelines on agronomy practices like cultivar choice, planting date, planting density, optimal fertilization and irrigation are essential. such information is very scanty for the aforementioned region, probably because canola production is a rarity. a general overview of agronomic practices is given by hammond (2011), but these are usually site-specific due to being based on experience in the western cape (daff, 2020). as canola will probably be cultivated under irrigation in a semiarid climate, quantification of the crop’s water use will be vital to several role players in the farming industry. farmers need such information for planning weekly and seasonal water budgets at farm level (barnard et al., 2013; barnard et al., 2021), i.e., irrigation scheduling decisions. in addition, farmers can benefit from knowledge regarding canola’s response to sustained deficit irrigation (sdi), as a strategy for reducing agricultural water use. sdi has been recognized as a popular deficit irrigation strategy (fereres and soriano, 2007). with this strategy water deficit increases progressively during the season, because of a reduced irrigation depth per event, which allows plants to adapt to water deficits in soils with high water storage capacities. on the other hand, water user associations require https://www.watersa.net https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ 156water sa 49(2) 155–163 / apr 2023 https://doi.org/10.17159/wsa/2023.v49.i2.3965 this kind of information for balancing the supply and demand of water by all the farming enterprises at scheme level (steduto et al., 2007; barnard et al., 2015). agricultural engineers may also benefit from this knowledge when designing irrigation systems (reinders, 2011). in south africa, to our knowledge, very little research has been done on the evapotranspiration and response of canola to water deficits. the research done by tesfamariam et al. (2010) and dirwai et al. (2021) at pretoria and pietermaritzburg, respectively, are the exceptions. even internationally, evapotranspiration data for cultivated canola under irrigation in a semi-arid climate are not abundant. reported evapotranspiration values range between 390 and 710 mm, (e.g., tesfamariam et al., 2010; kamkar et al., 2011; sadras and mcdonald, 2012; ismail, 2016; abdelraouf et al., 2021). a similar argument can be made regarding the lack of benchmarks for several water use indicators that are used to assess on-farm irrigation decisions. this is aggravated by the lack of consensus regarding terms and equations used for various indicators (fernández et al., 2020). despite that canola has a high plasticity, it is important that plant density matches sdi because of the complementary nature of the two factors (angadi et al., 2003). across a range of 175 to 420 mm water application in central free state, the highest seed (4 653 kg.ha−1) and stover (5 388 kg.ha−1) yield was realized at densities of 25 and 75 plants.m−2 (seetseng et al., 2022). the influence of the two factors on one another is, to our knowledge, rarely investigated with respect to water use by canola. either sdi or plant density was shown independently to influence water use indicators (hergert et al., 2016; abelraouf et al., 2021). a need therefore exists in south africa for in-situ values of evapotranspiration and various water use indicators when canola is cultivated under a semi-arid climate in a summer rainfall region. the objectives with this study were two-fold: to quantify the effects of sustained deficit irrigation and plant density combinations on (i) seasonal evapotranspiration and (ii) various water use indicators for canola. materials and methods description of experimental site the study was conducted in 2016 on the experimental farm of the department of soil, crop and climate sciences, university of the free state. this farm is located (latitude = 29° 01’ 12” s, longitude = 26° 08’ 60” e, elevation = 1 354 m) about 15 km northwest of bloemfontein. the soil of the experimental site was classified as a bainsvlei soil form of the amelia family (soil classification working group, 1991), which qualifies as a plinthosol (fey, 2010), although a few of the set criteria are not met (van huyssteen, 2020). some properties of the deep, apedal, eutrophic soil relevant to the study are given in table 1. the soil has a high potential, with no apparent physical, chemical or biological constraints for canola production. long-term climate data of glen agriculture institute situated 30 km from the study site (adapted from botha et al., 2003) and climate data for the canola growing season, which was measured with an automatic weather station located 50 m from the study site (supplied by arc-scw, 2020), are presented in table 2. the precipitation and reference evapotranspiration were slightly lower than the long-term values, while the opposite is true for maximum, minimum and average temperatures. table 1. some morphological and chemical characteristics of the bainsvlei amalia soil at the experimental site characteristic horizon* ap b1 b2 c depth (m) 0 – 0.35 0.35 – 1.18 1.18 – 1.40 1.40 – 3.00 texture class fine sand fine sandy loam fine sandy clay loam fine sandy clay loam structure apedal, massive coarse, weak, prismatic apedal, massive course, strong, angular blocky color red brown: (5yr4/4) red brown: (5yr5/6) brown: (10yr4/6) yellow orange: (10yr6/4) p (bray 1) (mg·kg−1) 7.8 2.4 2.1 1.8 ca (nh4oac) (mg·kg −1) 112 68 422 564 mg (nh4oac) (mgc·kg −1) 98 60 298 318 k (nh4oac) (mgc·kg −1) 70 27 106 164 ph (h2o) 6.2 6.5 5.9 5.7 *ap = orthic a, b1 = red apedal b, b2 = soft plinthic b; c = weathered mudstone table 2. long-term climate data during the growing season of canola at the study site (adapted from botha et al. 2003) and climate data of the investigated growth season (supplied by arc-iscw, 2020) parameter june july aug sept oct season annual precipitation (mm) long-term 9 8.1 11.6 19.3 49 97 543 growth season 23.3 0.6 4.9 0.4 27.9 57 – reference evapotranspiration (eto, mm) long-term 81.9 93.5 140.6 197.5 239.1 753 2 198 growth season 81 89.9 120.9 153 173.6 618.4 – maximum temperature (°c) long-term 17.9 17.8 20.6 24.4 25.4 21.2 24.8 growth season 19.5 20.3 21.8 26.5 26.9 22.8 – minimum temperature (°c) long-term −1.1 −1.6 0.9 5.2 9.2 2.5 7.5 growth season 3.1 2.8 4.2 7.9 11.6 6.0 – average temperature (°c) long-term 8.2 8.1 10.7 14.8 17.5 11.9 16.2 growth season 11.3 11.6 13.0 17.2 19.3 14.5 – 157water sa 49(2) 155–163 / apr 2023 https://doi.org/10.17159/wsa/2023.v49.i2.3965 agronomic practices before the onset of the experiment, the area was used for commercial wheat production. after the summer fallow period of 5 months, fertilizers were broadcast with a fertilizer caster at a rate of 170 kg n.ha−1 as limestone ammonium nitrate (28% n) and 60 kg p.ha−1 as single superphosphate (10.5% p). these applications were estimated for the assumed 5 000 kg.ha−1 seed yield under no water shortage conditions using published (fertasa, 2016) removal figures of 40 kg n and 7 kg p per 1 000 kg seed. the estimated amounts of 200 kg n.ha−1 and 35 kg p.ha−1 were downscaled to 170 kg.ha−1 for n mineralization and up-scaled to 60 kg p.ha−1 for extractable p increase, respectively. thereafter the area was ploughed to a depth of 0.25 m and then disk ploughed to smooth the soil surface. a rotavator was used to prepare a seedbed. the canola cultivar outback was planted mid-june 2011 with a modified bramley wheat planter at a seeding rate of 6.2 kg.ha−1 as recommended. unfortunately, this cultivar became obsolete within a few years of completion of the experiment due to exceptional advances with canola hybrids. experimental design and treatments the line source irrigation approach of hanks (1976) was used (fig. 1). five non-randomized water application levels (full irrigation, sdi67%, sdi52%, sdi34% and sdi19%, hereafter referred to as w5, w4, w3, w2 and w1 respectively) were combined with five fully randomized plant densities (25, 50, 75, 100 and 125 plants.m−2, hereafter referred to pd25, pd50, pd75, pd100 and pd125, respectively). the resulting 25 treatment combinations were replicated 4 times as blocks. the water application level decreased approximately linearly, in a perpendicular direction from the lateral on both sides, w5 to w1. bird 30h sprinklers (rain bird cooperation, azusa, california, usa) were installed on the lateral with 1.5 m rises (20 mm diameter) at 6 m intervals. the operating pressure was set at 350 kpa throughout the growing season. irrigation was not always possible at wind speeds lower than the specified 3 m.s−1. water applications were therefore measured with rain gauges installed just above the plant canopy. the perpendicular distances of the rain gauges from the lateral were 11.1, 9.0, 6.9, 4.8 and 2.7 m for the w1 to w5 treatments, respectively. seasonal mean irrigation amounted to 118 mm for w1, 176 mm for w2, 238 mm for w3, 294 mm for w4 and 363 mm for w5, i.e., water application treatments with a mean reduction in irrigation depth per event of 67%, 52%, 34%, 19% and 0%, respectively (sdi67%, sdi52%, sdi34%, sdi19% and full irrigation). this resulted in water application levels of 175 mm, 233 mm, 295 mm, 351 mm and 420 mm when the 57 mm precipitation (table 2) is added. seasonal irrigation at w5 was estimated based on the assumption that a seed yield of 5 000 kg ha−1 with a water use efficiency of 14 kg.ha−1.mm−1 is attainable (e.g., taylor et al., 1991; robertson and kirkgaarde, 2005). based on volumetric water contents measured weekly with a calibrated neutron water meter (cpn 503 hydroprobe) at 300 mm intervals to 2.1 m depth, soil profiles of the w5 plots were refilled to upper drain limit (0.24 mm.mm−1) by weekly irrigations. the upper drain limit of the soil was determined in a previous study (bennie et al., 1994). the amount of water irrigated each time was measured in the rain gauges as a check. the experimental block consisted of 45 plant rows parallel to each side of the lateral. plant rows started 0.3 m from the lateral and were spaced at 0.3 m widths. three rows, with the installed rain gauge in the centre row, were used to represent a plot which was 10.4 m long. the area of an individual plot was therefore 9.36 m2. three weeks after germination, the seedlings were hand thinned to densities of 7.5, 15, 22.5, 30, and 37.5 plants.m−1 in the row, hence equivalent to 25, 50, 75, 100 and 125 plants.m−2 for the pd25, pd50, pd75, pd100 and pd125 treatments, respectively. according to literature, this plant density range covers the full spectrum usually recommended for diverse water supply conditions (e.g., clarke and simpson, 1978; momoh and zhou, 2001; gan et al., 2007). in the western cape province, due to the introduction of modern canola hybrids, the recommended plant density was reduced from 80 to 50 plants.m−2 for production of dryland canola. data collection and processing seasonal (s) evapotranspiration (et, mm) was calculated with eq. 1, where p is precipitation (mm), i is irrigation (mm), d is drainage (mm), r is run-off (mm) and ∆w is the change in soil water content of the measured profile (mm). ets = ps + is – ds – rs – ∆ws (1) precipitation and irrigation were measured with the installed rain gauges. the concept of crop-modified upper limit (cmul) as described by hattingh (1993) was used to calculate drainage. weekly measured volumetric soil water content in the w1pd75 experimental plots was never above cmul values, indicating no drainage. the maximum application rate of the line source irrigation system (6.25 l.h−1) was lower than the soil’s final infiltration rate (13.2 l.h−1), as measured with a double ring infiltrometer by bennie et al. (1994), implying that there was no runoff during irrigation. no signs of runoff were observed also after rainfall events. runoff was therefore assumed to be zero. gravimetric soil water content was measured in all plots at the start (first week of june) and the end of the growing season (last week of november). figure 1. layout of the line source experiment showing water application levels (w5 to w1, not randomized) as main treatments and plant densities as sub-treatments (pd25 to pd125, fully randomized) 158water sa 49(2) 155–163 / apr 2023 https://doi.org/10.17159/wsa/2023.v49.i2.3965 seasonal change in soil water (eq. 1) was obtained from samples that were collected in triplicate from a plot at 0.3 m depth intervals to 1.5 m, using an edelman auger. the samples were weighed immediately, before drying at 105°c to constant weight. after drying, the samples were weighed again to calculate gravimetric water content. the gravimetric soil water contents were converted to volumetric soil water contents using bulk densities (hillel, 1982), measured with the core method (blake and hartge 1986). for the conversions, bulk density values of 1 670, 1 650, 1 600, 1 660 and 1 690 kg.m−3 were used for the 0–300, 600–900, 900– 1 200 and 1 200–1 500 mm depth intervals, respectively. indicators of water use by canola that were calculated were crop water use efficiency (wuec) and water productivity for either biomass (wpbm) or seed (wps) yield. according to perry et al. (2009), wuec is the ratio of the amount of water used by the crop to the total amount of water added through irrigation and precipitation. in this study wp is the ratio between either above-ground biomass or seed yield and evapotranspiration (fernandez et al., 2020). harvesting was done by hand because the experimental farm is not equipped with a plot combine harvester. the seed and stover yield of canola in each plot were determined on an area of 6 m2. after racemation, plastic sheets were spread between the rows to collect shattered pods. the plants were cut just above the soil surface when most of the pods had matured. all of the plants and pods were put into plastic bags before being transferred to a glasshouse and dried to constant weight. seeds were then separated from the pods by hand, and seed and stover were weighed separately. these weights were converted to kg.ha−1 before biomass yield (seed yield plus stover yield) and harvest index (seed yield/biomass yield) were calculated. two-way analyses of variance were done at a confidence level of 95% with the ncss statistical package, on seasonal evapotranspiration, seed yield, above-ground biomass yield, harvest index, wuec, wpbm and wps, after testing residuals for normality and variance for homogeneity (hintze, 1998). table 3 provides the associated f values and coefficients of variation for the above-mentioned variables. treatment means were compared where necessary with tukey’s multiple comparison test by calculating honestly significant differences (hsd) at p = 0.05. the associated hsd values for the main (sdi, pd) or interacting (sdi x pd) effects are provided in the captions of figs 2 to 7. results and discussion seasonal evapotranspiration the seasonal ets for each sdi and plant density treatment are summarized in fig. 2. with a mean seasonal reference evapotranspiration (eto) of about 620 mm, the mean seasonal et over the various plant densities for the fully irrigated treatment amounted to 429 mm (standard deviation = 14 mm). tesfamariam (2004) reported seasonal et values of about 700 mm for canola produced on the highveld (pretoria) of south africa. from several field trials done in california, usa, george et al. (2018) reported maximum et values of about 360 mm. for the high plains of the usa, maximum seasonal et amounted to 582 mm (hergert et al., 2016), while in albacete, spain, lópez-urrea et al. (2020) measured a seasonal et of 472 and 602 mm during 2008 and 2012, respectively. katuwal et al. (2020) reported seasonal ets of 582 and 459 mm during 2015 and 2016, respectively, as measured at new mexico state university, usa. in contrast to planting density, the sdi treatments influenced seasonal et significantly (fig. 2). reducing the irrigation depth per event by 19%, through an sdi strategy, did not affect seasonal et compared to where full irrigation was applied. this was possible because of the soil’s high water storage capacity (sandy loam 1.5 m deep = ± 170 mm, bennie et al., 1994) given that rainfall was about 50 mm, i.e., the mean change in soil moisture over the growing season for the sdi19% treatment amounted to −71 mm. reducing the irrigation depth per event by more than 20% under these aforementioned conditions, will decrease the mean seasonal et by 3.5 mm per unit percentage increase, irrespective of plant density. figure 2. box and whisker plot of seasonal evapotranspiration (mm) for canola as influenced by sustained deficit irrigation (sdi) and plant density (pd) (hsd t ≤ 0.05 sdi = 10.8) table 3. calculated f values (p < 0.05) and coefficients of variation (cv) for seasonal evapotranspiration (et), seed yield, above-ground biomass yield, harvest index, crop water use efficiency (wuec ), and biomass (wpbm ) and seed (wps ) water productivity measured variable f value cv (%) seasonal et w = 817 3.51 seed yield w x pd = 16.26 8.23 above-ground biomass yield w x pd = 3.77 8.53 harvest index w x pd = 2.14 9.28 wue c w = 139 4.36 wpbm w x pd = 2.17 9.27 wps w x pd = 7.77 9.10 159water sa 49(2) 155–163 / apr 2023 https://doi.org/10.17159/wsa/2023.v49.i2.3965 yield and harvest index the effects of sdi and plant density on seed yield are displayed in fig. 3. seed yield was highest (approx. 5 000 kg.ha−1) with 0% sdi at pd25 and lowest (approx. 500 kg.ha−1) with 67% sdi at pd125. regardless of the sdi treatment, seed yield decreased from pd25 to pd125. compared to the current recommended plant density of 50 plants.m−2 for dryland canola in the western cape, a plant density of 25 plants.m−2 is apparently suitable for sdi canola in the free state. this lower plant density can be attributed to the high plasticity of canola (seetseng et al., 2022). figure 4 shows the effect of sdi and plant density on above-ground biomass yield. an sdi of 19% and 34% reduced mean aboveground biomass yield by 23% and 39%, respectively, compared to full irrigation. the mean above-ground biomass yield stabilized just below 4 000 kg.ha−1 when the irrigation depth per event was reduced by more than 52%, through an sdi strategy, irrespective of plant density. the pd25, pd50 and pd75 did not significantly influence above-ground biomass yield for all the sdi treatments on average. only at a pd100 and pd125 did mean above-ground biomass yield decrease by 16% and 25%, respectively, compared to the mean of pd25, pd50 and pd75. figure 5 depicts the harvest index as affected by sdi and plant density. the sdi67% treatment significantly reduced the mean harvest index, irrespective of plant density, compared to the other treatments. for pd75, pd100 and pd125, the mean harvest index was below 0.2 and for pd25 and pd50 it was 0.28 and 0.20, respectively. less than 50% of maximum biomass was produced, irrespective of the plant density. hence, the results of this study were in accordance with literature on deficit irrigation. according to fereres and soriano (2007), a maximum harvest index for maize (farre and faci, 2006), wheat (ilbeyi et al., 2006) and sunflower (soriano et al., 2002) should be realized when irrigation is sufficient to produce at least 60% of maximum biomass. an important interaction of sdi and plant density on harvest index of canola only became evident when the irrigation depth per event was not reduced by 52% or less. no literature on this was found. in the case of pd25, the mean harvest index was more than 0.45, irrespective of sdi strategy. hence, the harvest index was maintained close to a maximum value even when only 38% (sdi52%), 55% (sdi34%) and 70% (sdi19%) of maximum biomass was produced, provided the plant density is low (pd25). when the plant density was increased to pd50 the mean harvest index for the various sdi treatments, except for sdi19, decreased below 0.4. a further increase in plant density (i.e., pd75, pd100 and pd125) for sdi34%, sdi19% and sdicontrol, did not significantly influence the harvest index, as the mean value stabilized at 0.35 with a standard deviation of 0.023. with these treatment combinations more than 60% of maximum biomass was produced. at sdi52% the mean harvest index for pd75, pd100 and pd125 was 0.28, while a mean 44% of maximum biomass was produced. figure 3. mean (error bars give standard deviation) seed yield for canola as influenced by sustained deficit irrigation (sdi) and plant density (pd) (hsd t ≤ 0.05 sdi x pd = 429) figure 4. mean (error bars give standard deviation) above-ground biomass yield (kg·ha−1) for canola as influenced by sustained deficit irrigation (sdi) and plant density (pd) (hsd t ≤ 0.05 sdi x pd = 1 255) 160water sa 49(2) 155–163 / apr 2023 https://doi.org/10.17159/wsa/2023.v49.i2.3965 water use indicators the wuec for canola is presented in fig. 6. a value of 1 would indicate highly efficient use of irrigation-plus-precipitation in supplying canola evapotranspiration. as expected, plant density did not influence wuec. an advantage of sdi is clearly shown in fig. 6, as a unit percentage reduction in irrigation depth per event caused a mean increase in wuec of 0.0053. canola’s wpbm and wps as influenced by sdi and plant density are shown in fig. 7. no clear visual trend regarding the response of wpbm to sdi and pd was observed. this is probably because of the plasticity properties associated with the production of canola (seetseng et al., 2022). it seems however that for pd100 and pd125 the wpbm was lower compared to the other plant densities, irrespective of sdi. the highest mean wpbm for sdi67%, sdi52%, sdi34%, sdi19% and sdicontrol was 18, 15, 17, 18 and 22 kg.ha−1.mm−1 for pd75, pd50, pd75, pd75 and pd75, respectively (fig. 7). the highest wps was obtained with no sdi at pd25, which amounted to a mean of 11 kg.ha−1.mm−1. tesfamariam (2004), george et al. (2018), faraji et al. (2009), hergert et al. (2016) and katuwal et al. (2020) reported maximum wps values of around 5, 16, 12, 7.5 and 4.4 kg.ha−1.mm−1, for canola produced in pretoria (south africa), california (usa), gonbad (iran), scottsbluff and alliance (high plains, usa) and clovis (u.s. southern great plains), respectively. for all treatments a visual decreasing trend in wps can be observed with an increase in plant density. the wps at all plant densities also tended to decrease with an increase in the reduction of irrigation depth per event (fig. 7). the authors acknowledge that these decreasing trends in wps due to sdi and pd are apparently non-linear. however, due to the limited data points a multiple linear regression was done. wps was taken as the dependent variable and sdi and pd as the independent variables, which explained a high (r2 = 0.87) proportion of variation in wps. the regression (function), intercept and two independent variables (sdi and pd) were highly significant (at 1%). the intercept amounted to 10.13 kg.ha−1.mm−1. for a unit increase in the percentage reduction of irrigation depth, through sdi, wps decreased by a mean of 0.071 kg.ha−1.mm−1, while a unit increase in plant density will decrease wps by a mean of 0.033 kg.ha−1.mm−1. katuwal et al. (2020) reported a mean wps of 2.8, 4.7 and 2.2 kg.ha−1.mm−1 for treatments of no irrigation at the reproductive stage, no irrigation at the vegetative stage and dryland canola, respectively. the water use indicators were established with an outdated cultivar that is no longer locally available and is likely inferior to current genetics in terms of the estimated indicators. hence the water use indicators may deviate from those reported here if the study is repeated with new hybrids that usually have a higher harvest index when they are not subject to any stress (steduto et al., 2012). steduto et al. (2012) are of the opinion, however, that changes in fertilizer applications and atmospheric co2 concentrations have a larger influence on water use indicators figure 5. mean (error bars give standard deviation) harvest index for canola as influenced by sustained deficit irrigation (sdi) and plant density (pd) (hsd t ≤ 0.05 sdi x pd = 0.084) figure 6. box and whisker plot crop water use efficiency (wue c = et / i+p) for canola as influenced by sustained deficit irrigation (sdi) and plant density (pd) (hsd t ≤ 0.05 sdi = 0.048) 161water sa 49(2) 155–163 / apr 2023 https://doi.org/10.17159/wsa/2023.v49.i2.3965 than plant breeding, aspects that have not yet been thoroughly investigated. but if water use indicators are indeed significantly influenced by improved canola hybrids, the implication is that the indicators should be regularly updated to optimize the cultivation of irrigated canola. a thorough study to quantify the influence of canola hybrids on water use indicators is therefore suggested. conclusion the data derived from this study with an outdated cultivar could support informed decision making when canola production is expanded to the semi-arid summer rainfall areas of south africa, especially under irrigation. seasonal evapotranspiration was not significantly influenced by plant density. reducing the irrigation depth per event by less than 20% through sustained deficit irrigation for this deep sandy loam soil did not significantly decrease seasonal evapotranspiration compared to fully irrigated plants. decreasing irrigation depth per event further reduced seasonal evapotranspiration by 3.5 mm per unit percentage increase in the irrigation deficit. water use efficiency (evapotranspiration/rainfall-plus-irrigation) increased by a mean of 0.5% for a unit percentage reduction in irrigation depth per event. no sustained deficit irrigation and a plant density of 75 plants.m−2 provided the highest biomass water productivity (22 kg.ha−1.mm−1). biomass water productivity did not differ much between the various sustained deficit irrigation treatments for plant densities of 50 and 75 plants.m−2 (15 to 18 kg.ha−1.mm−1). full irrigation and a plant density of 25 plants.m−2 gave the highest seed water productivity (11 kg.ha−1.mm−1). a percentage reduction in irrigation depth and increase in plant density reduced seed water productivity by 0.071 and 0.033 kg.ha−1.mm−1, respectively. acknowledgements our gratitude to the national department of agriculture, national research foundation and university of the free state for financial support of this study. the study would also not have been possible without the help of several staff members of the department of soil, crop and climate sciences. references abdelraouf re, el-shawadfy ma, dewedar om and hozayn m (2021) improving yield and water productivity of canola under irrigation frequency of n-fertilization. asian j. plant sci. 20 143–156. https://doi.org/10.3923/ajps.2021.143.156 agenbag ga and de kock j (2009) overview: canola in south africa. protein research foundation, pretoria. angadi sv, cutforth hw, mcconkry bg and gan y (2003) yield adjustment by canola at different plant populations under semi-arid conditions. crop sci. 43 1538–1366. https://doi. org/10.2135/cropsci2003.1358 arc-scw (agricultural research council – soil, climate and water, south africa) (2020) agrometeorological data base. agricultural research council – soil, climate and water, pretoria. barnard jh, bennie atp, van rensburg ld and du preez cc (2015) swamp: a soil layer supply model for simulating macroscopic crop water uptake under osmotic stress. agric. water manage. 148 150–163. https://doi.org/10.1016/j.agwat.2014.09.024 figure 7. mean (error bars give standard deviation) biomass and seed water productivity (wpbm = above-ground biomass / et, wps = seed yield / et) for canola as influenced by sustained deficit irrigation (sdi) and plant density (pd) (wpbm: hsd t ≤ 0.05 sdi x pd = 3.84; wps: hsd t ≤ 0.05 sdi x pd = 1.28) https://doi.org/10.3923/ajps.2021.143.156 https://doi.org/10.2135/cropsci2003.1358 https://doi.org/10.2135/cropsci2003.1358 https://doi.org/10.1016/j.agwat.2014.09.024 162water sa 49(2) 155–163 / apr 2023 https://doi.org/10.17159/wsa/2023.v49.i2.3965 barnard jh, matthews n and du preez cc (2021) formulating and assessing of on-farm water and salt management practices: lessons from non-saline and water-logged irrigated fields. agric. water manage. 247 106706. https://doi.org/10.1016/j. agwat.2020.106706 barnard jh, van rensburg ld, bennie atp and du preez cc (2013) simulating water uptake of irrigated field crops from non-saline water table soils: validation and application of the model swamp. agric. water manage. 126 19–32. https://doi.org/10.1016/ j.agwat.2013.04.008 bennie atp, hoffman je, coetzee mj and vrey hs (1994) storing and using of rainwater for the stabilization of plant production in semi-arid areas (in afrikaans). wrc report no. 227/1/94. water research commission, pretoria. beukes dj, bennie atp and hensley m (2004) optimizing soil water balance components for sustainable crop production in dry areas of south africa. in: rao sc and ryan j (eds) challenges and strategies for dryland agriculture. crop science society of america, madison. blake gr and hartge kh (1986) bulk density. in klute a (ed.). methods of soil analysis. part 1: physical and mineralogical methods. soil science society of america, madison, wisconsin. botha jj, van rensburg ld, anderson jj, hensley m, macheli ms, van staden pp, kunhlande g, groenewalt dg and baiphethi mn (2003) water conservation techniques on small plots in semi-arid areas to enhance rainfall efficiency, food security sustainable crop production. wrc report no. 1176/1/03. water research commission, pretoria. clarke jm and simpson gm (1978) influence of irrigation and seeding rates on yield and yield components of brassica napus cv. tower. can. j. plant sci. 58 731–737. https://doi.org/10.4141/cjps78-108 crop estimates committee (2022) winter cereals: final area planted and production figures. directorate of statistics and economic analysis, department of agriculture, land reform and rural development, pretoria. daff (department of agriculture, forestry and fisheries, south africa) (2019) a profile of the south african canola market value chain. directorate marketing of the department of agriculture, forestry and fisheries, pretoria. daff (department of agriculture, forestry and fisheries, south africa) (2020) production guideline for canola. department of agriculture, forestry and fisheries, pretoria. de kock j (2018) development plan for canola – 2018. protein research foundation, protein. dirwai tl, senzanje a and mabhaudhi t (2021) calibration and evaluation of the fao aquacrop model for canola (brassica napus) under varied moistube irrigation regimes. agriculture 11 410. https://doi.org/10.3390/agriculture11050410 faraji a, latifi n, soltani a and rad ahs (2009) seed yield and water use efficiency of canola (brassica napus l.) as affected by high temperature stress and supplemental irrigation. agric. water manage. 96 132–140. https://doi.org/10.1016/j.agwat.2008.07.014 farré i and faci jm (2006) comparative response of maize (zea mays l.) and sorghum (sorghum bicolour l. moench) to deficit irrigation in a mediterranean environment. agric. water manage. 83 135–143. https://doi.org/10.1016/j.agwat.2005.11.001 fereres e and soriano ma (2007) deficit irrigation for reducing agricultural water use. j. exp. bot. 58  147–159. https://doi.org/ 10.1093/jxb/erl165 fernándes je, alcon f, diaz-espejo a, hernandezsantana v and cuevas mv (2020) water use indicators and economic analysis for on-farm irrigation decision: a case study of a super high density olive orchard. agric. water manage. 237 106074. https://doi.org/10.1016/j.agwat.2020.106074 fertasa (2016) fertilizer handbook (8th edition). fertilizer association of south africa, pretoria. fey mv (2010) soils of south africa. cambridge university press, cambridge. galal s (2021) production of canola in south africa 2000 – 2019. statistica gmbh, hamburg. gan y, mahi ss, brandt s, katepa-mupondwa f and kutcher hr (2007) brassica juncea canola in the great plains: responses to diverse environments and nitrogen fertilization. agron. j. 99 1208–1218. https://doi.org/10.2134/agronj2006.0296 george n, thompson se, hollingsworth j, orloff s and kaffka s (2018) measurement and simulation of water-use by canola and camelina under cool-season conditions in california. agric. water manage. 196 15–23. https://doi.org/10.1016/j.agwat. 2017.09.015 hammond r (2011) agronomy. in: daun jk, eskin nam and hickling d (eds) canola: chemistry, production, processing, and utilization. aocs press, urbana, illinois. hanks rj (1976) model for predicting plant yield as influenced by water use. agron. j. 66 660–665. https://doi.org/10.2134/agronj1974. 00021962006600050017x hardy mb and wallace mg (2013) determining the area of arable land suited to canola production in the western cape. western cape department of agriculture, elsenburg. hattingh hw (1993) the estimation of evaporation from soil surface under rainfed wheat and maize cultivation (in afrikaans). msc. agric. dissertation, university of the free state. hergert gw, margheim jf, pavlista ad, martin dl, supalla rj and isbell ta (2016) yield, irrigation response and water productivity of deficit to fully irrigated spring canola. agric. water manage. 168 96–103. https://doi.org/10.1016/j.agwat. 2016.02.003 hillel d (1982) introduction to soil physics. academic press, new york. https://doi.org/10.1016/b978-0-08-091869-3.50005-6 hintze jl (1998) number cruncher statistical system – ncss 2000. ncss, kaysville, utah. ilbeyi a, ustun h, oweis t, pala m and benli b (2006) wheat water productivity and yield in a cool high land environment: effect of early sowing with supplemental irrigation. agric. water manage. 82 399–410. https://doi.org/10.1016/j.agwat.2005.08.005 ismail sm (2016) maximizing production and irrigation water productivity of canola crop (brassica napus l.) under arid land conditions. irrig. drainage 65 254–263. https://doi.org/10.1002/ird.1956 kamkar b, daneshmand ar, gooshchi f, shiranirad ah and laroudi ar (2011) the effects of irrigation regimes and nitrogen rates on some agronomic traits of canola under semiarid environment. agric. water manage. 98 1005–1012. https://doi.org/ 10.1016/j.agwat.2011.01.009 katuwal kb, cho y, singh s, angadi sv, gegna s and stamm m (2020) soil water extraction pattern and water use efficiency of spring canola under growth-stage-based irrigation management. agric. water manage. 239 106232. https://doi.org/ 10.1016/j.agwat.2020.106232 lópez-urrea r, sánchez jm, de la cruz f, gonźalezpiqueras j and chávez jl (2020) evapotranspiration and crop coefficients from lysimeter measurements for sprinkler-irrigated canola. agric. water manage. 239 106260. https://doi.org/10.1016/j. agwat.2020.106260 momoh ejj and zhou w (2001) growth and yield responses to plant density and stage of transplanting in winter oilseed rape (brassica napus l.). j. agron. crop sci. 186  253–259. https://doi.org/10.1046/ j.1439-037x.2001.00476.x perry c, steduto p, allen rg and burt cm (2009) increasing productivity in irrigated agriculture: agronomic constraints and hydrological realities. agric. water manage. 96 1517–1524. https:// doi.org/10.1016/j.agwat.2009.05.005 przybylski r and eskin nam (2011) oil composition and properties. in: daun jk, eskin nam, hickling d (eds) canola: chemistry, production, processing, and utilization. aocs press, urbana, illinois. https://doi.org/10.1016/b978-0-9818936-5-5.50011-5 reinders fb (2011) irrigation methods for efficient water application: 40 years of south african research excellence. water sa 37 765–770. https://doi.org/10.4314/wsa.v37i5.13 robertson mj and kirkgaarde ja (2005) water-use efficiency of dryland canola in equi-seasonal rainfall environment. aust. j. agric. res. 56 1373–1386. https://doi.org/10.1071/ar05030 sadras vo and mcdonald g (2012) water use efficiency of grain crops in australia: principles, benchmarks and management. grains research and development cooperation, adelaide. seetseng ka, van rensburg ld, barnard jh and du preez cc (2022) influence of water application levels and plant densities on the plasticity of canola (brassica napus l.) in central free state, south africa. s. afr. j. plant soil 39 77–84. https://doi.org/10.1080/0 2571862.2021.2001597 https://doi.org/10.1016/j.agwat.2020.106706 https://doi.org/10.1016/j.agwat.2020.106706 https://doi.org/10.1016/j.agwat.2013.04.008 https://doi.org/10.1016/j.agwat.2013.04.008 https://doi.org/10.4141/cjps78-108 https://doi.org/10.3390/agriculture11050410 https://doi.org/10.1016/j.agwat.2008.07.014 https://doi.org/10.1016/j.agwat.2005.11.001 https://doi.org/10.1093/jxb/erl165 https://doi.org/10.1093/jxb/erl165 https://doi.org/10.1016/j.agwat.2020.106074 https://doi.org/10.2134/agronj2006.0296 https://doi.org/10.1016/j.agwat.2017.09.015 https://doi.org/10.1016/j.agwat.2017.09.015 https://doi.org/10.2134/agronj1974.00021962006600050017x https://doi.org/10.2134/agronj1974.00021962006600050017x https://doi.org/10.1016/j.agwat.2016.02.003 https://doi.org/10.1016/j.agwat.2016.02.003 https://doi.org/10.1016/b978-0-08-091869-3.50005-6 https://doi.org/10.1016/j.agwat.2005.08.005 https://doi.org/10.1002/ird.1956 https://doi.org/10.1016/j.agwat.2011.01.009 https://doi.org/10.1016/j.agwat.2011.01.009 https://doi.org/10.1016/j.agwat.2020.106232 https://doi.org/10.1016/j.agwat.2020.106232 https://doi.org/10.1016/j.agwat.2020.106260 https://doi.org/10.1016/j.agwat.2020.106260 https://doi.org/10.1046/j.1439-037x.2001.00476.x https://doi.org/10.1046/j.1439-037x.2001.00476.x https://doi.org/10.1016/j.agwat.2009.05.005 https://doi.org/10.1016/j.agwat.2009.05.005 https://doi.org/10.1016/b978-0-9818936-5-5.50011-5 https://doi.org/10.4314/wsa.v37i5.13 https://doi.org/10.1071/ar05030 https://doi.org/10.1080/02571862.2021.2001597 https://doi.org/10.1080/02571862.2021.2001597 163water sa 49(2) 155–163 / apr 2023 https://doi.org/10.17159/wsa/2023.v49.i2.3965 soil classification working group (1991) soil classification – a taxonomic system for south africa. memoirs of the national agricultural resources for south africa no.15. department of agriculture, pretoria. soriano ma, villalobos fj and fereres e (2002) stress timing effects on sunflower harvest index. in: villalobos fj and testi l (eds) vii congress of the european society for agronomy, sevilla, spain. ja conseje ıa de agricultura y pesca. 141–142. steduto p, hsiao tc and fereres e (2007) on the conservative behavior of biomass water productivity. irrig. sci. 25  189–207. https://doi.org/10.1007/s00271-007-0064-1 steduto p, hsiao tc, fereres e and raes d (2012) crop yield response to water. fao irrigation and drainage paper no 66. fao, rome. taylor aj, smith cj and wilson ib (1991) effect of irrigation and nitrogen fertilizer on yield, oil content, nitrogen accumulation and water use of canola (brassica napus l.). fert. res. 29  249–260. https://doi.org/10.1007/bf01052393 tesfamariam eh (2004) modelling the soil water balance of canola brassica napus l. (hyola 60). msc. (agric) dissertation, university of pretoria. tesfamariam eh, annandale jg and steyn jm (2010) water stress effects on winter canola growth and yield. agron. j. 102 658–666. https://doi.org/10.2134/agronj2008.0043 usda (2021) south africa: oilseeds and products annual. foreign agriculture science – united states department of agriculture, washington, dc. van huyssteen cw (2020) relating the south african soil taxonomy to the world reference base for soil resources. sun media, bloemfontein. https://doi.org/10.18820/9781928424666 zhou y, zhao w, lai y, zhang b and zhang d (2020) edible plant oil: global status, health issues and perspectives. front. plant sci. 11 1315. https://doi.org/10.3389/fpls.2020.01315 https://doi.org/10.1007/s00271-007-0064-1 https://doi.org/10.1007/bf01052393 https://doi.org/10.2134/agronj2008.0043 https://doi.org/10.18820/9781928424666 https://doi.org/10.3389/fpls.2020.01315 water sa 49(1) 36–45 / jan 2023 https://doi.org/10.17159/wsa/2023.v49.i1.3970 research paper issn (online) 1816-7950 available on website https://www.watersa.net 36 correspondence kapil moothi email kmoothi@uj.ac.za dates received: 10 december 2021 accepted: 21 november 2022 key words wastewater activated carbon adsorption btex compounds macadamia nut shell copyright © the author(s) published under a creative commons attribution 4.0 international licence (cc by 4.0) in this study, adsorptive removal of benzene, toluene, ethylbenzene and xylenes (btex) from synthetic water using activated carbon adsorbent derived from macadamia nut shells was investigated. the surface functional groups of the synthesized adsorbents were assessed by fourier transform infrared spectra. the specific surface area, pore size and pore volume at 77 k nitrogen adsorption, surface morphology, and the crystalline structure of the adsorbents were determined using brunauer-emmett-teller, scanning electron microscopy and x-ray diffraction, respectively. batch adsorption mode was used to evaluate the performance of the activated carbon. the stock solutions of synthetic wastewater were prepared by dissolving 100 mg/l of each of the btex compound into distilled water in a 250 ml volumetric flask. effect of initial concentration of btex compounds, contact time, and mass of adsorbent on the removal of btex compounds from the synthetic wastewater was investigated. the macadamia nut shell–derived activated carbon (mac) proved to be an effective adsorbent for btex compounds, with a large surface area of 405.56 m2/g. the exposure time to reach equilibrium for maximum removal of btex was observed to be 20 min. the adsorption capacity of the btex compounds by mac followed the following adsorption order: benzene > toluene > ethylbenzene > xylene. adsorptive removal of btex compounds from wastewater using activated carbon derived from macadamia nut shells kedibone melaphi1, olawumi o sadare1, geoffrey s simate2, stephan wagenaar3 and kapil moothi1 1department of chemical engineering, faculty of engineering and the built environment, doornfontein campus, university of johannesburg, po box 17011, doornfontein 2028, johannesburg, south africa 2school of chemical and metallurgical engineering, faculty of engineering and the built environment, university of the witwatersrand, johannesburg, wits 2050, south africa 3department of chemical sciences, faculty of science, university of johannesburg, po box 17011, doornfontein 2028, johannesburg, south africa introduction the presence of organic compounds such as benzene, toluene, ethylbenzene and xylenes (btex) in industrial and municipal wastewaters has been recognized as a serious environmental problem (aghdam et al., 2015; mohammadi et al., 2020). the btex compounds are common groundwater and potable water pollutants which are introduced to the environment through leakages from underground storage tanks, accidental spillages, and improper waste disposal practices, causing contamination of surface soils, seawater and the groundwater environment (chriac et al., 2007; slack et al., 2005; mitra et al., 2011). the united states environmental protection agency (usepa) has classified btex as priority pollutants that pose significant threats to human health and the environment due to their carcinogenic properties (mohammadi et al., 2017; hackbarth et al., 2014; mottaleb et al., 2003). health concerns relating to btex compounds include irritation of mucous membranes, irritation of organs and respiratory problems (nourmoradi et al., 2012). in spite of the negative health effects, btex pollutants remain untreated or undetected in municipal water treatment systems (fayemiwo et al., 2018; makhathini et al., 2017). this makes their removal from wastewater essential. many approaches, such as bioremediation, chemical oxidation and natural attenuation, have been employed to remove btex from wastewater. these techniques have proved to be successful; however, they are time-consuming and expensive (fayemiwo et al., 2017; agarwal et al., 2017). in the recent past, attention of researchers has been drawn towards the application of adsorption techniques, because these can be carried out at lower temperatures and pressures, making the process less energy intensive. in addition, the adsorption approach has low operational cost, is easy to operate, and adsorbents can be easily regenerated (edet et al., 2020; rodrigues et al., 2013). several adsorbents, such as polysterin resin, organoclay, natural clays and activated carbon (ac) have been used to remove btex compounds from water through adsorption processes (makhathini et al., 2017; nasrollahpour et al., 2020; carvallo et al., 2012). although commercial ac is popular and widely utilized owing to its high surface area, microporous structure and chemical stability, its applications have been hampered due to high cost of starting material (e.g., wood or coal). thus, it is imperative to use an efficient, cheap, and locally available adsorbent that is derived from renewable biomass materials (dao et al., 2021). macadamia nuts are an agricultural product, which is grown in subtropical regions around the world. the macadamia tree (macadamia spp.) is native to australia, where it was first discovered in in 1857 (dao et al., 2021). macadamia nuts are grown commercially in limpopo, the northernmost province of south africa. the production of ac using different agricultural waste products has been extensively documented in literature, whereas macadamia nut shells have received little attention. moreover, utilisation of macadamia nut shells as a starting material to produce ac for removal of btex compounds is scantily reported in literature. https://www.watersa.net https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ 37water sa 49(1) 36–45 / jan 2023 https://doi.org/10.17159/wsa/2023.v49.i1.3970 macadamia nut shells are an abundant resource. australia produces 47 000 tons of macadamia nuts with about 10  800– 120 000 tons of macadamia nut shells discarded as solid waste per annum, posing a significant waste management issue (dao et al., 2020). however, recycling of macadamia nut shells has played a vital role in producing biochar, which has been used to make activated carbon, because the shells have high carbon content (dao et al., 2021). in fact, agricultural waste materials that are carbon based can be used as effective raw materials for making ac. recent studies have investigated the use of agricultural waste such as, cocoa husk, corn cob, nut shell, macadamia nut shells and orange peels as raw materials for synthesis of adsorbents (dejang et al., 2015; jawad et al., 2017). activated carbons derived from macadamia nut shells have shown to be promising adsorbents for the removal of various pollutants (pakade et al., 2016; wongcharee et al., 2017; dao et al., 2020). in view of the aforementioned, application of macadamia nut shell as a promising adsorbent precursor for production of powdered and granular activated carbons could solve the challenge associated with its disposal and reduce environmental pollution. macadamia nut shell–derived activated carbons (macs) are a common carbon-based group of nanomaterials derived from biomass. they have microporous and mesoporous structures with a large surface area of 700–1 100 m2/g (rotorcarb activated carbon, 2020). furthermore, macs have many reactive sites on their surface, resulting in high adsorption capacity. the unique structure of macs makes it suitable for bridging the gap between conventional coal and coconut carbons (rotorcarb activated carbon, 2020). they have many applications in water purification, such as odour removal, colour correction, alcohol removal and toxin removal (rodrigues et al., 2013). therefore, they can be extensively used as effective and affordable adsorbent for removal of btex compounds from industrial wastewater. in a previous study, dao et al. (2020) reported the synthesis of macadamia nut shell by h3po4 activation for effective removal of cu2+ and zn2+ from wastewater. the adsorption efficiencies obtained were 84.02% and 53.42%, respectively. wongcharee et al. (2018) also reported the use of mac synthesized through carbon dioxide activation for adsorption of methylene blue. the results showed adsorption capacities in the range of 134–144 mg/g. in other studies, rice husk activated carbons (yakout et al., 2014), paper mill sludge activated carbons (aghdam et al., 2015) and biological activated carbons (zhang et al., 2011) have been reported to be effective adsorbents for removal of btex compounds from wastewater. however, as far as it can be ascertained, no studies have been reported in literature on the use of activated carbon derived from macadamia nut shells as an adsorbent for removal of btex compounds from synthetic wastewater. against this background, this study investigated the performance of macs in a batch adsorption mode for the removal of btex compounds from synthetic wastewater. in addition, the study provides information on the adsorption behaviour and kinetics of the adsorbent during the adsorption process. materials and methods the powdered macadamia nut shell activated carbons (pmac, 250 μm) used in this study were donated by rotocarb activated carbon, olifantsfontein, south africa. the mac was used as received from the manufacturer without any further purification. the btex chemicals, consisting of benzene (purity: 99.7%), toluene (purity: 99.7%), ethylbenzene (purity: 99.7%), and xylene (purity: 99.7%) were purchased from sigma-aldrich johannesburg, south africa. the chemicals used in this study were used without further purification. physico-chemical characterization of mac specific surface area, pore size, and pore volume was obtained by brunauer-emmet-teller (bet). the samples were analysed by physical adsorption of nitrogen at 77k using a nova 3200e instrument. the samples were degassed at 150˚c up to 4 h prior to each measurement. the sem joel jsm-5600 scanning electron microscope (sem) was used to examine the surface morphology of the adsorbent. the samples were coated with carbon to obtain better images. x-ray diffraction (xrd) analysis was used to examine the crystalline structure of the macs. xrd patterns were obtained with bruker xrd machine carried out in the two theta (2θ) on a d8 diffractometer. functional groups of the adsorbent sample were assessed with fourier-transform infrared (ftir) spectroscopy perkin elmer two atr-ftir equipment to detect surface functional groups. a small amount of kbr powder was mixed with macs. the mixture was ground for 5 min in a mortar to fine powder. the pellets were placed on the ftir sample holder for analysis. the spectra for macs were obtained in a frequency band range from 500 to 4 000 cm-1. preparation of synthetic btex solution the synthetic wastewater was prepared by dissolving 100 mg/l of each of the compounds (benzene, toluene, ethylbenzene and xylene), using a micropipette, in distilled water in a 250 ml volumetric flask to prepare the stock solution. the flask was closed with a lid and placed in the orbital shaker incubator running at 180 r/min at room temperature for 60 min to allow dissolution of btex compounds (fadaei et al., 2017). new solutions were prepared daily with the initial concentration of the adsorbate calculated before the start of each experiment. dilutions of the stock solution were prepared for calibration standard. performance evaluation of mac for removal of btex compounds for adsorption capacity studies, btex compounds were dissolved in distilled water and 0.055 g of the adsorbent was added to the flask containing different initial concentrations of btex compounds, ranging from 50 mg/l to 250 mg/l, in water. the experiments were conducted at 25°c for 60 min; the samples were then analysed with uv-vis (shimadzu uv mini 1240 model) between 215 and 261 nm. the experiments were conducted in duplicate. the adsorption capacity of the adsorbent was calculated using eq. 1. q c c m vt o t� � � ( ) (1) where: qt = adsorption capacity of adsorbent (mg/g); c0 = initial concentration of adsorbate (mg/l); ct = concentration at time t (mg/l); v = solution volume (l); and m = mass of adsorbent used (g). to determine the btex removal percentage, eq. 2 was used: removal efficiency % ( ) � � � c c c i e i 100 (2) where ci is the initial dose of the pollutants and ce is the effluent concentration in mg/l. table 1 provides detailed information on the conditions of the experiment: contact time, adsorbent dosage, and concentration. adsorption isotherms the results obtained from eq. 1 were used to determine the adsorption isotherms. the langmuir and freundlich isotherms were used to examine the adsorption mechanism of mac for the removal of btex compounds from synthetic btex-containing wastewater. 38water sa 49(1) 36–45 / jan 2023 https://doi.org/10.17159/wsa/2023.v49.i1.3970 langmuir isotherm the langmuir isotherm model assumes homogeneous monolayer adsorption; adsorption occurs via a fixed number of the same sorption sites (makhathini et al., 2017). the model is expressed in eq. 3: 1 1 1 1 q q k q cle e � � � max max (linear) (3) where qe (mg/g) is the amount of btex pollutants adsorbed at equilibrium, kl is the langmuir constant, ce is the equilibrium concentration of btex pollutants in solution after adsorption (mg/l) and qmax is the maximum amount of adsorption equivalent to complete monolayer coverage on the surface (mg/g) (makhathini et al., 2017). in this experiment, ce was measured and qe is calculated for different sets of conditions. the langmuir model produced a graph of 1/qe vs. 1/ce to establish the best-fit line and determine the r2 values for each pollutant adsorbed onto the mac adsorbents. the feasibility of the processes was evaluated using the separation factor rl. a dimensionless constant or separation factor (rl) is represented by eq. 4: r k cl l o � � 1 1 (4) where rl is used to describe the favourable nature of the adsorption process whereby rl > 1 is unfavorable, rl = 0 is linear, 0 < rl < 1 is favourable, and rl = 0 is irreversible (foo et al., 2010) freundlich isotherm the freundlich isotherm describes a heterogeneous process whereby the amount of solute adsorbed per unit adsorbent mass grows gradually (edet et al., 2020). the freundlich isotherm model was originally developed as an empirical model expressed as follows: ln ln lnq n cfe ek� � 1 (5) where kf is the constant of the freundlich isotherm (l/g) and n is an isotherm constant. the value of n is determined by the nature and strength of the adsorption process as well as the available active sites (saeed et al., 1996). the n value is an empirical constant related to heterogeneity of the adsorbent surface. the parameter n indicates the nature of the adsorption process whereby if n lies between 0 and 1, adsorption is favourable, if n > 1 adsorption is unfavourable, and n = 1 represents linear adsorption, and if n = 0 the process is irreversible. the values of n and kf are calculated from the slope and intercept of the plot of ln qe versus ln ce (aziam et al., 2017). the best-fit kinetic model is selected by considering the regression coefficient of determination (r2) which is a measure of how well predicted values from a forecast model match the experimental data. the freundlich kinetic model is applied to plot ln qe vs. ln ce graph for the best-fit line that determines the r2 values for each pollutant adsorbed onto mac. adsorption kinetics the adsorption kinetics for adsorption of btex compounds onto macs was investigated using the pseudo-first-order (pfo) and pseudo-second-order (pso) kinetic models. the pfo kinetic model describes the relationship between the rate at which the sorption sites of the adsorbents are occupied and the number of unoccupied sites (sadare and daramola, 2019). it is defined using eq. 6: ( ) lnq q q k tte e� � � 1 (6) where qe and qt are the amounts of btex adsorbed at equilibrium and at time t (min), respectively, and k1 is the rate constant of adsorption (min−1). the linear plot of ln (qe − qt) against time is used to determine the rate constant k1. the pso kinetic model describes the dependency of the adsorption capacity of the adsorbent on time and can be determined based on eq. 7: t q k t qt q � � 1 2 2 e (7) where qt and qe are the amounts of btex adsorbed at equilibrium and at time t (min), respectively, and k2 is the pseudo-secondorder rate constant (g/(mg·min). the linear plot of t/qi against time is used to determine qe and k2 from the slope and intercept, respectively, results and discussion physicochemical characterization of mac figure 1 depicts the surface morphology of mac, whereby the surface was observed to be glossy and smooth. the pores of the mac were elongated, and the microstructure had high porosity (fab et al., 2018). the alignment indicates that the macadamia kept the structure of lignocellulose-based plant materials, showing that during the activation process non-carbon materials were removed. there was also an increase in the presence of mesopores and macropores which confirms the high specific surface area of macs from bet results. this is an indication that macs could be a suitable adsorbent for effective adsorption of btex pollutants (wongcharee et al., 2018) figure 2 illustrates the surface functional groups on macs as assessed by ftir spectroscopy. surface functional groups on the macs play an essential role in the adsorption and provide selectivity and affinity towards btex. the infrared spectrum of activated carbon derived from macadamia nut shell showed a strong peak at 3 443 cm-1, representing the oh stretching vibration of hydroxyl functional groups, which is commonly seen when water is used in the preparation process (makhathini et al., 2015). the aliphatic stretching vibration c–h is observed at a very weak band at 2 847 cm-1 while the peak at 2 909 cm-1 represents the presence of ch2 stretching (fan et al., 2018). the peaks at 1 631 cm-1 to 1 080 cm-1 represent c–o and c=o which is attributed to the presence of carboxylic acids (phele et al., 2019; wongcharee et al., 2018). the peak at 1 351 cm-1 corresponds to c=c stretching of the aromatic rings, which indicates the presence of carbon in the macadamia nut shells (mopoung et al., 2015). this could be formed by decomposition of c–h bonds at high activation temperature. the peak at 1 080 cm-1 represents c–oh stretching of phenol groups (phele at al., 2019). table 1. experimental conditions parameter variation btex solution 50–250 mg/l time 0–60 min concentration 50–250 mg/l dosage 0.02–0.065 g agitation speed 180 r/min temperature 25°c volume 100 ml 39water sa 49(1) 36–45 / jan 2023 https://doi.org/10.17159/wsa/2023.v49.i1.3970 these are the main functional groups that can be attributed to the macadamia activated carbon component. the results observed in this study are comparable to literature (mopoung et al., 2015; phele et al., 2019; wongcharee et al., 2018). figure 3 depicts the crystalline structure of the mac composite. from the xrd graph (fig. 4), a broad intensity at 22.6° which correlates to carbon and graphite at 38.8° is observed at the initial phase of carbon powder, which can be indexed as 002 and 222 plane reflection. the peaks obtained correspond to amorphous carbon and graphite at high broad peaks. at high temperature, applied during the activation process, the macadamia nut shell was transformed to a crystalline structure of carbon (dejang et al., 2015). the results indicate the presence of graphite crystallite in the macadamia nut shell (xie et al., 2014). similar observations were reported by wongcharee et al. (2017) and dejang et al. (2015). table 2 presents the textural properties of the mac adsorbent. the bet technique was used to characterize the textural properties of activated carbon. the adsorbent materials were characterized in terms of pore sizes and surface area. from table 2, it can be seen that the activated carbon has a specific surface area of 405.56 m2/g. this could be due to its micro-pore size of 241.89 å and the temperature employed during synthesis. kemp et al. (2015) claimed that temperature employed during the synthesis of an adsorbent determines the development of surface areas. makhathini et al. (2015) reported that the porous structure of activated carbons is positively or negatively affected by the surface oxidation. in a positive way, reaction of oxygen with a reactive carbon skeleton can form new micropores which increase the specific surface area. however, in a negative way, the increase in size of pores, from micropore to macropore, can result in an overall decrease in the specific surface area (makhathini et al., 2015). figure 1. sem image depicting the surface morphology of macs figure 2. ftir spectra of macs 40water sa 49(1) 36–45 / jan 2023 https://doi.org/10.17159/wsa/2023.v49.i1.3970 performance evaluation of mac for adsorptive removal of btex compounds effect of adsorbent contact time the effect of contact time on the adsorptive removal of btex compounds from synthetic btex solution is depicted in fig. 4. the contact time was varied from 2 to 60 min while all other parameters remained constant. percentage btex removal increased with time. the rapid increase in the adsorption of btex compound from 2–20 min might be due to the numerous adsorption sites that are available at the beginning of the reaction, which subsequently decreased with increase in contact time as the adsorption sites become saturated (sadare and daramola, 2019; sadare et al., 2020). mekonnen et al. (2015) and kaya et al. (2014) reported similar trends, using papaya peels and wheat bran–derived adsorbents for removal of cr6+, respectively. dao et al. (2020) also observed a similar trend during investigation of cu2+ and zn2+ removal using activated carbon derived from macadamia nut shell. the adsorption rate was said to be quicker before the reaction approached equilibrium and slower as the reaction attained equilibrium (wongcharee et al., 2017; sadare et al., 2020). the results also showed that xylene was the most adsorbed compound among the btex compounds, and the order of percentage removal was b < t < e < x. this can be attributed to their differing water solubility, at 1 780 mg/l for benzene, 500 mg/l toluene, 150 mg/l for ethylbenzene and 150 mg/l for o, m, p xylenes (su et al., 2010). this observed trend could also be attributed to their hydrophobicity (based on log kow) with benzene = 2.13, toluene = 2.69, ethylbenzene = 3.15 and xylenes = 3.15. similar results were obtained by nourmoradi et al. (2012) and jodeh et al. (2015) using various adsorbents. effect of adsorbent dosage figure 5 presents the percentage removal of btex compounds from synthetic aqueous solution. the adsorbent dosage was varied from 0.02–0.0655 g, while all other parameters remained constant. percentage removal of btex compounds increased as the adsorbent mass was increased. this was attributed to the additional active sorption sites and surface area of mac, which was 405.56 m2/g as obtained from bet analysis (edet et al., 2020). it could be observed that at 0.025 g of mac, 85.56%, 78.49%, 70.40% and 58.90% removal were obtained for xylene, ethylbenzene, toluene and benzene, respectively. at 0.025 g adsorbent dosage, no further adsorption took place; this is because most of the btex compounds were adsorbed (jodeh et al., 2015). the removal percentage for btex followed the order b < t < e < x. less hydrophobic compounds such as benzene, which is more soluble compared to the other compounds, has less affinity toward the mac adsorbent. recent studies have concluded that btex adsorption onto various promising adsorbents favours the adsorption rate order of b < t < e < x (nourmoradi et al., 2012, kong et al., 2020). this is possibly because of the decrease in water solubility as well as the combination of molecular weight and hydrophobicity (log kow). effect of initial concentration the effect of initial adsorbate concentration on the removal of btex compounds by mac is shown in fig. 6. the initial concentration of btex was varied from 0–250 mg/l while all other adsorption parameters remained constant. at lower btex concentrations (0–100 mg/l) the percentage removal of btex increased. this could be due to the availability of more vacant adsorption sites at low concentrations of btex compounds. at higher concentrations from 100 mg/l to 250 mg/l, it was observed that the percentage removal decreased, and equilibrium was reached. the decrease in percentage removal at higher initial concentration could be attributed to the saturation of adsorption sites (owalude and tella, 2016; sadare and daramola., 2019). figure 3. xrd pattern for macadamia nut shell–derived activated carbon table 2. textural properties of the adsorbent from bet analysis adsorbent surface area (m2/g) pore volume (cm3/g) pore size (nm) activated carbon 405.56 0.205 24.189 41water sa 49(1) 36–45 / jan 2023 https://doi.org/10.17159/wsa/2023.v49.i1.3970 figure 4. effect of contact time on the adsorption of btex compounds from synthetic aqueous solution. experimental condition: amount of adsorbent – 0.025 g, initial concentration of btex compound – 100 mg/l, stirring speed – 180 r/min, reaction temperature – 25°c figure 5. effect of adsorbent dosage on the adsorption of btex compounds from synthetic aqueous solution. experimental conditions: contact time – 20 min, initial concentration of btex compound – 100 mg/l, stirring speed – 180 r/min, reaction temperature – 25°c figure 6. effect of initial concentration on the adsorption of btex compounds from synthetic aqueous solution. experimental conditions: contact time – 20 min, amount of adsorbent – 0.025 g, stirring speed – 180 r/min, reaction temperature – 25°c 42water sa 49(1) 36–45 / jan 2023 https://doi.org/10.17159/wsa/2023.v49.i1.3970 comparison of results with literature table 3 summarises and compares published studies where various adsorbents have been used to remove btex pollutants from aqueous solutions. jodeh et al. (2015) reported the use of date palm pits for removing btex at 0.1 adsorbent dosage, 20°c and 100 ml btex solution. the percentage removals obtained were 68% for benzene, 72% for toluene and 77% for xylene. similarly, in a study conducted by yakout et al. (2014) in which the removal of btex was achieved by using activated carbon prepared from rise husk, the removal percentage was 22% benzene, 33% toluene, 58% ethylbenzene, and 18.8% of p-xylene. in this study, removal of btex was investigated using mac at 0.055 g dosage, 100 ml/g btex solution at 25°c. the removal percentages obtained were 85.56%, 78.49%, 70.40% and 58.90% for xylene, ethylbenzene, toluene and benzene, respectively. the results obtained from the current study showed higher adsorption performance compared to jodeh et al. (2015) and yakout et al., (2014). removal of btex compounds using mac proved to give high removal efficiencies. it is expected that percentage removal will increase with increase in surface area. however, this was not the case in this study, where surface area for mac was 405.56 m2/g before modification, while surface area for date pit and rice husk activated carbon was 893.78 m2/g and 956.51 m2/g, respectively, after modification (anjum et al., 2017). this indicates that specific surface area is not the main factor which determines high removal percentages. bansode et al. (2013) established that activated carbons with high surface areas do not always result in good aromatic adsorption. in another example, in the removal of btex using paper mill sludge activated carbon the surface area was 613.38 m2/g with removal efficiencies above 92% for all for compounds at 10 ml/g and 1 g/l dosage (aghdam et al., 2015). other factors such as selection of raw materials and activation play an essential role (anjum et al., 2017). raw materials that have abundant lignin content have a microporous structure while raw materials that have high cellulosic content have a macroporous structure. surface functional groups such as carboxylic groups are also the main feature enabling adsorption of btex (aghdam et al., 2015). therefore, further studies should consider how the surface of the adsorbent can be modified in order to improve the efficiency of the mac adsorbent. adsorption isotherm studies equilibrium data were fitted to the langmuir and freundlich isotherm models as described by eqs 4 and 6. figure 7a shows the freundlich isotherm plot of btex sorption onto mac adsorbent. the isotherm failed to adequately fit in the data, with r2 = 0.7109. the freundlich constant 1/n was found to be 0.4264, which indicates that adsorption of btex by the mac was favourable. similar results were obtained in a study conducted by sivakumar et al. (2019) for the removal of azure a dye in wastewater. the langmuir isotherm presented in fig.7b fitted the data perfectly with r2 = 1.000, suggesting that the adsorption process occurs as a monolayer without a lot of interactions between molecules of the adsorbate. edokpayi et al. (2020) and wongcharee et al. (2018) reported similar results using macadamia nut shell for sorption of methylene blue. the feasibility of the processes was evaluated using the separation factor rl.. in this study, the value for rl is 0.019; this indicates that the adsorption process is favourable (wongcharee et al., 2018). in other studies to investigate the adsorption of btex compounds, the results have differed from the findings of this study. nourmoradi et al. (2012) reported that the freundlich isotherm was a better fit for btex adsorption on montmorillonite adsorbent. on the other hand, makhathini et al. (2017) reported that the langmuir isotherm was a better fit for btex adsorption on pad polystyrenic resins. this indicates that the adsorption of btex can be described by different isotherms, possibly based on the nature of the adsorbent used. adsorption kinetics in this study, pfo and pso were evaluated for btex compounds adsorbed on the mac. it is evident from the plots (fig. 8a and b) that the pso fitted the data better than pfo. r2 for the pso was above 0.9 and for the pfo was less than 0.9. this observation indicates that that the rate-limiting step for adsorption of btex on macs may be chemisorption. in chemical adsorption, the btex molecules stick to the adsorbent surface by forming strong covalent bonds. the data show large difference between the experimental and calculated adsorption capacity (qe) for btex in the pfo model. table 3. adsorption of btex by mac in current study compared with results reported in literature adsorbent adsorbate modification surface area (m2/g) pore volume (cm3/g) temp. (°c) %r ref. date pits (ac) btex modified 800 0.58 20 b = 68 jodeh et al. (2015) t = 72 x = 75 rise husk (ac) btex modified 965.5 0.726 b = 22 yakout et al. (2014) t = 33 eb = 58 x = 18.8 almond shells (ac) btex modified 1279 1.011 25 daifullah et al. (2003) olive stones (ac btex modified 848 0.632 25 daifullah et al. (2003) peach stones (ac) btex modified 1346 0.935 25 daifullah et al. (2003) coconut shell (ac) btex unmodified 724 0.39 30 t = 79 eb = 83 x = 79 souza et al. (2012) macadamia nut shell ac btex unmodified 405 0.205 25 b = 58.90 this study t = 70.4 eb = 78.49 x = 85.56 43water sa 49(1) 36–45 / jan 2023 https://doi.org/10.17159/wsa/2023.v49.i1.3970 figure 7. (a) plot for freundlich isotherm (ln ce vs. ln qe) and (b) plot for langmuir isotherm (1/ce vs. 1/qe). experimental conditions: 60 min reaction time, 0.025 g macs, 25°c table 4. pfo and pso kinetic parameters for the removal of btex compounds rate order benzene toluene ethylbenzene xylene pseudo-first-order k1 (min −1) 0.00055 0.00057 0.00066 0.00068 qe1 (mg/g) 0.85 0.87 0.88 0.89 r2 0.44 0.56 0.59 0.61 pseudo-second-order k2 (g/(mg·min) 0.82 1.22 1.13 1.80 qe2 (mg/g) 2.05 3.33 3.34 3.71 r2 0.96 0.98 0.99 0.99 figure 8. (a) pfo kinetics for btex using macs and (b) pso kinetics for removal of btex compounds using macs. experimental conditions: contact time – 60 min, amount of adsorbent – 0.025g, stirring speed – 180 r/min, reaction temperature – 25°c 44water sa 49(1) 36–45 / jan 2023 https://doi.org/10.17159/wsa/2023.v49.i1.3970 conclusion this study has successfully established a proof-of-concept that activated carbon derived from macadamia nut shell is a promising adsorbent for effective removal of btex compounds from synthetic aqueous solution. the adsorption capacity was affected by the initial btex concentration, adsorbent dose, and contact time. it reached a maximum concentration of 100 mg/l at adsorbent dose of 0.025 g and a sorption time of 20 min. the sorption capacity of btex increased in the order b < t < e < x, due to their differing molecular weights. the increase in percentage removal compared to other activated carbons was also attributed to the surface area of mac which was 405.56 m2/g. this confirms that the adsorbent has a mesoporous structure. the equilibrium adsorption was better represented by the langmuir isotherm which indicates a monolayer coverage of the adsorbate on the surface of the mac. the kinetic study indicated that the pso described the data better with r2 of 0.99. waste macadamia nut shells are readily available, hence making the adsorption process a cheaper alternative to other conventional techniques of treating btex-contaminated water. the results of this study could stimulate further research in this direction. furthermore, the results reported in this study could be instrumental in addressing the challenge posed by the disposal of waste macadamia nut shell and thus alleviate environmental pollution. author contributions conceptualization by km and km. the manuscript was written by kem, kam, oos. kam, oos and gss contributed to the preparation and review of this manuscript. experiments were performed by kem and data analyses were carried out by kem in discussion with oos. the project was supervised by kam and gss with project administration by kam. all authors have read and agreed to the published version of the manuscript. acknowledgements the authors acknowledge the financial support provided by national research fund (nrf) and bp education foundation sa. conflict of interest the authors declare no conflict of interest. references agarwal m and singh k (2017) heavy metal removal from wastewater using various adsorbents: a review.  j. water reuse desalin. 7 (4) 387–419. https://doi.org/10.2166/wrd.2016.104 aghdam e, aminzadeh b, baghdadi m and fard ma (2015) removal of btex from aqueous solutions by paper mill sludge-based activated carbon.  j. adv. chem. 11 (1). https://doi.org/10.24297/jac. v11i1.6688 anjum h, chemat f, gnanasundaram n, arunagiri a and thanabalan m (2017) impact of surface modification of activated carbon on btex removal from aqueous solutions: a review. in: sen tk (ed.) air, gas, and water pollution control using industrial and agricultural solid wastes adsorbents, crc press. 293–312. aziam r, chiban m, eddaoudi h, soudani a, zerbet m and sinan f (2017) kinetic modelling, equilibrium isotherm and thermodynamic studies on a batch adsorption of anionic dye onto eco-friendly dried carpobrotus edulis plant. eur. phys. j. spec. topics 226 (5) 977–992. https://doi.org/10.1140/epjst/e2016-60256-x carriero g, neri l, famulari d, di lonardo s, piscitelli d, manco a, esposito a, chirico a, facini o, finardi s and tinarelli g (2018) composition and emission of voc from biogas produced by illegally managed waste landfills in giugliano (campania, italy) and potential impact on the local population.  sci. total environ. 640 377–386. https://doi.org/10.1016/ j.scitotenv.2018.05.318 dao mt, nguyen tt, nguyen xd, la dd, nguyen dd, chang sw, chung wj, and nguyen vk (2020) toxic metal adsorption from aqueous solution by activated biochars produced from macadamia nut shell waste. sustainability 12 (19) 7909. https:// doi.org/10.3390/su12197909 dao mt, tran tpl, vo dt, nguyen vk and hoang lttt (2021) utilization of macadamia nut shell residue for the synthesis of magnetic activated carbon toward zinc (ii) ion removal.  adv. mater. sci. eng.  2021 article id 2543197, 10 pp. https://doi.org/ 10.1155/2021/2543197 dejang n, somprasit o and chindaruksa s (2015) a preparation of activated carbon from macadamia shell by microwave irradiation activation. energ. proced. 79 727–732. https:// doi.org/10.1016/j.egypro.2015.11.556 edet ua and ifelebuegu ao (2020) kinetics, isotherms, and thermodynamic modeling of the adsorption of phosphates from model wastewater using recycled brick waste.  processes  8 (6) 665. https://doi.org/10.3390/pr8060665 edokpayi jn, alayande so, adetoro a and odiyo jo (2020) the equilibrium, kinetics, and thermodynamics studies of the sorption of methylene blue from aqueous solution using pulverized raw macadamia nut shells.  j. anal. meth. chem.  2020 article id 8840666, 10 pp. https://doi.org/10.1155/2020/8840666 fan f, yang z, li h, shi z and kan h (2018) preparation and properties of hydro chars from macadamia nut shell via hydrothermal carbonization. r. soc. open sci. 5 (10) 181126. https:// doi.org/10.1098/rsos.181126 fadaei s, moghadam fn, hashemi m and pourzamani h (2017) btex removal from aqueous solution by modified multi-walled carbon nanotubes with ozone.  an. inst. geoci. 40 (1) 235–242. https://doi.org/10.11137/2017_1_235_242 fayemiwo o, moothi k and daramola m (2017) btex compounds in water–future trends and directions for water treatment. water sa 43 (4) 602–613. https://doi.org/10.4314/wsa. v43i4.08 fayemiwo om, daramola mo and moothi k (2018) tanninbased adsorbents from green tea for removal of monoaromatic hydrocarbons in water: preliminary investigations.  chem. eng. comm. 205 (4) 549–556. https://doi.org/10.1080/00986445.2017.14 09738 jawad ah, mamat nfh, abdullah mf and ismail k (2017) adsorption of methylene blue onto acid-treated mango peels: kinetic, equilibrium and thermodynamic study.  desalin. water treat. 59 210–219. jodeh s, ahmad r, suleiman m, radi s, emrank m, salghi r, warad i and hadda tb (2015) kinetics, thermodynamics and adsorption of btx removal from aqueous solution via date-palm pits carbonization using spme/gc–ms.  j. mater. environ. sci  6 (10) 2853–2870. kong h, mat h and yunus mac (2020) batch adsorptive removal of btex from aqueous solution: a review. in:  third international conference on separation technology 2020 (icost2020).  atlantis press. 303–318. https://doi.org/10.2991/aer.k.201229.040 leite ab, saucier c, lima ec, dos reis gs, umpierres cs, mello bl, shirmardi m, dias sl and sampaio ch (2018) activated carbons from avocado seed: optimisation and application for removal of several emerging organic compounds.  environ. sci. pollut. res.  25 (8) 7647–7661. https://doi.org/10.1007/s11356-0171105-9 lima lf, de andrade jr, da silva mg and vieira mg (2017) fixed bed adsorption of benzene, toluene, and xylene (btx) contaminants from monocomponent and multicomponent solutions using a commercial organoclay. indust. eng. chem. res. 56 (21) 6326–6336. https://doi.org/10.1021/acs.iecr.7b00173 makhathini tp and sudesh r (2017) investigation of btex compounds adsorption onto polystyrenic resin. s. afr. j. chem. eng. 23 (2017) 71–80. https://doi.org/10.1016/j.sajce.2017.03.001 makhathini tp (2015) investigation of the adsorption performance of polystyrenic resin and gac for the removal of btex compounds from industrial wastewater. phd dissertation, durban university of technology, durban. https://hdl.handle.net/10321/1496 mitra s and roy p (2011) btex: a serious ground water contaminant. res. j. environ. sci. 5 (5) 394–398. https://doi.org/10.3923/rjes.2011. 394.398 https://doi.org/10.2166/wrd.2016.104 https://doi.org/10.24297/jac.v11i1.6688 https://doi.org/10.24297/jac.v11i1.6688 https://doi.org/10.1140/epjst/e2016-60256-x https://doi.org/10.1016/j.scitotenv.2018.05.318 https://doi.org/10.1016/j.scitotenv.2018.05.318 https://doi.org/10.3390/su12197909 https://doi.org/10.3390/su12197909 https://doi.org/10.1155/2021/2543197 https://doi.org/10.1155/2021/2543197 https://doi.org/10.1016/j.egypro.2015.11.556 https://doi.org/10.1016/j.egypro.2015.11.556 https://doi.org/10.3390/pr8060665 https://doi.org/10.1155/2020/8840666 https://doi.org/10.1098/rsos.181126 https://doi.org/10.1098/rsos.181126 https://doi.org/10.11137/2017_1_235_242 https://doi.org/10.4314/wsa.v43i4.08 https://doi.org/10.4314/wsa.v43i4.08 https://doi.org/10.1080/00986445.2017.1409738 https://doi.org/10.1080/00986445.2017.1409738 https://doi.org/10.2991/aer.k.201229.040 https://doi.org/10.1007/s11356-017-1105-9 https://doi.org/10.1007/s11356-017-1105-9 https://doi.org/10.1021/acs.iecr.7b00173 https://doi.org/10.1016/j.sajce.2017.03.001 https://hdl.handle.net/10321/1496 https://doi.org/10.3923/rjes.2011.394.398 https://doi.org/10.3923/rjes.2011.394.398 45water sa 49(1) 36–45 / jan 2023 https://doi.org/10.17159/wsa/2023.v49.i1.3970 mohammadi l, rahdar a, bazrafshan e, dahmardeh h, susan abh and kyzas gz (2020) petroleum hydrocarbon removal from wastewaters: a review. processes 8 (4) 447. https://doi. org/10.3390/pr8040447 mohammadi l, bazrafshan e, noroozifar m, ansarimoghaddam a, barahuie f and balarak d (2017) adsorptive removal of benzene and toluene from aqueous environments by cupric oxide nanoparticles: kinetics and isotherm studies.  j. chem.  2017 article id 2069519. https://doi.org/10.1155/ 2017/2069519 mopoung s, moonsri p, palas w and khumpai s (2015) characterization and properties of activated carbon prepared from tamarind seeds by koh activation for fe (iii) adsorption from aqueous solution. sci. world j. 2015 article id 415961. 9 pp. https:// doi.org/10.1155/2015/415961 mottaleb ma, abedin mz and islam ms (2003) determination of benzene, toluene, ethylbenzene and xylene in river water by solid-phase extraction and gas chromatography. anal. sci. 19 (10) 1365–1369. https://doi.org/10.2116/analsci.19.1365 nourmoradi h, nikaeen m and khiadani m (2012) removal of benzene, toluene, ethylbenzene and xylene (btex) from aqueous solutions by montmorillonite modified with nonionic surfactant: equilibrium, kinetic and thermodynamic study.  chem. eng. j. 191 341–348. https://doi.org/10.1016/j.cej.2012.03.029 nourmoradi h, khiadani m and nikaeen m (2013) multicomponent adsorption of benzene, toluene, ethylbenzene, and xylene from aqueous solutions by montmorillonite modified with tetradecyl trimethyl ammonium bromide. j. chem. 2013 article id 589354. 10 pp. https://doi.org/10.1155/2013/589354 nasrollahpour s, daryoush yk, mohammad g, and omid gf (2020) application of organically modified clay in removing btex from produced water. in:  geo-congress 2020: geo-systems, sustainability, geoenvironmental engineering, and unsaturated soil mechanics. american society of civil engineers, reston, va. 275–283. https://doi.org/10.1061/9780784482827.031 owalude so and tella ac (2016) removal of hexavalent chromium from aqueous solutions by adsorption on modified groundnut hull. beni-suef univ. j. basic appl. sci. 5 (4) 377–388. https://doi.org/10.1016/j.bjbas.2016.11.005 pakade ve, ntuli t and ofomaja ae (2016) biosorption of hexavalent chromium 128 from aqueous solutions by macadamia nut shell powder. appl. water sci. 6 1–16. https://doi.org/10.1007/ s13201-016-0412-5 phele mj, ejidike ip and mtunzi fm (2019) adsorption efficiency of activated macadamia nut shell for the removal organochlorine pesticides: endrin and 4, 4-ddt from aqueous solution. j. pharm. sci. res. 11 (1) 258–262. rotorcarb-activated carbon. rotorcarbs products. url: www.rotocarb.co.za (accessed 3 august 2020). rodrigues la, de sousa ribeiro la, thim gp, ferreira rr, alvarez-mendez mo and dos reis coutinho a (2013) activated carbon derived from macadamia nut shells: an effective adsorbent for phenol removal. j. por. mater. 20 (4) 619–627. https:// doi.org/10.1007/s10934-012-9635-5 sadare oo and daramola mo (2019) adsorptive removal of dibenzothiophene from petroleum distillates using pomegranate leaf (punica granatum) powder as a greener adsorbent. chem. eng. comm. 206 (3) 333–345. https://doi.org/10.1080/00986445.2018.148 8691 sadare oo, ayeni ao and daramola mo (2020) performance evaluation of green adsorbent (neem leaf powder) for desulfurization of petroleum distillate. chem. eng. trans. 80 361–366. https://doi. org/10.3303/cet2080061 sivakumar s, muthirulan p and meenakshi sundaram m (2019) adsorption kinetic and isotherm studies of azure a on various activated carbons derived from agricultural wastes. arab. j. chem. 12 (7) 1507–1514. https://doi.org/10.1016/j.arabjc.2014.10.028 slack rj, gronow jr and voulvoulis n (2005) household hazardous waste in municipal landfills: contaminants in leachate.  sci. total environ.  337 (1–3) 119–137. https://doi.org/10. 1016/j.scitotenv.2004.07.002 su f, lu c, johnston kr and hu s (2010) chapter 5 – kinetics, thermodynamics, and regeneration of btex adsorption in aqueous solutions via naocl-oxidized carbon nanotubes. in: fan m, huang c-p, bland ae, wang z, slimane r & wright i (eds) environanotechnology. elsevier. 71–97. https://doi.org/10.1016/b9 78-0-08-054820-3.00005-8 stofela skf, de andrade jr and vieira mga (2017) adsorption of benzene, toluene, and xylene (btx) from binary aqueous solutions using commercial organoclay.  can. j. chem. eng. 95 (6) 1034–1044. https://doi.org/10.1002/cjce.22748 yakout sm and daifullah aam (2013) adsorption/desorption of btex on activated carbon prepared from rice husk. desalin. water treat. 52 (22–24) 4485–4491. https://doi.org/10.1080/19443994.201 3.821629 wongcharee s, aravinthan v, erdei l and sanongraj w (2017) use of macadamia nut shell residues as magnetic nanosorbents. int. biodeterior. biodegrad. 124 276–287. https://doi. org/10.1016/j.ibiod.2017.04.004 wongcharee s, aravinthan v, erdei l and sanongraj w (2018) mesoporous activated carbon prepared from macadamia nut shell waste by carbon dioxide activation: comparative characterisation and study of methylene blue removal from aqueous solution. asia‐pacific j. chem. eng. 13 (2) 2179. https://doi. org/10.1002/apj.2179 zhang w, ding w and ying w (2011) biological activated carbon treatment for removing btex from water. chin. environ. sci. 31 (12) 1965–1971. https://doi.org/10.1061/(asce)ee.1943-7870.0000731 https://doi.org/10.3390/pr8040447 https://doi.org/10.3390/pr8040447 https://doi.org/10.1155/2017/2069519 https://doi.org/10.1155/2017/2069519 https://doi.org/10.1155/2015/415961 https://doi.org/10.1155/2015/415961 https://doi.org/10.2116/analsci.19.1365 https://doi.org/10.1016/j.cej.2012.03.029 https://doi.org/10.1155/2013/589354 https://doi.org/10.1061/9780784482827.031 https://doi.org/10.1016/j.bjbas.2016.11.005 https://doi.org/10.1007/s13201-016-0412-5 https://doi.org/10.1007/s13201-016-0412-5 http://www.rotocarb.co.za https://doi.org/10.1007/s10934-012-9635-5 https://doi.org/10.1007/s10934-012-9635-5 https://doi.org/10.1080/00986445.2018.1488691 https://doi.org/10.1080/00986445.2018.1488691 https://doi.org/10.3303/cet2080061 https://doi.org/10.3303/cet2080061 https://doi.org/10.1016/j.arabjc.2014.10.028 https://doi.org/10.1016/j.scitotenv.2004.07.002 https://doi.org/10.1016/j.scitotenv.2004.07.002 https://doi.org/10.1016/b978-0-08-054820-3.00005-8 https://doi.org/10.1016/b978-0-08-054820-3.00005-8 https://doi.org/10.1002/cjce.22748 https://doi.org/10.1080/19443994.2013.821629 https://doi.org/10.1080/19443994.2013.821629 https://doi.org/10.1016/j.ibiod.2017.04.004 https://doi.org/10.1016/j.ibiod.2017.04.004 https://doi.org/10.1002/apj.2179 https://doi.org/10.1002/apj.2179 https://doi.org/10.1061/(asce)ee.1943-7870.0000731 water sa 49(3) 211–219 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.3964 research paper issn (online) 1816-7950 available on website https://www.watersa.net 211 correspondence anthony palmer email t.palmer@ru.ac.za dates received: 17 november 2021 accepted: 5 july 2023 key words water fluxes penman-monteith-leuning medrush mod16 copyright © the author(s) published under a creative commons attribution 4.0 international licence (cc by 4.0) ecosystem services in the south african grassland biome are being impacted by the presence of invasive alien plants (iaps), particularly from the australian genus acacia. iaps have elevated landscape water use and determining water fluxes is crucial to defining suitable interventions. this study evaluates three models of water flux over iap-invaded grassland against evapotranspiration (et) measured by a large-aperture scintillometer (las). et was modelled using an energy balance model (medrush), a biophysical model (penman-monteith-leuning (pml)) and a remotely sensed product (mod16), and their results compared with et measured by the las. etlas was measured during an abbreviated field campaign in november 2019 over a dense silver wattle (a. dealbata) stand associated with hillslope seeps. of the three models tested against the las campaign, medrush performed well-enough to be used to model et over the continuous scientific-grade micro-meteorological record (315 days). we used medrush to model et over the invaded hillslope seeps and compared this with the expected et that would occur over the adjacent, un-invaded grassland. total et over the iap-invaded area was approximately 536 mm (60% of reference et) as compared with the grassland (202 mm), showing that woody encroachment significantly increases landscape water use. to estimate the local impact of this, we used earth observation to determine the area of woody invasion in a 2 664 km2 regional window. approximately 10% (274 km2) of this window was invaded by iaps and, assuming the geographic window was representative of all the areas invaded by wattle, this represents ~ 89 000 ml of water used annually by the iaps. removal of wattle, followed by suitable restoration of landscape functionality, would greatly enhance rangeland productivity and water production from hillslope seeps. an evaluation of three evapotranspiration models to determine water fluxes over hillslopes encroached by invasive alien plants in eastern cape province, south africa anthony palmer1, craig weideman1, heidi-jane hawkins2,3, perushan rajah2, tawanda marandure4, cletos mapiye5, lianhai wu6, onalenna gwate7 and james bennett4 1institute for water research, rhodes university, po box 94, makhanda 6140, south africa 2conservation south africa, 301 heritage house, claremont 7375, south africa 3department of biological sciences, university of cape town, private bag x3, rondebosch 7701, south africa 4centre for agroecology, water and resilience (cawr), coventry university, ryton gardens, wolston lane, coventry, cv8 3lg, united kingdom 5department of animal sciences, stellenbosch university, p. bag x1, matieland 7602, south africa 6sustainable agriculture sciences, rothamsted research, north wyke, okehampton, devon ex20 2sb, united kingdom 7afromontane research unit, university of the free state, qwaqwa campus, phuthaditjhaba 9866, free state, south africa introduction terrestrial biomes are strongly linked to climatic factors, soil types, land-form and disturbance regimes. plant functional types interact with soil and climate to give each biome a unique set of climatic conditions with respect to the nature and strength of the interactions with the atmosphere. south africa’s grassland biome can be distinguished from the other biomes by the presence of a strong summer seasonality in precipitation, low base status soils, the prevalence of frost from april to september, and the regular occurrence of fires (mucina et al., 2006). the biome has also experienced invasion by several woody invasive alien plants (iaps), with two australian wattle species (acacia mearnsii and a. dealbata) representing the greatest threat. a. dealbata is particularly successful at invading the hillslope seeps associated with the sandstone beds of the karoo supergroup (johnson et al., 1996). invasion is accompanied by a decrease in biodiversity under the wattle canopy and a reduction in grass production, as only a few shade-tolerant, c3 grasses are able to survive (gwate et al., 2016). the presence of wattle along these seeps reduces flow from perennial springs arising from the fractured rock aquifers. as the wattle is of limited economic value and not generally consumed by livestock, there is a strong ecological and political agenda within south africa (turpie et al., 2008) to clear-fell the wattle and restore the grasslands. it has been established that the removal of riparian wattle leads to significant reductions in annual evapotranspiration (et) which in turn will enhance streamflow (dye et al., 2001). this has been further elaborated recently in comprehensive reviews by everson et al. (2011) and le maitre et al. (2020), which provided support for clearing efforts. in order to quantify the et that woody encroachment by invasive alien plant (iaps) accounts for in south africa, several different direct and indirect approaches have been used to measure or estimate et over fynbos, grassland and woodland ecosystems. these include: measurement with a large-aperture scintillometer (las) system (gwate et al. 2018); sap flow measurements (scott-shaw et al., 2017); eddy covariance (ec) systems (gwate et al., 2019); modelling at a biome scale (gwate et al., 2018) and the improved parsimonious single layer et model (penman-monteith-palmer (pmp) validated with las (palmer et al., 2015). as it is costly and impractical to measure et continuously, modelling is a necessary alternative. https://www.watersa.net https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ 212water sa 49(3) 211–219 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.3964 however, it remains unclear how consistent et comparisons are for specific ecosystems using these different modelling approaches, particularly when comparing native grasslands with and without iaps. furthermore, a lack of site-specific, long-term micro-meteorological data has also limited the confidence that can be placed in the et values produced by different models. to this end, our study compares the performance of three models when simulating et over grassland and woodland ecosystems, with reference to an iap-invaded area of grassland in eastern cape province, south africa, where long-term micrometeorological data were available for 95% of a hydrological year. these are the medrush model (osborne and woodward, 1999), the mod16 product (mu et al., 2013) and the penman-monteithleuning (pml) model (leuning et al., 2008). in each case, the output of these models is compared with ground measurements made using a las. outputs from the best-performing model then enabled us to estimate total annual water loss due to iap invasion for a defined area of the study site. the aims of this study were: • to identify the most appropriate model for estimating evapotranspiration from iap-invaded rangeland by comparing the model output to the results from an abbreviated las field campaign • to use the selected model to calculate et over the invaded area and the adjacent grasslands and settlements using meteorological data from a 315-day dataset • to determine, with the aid of earth observation, the area of land invaded by iaps within a defined area of the study site • to estimate the total water loss resulting from the invasion of iaps material and methods study area the study area is located within nkasela, a rural village approximately 20 km north of matatiele, eastern cape province (30.20°s; 28.77°e). the dominant vegetation is east griqualand grassland and is mainly restricted to foothills of the drakensberg mountain range. geology comprises sedimentary mudstones and sandstones of the beaufort group of the karoo supergroup, with rocks of the molteno, elliot and clarens formations also occasionally present. the dominant soils on the sedimentary parent material are well drained, with a depth of 500–800 mm and clay content from 15–55%. the region experiences mostly summer rainfall, with mean annual precipitation of 700 mm, ranging from 620–816 mm. kokstad (−30.51°s; 29.41°e), the nearest long-term automatic weather station (aws), records 88  rain days in a year and only 3 of those occur in the midwinter (june–july). both mist and snow occur infrequently (kokstad 26 misty days per year) and much of the rain comes in the form of thunderstorms (kokstad 45 days). mean annual temperature is 15°c. moderately severe frosts occur 30 days in a year. mean annual reference et (fao56 eto) derived from the kokstad aws (15 years of complete data) is 1 150 mm. the grassland biome has a rich biodiversity, but has been invaded by woody species, especially black wattle (acacia mearnsii) from planted woodlots and in the riparian zone, and silver wattle (a. dealbata) along hillslope seeps. the invasion by black wattle has occurred by spreading away from intentional plantings such as windbreaks and woodlots, with the direction of spread being worst into abandoned arable lands (scorer et al., 2016). there has been little research on the invasion by silver wattle, with the exception of seath and shackleton (2022). eye-balling of very high resolution satellite imagery of the region revealed that silver wattle was predominantly occurring along seep-lines associated with fractured rock aquifers of the sandstone layers of the beaufort group. large-aperture scintillometer (las) a large-aperture scintillometer (las mkii, kipp & zonen b.v., netherlands) was installed at the site (fig. 1) during an abbreviated field campaign from 26 november 2019 until 1 december 2019. the las measures the path-averaged structure parameter of the refractive index of air ( )cn 2 over horizontal path lengths from 250 m to 4.5 km, and has a 0.149 m diameter (d) beam. the light source of the las mkii transmitter operates at 850 nm and the scintillations measured by the instrument are caused by turbulent temperature fluctuations. at nkasela, a suitable stand of relatively homogenous silver wattle on a hillslope seep was identified, with a path length of 250 m. since the path length was less than 1 km, 0.1 m aperture diameter restrictors were fitted (kipp and zonen, 2012). the instrumental set-up was arranged to ensure that the fetch comprised relatively homogenous vegetation, although small stretches of grass were unavoidable. a las measures the amount of scattering of electromagnetic radiation caused by turbulence in the atmosphere using a transmitted beam of light over a horizontal path between a transmitter and a receiver (meijninger et al., 2002). at the receiver, the fluctuation in light intensity is analysed. these refractive index fluctuations lead to intensity variations, which are known as scintillations (kohsiek et al., 2002; tunick, 2003). the scintillations are caused by the fluctuations of the refractive index (n) of air along the propagation path and its magnitude can be described by the structure parameter of the refractive index of air ( )cn 2 , which is the basic parameter derived from scintillometer data (hill, 1992; pozníková et al., 2015). the cn 2 m-2/3 is a representation of atmospheric turbulent strength or the ability of the atmosphere to transport scalars, such as heat, humidity and other atmospheric gases. the value of cn 2 in the lower atmosphere has generally been observed to range from about 10−12 to 10−17 m−2/3 (kipp and zonen, 2012). high values of cn 2 (≥ 10−12 m−2/3) indicate a highly unstable atmosphere, while lower values ranging from 10−16 to 10−17m−2/3 are indicative of weak and insignificant atmospheric optical turbulence over shorter (≤ 2 km) optical paths (tunick, 2003). by applying the monin-obukhov similarity theory (most), surface flux of sensible heat (h) can be determined. further, the latent heat (le) flux can be derived from the surface energy balance, if ancillary meteorological data are available. for a las that has equal apertures, the relationship between the measured variance of the natural logarithm of intensity fluctuations ( )σ lni2 and cn 2 is as follows (kipp and zonen, 2012). c d ln lni 2 2 7 3 31 12� �. /� (1) where d is the aperture diameter of the las, l the distance between the transmitter and the receiver (i.e. the path length). essentially, the accuracy of the energy fluxes from a las is influenced by the mean height of the las mkii optical beam above the surface. for flat surfaces, determining the effective las beam height is simple and can be derived from the transmitter and receiver heights (kipp and zonen, 2012). however, an ideal flat surface is rare and the evation software program (v2.5.0.11, kipp & zonen b.v., delft, netherlands) was used to determine effective las beam height following hartogensis et al. (2003). a slope profile along the path length was generated from elevation values extracted from google earth pro. 20-min et was calculated from the las output using evation. micro-meteorological station a micro-meteorological weather station, comprising a range of key instruments (table 1), was installed at the nkasela village 213water sa 49(3) 211–219 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.3964 between 4 october 2019 and 16 august 2020. this station recorded data from each instrument at 20-min intervals, resulting in 315 days of scientific-grade data. the station measured net radiation (rn), wind speed and direction, soil heat flux, volumetric soil water content (swc), air and soil temperature as well as relative humidity (rh). the pair of net radiometers provided a mean measure of net radiation (rn) at 2 m above the canopy, while soil heat flux was measured using 4 soil heat flux plates (table 1). a system of parallel soil thermocouple probes measured soil temperature above the heat flux plates and the volumetric soil water content was measured in the upper 60 mm of soil using 2 sensors. the installation of heat flux plates, soil temperature thermocouples and the water content reflectometer was completed following campbell scientific (2002). an hc2s3 temperature and rh probe (campbell scientific inc., logan, utah, usa) was used to measure air temperature and rh in a radiation shield. air temperature was also measured using 2 unshielded type-e (chromel/constantan) fine-wire thermocouples (fw05) placed at heights of 1 m and 2.7 m above the ground surface. wind speed and direction were measured using an anemometer (wind monitoraq, model 05305, r.m. young company, michigan, usa) located at 3.7 m above the surface. figure 1. location of the transmitter (trs) and receiver (rec) at the nkasela large-aperture scintillometer (las) site table 1. list of instruments at the large-aperture scintillometer micro-meteorological station bio-meteorological variable instrument soil heat flux (w·m−2) 4 x soil heat plate (hfp01), (hukseflux thermal sensors, delft, netherlands) volumetric water content (%) water content reflectometer (cs616, campbell scientific inc., logan, utah, usa) temperature and rh (%) hc2s3 temperature and rh probe (campbell scientific inc., logan, utah, usa) soil temperature (°c) 2 x averaging soil thermocouples probe (tcav, campbell scientific inc., logan, utah, usa) net radiation (w·m−2) 2 x net radiometers (nr-lite2) (kipp and zonen, netherlands) air temperature (°c) 2 x fine wire thermocouples (fw05: 0.0005 inch /0.0127 mm, campbell scientific inc., logan, utah, usa) at 1.0m and 2.5m above soil surface wind speed (m·s−1) and direction (degrees) wind monitor-aq, model 05305, r.m. young company, michigan, usa 214water sa 49(3) 211–219 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.3964 theory of the models trained using the las output medrush model the medrush model operates on a variable time scale depending on the input interval of the weather data and provides a mechanistic description of the movement of water and energy in an ecosystem. the model is driven by meteorological and stomatal conductance measurements to simulate fluxes over a crop or area of land. the version of the model used in this study was originally developed by osborne and woodward (osborne and woodward, 1999) and has undergone subsequent development. the model, written in r script, uses an equation from buck (1981), reproduced by jones (2014), to calculate saturation vapour pressure from air temperature. day-time stomatal conductance (gs), a required input into the model, was measured for silver wattle at 8 mmol·m-2·s-1 using a leaf porometer (decagon devices, us/canada). for the grassland simulation, gs of 3 mmol·m−2·s−1 was used based on a previous study in the perennial c4 grasslands within the same geographic region (gwate et al., 2018). the meteorological data used by medrush include minimum and maximum temperature, relative humidity, soil temperature, wind speed and solar radiation. all data were obtained from the weather station at the site. penman-monteith-leuning (pml) model the pml model (leuning et al., 2008) is a biophysical model which assumes that actual et is a combination of canopy transpiration (ec), evaporation of intercepted water by canopy and litter (ei) and soil evaporation (es) (morillas et al., 2013). the pmlswc model is based on the penman-monteith equation integrated with a leaf area index derived from earth observation (morillas et al., 2013). mod16 et model (mod16a2) the moderate resolution imaging spectro-radiometer (modis) provides global observations of the earth’s land, atmosphere and oceans in the visible and infrared regions of the spectrum. mod16 is a modis global et product that provides continuous et datasets (both actual et and reference et) at 0.5 km spatial resolution and 8-day, monthly and annual temporal scale using priestley-taylor, penman-monteith and land surface model approaches (aguilar et al., 2018; khan et al., 2018). mod16 product is an operational source of et data with adequate spatial resolution for many water resource applications, both at local and regional scales. this study used the mod16 et (mod16a2.006) product (running et al., 2015), which is available with 0.25 km2 spatial and an 8-day temporal resolution. this version uses an improved algorithm (mu et al., 2011) which is based on the penman–monteith equation and estimates evaporation from soil and wet surfaces as well as transpiration from the vegetation (aguilar et al., 2018). the improved model is distinguished by: (i) calculation of et as the sum of daytime and night-time component; (ii) calculation of the soil heat flux; (iii) a simplified calculation of the plant cover fraction; and (iv) improved estimates of stomatal conductance, aerodynamic resistance, and resistance of the boundary layer (aguilar et al., 2018; mu et al., 2011). biophysical attributes of the study site leaf area index in-situ leaf area index (lai) was measured with an accupar ceptometer (decagon devices inc., pullman, washington, usa) at 10 points directly under the wattle canopy and immediately below the beam of the las. points were selected along an ndvi gradient derived from esa sentinel 2 pixels (10 m x 10 m), and at each point 5 readings were made with the ceptometer. readings were taken at or around noon, when the sun was directly overhead. the par (photosynthetically active radiation) extension sensor for the accupar ceptometer was used to provide continuous, above-canopy par, readings. the lai was also extracted from the modis lai product to provide a landscape-scale lai. land area invaded by wattle in order to determine the area of land invaded by both species of wattle in the region, we developed a land cover classification based on 8 recognisable (from aerial photography and high-resolution imagery) land cover classes. we identified a 50 km x 50 km regional window that included all the rural villages selected for the funded project. this included the research site at nkasela and was broadly representative of the local variation in wattle density. the spectral signatures from 416 training sites, representing each of these cover classes, were extracted from landsat 8 imagery. these signatures were used to produce a map in google earth engine after applying the random forest classification algorithm (ho, 1998). data analysis las data processing from the reference point (transmitter), a total of 4 points 50 m apart were geo-coded and their height above sea level extracted from google earth pro and used to derive effective height. further input parameters into evation included an expression for zero-plane displacement height (z0m) and roughness length (d) which affect the intensity of mechanical turbulence and the fluxes of sensible heat (h), latent heat (le) and momentum above the surface. vegetation height was measured using a disto x310 laser distance meter (leica-geosystems, germany) to derive mean canopy height. the z0m and d were determined from the estimated canopy height (h) as 0.1 h and 0.66 h, respectively (allen et al., 1998). data were processed using evation and the derived le was converted into mm·h−1 to arrive at an estimation of water loss. data quality control during processing, las data were controlled using several quality checks. data were filtered for low signal (demodulated signal less than 10 mv as per requirements of evation software). the bowen ratio was also used to reject positive fluxes when it was >3, since h would be far larger than le and the latter insignificant. any data points where the bowen ratio (β) was between –0.05 and 0 were removed, due to instability of the solution for this extreme value range (rambikur and chávez, 2014). it should be noted that over wet surfaces β is small, <0.5 and when β > 3 le is insignificant (bouin et al., 2012; kipp and zonen, 2012). in addition, when β is close to −1, i.e. (−1.25 < β <−0.75), le and h are assumed negligible (campbell scientific, 2005). positive fluxes during periods between sunset and sunrise with wind speed (u*) < 0.1 m·s−1 were also filtered out to avoid conditions with poorly developed turbulence. periods with a temperature gradient of less than 0.2°c between the lower and upper air temperature sensors were filtered out to avoid the risk of inaccurate determination of atmospheric stability. furthermore, the obukhov length (lom) was used to filter out large positive (~1 mm) fluxes on a period of absolute stability as determined by the stability parameter. the physical interpretation of lom is that a positive value indicates stable conditions while a negative value indicates unstable convective conditions. the cn 2 was also used to filter out data with ≤10−16 m−2/3 since this is indicative of weak and insignificant atmospheric optical turbulence over shorter (≤2 km) optical paths. (tunick, 2003). in addition, the upper scintillation 215water sa 49(3) 211–219 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.3964 saturation criterion was also considered as a potential basis for rejecting fluxes (kohsiek et al., 2002; bouin et al., 2012). sensitivity analysis of pmlswc and medrush models the sensitivity analysis of the pmlswc approach was focused on the aerodynamic components and lai, while that of medrush focused on the consequences of rapid changes in wind speed. for aerodynamic components of the pmlswc model, sensitivity analysis was accomplished by varying the height of wind speed measurement and wind speed at different canopy heights through the use of a power law equation (manwel et al., 2002) and then computing et total. the lai was changed from low to high values to decipher its impact on et. similarly, the sensitivity of the site parameters used in the medrush model was determined by varying the stomatal conductance and using temperatures at different heights and noting the effect on simulated et. model evaluation performance of the models medrush, pmlswc and modis were assessed using various evaluation criteria, namely: percent bias (pbias), root mean squared error (rmse), rmse-observations standard deviation ratio (rsr) and mean absolute error (mae) (granata, 2019). rmse and mae show the level of the errors between the measured and simulated et, while rsr technique normalizes rmse using standard deviation of the observed. the mae technique is appropriate for errors that are uniformly distributed, while the rmse technique is best for evaluating normally distributed data. average tendency of the simulated data to be larger or smaller than measured was assessed using pbias. lastly, coefficient of determination (r2) was used to assess the extent of collinearity between measured and simulated et. results and discussion environmental conditions average daily environmental conditions during the study period are provided (table 2). swc ranged from 18.4 to 28.9% and maximum daily solar radiation reached 1 130 w·m−2 on 5 february 2020, during the peak of the summer season. rh, vpd and wind speed ranged from 1.62–100%, 0.14–4.947 kpa and 0.12–13 m·s−1, respectively. reference et (calculated using the fao56 (allen et al., 1998)) ranged from 0.47–5.31 mm·day−1 for the study period. leaf area index for the purposes of modelling, a fixed lai, based on that recorded in the field using the ceptometer of 3.2 was used in the pmlswc model. the mean sentinel 2 ndvi for the fetch below the las beam on 23 november 2019 was 0.6. comparison of the models the output from the las for the field campaign was compared against the reference et (eto) (figs 2 and 3). this result showed that the las was measuring less than eto, which was a positive outcome. medrush8 (gs = 8 mmol·m−2·s−1) provided the best estimate of hourly et (figs 4–5) for the period of the field campaign against the observed data recorded by the las, which had been located over the dense wattle stand. this, together with a comparison of the three models (pmlswc, medrush8, medrush3) against the 20-min output from the las, led to the selection of medrush8 as the most appropriate model to compute et for silver wattle. medrush was run using the 315 days of meteorological and soil temperature data for both grassland (gs = 3 mmol·m−2·s−1) and wattle. as an additional validation of the output for the grassland, mod16 data were extracted for a single modis pixel over the study site for the corresponding 315-day period. a summary of the output from these models is provided (table 3). total et for the silver wattle and grassland, covering the 2019–2020 growing season, for mod16, medrush8 (wattle), medrush3 (grassland) and pml were 428 mm, 536 mm, 202 mm and 615 mm, respectively. rainfall during that period was 608 mm. the mod16 pixel (footprint 0.25 km2), which covers a complex mixture of dwellings, abandoned arable land and unimproved grassland, had the lowest estimate of total et for the study period. the medrush8 total et is 70 mm less than the total rainfall modelled for that same period and gives us confidence in the explanatory value of the two independent models over grassland. the medrush8 model, when run for the silver wattle (gs = 8), produced a lower et (536 mm) for the 315 days of the study period than the reference eto (869 mm) from the kokstad weather station. this is expected as actual et should not exceed reference et. removal of silver wattle by the working for water programme has resulted in an observable increase in the flows of local groundwater springs ( macleod, 2021). this would explain the difference in the et over grassland (202 mm·a−1) versus wattle 536 mm·a−1). the removal of the wattle and replacing it with grass cover would result in 334 mm being released as run-off and recharge. table 2. summary of environmental conditions at nkasela during the 315 days of continuous data recorded from 4 october 2019 to 16 august 2020 environmental parameter mean maximum minimum air temperature (°c) 15.6 37.4 −6.6 soil temperature (°c) 16.08 26.01 2.16 wind speed (m·s−1) 2.97 13.0 0.14 vapour pressure deficit (kpa) 0.9447 4.947 0.12 relative humidity (%) 64.12 100 1.62 soil water content (m3·m−3) 21.3 28.9 18.4 leaf area index (m2·m−2) 1.07 2.4 0.3 solar radiation (w·m−2) 91.1 1 130 na total precipitation (mm) (funk et al., 2015) 608 table 3. summary of the modelled et over wattle and grassland for 315 day study period. total precipitation during this period according to chirps model was 608 mm. model land cover total et (mm) no. of days max daily et (mm) min daily et (mm) mean daily et (mm) gs (mmol·m−2·s−1) mod16 settlement and grassland 428 315 3.2 0.35 1.85 na medrush8 wattle 536 315 4.8 0.01 1.7 8 medrush3 grassland 202 315 1.8 0.01 0.63 3 pml wattle 613 315 5.5 0.1 2.1 na 216water sa 49(3) 211–219 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.3964 figure 2. relationship between the measured et using the larger aperture scintillometer and that calculated using fao56 (allen et al., 1998) from the data collected at the micro-meteorological station figure 4. boxplot of the observed et (las) and the modelled et (medrush3, medrush8 and pmlswc) over silver wattle. inputs to the medrush model were weather data at 20-min intervals (air temp, rh, radiation, wind speed and soil temp). the stomatal conductance for medrush8 and medrush3 was 8 mmol·m−2·s−1 and 3 mmol·m−2·s−1, respectively. anova revealed that las and medrush8 are not significantly different (p = 0.987). figure 3. box and whisker plot of the hourly etlas versus eto 217water sa 49(3) 211–219 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.3964 the medrush model used in this study did well to compute et when compared to the observed measured by the las. among the three models tested against the las campaign data, cumulative et from medrush is slightly higher than that from las, whereas pmlswc and mod16 were lower. these discrepancies could be attributed to uncertainties associated with et methods and remote-sensed products where there is a scale mismatch amongst coarser meteorological forcing and cloud-free images, which results in higher uncertainties in et estimations (long et al., 2014). although, the differences in et estimates are not peculiar to the models used in this study, chen et al. (2014) found that the et simulated using different models varied between 61% and 80% when compared with et from las towers. also, mod16 et was found to under-estimate annual et from las in ponderosa pine forests by approximately 51%, possibly because of underestimation of leaf area index (ha et al., 2015). using the rsr evaluation technique (table 4), the performance of the three models was generally good, with medrush8 performing better than the other two, followed by pmlswc and mod16. there was underestimation bias for the three models indicated by positive values of the pbias (table 4). pbias values for all the models are low, which indicates good model simulation. the r2 values for the mod16 and pmlswc models were generally low. insensitivity of r2 to relative differences between measured and predicted values and its sensitivity to high extreme values could have contributed to poor performance of these models. determination of area invaded by black and silver wattle the data were randomly divided into a training (n = 356) and a testing (n = 215) sub-set. the final validation accuracy of the rf classification using the training sub-set was 0.889. wattle and sparse wattle were classified at 97% and 80%, respectively, although the misclassifications in the sparse wattle category were all recognised as mature wattle, indicating an effective accuracy for wattle as 100% (table 5 and 6). using earth observation, we determined that 10% (274 km2) of a 2 647 km2 geographic window is invaded by iaps. assuming the difference between woodland and grassland et (234 mm) was being used by the trees through their link to the groundwater, this invasion accounts for approximately 89 000 ml of water per annum. table 4. summary of the model evaluation parameters used to assess the three models models mae rmse pbias rsr r2 mean± sd modis 0.48 0.67 0.18 0.05 0.686 0.79±0.29 pmlswc 0.42 0.59 0.14 0.04 0.631 0.72±0.40 medrush8 0.50 0.79 0.26 0.06 0.88 0.80±1.08 table 5. validation error matrix of the test sub-set mature wattle un-improved grassland; abandoned cultivated land irrigated indigenous forest water bodies sparse wattle indigenous bush validation producers accuracy mature wattle 42 0 0 0 0 1 0 0.97 un-improved grassland; abandoned cultivated land 1 53 0 5 0 6 2 0.79 irrigated 0 0 16 0 0 0 0 1 indigenous forest 0 2 0 18 0 0 0 0.9 water bodies 0 0 0 0 11 0 0 1 sparse wattle 7 0 0 0 0 28 0 0.8 indigenous bush 0 0 0 0 0 0 23 1 figure 5. plot of the observed et (las) and the modelled et (medrush8). for the medrush8 model, inputs were weather data at 20 min intervals (air temp, rh, radiation, wind speed and soil temp). the stomatal conductance used was 8 mmol·m−2·s−1. 218water sa 49(3) 211–219 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.3964 conclusion water fluxes over wattle-invaded seep lines were assessed using et data, combining both a direct measurement and modelling approach. total et for the 2019–2020 growing season in an iapinvaded area was 324 mm greater than in adjacent un-invaded grassland (202 mm), confirming that woody encroachment significantly increases landscape water use. the extent of the wattle invasion (both mature and immature) in the 2 647 km2 regional window was approximately 10% of the land area. the invaded hillslope seeps were linked to groundwater, indicating that the elevated et was attributable mainly to a groundwater source, and the invading woody shrubs substantially reduced groundwater return flows from seeps and springs. these seeps and springs feed the riparian zone, as well as its associated grazing meadows, and are used by livestock and rural households as a water source in exceptional circumstances. these riparian areas around the seeps are an important grazing resource for livestock, and the wattle invasion has reduced base stream flow as well as grass production in the ‘meadow’ adjacent to the riparian zone. this production has been lost to the livestock sector due to the invasion. continued removal of wattle, followed by suitable restoration of landscape functionality (i.e re-vegetation using perennial grasses), would greatly enhance rangeland productivity and water production from hillslope seeps. this water could contribute substantially to grass production adjacent to the hillslope seeps, and any run-off would contribute to production in the grass meadows. acknowledgements the research was supported by a united kingdom research and innovation grant through the biotechnology and biological sciences research council (grant number bb/s014683) in funding arp and equipment installation and the national research foundation of south africa (national equipment programme) in partially funding purchase of the equipment. we are grateful to the anonymous reviewer who contributed greatly to the improvement of this manuscript. references aguilar a, flores h, crespo g, marín m, campos i and calera a (2018) performance assessment of mod16 in evapotranspiration evaluation in northwestern mexico. water 10 (7) 901. https://doi.org/10.3390/w10070901 allen rg, pereira ls, raes d and smith m (1998) crop evapotranspiration (guidelines for computing crop requirements). irrig. drainage 300 (56) 1–300. bouin mn, legain d, traulle q, belamari s, caniaux g, fiiandrino a, lagarde f, barrie j and moulin eg (2012) using scintillometry to estimate sensible heat fluxes over water: first insights. boundary layer meteorol. 143 (june) 451–480. https:// doi.org/10.1007/s10546-012-9707-8 buck a (1981) new equations for computing vapor pressure and enhancement factor. j. appl. meteorol. climatol. 20 1527–1532. https://doi.org/10.1175/1520-0450(1981)020<1527:nefcvp>2.0.co;2 campbell scientific (2002) model hfp01 soil heat flux plate, instruction manual. campbell scientific, logan, utah, usa. campbell scientific (2005) bowen ratio instrumentation. instruction manual. 36. campbell scientific, logan, utah, usa. chen y, xia j, liang s, feng j, fisher jb, li x, li x, liu s, ma z, miyata a and co-authors (2014) comparison of satellitebased evapotranspiration models over terrestrial ecosystems in china. remote sens. environ. 140 279–293. https://doi.org/10.1016/ j.rse.2013.08.045 dye p, moses g, vilakazi p, ndlela r and royappen m (2001) comparative water use of wattle thickets and indigenous plant communities at riparian sites in the western cape and kwazulu-natal. water sa 27 (4) 529–538. https://doi.org/10.4314/ wsa.v27i4.4967 everson cs, dye pj, gush mb and everson tm (2011) water use of grasslands, agroforestry systems and indigenous forests. water sa 37 (5) 781–788. https://doi.org/10.4314/wsa.v37i5.15 funk c, peterson p, landsfeld m, pedreros d, verdin j, shukla s, husak g, rowland j, harrison l, hoell a and michaelsen j (2015) the climate hazards infrared precipitation with stations – a new environmental record for monitoring extremes. sci. data 2 (1) 150066. https://doi.org/10.1038/ sdata.2015.66 granata f (2019) evapotranspiration evaluation models based on machine learning algorithms – a comparative study. agric. water manage. 217 303–315. https://doi.org/10.1016/j.agwat.2019.03.015 gwate o, mantel sk, palmer ar, gibson la and munch z (2018) measuring and modelling evapotranspiration in a south african grassland: comparison of two improved penman-monteith formulations. water sa 44 (3) 482–494. https:// doi.org/10.4314/wsa.v44i3.16 gwate o, mantel sk, finca a, gibson la, munch z and palmer ar (2016) exploring the invasion of rangelands by acacia mearnsii (black wattle): biophysical characteristics and management implications. afr. j. range forage sci. 33 (4) 265–273. https://doi.org/10.2989/10220119.2016.1271013 ha w, kolb te, springer ae, dore s, o’donnell fc, martinez morales r, masek lopez s and koch gw (2015) evapotranspiration comparisons between eddy covariance measurements and meteorological and remote-sensing-based models in disturbed ponderosa pine forests. ecohydrology 8 (7) 1335–1350. https://doi.org/10.1002/eco.1586 hartogensis ok, watts cj, rodriguez j-c and de bruin hr (2003) derivation of an effective height for scintillometers: la poza experiment in northwest mexico. j. hydrometeorol. 4 (5) 915–928. https://doi.org/10.1175/1525-7541 (2003)004<0915:doaehf>2.0.co;2 hill rj (1992) review of optical scintillation methods of measuring the refractive-index spectrum, inner scale and surface fluxes. waves random complex media 2 (3) 179–201. https://doi. org/10.1088/0959-7174/2/3/001 ho tk (1998) the random subspace method for constructing decision forests. ieee trans. pattern anal. mach. intell. 20 (8) 832–844. https://doi.org/10.1109/34.709601 table 6. the area of the seven land cover classes that occur in the 50 km x 50 km window over the study area class area in 2019 (km2) un-improved grassland; abandoned cultivated land 1 254 mature wattle 159 sparse wattle 115 indigenous bush 948 irrigation 18 indigenous forest 145 water bodies 8 total 2 647 https://doi.org/10.3390/w10070901 https://doi.org/10.1007/s10546-012-9707-8 https://doi.org/10.1007/s10546-012-9707-8 https://doi.org/10.1175/1520-0450(1981)020%3c1527:nefcvp%3e2.0.co;2 https://doi.org/10.1016/j.rse.2013.08.045 https://doi.org/10.1016/j.rse.2013.08.045 https://doi.org/10.4314/wsa.v27i4.4967 https://doi.org/10.4314/wsa.v27i4.4967 https://doi.org/10.4314/wsa.v37i5.15 https://doi.org/10.1038/sdata.2015.66 https://doi.org/10.1038/sdata.2015.66 https://doi.org/10.1016/j.agwat.2019.03.015 https://doi.org/10.4314/wsa.v44i3.16 https://doi.org/10.4314/wsa.v44i3.16 https://doi.org/10.2989/10220119.2016.1271013 https://doi.org/10.1002/eco.1586 https://doi.org/10.1175/1525-7541(2003)004%3c0915:doaehf%3e2.0.co;2 https://doi.org/10.1175/1525-7541(2003)004%3c0915:doaehf%3e2.0.co;2 https://doi.org/10.1088/0959-7174/2/3/001 https://doi.org/10.1088/0959-7174/2/3/001 https://doi.org/10.1109/34.709601 219water sa 49(3) 211–219 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.3964 johnson mr, van vuuren cj, hegenberger wf, key r and shoko u (1996) stratigraphy of the karoo supergroup in southern africa: an overview. j. afr. earth sci. 23 (1) 3–15. https:// doi.org/10.1016/s0899-5362(96)00048-6 jones h (2014) plants and microclimate a quantitative approach to environmental plant physiology (3rd edn). cambridge university press, cambridge. https://doi.org/10.1017/cbo9780511845727 kipp and zonen bv (2012) instruction manual, las mkii scintillometer. kipp and zonen b.v., delft. kohsiek w, meijninger wml, moene af, heusinkveld bg, hartogensis ok, hillen wcam and de bruin har (2002) an extra large aperture scintillometer for long range applications. boundary layer meteorol. 105 (1) 119–127. https://doi. org/10.1023/a:1019600908144 le maitre dc, blignaut jn, clulow a, dzikiti s, everson cs, görgens ahm and gush mb (2020) impacts of plant invasions on terrestrial water flows in south africa. in: van wilgen b, measey j, richardson d, wilson j and zengeya t (eds) biological invasions in south africa. springer. https://doi. org/10.1007/978-3-030-32394-3_15 leuning r, zhang yq, rajaud a, cleugh h and tu k (2008) a simple surface conductance model to estimate regional evaporation using modis leaf area index and the penmanmonteith equation. water resour. res. 44 (10). https://doi.org/10. 1029/2007wr006562 long d, longuevergne l and scanlon br (2014) uncertainty in evapotranspiration from land surface modeling, remote sensing, and grace satellites. water resour. res. 50 (2) 1131–1151. https://doi.org/10.1002/2013wr014581 manwel jf, mcgowan jg and rogers al (2002) wind energy explained: theory, design and application (2nd edn). john wiley and sons, chichester. macleod n (2021) personal communication. october 2021. dr n macleod, director, environmental and rural solutions, matatiele, eastern cape, south africa. meijninger wml, hartogensis ok, kohsiek w, hoedjes jcb, zuurbier rm and de bruin har (2002) determination of area-averaged sensible heat fluxes with a large aperture scintillometer over a heterogeneous surface – flevoland field experiment. boundary layer meteorol. 105 (1) 37–62. https:// doi.org/10.1023/a:1019647732027 morillas l, leuning r, villagarc l and domingo f (2013) improving evapotranspiration estimates in mediterranean drylands: the role of soil evaporation. water resour. res. 49 6572–6586. https://doi.org/10.1002/wrcr.20468 mu q, zhao m and running sw (2013) modis global terrestrial evapotranspiration (et) product (mod16a2/a3) algorithm theoretical basis document collection 5. nasa, washington dc. url: https://modis-land.gsfc.nasa.gov/pdf/mod 16atbd.pdf (accessed 1 october 2020). mu qz, zhao m and running s (2011) improvements to a modis global terrestrial evapotranspiration algorithm. remote sens. environ. 115 (8) 1781–1800. https://doi.org/10.1016/j.rse.2011.02.019 mucina l, hoare d, lötter m, du preez p, rutherford m, scott-shaw c, bredenkamp g, powrie l, scott l, camp k and co-authors (2006) grassland biome. in: mucina l and rutherford mc (eds.) the vegetation of south africa, lesotho and swaziland (1st edn). south african national biodiversity institute, pretoria. osborne cp, mitchell pl, sheehy je and woodward fi (2000) modelling the recent historical impacts of atmospheric co2 and climate change on mediterranean vegetation. glob. change biol. 6 (4) 445–458. https://doi.org/10.1046/j.1365-2486.2000.00336.x osborne cp and woodward fi (1999) the medrush vegetation model. url: http://www.shef.ac.uk/aps/medveg.pdf (accessed 1 october 2020). palmer ar, weideman c, finca a, everson cs, hanan n and ellery w (2015) modelling annual evapotranspiration in a semi-arid, african savanna: functional convergence theory, modis lai and the penman–monteith equation. afr. j. range forage sci. 32 (1). https://doi.org/10.2989/10220119.2014.931305 pozníková g, fischer m, žalud z and trnka m (2015) scintillometry based energy fluxes compared to bowen ratio/energy balance method for evapotranspiration determination over winter wheat. in: proceedings of the conference ‘towards climatic services’, 15–18 september 2015, nitra, slovakia. rambikur eh and chávez jl (2014) assessing inter-sensor variability and sensible heat flux derivation accuracy for a large aperture scintillometer. sensors (switzerland) 14 (2) 2150–2170. https://doi.org/10.3390/s140202150 running s, mu q and zhao m (2015) mod17a2h modis/ terra gross primary productivity 8-day l4 global 500m sin grid v006. 2015. distributed by nasa eosdis land processes daac. https://doi.org/10.5067/modis/mod17a2h.006 scorer c, mantel sk and palmer ar (2019) do abandoned farmlands promote spread of invasive alien plants? change detection analysis of black wattle in montane grasslands of the eastern cape. s. afr. geogr. j. 101 (1) 1–15. https://doi.org/10.1080/0 3736245.2018.1541018 scott-shaw bc, everson cs and clulow ad (2017) wateruse dynamics of an alien-invaded riparian forest within the mediterranean climate zone of the western cape, south africa. hydrol. earth syst. sci. 21 4551–4562. https://doi.org/10.5194/hess21-4551-2017 seath j and shackleton c (2022) comparative avifaunal richness and diversity in invasive acacia dealbata patches and adjacent montane grasslands. afr. zool. 57 (1) 12–19. https://doi.org/ 10.1080/15627020.2022.2047104 tunick a (2003) cn2 model to calculate the micrometeorological influences on the refractive index structure parameter. environ. modell. softw. 18 (2) 165–171. https://doi.org/10.1016/s1364-8152 (02)00052-x turpie jk, marais c and blignaut jn (2008) the working for water programme: evolution of a payments for ecosystem services mechanism that addresses both poverty and ecosystem service delivery in south africa. ecol. econ. 65 (4) 788–798. https://doi. org/10.1016/j.ecolecon.2007.12.024 https://doi.org/10.1016/s0899-5362(96)00048-6 https://doi.org/10.1016/s0899-5362(96)00048-6 https://doi.org/10.1017/cbo9780511845727 https://doi.org/10.1023/a:1019600908144 https://doi.org/10.1023/a:1019600908144 https://doi.org/10.1007/978-3-030-32394-3_15 https://doi.org/10.1007/978-3-030-32394-3_15 https://doi.org/10.1029/2007wr006562 https://doi.org/10.1029/2007wr006562 https://doi.org/10.1002/2013wr014581 https://doi.org/10.1023/a:1019647732027 https://doi.org/10.1023/a:1019647732027 https://doi.org/10.1002/wrcr.20468 https://modis-land.gsfc.nasa.gov/pdf/mod16atbd.pdf https://modis-land.gsfc.nasa.gov/pdf/mod16atbd.pdf https://doi.org/10.1016/j.rse.2011.02.019 https://doi.org/10.1046/j.1365-2486.2000.00336.x http://www.shef.ac.uk/aps/medveg.pdf https://doi.org/10.2989/10220119.2014.931305 https://doi.org/10.3390/s140202150 https://doi.org/10.5067/modis/mod17a2h.006 https://doi.org/10.1080/03736245.2018.1541018 https://doi.org/10.1080/03736245.2018.1541018 https://doi.org/10.5194/hess-21-4551-2017 https://doi.org/10.5194/hess-21-4551-2017 https://doi.org/10.1080/15627020.2022.2047104 https://doi.org/10.1080/15627020.2022.2047104 https://doi.org/10.1016/s1364-8152(02)00052-x https://doi.org/10.1016/s1364-8152(02)00052-x https://doi.org/10.1016/j.ecolecon.2007.12.024 https://doi.org/10.1016/j.ecolecon.2007.12.024 water sa 49(3) 273–281 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.3907 research paper issn (online) 1816-7950 available on website https://www.watersa.net 273 correspondence john okedi email john.okedi@uct.ac.za dates received: 27 may 2021 accepted: 19 june 2023 key words real-time-control water supply rainwater harvesting cape town copyright © the author(s) published under a creative commons attribution 4.0 international licence (cc by 4.0) in the period 2015–2017, the city of cape town, south africa, faced the possibility of taps running dry due to a prolonged drought. to mitigate the impacts of water scarcity, many households installed rainwater tanks to harvest water to use for non-potable purposes such as toilet flushing and washing. the installation of the rainwater tanks was mainly arbitrary, in response to perceived impact of water scarcity rather than a systematic needs assessment. this study was thus undertaken to determine the available opportunity to optimise the use of these rainwater tanks using real-time control (rtc) techniques. many studies have demonstrated the potential of rainwater harvesting (rwh) systems to supplement potable water supply and minimize stormwater flows to downstream drainage networks. rtc technology can be used to enhance the performance of rwh systems in achieving these two objectives, by receiving a rainfall forecast and initiating pre-storm release in real time. in this study, rtc was applied on the rwh system at the new engineering building, university of cape town (uct) to enhance water supply and increase rainwater retention period. the performance with rtc was compared with the conventional management of the rwh system. it was determined that rwh with rtc technology was generally superior in simultaneously achieving water supply and rainwater retention benefits compared to the conventional management approach. rtc provides an active operation which optimizes the performance of the system across varying conditions but requires an assiduous management process designed to meet set objectives. it was concluded that the active release mechanism employing rtc exhibited great potential; the system opens up the possibility of delivering a more robust and reliable system due to its ability to provide failure detection and centralised control. the system can readily be adapted to variation of local climatic conditions in the short and long term. assessing the benefits of real-time control to enhance rainwater harvesting at a building in cape town, south africa malesela michael mogano1 and john okedi1 1department of civil engineering, university of cape town, private bag x3, rondebosch 7701, cape town, south africa introduction in recent times, lack of appropriate management of stormwater flows has resulted in serious problems to society and the environment (campisano et al., 2015). due to urbanisation, natural vegetated areas are constantly being replaced by impervious surfaces, which results in increased runoff discharges and volumes during wet weather conditions (marsalek, 2005). increased runoff from impervious areas increases the risk of flooding and poses a threat to people and property. economic and social development depend on water, which is a vital element for humanity. restrictions on water supply and water stress in many countries are a result of over-exploitation of water resources. increasing the efficiency of water use reduces the demand for potable water, promotes sustainability and assures water quantity and quality for generations to come (eea, 2009). rainwater harvesting (rwh) systems aim to increase water use efficiency and reduce urban water consumption (eea, 2012). rwh is an ancient practice that is widely used across the world to handle water supply needs (campisano et al., 2017). rwh systems have the potential of reducing potable water consumption. in sweden, more than 60% of the main water supply could be saved when rainwater was collected for water closet (wc) flushing (villarreal and dixon, 2005). various studies such as chilton et al., (2000); and muthukumaran et al., (2011) have shown that about 40% of potable water can be saved by implementing rwh. rwh systems are linked to three key research challenges, including, inter alia: lack of data on system operation; maintenance issues; and devoting research to the understanding of how best institutional and socio-political support can be targeted (campisano et al., 2017). real-time control (rtc) can be defined as a flexible and cost-effective tool which can guide urban water managers to handle precipitation changes (vezzaro and grum, 2014). rtc can also be defined as a tool that integrates structural solutions, such as reducing the total investment that urban water utilities need to make to meet targets. generally, rtc aims to effectively utilize available storage capacity and improve the management of rwh. furthermore, rtc can benefit from future information input and models that provide results of the behaviour of a rwh system. lastly, rtc considers the status of receiving water bodies and other variables such as energy consumption in the optimisation of a model. application of rtc techniques in rwh systems can enhance their performance in terms of both water supply and stormwater retention (xu et al., 2020). rtc has a major advantage over conventional systems (cs) due to its ability to use available information such as weather forecasts and environmental monitoring (kerkez et al., 2016). in addition, rtc systems usually utilize an active outlet and are mainly designed for pre-storm release to minimize uncontrolled overflows. https://www.watersa.net https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://orcid.org/0000-0001-7707-2721 274water sa 49(3) 273–281 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.3907 the released volume is computed by using local rainfall forecasts in comparison with current available headroom (xu et al., 2020). there are studies that have shown the ability of rtc in enhancing stormwater retention and peak flow reduction (di matteo et al., 2019). recent application of rtc includes a possibility of stream baseflow restoration through a persistent low-rate discharge that mimics the natural flow regimes (xu et al., 2018). pre-storm release without attention to flow regime could simply emulate the ‘uncontrolled’ overflow that can lead to a highly disturbed flow regime with ecological and geomorphic consequences for downstream receiving waters. hence, rtc application for water supply and stormwater retention are best managed by using a 24-hr forecast, meaning that the release must take place rapidly for completion prior to the predicted rainfall (xu et al., 2020). some studies have also shown that rtc combined with the 7‐day forecast can enhance the functionality of rwh systems to restore and even mimic the entire natural flow regime in receiving streams (xu et al., 2020). however, the practical use of the 7-day forecast and associated effect on pre-storm release requires further research. in this study, the performance of rwh systems with rtc techniques was evaluated by model simulations using data based on rainfall forecasts in cape town. rainfall forecasts can be used to initiate pre-storm release in real time to enhance the performance of rwh systems through rtc techniques. the study focused on linking rainfall forecast to rwh storage volume, prediction of inflow volume and the required storage, in order to minimize rainwater loss. in addition, the study explored model simulations such as the daily/monthly water balance method, the dry period demand method and dimensionless analysis. literature review the preponderance of modelling and data coupled with rainwater harvesting is focused on developing countries, where basic human health is not a matter of economics but of water scarcity. there is a gap in the developing world that can be filled by rainwater harvesting to improve conditions of access to freshwater. water scarcity may further increase with rising population and urbanisation associated with climate change. however, water scarcity can be overcome if rainfall is well harnessed. various studies on rainwater harvesting optimisation have been identified in literature, including the following: in abeokuta, nigeria, a study analysed and determined benefits of household rainwater harvesting using the daily water balance model (imteaz et al., 2012). the model consisted of simple spreadsheet calculations of daily water balance, and variables such as rainfall, contributing roof area, water uses, storage volume, losses including leakage, spillage, and evaporation. equations 1–5 describe the overall mathematical processes in the model (imteaz et al., 2012): st = vt + st−1 − d (1) st = 0, for st < 0 (2) st = c, for st > c (3) where st is the cumulative water stored in the rainwater tank (l) after the end of the tth day, vt is the harvested rainwater (l) on the tth day, st−1 is the storage in the tank (l) at the beginning of tth day, d is the daily rainwater demand (l), and c is the capacity of the rainwater tank (l) equation 4 is the town water use equation: tw = d − st, for st < d (4) where tw is the town water use on the tth day (l). equation 5 is the overflow equation: of = st − c, for st > c (5) where of is the overflow on the tth day (l). reliability is calculated with eq. 6: re = (n – u)/n × 100 (6) where re is the reliability of the tank to be able to supply intended demand (%), u is the number of days in a year the tank was unable to meet the demand, and n is the total number of days in a particular year. the case study focused on the reliability of rainwater tanks for a typical dry year under varying tanks and different scenarios (low and high demand). rainwater use for toilet flushing and for both toilet flushing and laundry was defined as low and high demand, respectively. the study showed that significant water savings can be achieved from rainwater harvesting even in the dry years. hence, the findings revealed the importance of implementing rainwater harvesting as a water management strategy (imteaz et al., 2012). a study in taiwan focused on the development of an easy-to-use methodology that could be combined with dimensionless analysis to design a domestic rainwater harvesting system (drwhs) at a regional level. in the dimensionless analysis, various combinations of storage capacity, rainwater demand, rainfall, rainwater supply reliability and effective roof area were considered for the drwhs. the development of the drwhs can be defined as a production process needed to determine how inputs are integrated to construct a specific output, as shown in eq. 7: f(x, z) = 0 (7) where x is total input vector and z is the total output vector. the rainwater supply performance of the drwhs depends on various variables. in addition to the rainfall amount, effective roof area, water demand and storage capacity at the site are vital to evaluate the rainwater supply. the volumetric reliability and annual water demand can be used to compute the annual rainwater supply (liaw and chiang, 2014). fewker et al., (2000) proposes two dimensionless ratios that consider several combinations of rainfall, effective roof area, water demand and storage capacity. the following illustrates two ratios defined as demand fraction (eq. 8) and storage fraction (eq. 9): d = dawd/ar = dd/r (dimensionless) (8) s = s/ar = sd/r (dimensionless) (9) where d is the demand fraction; s is the storage fraction; a is the effective roof area in square meters; dawd is the annual water demand in terms of volume (m3); dd is the annual water demand in terms of depth (m); r is the average annual rainfall (m); s is the storage capacity in terms of volume (m3); and sd is the storage capacity in terms of depth (m). the drwhs performance was related to the adopted dimensionless parameters using a regional regression analysis. the correlation between d and s can be shown as: dd /r = b'(sd/r)c (10) where b and c are regression coefficients that are adjusted based on simulation results. the correlation between these coefficients can be shown as b' = b(ar)c–1. a fixed daily water demand (q) can be shown as a function of the storage capacity, effective roof area and average annual rainfall as follows: q = 0.0027b'sc(ar)1 – c (11) 275water sa 49(3) 273–281 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.3907 storage sizing for drwhs design becomes difficult when detailed rainfall information is not available. regional zoning was used to determine storage tank sizes in areas where rainfall data were unavailable. in addition, a regional scale analysis was used to design drwhs storage tanks. dimensionless graphs were developed in the study to design drwhs at a regional level in northern taiwan. rainwater supply reliabilities of 50%, 70%, 80%, 90%, and 95% were obtained for each sub-region using dimensionless curves based on the two dimensionless parameters (storage and demand fraction). furthermore, storage capacities obtained from dimensionless curves were compared with the adopted method in gbem. the results revealed that the storage capacity obtained using the gbem method was less than that obtained using dimensionless curves. the method adopted in the gbem limits the storage capacity for a given effective roof area and lacks the concept of system reliability (liaw and chiang, 2014). in another study in greece, the dry period demand method and the daily water balance method were used to compute the optimal size of rwh systems. the two methods were used in 75 regions of greece to meet in-house water demand of a household of 3 to 5 residents. a heuristic algorithm that was used to develop the daily water balance model allows excess water overflow and sets public water supply to zero. the simple method of maximum annual dry period was implemented to estimate the required rainwater harvesting tank size (londra et al., 2015). the sizing of the rainwater harvesting tank was computed using the daily water balance model. the following water balance equation was used (tsihrintzis and baltas, 2013): st = st–1 + rt – dt, 0 ≤ st–1 ≤ vtank (12) where st is the stored volume at the end of the tth day (m3), st−1 the stored volume at the beginning of the tth day (m3), rt  the harvested rainwater volume during the tth day (m3), dt the daily water demand of the tth day (m3) and vtank the capacity of rainwater tank (m3). the daily harvested rainwater volume (runoff ),  rt  (m3), from a roof area is computed as: rt = c·a·peff,t (13) where c is the runoff coefficient, a is the rainfall collection area (m2), and peff,t is the daily effective rainfall depth at the end of the tth day (m). the daily rainwater demand, dt, of a household is computed as: dt = ncap·q(p/100) (14) where ncap is the number of residents (capita), q is the total daily water demand per capita, and  p  is the percentage of total water demand satisfied by harvested rainwater. in the determination of minimum required rainwater collection area, the mean effective annual rainfall, peff, (m) based on the daily effective rainfall, can be computed as: p p n t n eff eff,t � � � �365 1 (15) where  peff,t  is the daily effective rainfall depth at the end of  the tth day (m), and n is the number of data points of the record. accordingly, the mean annual harvested rainwater volume, r (m3), can be computed as: r c a p� � � eff (16) where c is the runoff coefficient, a is the rainfall collection area (m2), and peff is the mean effective annual rainfall (m). conversely, using the daily water demand, the mean annual demand, d (m3), can be computed as: d n qcap p� � � �365 100( ) (17) where ncap is the number of residents, q is the daily water use per capita (m3), and p is the percentage of total water demand satisfied by harvested rainwater. assuming that the annual demand is equal to the mean annual harvested rainwater volume then the required rainwater collection, amin, to satisfy the percentage p of the total water demand, is computed as (tsihrintzis and baltas, 2013): r d a nq c p p cap eq eq eff . . min 5 6 100365 (18) where q is the daily water use per capita (m3), ncap is the number of residents, c is the runoff coefficient and peff is the mean effective annual rainfall (m). considering eqs 17 to 19, the daily rainwater stored volume is computed as: s s c p n qt t p � � � � � ��1 100eff,t cap ( ) (19) where st is the stored volume at the end of the tth day (m3), st−1 the stored volume at the beginning of the tth day (m3), c is the runoff coefficient,  a  is the rainfall collection area (m2),  peff,t  is the daily effective rainfall depth at the end of  the tth  day (m),  ncap  is the number of residents,  q  is the daily water use per capita (m3), and  p  is the percentage of total water demand satisfied by harvested rainwater. the daily difference between runoff (inflow) and demand (outflow), δst (m3), is computed using eq. 20: �s c a p n qt p � � � � � �eff t cap, ( )100 (20) where c is the runoff coefficient, a is the rainfall collection area (m2),  peff,t  is the daily effective rainfall depth at the end of  the tth  day (m),  ncap  is the number of residents,  q  is the daily water use per capita (m3), and p is the percentage of total water demand satisfied by harvested rainwater. the following heuristic algorithm can be used iteratively to compute the daily stored water in the tank. vtank accounts for the capacity of the rainwater tank: if thentank tanks s v vt t� � �1 � , if then 0s st t� � �1 0� (21) else s s s st k t t� � ��t,tan 1 � where st is the stored volume at the end of the tth day (m3), st−1 the stored volume at the beginning of the tth day (m3), δst is the daily difference between runoff and demand (m3) and st,tank is the actual available stored water volume in the tank at the tth day. the following algorithm can compute the volume of water that overflows, ot, from the tank when the tank is full: if st ≥ vtank then ot = st – vtank else ot = 0 (22) where  st   is the stored volume at the end of  the tth  day (m3), and vtank is the capacity of the rainwater tank (m3). in the case when the demand, dt, cannot be achieved using the stored water volume in the tank, st,tank  , then the water delivered from public water supply, tt, can satisfy the demand using the following algorithm: if st,tank < dt then tt = dt – st,tank else tt (23) daily rainfall record of at least 5 to 10 years for the area where the tank will be located must be available for the successful application of the procedure. 276water sa 49(3) 273–281 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.3907 a study in melbourne, australia, applied rtc to optimise rwh (xu et al., 2018). the study also presented two innovative rwh systems, i.e., passive and active release systems. the passive release system divided the rwh into two segments, namely, the retention storage volume and the stormwater detention via the addition of a passive discharge orifice at an intermediate depth. water supply for domestic consumption was achieved via the retention storage volume, compromising the bottom portion of the storage, while the top portion of the system is occupied by the detention volume. the active release system (ars) was operated by a novel approach – real-time control (rtc) – which uses a wireless connection to remotely control rwh systems. the performance of the rwh system was optimized by employing rtc technology via management of released water from the system to reduce the volume of uncontrolled stormwater runoff. many wastewater systems use rtc technology to monitor and control water quality and address sanitary sewer overflow (sso) and combined sewer overflow (cso) issues. however, the possibility of employing rtc into rwh systems remains largely untested. rainfall forecast data in real time was received via the ars which utilized rtc technology and automatically initiated a pre-storm release through a customized valve, in relation to the forecast precipitation and water level within the rwh system. the release of water in the system only occurred when there was insufficient storage capacity to capture the amount of forecast precipitation. consequently, the water conservation function was preserved via this customization. in addition, pre-storm release was able to significantly reduce or even eliminate the uncontrolled stormwater runoff that discharges into the storm drainage system establishing a flood risk. in xu et al. (2018), the study focused on the comparison of the modelled performance of rwh systems employed with rtc technology to both conventional systems and passive release systems. water supply, stormwater retention and baseflow restoration assessment metrics were used to characterize system performance. a model using the r software was constructed to simulate the behaviour of three allotment-scale rwh systems, viz., the conventional system, passive release system and active release system (rtc). the conventional system (fig. 1a) is an allotment-scale rwh system that collects impervious runoff from roof areas and supplies a wide range of household end-uses. it has an overflow pipe at the top of the system which is unregulated and drains to the conventional drainage network. the passive release system (fig. 1b) is identical to the conventional one but has an additional elevated outlet, i.e., ‘trickle-release’. the tank storage is divided by this outlet into a retention volume (that below the trickle release) and detention volume (the volume above the elevated trickle release). the baseflow is mimicked using a small orifice by slowly releasing any water that is stored in the detention volume to the receiving water bodies (via the stormwater network). passive release systems with detention volumes of 25% and 75% were simulated. the passive release systems with 25% and 75% detention volumes favour the water supply performance of the rwh system and increased stormwater retention and baseflow restoration performance, respectively. this provided opportunities to explore the impact of different system designs on multi-objective performance. the active release system (fig. 1c) is a combination of conventional system with rtc technology. it contributes baseflow to the receiving stream via controlled slow release, provides a purge release from the system prior to the storm event and can receive rainfall forecasts in real time. this mitigates flooding, as additional storage for predicted stormwater runoff is provided. the controlled outlet is termed ‘pre-storm release’. the predicted overflow (prestorm release) volume was computed as the difference between the predicted runoff volume and available tank storage volume at the end of the previous day. figure 1. schematic representation of the three types of rwh systems (from xu et al., 2018): (a) conventional system; (b) passive release system; and (c) active release system using real-time control. tin is the tank inflow (l/6min), qot is the tank overflow (uncontrolled discharge) at timestep t (l/6-min), yt is the rainwater yield at timestep t (l/6-min), vt is the volume in store (l) during time interval t, dt is demand at timestep t (l/6-min), s is the tank size (l), qbt is controlled baseflow discharge at timestep t (l/6-min) and qpurge is the controlled pre-storm release subject to rainfall forecast (l/6-min) (xu et al., 2018). 277water sa 49(3) 273–281 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.3907 method based on the extensive literature review, the most suitable model was selected to estimate benefits derived from application of rtc techniques in enhancing rwh using rainfall forecast at the new engineering building (neb), university of cape town. the model used in this study was formed by the two main modules, i.e., rainwater inflow and end-use demand. the model was set to compute assessment metrics to allow system configurations to be compared using continuous simulation. the following steps were undertaken. • rainwater inflow – the main input data was daily rainfall forecasts obtained from newlands station from the period 1 january 2017 to 31 september 2020 (fig. 2). the rainfall forecasts were converted to predicted runoff volume from the neb roof with initial loss of 0.2 mm, 2-h antecedent period and 0.2 mm/day. • end-use demand module – the daily toilet flushing water demand at the neb building was estimated as 1 333 l/day. • continuous simulation – was modelled using the yield after spillage rule (yas) rtc algorithm. • assessment metrics – system performances were evaluated by four standardized performance parameters from assessment metrics. the study focused on investigating the use of rainfall forecast to optimize storage volumes of rwh systems. the assessment of the prospects for rtc techniques on the neb rwh system included modelling water balance to estimate the quantity of rainwater resource, identification of appropriate constraints and volumetric capacity, and the effectiveness of rtc to address the challenges of storage. in addition, issues such as appropriate demand to be supplied (potable or non-potable), costs (operation and maintenance), the extent of volumetric reliability, and benefits associated with rtc on rwh systems were assessed the modelling aimed at predicting inflow volume from forecasted rainfall and required storage to minimize overflow loss so that water can be used optimally for toilet flushing from the two 5kl rainwater harvesting tanks at the neb. a model was developed to continuously simulate and monitor the water level changes in the two rwh tanks. the assessment also included a comparison of the performance of cs and ars using rtc. the cs (fig. 3a) is an allotment-scale rwh system that collects impervious runoff from roof areas and is connected to the neb end-use. it also has an overflow pipe at the top of the system which is unregulated and drains to the conventional drainage network. the ars in fig. 3b is a combination of cs with rtc concepts. it provides a purge release from the system prior to the storm event and can receive rainfall forecasts in real time. this mitigates flooding as additional storage for predicted stormwater runoff is provided. the controlled outlet is termed ‘pre-storm release’. hence, the predicted overflow (pre-storm release) volume is computed as the difference between the predicted runoff volume and available tank storage volume at the end of the previous day. for example, if the 5 kl system is half full (2.5 kl) at the end of the previous day and predicted rainfall inflow is 3 kl, the pre-storm release volume is 0.5 kl. this pre-storm release is discharged through a 10 mm automated valve, driven by gravity. the outflow rate q (m3/s) was computed by the orifice equation: q c d ghd� � � � � � � � 2 4 2 (24) where d is the equivalent orifice diameter (0.01 m), h is the head (m) acting over the centreline of the orifice at timestep t, cd is the orifice discharge coefficient (cd = 0.7 was adopted), and g is the acceleration due to gravity (9.81 m/s2). rainfall data recorded from the period 1 january 2017 to 30 september 2020 were used to predict the inflows for the two types of rwh systems, i.e., conventional and rtc. the conversion of rainfall data to stormwater runoff (volume of system inflow) was estimated using initial loss model (i.e., 0.2 mm with 2-h antecedent period) as shown in eq. 25. tin = art (25) where rt is the roof runoff at timestep t in mm/day and a is the roof size (m2) a pre-storm release can be initiated using the ars according to predicted rainfall. rainfall forecasts that had at least 70% probability of occurrence were used to predict the storm runoff volume, considering an initial loss of 0.2 mm and resetting at every midnight. the rainfall forecast was predicted at midnight each day indicating both occurrence probability and rainfall depth in the next 24 h. the pre-storm release volume (qpurge) is the predicted overflow volume (qotp) which was determined by eqs 26 and 27: figure 2. forecast data (from csag, 2021) 278water sa 49(3) 273–281 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.3907 t a r d r rinp tp il prob prob � �� � � � � � � �� , % , % 70 0 70 (26) q q v t s v v t st t tpurge otp inp inpotherwise � � � �� � � ��� � � �min , , , 1 1 1 0�� (27) where rtp is the historical records of rainfall forecast on a daily basis (mm/day), rprob is the probability of predicted precipitation, diɩ is the initial loss (0.2 mm/day), a is the roof size (m2), vt−1 is the volume in store (l/day) at timestep (t−1)(previous), tinp is the predicted system inflow in the next 24 h (l/day), qpurge is the required volume of pre-storm release (l/day), qotp is the predicted tank overflow (l/day), s is the tank size. neb end-use water demand was derived from real water consumption in the neb building collected by the local water authority (city of cape town). the hourly water demand dt (l/h) was determined by computing the mean of supply in the monitored neb property: d w nt t� � (28) where wt (l/h) is the water meter reading for the neb at timestep t and n is the number of properties which is equal to one. a daily timestep over the same period as the rainfall dataset (1 january 2017 to 30 september 2020) was used to simulate the behaviours of the two systems. the system outflow and volume were simulated using the yield-after-spillage (yas) operating rule which provides a more accurate estimate of yield (eqs 29, 30 and 31), given that the demand flow rate is less than the potential spillage flow in each timestep: q v t sot t� � �� �max in1 0 (29) y dvt t t � � �min 1 (30) v v t s s yt t in t � � � �� �min 1 (31) where vt and vt−1 are the volumes at timestep t (current) and t−1 (previous), dt is the rainwater demand at timestep t, yt is the rainwater yield at the current timestep (t), tin is the tank inflow, qot is the tank overflow at timestep t and s is tank size. in the model scenario, three assumptions were applied: i.e., the initial system volume was fixed at zero; yield always occurred after overflow (yas rule); and the end-use was drawn at each time step. one rainwater harvesting system scenario was used to assess the influence of given operating and design factors on system performance. roof catchment area was represented through the selection of one roof size. only one tank size was considered and, lastly, the neb end-uses modelled toilet flushing as the only enduse type. the physical parameters used included roof size – 350 m2; tank size – 5 kl; neb toilet flushing demand – 1 333 l/day. the assessment metrics which characterize the two objectives, i.e., stormwater retention and water supply, measured the performance of each rwh system based on two assessment indicators shown in table 1. the assessment indicators, i.e., efficiency and frequency, were used to quantify volumetric efficiency and frequency characteristics. the roof size controls the scale of the system inflow, and the assessment parameters are all expressed as a proportion of total volume for comparison of the performance of the two system configurations, i.e., conventional and rtc. the objectives are evaluated by two parameters quantifying the amount and frequency. for water supply: yt is water supply yield at current timestep (l/day), dt is the neb demand at timestep t (l/day), nt is counted if demand is satisfied in timestep t and n is the total number of timesteps. for stormwater retention: qot is tank overflow at timestep t (l/day), a is roof size (m2), rt is roof runoff at timestep t (mm/day), nt is counted if overflow occurs at timestep t and n is the total number of timesteps. figure 3. schematic representation and functions of the two types of rwh systems: (a) conventional system (cs) and (b) active release system (ars) using real-time control. tin is the tank inflow (l), qot is the tank overflow (uncontrolled discharge) at timestep t (l), yt is the rainwater yield at timestep t (l), vt is the volume in store (l) during time interval t, dt is demand at timestep t (l), s is the tank size (l) and qpurge is the controlled pre-storm release subject to rainfall forecast (l). 279water sa 49(3) 273–281 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.3907 results the rwh system configuration was modelled with and without rtc in terms of stormwater retention and overflow frequency, while water supply remained unaltered. the ability to enhance stormwater retention with no detriment to water supply was evident in the comparison between ars (with rtc) and cs (without rtc). the results of yield and overflow are shown in fig. 4. a 7-day smoothed moving average was applied on the results to remove the noise and volatility due to the rapid changes caused by the small-sized rwh storage tanks. the smoothed values provide a clearer picture of the overall and long-term trends over a long period of time. figure 5 shows monthly yields for both ars and cs. the study determined that for a 350 m2 roof draining to two 5 kl tanks with only toilet flushing as the end-use connection, the average annual yield and overflow for ars was 660 kl and 170 kl, respectively. the average annual yield and overflow for cs was 470 kl and 360 kl, respectively. hence, the retention and prerelease performance of the rwh system significantly improved water supply and reduced overflow (loss of water resource). the performance results based on assessment metrics for both ars and cs are shown in figs 6 and 7. these results can be improved with increased rwh storage to about 30% of yield (okedi, 2019). the 2 x 5 kl rwh storage was small compared to the 350 m2 catchment, and this resulted in significant loss of water through overflow, even from the ars (see fig. 4). in summary, the results show that the stormwater retention performance of rwh systems can be substantially improved by using rtc technology. this is accomplished by collecting rainfall forecasts in real time and discharging water from the system before the rainfall occurs (pre-storm release). upcoming storm runoff can be contained using pre-storm release which gives the system additional capacity. in addition, the possibility of generating uncontrolled system overflow can also be reduced by pre-storm release. however, the rainfall depth of forecasts is generally higher than real-time which often produces an overestimated volume of pre-storm release. thus, during pre-storm release, an unnecessarily large volume of water was discharged on occasion from the active release system. hence, this has the possibility of diminishing performance for ‘water supply’. this ‘wastage’ can be reduced through the utilization of more accurate and sub-daily rainfall forecast data which optimizes the system. system design controls the overall performance of the active release mechanism of the rwh systems. xu et al. (2018) showed that the performance of the ars in retaining storm runoff is closely related to the storage size and outlet orifice size. the storage available for upcoming inflows can be achieved by a large orifice which can deliver the pre-storm release faster. the timing of the system overflow can simply shift when a large orifice is utilized (faster release). the valve opening-closing control would vary the outlet orifice size of the ars in real time. thus, the outflow rate of ars can be customized according to system water level by the novel active control. therefore, specific objectives of the ars can be met by designing the system carefully. active release systems open possibilities for delivering a more reliable system due to their centralised control and failure detection abilities, which can be monitored remotely, allowing faults to be identified and fixed. in addition, such a system can adapt to variation of climate and local conditions over both the short and long term. various objectives of the ars can be satisfied according to requirements using an advanced active release that can customize the system from a centralised location. moreover, the water quality for harvested rainwater can be of concern for potable water supply but there is the potential to integrate a treatment train including uv, filtration, ozonation, etc., to purify the first flush to potable standard in real deployment. these technologies would be suitable for application in buildings such as the neb since they are readily available. conclusions and recommendations in this study, a continuous simulation was conducted to model the performance of two types of rwh systems, i.e., conventional and active release systems, to simultaneously deliver: (i) water supply and (ii) extended stormwater retention. the study established that application of rtc techniques can improve the retention performance of a rwh system with limited impact to water supply. the ars with rtc exhibited great potential in enhancing rainwater harvesting systems to simultaneously deliver stormwater management and water conservation. the system opens the possibility of delivering a more reliable and stable system due to its ability to provide failure detection and centralised control, which can be readily adapted to variation of climate and local conditions over both the short and long-term. the deployment of rwh systems to retrofit stormwater control is likely to require a combination of two different configurations: conventional and active release systems. this study has shown that the conventional system, which is simple and inexpensive, may be more suitable for small systems at household residences. but for large commercial buildings and other high-demand users, the ars is more efficient, and shows a promising ability to deliver on multiple objectives. table 1. assessment metrics to characterize the system performance of two objectives objective assessment indicator efficiency frequency water supply water supply efficiency, ews: e y d %ws t t� � � �100 water supply frequency, fws: n y delset t t� ��1 0, , f n n %ws t� � �100 stormwater retention retention efficiency, er: e q a rr ot t � � � � � 1 overflow frequency fo: n q elset ot� ��1 00, , f n no t� � 280water sa 49(3) 273–281 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.3907 figure 6. water supply efficiency for the active release system (ars) and conventional system (cs) configurations figure 7. overflow frequency for the active release system (ars) and conventional system (cs) configurations figure 5. total monthly yield: active release system (ars) with real-time control (rtc) and conventional system (cs) figure 4. smoothed moving average yield and overflow for active release system (ars) with real-time control (rtc) and conventional system (cs) 281water sa 49(3) 273–281 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.3907 in other studies, such as xu et al. (2020), it was also determined that the feasibility of implementing rtc in rainwater harvesting systems can be improved by using current sensor technology. this enables real-time monitoring of environmental conditions (e.g., rainfall and streamflow) and the present system (water level, pump flow and valve status) in real time (schütze et al., 2004). for large-scale implementation, an affordable and highly customized solution to tackle economic and technological challenges can be attained using low-cost sensors, as indicated by recent advances (montserrate et al., 2013). platforms and wireless communication can be used to transmit and store collected data and control decisions (yang, 2006). future research is required to develop a comprehensive cost-benefit analysis, including cost-saving on reduced requirements, direct cost of different configurations, and energy consumption for water supply and stormwater infrastructure (xu et al., 2018). further improvement of the performance of the ars using more reliable and accurate prediction of precipitation is also essential. as shown in xu et al. (2018), this study confirmed that future work is required to maximize flood protection for large rainfall events by investigating the costs and benefits of rtc systems that use lowprobability (e.g., 10% chance of ) rainfall forecasts. moreover, the exploration of how rtc techniques can minimize the impact of forecast errors would require investigating associated uncertainty in future studies. further, optimal scale and suitable arrangement of such systems is an area that would be addressed by future research. the study also identified potential for active release systems to provide centralized stormwater harvesting and larger scale flood protection for an area. the development of technology to allow systems to integrate optimally, and determining the optimal combination of scales, is a logical next step. author contributions malesela michael mogano undertook the research including the literature review, selection of a suitable method, development of the assessment model, generation of the results, wrote the draft paper, and implemented the revisions from feedback/comments received from co-author. john okedi proposed the research topic, managed and supervised the study, assisted in the paper writing process, and formatted the paper for submission. orcid john okedi https://orcid.org/0000-0001-7707-2721 references adeboye o and alatise m (2008) surface water potential of river osun at apoje sub-basin, nigeria. soil water res. 3 (2) 74–79. https://doi.org/10.17221/2423-swr aladenola o and adeboye o (2010) assessing the potential or rainwater harvesting. water resour. manage. 24 (2010) 2129–2137. https://doi.org/10.1007/s11269-009-9542-y campisano a, butler d, burns mj, freidler e, debusk k, fisher-jeffes ln, ghisi e, rahman a, furumai h and han m (2017) urban rainwater harvesting systems: research, implementation and future perpectives. water res. 115  195–209. https://doi.org/10.1016/j.watres.2017.02.056 campisano a, creaco e and modica c (2015) application of real-time control to reduce water volume discharges from quality-oriented cso devices. j. environ. eng. 142 (1). https://doi. org/10.1061/(asce)ee.1943-7870.0001013 chilton jc, maidment gg, marriot d, francis a and tobias g (2000) case study of a rainwater recovery system in a commercial building with a large roof. urban water 1 (4) 345–354. https://doi.org/10.1016/s1462-0758(00)00032-7 csag (2021) current-seasons-rainfall-in-cape town. url: http://www. csag.uct.ac.za (accessed 10 january 2021). di matteo m, liang r, maier hr, thyer ma, simpson ar, dandy gc and ernst b (2019) contolling rainwater storage as a system: an opportunity to reduce urban flood peaks for rare, long duration storms. environ. model. softw. 111 34–41. https://doi. org/10.1016/j.envsoft.2018.09.020 eea (2009) eea signals 2009: key environmental issues facing europe. european environment agency, copenhagen. 38 pp. isbn 978-929167-391-9. eea (2012) towards efficient use of water resources in europe. eea report no1/2012. european environment agency, copenhagen. 68 pp. imteaz ma, adeboye ob, rayburg s and shanableh a (2012) rainwater harvesting potential for southwest nigeria using daily water balance model. resour. conserv. recycl. 62 51–55. https://doi.org/10.1016/j.resconrec.2012.02.007 kerkez b, gruden c, lewis m, montestruque l, quigley m, wong b, bedig a, kerstesz r, brown t, chadwalar o, paresky a and pak c (2016) smarter stormwater systems. environ. sci. technol. 50 (14) 7267–7273. https://doi.org/10.1021/acs. est.5b05870 liang i, denby c and prince j (1988) design of roof runoff collection systems in western australia. hydrology and water resources symposium 1988, 1–3 february 1988, anu, canberra. liaw c-h and chiang y-c (2014) dimensionless analysis for designing domestic rainwater harvesting systems at the regional level in northern taiwan. water 6 (12) 3913–3933. https://doi. org/10.3390/w6123913 londra p, theocharis a, baltas e and tsihrintzis v (2015) optimal sizing of rainwater harvesting tanks for domestic use in greece. water resour. manage. 29 4357–4377. https://doi. org/10.1007/s11269-015-1064-1 marsalek j (2005) evolution of urban drainage from cloaca maxima to environmental sustainability. in: rasulo g, artina s, paoletti a, del giudice g and della morte r. (eds) proc. acqua e citta conf., csdu, milano. 79–81. montserrate a, guiterrez o, poch m and cororminas l (2013) field validation of a new low-cost method for determing occurrence and duration of combined sewer overflow. sci. tot. environ. 1 (463–464) 904–912. https://doi.org/10.1016/j.scitotenv. 2013.06.010 muthukumaran s, baskaran k and sexton n (2011) quantification of potable water savings by residential water conservation and reuse – a case study. resour. conserv. recycl. 55 (11) 945–952. https://doi.org/10.1016/j.resconrec.2011.04.013 okedi j (2019) the prospects for stormwater harvesting in cape town, south africa, using the zeekoe catchment as a case study. phd thesis, university of cape town. schütze m, campisano a, colas h, schilling w, and vanrolleghem pa (2004) real time control of urban wastewater system – where do we stand today? j. hydrol. 299 (3–4) 335–348. https://doi.org/10.1016/j.jhydrol.2004.08.010 tsihrintzis v and baltas e (2013) sizing of rainwater harvesting tank for in-house water supply. 13th international conference on environmental science and technology, 5–7 september 2013.athens. vezzaro l and grum m (2014) a generalised dynamic overflow risk assessment (dora) for real time control of urban drainage systems. j. hydrol. 1 (515) 292–303. https://doi.org/10.1016/j.jhydrol 2014.05.019 villarreal e and dixon a (2005) analysis of a rainwater collection system for domestic water supply in ringdansen, norrkoping, sweden. build. environ. 40 (9) 1174–1184. https://doi. org/10.1016/j.buildenv.2004.10.018 xu w, fletcher td, burns mj and cherqui f (2020) real time control of rainwater harvesting systems: the benefits of increasing rainfall forecast window. water resour. res. 56 (9) e2020wr027856. https://doi.org/10.1029/2020wr027856 xu w, fletcher t, duncan h, bergmann d, breman j and burns m (2018) improving the multi-objective performance of rainwater harvesting systems using real-time control technology. water 10 (2) 147. https://doi.org/10.3390/w10020147 yang t (2006) networked control system: a brief survey. iee proc. control theor. appl. 153 (4) 403–412. https://doi.org/10.1049/ipcta:20050178 https://orcid.org/0000-0001-7707-2721 https://doi.org/10.17221/2423-swr https://doi.org/10.1007/s11269-009-9542-y https://doi.org/10.1016/j.watres.2017.02.056 https://doi.org/10.1061/(asce)ee.1943-7870.0001013 https://doi.org/10.1061/(asce)ee.1943-7870.0001013 https://doi.org/10.1016/s1462-0758(00)00032-7 http://www.csag.uct.ac.za http://www.csag.uct.ac.za https://doi.org/10.1016/j.envsoft.2018.09.020 https://doi.org/10.1016/j.envsoft.2018.09.020 https://doi.org/10.1016/j.resconrec.2012.02.007 https://doi.org/10.1021/acs.est.5b05870 https://doi.org/10.1021/acs.est.5b05870 https://doi.org/10.3390/w6123913 https://doi.org/10.3390/w6123913 https://doi.org/10.1007/s11269-015-1064-1 https://doi.org/10.1007/s11269-015-1064-1 https://doi.org/10.1016/j.scitotenv.2013.06.010 https://doi.org/10.1016/j.scitotenv.2013.06.010 https://doi.org/10.1016/j.resconrec.2011.04.013 https://doi.org/10.1016/j.jhydrol.2004.08.010 https://doi.org/10.1016/j.jhydrol.2014.05.019 https://doi.org/10.1016/j.jhydrol.2014.05.019 https://doi.org/10.1016/j.buildenv.2004.10.018 https://doi.org/10.1016/j.buildenv.2004.10.018 https://doi.org/10.1029/2020wr027856 https://doi.org/10.3390/w10020147 https://doi.org/10.1049/ip-cta:20050178 https://doi.org/10.1049/ip-cta:20050178 water sa 49(3) 282–290 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4008 research paper issn (online) 1816-7950 available on website https://www.watersa.net 282 correspondence glynn k pindihama email gpindihama@gmail.com dates received: 30 july 2022 accepted: 30 june 2023 key words brassica oleracea combined effects sodium-dodecyl-sulfonate metals solanum tuberosum copyright © the author(s) published under a creative commons attribution 4.0 international licence (cc by 4.0) the hyper-eutrophic conditions in impoundments used for irrigation around south africa’s major cities promote the co-existence of linear alkylbenzene sulfonate (las) and other pollutants such as metals. the combined effects of las and metals, when such water is used to irrigate crops, has not been properly investigated in light of human health risks and prevailing local conditions. to understand the potential risks, pot-culture experiments were conducted to assess the effect of the las, sodium-dodecyl-sulfonate (sds), on the accumulation of aluminum (al), manganese (mn) and strontium (sr) in brassica oleracea (cabbage) and solanum tuberosum (potato) plants. the plants were watered with dam water containing 3.48 mg·l−1 of the las (sodium dodecyl sulfonate) and mn (0.257 mg·l−1), al (0.6 mg·l−1) and sr (0.16 mg·l−1) as determined by field surveys, for 20 days. the presence of sds in the irrigation water at environmentally relevant concentrations did not enhance uptake of sr, mn, al in the two plants, as demonstrated by statistically insignificant differences in the means of the treatments (with and without sds). in addition, the presence of the metals, high ph, ec and presence of cyanotoxins in the water did not affect total chlorophyll and growth of the plants. these findings imply that the prevailing levels of anionic surfactants such as sds, metals and other contaminants in the hyper-eutrophic reservoirs pose little risk to crop yields, quality of crops and human health, due to the possible accumulation of these contaminants in irrigated plants. despite the study reporting no immediate inherent risk to the plants and human health, continuous monitoring of the contaminants in water, soil and irrigated plants is recommended since the conditions, concentrations and other factors can quickly change if the management of the catchment does not improve in the near future. the effect of the linear alkylbenzene sulfonate, sodium-dodecyl-sulfonate (sds), on the bioaccumulation of al, sr and mn by brassica oleracea and solanum tuberosum glynn k pindihama1 and mugera w gitari1,2 1environmental remediation and nano sciences research group, department of geography & environmental sciences, faculty of science, engineering and agriculture, university of venda, south africa 2department of chemical sciences and technology, school of chemistry and material sciences, technical university of kenya, nairobi, kenya introduction south africa is known for having scarce and extremely limited water resources and depends mainly on surface water for its urban, industrial and irrigation requirements. metal contaminants in soil have the ability to migrate and accumulate (sulaiman and hamzah, 2018). the accumulation of metal contaminants in soil is of concern, since these can affect the well-being of plants, animals, and humans. in plants, increased levels of metals can induce oxidative stress and also hinder the plants’ ability to produce chlorophyll (sulaiman and hamzah, 2018). linear alkylbenzene sulfonates (las) belong to a group of anionic surfactants commonly used in domestic and industrial processes (wang et al., 2015). anionic surfactants, in particular, are a common ingredient in detergents due to their simple synthesis and low cost (pierattini et al., 2018). las find their way into the aquatic environment through the discharge of untreated and treated wastewater. las elimination in the aquatic environment is via adsorption and biodegradation, but their degradation is very slow in anaerobic and anoxic environments and this leads to their accumulation under such conditions in water (wang et al., 2012). this makes hypereutrophic lakes and reservoirs ideal environments for the co-existence of toxic cyanobacteria, las and other pollutants, since the excessive growth of cyanobacteria in eutrophic lakes consumes oxygen and their eventual death and degradation makes water bodies anoxic and anaerobic. previous studies have looked into the synergic impacts of las with other contaminants such as metal pollutants, pyrene and oil (wang et al., 2012). in south africa (sa), dams like the roodeplaat and hartbeespoort, which are found in the gauteng and north west provinces, respectively, are renowned as hyper-eutrophic and having poor water quality (pindihama and gitari, 2020). the co-existence of las and other pollutants such as microcystins (mcs) and metals thus require examination, since water derived from these dams is mainly used for irrigation. the aim of this study was to assess the effect of the las, sodiumdodecyl-sulfonate (sds), on the accumulation of the metals aluminum (al), manganese (mn) and strontium (sr) in brassica oleracea (cabbage) and solanum tuberosum (potato) plants when exposed to environmentally relevant concentrations of the pollutants. materials and methods materials and reagents a field survey was conducted in june 2019 and september 2019 to identify and collect field water suitable for the experiments. the water was collected from canals and farm dams from the two sites: https://www.watersa.net https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://orcid.org/0000-0001-5537-7591 https://orcid.org/0000-0002-6387-0682 283water sa 49(3) 282–290 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4008 roodeplaat dam and hartbeespoort dam. total dissolved solids (tds), electrical conductivity (ec), ph and turbidity of the water were monitored in-situ, and anionic surfactants, chlorophyll a, microcystins (mcs) and cations were measured ex-situ. the water was kept frozen at −20°c until required. the las used in this study was sodium dodecylbenzene sulfonate (sds) (cas no. 25155-30-0; molar mass 348.48 g.mol−1; and chemical formula c18h29nao3s, acquired from bymaz pty ltd, johannesburg, south africa). pot-culture experimental design the brassica oleracea seeds were purchased from ntk agricultural products & services (sa) and the solanum tuberosum seeds were purchased from livingseeds heirloom seeds (pty) ltd midvaal, gauteng. all the s. tuberosum seeds were first washed with distilled water before being planted in 200  mm plant pots filled with uncontaminated soil. the b. oleracea seedlings were produced and pre-grown in plastic trays with uncontaminated soil. the soil used in this study was collected from the agricultural farm at the university of venda. the farm lies within the lowveld climatic zone and has well-drained deep red soils mostly dominated by clay; the soil falls in the hutton classification which is the same as the rhodic ferralsol (mabasa, 2019). the background levels of metal elements in the soil used in the pots are presented in table 1. the metal elements in the soils were extracted and determined as described in the section on ‘digestion of plant and soil samples’. with regards to the three main nutrients, p, k, total n and organic matter, the soils were analysed at the south african agricultural research council. the organic carbon was analysed using the walkley-black method, p was extracted using the isfei method as described by manson and roberts (2001) and the extract was determined via the molybdenum method using an auto-analyser. exchangeable and soluble k was extracted using the procedure described by manson and roberts (2001) and the k in the leachate was determined by atomic absorption spectrophotometry. total n in the soil was determined using the wet oxidation procedure, commonly known as the kjeldahl distillation, as described by manson and roberts (2001). p, k, total n and organic matter in the soils were 25.86 mg.kg−1; 184 mg.kg−1; 0.079% and 2.07%, respectively, which are typical of agricultural soils (fao, 2015). the soil was collected from a depth of 0–50 cm, and approximately 15 kg of the soil was placed into 200 mm plastic pots for the experiments and treated with 6 g of protek general fertilizer with n:p:k (%) 2:3:2 (14) before introducing the plants. to investigate the effect of the las sodium-dodecyl-sulfonate (sds) on metal (mn, al and sr) accumulation in b. oleracea and s. tuberosum, plants were watered daily with roodeplaat dam water containing 3.4 mg.l−1 of sds (as determined by the field study), a known concentration of microcystins (± 15 µg.l−1), and fixed levels of mn (0.257 mg.l−1), al (0.6 mg.l−1) and sr (0.16 mg.l−1) as established from the field study (table 3) for 20 days. during the field surveys irrigation water from the roodeplaat dam was monitored twice over a 4-month period to determine levels of a range of metallic elements (table 3). three elements, al, mn and sr, were consistently detected, and the highest concentrations reported for the three elements were applied in order to investigate the worst-case scenario. the experimental design showing the 4 treatments the plants were exposed to is presented in table 2. treatment 1 consisted of milli-q water (without any contaminants). treatment 2 was raw dam water with the metals under investigation but without sds. treatment 3 consisted of milli-q water and sds (refreshed daily) but without the metals. treatment 4 was raw dam water with the metals and sds (refreshed daily to maintain constant sds levels). in order to maintain approximately constant concentrations of the sds, the media were tested daily using a hanna hi96769 anionic surfactants portable photometer, and refreshed accordingly. the accumulation of metals was determined in b. oleracea after 5 days and again after 20 days. metal accumulation in s. tuberosum was determined only after 20 days. the total chlorophyll was determined in leaves of both plants at day 20. table 1. background level of cations in the soil (n = 3) element background level (mg·kg−1) element background level (mg·kg−1) b <280 sn 0.09 ± 0.01 v 9.14 ± 12.91 sb <1 cr 56.01 ± 33.40 ba 72.48 ± 2.53 mn 1 709.85 ± 160.28 hg 0.01 ± 0.01 co 60.40 ± 18.85 pb 11.53 ± 1.69 ni 27.67 ± 9.63 al 14 060.00 ± 1 798.88 cu 126.28 ± 48.07 fe 33 286.00 ± 31 726.47 zn 46.97 ± 1.75 ca 1 877.10 ± 196.43 as 0.79 ± 0.26 k 424.50 ± 129.68 se 0.09 ± 0.02 mg 985.30 ± 43.70 sr 9.83 ± 2.08 na 290.60 ± 12.16 mo <3 p 168.30 ± 0.00 cd 0.06 ± 0.01 si 558.00 ± 94.47 table 2. design of the experiment and sampling intervals treatment description treatment 1 (t1) control: milli-q water with no contaminants treatment 2 (t2) raw dam water with mn (0.257 mg.l−1), al (0.6 mg.l−1) and sr (0.16 mg.l−1) treatment 3 (t3) milli-q water with 3.4 mg.l−1 sds treatment 4 (t4) combined exposure: raw dam water, sds (3.4 mg.l−1) + spiked with mn (0.257 mg.l−1), al (0.6 mg.l−1) and sr (0.16 mg.l−1) 284water sa 49(3) 282–290 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4008 determination of total chlorophyll reactive oxygen species (ros) generation in a stress environment in plants causes changes in chlorophyll, anthocyanin and membrane integrity, among other effects; therefore, ros generation can be measured indirectly by measuring the changes in these compounds (venkidasamy et al., 2019). chlorophyll content was measured according to baskar et al. (2015). in brief, 50 mg of the plant leaves was sliced into small pieces and soaked in 95% (v/v) ethanol and then incubated for 3 days in the dark. the absorbance of the supernatant was read at 664.2 and 648.6 nm by uvvis spectrophotometer (spectrostar nano, bmg labtech, germany). chlorophyll a and b and total chlorophyll content were calculated according to baskar et al. (2015) using the following formulae: chl a = 13.36 a664.2 − 5.19 a648.6 (1) chl b = 27.43 a648.6 − 8.12 a664.2 (2) total chlorophyll = chl a + chl b (3) total chlorophyll content was expressed as milligram per gram of fresh matter (fm). digestion of plant and soil samples both soil and plant samples were digested according to rashid et al. (2016). in brief, soil samples were dried for 24 h at 60°c in an oven then ground into a fine powder using a mortar and pestle. the ground soil samples (5 g) were then transferred into a 250 ml conical flask, and 10 ml of aqua regia (hcl:hno3 (3:1)) was added. a hot plate was used to digest the samples at 95°c for 1 h; then left to cool to room temperature. the samples were diluted with deionized water and the supernatant filtered through macherey-nagel no.1 filter paper (0.45  μm), macherey-nagel, germany, before analysis with icp-ms. the edible parts of the plants (leaves for b. oleracea and tubers for s. tuberosum) were first freeze dried for 48 h at −54°c under a constant vacuum of 44  μmhg (telstar lyoquest freeze dryer, terrassa, spain). the freeze-dried material was ground to powder using mortar and pestle, and 1 g of the ground material was mixed with 10 ml of hno3 and allowed to stand overnight before being digested on a hot plate until the solution was semidry. the mixture was cooled and filtered through machereynagel no. 1 filter paper (0.45  μm), macherey-nagel, germany, and then diluted with deionized water to the mark in a 50  ml volumetric flask and then sent to the stellenbosch university central analytical facility for inductively coupled plasma mass spectrometry (icp-ms) analysis. determination of cyanobacterial biomass and microcystins to determine chlorophyll a levels, hot ethanol extraction followed by spectrophotometric analysis of absorbency wavelength on a spectro-star nano (bmg labtech, 601-1106, germany) according to lawton et al. (1999) was used. briefly, absorbency was monitored at 665 and 750  nm wavelengths and second readings were taken upon acidifying the same samples with 10  µl of hydrochloric acid (1  mol.l−1) at the same wavelengths to correct for turbidity. the corrected absorbance and turbidity at 750  nm was subtracted from 665  nm absorbance before and after addition of hydrochloric acid. the total chlorophyll a was determined according to the following formula provided by lawton et al. (1999): correction for turbidity: absorbance 665a −750a = corrected 665a absorbance (4) 665b − 750b = corrected 665b absorbance (5) chlorophyll mg mve vs a a b i � �� � � �29 62 665 665 3. ( ) (6) where: ve = volume of ethanol extract (ml); vs = volume of water sample (l); i = path length of cuvette (cm) levels of microcystins (mcs) in the roodeplaat dam water used were determined using the commercially available enzyme-linked immunosorbent assay (elisa) microcystin plate kits (envirologix inc. (kit lot: 071499 cat no: ep 022)). this assay uses antibodies against microcystins and a microplate reader spectro-star nano (bmg labtech, 601-1106, germany) was used to quantify the mcs after the assay. prior to analysis, 5  ml of each sample was filtered using the 0.20  µm glass fibre syringe filters and 50  µl of the filtered sample was used for the assay. data analyses to compare the levels of accumulated cations and the total chlorophyll of the various plant treatments, analysis of variance (anova) and/or kruskal–wallis tests were used at p < 0.05 using graphpad instat 3 (graphpad software, california, united states). levels of cations are presented by their means ± the standard deviation (sd). kolmogorov–smirnov and bartlett tests were used to test for normality and variance homogeneity at p ≤ 0.05. data which passed this test were compared using anova and data which did not pass that test was compared using the kruskal–wallis at p < 0.05. the tukey–kramer multiple comparisons test and the dunn’s multiple comparisons test were used as post-hoc assays for data which passed the normality tests and data which did not pass the normality test, respectively. results physicochemical parameters of the dam water dam water used to water the plants was alkaline, with mean ph of 9.02 (± 0.29), high ec and tds levels (380 ± 16.52 µs.cm−1 and 228 ± 7.51 mg.l−1, respectively). the water also had a high cyanobacterial biomass (chlorophyll a 440.24 ± 328.147 μg.l−1) and high mc levels (13.03 ± 3.599 µg.l−1). the ph of the dam water used for irrigation was above the 6.5–8.4 threshold for water intended for irrigation in sa (dwaf, 1996). even though the ec of the dam water was quite high, it was within the sa (dwaf, 1996) and food and agriculture organization (fao) (1985) (ayers and westcot, 1985) limits for irrigation water of ≤ 400 μs.cm−1 and 700 μs.cm−1, respectively. the levels of anionic surfactants in the water ranged from 0.13 to 3.4 mg.l−1. table 3 shows the levels of cations in the raw dam water. all the cations in the dam water were within the sa (dwaf, 1996) and fao (1985) guidelines for irrigation water. metals such as sr, mn and al were detected at significant levels in the dam water; hence their selection for the pot culture experiments. accumulation of al, sr, mn and other cations by b. oleracea in the presence of sds findings from the pot-culture experiments in table 4 show that upon 20 days of exposure to the various treatments, the b. oleracea leaves accumulated mn to a maximum of 69.79 (± 22.97) µg.kg−1 (treatment 2) and a minimum of 57.69 (± 12.52) µg.kg−1 (treatment 1). sr was accumulated up to 127.98 (± 26.60) µg.kg−1 (treatment 3), with a lowest accumulation of 126.22 (±28.26) µg.kg−1 (treatment 2). the highest levels of al were accumulated in treatment 1 at 0.18 (± 0.04) mg.kg−1, and the lowest levels were accumulated in treatments 3 and 4, at 0.15 (± 0.04) mg.kg−1. the findings indicate no significant differences in the accumulated 285water sa 49(3) 282–290 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4008 levels of mn, sr and al in b. oleracea leaves after 5 days of exposure and after 20 days of exposure (anova, p ≥ 0.05) (fig. 1). a comparison of the accumulated metals among the 4 treatments presented in fig. 2 and table 4 shows that no significant differences were observed among the treatments for sr and mn (p > 0.05). significantly higher levels of al were accumulated in plants exposed to treatment 2 (t2, dam water containing the three metals) compared to the other treatments (p < 0.05). this implies that accumulation of al in b. oleracea was not affected by the presence of the sds in treatment 3 and combined exposure of metals and sds in treatment 4. with regards to the 19 other major and trace cations also assessed in table 4, only cr, co, mg and p showed a significant difference in the levels accumulated among the 4 treatments (p < 0.05). for co, cr and p, much higher levels were accumulated in plants exposed to treatment 1 compared to the other treatments, and for na, plants exposed to treatment 2 accumulated higher levels of the cation. table 3. metals in the roodeplaat dam raw water used in the experiments (mean ± sd, n = 6) metal (mg·l−1) june 2019 september 2019 sa guidelines (dwaf, 1996) fao guidelines (ayers and westcot, 1985) al 0.376 (± 0.817) 0.624 (± 0.726) 5–20 5.0 as 0.002 (± 0.001) 0.001 (± 0.000) 0.1–2.0 0.1 b 0.059 (± 0.008) 0.068 (± 0.005) 0.5–6.0 0.7 ba 0.049 (± 0.015) 0.152 (± 0.056) − − cu 0.006 (± 0.003) 0.006 (± 0.007) 0.2–0.5 0.2 mn 0.257 (± 0.179) 0.158 (± 0.109) 0.02–10 0.2 ni 0.006 (± 0.003) 0.008 (± 0.003) 0.2–2.0 0.2 pb 0.004 (± 0.004) 0.001 (± 0.001) 0.2–2.0 5.0 sr 0.144 (± 0.116) 0.118 (± 0.020) − − zn 0.083 (± 0.080) 0.090 (± 0.033) 1.0–5.0 2.0 note: the 1996 south african and the 1985 fao guidelines do not have a value for barium (ba) and strontium (sr) figure 1. comparison of accumulation of metals in cabbage (brassica oleracea) leaves after 5 days vs 20 days of exposure to the various treatments (n = 6): (a) sr, (b) mn, (c) al 286water sa 49(3) 282–290 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4008 figure 2. accumulation of metals in cabbage (brassica oleracea) leaves after 20 days of exposure to the various treatments (n = 6): (a) sr, (b) mn, (c) al. note: different lowercase letters indicate a significant difference between treatments (p < 0.05). table 4. cations accumulated in b. oleracea leaves upon 20-day exposure to the 4 treatments. data labeled with different small letters (a–c) differed significantly at p < 0.05 in each row (mean ±sd, n = 6). t1 = control (milli-q water); t2 = roodeplaat dam water (mn 0.257 mg.l−1, al 0.6 mg.l−1, sr 0.16 mg.l−1); t3 = milli-q water with 3.4 mg l−1 sds; t4 = roodeplaat dam water (sds 3.4 mg.l−1, mn 0.257 mg.l−1, al 0.6 mg.l−1, sr 0.16 mg.l−1) category element t1: control t2: roodeplaat dam water t3: milli-q water with sds t4: roodeplaat dam water with sds significance minor cations (µg.kg−1) b 32.42 (± 7.01) 26.47 (± 4.67) 25.84 (± 4.15) 26.21 (± 5.24) n.s v 1.00 (± 0.40) 0.63 (± 0.22) 0.59 (± 0.29) 0.60 (± 0.27) n.s cr 3.80 (± 0.36)a 3.44 (± 0.28)a,b 3.43 (± 0.19)a,b 3.39 (± 0.21)b * mn 57.69 (± 12.52) 69.79 (± 22.97) 57.76 (± 14.86) 60.16 (± 21.10) n.s co 0.67 (± 0.11)a 0.62 (± 0.12)a,b 0.51 (± 0.11)a,b 0.53 (± 0.12)b * ni 2.17 (± 0.29) 1.87 (± 0.10) 2.20 (± 0.76) 2.13 (± 0.71) n.s cu 3.75 (± 0.89) 3.80 (± 0.61) 4.08 (± 0.51) 3.92 (± 0.57) n.s zn 45.77 (± 14.41) 43.23 (± 11.49) 38.90 (± 10.87) 39.14 (± 10.94) n.s as 0.05 (± 0.01) 0.14 (± 0.17) 0.26 (± 0.56) 0.25 (± 0.51) n.s se 0.56 (± 0.11) 0.76 (± 0.15) 0.73 (± 0.10) 0.71 (± 0.10) n.s sr 127.10 (± 31.70) 126.22 (± 28.26) 127.98 (± 26.60) 127.48 (± 27.64) n.s mo 2.83 (± 0.98) 1.57 (± 1.38) 1.70 (± 1.62) 1.75 (± 1.59) n.s ba 104.41 (± 23.00) 100.90 (± 29.52) 105.14 (± 30.32) 103.41 (± 30.75) n.s pb 0.20 (± 0.04) 0.19 (± 0.04) 0.21 (± 0.06) 0.19 (± 0.06) n.s major cations (mg.kg−1) al 0.18 (± 0.04)a,b 0.17 (± 0.04)a 0.15 (± 0.04)b 0.15 (± 0.04)b *** fe 0.30 (± 0.11) 0.20 (± 0.07) 0.20 (± 0.09) 0.19 (± 0.09) n.s ca 35.94 (± 10.11) 33.72 (± 10.38) 33.63 (± 8.31) 32.79 (± 9.23) n.s k 19.11 (± 3.13) 16.52 (± 4.79) 16.86 (± 4.76) 17.11 (± 4.11) n.s mg 6.31 (± 1.64) 5.83 (± 1.38) 5.69 (± 1.06) 5.70 (± 1.11) n.s na 0.28 (± 0.10)b 0.41 (± 0.18)a 0.36 (± 0.17)b 0.37 (± 0.16)a,b ** p 3.81 (± 1.45)a 2.74 (± 0.91)b 2.66 (± 0.93)b 2.65 (± 0.94)b * si 1.39 (± 2.96) 0.04 (± 0.01) 0.04 (± 0.01) 0.04 (± 0.01) n.s note: *p < 0.05, **p <0.01, ***p < 0.001, n.s = not significant. accumulation of al, sr, mn and other cations by s. tuberosum in the presence of sds table 5 and figure 3 shows the accumulation of the metals in the s. tuberosum tubers. higher levels of mn were accumulated for treatment 3 (17.34 ± 4.93 µg.kg−1) and lowest levels for treatment 1 (11.07 ± 2.85 µg.kg−1). for sr, higher accumulation was also for treatment 3 (4.73 ± 0.91 µg.kg−1) and lowest for treatment 1 (2.93 ± 0.38 µg.kg−1). accumulation of al was highest for treatment 3 (0.17 ± 0.06 µg.kg−1) and lowest for treatment 4 (0.10 ± 0.05 µg.kg−1). accumulation of mn and sr was much higher in the edible parts of b. oleracea (leaves) compared to the edible parts (tubers) of s. tuberosum plants (highest mn accumulation of 69.79 (± 22.97) in 287water sa 49(3) 282–290 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4008 b. oleracea and 17.34 (± 4.93) in s. tuberosum and highest accumulation for sr of 127.98 (± 26.60) in b. oleracea and 4.73 (± 0.91) in s. tuberosum). the accumulation of al was comparable in the edible parts of the two plant species (maximum accumulation of 0.18 (± 0.04) in b. oleracea leaves and 0.17 (± 0.06) in s. tuberosum tubers). there were no significant differences in the accumulation of al and mn in the s. tuberosum tubers (p > 0.05), but significantly different accumulations were found for sr (p < 0.05), with treatment 1 having a significantly lower uptake compared to the other three treatments. since plants exposed to treatment 1 were not exposed to any sds nor metals, this probably explains the lower levels of sr accumulated by the tubers in treatment 1. with regards to the other major and minor cations also assessed in the tubers (table 5), no significant differences in the accumulations were found for all the other cations assessed (p > 0.05). table 5. cations accumulated in s. tuberosum tubers upon 20-day exposure to the 4 treatments. data labeled with different small letters (a–c) differed significantly at p < 0.05 in each row (mean ± sd, n = 6). t1 = control (milli-q water); t2 = roodeplaat dam water (mn 0.257 mg.l−1, al 0.6 mg.l−1, sr 0.16 mg.l−1); t3 = milli-q water with 3.4 mg l−1 sds; t4 = roodeplaat dam water with 3.4 mg.l−1 sds (sds 3.4 mg.l−1, mn 0.257 mg.l−1, al 0.6 mg.l−1, sr 0.16 mg.l−1) category element t1: control t2: roodeplaat dam water t3: milli-q water with sds t4: roodeplaat dam water with sds significance minor cations (µg.kg−1) b 5.86 (± 0.57) 6.59 (± 0.60) 6.51 (± 1.65) 10.69 (± 11.99) n.s v 0.51 (± 0.26) 1.00 (± 0.73) 1.18 (± 0.66) 2.50 (± 4.96) n.s cr 3.20 (± 0.17) 3.28 (± 0.19) 3.35 (± 0.20) 3.45 (± 1.30) n.s mn 11.07 (± 2.85) 15.27 (± 6.32) 17.34 (± 4.93) 13.51 (± 6.51) n.s co 0.68 (± 0.70) 0.51 (± 0.22) 0.59 (± 0.24) 0.80 (± 0.86) n.s ni 2.47 (± 0.44) 2.51 (± 0.39) 2.42 (± 0.50) 3.61 (± 1.52) n.s cu 5.68 (± 1.14) 6.65 (± 1.81) 6.19 (± 1.09) 8.55 (± 2.86) n.s zn 13.75 (± 2.25) 14.07 (± 2.60) 12.66 (± 1.82) 16.71 (± 4.19) n.s sr 2.93 (± 0.38)b 4.64 (± 0.99)a 4.73 (± 0.91)a 4.38 (± 0.77)a ** mo 0.34 (± 0.08) 0.33 (± 0.05) 0.33 (± 0.04) 0.29 (± 0.05) n.s ba 6.29 (± 2.15) 9.68 (± 4.34) 8.51 (± 1.85) 8.99 (± 4.23) n.s pb 0.10 (± 0.01) 0.16 (± 0.05) 0.16 (± 0.04) 0.23 (± 0.17) n.s major cations (mg.kg−1) al 0.11 (± 0.03) 0.16 (± 0.07) 0.17 (± 0.06) 0.10 (± 0.05) n.s fe 0.12 (± 0.12) 0.30 (± 0.27) 0.34 (± 0.21) 0.71 (± 1.51) n.s ca 0.70 (± 0.19) 1.00 (± 0.48) 1.02 (± 0.39) 0.75 (± 0.30) n.s k 18.08 (± 4.06) 18.17 (± 3.99) 15.32 (± 1.81) 14.64 (± 2.43) n.s mg 1.13 (± 0.34) 1.16 (± 0.24) 1.16 (± 0.25) 1.05 (± 0.17) n.s na 0.14 (± 0.03) 0.18 (± 0.03) 0.15 (± 0.05) 0.18 (± 0.06) n.s p 1.94 (± 0.76) 1.96 (± 0.46) 1.79 (± 0.48) 1.90 (± 0.41) n.s si 0.02 (± 0.01) 0.03 (± 0.02) 0.03 (± 0.02) 0.03 (± 0.01) n.s note: *p < 0.05, **p < 0.01, ***p < 0.001, n.s. = not significant figure 3. accumulation of metals in potato (solanum tuberosum) tubers after 20 days of exposure to the various treatments (n = 6): (a) sr (b) mn (c) al. note: different lowercase letters indicate a significant difference between treatments (p < 0.05). 288water sa 49(3) 282–290 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4008 figure 4. total chlorophyll in (a) cabbage (brassica oleracea) leaves, (b) potato (solanum tuberosum) leaves, after 20 days of exposure to the 4 treatments (n = 6) effects of al, sr, mn and other cations on b. oleracea tolerance and s. tuberosum since increased levels of metals in plants are known to induce oxidative stress and also hinder the plants’ ability to produce chlorophyll (shakya et al., 2008; sulaiman and hamzah, 2018), we monitored total chlorophyll levels in the two plant species to assess the potential effects of the al, sr, mn and other cations on the plants. in addition, the dam water used in treatments 2 and 4 also had significant levels of microcystins (mcs) (15 ± 3.88 µg.l−1), high ph (9.02 ± 0.29), high ec levels (380 ± 16.52 µs.cm−1) and high tds levels (228 ± 7.51 mg.l−1). all these contaminants, i.e. mcs (saqrane et al., 2008; machado et al., 2017), high ph and ec (huang et al., 2017) and anionic surfactants (pandey and gopal, 2010; wang et al., 2012) are also known to induce oxidative stress, reduce chlorophyll production and affect plant growth. figure 4a shows comparable total chlorophyll content in the leaves of b. oleracea plants exposed to treatment 1 compared to other treatments (no statistically significant differences in the mean total chlorophyll content among the plants exposed to the 4 treatments after 20 days of exposure (anova, p ≥ 0.05)). with regards to the total chlorophyll content of the s. tuberosum leaves, comparable total chlorophyll levels were observed in plants exposed to treatments 1 to 4 (no statistically significant differences in the mean total chlorophyll levels among the 4 treatments; anova, p ≥ 0.05). the findings imply that exposure to environmentally relevant levels of the 3 metals and sds as applied in this study, and the presence of other major and trace cations and mcs in the raw dam water did not induce oxidative stress nor inhibit chlorophyll production in the plants. in addition, no significant visual impacts were observed on the plants exposed to the 4 treatments. discussion pollution of aquatic ecosystems and soils by anionic surfactants is common due to their widespread use in soaps and detergents globally. the presence of anionic surfactants in the dam water collected from roodeplaat and hartbeespoort dam sites was confirmed. levels of anionic surfactants found in the water (0.13 to 3.4 mg.l−1) were within the range (0.001 and 20 mg.l−1) generally found in surface waters (wang et al., 2015). both dams are considered hyper-eutrophic and warm monomictic impoundments (van ginkel, 2004) and the long history of mining, industrial activities and a rapidly growing urban population in the catchments where these two dams are found promotes the co-existence of pollutants such as anionic surfactants las, cyanotoxins and metals in these two dams (pindihama and gitari, 2020). some of the contaminants observed in the dam water used to irrigate the plants in treatments 2 and 4 have been reported to have adverse effects on plants, e.g., mcs are known to induce oxidative stress (saqrane et al., 2008; machado et al., 2017), high ph and ec are known to induce oxidative stress and affect chlorophyll production (huang et al., 2017), and anionic surfactants like las are also known to induce oxidative stress, reduce chlorophyll production and affect plant growth (pandey and gopal, 2010; wang et al., 2012). in this study, exposure to las in the form of sds at relevant environmental concentrations did not affect the total chlorophyll of the plants. previous studies have reported improved plant growth due to exposure to las in the range 0.3–10 mg.l−1, and significant stunted growth when the common aquatic duckweed (lemna minor) was exposed to 20–30 mg.l−1 sds (wang et al., 2012). anionic surfactants like sds are amphipathic compounds and can easily interact with the polar and non-polar components of cell membranes, resulting in membrane damage, and induce oxidative stress (forni et al., 2012; pierattini et al., 2018). toxic effects such as reduced phenols and chlorophyll content and increased activity of stress-related enzymes upon exposure to sds have been reported in aquatic plants like l. minor (wang et al., 2012; forni et al., 2012) and azolla pinnata (pandey and gopal, 2010). in the current study, the plants were exposed to much lower levels (± 3 mg.l−1) of sds compared to those reported in previous studies (≥ 10 mg.l−1) (e.g. pandey and gopal, 2010; wang et al., 2012; forni et al., 2012); this may be the reason that no significant impacts on total chlorophyll were reported between the treatments and the control plants. the presence of las in the irrigation water, in the form of sds at environmentally relevant concentrations, did not enhance uptake of sr, mn, al in the two plants tested here, as demonstrated by statistically insignificant differences in the means of the four treatments. in the case of s. tuberosum, where a statistically significant difference was observed for sr, low uptakes were reported in the control plants, but plants exposed to metal-containing dam water without any sds, plants exposed to milli-q water with sds (without any metals) and plants exposed to dam water with sds and containing the three metals (sr, mn and al), showed no differences. this implied that the accumulation of sr in the s. tuberosum tubers was not affected by the presence of sds and was independent of the presence of the metal in the water used for irrigation. the presence of sds also did not affect the uptake and accumulation of sr, mn, al and 19 other major and trace cations in b. oleracea. statistically significant higher accumulation of al in treatment 2 (dam water spiked with sr, mn and al) compared to other treatments, particularly treatments 3 and 4 which had sds, implies that sds at the levels tested (3.4 mg.l−1) did not enhance the uptake of the metal by the plants. with regards to other cations which were not spiked in any of the treatments, but were initially 289water sa 49(3) 282–290 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4008 present in the dam water and soils used, significantly higher accumulations of cr, co, mg and p in treatments 1 and 2, which did not have any sds, also supported the finding that uptake and accumulation was independent of the presence of sds. previous studies reported contrasting results on the uptake of metals in the presence of anionic surfactants like the las, sds. hasan et al. (2019) reported increased cd accumulation in shoots and roots of althaea rosea upon exposure to 348.48 mg.l−1 of sds. in another study, pierattini et al. (2018) did not report significant total accumulation of zn by poplar plants poplus alba, but observed increased accumulation in leaves when 1 mm zn was applied in combination with 0.5 mm of sds compared to when 1  mm zn was applied alone. pierattini et al. (2018) also reported increased translocation of zn from roots to leaves when the poplar plants were exposed to sds. contrary to pierattini et al. (2018), almeida et al. (2009) found that the las, sds enhanced cu accumulation in the salt marsh plant halimione portulacoides, but did not find any cu translocation to the other parts of the plant. consistent with our findings, zhang et al. (2008) reported a reduction in cd uptake by soybean plants in the presence of las. zhang et al. (2008) found a reduction in cd bound to carbonates and exchangeable cd in the soils when the soils are exposed to las, hence the low uptakes reported. almeida et al. (2009) did not find any influence of las on cu levels in sediments. in addition to data suggesting little influence of anionic surfactants on the solubility of metals, hasan et al. (2019) and mao et al. (2015) reported degradation of las by strains of pseudomonas, which use the contaminant as a source of carbon. the presence of such bacteria (pseudomonas) to degrade the las in the soils in the study area was highly likely, given the climate (average annual temperatures ranging between 14°c and 29°c) in the study area. in addition the levels of las applied here were much lower compared to those applied in studies where significant metal uptakes were reported (e.g. pierattini et al., 2018; hasan et al., 2019). at low concentrations, surfactants build up at liquid to liquid or at solid to liquid interfaces as monomers (mao et al., 2015). increasing their concentrations eventually replaces the interfacial solvent, such as water, leading to decreased polarity of the aqueous phase and a surface tension reduction. at high concentrations of surfactants, dissolved pollutants in the aqueous phase gain more mobility, which is conducive to removal and uptake by plants and even degradation by microbes. also, the properties of the soil, and the surfactant itself, influence the adsorption of a surfactant (mao et al., 2015). the interaction and combination of las and other contaminants like mcs and metal ions has been found to be both synergistic and in some cases antagonistic (chai et al., 2020). our findings did not suggest any synergistic nor antagonistic effects of las in combination with metals and other contaminants such as mcs which were detected in the water used. consistent with our findings, zhang et al. (2008) did not find increased uptake of cd by soybean in the presence of las. jensen and sverdrup (2002) also did not find any combined effect of las and pyrene on folsomia fimetaria. according to chai et al. (2020), synergistic or combined effects are influenced by a number of factors, including the types of contaminants tested, plant species, concentrations tested and the duration of exposure. in this study, factors such as faster biodegradation of las by microbes, a reduction in the exchangeable metals available in the media and low concentrations of las tested could all have affected las, metals and other contaminants’ activity and toxicity to the plants. what we also observed was a noticeably higher uptake in the edible parts of b. oleracea plants (leaves) compared to s. tuberosum plants (tubers). according to hasan et al. (2019), b. oleracea, in the brassicaceae family, belongs to a group of plants known to be hyperaccumulators and suited to grow in soils polluted with metals. hyperaccumulators can take up zn and mn at concentrations up to 10 000 mg.kg−1; cu, ni and pb beyond 1 000 mg.kg−1 dry mass, cd at up to 100 mg.kg−1 dry mass in contaminated media (hasan et al., 2019). conclusions and recommendations this study explored the effect of an anionic surfactant (las in the form of sds) on the accumulation of the metals aluminum (al), manganese (mn) and strontium (sr) in brassica oleracea (cabbage) and solanum tuberosum (potato) plants when exposed to environmentally realistic concentrations of the pollutants. the findings indicated that when common cabbage (b. oleracea) and cultivated potato (s. tuberosum) plants were exposed to environmentally relevant concentrations of sds and metals (sr, mn, al and other cations), no negative effects could be observed on the plants. moreover, the combined exposure of the plants to these contaminants did not result in increased uptake and accumulation of the metals as was anticipated. this implies that the existing levels of anionic surfactants such as las, metals and other contaminants such as mcs found in hyper-eutrophic reservoirs such as roodeplaat and hartbeespoort dams in south africa, pose little risk to the crop yields, quality of the crops and human health due to the possible accumulation of these contaminants in irrigated plants. despite there being no immediate inherent risk to the plants and human health, continuous monitoring of the contaminants in water, soil and irrigated plants is recommended since the conditions, concentrations and other factors can quickly change if the management of the catchments does not improve in the near future. conflict of interest none declared. funding funding for this study was granted by the south african water research commission (wrc) project no: k5/2972. data availability statement the datasets generated during and/or analysed during the current study are available from the corresponding author upon reasonable request. orcids glynn k pindihama https://orcid.org/0000-0001-5537-7591 mugera w gitari https://orcid.org/0000-0002-6387-0682 references almeida cmr, dias ac, mucha ap, bordalo aa and vasconcelos mtsd (2009) influence of surfactants on the cu phytoremediation potential of a salt marsh plant. chemosphere 75 (2) 135–140. https://doi.org/10.1016/j.chemosphere.2008.12.037 ayers rs and westcot dw (1985) water quality for agriculture. fao irrigation and drainage paper no. 29. fao, rome. baskar v, venkatesh j and park sw (2015) impact of biologically synthesized silver nanoparticles on the growth and physiological responses in brassica rapa ssp. pekinensis. environ. sci. pollut. res. 22 (22) 17672–17682. https://doi.org/10.1007/s11356015-4864-1 chai l, yang l, zhang y, zhou y, wang f and wu z (2020) antagonism or synergism? responses of hydrocharis dubia (bl.) backer to linear alkylbenzene sulfonate, naphthalene and their joint exposure. ecotoxicol. environ. saf. 200 (january) 110747. https://doi.org/10.1016/j.ecoenv.2020.110747 https://orcid.org/0000-0001-5537-7591 https://orcid.org/0000-0002-6387-0682 https://doi.org/10.1016/j.chemosphere.2008.12.037 https://doi.org/10.1007/s11356-015-4864-1 https://doi.org/10.1007/s11356-015-4864-1 https://doi.org/10.1016/j.ecoenv.2020.110747 290water sa 49(3) 282–290 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4008 dwaf (department of water affairs and forestry, south africa) (1996) water quality guidelines volume 4 agricultural use: irrigation. department of water affairs and forestry, pretoria. url:  http://www.dwa.gov.za/iwqs/wq_guide/edited/pol_sawq guidefreshirrigationvol4.pdf (accessed 11 may 2022). fao (2015) international year of soils 2015: healthy soils for a healthy life. rome, italy. url: https://www.fao.org/soils-2015/ news/news-detail/en/c/277682/ (accessed 30 march 2023). forni c, braglia r, harren fjm and cristescu sm (2012) stress responses of duckweed (lemna minor l.) and water velvet (azolla filiculoides lam.) to anionic surfactant sodium-dodecylsulphate (sds). aquat. toxicol. 110–111 107–113. https://doi.org/ 10.1016/j.aquatox.2011.12.017 hasan mm, uddin mn, ara-sharmeen i, alharby hf, alzahrani y, hakeem kr and zhang l (2019) assisting phytoremediation of heavy metals using chemical amendments. plants 8 (9) 1–14. https://doi.org/10.3390/plants8090295 huang l, liu x, wang z, liang z, wang m, liu m and suarez dl (2017) interactive effects of ph, ec and nitrogen on yields and nutrient absorption of rice (oryza sativa l.). agric. water manage. 194 (december) 48–57. https://doi.org/10.1016/j. agwat.2017.08.012 jensen j and sverdrup le (2002) joint toxicity of linear alkylbenzene sulfonates and pyrene on folsomia fimetaria. ecotoxicol. environ. saf. 52 (1) 75–81. https://doi.org/10.1006/eesa. 2002.2149 lawton l, marsalek b, padisák j and ingrid c (1999) chapter 12. determination of cyanobacteria in: toxic cyanobacteria in water: a guide to their public health consequences, monitoring and management. e & fn spon, london. 347–367. https://doi. org/10.1201/9781482295061-18 mabasa hz (2019) spatial variability of aggregate stability, size distribution, erosion and runoff in selected soils in south africa. masters dissertation, university of venda. url:  https://univend space.univen.ac.za/bitstream/handle/11602/1647/dissertation-mabasa %2c h.z.-.pdf?sequence=1&isallowed=y machado j, campos a, vasconcelos v and freitas m (2017) effects of microcystin-lr and cylindrospermopsin on plant-soil systems: a review of their relevance for agricultural plant quality and public health. environ. res. 153 (may 2016) 191–204. https://doi.org/10.1016/j.envres.2016.09.015 manson ad and roberts vg (2001) analytical methods used by the soil fertility and analytical services section. kzn agri-report no. n/a/2001/04 (4). kwazulu-natal department of agriculture and rural development. url: https://www.kzndard.gov.za mao x, jiang r, xiao w and yu j (2015) use of surfactants for the remediation of contaminated soils: a review. j. hazardous mater. 285 419–435. https://doi.org/10.1016/j.jhazmat.2014.12.009 pandey p and gopal b (2010) effect of detergents on the growth of two aquatic plants: azolla pinnata and hydrilla verticillata. int. j. sci. technol. 5 (1) 107–114. pierattini ec, francini a, raffaelli a and sebastiani l (2018) surfactant and heavy metal interaction in poplar: a focus on sds and zn uptake. tree physiol. 38 (1) 109–118. https://doi. org/10.1093/treephys/tpx155 pindihama gk and gitari mw (2020) cyanobacterial toxins: an emerging threat in south african irrigation water. water environ. j. 34 (3) 506–516. https://doi.org/10.1111/wej.12473 rashid mh, fardous z, chowdhury maz, alam mk, bari ml, moniruzzaman m and gan sh (2016) determination of heavy metals in the soils of tea plantations and in fresh and processed tea leaves: an evaluation of six digestion methods. chem. centr. j. 10 (1) 1–13. https://doi.org/10.1186/s13065-016-0154-3 saqrane s, ghazali i el, oudra b, bouarab l and vasconcelos v (2008) effects of cyanobacteria producing microcystins on seed germination and seedling growth of several agricultural plants. j. environ. sci. health – part b pesticides food contam. agric. wastes 43 (5) 443–451. https://doi. org/10.1080/03601230802062307 shakya k, chettri mk and sawidis t (2008) impact of heavy metals (copper, zinc, and lead) on the chlorophyll content of some mosses. arch. environ. contam. toxicol. 54 (3) 412–421. https://doi.org/10.1007/s00244-007-9060-y sulaiman fr and hamzah ha (2018) heavy metals accumulation in suburban roadside plants of a tropical area (jengka, malaysia). ecol. process. 7 (1). https://doi.org/10.1186/s137 17-018-0139-3 van ginkel ce (2004) a national survey of the incidence of cyanobacterial blooms and toxin production in major impoundments. directorate: resource quality services, department of water affairs and forestry, pretoria. venkidasamy b, karthikeyan m and ramalingam s (2019) methods/protocols for determination of oxidative stress in crop plants. in: hasanuzzaman m, fotopoulos v, nahar k and fujita m (eds) reactive oxygen, nitrogen and sulfur species in plants: production, metabolism, signaling and defense mechanisms. john wiley & sons, hoboken. 421–435. https://doi. org/10.1002/9781119468677.ch17 wang z, xiao b, song l, wang c and zhang j (2012) responses and toxin bioaccumulation in duckweed (lemna minor) under microcystin-lr, linear alkybenzene sulfonate and their joint stress. j. hazardous mater. 229–230 137–144. https://doi.org/ 10.1016/j.jhazmat.2012.05.109 wang z, zhang j, song l, li e, wang x and xiao b (2015) effects of linear alkylbenzene sulfonate on the growth and toxin production of microcystis aeruginosa isolated from lake dianchi. environ. sci. pollut. res. 22 (7) 5491–5499. https://doi.org/10.1007/ s11356-014-3784-9 zhang y, liao b-h, zeng q-r, zeng m and lei m (2008) surfactant linear alkylbenzene sulfonate effect on soil cd fractions and cd distribution in soybean plants in a pot experiment. pedosphere. 18 (2) 242–247. https://doi.org/10.1016/s1002-0160(08) 60013-2 http://www.dwa.gov.za/iwqs/wq_guide/edited/pol_sawqguidefreshirrigationvol4.pdf http://www.dwa.gov.za/iwqs/wq_guide/edited/pol_sawqguidefreshirrigationvol4.pdf https://www.fao.org/soils-2015/news/news-detail/en/c/277682/ https://www.fao.org/soils-2015/news/news-detail/en/c/277682/ https://doi.org/10.1016/j.aquatox.2011.12.017 https://doi.org/10.1016/j.aquatox.2011.12.017 https://doi.org/10.3390/plants8090295 https://doi.org/10.1016/j.agwat.2017.08.012 https://doi.org/10.1016/j.agwat.2017.08.012 https://doi.org/10.1006/eesa.2002.2149 https://doi.org/10.1006/eesa.2002.2149 https://doi.org/10.1201/9781482295061-18 https://doi.org/10.1201/9781482295061-18 https://univendspace.univen.ac.za/bitstream/handle/11602/1647/dissertation-mabasa%2c%20h.z.-.pdf?sequence=1&isallowed=y https://univendspace.univen.ac.za/bitstream/handle/11602/1647/dissertation-mabasa%2c%20h.z.-.pdf?sequence=1&isallowed=y https://univendspace.univen.ac.za/bitstream/handle/11602/1647/dissertation-mabasa%2c%20h.z.-.pdf?sequence=1&isallowed=y https://doi.org/10.1016/j.envres.2016.09.015 https://www.kzndard.gov.za https://doi.org/10.1016/j.jhazmat.2014.12.009 https://doi.org/10.1093/treephys/tpx155 https://doi.org/10.1093/treephys/tpx155 https://doi.org/10.1111/wej.12473 https://doi.org/10.1186/s13065-016-0154-3 https://doi.org/10.1080/03601230802062307 https://doi.org/10.1080/03601230802062307 https://doi.org/10.1007/s00244-007-9060-y https://doi.org/10.1186/s13717-018-0139-3 https://doi.org/10.1186/s13717-018-0139-3 https://doi.org/10.1002/9781119468677.ch17 https://doi.org/10.1002/9781119468677.ch17 https://doi.org/10.1016/j.jhazmat.2012.05.109 https://doi.org/10.1016/j.jhazmat.2012.05.109 https://doi.org/10.1007/s11356-014-3784-9 https://doi.org/10.1007/s11356-014-3784-9 https://doi.org/10.1016/s1002-0160(08)60013-2 https://doi.org/10.1016/s1002-0160(08)60013-2 water sa 49(3) 301–310 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4004 research paper issn (online) 1816-7950 available on website https://www.watersa.net 301 correspondence edip avşar email edip.avsar@bilecik.edu.tr dates received: 18 june 2022 accepted: 14 july 2023 key words haas risk assessment dcaa chlorination groundwater muş province copyright © the author(s) published under a creative commons attribution 4.0 international licence (cc by 4.0) chlorine not only removes parasitic pathogenic microorganisms in water, but also causes the formation of disinfection by-products (dbps) that can be carcinogenic to humans, due to reacting with natural organic matter (noms) in raw water sources. haloacetic acids (haas) are one of the most well-known and common disinfection by-product groups (dbps) in the literature. in the risk definitions of the epa, some of its components have been identified as carcinogenic. therefore, determination of haa concentration in water and execution of a risk analysis are very important in terms of determining the possible effects on public health. this study aimed to monitor the seasonal and spatial variations of haloacetic acids (haas) in 2 different water supplies (surface and groundwater) serving the city center of muş province, türkiye, and to demonstrate their public health implications. in this context, an analytical study was conducted covering 4 seasons. according to the results, although the amount of nom in water bodies was less than 1 mg·l−1, the haa5 content may occasionally exceed the usepa limits of 60 µg·l −1, but did not exceed the canadian 80 µg·l−1 limit. when the who limit values were examined on a component basis, it was determined that the mcaa concentrations in both water sources sometimes exceeded the limit of 20 µg·l−1 in the july and october sampling periods. the risk level related to maximum dcaa level in the main network by means of ingestion pathway was found to be 18.7 times higher for women and 16.5 times higher for men when compared with usepa risk criteria. also, in the muratpaşa water network, risk from dcaa exceeds the usepa risk level 15.2-fold in women and 13.4-fold in men. however, since it was also found that the level of free chlorine in the network does not meet the required level, it should be noted that there may be an increase in the risk level if there is adequate chlorination in the supply. monitoring seasonal variations of haloacetic acids (haas) in low-toc and low-chlorine networks and assessing risk to public health: muş, türkiye case edip avşar1 and adile kılıç2 1vocational school environmental protection technologies department, bilecik şeyh edebali university, bilecik, türkiye 2graduate education institute, bitlis eren university, bitlis, türkiye introduction chlorine is the most commonly used disinfectant in drinking water treatment due to its low cost, ease of use, and effectiveness in preventing waterborne disease. chlorine kills or deactivates a large variety of waterborne microorganisms. however, since the mid-1970s, public health concerns about the disinfection process have increased. studies have shown that chlorine reacts not only with waterborne parasitic pathogenic microorganisms, but also with natural organic matter (nom), bromide, iodide, and nitrite in water to form trihalomethanes (thms), haloacetic acids (haas), halonitromethanes (hnms) and other disinfection by-products (dbps) (avşar et al., 2014; avşar et al., 2015; özdemir, 2020). studies on the formation of dbps post-chlorination have shown that more than 700 species are formed in the water. however, in addition to these, there are also undetectable halogenated organic structures and it is clear that the undetectable compounds make up a significant portion of the total (avşar et al., 2014; avşar et al., 2015; özdemir, 2021). given such potentially carcinogenic effects of some dbps, dbp formation is the most important problem of the drinking water sector. toxicological studies also show that dbps can have adverse effects on development and reproduction. the potential health risks of dbps have put pressure on industrialized countries to introduce maximum contaminant levels (mcl), in other words, limits, for types of dbps in drinking water (uyak et al., 2014). haas is one of the important dbp groups and the most prevalent haas are mcaa (monochloroacetic acid), tcaa (trichloroacetic acid), and dcaa (dichloroacetic acid). the sum of mcaa, mbaa (monobromoacetic acid), dcaa, tcaa, and dbaa (dibromochloroacetic acid) is expressed as haa5. haa5 plus bcaa (bromochloroacetic acid), tbaa (tribromoacetic acid), bdcaa (bromodichloroacetic acid) and cdbaa (dibromochloroacetic acid) together makes up haa9. the united states environmental protection agency’s (usepa) integrated risk information system has classified dcaa as a group b2 (probable human carcinogen) and tcaa as a group c (possible human carcinogen) component, and both components have been shown to be carcinogenic in animals (avşar et al., 2014; avşar et al., 2015; thompson et al., 2015). in 1998, because of the possible health risks, the maximum contaminant level of haa5 was set to 60 µg.l−1 by the usepa. in canada, the limit has been set at 80 µg.l−1 since 2008. the world health organization (who) has set up guidelines for chlorinated haas (mcaa: 20 µg.l−1, dcaa: 50 µg.l−1, tcaa: 200 µg.l−1), but not for brominated haas. neither the european union nor türkiye has set a limit value yet. however, the amount of haa9 in bromine-rich waters is 20–50% higher https://www.watersa.net https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://orcid.org/0000-0001-6249-4753 https://orcid.org/0000-0003-2222-1704 302water sa 49(3) 301–310 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4004 than haa5, and it is important to consider haa9 in such waters because brominated species are potentially more carcinogenic than chlorinated species (health canada, 2008; thompson et al., 2015). monitoring haas in the drinking water network is a complex process. various parameters, such as the disinfection plan and chemicals used (chlorine or chlorine/chloramine or ozone/ chlorine), water treatment processes, water source characteristics, bromide content, ph of chlorinated and distributed water, temperature, concentration of total and free chlorine, residence time, distribution system characteristics, and total organic carbon (toc), affect the formation of haas. the formation kinetics, formation and stability of haas are still not completely understood. it is known that haas form faster than thms, that some species decompose as ph increases, and that some species biodegrade in the absence of residual chlorine (uyak et al., 2014; thompson et al., 2015). the formation of haas in chlorinated water varies considerably depending on the season and the length of the distribution system. these variations depend on the quality of the raw and treated water and on the operating parameters of the treatment plant as well. there are studies showing that the concentration of haas tends to first increase and then decrease with extended residence time in the water network (uyak et al., 2014, thompson et al., 2015). because of all these reasons, monitoring seasonal changes in haas in drinking water systems as a function of the length of the distribution system is important for protecting public health and providing healthy drinking water. in a study conducted by uyak et al. (2014), seasonal and spatial variation in haas was observed in drinking water distribution networks fed by 3 different drinking water treatment plants in istanbul. the highest median haa9 concentrations were observed in the spring and summer seasons, while the lowest concentrations were obtained in the autumn and winter periods. dcaa and tcaa were identified as the most significant haa9 components. it was observed that the seasonal average values of haa9 in all three distribution systems remained below 60 µg.l−1, while the haa9 concentration in only one sample was measured to be 100.16 µg.l−1 during the sampling period. according to a study that was conducted in istanbul surface water sources (büyükçekmece and ömerli lakes, between february 2010 and february 2011) by avşar et al. (2014); the most important haa9 formation was caused by hydrophobic (hpo) and hydrophilic (hpi) fractions of nom, respectively. according to avşar et al. (2015), which was conducted for the same water sources as avşar et al. (2014), organic substances with a molecular size below 1 kda were found to be effective in the formation of haa9. uyak et al. (2007) studied terkos, büyükçekmece and ömerli lakes, istanbul, with different bromide and organic matter concentrations, and observed the effect of this difference on dbp formation in terms of contact time, ph, chlorine dose and specific ultraviolet absorbance parameters. the predominant species of haa was tcaa, followed by dcaa, with 60%, 49%, and 66% of total haa in terkos, büyükçekmece, and ömerli, respectively. in the study of ateş et al. (2007), a total of 29 surface waters from different regions of türkiye were sampled seasonally and dbp formation potential was determined. the results showed that dissolved organic carbon (doc) content was low in all water samples and ranged from 0.91 to 4.42 mg.l−1. the ranges of annual average total thm and haa concentrations were 21–189 and 18–149 µg.l−1, respectively. although the amount and distribution of dbps vary by water source and season, chloroform and trichloroacetic acid (tcaa) are the most important species. the lack of a consistent trend in seasonal variations in water bodies suggests that the characteristics of dissolved organic matter (dom) and its reactivity with chlorine vary seasonally in almost all water bodies. chen et al. (2008) investigated the formation potential for thms and haas in a traditional water treatment plant in northern china. the highest concentrations of thms and haas (each almost 500 µg.l−1) were detected in autumn and the lowest in spring (no more than 100 µg.l−1). organic matter and algae were found to be significant dbp precursors. the hydrophobic acid fraction has the highest thm and haa formation potential. algae contribute about 20% to 50% of the total dbp formation potential during an algal bloom. gan et al. (2013) measured dbps from the distribution systems of 10 water treatment plants in 3 provinces in china. the median of thm and haa levels ranged from 0.7–62.7 µg.l−1 and 0.3–81.3 µg.l−1, respectively. chloroform, dcaa and tcaa were the dominant species observed in guangzhou and foshan water, while brominated thms predominated in water from zhuhai. thms and haas showed clear seasonal variations with the total concentrations higher in winter than in summer. ghoochani et al. (2013) examined the variation of organic matter and haa formation through samples collected from 3 major rivers (raw water) and 3 water treatment plant outlets (chlorinated water) supplied by these rivers in tehran, iran. changes in the total organic matter (toc), ultraviolet absorbance (uv254), and specific ultraviolet absorbance (suva) were measured in raw water samples. haas were also measured in chlorinated water samples. the seasonal average concentration of toc for the 3 rivers and haas for the 3 water treatment plants in were 4.00, 2.41 and 4.03 mg.l−1 and 48.75, 43.79 and 51.07 µg.l−1 for spring, summer and autumn, respectively. seasonal variation indicated that haa levels were much higher in spring and autumn, whereas toc concentrations were similarly higher. golea et al. (2017) investigated the effect of dom in thm and haa formation in raw and treated surface waters. dbp formation potential in surface water sources has been studied with reference to the key water quality determinants (wqds) of uv absorption (uv254), colour, and dom concentration. the dom in the raw waters was found to comprise 30–84% (average 66%) of the more reactive hpo fraction, with this proportion falling to 18–63% (average 50%) in the treated water. results suggest uv254 to be as good an indicator of dbpfp as doc or hpo for the raw waters, with values ranging from 0.79 to 0.82 for thms and from 0.71 to 0.73 for haas for these three determinants. for treated waters the corresponding values were significantly lower, reflecting the lower hpo concentration. guilherme et al. (2014) investigated the occurrence of regulated and non-regulated dbps in the drinking water of small systems in 2 provinces in canada. it was reported that average measured concentrations of these compounds was much higher than that reported in the literature for medium and large systems. the measured average value for thms was 75 µg.l−1 and for haas was 77 µg.l−1. investigated dbps decreased between the autumn and winter and then increased to eventually reach a maximum in late summer. rodriguez et al. (2004) investigated the seasonal and spatial variation of post-chlorination dbps in a drinking water distribution system located in a region where very significant seasonal variations in water temperature and surface water quality occur. the analysis of a large number of collected samples showed that the seasonal and geographical variations of thms and haas were of particular importance in this region. thm levels were found to be about 5 times higher on average in summer and autumn than in winter, while average haa levels were about 4 times higher in spring than in winter. 303water sa 49(3) 301–310 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4004 rodriguez et al. (2007) studied haa formation during the treatment process in 2 facilities where surface water is prechlorinated. samples were collected over 1 year at 4 stations in order to investigate both seasonal and spatial variations of haas. the results revealed that the formation of haas was highest during the pre-chlorination process, where precursor compounds and pre-chlorination dose were both higher and more variable, and that formation lasted from the pre-chlorination point until the settled water occurred, due to remaining levels of residual chlorine. it was identified that dcaa was the predominant haa species. to understand water quality variability in small systems, scheili et al. (2015) monitored water quality in 25 small municipal systems in 2 canadian regions from the water source to the end of the distribution system. the database obtained was used to create a global portrait of physical, chemical, and microbiological water quality parameters. it was observed that the values of dom varied during the different seasons, with maxima in autumn for both provinces. in the regions studied, the highest thm and haa values were reached in the warmer seasons (summer, autumn), as observed in previous studies with large systems. observed thm and haa levels were 3 times higher in systems in the province of newfoundland and labrador than in the province of quebec. serodes et al. (2003) chlorinated seasonally treated waters from 3 major drinking water supplies in the quebec city region and studied the formation of thm and haa. they concluded that chloroform was the predominant compound for thm species, while dichloroacetic acid and trichloroacetic acid were the most abundant for dbp species due to low bromide concentrations in the raw waters. significant differences in dbp formation were observed, mainly due to the type of disinfectant used for raw water in the three utilities. the use of pre-ozonation as opposed to pre-chlorination (or direct chlorination) in one of the utilities appears to be the primary factor contributing to that utility’s ability to meet current thm and future haa standards. in this study, haa formation and health risk via ingestion were investigated in 2 networks fed by groundwater and surface water, where the organic matter level is low, when chlorination is not properly utilized (under uncontrolled conditions). haas are of special importance in these networks, since the networks are short and haas are formed faster than other dbps. in addition, no study has been found in the literature evaluating the formation of haa under insufficient chlorination conditions in groundwater with low nom levels. there is also no study apparent in the literature on whether haa formation will pose a risk in low organic content waters under insufficient chlorination conditions. in this study, answers to all these questions were sought. although the formation of haa is important and may pose a risk in türkiye, there is no limit value being applied yet. materials and methods sampling points this study investigated the quality of raw water sources used in muş province city centre, the seasonal and spatial variance of haas formed after chlorination of these sources, and the risk to human health via ingestion. therefore, sampling and analytical studies were conducted on the dates of 20 july 2017 (summer); 26 october 2017 (autumn); 8 january 2018 (winter); and 7 march 2018 (spring) in the city centre of muş province, to characterize the summer, autumn, winter, and spring seasons. figure 1 shows the location of muş, networks and sampling points used in the study. the drinking water network for muş city centre is provided from groundwater extracted by 17 existing boreholes around the main pumping station (point 1 in fig. 1). the water taken through the boreholes is pumped to the tank of the main pumping station, and released to the water network after chlorination via liquid sodium hypochlorite solution (naocl). there is also another small network in the city centre. water from a mountain spring (surface water) is fed to the muratpaşa water tank, chlorinated with naocl, and pumped to the small water network (point 5 in fig. 1). figure 2 shows photographs of the water tanks. the characteristics of water networks and sampling points are shown in table 1. the points in table 1 are arranged in the order relating to the water path between source and water network. it was observed that the water drawn from 17 boreholes in the vicinity of the main pumping station, station 1, reached the main pumping station where it was mixed in the tank, chlorinated, and sent to the reservoir 3 at point 9 and released to the network. seasonal sampling and analyses were conducted at points 2, 9, 7, 10, 4 and 3 of this network. additionally, seasonal sampling figure 1. networks and sampling points in the center of muş province 304water sa 49(3) 301–310 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4004 and analyses were conducted for muratpaşa reservoir, where the mountain spring was located, and at points 6 and 8 of the network supplied from this reservoir. haas from post-chlorination dbps in the reservoirs and water distribution systems of 2 different distribution networks were monitored. the sampling points in both networks are listed in table 1, give in order from the source to the final distribution point. one-time sampling was conducted in the context of 4 different seasons from 2 networks consisting of 10 points in total. water was wasted for at least 1 min in each fountain before sampling. samples were taken in polyethylene sample containers and transferred to the laboratory for further analysis. analytical methods as part of the study, the water quality parameters and postchlorination–formed haa species were measured in 4 seasons in 2 water reservoirs and water networks where the existing water is supplied in the reservoirs in the city centre of muş. the parameters measured, the devices used and the measurement methods of the devices are given in table 2. detailed analytical methods are given in avşar and toröz (2018); avşar et al. (2014); avşar et al. (2015) and avşar et al. (2020). conductivity, ph, orp, free and total chlorine, and turbidity were measured on-site after sampling. than samples were dechlorinated with 0.1 ml of 100 mg.ml−1 na2s solution and transferred to the laboratory for further analysis, given in table 2. haa analysis was conducted according to usepa 552.3 liquidliquid micro-extraction method via a gc equipped with µecd detector. the method consists of sample extraction and methyl ester conversion of haa species. further information about device, method and detection limits is given in avşar and toröz (2018). figure 2. photographs showing the reservoirs where the study was conducted: (a) external view of main pumping station; (b) chlorine dosage pump inside main tank; (c) main water tank inside; (d) muratpaşa water tank table 1. description of sampling points no. name of point type of sample coordinates main reservoir and water network 1 main reservoir raw water (chlorinated) 38.727294; 41.580537 2 main reservoir outlet chlorinated tap water 38.727801; 41.580370 9 muş centre, inner side of reservoir 3 chlorinated tap water 38.736459; 41.496992 7 central restaurant chlorinated tap water 38.740921; 41.496384 4 central atatürk playground chlorinated tap water 38.745588; 41.499400 10 central bus terminal garden chlorinated tap water 38.747446; 41.507699 3 final point of water network chlorinated tap water 38.760184; 41.512072 muratpaşa reservoir and its water network 5 muratpaşa reservoir outlet raw water (chlorinated) 38.731482; 41.482136 6 central kale park chlorinated tap water 38.730002; 41.485636 8 front of central reservoir 3 chlorinated tap water 38.736480; 41.497141 305water sa 49(3) 301–310 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4004 results the research carried out consisted of 2 stages. in the first stage, sampling and analysis were carried out for 2 different networks. in the second stage, according to the haa analysis results obtained in the first stage, risk analysis was conducted to determine whether drinking these waters poses a human health risk. analytical results the water quality parameters for the samples taken from the main reservoir and its network in the 4 seasons are compared with turkish standards (ts 266, 2005: water intended for human consumption) in table 3. minimum, maximum and mean values for the main reservoir are given in table 4. a comparison of seasonal results for muratpaşa water reservoir and its network with turkish standards of is given in table 5. minimum, maximum and mean values of the results for muratpaşa network are given in table 6. haa concentrations recorded in 2 reservoirs and their networks are given in tables 7 and 8. sampling points for both water supplies are listed in the tables in an order that matches the route the water takes in the water network. when the water quality results are examined, it can be seen that chlorination was insufficient in both water sources. free chlorine was detected at the main reservoir outlet (point 2) in 4 seasons (min: 0.2; max: 1.3 and mean: 0.9 mg.l−1). however, in general, free chlorine in the main network is depleted as it goes from reservoir outlet (point 2) to network end-point (point 3). at point 3, no free chlorine was detected in the water during any sampling period (tables 3–4). except for the last point (point 8: min: 0; max: 0.6; mean: 0.2 mg.l−1), no chlorine was found in the network during the sampling period in the muratpaşa reservoir and network (tables 5–6). this is related to frequent power cuts in the city. when the electricity is off, the chlorine dosing system is disabled. the dosing system is not activated automatically when the electricity is re-supplied to the system. manual start-up of the dosing system is required. this prevents sufficient chlorine dosing to the system. toc (min: 0.0021; max: 0.3553; mean: 0.1787 mg.l−1), tn (min: 1.9166; max: 2.4552; mean: 2.2773 mg.l−1) and turbidity (min: 0.10; max: 0.65; mean: 0.27 ntu) values in the main reservoir were generally at low levels. it was observed that the nitrate value (min: 2.00; max: 4.80; mean: 3.55 mg.l−1) remained below the ts 266 limit value throughout the monitoring period. the uv254 parameter (min: 0.002; max: 0.0140; mean: 0.0063 cm−1), which is an indicator of the organic content in the water, is similarly low, along with the toc values. these results indicate that there is no significant pollution of the groundwater, in general. toc (min: 0.1088; max: 0.3052; mean: 0.2070 mg.l−1) and tn values (min: 0.6358; max: 1.0441; mean: 0.8729 mg.l−1) in the muratpaşa reservoir were also low. however, from time to time, the limit value is exceeded in terms of turbidity in the reservoir (max: 4.19 ntu) and network (max: 2.11 ntu). it is thought that this situation is due to the leakages that occur due to the age of the pipelines. the low uv254 values in both networks indicate low organic content in the waters. there was no significant change in conductivity or orp values either. there was no significant change in water quality parameters at the measurement points of both networks. it is thought that the changes at specific measurement points that can be seen in the parameters from time to time are related to the network leakages that occur from time to time at these points. usepa national primary drinking water regulation (1994) states that in order to prevent dbp formation, the toc concentration in the water should be reduced to below 2 mg.l−1 before chlorination. however, although the toc and uv254 parameters in both networks are considerably lower than the values specified in the publications referenced in the introduction, it was determined that the usepa haa5 limit value of 60 µg.l−1 is exceeded (max: 68.87 µg.l−1) in the main network at times. haa9 values reach values of up to 91.54 µg.l−1. in muratpaşa network, the haa5 limit value was not exceeded. however, despite the lack of sufficient chlorine in the water, concentrations close to the limit value (max haa5: 54.95 µg.l−1) were determined, while maximum haa9 concentration was determined as 55.07 µg.l−1. on the other hand, mcaa can occasionally exceed the who limit value of 20 µg.l−1 in both networks. this shows that there is potential for haa formation in the case of adequate chlorination of the water, and that the water includes precursor compounds for dbp formation. table 2. parameters measured, devices and measurement methods utilized parameter device method references toc (total organic carbon) teledyne tekmar torch toc/tn analyzer standard methods 5310-b avşar and toröz, 2018 avşar et al., 2014 avşar et al., 2015 avşar et al., 2020 tn (total nitrogen) standard methods 4500n-b ph/temperature hach hq40d multimeter usepa electrode method 8156 conductivity usepa direct measurement method 8160 orp (oxidation reduction potential) direct measurement method 10228 haas agilent 6890 gc-μecd usepa method 552.3 free chlorine lovibond comparator standard methods 4500 cl-g total chlorine nitrate wtw photolab 7600 uv-vis spectrophotometer standard methods 4500 no3 -b bromide standard methods 4500 br-b alkalinity titrimetric standard methods 2320-b turbidity wtw turb 355 ir iso 7027 – din/en 27 027 uv254 wtw photolab 7600 uv-vis spectrophotometer standard methods 5910-b 306water sa 49(3) 301–310 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4004 table 3. all-season water quality parameters for samples taken at the points determined in the main pumping station and the connected water network parameter ph conductivity orp temp. free chlorine total chlorine alkalinity nitrate bromide turbidity uv254 toc tn unit µs▪cm−1 mv °c mg▪l−1 mg▪l−1 mgcaco3▪l−1 mg▪l−1 mg▪l−1 ntu cm−1 mg▪l−1 mg▪l−1 point 1 1 6.98 285 222 15.8 0 0 135.1 2 <0.1 0.11 0.014 0.3553 1.9166 2 7.58 313 215.7 12.2 0 0 116.04 3.2 0.16 0.10 0.002 <0.05 2.4552 3 7.87 412 415 8.5 0 0 154 4.2 0.37 0.21 0.005 <0.05 2.4267 4 7.75 473 174.2 11.4 0 0 154 4.8 0.44 0.65 0.004 0.002 2.311 point 2 1 7.08 362 561.5 16.1 0.8 0.8 0.56 0.001 0.3791 2.9867 2 7.4 323 325.9 14.3 1.1 1.1 0.45 0.002 <0.05 3.2475 3 7.71 395 528.5 10.2 0.2 0.2 0.02 0.003 0.1824 2.5507 4 7.79 473 670.9 12.2 1.3 1.5 0.83 0.001 <0.05 2.2882 point 9 1 7.41 357 620 20.01 0.9 1.1 0.24 0.027 0.381 2.7268 2 7.16 425 213.1 14.9 0 0 0.63 0.009 <0.05 2.8859 3 7.88 369 184.3 8.4 0 0 0.11 0.001 <0.05 2.6631 4 7.64 346 115.5 12.1 0 0 0.86 0.003 <0.05 2.4572 point 7 1 7.39 356 529.5 17.7 0.2 0.2 0.41 0.004 0.0953 2.6179 2 7.44 382 151.2 14.2 0 0 0.57 0.002 <0.05 2.2629 3 7.82 404 163.7 11.3 0 0 0.11 0 <0.05 1.999 4 7.58 422 231.4 13 0 0 4.34 0.001 <0.05 1.5233 point 4 1 7.05 682 230.5 20.1 0 0 0.18 0.002 0.3975 5.6338 2 7.46 375 135 14.8 0 0 1.43 0.001 <0.05 2.5835 3 7.9 413 211.6 9.9 0 0 0.11 0 0.3376 2.2249 4 7.38 477 180.5 12 0 0 3.86 0.003 0.9574 1.9761 point 10 1 7.28 353 574.9 17.2 0.5 0.7 0.41 0.009 0.3421 2.8497 2 7.34 374 140.6 15.4 0.1 0.1 0.59 0.003 0.2221 3.0244 3 8.23 416 214.2 9.4 0 0 0.27 0.005 0.9126 2.6973 4 7.78 361 194.2 12.3 0 0 1.03 0.009 <0.05 2.4904 point 3 1 7.24 375 368.1 24.9 0 0 0.32 0.007 0.3244 2.9443 2 7.23 754 162.2 17.8 0 0 0.29 0.002 <0.05 7.4393 3 7.87 397 197.4 8.3 0 0 0.04 0.003 0.1005 2.8998 4 8.38 475 178.3 12.2 0 0 0.65 0.001 <0.05 2.3424 ts 266 limits -2005 6.5–9.5 is desirable to be at least 0.2–0.5 mg▪l−1 50 1 1 – summer, 20 july 2017; 2 – autumn, 26 october 2017; 3 – winter, 8 january 2018; 4 – spring, 7 march 2018 table 4. the minimum, maximum and mean values of the all-season water quality parameters of the samples taken at the points determined in the main pumping station and the connected water network parameter ph conductivity orp temp. free chlorine total chlorine alkalinity nitrate bromide turbidity uv254 toc tn unit µs▪cm−1 mv °c mg▪l−1 mg▪l−1 mgcaco3▪l−1 mg▪l−1 mg▪l−1 ntu cm−1 mg▪l−1 mg▪l−1 point 1 min 6.98 285 174.2 8.5 0.0 0.0 116.0 2.00 0.16 0.10 0.002 0.0021 1.9166 max 7.87 473 415.0 15.8 0.0 0.0 154.0 4.80 0.44 0.65 0.0140 0.3553 2.4552 mean 7.55 371 256.7 12.0 0.0 0.0 139.8 3.55 0.32 0.27 0.0063 0.1787 2.2773 point 2 min 7.08 323 325.9 10.2 0.2 0.2 0.02 0.0010 0.0000 2.2882 max 7.79 473 670.9 16.1 1.3 1.5 0.83 0.0030 0.3791 3.2475 mean 7.50 388 521.7 13.2 0.9 0.9 0.46 0.0018 0.1872 2.7683 point 9 min 7.16 346 115.5 8.4 0.0 0.0 0.11 0.0010 0.0000 2.4572 max 7.88 425 620.0 20.0 0.9 1.1 0.86 0.0270 0.3810 2.8859 mean 7.52 374 283.2 13.9 0.2 0.3 0.46 0.0100 0.1905 2.6833 point 7 min 7.39 356 151.2 11.3 0.0 0.0 0.11 0.0000 0.0000 1.5233 max 7.82 422 529.5 17.7 0.2 0.2 4.34 0.0040 0.0953 2.6179 mean 7.56 391 269.0 14.1 0.1 0.1 1.36 0.0018 0.0477 2.1008 point 4 min 7.05 375 135.0 9.9 0.0 0.0 0.11 0.0000 0.3376 1.9761 max 7.90 682 230.5 20.1 0.0 0.0 3.86 0.0030 0.9574 5.6338 mean 7.45 487 189.4 14.2 0.0 0.0 1.39 0.0015 0.5642 3.1046 point 10 min 7.28 353 140.6 9.4 0.0 0.0 0.27 0.0030 0.0000 2.4904 max 8.23 416 574.9 17.2 0.5 0.7 1.03 0.0090 0.9126 3.0244 mean 7.66 376 281.0 13.6 0.2 0.2 0.58 0.0065 0.3692 2.7655 point 3 min 7.23 375 162.2 8.3 0.0 0.0 0.04 0.0010 0.0000 2.3424 max 8.38 754 368.1 24.9 0.0 0.0 0.65 0.0070 0.3244 7.4393 mean 7.68 500 226.5 15.8 0.0 0.0 0.32 0.0033 0.1416 3.9065 307water sa 49(3) 301–310 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4004 table 5. all-season water quality parameters analysis results of the samples taken at the points determined in muratpaşa reservoir and the connected water network parameter ph conductivity orp temp. free chlorine total chlorine alkalinity nitrate bromide turbidity uv254 toc tn unit µs▪cm−1 mv °c mg▪l−1 mg▪l−1 mgcaco3▪l−1 mg▪l−1 mg▪l−1 ntu cm−1 mg▪l−1 mg▪l−1 point 5 1 7.39 323 200.5 21.1 0 0 177.6 1.1 0.12 0.23 0.005 0.3052 0.8554 2 6.82 335 183.6 11.1 0 0 181.796 1.5 0.15 0.28 0.004 <0.05 0.6358 3 7.54 455 249 3.6 0 0 230 2.2 0.4 0.09 0 <0.05 0.9564 4 7.54 433 141.2 10.1 0 0 154 3.4 0.44 4.19 0.002 0.1088 1.0441 point 6 1 7.56 360 180.6 22.7 0 0 0.35 0.014 0.3384 0.8704 2 7.02 327 212.7 14.5 0 0 0.24 0.006 <0.05 0.6658 3 6.26 402 256.3 5 0 0 0.01 0 <0.05 0.8775 4 7.36 353 117.1 8 0 0 2.11 0.006 0.2549 0.9992 point 8 1 7.43 352 596 16.9 0.6 0.8 0.22 0.006 0.4522 2.4642 2 7.13 360 219.8 13.3 0 0 0.75 0.006 <0.05 3.0502 3 8.26 394 158.1 7.2 0 0 0 0.001 <0.05 2.6618 4 7.68 424 115 12 0 0 0.84 0 0 2.3894 ts 266 limits -2005 6.5–9.5 is desirable to be at least 0.2–0.5 mg▪l−1 50 1 1 – summer, 20 july 2017; 2 – autumn, 26 october 2017; 3 – winter, 8 january 2018; 4 – spring, 7 march 2018 table 6. the minimum, maximum and mean values of the all-season water quality parameters of the samples taken at the points determined in the muratpaşa water reservoir and the connected water network parameter ph conductivity orp temperature free chlorine total chlorine alkalinity nitrate bromide turbidity uv254 toc tn unit µs▪cm−1 mv °c mg▪l−1 mg▪l−1 mgcaco3▪l−1 mg▪l−1 mg▪l−1 ntu cm−1 mg▪l−1 mg▪l−1 point 5 min 6.82 323.00 141.2 3.6 0.0 0.0 154.0 1.1 0.12 0.09 0.000 0.1088 0.6358 max 7.54 455.00 249.0 21.1 0.0 0.0 230.0 3.4 0.44 4.19 0.005 0.3052 1.0441 mean 7.32 386.50 193.6 11.5 0.0 0.0 185.8 2.1 0.28 1.20 0.003 0.2070 0.8729 point 6 min 6.26 327.00 117.1 5.0 0.0 0.0 0.01 0.000 0.2549 0.6658 max 7.56 402.00 256.3 22.7 0.0 0.0 2.11 0.014 0.3384 0.9992 mean 7.05 360.50 191.7 12.6 0.0 0.0 0.68 0.007 0.2967 0.8532 point 8 min 7.13 352.00 115.0 7.2 0.0 0.0 0.00 0.000 <0.05 2.3894 max 8.26 424.00 596.0 16.9 0.6 0.8 0.84 0.006 0.4522 3.0502 mean 7.63 382.50 272.2 12.4 0.2 0.2 0.45 0.003 0.2261 2.6414 table 7. all-season haa analyses of samples taken from the points determined in the main pumping station and connected water network parameter mcaa mbaa dcaa bcaa tcaa dbaa bdcaa cdbaa tbaa haa5 haa9 unit µg▪l−1 point 1 1 * 0.59 1.89 2.48 2.48 2 0.49 1.91 2.40 2.40 3 4 point 2 1 39.51 0.75 0.40 40.66 40.66 2 59.68 0.86 3.43 2.34 25.23 63.97 91.54 3 1.86 1.86 1.86 4 point 9 1 44.39 0.66 12.49 0.44 0.20 57.74 58.18 2 0.50 2.38 2.89 2.89 3 4 point 7 1 41.76 0.65 2.77 0.60 0.25 45.43 46.03 2 0.06 1.97 2.04 2.04 3 4 0 point 4 1 64.27 1.34 3.27 13.28 68.87 82.15 2 0.06 2.24 2.30 2.30 3 2.40 1.38 3.79 3.79 4 point 10 1 0.24 1.96 2.20 2.20 2 37.73 0.51 0.59 0.40 39.22 39.22 3 4 point 3 1 40.71 0.74 2.75 0.37 44.56 44.56 2 0.22 2.27 2.49 2.49 3 4 empty cells mean compound or group not detectable (nd) 1 – summer, 20 july 2017; 2 – autumn, 26 october 2017; 3 – winter, 8 january 2018; 4 – spring, 7 march 2018 308water sa 49(3) 301–310 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4004 table 8. all-season haa analyses of samples taken from the points determined in the muratpaşa reservoir and connected water network parameter mcaa mbaa dcaa bcaa tcaa dbaa bdcaa cdbaa tbaa haa5 haa9 unit µg▪l−1 point 5 1 36.28 1.79 2.58 * 40.66 40.66 2 0.05 2.08 2.13 2.13 3 4 point 6 1 41.87 1.77 0.00 0.18 43.83 43.83 2 0.21 2.29 2.50 2.50 3 4 point 8 1 43.66 0.65 10.17 0.12 0.47 54.95 55.07 2 0.26 2.21 2.47 2.47 3 4 empty cells mean compound or group not detectable (nd) 1 – summer, 20 july 2017; 2 – autumn, 26 october 2017; 3 – winter, 8 january 2018; 4 – spring, 7 march 2018 the fact that there is not enough chlorine in the water most of the time made it impossible to make a seasonal assessment of haa formation. in both networks, haa components could not be detected in the water in the winter and spring periods. likewise, although the amount of bromide in both water supplies is highest in the winter and spring periods, the absence of haa detection during these periods makes it impossible to evaluate the effect of bromide on haa formation potential. in both networks, the most important haa component was determined as mcaa. in general, the irregularity of chlorination in the networks prevents the evaluation of the residence time in the both networks. however, considering the summer period in which haa types were detected in both networks, the highest haa5 and haa9 concentrations were determined towards the end in the main network and at the last point in the muratpaşa network. the low bromide level in both water sources limits the formation of brominated haas in the water. brominated species were not detected in water for most of the sampling period. risk assessment despite the lack of sufficient chlorination and the low organic matter content in both networks, it was observed that haa species could form and exceed the limit values from time to time. in this context, the effect of consuming these waters on public health in terms of haa compounds was determined through a risk assessment. the measurement of cancer risk for dbps is performed from 3 perspectives: through oral ingestion, dermal absorption, and inhalation exposure. however, since there are only risk factors for oral ingestion of haa components (dcaa and tcaa) in the literature, it is not possible to perform measurements for dermal absorption and inhalation exposure. the oral ingestion-related risk is calculated using the following equation (gan et al., 2013; avşar et al., 2020): cr = cdi pforal oral× (1) cdi cw ir ef et) bw at)oral � � � � � ( ( (2) where: cr is cancer risk from haa component ingestion; cdioral is chronic daily ingestion of that species (oral: mg.kg−1.day−1); pforal is potential factor or slope factor (oral: mg.kg−1.day−1) among the haas examined in the study, there are pforal values for dcaa and tcaa reported in the literature as 0.05 and 0.07, respectively (gan et al., 2013). the variables in eq. 2 and the values used to calculate them are listed in table 9. given the variables in table 9, the measured risk values for the highest concentrations obtained in 2 different water supplies for dcaa and tcaa are given in table 10. according to the epa, a probability of occurrence of an event of more than 1 in 1 million means that the minimum or negligible risk level for that event has been exceeded (gan et al., 2013; avşar et al. 2020). in this context if the estimated cr is greater than 1 million it indicates a health risk. alternatively, multiple rate (mr) values can be estimated using eq. 3. m c r r = ( )1 106× (3) the risk assessment considered the highest concentrations detected in the network to determine the worst case for the haa compounds that were used as the basis for the assessment. in this context, the risk level related to dcaa in the main network was found to be 18.7 times higher for women and 16.5 times higher for men, based on the components for which a risk assessment was performed. since tcaa is not detectable in the network, there is no risk in relation to this component. in the muratpaşa water network, on the other hand, it was observed that the maximum concentration determined for dcaa exceeds the risk level 15.2-fold for women and 13.4-fold for men. the concentration determined in relation to tcaa does not pose a risk for men or women. however, since it was found that the level of free chlorine in the network does not meet the required level, it should be noted that there may be an increase in the risk level if there is adequate chlorination in the supplies. the risk assessment, therefore, should be repeated using values obtained after adequate chlorination in the system. quantitative differences in the variables underlying the calculation for men and women lead to different results, so that the risk values calculated for women are higher at the same concentration. conclusions and recommendations in the study, seasonal changes in water quality parameters in 2 water sources and connected water supplies in muş city center, and haa formation as a result of chlorination, were monitored. both water supplies have undergone many revisions since their construction, but it was not possible to obtain a plan or project on which these revisions were plotted. the networks need to be 309water sa 49(3) 301–310 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4004 table 9. values based on risk assessment variable description unit accepted value in this study reference cw concentration of chemical (haa component) in water mg▪l−1 the highest concentrations measured for the species in 2 different networks to calculate the maximum risk gan et al., 2013 ir ingestion rate l▪day−1 2 gan et al., 2013 ef exposure frequency day▪yr−1 365 gan et al., 2013 et exposure time yr according to tsi statistics for the period of 2014–2016, life expectancy at birth in turkey is generally 78 years, with an average of 75.3 years for men and 80.7 years for women. tsi 2018 bw body weight kg according to tuik 2010 data, the average weight in türkiye was determined as 71.5 kg. while the average weight was 75.8 kg for men, it was determined as 66.9 kg for women. tsi 2010 at average time day average life expectancy expressed in days tsi 2018 table 10. risk assessment results network contaminant dbp concentration (mg▪l−1) cr for women mr for women cr for men mr for men main network dcaa 12.48532 x 10−3 1.8674 x 10−5 18.7 1.647135 x 10−5 16.5 tcaa muratpaşa network dcaa 10.17277 x 10−3 1.52057 x 10−5 15.2 1.342205 x 10−5 13.4 tcaa 0.18424 x 10−3 3.85549 x 10−7 0.4 3.40284 x 10−7 0.3 observable and controllable for the distribution of healthy water. therefore, a sound network plan should be created, first and foremost. the first phase of the study consisted of water quality analyses. chlorine, turbidity, ph, temperature, alkalinity, toc, tn, ammonia, bromide, uv254, conductivity and orp parameters were measured. it was found that several quality parameters can sometimes be outside the limit range given in ts 266. during the monitoring period, adequate and necessary chlorination was not performed in both water supplies. in this context, the chlorination process carried out by the muş municipality in the reservoirs and in the network should be monitored regularly. in addition, due to the frequent power outages, it would be beneficial to support the chlorination plant with a generator. it was observed that the ph falls below 6.5 in winter at point 6 of the muratpaşa network. this is believed to be a local problem that does not affect the entire network, and it would be beneficial to periodically review the network to identify such local problems and develop solutions. turbidity levels exceeded the limit at some locations in both supplies and in the muratpaşa reservoir, especially in the spring season. the high turbidity value in the muratpaşa reservoir indicates that the residence time is not sufficient to allow for solids to settle out or that the reservoir is contaminated or not sufficiently cleaned. in the second phase of the work, seasonal and spatial monitoring for haas in the network was conducted. however, since no chlorine was detected in the water most of the time during the study period, it was not possible to obtain sufficient data to determine the haa formation potential in the water or the spatial variation. in this case, it will be useful to determine the haa formation potential in the laboratory by taking raw water from both reservoirs on a seasonal basis. given the obtained haa measurements, it was noted that: • the haa5 concentration in the central network exceeds the limit from time to time, while the limit is not exceeded in muratpaşa, but haa5 levels may exceed the limits if the necessary chlorination is carried out in both waters. • the limits for mcaa given by the world health organization are exceeded from time to time. • currently, there appears to be a potential risk to women and men from both supplies with respect to the dcaa component via ingestion. acknowledgment we would like to thank bitlis eren university scientific research projects (bebap) for providing resources for the performance of our experimental studies with its support in the project numbered 2017.07. author contributions ea (associate professor) wrote the manuscript, conducted all the experiments and visited facilities. ak (msd student) wrote the manuscript and conducted the experiments. orcids edip avşar https://orcid.org/0000-0001-6249-4753 adile kılıç https://orcid.org/0000-0003-2222-1704 references ateş n, kaplan ş, şahi̇nkaya e, yeti̇ş ü, di̇lek fb and ki̇ti̇ş m (2007) occurrence of disinfection by-products in low doc surface waters in turkey. j. hazardous mater. 142 526–534. https://doi.org/10.1016/j.jhazmat.2006.08.076 https://orcid.org/0000-0001-6249-4753 https://orcid.org/0000-0003-2222-1704 https://doi.org/10.1016/j.jhazmat.2006.08.076 310water sa 49(3) 301–310 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4004 avşar e, toröz i̇, hanedar a and yilmaz m (2014) chemical characterization of natural organic matter and determination of disinfection by-product formation potentials. istanbul ömerli and büyükçekmece surface waters case study. fresenius environ. bull. 23 (2a) 494–501. avşar e, toroz i and hanedar a (2015) physical characterisation of natural organic matter and determination of disinfection by product formation potentials in i̇stanbul surface waters. fresenius environ. bull. 24 (9) 2773–2770. avşar e, deni̇z avşar d and hayta ş (2020) evaluation of disinfection by-product (dbp) formation and fingerprint in a swimming pool in bitlis/turkey: a case study. environ. forensics 21 (3–4) 375–385. https://doi.org/10.1080/15275922.2020.1772413 avşar e and toröz i̇ (2018) seasonal determination and investigation of disinfection by product formation potentials (dbpfps) of surface waters, i̇stanbul ömerli and büyükçekmece case study. anadolu univ. j. sci. technol. b – theor. sci. 6 (1) 22–35. https://doi. org/10.20290/aubtdb.333707 chen c, zhang xj, zhu lx, li̇u j, he wj and han hd (2008) disinfection by-products and their precursors in a water treatment plant in north china: seasonal changes and fraction analysis. sci. total environ. 397 140–147. https://doi.org/10.1016/j. scitotenv.2008.02.032 gan w, guo w, mo j, he y, li̇u y, li̇u w, li̇ang y and yang x (2013) the occurrence of disinfection by-products in municipal drinking water in china’s pearl river delta and a multi pathway cancer risk assessment. sci. total environ. 447 108–115. https://doi.org/10.1016/j.scitotenv.2012.12.091 ghoochani̇ m, rastkari̇ n, nodehi̇ rn, mahvi̇ ah, nasseri̇ s and nazmara s (2013) study on the toc concentration in raw water and haas in tehran’s water treatment plant outlet. j. environ. health sci. eng. 11 (28) 1–6. http://doi. org/10.1186/2052-336x-11-28 golea dm, upton a, jarvi̇s p, moore g, sutherland s, parsons sa and judd sj (2017) thm and haa formation from nom in raw and treated surface waters. water res. 112  226–235. https://doi.org/10.1016/j.watres.2017.01.051 gui̇lherme s and rodri̇guez mj (2014) occurrence of regulated and non-regulated disinfection by-products in small drinking water systems. chemosphere 117 425–432. https://doi.org/ 10.1016/j.chemosphere.2014.08.002 health canada (2008) guidelines for canadian drinking water quality: guideline technical document haloacetic acids. water, air and climate change bureau, healthy environments and consumer safety branch, health canada, ottawa, ontario. özdemi̇r k (2021) investigation of trihalomethane formation after chlorine dioxide preoxidation followed by chlorination of natural organic matter. environ. protect. eng. 47 (2) 125–137. https://doi. org/10.37190/epe210209 özdemi̇r k (2020) chlorine and chlorine dioxide oxidation of natural organic matter in water treatment plants. environ. protect. eng. 46 (4) 87–97. https://doi.org/10.37190/epe200407 rodri̇guez mj, serodes jb and levalloi̇s p (2004) behavior of trihalomethanes and haloacetic acids in a drinking water distribution system. water res. 38 4367–4382. https://doi.org/10. 1016/j.watres.2004.08.018 rodri̇guez mj, serodes j and roy d (2007) formation and fate of haloaceticacids (haas) with in the water treatment plant. water res. 41 4222–4232. https://doi.org/10.1016/j.watres. 2007.05.048 schei̇li̇ a, rodri̇guez mj and sadi̇q r (2015) seasonal and spatial variations of source and drinking water quality in small municipal systems of two canadian regions. sci. total environ. 508 514–524. https://doi.org/10.1016/j.scitotenv.2014.11.069 serodes jb, rodri̇guez mj, li̇ h and bouchard c (2003) occurrence of thms and haas in experimental chlorinated waters of the quebec city area (canada). chemosphere 51 253–263. https:// doi.org/10.1016/s0045-6535(02)00840-8 thompson kc, gillespie s and goslan eh (2015) disinfection by-products in drinking water. royal society of chemistry, cambridge. 368 pp. https://doi.org/10.1039/9781782622710 turkish statistical institute (2010) height and weight statistics. url: http://www.milliyet.com/ (accessed 7 march 2018). turkish statistical institute (2018) life tables 2014-2016. url: http://www.tuik.gov.tr/ (accessed 7 march 2018). usepa (united states environmental protection agency) (1994) national primary drinking water regulations; disinfectants and disinfection byproducts; proposed rule. fed. reg. 59:145:38668. (july 29, 1994). uyak v, özdemi̇r k and toröz i̇ (2007) multiple linear regression modeling of disinfection by-products formation in istanbul drinking water reservoirs. sci. total environ. 378 269–280. https://doi.org/10.1016/j.scitotenv.2007.02.041 uyak v, soylu s, topal t, karapinar n, özdemi̇r k, ozaydin s and avşar e (2014) spatial and seasonal variations of disinfection by products (dbps) in drinking water distribution systems of istanbul city, turkey. environ. forensics 15 (2) 190–205. https://doi.org/10.1080/15275922.2014.890145 https://doi.org/10.1080/15275922.2020.1772413 https://doi.org/10.20290/aubtdb.333707 https://doi.org/10.20290/aubtdb.333707 https://doi.org/10.1016/j.scitotenv.2008.02.032 https://doi.org/10.1016/j.scitotenv.2008.02.032 https://doi.org/10.1016/j.scitotenv.2012.12.091 http://doi.org/10.1186/2052-336x-11-28 http://doi.org/10.1186/2052-336x-11-28 https://doi.org/10.1016/j.watres.2017.01.051 https://doi.org/10.1016/j.chemosphere.2014.08.002 https://doi.org/10.1016/j.chemosphere.2014.08.002 https://doi.org/10.37190/epe210209 https://doi.org/10.37190/epe210209 https://doi.org/10.37190/epe200407 https://doi.org/10.1016/j.watres.2004.08.018 https://doi.org/10.1016/j.watres.2004.08.018 https://doi.org/10.1016/j.watres.2007.05.048 https://doi.org/10.1016/j.watres.2007.05.048 https://doi.org/10.1016/j.scitotenv.2014.11.069 https://doi.org/10.1016/s0045-6535(02)00840-8 https://doi.org/10.1016/s0045-6535(02)00840-8 https://doi.org/10.1039/9781782622710 http://www.milliyet.com/ http://www.tuik.gov.tr/ https://doi.org/10.1016/j.scitotenv.2007.02.041 https://doi.org/10.1080/15275922.2014.890145 water sa 49(3) 282–290 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4008 research paper issn (online) 1816-7950 available on website https://www.watersa.net 282 correspondence glynn k pindihama email gpindihama@gmail.com dates received: 30 july 2022 accepted: 30 june 2023 key words brassica oleracea combined effects sodium-dodecyl-sulfonate metals solanum tuberosum copyright © the author(s) published under a creative commons attribution 4.0 international licence (cc by 4.0) the hyper-eutrophic conditions in impoundments used for irrigation around south africa’s major cities promote the co-existence of linear alkylbenzene sulfonate (las) and other pollutants such as metals. the combined effects of las and metals, when such water is used to irrigate crops, has not been properly investigated in light of human health risks and prevailing local conditions. to understand the potential risks, pot-culture experiments were conducted to assess the effect of the las, sodium-dodecyl-sulfonate (sds), on the accumulation of aluminum (al), manganese (mn) and strontium (sr) in brassica oleracea (cabbage) and solanum tuberosum (potato) plants. the plants were watered with dam water containing 3.48 mg·l−1 of the las (sodium dodecyl sulfonate) and mn (0.257 mg·l−1), al (0.6 mg·l−1) and sr (0.16 mg·l−1) as determined by field surveys, for 20 days. the presence of sds in the irrigation water at environmentally relevant concentrations did not enhance uptake of sr, mn, al in the two plants, as demonstrated by statistically insignificant differences in the means of the treatments (with and without sds). in addition, the presence of the metals, high ph, ec and presence of cyanotoxins in the water did not affect total chlorophyll and growth of the plants. these findings imply that the prevailing levels of anionic surfactants such as sds, metals and other contaminants in the hyper-eutrophic reservoirs pose little risk to crop yields, quality of crops and human health, due to the possible accumulation of these contaminants in irrigated plants. despite the study reporting no immediate inherent risk to the plants and human health, continuous monitoring of the contaminants in water, soil and irrigated plants is recommended since the conditions, concentrations and other factors can quickly change if the management of the catchment does not improve in the near future. the effect of the linear alkylbenzene sulfonate, sodium-dodecyl-sulfonate (sds), on the bioaccumulation of al, sr and mn by brassica oleracea and solanum tuberosum glynn k pindihama1 and mugera w gitari1,2 1environmental remediation and nano sciences research group, department of geography & environmental sciences, faculty of science, engineering and agriculture, university of venda, south africa 2department of chemical sciences and technology, school of chemistry and material sciences, technical university of kenya, nairobi, kenya introduction south africa is known for having scarce and extremely limited water resources and depends mainly on surface water for its urban, industrial and irrigation requirements. metal contaminants in soil have the ability to migrate and accumulate (sulaiman and hamzah, 2018). the accumulation of metal contaminants in soil is of concern, since these can affect the well-being of plants, animals, and humans. in plants, increased levels of metals can induce oxidative stress and also hinder the plants’ ability to produce chlorophyll (sulaiman and hamzah, 2018). linear alkylbenzene sulfonates (las) belong to a group of anionic surfactants commonly used in domestic and industrial processes (wang et al., 2015). anionic surfactants, in particular, are a common ingredient in detergents due to their simple synthesis and low cost (pierattini et al., 2018). las find their way into the aquatic environment through the discharge of untreated and treated wastewater. las elimination in the aquatic environment is via adsorption and biodegradation, but their degradation is very slow in anaerobic and anoxic environments and this leads to their accumulation under such conditions in water (wang et al., 2012). this makes hypereutrophic lakes and reservoirs ideal environments for the co-existence of toxic cyanobacteria, las and other pollutants, since the excessive growth of cyanobacteria in eutrophic lakes consumes oxygen and their eventual death and degradation makes water bodies anoxic and anaerobic. previous studies have looked into the synergic impacts of las with other contaminants such as metal pollutants, pyrene and oil (wang et al., 2012). in south africa (sa), dams like the roodeplaat and hartbeespoort, which are found in the gauteng and north west provinces, respectively, are renowned as hyper-eutrophic and having poor water quality (pindihama and gitari, 2020). the co-existence of las and other pollutants such as microcystins (mcs) and metals thus require examination, since water derived from these dams is mainly used for irrigation. the aim of this study was to assess the effect of the las, sodiumdodecyl-sulfonate (sds), on the accumulation of the metals aluminum (al), manganese (mn) and strontium (sr) in brassica oleracea (cabbage) and solanum tuberosum (potato) plants when exposed to environmentally relevant concentrations of the pollutants. materials and methods materials and reagents a field survey was conducted in june 2019 and september 2019 to identify and collect field water suitable for the experiments. the water was collected from canals and farm dams from the two sites: https://www.watersa.net https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://orcid.org/0000-0001-5537-7591 https://orcid.org/0000-0002-6387-0682 283water sa 49(3) 282–290 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4008 roodeplaat dam and hartbeespoort dam. total dissolved solids (tds), electrical conductivity (ec), ph and turbidity of the water were monitored in-situ, and anionic surfactants, chlorophyll a, microcystins (mcs) and cations were measured ex-situ. the water was kept frozen at −20°c until required. the las used in this study was sodium dodecylbenzene sulfonate (sds) (cas no. 25155-30-0; molar mass 348.48 g.mol−1; and chemical formula c18h29nao3s, acquired from bymaz pty ltd, johannesburg, south africa). pot-culture experimental design the brassica oleracea seeds were purchased from ntk agricultural products & services (sa) and the solanum tuberosum seeds were purchased from livingseeds heirloom seeds (pty) ltd midvaal, gauteng. all the s. tuberosum seeds were first washed with distilled water before being planted in 200  mm plant pots filled with uncontaminated soil. the b. oleracea seedlings were produced and pre-grown in plastic trays with uncontaminated soil. the soil used in this study was collected from the agricultural farm at the university of venda. the farm lies within the lowveld climatic zone and has well-drained deep red soils mostly dominated by clay; the soil falls in the hutton classification which is the same as the rhodic ferralsol (mabasa, 2019). the background levels of metal elements in the soil used in the pots are presented in table 1. the metal elements in the soils were extracted and determined as described in the section on ‘digestion of plant and soil samples’. with regards to the three main nutrients, p, k, total n and organic matter, the soils were analysed at the south african agricultural research council. the organic carbon was analysed using the walkley-black method, p was extracted using the isfei method as described by manson and roberts (2001) and the extract was determined via the molybdenum method using an auto-analyser. exchangeable and soluble k was extracted using the procedure described by manson and roberts (2001) and the k in the leachate was determined by atomic absorption spectrophotometry. total n in the soil was determined using the wet oxidation procedure, commonly known as the kjeldahl distillation, as described by manson and roberts (2001). p, k, total n and organic matter in the soils were 25.86 mg.kg−1; 184 mg.kg−1; 0.079% and 2.07%, respectively, which are typical of agricultural soils (fao, 2015). the soil was collected from a depth of 0–50 cm, and approximately 15 kg of the soil was placed into 200 mm plastic pots for the experiments and treated with 6 g of protek general fertilizer with n:p:k (%) 2:3:2 (14) before introducing the plants. to investigate the effect of the las sodium-dodecyl-sulfonate (sds) on metal (mn, al and sr) accumulation in b. oleracea and s. tuberosum, plants were watered daily with roodeplaat dam water containing 3.4 mg.l−1 of sds (as determined by the field study), a known concentration of microcystins (± 15 µg.l−1), and fixed levels of mn (0.257 mg.l−1), al (0.6 mg.l−1) and sr (0.16 mg.l−1) as established from the field study (table 3) for 20 days. during the field surveys irrigation water from the roodeplaat dam was monitored twice over a 4-month period to determine levels of a range of metallic elements (table 3). three elements, al, mn and sr, were consistently detected, and the highest concentrations reported for the three elements were applied in order to investigate the worst-case scenario. the experimental design showing the 4 treatments the plants were exposed to is presented in table 2. treatment 1 consisted of milli-q water (without any contaminants). treatment 2 was raw dam water with the metals under investigation but without sds. treatment 3 consisted of milli-q water and sds (refreshed daily) but without the metals. treatment 4 was raw dam water with the metals and sds (refreshed daily to maintain constant sds levels). in order to maintain approximately constant concentrations of the sds, the media were tested daily using a hanna hi96769 anionic surfactants portable photometer, and refreshed accordingly. the accumulation of metals was determined in b. oleracea after 5 days and again after 20 days. metal accumulation in s. tuberosum was determined only after 20 days. the total chlorophyll was determined in leaves of both plants at day 20. table 1. background level of cations in the soil (n = 3) element background level (mg·kg−1) element background level (mg·kg−1) b <280 sn 0.09 ± 0.01 v 9.14 ± 12.91 sb <1 cr 56.01 ± 33.40 ba 72.48 ± 2.53 mn 1 709.85 ± 160.28 hg 0.01 ± 0.01 co 60.40 ± 18.85 pb 11.53 ± 1.69 ni 27.67 ± 9.63 al 14 060.00 ± 1 798.88 cu 126.28 ± 48.07 fe 33 286.00 ± 31 726.47 zn 46.97 ± 1.75 ca 1 877.10 ± 196.43 as 0.79 ± 0.26 k 424.50 ± 129.68 se 0.09 ± 0.02 mg 985.30 ± 43.70 sr 9.83 ± 2.08 na 290.60 ± 12.16 mo <3 p 168.30 ± 0.00 cd 0.06 ± 0.01 si 558.00 ± 94.47 table 2. design of the experiment and sampling intervals treatment description treatment 1 (t1) control: milli-q water with no contaminants treatment 2 (t2) raw dam water with mn (0.257 mg.l−1), al (0.6 mg.l−1) and sr (0.16 mg.l−1) treatment 3 (t3) milli-q water with 3.4 mg.l−1 sds treatment 4 (t4) combined exposure: raw dam water, sds (3.4 mg.l−1) + spiked with mn (0.257 mg.l−1), al (0.6 mg.l−1) and sr (0.16 mg.l−1) 284water sa 49(3) 282–290 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4008 determination of total chlorophyll reactive oxygen species (ros) generation in a stress environment in plants causes changes in chlorophyll, anthocyanin and membrane integrity, among other effects; therefore, ros generation can be measured indirectly by measuring the changes in these compounds (venkidasamy et al., 2019). chlorophyll content was measured according to baskar et al. (2015). in brief, 50 mg of the plant leaves was sliced into small pieces and soaked in 95% (v/v) ethanol and then incubated for 3 days in the dark. the absorbance of the supernatant was read at 664.2 and 648.6 nm by uvvis spectrophotometer (spectrostar nano, bmg labtech, germany). chlorophyll a and b and total chlorophyll content were calculated according to baskar et al. (2015) using the following formulae: chl a = 13.36 a664.2 − 5.19 a648.6 (1) chl b = 27.43 a648.6 − 8.12 a664.2 (2) total chlorophyll = chl a + chl b (3) total chlorophyll content was expressed as milligram per gram of fresh matter (fm). digestion of plant and soil samples both soil and plant samples were digested according to rashid et al. (2016). in brief, soil samples were dried for 24 h at 60°c in an oven then ground into a fine powder using a mortar and pestle. the ground soil samples (5 g) were then transferred into a 250 ml conical flask, and 10 ml of aqua regia (hcl:hno3 (3:1)) was added. a hot plate was used to digest the samples at 95°c for 1 h; then left to cool to room temperature. the samples were diluted with deionized water and the supernatant filtered through macherey-nagel no.1 filter paper (0.45  μm), macherey-nagel, germany, before analysis with icp-ms. the edible parts of the plants (leaves for b. oleracea and tubers for s. tuberosum) were first freeze dried for 48 h at −54°c under a constant vacuum of 44  μmhg (telstar lyoquest freeze dryer, terrassa, spain). the freeze-dried material was ground to powder using mortar and pestle, and 1 g of the ground material was mixed with 10 ml of hno3 and allowed to stand overnight before being digested on a hot plate until the solution was semidry. the mixture was cooled and filtered through machereynagel no. 1 filter paper (0.45  μm), macherey-nagel, germany, and then diluted with deionized water to the mark in a 50  ml volumetric flask and then sent to the stellenbosch university central analytical facility for inductively coupled plasma mass spectrometry (icp-ms) analysis. determination of cyanobacterial biomass and microcystins to determine chlorophyll a levels, hot ethanol extraction followed by spectrophotometric analysis of absorbency wavelength on a spectro-star nano (bmg labtech, 601-1106, germany) according to lawton et al. (1999) was used. briefly, absorbency was monitored at 665 and 750  nm wavelengths and second readings were taken upon acidifying the same samples with 10  µl of hydrochloric acid (1  mol.l−1) at the same wavelengths to correct for turbidity. the corrected absorbance and turbidity at 750  nm was subtracted from 665  nm absorbance before and after addition of hydrochloric acid. the total chlorophyll a was determined according to the following formula provided by lawton et al. (1999): correction for turbidity: absorbance 665a −750a = corrected 665a absorbance (4) 665b − 750b = corrected 665b absorbance (5) chlorophyll mg mve vs a a b i � �� � � �29 62 665 665 3. ( ) (6) where: ve = volume of ethanol extract (ml); vs = volume of water sample (l); i = path length of cuvette (cm) levels of microcystins (mcs) in the roodeplaat dam water used were determined using the commercially available enzyme-linked immunosorbent assay (elisa) microcystin plate kits (envirologix inc. (kit lot: 071499 cat no: ep 022)). this assay uses antibodies against microcystins and a microplate reader spectro-star nano (bmg labtech, 601-1106, germany) was used to quantify the mcs after the assay. prior to analysis, 5  ml of each sample was filtered using the 0.20  µm glass fibre syringe filters and 50  µl of the filtered sample was used for the assay. data analyses to compare the levels of accumulated cations and the total chlorophyll of the various plant treatments, analysis of variance (anova) and/or kruskal–wallis tests were used at p < 0.05 using graphpad instat 3 (graphpad software, california, united states). levels of cations are presented by their means ± the standard deviation (sd). kolmogorov–smirnov and bartlett tests were used to test for normality and variance homogeneity at p ≤ 0.05. data which passed this test were compared using anova and data which did not pass that test was compared using the kruskal–wallis at p < 0.05. the tukey–kramer multiple comparisons test and the dunn’s multiple comparisons test were used as post-hoc assays for data which passed the normality tests and data which did not pass the normality test, respectively. results physicochemical parameters of the dam water dam water used to water the plants was alkaline, with mean ph of 9.02 (± 0.29), high ec and tds levels (380 ± 16.52 µs.cm−1 and 228 ± 7.51 mg.l−1, respectively). the water also had a high cyanobacterial biomass (chlorophyll a 440.24 ± 328.147 μg.l−1) and high mc levels (13.03 ± 3.599 µg.l−1). the ph of the dam water used for irrigation was above the 6.5–8.4 threshold for water intended for irrigation in sa (dwaf, 1996). even though the ec of the dam water was quite high, it was within the sa (dwaf, 1996) and food and agriculture organization (fao) (1985) (ayers and westcot, 1985) limits for irrigation water of ≤ 400 μs.cm−1 and 700 μs.cm−1, respectively. the levels of anionic surfactants in the water ranged from 0.13 to 3.4 mg.l−1. table 3 shows the levels of cations in the raw dam water. all the cations in the dam water were within the sa (dwaf, 1996) and fao (1985) guidelines for irrigation water. metals such as sr, mn and al were detected at significant levels in the dam water; hence their selection for the pot culture experiments. accumulation of al, sr, mn and other cations by b. oleracea in the presence of sds findings from the pot-culture experiments in table 4 show that upon 20 days of exposure to the various treatments, the b. oleracea leaves accumulated mn to a maximum of 69.79 (± 22.97) µg.kg−1 (treatment 2) and a minimum of 57.69 (± 12.52) µg.kg−1 (treatment 1). sr was accumulated up to 127.98 (± 26.60) µg.kg−1 (treatment 3), with a lowest accumulation of 126.22 (±28.26) µg.kg−1 (treatment 2). the highest levels of al were accumulated in treatment 1 at 0.18 (± 0.04) mg.kg−1, and the lowest levels were accumulated in treatments 3 and 4, at 0.15 (± 0.04) mg.kg−1. the findings indicate no significant differences in the accumulated 285water sa 49(3) 282–290 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4008 levels of mn, sr and al in b. oleracea leaves after 5 days of exposure and after 20 days of exposure (anova, p ≥ 0.05) (fig. 1). a comparison of the accumulated metals among the 4 treatments presented in fig. 2 and table 4 shows that no significant differences were observed among the treatments for sr and mn (p > 0.05). significantly higher levels of al were accumulated in plants exposed to treatment 2 (t2, dam water containing the three metals) compared to the other treatments (p < 0.05). this implies that accumulation of al in b. oleracea was not affected by the presence of the sds in treatment 3 and combined exposure of metals and sds in treatment 4. with regards to the 19 other major and trace cations also assessed in table 4, only cr, co, mg and p showed a significant difference in the levels accumulated among the 4 treatments (p < 0.05). for co, cr and p, much higher levels were accumulated in plants exposed to treatment 1 compared to the other treatments, and for na, plants exposed to treatment 2 accumulated higher levels of the cation. table 3. metals in the roodeplaat dam raw water used in the experiments (mean ± sd, n = 6) metal (mg·l−1) june 2019 september 2019 sa guidelines (dwaf, 1996) fao guidelines (ayers and westcot, 1985) al 0.376 (± 0.817) 0.624 (± 0.726) 5–20 5.0 as 0.002 (± 0.001) 0.001 (± 0.000) 0.1–2.0 0.1 b 0.059 (± 0.008) 0.068 (± 0.005) 0.5–6.0 0.7 ba 0.049 (± 0.015) 0.152 (± 0.056) − − cu 0.006 (± 0.003) 0.006 (± 0.007) 0.2–0.5 0.2 mn 0.257 (± 0.179) 0.158 (± 0.109) 0.02–10 0.2 ni 0.006 (± 0.003) 0.008 (± 0.003) 0.2–2.0 0.2 pb 0.004 (± 0.004) 0.001 (± 0.001) 0.2–2.0 5.0 sr 0.144 (± 0.116) 0.118 (± 0.020) − − zn 0.083 (± 0.080) 0.090 (± 0.033) 1.0–5.0 2.0 note: the 1996 south african and the 1985 fao guidelines do not have a value for barium (ba) and strontium (sr) figure 1. comparison of accumulation of metals in cabbage (brassica oleracea) leaves after 5 days vs 20 days of exposure to the various treatments (n = 6): (a) sr, (b) mn, (c) al 286water sa 49(3) 282–290 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4008 figure 2. accumulation of metals in cabbage (brassica oleracea) leaves after 20 days of exposure to the various treatments (n = 6): (a) sr, (b) mn, (c) al. note: different lowercase letters indicate a significant difference between treatments (p < 0.05). table 4. cations accumulated in b. oleracea leaves upon 20-day exposure to the 4 treatments. data labeled with different small letters (a–c) differed significantly at p < 0.05 in each row (mean ±sd, n = 6). t1 = control (milli-q water); t2 = roodeplaat dam water (mn 0.257 mg.l−1, al 0.6 mg.l−1, sr 0.16 mg.l−1); t3 = milli-q water with 3.4 mg l−1 sds; t4 = roodeplaat dam water (sds 3.4 mg.l−1, mn 0.257 mg.l−1, al 0.6 mg.l−1, sr 0.16 mg.l−1) category element t1: control t2: roodeplaat dam water t3: milli-q water with sds t4: roodeplaat dam water with sds significance minor cations (µg.kg−1) b 32.42 (± 7.01) 26.47 (± 4.67) 25.84 (± 4.15) 26.21 (± 5.24) n.s v 1.00 (± 0.40) 0.63 (± 0.22) 0.59 (± 0.29) 0.60 (± 0.27) n.s cr 3.80 (± 0.36)a 3.44 (± 0.28)a,b 3.43 (± 0.19)a,b 3.39 (± 0.21)b * mn 57.69 (± 12.52) 69.79 (± 22.97) 57.76 (± 14.86) 60.16 (± 21.10) n.s co 0.67 (± 0.11)a 0.62 (± 0.12)a,b 0.51 (± 0.11)a,b 0.53 (± 0.12)b * ni 2.17 (± 0.29) 1.87 (± 0.10) 2.20 (± 0.76) 2.13 (± 0.71) n.s cu 3.75 (± 0.89) 3.80 (± 0.61) 4.08 (± 0.51) 3.92 (± 0.57) n.s zn 45.77 (± 14.41) 43.23 (± 11.49) 38.90 (± 10.87) 39.14 (± 10.94) n.s as 0.05 (± 0.01) 0.14 (± 0.17) 0.26 (± 0.56) 0.25 (± 0.51) n.s se 0.56 (± 0.11) 0.76 (± 0.15) 0.73 (± 0.10) 0.71 (± 0.10) n.s sr 127.10 (± 31.70) 126.22 (± 28.26) 127.98 (± 26.60) 127.48 (± 27.64) n.s mo 2.83 (± 0.98) 1.57 (± 1.38) 1.70 (± 1.62) 1.75 (± 1.59) n.s ba 104.41 (± 23.00) 100.90 (± 29.52) 105.14 (± 30.32) 103.41 (± 30.75) n.s pb 0.20 (± 0.04) 0.19 (± 0.04) 0.21 (± 0.06) 0.19 (± 0.06) n.s major cations (mg.kg−1) al 0.18 (± 0.04)a,b 0.17 (± 0.04)a 0.15 (± 0.04)b 0.15 (± 0.04)b *** fe 0.30 (± 0.11) 0.20 (± 0.07) 0.20 (± 0.09) 0.19 (± 0.09) n.s ca 35.94 (± 10.11) 33.72 (± 10.38) 33.63 (± 8.31) 32.79 (± 9.23) n.s k 19.11 (± 3.13) 16.52 (± 4.79) 16.86 (± 4.76) 17.11 (± 4.11) n.s mg 6.31 (± 1.64) 5.83 (± 1.38) 5.69 (± 1.06) 5.70 (± 1.11) n.s na 0.28 (± 0.10)b 0.41 (± 0.18)a 0.36 (± 0.17)b 0.37 (± 0.16)a,b ** p 3.81 (± 1.45)a 2.74 (± 0.91)b 2.66 (± 0.93)b 2.65 (± 0.94)b * si 1.39 (± 2.96) 0.04 (± 0.01) 0.04 (± 0.01) 0.04 (± 0.01) n.s note: *p < 0.05, **p <0.01, ***p < 0.001, n.s = not significant. accumulation of al, sr, mn and other cations by s. tuberosum in the presence of sds table 5 and figure 3 shows the accumulation of the metals in the s. tuberosum tubers. higher levels of mn were accumulated for treatment 3 (17.34 ± 4.93 µg.kg−1) and lowest levels for treatment 1 (11.07 ± 2.85 µg.kg−1). for sr, higher accumulation was also for treatment 3 (4.73 ± 0.91 µg.kg−1) and lowest for treatment 1 (2.93 ± 0.38 µg.kg−1). accumulation of al was highest for treatment 3 (0.17 ± 0.06 µg.kg−1) and lowest for treatment 4 (0.10 ± 0.05 µg.kg−1). accumulation of mn and sr was much higher in the edible parts of b. oleracea (leaves) compared to the edible parts (tubers) of s. tuberosum plants (highest mn accumulation of 69.79 (± 22.97) in 287water sa 49(3) 282–290 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4008 b. oleracea and 17.34 (± 4.93) in s. tuberosum and highest accumulation for sr of 127.98 (± 26.60) in b. oleracea and 4.73 (± 0.91) in s. tuberosum). the accumulation of al was comparable in the edible parts of the two plant species (maximum accumulation of 0.18 (± 0.04) in b. oleracea leaves and 0.17 (± 0.06) in s. tuberosum tubers). there were no significant differences in the accumulation of al and mn in the s. tuberosum tubers (p > 0.05), but significantly different accumulations were found for sr (p < 0.05), with treatment 1 having a significantly lower uptake compared to the other three treatments. since plants exposed to treatment 1 were not exposed to any sds nor metals, this probably explains the lower levels of sr accumulated by the tubers in treatment 1. with regards to the other major and minor cations also assessed in the tubers (table 5), no significant differences in the accumulations were found for all the other cations assessed (p > 0.05). table 5. cations accumulated in s. tuberosum tubers upon 20-day exposure to the 4 treatments. data labeled with different small letters (a–c) differed significantly at p < 0.05 in each row (mean ± sd, n = 6). t1 = control (milli-q water); t2 = roodeplaat dam water (mn 0.257 mg.l−1, al 0.6 mg.l−1, sr 0.16 mg.l−1); t3 = milli-q water with 3.4 mg l−1 sds; t4 = roodeplaat dam water with 3.4 mg.l−1 sds (sds 3.4 mg.l−1, mn 0.257 mg.l−1, al 0.6 mg.l−1, sr 0.16 mg.l−1) category element t1: control t2: roodeplaat dam water t3: milli-q water with sds t4: roodeplaat dam water with sds significance minor cations (µg.kg−1) b 5.86 (± 0.57) 6.59 (± 0.60) 6.51 (± 1.65) 10.69 (± 11.99) n.s v 0.51 (± 0.26) 1.00 (± 0.73) 1.18 (± 0.66) 2.50 (± 4.96) n.s cr 3.20 (± 0.17) 3.28 (± 0.19) 3.35 (± 0.20) 3.45 (± 1.30) n.s mn 11.07 (± 2.85) 15.27 (± 6.32) 17.34 (± 4.93) 13.51 (± 6.51) n.s co 0.68 (± 0.70) 0.51 (± 0.22) 0.59 (± 0.24) 0.80 (± 0.86) n.s ni 2.47 (± 0.44) 2.51 (± 0.39) 2.42 (± 0.50) 3.61 (± 1.52) n.s cu 5.68 (± 1.14) 6.65 (± 1.81) 6.19 (± 1.09) 8.55 (± 2.86) n.s zn 13.75 (± 2.25) 14.07 (± 2.60) 12.66 (± 1.82) 16.71 (± 4.19) n.s sr 2.93 (± 0.38)b 4.64 (± 0.99)a 4.73 (± 0.91)a 4.38 (± 0.77)a ** mo 0.34 (± 0.08) 0.33 (± 0.05) 0.33 (± 0.04) 0.29 (± 0.05) n.s ba 6.29 (± 2.15) 9.68 (± 4.34) 8.51 (± 1.85) 8.99 (± 4.23) n.s pb 0.10 (± 0.01) 0.16 (± 0.05) 0.16 (± 0.04) 0.23 (± 0.17) n.s major cations (mg.kg−1) al 0.11 (± 0.03) 0.16 (± 0.07) 0.17 (± 0.06) 0.10 (± 0.05) n.s fe 0.12 (± 0.12) 0.30 (± 0.27) 0.34 (± 0.21) 0.71 (± 1.51) n.s ca 0.70 (± 0.19) 1.00 (± 0.48) 1.02 (± 0.39) 0.75 (± 0.30) n.s k 18.08 (± 4.06) 18.17 (± 3.99) 15.32 (± 1.81) 14.64 (± 2.43) n.s mg 1.13 (± 0.34) 1.16 (± 0.24) 1.16 (± 0.25) 1.05 (± 0.17) n.s na 0.14 (± 0.03) 0.18 (± 0.03) 0.15 (± 0.05) 0.18 (± 0.06) n.s p 1.94 (± 0.76) 1.96 (± 0.46) 1.79 (± 0.48) 1.90 (± 0.41) n.s si 0.02 (± 0.01) 0.03 (± 0.02) 0.03 (± 0.02) 0.03 (± 0.01) n.s note: *p < 0.05, **p < 0.01, ***p < 0.001, n.s. = not significant figure 3. accumulation of metals in potato (solanum tuberosum) tubers after 20 days of exposure to the various treatments (n = 6): (a) sr (b) mn (c) al. note: different lowercase letters indicate a significant difference between treatments (p < 0.05). 288water sa 49(3) 282–290 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4008 figure 4. total chlorophyll in (a) cabbage (brassica oleracea) leaves, (b) potato (solanum tuberosum) leaves, after 20 days of exposure to the 4 treatments (n = 6) effects of al, sr, mn and other cations on b. oleracea tolerance and s. tuberosum since increased levels of metals in plants are known to induce oxidative stress and also hinder the plants’ ability to produce chlorophyll (shakya et al., 2008; sulaiman and hamzah, 2018), we monitored total chlorophyll levels in the two plant species to assess the potential effects of the al, sr, mn and other cations on the plants. in addition, the dam water used in treatments 2 and 4 also had significant levels of microcystins (mcs) (15 ± 3.88 µg.l−1), high ph (9.02 ± 0.29), high ec levels (380 ± 16.52 µs.cm−1) and high tds levels (228 ± 7.51 mg.l−1). all these contaminants, i.e. mcs (saqrane et al., 2008; machado et al., 2017), high ph and ec (huang et al., 2017) and anionic surfactants (pandey and gopal, 2010; wang et al., 2012) are also known to induce oxidative stress, reduce chlorophyll production and affect plant growth. figure 4a shows comparable total chlorophyll content in the leaves of b. oleracea plants exposed to treatment 1 compared to other treatments (no statistically significant differences in the mean total chlorophyll content among the plants exposed to the 4 treatments after 20 days of exposure (anova, p ≥ 0.05)). with regards to the total chlorophyll content of the s. tuberosum leaves, comparable total chlorophyll levels were observed in plants exposed to treatments 1 to 4 (no statistically significant differences in the mean total chlorophyll levels among the 4 treatments; anova, p ≥ 0.05). the findings imply that exposure to environmentally relevant levels of the 3 metals and sds as applied in this study, and the presence of other major and trace cations and mcs in the raw dam water did not induce oxidative stress nor inhibit chlorophyll production in the plants. in addition, no significant visual impacts were observed on the plants exposed to the 4 treatments. discussion pollution of aquatic ecosystems and soils by anionic surfactants is common due to their widespread use in soaps and detergents globally. the presence of anionic surfactants in the dam water collected from roodeplaat and hartbeespoort dam sites was confirmed. levels of anionic surfactants found in the water (0.13 to 3.4 mg.l−1) were within the range (0.001 and 20 mg.l−1) generally found in surface waters (wang et al., 2015). both dams are considered hyper-eutrophic and warm monomictic impoundments (van ginkel, 2004) and the long history of mining, industrial activities and a rapidly growing urban population in the catchments where these two dams are found promotes the co-existence of pollutants such as anionic surfactants las, cyanotoxins and metals in these two dams (pindihama and gitari, 2020). some of the contaminants observed in the dam water used to irrigate the plants in treatments 2 and 4 have been reported to have adverse effects on plants, e.g., mcs are known to induce oxidative stress (saqrane et al., 2008; machado et al., 2017), high ph and ec are known to induce oxidative stress and affect chlorophyll production (huang et al., 2017), and anionic surfactants like las are also known to induce oxidative stress, reduce chlorophyll production and affect plant growth (pandey and gopal, 2010; wang et al., 2012). in this study, exposure to las in the form of sds at relevant environmental concentrations did not affect the total chlorophyll of the plants. previous studies have reported improved plant growth due to exposure to las in the range 0.3–10 mg.l−1, and significant stunted growth when the common aquatic duckweed (lemna minor) was exposed to 20–30 mg.l−1 sds (wang et al., 2012). anionic surfactants like sds are amphipathic compounds and can easily interact with the polar and non-polar components of cell membranes, resulting in membrane damage, and induce oxidative stress (forni et al., 2012; pierattini et al., 2018). toxic effects such as reduced phenols and chlorophyll content and increased activity of stress-related enzymes upon exposure to sds have been reported in aquatic plants like l. minor (wang et al., 2012; forni et al., 2012) and azolla pinnata (pandey and gopal, 2010). in the current study, the plants were exposed to much lower levels (± 3 mg.l−1) of sds compared to those reported in previous studies (≥ 10 mg.l−1) (e.g. pandey and gopal, 2010; wang et al., 2012; forni et al., 2012); this may be the reason that no significant impacts on total chlorophyll were reported between the treatments and the control plants. the presence of las in the irrigation water, in the form of sds at environmentally relevant concentrations, did not enhance uptake of sr, mn, al in the two plants tested here, as demonstrated by statistically insignificant differences in the means of the four treatments. in the case of s. tuberosum, where a statistically significant difference was observed for sr, low uptakes were reported in the control plants, but plants exposed to metal-containing dam water without any sds, plants exposed to milli-q water with sds (without any metals) and plants exposed to dam water with sds and containing the three metals (sr, mn and al), showed no differences. this implied that the accumulation of sr in the s. tuberosum tubers was not affected by the presence of sds and was independent of the presence of the metal in the water used for irrigation. the presence of sds also did not affect the uptake and accumulation of sr, mn, al and 19 other major and trace cations in b. oleracea. statistically significant higher accumulation of al in treatment 2 (dam water spiked with sr, mn and al) compared to other treatments, particularly treatments 3 and 4 which had sds, implies that sds at the levels tested (3.4 mg.l−1) did not enhance the uptake of the metal by the plants. with regards to other cations which were not spiked in any of the treatments, but were initially 289water sa 49(3) 282–290 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4008 present in the dam water and soils used, significantly higher accumulations of cr, co, mg and p in treatments 1 and 2, which did not have any sds, also supported the finding that uptake and accumulation was independent of the presence of sds. previous studies reported contrasting results on the uptake of metals in the presence of anionic surfactants like the las, sds. hasan et al. (2019) reported increased cd accumulation in shoots and roots of althaea rosea upon exposure to 348.48 mg.l−1 of sds. in another study, pierattini et al. (2018) did not report significant total accumulation of zn by poplar plants poplus alba, but observed increased accumulation in leaves when 1 mm zn was applied in combination with 0.5 mm of sds compared to when 1  mm zn was applied alone. pierattini et al. (2018) also reported increased translocation of zn from roots to leaves when the poplar plants were exposed to sds. contrary to pierattini et al. (2018), almeida et al. (2009) found that the las, sds enhanced cu accumulation in the salt marsh plant halimione portulacoides, but did not find any cu translocation to the other parts of the plant. consistent with our findings, zhang et al. (2008) reported a reduction in cd uptake by soybean plants in the presence of las. zhang et al. (2008) found a reduction in cd bound to carbonates and exchangeable cd in the soils when the soils are exposed to las, hence the low uptakes reported. almeida et al. (2009) did not find any influence of las on cu levels in sediments. in addition to data suggesting little influence of anionic surfactants on the solubility of metals, hasan et al. (2019) and mao et al. (2015) reported degradation of las by strains of pseudomonas, which use the contaminant as a source of carbon. the presence of such bacteria (pseudomonas) to degrade the las in the soils in the study area was highly likely, given the climate (average annual temperatures ranging between 14°c and 29°c) in the study area. in addition the levels of las applied here were much lower compared to those applied in studies where significant metal uptakes were reported (e.g. pierattini et al., 2018; hasan et al., 2019). at low concentrations, surfactants build up at liquid to liquid or at solid to liquid interfaces as monomers (mao et al., 2015). increasing their concentrations eventually replaces the interfacial solvent, such as water, leading to decreased polarity of the aqueous phase and a surface tension reduction. at high concentrations of surfactants, dissolved pollutants in the aqueous phase gain more mobility, which is conducive to removal and uptake by plants and even degradation by microbes. also, the properties of the soil, and the surfactant itself, influence the adsorption of a surfactant (mao et al., 2015). the interaction and combination of las and other contaminants like mcs and metal ions has been found to be both synergistic and in some cases antagonistic (chai et al., 2020). our findings did not suggest any synergistic nor antagonistic effects of las in combination with metals and other contaminants such as mcs which were detected in the water used. consistent with our findings, zhang et al. (2008) did not find increased uptake of cd by soybean in the presence of las. jensen and sverdrup (2002) also did not find any combined effect of las and pyrene on folsomia fimetaria. according to chai et al. (2020), synergistic or combined effects are influenced by a number of factors, including the types of contaminants tested, plant species, concentrations tested and the duration of exposure. in this study, factors such as faster biodegradation of las by microbes, a reduction in the exchangeable metals available in the media and low concentrations of las tested could all have affected las, metals and other contaminants’ activity and toxicity to the plants. what we also observed was a noticeably higher uptake in the edible parts of b. oleracea plants (leaves) compared to s. tuberosum plants (tubers). according to hasan et al. (2019), b. oleracea, in the brassicaceae family, belongs to a group of plants known to be hyperaccumulators and suited to grow in soils polluted with metals. hyperaccumulators can take up zn and mn at concentrations up to 10 000 mg.kg−1; cu, ni and pb beyond 1 000 mg.kg−1 dry mass, cd at up to 100 mg.kg−1 dry mass in contaminated media (hasan et al., 2019). conclusions and recommendations this study explored the effect of an anionic surfactant (las in the form of sds) on the accumulation of the metals aluminum (al), manganese (mn) and strontium (sr) in brassica oleracea (cabbage) and solanum tuberosum (potato) plants when exposed to environmentally realistic concentrations of the pollutants. the findings indicated that when common cabbage (b. oleracea) and cultivated potato (s. tuberosum) plants were exposed to environmentally relevant concentrations of sds and metals (sr, mn, al and other cations), no negative effects could be observed on the plants. moreover, the combined exposure of the plants to these contaminants did not result in increased uptake and accumulation of the metals as was anticipated. this implies that the existing levels of anionic surfactants such as las, metals and other contaminants such as mcs found in hyper-eutrophic reservoirs such as roodeplaat and hartbeespoort dams in south africa, pose little risk to the crop yields, quality of the crops and human health due to the possible accumulation of these contaminants in irrigated plants. despite there being no immediate inherent risk to the plants and human health, continuous monitoring of the contaminants in water, soil and irrigated plants is recommended since the conditions, concentrations and other factors can quickly change if the management of the catchments does not improve in the near future. conflict of interest none declared. funding funding for this study was granted by the south african water research commission (wrc) project no: k5/2972. data availability statement the datasets generated during and/or analysed during the current study are available from the corresponding author upon reasonable request. orcids glynn k pindihama https://orcid.org/0000-0001-5537-7591 mugera w gitari https://orcid.org/0000-0002-6387-0682 references almeida cmr, dias ac, mucha ap, bordalo aa and vasconcelos mtsd (2009) influence of surfactants on the cu phytoremediation potential of a salt marsh plant. chemosphere 75 (2) 135–140. https://doi.org/10.1016/j.chemosphere.2008.12.037 ayers rs and westcot dw (1985) water quality for agriculture. fao irrigation and drainage paper no. 29. fao, rome. baskar v, venkatesh j and park sw (2015) impact of biologically synthesized silver nanoparticles on the growth and physiological responses in brassica rapa ssp. pekinensis. environ. sci. pollut. res. 22 (22) 17672–17682. https://doi.org/10.1007/s11356015-4864-1 chai l, yang l, zhang y, zhou y, wang f and wu z (2020) antagonism or synergism? responses of hydrocharis dubia (bl.) backer to linear alkylbenzene sulfonate, naphthalene and their joint exposure. ecotoxicol. environ. saf. 200 (january) 110747. https://doi.org/10.1016/j.ecoenv.2020.110747 https://orcid.org/0000-0001-5537-7591 https://orcid.org/0000-0002-6387-0682 https://doi.org/10.1016/j.chemosphere.2008.12.037 https://doi.org/10.1007/s11356-015-4864-1 https://doi.org/10.1007/s11356-015-4864-1 https://doi.org/10.1016/j.ecoenv.2020.110747 290water sa 49(3) 282–290 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4008 dwaf (department of water affairs and forestry, south africa) (1996) water quality guidelines volume 4 agricultural use: irrigation. department of water affairs and forestry, pretoria. url:  http://www.dwa.gov.za/iwqs/wq_guide/edited/pol_sawq guidefreshirrigationvol4.pdf (accessed 11 may 2022). fao (2015) international year of soils 2015: healthy soils for a healthy life. rome, italy. url: https://www.fao.org/soils-2015/ news/news-detail/en/c/277682/ (accessed 30 march 2023). forni c, braglia r, harren fjm and cristescu sm (2012) stress responses of duckweed (lemna minor l.) and water velvet (azolla filiculoides lam.) to anionic surfactant sodium-dodecylsulphate (sds). aquat. toxicol. 110–111 107–113. https://doi.org/ 10.1016/j.aquatox.2011.12.017 hasan mm, uddin mn, ara-sharmeen i, alharby hf, alzahrani y, hakeem kr and zhang l (2019) assisting phytoremediation of heavy metals using chemical amendments. plants 8 (9) 1–14. https://doi.org/10.3390/plants8090295 huang l, liu x, wang z, liang z, wang m, liu m and suarez dl (2017) interactive effects of ph, ec and nitrogen on yields and nutrient absorption of rice (oryza sativa l.). agric. water manage. 194 (december) 48–57. https://doi.org/10.1016/j. agwat.2017.08.012 jensen j and sverdrup le (2002) joint toxicity of linear alkylbenzene sulfonates and pyrene on folsomia fimetaria. ecotoxicol. environ. saf. 52 (1) 75–81. https://doi.org/10.1006/eesa. 2002.2149 lawton l, marsalek b, padisák j and ingrid c (1999) chapter 12. determination of cyanobacteria in: toxic cyanobacteria in water: a guide to their public health consequences, monitoring and management. e & fn spon, london. 347–367. https://doi. org/10.1201/9781482295061-18 mabasa hz (2019) spatial variability of aggregate stability, size distribution, erosion and runoff in selected soils in south africa. masters dissertation, university of venda. url:  https://univend space.univen.ac.za/bitstream/handle/11602/1647/dissertation-mabasa %2c h.z.-.pdf?sequence=1&isallowed=y machado j, campos a, vasconcelos v and freitas m (2017) effects of microcystin-lr and cylindrospermopsin on plant-soil systems: a review of their relevance for agricultural plant quality and public health. environ. res. 153 (may 2016) 191–204. https://doi.org/10.1016/j.envres.2016.09.015 manson ad and roberts vg (2001) analytical methods used by the soil fertility and analytical services section. kzn agri-report no. n/a/2001/04 (4). kwazulu-natal department of agriculture and rural development. url: https://www.kzndard.gov.za mao x, jiang r, xiao w and yu j (2015) use of surfactants for the remediation of contaminated soils: a review. j. hazardous mater. 285 419–435. https://doi.org/10.1016/j.jhazmat.2014.12.009 pandey p and gopal b (2010) effect of detergents on the growth of two aquatic plants: azolla pinnata and hydrilla verticillata. int. j. sci. technol. 5 (1) 107–114. pierattini ec, francini a, raffaelli a and sebastiani l (2018) surfactant and heavy metal interaction in poplar: a focus on sds and zn uptake. tree physiol. 38 (1) 109–118. https://doi. org/10.1093/treephys/tpx155 pindihama gk and gitari mw (2020) cyanobacterial toxins: an emerging threat in south african irrigation water. water environ. j. 34 (3) 506–516. https://doi.org/10.1111/wej.12473 rashid mh, fardous z, chowdhury maz, alam mk, bari ml, moniruzzaman m and gan sh (2016) determination of heavy metals in the soils of tea plantations and in fresh and processed tea leaves: an evaluation of six digestion methods. chem. centr. j. 10 (1) 1–13. https://doi.org/10.1186/s13065-016-0154-3 saqrane s, ghazali i el, oudra b, bouarab l and vasconcelos v (2008) effects of cyanobacteria producing microcystins on seed germination and seedling growth of several agricultural plants. j. environ. sci. health – part b pesticides food contam. agric. wastes 43 (5) 443–451. https://doi. org/10.1080/03601230802062307 shakya k, chettri mk and sawidis t (2008) impact of heavy metals (copper, zinc, and lead) on the chlorophyll content of some mosses. arch. environ. contam. toxicol. 54 (3) 412–421. https://doi.org/10.1007/s00244-007-9060-y sulaiman fr and hamzah ha (2018) heavy metals accumulation in suburban roadside plants of a tropical area (jengka, malaysia). ecol. process. 7 (1). https://doi.org/10.1186/s137 17-018-0139-3 van ginkel ce (2004) a national survey of the incidence of cyanobacterial blooms and toxin production in major impoundments. directorate: resource quality services, department of water affairs and forestry, pretoria. venkidasamy b, karthikeyan m and ramalingam s (2019) methods/protocols for determination of oxidative stress in crop plants. in: hasanuzzaman m, fotopoulos v, nahar k and fujita m (eds) reactive oxygen, nitrogen and sulfur species in plants: production, metabolism, signaling and defense mechanisms. john wiley & sons, hoboken. 421–435. https://doi. org/10.1002/9781119468677.ch17 wang z, xiao b, song l, wang c and zhang j (2012) responses and toxin bioaccumulation in duckweed (lemna minor) under microcystin-lr, linear alkybenzene sulfonate and their joint stress. j. hazardous mater. 229–230 137–144. https://doi.org/ 10.1016/j.jhazmat.2012.05.109 wang z, zhang j, song l, li e, wang x and xiao b (2015) effects of linear alkylbenzene sulfonate on the growth and toxin production of microcystis aeruginosa isolated from lake dianchi. environ. sci. pollut. res. 22 (7) 5491–5499. https://doi.org/10.1007/ s11356-014-3784-9 zhang y, liao b-h, zeng q-r, zeng m and lei m (2008) surfactant linear alkylbenzene sulfonate effect on soil cd fractions and cd distribution in soybean plants in a pot experiment. pedosphere. 18 (2) 242–247. https://doi.org/10.1016/s1002-0160(08) 60013-2 http://www.dwa.gov.za/iwqs/wq_guide/edited/pol_sawqguidefreshirrigationvol4.pdf http://www.dwa.gov.za/iwqs/wq_guide/edited/pol_sawqguidefreshirrigationvol4.pdf https://www.fao.org/soils-2015/news/news-detail/en/c/277682/ https://www.fao.org/soils-2015/news/news-detail/en/c/277682/ https://doi.org/10.1016/j.aquatox.2011.12.017 https://doi.org/10.1016/j.aquatox.2011.12.017 https://doi.org/10.3390/plants8090295 https://doi.org/10.1016/j.agwat.2017.08.012 https://doi.org/10.1016/j.agwat.2017.08.012 https://doi.org/10.1006/eesa.2002.2149 https://doi.org/10.1006/eesa.2002.2149 https://doi.org/10.1201/9781482295061-18 https://doi.org/10.1201/9781482295061-18 https://univendspace.univen.ac.za/bitstream/handle/11602/1647/dissertation-mabasa%2c%20h.z.-.pdf?sequence=1&isallowed=y https://univendspace.univen.ac.za/bitstream/handle/11602/1647/dissertation-mabasa%2c%20h.z.-.pdf?sequence=1&isallowed=y https://univendspace.univen.ac.za/bitstream/handle/11602/1647/dissertation-mabasa%2c%20h.z.-.pdf?sequence=1&isallowed=y https://doi.org/10.1016/j.envres.2016.09.015 https://www.kzndard.gov.za https://doi.org/10.1016/j.jhazmat.2014.12.009 https://doi.org/10.1093/treephys/tpx155 https://doi.org/10.1093/treephys/tpx155 https://doi.org/10.1111/wej.12473 https://doi.org/10.1186/s13065-016-0154-3 https://doi.org/10.1080/03601230802062307 https://doi.org/10.1080/03601230802062307 https://doi.org/10.1007/s00244-007-9060-y https://doi.org/10.1186/s13717-018-0139-3 https://doi.org/10.1186/s13717-018-0139-3 https://doi.org/10.1002/9781119468677.ch17 https://doi.org/10.1002/9781119468677.ch17 https://doi.org/10.1016/j.jhazmat.2012.05.109 https://doi.org/10.1016/j.jhazmat.2012.05.109 https://doi.org/10.1007/s11356-014-3784-9 https://doi.org/10.1007/s11356-014-3784-9 https://doi.org/10.1016/s1002-0160(08)60013-2 https://doi.org/10.1016/s1002-0160(08)60013-2 water sa 49(3) 301–310 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4004 research paper issn (online) 1816-7950 available on website https://www.watersa.net 301 correspondence edip avşar email edip.avsar@bilecik.edu.tr dates received: 18 june 2022 accepted: 14 july 2023 key words haas risk assessment dcaa chlorination groundwater muş province copyright © the author(s) published under a creative commons attribution 4.0 international licence (cc by 4.0) chlorine not only removes parasitic pathogenic microorganisms in water, but also causes the formation of disinfection by-products (dbps) that can be carcinogenic to humans, due to reacting with natural organic matter (noms) in raw water sources. haloacetic acids (haas) are one of the most well-known and common disinfection by-product groups (dbps) in the literature. in the risk definitions of the epa, some of its components have been identified as carcinogenic. therefore, determination of haa concentration in water and execution of a risk analysis are very important in terms of determining the possible effects on public health. this study aimed to monitor the seasonal and spatial variations of haloacetic acids (haas) in 2 different water supplies (surface and groundwater) serving the city center of muş province, türkiye, and to demonstrate their public health implications. in this context, an analytical study was conducted covering 4 seasons. according to the results, although the amount of nom in water bodies was less than 1 mg·l−1, the haa5 content may occasionally exceed the usepa limits of 60 µg·l −1, but did not exceed the canadian 80 µg·l−1 limit. when the who limit values were examined on a component basis, it was determined that the mcaa concentrations in both water sources sometimes exceeded the limit of 20 µg·l−1 in the july and october sampling periods. the risk level related to maximum dcaa level in the main network by means of ingestion pathway was found to be 18.7 times higher for women and 16.5 times higher for men when compared with usepa risk criteria. also, in the muratpaşa water network, risk from dcaa exceeds the usepa risk level 15.2-fold in women and 13.4-fold in men. however, since it was also found that the level of free chlorine in the network does not meet the required level, it should be noted that there may be an increase in the risk level if there is adequate chlorination in the supply. monitoring seasonal variations of haloacetic acids (haas) in low-toc and low-chlorine networks and assessing risk to public health: muş, türkiye case edip avşar1 and adile kılıç2 1vocational school environmental protection technologies department, bilecik şeyh edebali university, bilecik, türkiye 2graduate education institute, bitlis eren university, bitlis, türkiye introduction chlorine is the most commonly used disinfectant in drinking water treatment due to its low cost, ease of use, and effectiveness in preventing waterborne disease. chlorine kills or deactivates a large variety of waterborne microorganisms. however, since the mid-1970s, public health concerns about the disinfection process have increased. studies have shown that chlorine reacts not only with waterborne parasitic pathogenic microorganisms, but also with natural organic matter (nom), bromide, iodide, and nitrite in water to form trihalomethanes (thms), haloacetic acids (haas), halonitromethanes (hnms) and other disinfection by-products (dbps) (avşar et al., 2014; avşar et al., 2015; özdemir, 2020). studies on the formation of dbps post-chlorination have shown that more than 700 species are formed in the water. however, in addition to these, there are also undetectable halogenated organic structures and it is clear that the undetectable compounds make up a significant portion of the total (avşar et al., 2014; avşar et al., 2015; özdemir, 2021). given such potentially carcinogenic effects of some dbps, dbp formation is the most important problem of the drinking water sector. toxicological studies also show that dbps can have adverse effects on development and reproduction. the potential health risks of dbps have put pressure on industrialized countries to introduce maximum contaminant levels (mcl), in other words, limits, for types of dbps in drinking water (uyak et al., 2014). haas is one of the important dbp groups and the most prevalent haas are mcaa (monochloroacetic acid), tcaa (trichloroacetic acid), and dcaa (dichloroacetic acid). the sum of mcaa, mbaa (monobromoacetic acid), dcaa, tcaa, and dbaa (dibromochloroacetic acid) is expressed as haa5. haa5 plus bcaa (bromochloroacetic acid), tbaa (tribromoacetic acid), bdcaa (bromodichloroacetic acid) and cdbaa (dibromochloroacetic acid) together makes up haa9. the united states environmental protection agency’s (usepa) integrated risk information system has classified dcaa as a group b2 (probable human carcinogen) and tcaa as a group c (possible human carcinogen) component, and both components have been shown to be carcinogenic in animals (avşar et al., 2014; avşar et al., 2015; thompson et al., 2015). in 1998, because of the possible health risks, the maximum contaminant level of haa5 was set to 60 µg.l−1 by the usepa. in canada, the limit has been set at 80 µg.l−1 since 2008. the world health organization (who) has set up guidelines for chlorinated haas (mcaa: 20 µg.l−1, dcaa: 50 µg.l−1, tcaa: 200 µg.l−1), but not for brominated haas. neither the european union nor türkiye has set a limit value yet. however, the amount of haa9 in bromine-rich waters is 20–50% higher https://www.watersa.net https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://orcid.org/0000-0001-6249-4753 https://orcid.org/0000-0003-2222-1704 302water sa 49(3) 301–310 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4004 than haa5, and it is important to consider haa9 in such waters because brominated species are potentially more carcinogenic than chlorinated species (health canada, 2008; thompson et al., 2015). monitoring haas in the drinking water network is a complex process. various parameters, such as the disinfection plan and chemicals used (chlorine or chlorine/chloramine or ozone/ chlorine), water treatment processes, water source characteristics, bromide content, ph of chlorinated and distributed water, temperature, concentration of total and free chlorine, residence time, distribution system characteristics, and total organic carbon (toc), affect the formation of haas. the formation kinetics, formation and stability of haas are still not completely understood. it is known that haas form faster than thms, that some species decompose as ph increases, and that some species biodegrade in the absence of residual chlorine (uyak et al., 2014; thompson et al., 2015). the formation of haas in chlorinated water varies considerably depending on the season and the length of the distribution system. these variations depend on the quality of the raw and treated water and on the operating parameters of the treatment plant as well. there are studies showing that the concentration of haas tends to first increase and then decrease with extended residence time in the water network (uyak et al., 2014, thompson et al., 2015). because of all these reasons, monitoring seasonal changes in haas in drinking water systems as a function of the length of the distribution system is important for protecting public health and providing healthy drinking water. in a study conducted by uyak et al. (2014), seasonal and spatial variation in haas was observed in drinking water distribution networks fed by 3 different drinking water treatment plants in istanbul. the highest median haa9 concentrations were observed in the spring and summer seasons, while the lowest concentrations were obtained in the autumn and winter periods. dcaa and tcaa were identified as the most significant haa9 components. it was observed that the seasonal average values of haa9 in all three distribution systems remained below 60 µg.l−1, while the haa9 concentration in only one sample was measured to be 100.16 µg.l−1 during the sampling period. according to a study that was conducted in istanbul surface water sources (büyükçekmece and ömerli lakes, between february 2010 and february 2011) by avşar et al. (2014); the most important haa9 formation was caused by hydrophobic (hpo) and hydrophilic (hpi) fractions of nom, respectively. according to avşar et al. (2015), which was conducted for the same water sources as avşar et al. (2014), organic substances with a molecular size below 1 kda were found to be effective in the formation of haa9. uyak et al. (2007) studied terkos, büyükçekmece and ömerli lakes, istanbul, with different bromide and organic matter concentrations, and observed the effect of this difference on dbp formation in terms of contact time, ph, chlorine dose and specific ultraviolet absorbance parameters. the predominant species of haa was tcaa, followed by dcaa, with 60%, 49%, and 66% of total haa in terkos, büyükçekmece, and ömerli, respectively. in the study of ateş et al. (2007), a total of 29 surface waters from different regions of türkiye were sampled seasonally and dbp formation potential was determined. the results showed that dissolved organic carbon (doc) content was low in all water samples and ranged from 0.91 to 4.42 mg.l−1. the ranges of annual average total thm and haa concentrations were 21–189 and 18–149 µg.l−1, respectively. although the amount and distribution of dbps vary by water source and season, chloroform and trichloroacetic acid (tcaa) are the most important species. the lack of a consistent trend in seasonal variations in water bodies suggests that the characteristics of dissolved organic matter (dom) and its reactivity with chlorine vary seasonally in almost all water bodies. chen et al. (2008) investigated the formation potential for thms and haas in a traditional water treatment plant in northern china. the highest concentrations of thms and haas (each almost 500 µg.l−1) were detected in autumn and the lowest in spring (no more than 100 µg.l−1). organic matter and algae were found to be significant dbp precursors. the hydrophobic acid fraction has the highest thm and haa formation potential. algae contribute about 20% to 50% of the total dbp formation potential during an algal bloom. gan et al. (2013) measured dbps from the distribution systems of 10 water treatment plants in 3 provinces in china. the median of thm and haa levels ranged from 0.7–62.7 µg.l−1 and 0.3–81.3 µg.l−1, respectively. chloroform, dcaa and tcaa were the dominant species observed in guangzhou and foshan water, while brominated thms predominated in water from zhuhai. thms and haas showed clear seasonal variations with the total concentrations higher in winter than in summer. ghoochani et al. (2013) examined the variation of organic matter and haa formation through samples collected from 3 major rivers (raw water) and 3 water treatment plant outlets (chlorinated water) supplied by these rivers in tehran, iran. changes in the total organic matter (toc), ultraviolet absorbance (uv254), and specific ultraviolet absorbance (suva) were measured in raw water samples. haas were also measured in chlorinated water samples. the seasonal average concentration of toc for the 3 rivers and haas for the 3 water treatment plants in were 4.00, 2.41 and 4.03 mg.l−1 and 48.75, 43.79 and 51.07 µg.l−1 for spring, summer and autumn, respectively. seasonal variation indicated that haa levels were much higher in spring and autumn, whereas toc concentrations were similarly higher. golea et al. (2017) investigated the effect of dom in thm and haa formation in raw and treated surface waters. dbp formation potential in surface water sources has been studied with reference to the key water quality determinants (wqds) of uv absorption (uv254), colour, and dom concentration. the dom in the raw waters was found to comprise 30–84% (average 66%) of the more reactive hpo fraction, with this proportion falling to 18–63% (average 50%) in the treated water. results suggest uv254 to be as good an indicator of dbpfp as doc or hpo for the raw waters, with values ranging from 0.79 to 0.82 for thms and from 0.71 to 0.73 for haas for these three determinants. for treated waters the corresponding values were significantly lower, reflecting the lower hpo concentration. guilherme et al. (2014) investigated the occurrence of regulated and non-regulated dbps in the drinking water of small systems in 2 provinces in canada. it was reported that average measured concentrations of these compounds was much higher than that reported in the literature for medium and large systems. the measured average value for thms was 75 µg.l−1 and for haas was 77 µg.l−1. investigated dbps decreased between the autumn and winter and then increased to eventually reach a maximum in late summer. rodriguez et al. (2004) investigated the seasonal and spatial variation of post-chlorination dbps in a drinking water distribution system located in a region where very significant seasonal variations in water temperature and surface water quality occur. the analysis of a large number of collected samples showed that the seasonal and geographical variations of thms and haas were of particular importance in this region. thm levels were found to be about 5 times higher on average in summer and autumn than in winter, while average haa levels were about 4 times higher in spring than in winter. 303water sa 49(3) 301–310 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4004 rodriguez et al. (2007) studied haa formation during the treatment process in 2 facilities where surface water is prechlorinated. samples were collected over 1 year at 4 stations in order to investigate both seasonal and spatial variations of haas. the results revealed that the formation of haas was highest during the pre-chlorination process, where precursor compounds and pre-chlorination dose were both higher and more variable, and that formation lasted from the pre-chlorination point until the settled water occurred, due to remaining levels of residual chlorine. it was identified that dcaa was the predominant haa species. to understand water quality variability in small systems, scheili et al. (2015) monitored water quality in 25 small municipal systems in 2 canadian regions from the water source to the end of the distribution system. the database obtained was used to create a global portrait of physical, chemical, and microbiological water quality parameters. it was observed that the values of dom varied during the different seasons, with maxima in autumn for both provinces. in the regions studied, the highest thm and haa values were reached in the warmer seasons (summer, autumn), as observed in previous studies with large systems. observed thm and haa levels were 3 times higher in systems in the province of newfoundland and labrador than in the province of quebec. serodes et al. (2003) chlorinated seasonally treated waters from 3 major drinking water supplies in the quebec city region and studied the formation of thm and haa. they concluded that chloroform was the predominant compound for thm species, while dichloroacetic acid and trichloroacetic acid were the most abundant for dbp species due to low bromide concentrations in the raw waters. significant differences in dbp formation were observed, mainly due to the type of disinfectant used for raw water in the three utilities. the use of pre-ozonation as opposed to pre-chlorination (or direct chlorination) in one of the utilities appears to be the primary factor contributing to that utility’s ability to meet current thm and future haa standards. in this study, haa formation and health risk via ingestion were investigated in 2 networks fed by groundwater and surface water, where the organic matter level is low, when chlorination is not properly utilized (under uncontrolled conditions). haas are of special importance in these networks, since the networks are short and haas are formed faster than other dbps. in addition, no study has been found in the literature evaluating the formation of haa under insufficient chlorination conditions in groundwater with low nom levels. there is also no study apparent in the literature on whether haa formation will pose a risk in low organic content waters under insufficient chlorination conditions. in this study, answers to all these questions were sought. although the formation of haa is important and may pose a risk in türkiye, there is no limit value being applied yet. materials and methods sampling points this study investigated the quality of raw water sources used in muş province city centre, the seasonal and spatial variance of haas formed after chlorination of these sources, and the risk to human health via ingestion. therefore, sampling and analytical studies were conducted on the dates of 20 july 2017 (summer); 26 october 2017 (autumn); 8 january 2018 (winter); and 7 march 2018 (spring) in the city centre of muş province, to characterize the summer, autumn, winter, and spring seasons. figure 1 shows the location of muş, networks and sampling points used in the study. the drinking water network for muş city centre is provided from groundwater extracted by 17 existing boreholes around the main pumping station (point 1 in fig. 1). the water taken through the boreholes is pumped to the tank of the main pumping station, and released to the water network after chlorination via liquid sodium hypochlorite solution (naocl). there is also another small network in the city centre. water from a mountain spring (surface water) is fed to the muratpaşa water tank, chlorinated with naocl, and pumped to the small water network (point 5 in fig. 1). figure 2 shows photographs of the water tanks. the characteristics of water networks and sampling points are shown in table 1. the points in table 1 are arranged in the order relating to the water path between source and water network. it was observed that the water drawn from 17 boreholes in the vicinity of the main pumping station, station 1, reached the main pumping station where it was mixed in the tank, chlorinated, and sent to the reservoir 3 at point 9 and released to the network. seasonal sampling and analyses were conducted at points 2, 9, 7, 10, 4 and 3 of this network. additionally, seasonal sampling figure 1. networks and sampling points in the center of muş province 304water sa 49(3) 301–310 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4004 and analyses were conducted for muratpaşa reservoir, where the mountain spring was located, and at points 6 and 8 of the network supplied from this reservoir. haas from post-chlorination dbps in the reservoirs and water distribution systems of 2 different distribution networks were monitored. the sampling points in both networks are listed in table 1, give in order from the source to the final distribution point. one-time sampling was conducted in the context of 4 different seasons from 2 networks consisting of 10 points in total. water was wasted for at least 1 min in each fountain before sampling. samples were taken in polyethylene sample containers and transferred to the laboratory for further analysis. analytical methods as part of the study, the water quality parameters and postchlorination–formed haa species were measured in 4 seasons in 2 water reservoirs and water networks where the existing water is supplied in the reservoirs in the city centre of muş. the parameters measured, the devices used and the measurement methods of the devices are given in table 2. detailed analytical methods are given in avşar and toröz (2018); avşar et al. (2014); avşar et al. (2015) and avşar et al. (2020). conductivity, ph, orp, free and total chlorine, and turbidity were measured on-site after sampling. than samples were dechlorinated with 0.1 ml of 100 mg.ml−1 na2s solution and transferred to the laboratory for further analysis, given in table 2. haa analysis was conducted according to usepa 552.3 liquidliquid micro-extraction method via a gc equipped with µecd detector. the method consists of sample extraction and methyl ester conversion of haa species. further information about device, method and detection limits is given in avşar and toröz (2018). figure 2. photographs showing the reservoirs where the study was conducted: (a) external view of main pumping station; (b) chlorine dosage pump inside main tank; (c) main water tank inside; (d) muratpaşa water tank table 1. description of sampling points no. name of point type of sample coordinates main reservoir and water network 1 main reservoir raw water (chlorinated) 38.727294; 41.580537 2 main reservoir outlet chlorinated tap water 38.727801; 41.580370 9 muş centre, inner side of reservoir 3 chlorinated tap water 38.736459; 41.496992 7 central restaurant chlorinated tap water 38.740921; 41.496384 4 central atatürk playground chlorinated tap water 38.745588; 41.499400 10 central bus terminal garden chlorinated tap water 38.747446; 41.507699 3 final point of water network chlorinated tap water 38.760184; 41.512072 muratpaşa reservoir and its water network 5 muratpaşa reservoir outlet raw water (chlorinated) 38.731482; 41.482136 6 central kale park chlorinated tap water 38.730002; 41.485636 8 front of central reservoir 3 chlorinated tap water 38.736480; 41.497141 305water sa 49(3) 301–310 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4004 results the research carried out consisted of 2 stages. in the first stage, sampling and analysis were carried out for 2 different networks. in the second stage, according to the haa analysis results obtained in the first stage, risk analysis was conducted to determine whether drinking these waters poses a human health risk. analytical results the water quality parameters for the samples taken from the main reservoir and its network in the 4 seasons are compared with turkish standards (ts 266, 2005: water intended for human consumption) in table 3. minimum, maximum and mean values for the main reservoir are given in table 4. a comparison of seasonal results for muratpaşa water reservoir and its network with turkish standards of is given in table 5. minimum, maximum and mean values of the results for muratpaşa network are given in table 6. haa concentrations recorded in 2 reservoirs and their networks are given in tables 7 and 8. sampling points for both water supplies are listed in the tables in an order that matches the route the water takes in the water network. when the water quality results are examined, it can be seen that chlorination was insufficient in both water sources. free chlorine was detected at the main reservoir outlet (point 2) in 4 seasons (min: 0.2; max: 1.3 and mean: 0.9 mg.l−1). however, in general, free chlorine in the main network is depleted as it goes from reservoir outlet (point 2) to network end-point (point 3). at point 3, no free chlorine was detected in the water during any sampling period (tables 3–4). except for the last point (point 8: min: 0; max: 0.6; mean: 0.2 mg.l−1), no chlorine was found in the network during the sampling period in the muratpaşa reservoir and network (tables 5–6). this is related to frequent power cuts in the city. when the electricity is off, the chlorine dosing system is disabled. the dosing system is not activated automatically when the electricity is re-supplied to the system. manual start-up of the dosing system is required. this prevents sufficient chlorine dosing to the system. toc (min: 0.0021; max: 0.3553; mean: 0.1787 mg.l−1), tn (min: 1.9166; max: 2.4552; mean: 2.2773 mg.l−1) and turbidity (min: 0.10; max: 0.65; mean: 0.27 ntu) values in the main reservoir were generally at low levels. it was observed that the nitrate value (min: 2.00; max: 4.80; mean: 3.55 mg.l−1) remained below the ts 266 limit value throughout the monitoring period. the uv254 parameter (min: 0.002; max: 0.0140; mean: 0.0063 cm−1), which is an indicator of the organic content in the water, is similarly low, along with the toc values. these results indicate that there is no significant pollution of the groundwater, in general. toc (min: 0.1088; max: 0.3052; mean: 0.2070 mg.l−1) and tn values (min: 0.6358; max: 1.0441; mean: 0.8729 mg.l−1) in the muratpaşa reservoir were also low. however, from time to time, the limit value is exceeded in terms of turbidity in the reservoir (max: 4.19 ntu) and network (max: 2.11 ntu). it is thought that this situation is due to the leakages that occur due to the age of the pipelines. the low uv254 values in both networks indicate low organic content in the waters. there was no significant change in conductivity or orp values either. there was no significant change in water quality parameters at the measurement points of both networks. it is thought that the changes at specific measurement points that can be seen in the parameters from time to time are related to the network leakages that occur from time to time at these points. usepa national primary drinking water regulation (1994) states that in order to prevent dbp formation, the toc concentration in the water should be reduced to below 2 mg.l−1 before chlorination. however, although the toc and uv254 parameters in both networks are considerably lower than the values specified in the publications referenced in the introduction, it was determined that the usepa haa5 limit value of 60 µg.l−1 is exceeded (max: 68.87 µg.l−1) in the main network at times. haa9 values reach values of up to 91.54 µg.l−1. in muratpaşa network, the haa5 limit value was not exceeded. however, despite the lack of sufficient chlorine in the water, concentrations close to the limit value (max haa5: 54.95 µg.l−1) were determined, while maximum haa9 concentration was determined as 55.07 µg.l−1. on the other hand, mcaa can occasionally exceed the who limit value of 20 µg.l−1 in both networks. this shows that there is potential for haa formation in the case of adequate chlorination of the water, and that the water includes precursor compounds for dbp formation. table 2. parameters measured, devices and measurement methods utilized parameter device method references toc (total organic carbon) teledyne tekmar torch toc/tn analyzer standard methods 5310-b avşar and toröz, 2018 avşar et al., 2014 avşar et al., 2015 avşar et al., 2020 tn (total nitrogen) standard methods 4500n-b ph/temperature hach hq40d multimeter usepa electrode method 8156 conductivity usepa direct measurement method 8160 orp (oxidation reduction potential) direct measurement method 10228 haas agilent 6890 gc-μecd usepa method 552.3 free chlorine lovibond comparator standard methods 4500 cl-g total chlorine nitrate wtw photolab 7600 uv-vis spectrophotometer standard methods 4500 no3 -b bromide standard methods 4500 br-b alkalinity titrimetric standard methods 2320-b turbidity wtw turb 355 ir iso 7027 – din/en 27 027 uv254 wtw photolab 7600 uv-vis spectrophotometer standard methods 5910-b 306water sa 49(3) 301–310 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4004 table 3. all-season water quality parameters for samples taken at the points determined in the main pumping station and the connected water network parameter ph conductivity orp temp. free chlorine total chlorine alkalinity nitrate bromide turbidity uv254 toc tn unit µs▪cm−1 mv °c mg▪l−1 mg▪l−1 mgcaco3▪l−1 mg▪l−1 mg▪l−1 ntu cm−1 mg▪l−1 mg▪l−1 point 1 1 6.98 285 222 15.8 0 0 135.1 2 <0.1 0.11 0.014 0.3553 1.9166 2 7.58 313 215.7 12.2 0 0 116.04 3.2 0.16 0.10 0.002 <0.05 2.4552 3 7.87 412 415 8.5 0 0 154 4.2 0.37 0.21 0.005 <0.05 2.4267 4 7.75 473 174.2 11.4 0 0 154 4.8 0.44 0.65 0.004 0.002 2.311 point 2 1 7.08 362 561.5 16.1 0.8 0.8 0.56 0.001 0.3791 2.9867 2 7.4 323 325.9 14.3 1.1 1.1 0.45 0.002 <0.05 3.2475 3 7.71 395 528.5 10.2 0.2 0.2 0.02 0.003 0.1824 2.5507 4 7.79 473 670.9 12.2 1.3 1.5 0.83 0.001 <0.05 2.2882 point 9 1 7.41 357 620 20.01 0.9 1.1 0.24 0.027 0.381 2.7268 2 7.16 425 213.1 14.9 0 0 0.63 0.009 <0.05 2.8859 3 7.88 369 184.3 8.4 0 0 0.11 0.001 <0.05 2.6631 4 7.64 346 115.5 12.1 0 0 0.86 0.003 <0.05 2.4572 point 7 1 7.39 356 529.5 17.7 0.2 0.2 0.41 0.004 0.0953 2.6179 2 7.44 382 151.2 14.2 0 0 0.57 0.002 <0.05 2.2629 3 7.82 404 163.7 11.3 0 0 0.11 0 <0.05 1.999 4 7.58 422 231.4 13 0 0 4.34 0.001 <0.05 1.5233 point 4 1 7.05 682 230.5 20.1 0 0 0.18 0.002 0.3975 5.6338 2 7.46 375 135 14.8 0 0 1.43 0.001 <0.05 2.5835 3 7.9 413 211.6 9.9 0 0 0.11 0 0.3376 2.2249 4 7.38 477 180.5 12 0 0 3.86 0.003 0.9574 1.9761 point 10 1 7.28 353 574.9 17.2 0.5 0.7 0.41 0.009 0.3421 2.8497 2 7.34 374 140.6 15.4 0.1 0.1 0.59 0.003 0.2221 3.0244 3 8.23 416 214.2 9.4 0 0 0.27 0.005 0.9126 2.6973 4 7.78 361 194.2 12.3 0 0 1.03 0.009 <0.05 2.4904 point 3 1 7.24 375 368.1 24.9 0 0 0.32 0.007 0.3244 2.9443 2 7.23 754 162.2 17.8 0 0 0.29 0.002 <0.05 7.4393 3 7.87 397 197.4 8.3 0 0 0.04 0.003 0.1005 2.8998 4 8.38 475 178.3 12.2 0 0 0.65 0.001 <0.05 2.3424 ts 266 limits -2005 6.5–9.5 is desirable to be at least 0.2–0.5 mg▪l−1 50 1 1 – summer, 20 july 2017; 2 – autumn, 26 october 2017; 3 – winter, 8 january 2018; 4 – spring, 7 march 2018 table 4. the minimum, maximum and mean values of the all-season water quality parameters of the samples taken at the points determined in the main pumping station and the connected water network parameter ph conductivity orp temp. free chlorine total chlorine alkalinity nitrate bromide turbidity uv254 toc tn unit µs▪cm−1 mv °c mg▪l−1 mg▪l−1 mgcaco3▪l−1 mg▪l−1 mg▪l−1 ntu cm−1 mg▪l−1 mg▪l−1 point 1 min 6.98 285 174.2 8.5 0.0 0.0 116.0 2.00 0.16 0.10 0.002 0.0021 1.9166 max 7.87 473 415.0 15.8 0.0 0.0 154.0 4.80 0.44 0.65 0.0140 0.3553 2.4552 mean 7.55 371 256.7 12.0 0.0 0.0 139.8 3.55 0.32 0.27 0.0063 0.1787 2.2773 point 2 min 7.08 323 325.9 10.2 0.2 0.2 0.02 0.0010 0.0000 2.2882 max 7.79 473 670.9 16.1 1.3 1.5 0.83 0.0030 0.3791 3.2475 mean 7.50 388 521.7 13.2 0.9 0.9 0.46 0.0018 0.1872 2.7683 point 9 min 7.16 346 115.5 8.4 0.0 0.0 0.11 0.0010 0.0000 2.4572 max 7.88 425 620.0 20.0 0.9 1.1 0.86 0.0270 0.3810 2.8859 mean 7.52 374 283.2 13.9 0.2 0.3 0.46 0.0100 0.1905 2.6833 point 7 min 7.39 356 151.2 11.3 0.0 0.0 0.11 0.0000 0.0000 1.5233 max 7.82 422 529.5 17.7 0.2 0.2 4.34 0.0040 0.0953 2.6179 mean 7.56 391 269.0 14.1 0.1 0.1 1.36 0.0018 0.0477 2.1008 point 4 min 7.05 375 135.0 9.9 0.0 0.0 0.11 0.0000 0.3376 1.9761 max 7.90 682 230.5 20.1 0.0 0.0 3.86 0.0030 0.9574 5.6338 mean 7.45 487 189.4 14.2 0.0 0.0 1.39 0.0015 0.5642 3.1046 point 10 min 7.28 353 140.6 9.4 0.0 0.0 0.27 0.0030 0.0000 2.4904 max 8.23 416 574.9 17.2 0.5 0.7 1.03 0.0090 0.9126 3.0244 mean 7.66 376 281.0 13.6 0.2 0.2 0.58 0.0065 0.3692 2.7655 point 3 min 7.23 375 162.2 8.3 0.0 0.0 0.04 0.0010 0.0000 2.3424 max 8.38 754 368.1 24.9 0.0 0.0 0.65 0.0070 0.3244 7.4393 mean 7.68 500 226.5 15.8 0.0 0.0 0.32 0.0033 0.1416 3.9065 307water sa 49(3) 301–310 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4004 table 5. all-season water quality parameters analysis results of the samples taken at the points determined in muratpaşa reservoir and the connected water network parameter ph conductivity orp temp. free chlorine total chlorine alkalinity nitrate bromide turbidity uv254 toc tn unit µs▪cm−1 mv °c mg▪l−1 mg▪l−1 mgcaco3▪l−1 mg▪l−1 mg▪l−1 ntu cm−1 mg▪l−1 mg▪l−1 point 5 1 7.39 323 200.5 21.1 0 0 177.6 1.1 0.12 0.23 0.005 0.3052 0.8554 2 6.82 335 183.6 11.1 0 0 181.796 1.5 0.15 0.28 0.004 <0.05 0.6358 3 7.54 455 249 3.6 0 0 230 2.2 0.4 0.09 0 <0.05 0.9564 4 7.54 433 141.2 10.1 0 0 154 3.4 0.44 4.19 0.002 0.1088 1.0441 point 6 1 7.56 360 180.6 22.7 0 0 0.35 0.014 0.3384 0.8704 2 7.02 327 212.7 14.5 0 0 0.24 0.006 <0.05 0.6658 3 6.26 402 256.3 5 0 0 0.01 0 <0.05 0.8775 4 7.36 353 117.1 8 0 0 2.11 0.006 0.2549 0.9992 point 8 1 7.43 352 596 16.9 0.6 0.8 0.22 0.006 0.4522 2.4642 2 7.13 360 219.8 13.3 0 0 0.75 0.006 <0.05 3.0502 3 8.26 394 158.1 7.2 0 0 0 0.001 <0.05 2.6618 4 7.68 424 115 12 0 0 0.84 0 0 2.3894 ts 266 limits -2005 6.5–9.5 is desirable to be at least 0.2–0.5 mg▪l−1 50 1 1 – summer, 20 july 2017; 2 – autumn, 26 october 2017; 3 – winter, 8 january 2018; 4 – spring, 7 march 2018 table 6. the minimum, maximum and mean values of the all-season water quality parameters of the samples taken at the points determined in the muratpaşa water reservoir and the connected water network parameter ph conductivity orp temperature free chlorine total chlorine alkalinity nitrate bromide turbidity uv254 toc tn unit µs▪cm−1 mv °c mg▪l−1 mg▪l−1 mgcaco3▪l−1 mg▪l−1 mg▪l−1 ntu cm−1 mg▪l−1 mg▪l−1 point 5 min 6.82 323.00 141.2 3.6 0.0 0.0 154.0 1.1 0.12 0.09 0.000 0.1088 0.6358 max 7.54 455.00 249.0 21.1 0.0 0.0 230.0 3.4 0.44 4.19 0.005 0.3052 1.0441 mean 7.32 386.50 193.6 11.5 0.0 0.0 185.8 2.1 0.28 1.20 0.003 0.2070 0.8729 point 6 min 6.26 327.00 117.1 5.0 0.0 0.0 0.01 0.000 0.2549 0.6658 max 7.56 402.00 256.3 22.7 0.0 0.0 2.11 0.014 0.3384 0.9992 mean 7.05 360.50 191.7 12.6 0.0 0.0 0.68 0.007 0.2967 0.8532 point 8 min 7.13 352.00 115.0 7.2 0.0 0.0 0.00 0.000 <0.05 2.3894 max 8.26 424.00 596.0 16.9 0.6 0.8 0.84 0.006 0.4522 3.0502 mean 7.63 382.50 272.2 12.4 0.2 0.2 0.45 0.003 0.2261 2.6414 table 7. all-season haa analyses of samples taken from the points determined in the main pumping station and connected water network parameter mcaa mbaa dcaa bcaa tcaa dbaa bdcaa cdbaa tbaa haa5 haa9 unit µg▪l−1 point 1 1 * 0.59 1.89 2.48 2.48 2 0.49 1.91 2.40 2.40 3 4 point 2 1 39.51 0.75 0.40 40.66 40.66 2 59.68 0.86 3.43 2.34 25.23 63.97 91.54 3 1.86 1.86 1.86 4 point 9 1 44.39 0.66 12.49 0.44 0.20 57.74 58.18 2 0.50 2.38 2.89 2.89 3 4 point 7 1 41.76 0.65 2.77 0.60 0.25 45.43 46.03 2 0.06 1.97 2.04 2.04 3 4 0 point 4 1 64.27 1.34 3.27 13.28 68.87 82.15 2 0.06 2.24 2.30 2.30 3 2.40 1.38 3.79 3.79 4 point 10 1 0.24 1.96 2.20 2.20 2 37.73 0.51 0.59 0.40 39.22 39.22 3 4 point 3 1 40.71 0.74 2.75 0.37 44.56 44.56 2 0.22 2.27 2.49 2.49 3 4 empty cells mean compound or group not detectable (nd) 1 – summer, 20 july 2017; 2 – autumn, 26 october 2017; 3 – winter, 8 january 2018; 4 – spring, 7 march 2018 308water sa 49(3) 301–310 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4004 table 8. all-season haa analyses of samples taken from the points determined in the muratpaşa reservoir and connected water network parameter mcaa mbaa dcaa bcaa tcaa dbaa bdcaa cdbaa tbaa haa5 haa9 unit µg▪l−1 point 5 1 36.28 1.79 2.58 * 40.66 40.66 2 0.05 2.08 2.13 2.13 3 4 point 6 1 41.87 1.77 0.00 0.18 43.83 43.83 2 0.21 2.29 2.50 2.50 3 4 point 8 1 43.66 0.65 10.17 0.12 0.47 54.95 55.07 2 0.26 2.21 2.47 2.47 3 4 empty cells mean compound or group not detectable (nd) 1 – summer, 20 july 2017; 2 – autumn, 26 october 2017; 3 – winter, 8 january 2018; 4 – spring, 7 march 2018 the fact that there is not enough chlorine in the water most of the time made it impossible to make a seasonal assessment of haa formation. in both networks, haa components could not be detected in the water in the winter and spring periods. likewise, although the amount of bromide in both water supplies is highest in the winter and spring periods, the absence of haa detection during these periods makes it impossible to evaluate the effect of bromide on haa formation potential. in both networks, the most important haa component was determined as mcaa. in general, the irregularity of chlorination in the networks prevents the evaluation of the residence time in the both networks. however, considering the summer period in which haa types were detected in both networks, the highest haa5 and haa9 concentrations were determined towards the end in the main network and at the last point in the muratpaşa network. the low bromide level in both water sources limits the formation of brominated haas in the water. brominated species were not detected in water for most of the sampling period. risk assessment despite the lack of sufficient chlorination and the low organic matter content in both networks, it was observed that haa species could form and exceed the limit values from time to time. in this context, the effect of consuming these waters on public health in terms of haa compounds was determined through a risk assessment. the measurement of cancer risk for dbps is performed from 3 perspectives: through oral ingestion, dermal absorption, and inhalation exposure. however, since there are only risk factors for oral ingestion of haa components (dcaa and tcaa) in the literature, it is not possible to perform measurements for dermal absorption and inhalation exposure. the oral ingestion-related risk is calculated using the following equation (gan et al., 2013; avşar et al., 2020): cr = cdi pforal oral× (1) cdi cw ir ef et) bw at)oral � � � � � ( ( (2) where: cr is cancer risk from haa component ingestion; cdioral is chronic daily ingestion of that species (oral: mg.kg−1.day−1); pforal is potential factor or slope factor (oral: mg.kg−1.day−1) among the haas examined in the study, there are pforal values for dcaa and tcaa reported in the literature as 0.05 and 0.07, respectively (gan et al., 2013). the variables in eq. 2 and the values used to calculate them are listed in table 9. given the variables in table 9, the measured risk values for the highest concentrations obtained in 2 different water supplies for dcaa and tcaa are given in table 10. according to the epa, a probability of occurrence of an event of more than 1 in 1 million means that the minimum or negligible risk level for that event has been exceeded (gan et al., 2013; avşar et al. 2020). in this context if the estimated cr is greater than 1 million it indicates a health risk. alternatively, multiple rate (mr) values can be estimated using eq. 3. m c r r = ( )1 106× (3) the risk assessment considered the highest concentrations detected in the network to determine the worst case for the haa compounds that were used as the basis for the assessment. in this context, the risk level related to dcaa in the main network was found to be 18.7 times higher for women and 16.5 times higher for men, based on the components for which a risk assessment was performed. since tcaa is not detectable in the network, there is no risk in relation to this component. in the muratpaşa water network, on the other hand, it was observed that the maximum concentration determined for dcaa exceeds the risk level 15.2-fold for women and 13.4-fold for men. the concentration determined in relation to tcaa does not pose a risk for men or women. however, since it was found that the level of free chlorine in the network does not meet the required level, it should be noted that there may be an increase in the risk level if there is adequate chlorination in the supplies. the risk assessment, therefore, should be repeated using values obtained after adequate chlorination in the system. quantitative differences in the variables underlying the calculation for men and women lead to different results, so that the risk values calculated for women are higher at the same concentration. conclusions and recommendations in the study, seasonal changes in water quality parameters in 2 water sources and connected water supplies in muş city center, and haa formation as a result of chlorination, were monitored. both water supplies have undergone many revisions since their construction, but it was not possible to obtain a plan or project on which these revisions were plotted. the networks need to be 309water sa 49(3) 301–310 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4004 table 9. values based on risk assessment variable description unit accepted value in this study reference cw concentration of chemical (haa component) in water mg▪l−1 the highest concentrations measured for the species in 2 different networks to calculate the maximum risk gan et al., 2013 ir ingestion rate l▪day−1 2 gan et al., 2013 ef exposure frequency day▪yr−1 365 gan et al., 2013 et exposure time yr according to tsi statistics for the period of 2014–2016, life expectancy at birth in turkey is generally 78 years, with an average of 75.3 years for men and 80.7 years for women. tsi 2018 bw body weight kg according to tuik 2010 data, the average weight in türkiye was determined as 71.5 kg. while the average weight was 75.8 kg for men, it was determined as 66.9 kg for women. tsi 2010 at average time day average life expectancy expressed in days tsi 2018 table 10. risk assessment results network contaminant dbp concentration (mg▪l−1) cr for women mr for women cr for men mr for men main network dcaa 12.48532 x 10−3 1.8674 x 10−5 18.7 1.647135 x 10−5 16.5 tcaa muratpaşa network dcaa 10.17277 x 10−3 1.52057 x 10−5 15.2 1.342205 x 10−5 13.4 tcaa 0.18424 x 10−3 3.85549 x 10−7 0.4 3.40284 x 10−7 0.3 observable and controllable for the distribution of healthy water. therefore, a sound network plan should be created, first and foremost. the first phase of the study consisted of water quality analyses. chlorine, turbidity, ph, temperature, alkalinity, toc, tn, ammonia, bromide, uv254, conductivity and orp parameters were measured. it was found that several quality parameters can sometimes be outside the limit range given in ts 266. during the monitoring period, adequate and necessary chlorination was not performed in both water supplies. in this context, the chlorination process carried out by the muş municipality in the reservoirs and in the network should be monitored regularly. in addition, due to the frequent power outages, it would be beneficial to support the chlorination plant with a generator. it was observed that the ph falls below 6.5 in winter at point 6 of the muratpaşa network. this is believed to be a local problem that does not affect the entire network, and it would be beneficial to periodically review the network to identify such local problems and develop solutions. turbidity levels exceeded the limit at some locations in both supplies and in the muratpaşa reservoir, especially in the spring season. the high turbidity value in the muratpaşa reservoir indicates that the residence time is not sufficient to allow for solids to settle out or that the reservoir is contaminated or not sufficiently cleaned. in the second phase of the work, seasonal and spatial monitoring for haas in the network was conducted. however, since no chlorine was detected in the water most of the time during the study period, it was not possible to obtain sufficient data to determine the haa formation potential in the water or the spatial variation. in this case, it will be useful to determine the haa formation potential in the laboratory by taking raw water from both reservoirs on a seasonal basis. given the obtained haa measurements, it was noted that: • the haa5 concentration in the central network exceeds the limit from time to time, while the limit is not exceeded in muratpaşa, but haa5 levels may exceed the limits if the necessary chlorination is carried out in both waters. • the limits for mcaa given by the world health organization are exceeded from time to time. • currently, there appears to be a potential risk to women and men from both supplies with respect to the dcaa component via ingestion. acknowledgment we would like to thank bitlis eren university scientific research projects (bebap) for providing resources for the performance of our experimental studies with its support in the project numbered 2017.07. author contributions ea (associate professor) wrote the manuscript, conducted all the experiments and visited facilities. ak (msd student) wrote the manuscript and conducted the experiments. orcids edip avşar https://orcid.org/0000-0001-6249-4753 adile kılıç https://orcid.org/0000-0003-2222-1704 references ateş n, kaplan ş, şahi̇nkaya e, yeti̇ş ü, di̇lek fb and ki̇ti̇ş m (2007) occurrence of disinfection by-products in low doc surface waters in turkey. j. hazardous mater. 142 526–534. https://doi.org/10.1016/j.jhazmat.2006.08.076 https://orcid.org/0000-0001-6249-4753 https://orcid.org/0000-0003-2222-1704 https://doi.org/10.1016/j.jhazmat.2006.08.076 310water sa 49(3) 301–310 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4004 avşar e, toröz i̇, hanedar a and yilmaz m (2014) chemical characterization of natural organic matter and determination of disinfection by-product formation potentials. istanbul ömerli and büyükçekmece surface waters case study. fresenius environ. bull. 23 (2a) 494–501. avşar e, toroz i and hanedar a (2015) physical characterisation of natural organic matter and determination of disinfection by product formation potentials in i̇stanbul surface waters. fresenius environ. bull. 24 (9) 2773–2770. avşar e, deni̇z avşar d and hayta ş (2020) evaluation of disinfection by-product (dbp) formation and fingerprint in a swimming pool in bitlis/turkey: a case study. environ. forensics 21 (3–4) 375–385. https://doi.org/10.1080/15275922.2020.1772413 avşar e and toröz i̇ (2018) seasonal determination and investigation of disinfection by product formation potentials (dbpfps) of surface waters, i̇stanbul ömerli and büyükçekmece case study. anadolu univ. j. sci. technol. b – theor. sci. 6 (1) 22–35. https://doi. org/10.20290/aubtdb.333707 chen c, zhang xj, zhu lx, li̇u j, he wj and han hd (2008) disinfection by-products and their precursors in a water treatment plant in north china: seasonal changes and fraction analysis. sci. total environ. 397 140–147. https://doi.org/10.1016/j. scitotenv.2008.02.032 gan w, guo w, mo j, he y, li̇u y, li̇u w, li̇ang y and yang x (2013) the occurrence of disinfection by-products in municipal drinking water in china’s pearl river delta and a multi pathway cancer risk assessment. sci. total environ. 447 108–115. https://doi.org/10.1016/j.scitotenv.2012.12.091 ghoochani̇ m, rastkari̇ n, nodehi̇ rn, mahvi̇ ah, nasseri̇ s and nazmara s (2013) study on the toc concentration in raw water and haas in tehran’s water treatment plant outlet. j. environ. health sci. eng. 11 (28) 1–6. http://doi. org/10.1186/2052-336x-11-28 golea dm, upton a, jarvi̇s p, moore g, sutherland s, parsons sa and judd sj (2017) thm and haa formation from nom in raw and treated surface waters. water res. 112  226–235. https://doi.org/10.1016/j.watres.2017.01.051 gui̇lherme s and rodri̇guez mj (2014) occurrence of regulated and non-regulated disinfection by-products in small drinking water systems. chemosphere 117 425–432. https://doi.org/ 10.1016/j.chemosphere.2014.08.002 health canada (2008) guidelines for canadian drinking water quality: guideline technical document haloacetic acids. water, air and climate change bureau, healthy environments and consumer safety branch, health canada, ottawa, ontario. özdemi̇r k (2021) investigation of trihalomethane formation after chlorine dioxide preoxidation followed by chlorination of natural organic matter. environ. protect. eng. 47 (2) 125–137. https://doi. org/10.37190/epe210209 özdemi̇r k (2020) chlorine and chlorine dioxide oxidation of natural organic matter in water treatment plants. environ. protect. eng. 46 (4) 87–97. https://doi.org/10.37190/epe200407 rodri̇guez mj, serodes jb and levalloi̇s p (2004) behavior of trihalomethanes and haloacetic acids in a drinking water distribution system. water res. 38 4367–4382. https://doi.org/10. 1016/j.watres.2004.08.018 rodri̇guez mj, serodes j and roy d (2007) formation and fate of haloaceticacids (haas) with in the water treatment plant. water res. 41 4222–4232. https://doi.org/10.1016/j.watres. 2007.05.048 schei̇li̇ a, rodri̇guez mj and sadi̇q r (2015) seasonal and spatial variations of source and drinking water quality in small municipal systems of two canadian regions. sci. total environ. 508 514–524. https://doi.org/10.1016/j.scitotenv.2014.11.069 serodes jb, rodri̇guez mj, li̇ h and bouchard c (2003) occurrence of thms and haas in experimental chlorinated waters of the quebec city area (canada). chemosphere 51 253–263. https:// doi.org/10.1016/s0045-6535(02)00840-8 thompson kc, gillespie s and goslan eh (2015) disinfection by-products in drinking water. royal society of chemistry, cambridge. 368 pp. https://doi.org/10.1039/9781782622710 turkish statistical institute (2010) height and weight statistics. url: http://www.milliyet.com/ (accessed 7 march 2018). turkish statistical institute (2018) life tables 2014-2016. url: http://www.tuik.gov.tr/ (accessed 7 march 2018). usepa (united states environmental protection agency) (1994) national primary drinking water regulations; disinfectants and disinfection byproducts; proposed rule. fed. reg. 59:145:38668. (july 29, 1994). uyak v, özdemi̇r k and toröz i̇ (2007) multiple linear regression modeling of disinfection by-products formation in istanbul drinking water reservoirs. sci. total environ. 378 269–280. https://doi.org/10.1016/j.scitotenv.2007.02.041 uyak v, soylu s, topal t, karapinar n, özdemi̇r k, ozaydin s and avşar e (2014) spatial and seasonal variations of disinfection by products (dbps) in drinking water distribution systems of istanbul city, turkey. environ. forensics 15 (2) 190–205. https://doi.org/10.1080/15275922.2014.890145 https://doi.org/10.1080/15275922.2020.1772413 https://doi.org/10.20290/aubtdb.333707 https://doi.org/10.20290/aubtdb.333707 https://doi.org/10.1016/j.scitotenv.2008.02.032 https://doi.org/10.1016/j.scitotenv.2008.02.032 https://doi.org/10.1016/j.scitotenv.2012.12.091 http://doi.org/10.1186/2052-336x-11-28 http://doi.org/10.1186/2052-336x-11-28 https://doi.org/10.1016/j.watres.2017.01.051 https://doi.org/10.1016/j.chemosphere.2014.08.002 https://doi.org/10.1016/j.chemosphere.2014.08.002 https://doi.org/10.37190/epe210209 https://doi.org/10.37190/epe210209 https://doi.org/10.37190/epe200407 https://doi.org/10.1016/j.watres.2004.08.018 https://doi.org/10.1016/j.watres.2004.08.018 https://doi.org/10.1016/j.watres.2007.05.048 https://doi.org/10.1016/j.watres.2007.05.048 https://doi.org/10.1016/j.scitotenv.2014.11.069 https://doi.org/10.1016/s0045-6535(02)00840-8 https://doi.org/10.1016/s0045-6535(02)00840-8 https://doi.org/10.1039/9781782622710 http://www.milliyet.com/ http://www.tuik.gov.tr/ https://doi.org/10.1016/j.scitotenv.2007.02.041 https://doi.org/10.1080/15275922.2014.890145 water sa 49(3) 230–238 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.3980 research paper issn (online) 1816-7950 available on website https://www.watersa.net 230 correspondence reinhard schroeder email reinhard.schroeder@aecom.com dates received: 9 february 2022 accepted: 24 july 2023 key words hydropower dams electricity renewable energy retrofitting copyright © the author(s) published under a creative commons attribution 4.0 international licence (cc by 4.0) south africa is in a critical power situation and is in dire need of additional generation capacity. thus, renewable energy sources such as wind, solar and hydropower should be evaluated to identify highpotential and cost-effective sites. rivers in south africa, as a water-scarce country, are already heavily impounded, meaning that there are limited sites available for conventional hydropower generation. instead, novel solutions such as retrofitting hydropower installations to existing infrastructure, like existing dams, are required. to estimate the retrofit hydropower potential at dams, a set of five tools was developed using python 3, known as the university of pretoria retrofit hydropower evaluation software (up-rhes). the up-rhes screens potential sites where historic flow records are available, then downloads the required flow records from the national database and performs a first-order hydraulic assessment of the site, as well as a first-order life cycle cost analysis. by applying the up-rhes to 118 dams operated by the department of water and sanitation (dws), it was found that a total estimated hydropower potential of 128 mw with an annual energy output of between 385 and 469 gwh exists at south african dams. the vaal, pongolapoort, goedertrouw and blyderivierpoort dams were found to be feasible sites with a combined capacity of 77 gwh/annum. development of a procedure and tool for retrofit hydropower evaluation at south african dams re schroeder1 , i loots1 , m van dijk1 and gl coetzee1 1department of civil engineering, university of pretoria, pretoria, south africa introduction building upon the widespread adoption of electricity brought about by the 2nd and 3rd industrial revolutions, the world has entered the 4th industrial revolution, and with it has moved into a digital age. as such, commerce, entertainment and education are all moving into the digital environment. hence, reliable energy supply has become the foundation of economic activity (world bank, 2022). despite this, 760 million people still do not have access to electricity, with most of these people living in developing asia and sub-saharan africa (world bank, 2021). this disadvantage is set to compound with the world’s shift into the digital environment, as access to electricity is a prerequisite to the opportunities therein. in particular, south africa is in a critical power situation and is in dire need of additional generation capacity. to accomplish this, attention must be given to identifying and evaluating sites with possible energy generation capabilities, with specific emphasis on evaluating the potential renewable energy available in and around existing infrastructure. this approach minimises the cost of entry for renewable energy, thereby increasing adoption by making full use of the existing infrastructure. this task is already being undertaken with the development of the south african hydropower atlas, wherein water distribution networks, pressure-reducing valves and dams have been identified as possible sites for renewable energy generation using retrofit hydropower, with the latter being the focus of this study (bekker et al., 2021). hydropower evaluation the practice of generating energy using water is relatively simple and has been used since the invention of the water wheel. hydropower is derived from the potential energy of stored water which, when released, can be converted to mechanical power through the use of hydraulic turbines such as pelton, francis, or kaplan turbines. the mechanical power can be used directly or converted to electricity using a generator. however, each conversion induces losses and thus a general efficiency factor is introduced to yield the following equation (bha, 2005): p = ηρqgh (1) where the efficiency, η, density, ρ and gravitational acceleration, g, can be assumed to remain constant. therefore, the flow, q, and available head, h, are the two variables required to evaluate the power, p. these variables are independent of each other but must be analysed simultaneously throughout the year to account for fluctuations caused by seasonal differences. three distinct methods of hydropower evaluation were identified, each of which has a unique approach to estimating the flow and head at a given site. the methods identified were: • duration curve analysis • monthly power computations • optimisation models https://www.watersa.net https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://orcid.org/0000-0002-9145-3632 https://orcid.org/0000-0003-0715-6852 https://orcid.org/0000-0002-3830-526x https://orcid.org/0000-0001-9616-6467 231water sa 49(3) 230–238 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.3980 duration curve analysis is commonly used in hydropower evaluation and provides an estimation of the potential hydropower for a series of exceedance probabilities. duration curves relate either the flow or head to an exceedance probability by ranking their historic sequences and tabulating the number of times a given value was exceeded (gulliver and arndt, 1991). similarly, a site’s historic outflow sequence and its corresponding water level can be used with eq. 1 to generate a power duration curve, in which the power for each entry in the outflow sequence can be calculated and ranked in descending order. this method allows for statistical confidence to be linked to the estimated potential power of the site, which is beneficial in predicting the long-term performance of the site as well as the expected return period of failure. monthly power computations use the average flows and the difference between monthly average headwater and expected tailrace elevations to estimate the average hydropower potential for each month of the year. the method was first noted as a method for retrofit hydropower evaluation by chadderton and niece (1983), who applied the method to estimate the potential at an existing dam in the usa. the method requires only basic datasets of monthly outflow and water level elevations and estimates the hydropower potential based on the current operation of the site. in contrast, optimisation models with an objective function of maximising the annual energy output are used to calculate the theoretical available power for a given inflow exceedance probability, subject to the constraints of irrigation, water supply and ecological releases. this method requires significantly more data than the two alternatives, as sequences of all dam abstractions and inflows must be known. however, this yields an accurate and optimised estimation of the hydropower potential of a site and has been used to estimate the retrofit hydropower potential at african dams by sule et al. (2018), but is not included in the scope of this study. development of evaluation tool to allow for a rapid and realistic first-order estimation of the retrofit hydropower potential at south african dams, a set of 5 tools was developed using python 3, which is a general-purpose programming language with an emphasis on code readability. these 5 tools are known as the university of pretoria retrofit hydropower evaluation software (up-rhes). the up-rhes was developed to identify and evaluate the maximum energy available at south african dams, using their current discharge volumes without considering changing the current operation of the dams. this was done by adapting historic flow and water level data provided by the south african department of water and sanitation (dws), which maintains a database of verified data on south africa’s water infrastructure. duration curve analysis and monthly power computations were included in the up-rhes. however, optimisation, as given by sule et al. (2018), could not be included as various datasets required to generate the optimisation model were unavailable. this is a shortcoming of optimisation models in developing countries, where consideration for data capturing and availability is often not a priority. to create a user-friendly environment, each tool is presented using a user interface, and only standard python libraries were used in the development of the up-rhes to ensure that the tools will run regardless of differences in python installations. the tools that comprise the up-rhes are as follows: • an initial screening tool that considers some of the environmental and social impacts that may make a site unfeasible • a dataset downloader that automates the process of downloading datasets from the dws’s website • a rapid assessment tool • a scenario assessment tool • a life cycle cost analysis (lcca) tool that determines the feasibility of a site at the pre-feasibility level the up-rhes identifies and evaluates the maximum energy available at south african dams, at the pre-feasibility level, through a 4-step procedure. the procedure begins by identifying a dam and a release point from the said dam, which is then screened using the initial screening tool to determine whether further investigation of the site is worthwhile. this is followed by a rapid assessment of the hydropower potential at the site, which can be used as starting point for the scenario assessment tool or indicate that the site is unfeasible. finally, the scenario assessment tool and lcca tool are used in tandem to evaluate and maximise the feasibility of retrofitting the site through iterative adjustments of the design scenario. it should be noted that any hydro-installation would be site specific and requires tailored engineering analysis to assess the viability of each site, for various layouts and equipment. the uprhes is not an alternative to the engineering design process, but rather serves as supplementary software to filter out sites that are not considered viable. furthermore, retrofitting hydroequipment into any dam wall involves inherent dam safety risks. a comprehensive dam safety analysis would be required during the feasibility stage for any site under consideration. the up-rhes is available to download, without cost, from the following link: https://tinyurl.com/uprhes and is compatible with windows, linux and macos devices. this requires the installation of python without cost, from https://www.python. org/downloads/. initial screening tool the initial screening tool determines whether further investigation of a site is worthwhile by eliminating unfeasible sites through a series of questions based on the environmental and social viability procedure developed by van vuuren et al. (2011), specifically for retrofit hydropower installations at south african dams. the first set of questions is obvious, such as if there is a demand for electricity at the site and whether an agreement can be made with the dam owner. the second set of questions is a checklist of positive impacts that may be achieved during hydropower development. finally, the third and fourth sets of questions are checklists of the possible environmental/social impacts that may be experienced during and after the construction of a hydropower station. the site is deemed feasible so long as all the following criteria are met: • there is at least one positive impact • none of the environmental/social impacts has a rating of very high • less than half of the environmental/social impacts have a rating of high dataset downloader during the development of the up-rhes, it was found that downloading the required datasets from the dws website can be tedious. thus, the dataset downloader was developed to automate the process of downloading the required datasets. when making a request using the dws website, the inputs specified by the user are used to generate a uniform resource locator (url) that opens a web page containing the required dataset. by manipulating the https://tinyurl.com/uprhes https://www.python.org/downloads/ https://www.python.org/downloads/ 232water sa 49(3) 230–238 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.3980 separate components of the url, the dataset for any combination of site, date and data type can be requested and stored. this process is repeated to create the entire dataset, or until there is a significant data gap that results in no data being available for that period. in that case, the downloader must be restarted using the next available date. this was left unautomated, as recognising the frequency of data gaps in a dataset is important in determining the quality of the dataset. if the error is frequently encountered for a station, it suggests that the quality of the dataset may be poor, and it may be necessary for the user to investigate the data quality before analysing the data. rapid assessment tool the rapid assessment tool is the first of the two stages of hydropower evaluation used in the up-rhes and estimates the hydropower potential at a dam using monthly power computations, as proposed by chadderton and niece (1983). average monthly power computations provide a useful breakdown of the expected hydropower available throughout the year and are calculated using the monthly average volume that flows through a release point of a dam and the average monthly water level as a percentage of the height of the dam wall. during the procedure the tool assumes the density of water (calculated from the fluid’s temperature), gravitational acceleration and efficiency of the turbine; however, these can be overwritten by the user – the default values are listed in table 1. the tool begins by importing the dataset and excluding any nonnumeric characters, such as ‘#’ or ‘+’, that indicate approximated or missing values. however, the dataset may still be of poor quality and it is recommended that the user inspects the dataset for repeated numbers, data gaps, excessive variance and rounded values to ensure the dataset is of sufficient quality. using the imported dataset, the average volume for each month is calculated and converted to flow by assuming that the flow is constant throughout the month. while the assumption fails to account for the timing of the releases it does provide a firstorder estimate of the hydropower potential, which may aid in identifying high-potential sites. therefore, a filter is imposed to provide a more realistic estimation of the energy available throughout the year. first, the average volume and standard deviation of the imported dataset are calculated, an upper limit is calculated using eq. 2, and values that exceed the upper limit are set to the average. this removes outliers, which are representative of floods, to better represent the potential of the site under normal conditions. equation 2 is an empirical simplification of the hypothesis testing procedure for a normal distribution, where 68, 95, and 99.7% of the values should lie within 1, 2 and 3 standard deviations from the mean, respectively. next, the average and standard deviation of the months adjacent to the month with the maximum average volume are calculated. the midpoint of these values is used to calculate a new upper limit, using eq. 2, and the values that exceed the upper limit are set to the midpoint of averages. this is done to limit the difference in estimated flow between subsequent months to generate a more realistic expectation of the power available throughout the year. ul = average + 3 x standard deviations (2) where: ul = upper limit finally, the theoretical power available at the dam is calculated using eq. 1, by assuming the average volume occurs evenly throughout the month. this results in an estimated hydropower potential and theoretical average energy output for each month. the theoretical hydropower potential of the site is taken as the theoretical power in the maximum month and the potential annual energy is calculated as the sum of the monthly energy outputs. scenario assessment tool the scenario assessment tool is used to evaluate the potential energy output for a given hydropower installation scenario. the tool estimates the amount of energy recoverable for a given combination of turbines by calculating the power duration curve for the site, based on the available historic flow and water level datasets, and evaluating how often the turbine combination can capture the available energy. the tool generates a daily power duration curve, wherein the flow is taken as the daily average flow of the release point of the dam and the head is calculated as the daily average height between the water level in the dam and the centreline of the turbine, assumed to be installed near the base of the dam wall and discharging to atmospheric pressure. during the calculations, the tool again assumes the parameters as presented in table 1, with the user having the ability to override the default values. additionally, the tool allows for the input or calculation of the head loss in the system using either a percentage of the total head or with darcy-weisbach with von kármán and prandtl, shown in eq. 3, in which the terms represent the friction and local losses, respectively (chadwick et al., 2013): head loss = l 2 + 2 2 2λ v gd k v g (3) and: 1 = 2 log 3.7 s� d k � � � � � � (4) where: v = velocity (m/s) d = pipe diameter (m) ks = absolute roughness (mm) l = length of pipe (m) k = local head loss coefficient similar to the rapid assessment tool, the scenario assessment tool begins by importing the required datasets while excluding any non-numeric characters, such as ‘#’ or ‘+’, which indicate table 1. assumptions parameter assumed value water temperature 20°c gravitational acceleration 9.81 m/s2 efficiency* < 20 kw 60% 20–100 kw 60–70% 100–500 kw 70–80% 500–1 000 kw 80–85% > 1 000 kw 85% *efficiencies obtained empirically from south african hydropower installations. efficiency is typically increased through tighter tolerances on the turbine runner seal rings, turbine pit wear plates, and by modifying the design of the wicket gates and reducing the wicket gate camber profile. the impact of mechanical losses is greater on smaller turbines than on larger systems. 233water sa 49(3) 230–238 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.3980 approximated or missing values, and it remains the user’s responsibility to review the quality of the dataset as discussed above. a daily power table is then generated using the primary dataset of the dam, which contains water levels relative to the crest of the spillway, recorded several times each day. the average of these is calculated and matched to the corresponding average flow, from the gauging station of the abstraction/release point, for the same date. the available head and average flow are used to calculate the theoretical power for each day using eq. 1 and a power duration curve is generated by ranking the theoretical daily power outputs in descending order. the exceedance probability for the theoretical daily power on the power duration curve is calculated as the quotient of the daily power’s rank and the total number of entries in the curve. it represents the amount of time according to the historic record that a theoretical power is available. for example, the 100% exceedance probability represents the minimum power estimated, however, this power is available 100% of the time, whereas the ~0% exceedance probability represents the maximum power estimated which only occurred once in the historic record, equivalent to being available ~0% of the time. thus, an energy curve is generated by multiplying the theoretical power, on the power duration curve, by its exceedance probability and the number of hours in a year (8 760 h). this allows the annual energy output for a given power to be read off the energy curve. additionally, the energy curve allows for the determination of the optimal point, wherein maximum energy output is achieved for a fixed power rating, as shown in fig. 1. the optimal point on the energy curve represents the maximum energy potential of the hydropower installation scenario if a single turbine was used. combinations of turbines can operate at multiple power ratings; for example, an installation scenario of three 1 mw turbines could operate at 1, 2 and 3 mw, respectively. the scenario assessment tool accounts for this by estimating the annual energy output of the installation as the sum of the energy outputs for each turbine combination. this is done by adding the respective energy outputs for each power rating that the turbine combination can operate at. additionally, turbines, much like pumps, can operate within a narrow range around their respective duty points. as such, the user may specify an operating allowance, which is the percentage of the turbine’s rated power by which it may deviate below its rated power. the tool then calculates the energy output for each power value of each combination’s operating range, as shown in fig. 2. in this case, the energy for power ratings below that of the rated power is calculated using an exceedance probability, which is the difference between the subsequent exceedance probabilities. for example, in the case of the rated power of 1 mw having an exceedance probability of 20%, energies for the turbine operating at 0.9 mw are calculated as its exceedance probability, say 21%, minus the previous exceedance probability, to yield a value of 1%. finally, the tool does not allow operating ranges for different turbine combinations to overlap, by requiring that the number of turbines be greater than the inverse of the operating allowance. multi-turbine operation allows the installation to operate across a wider range of the power duration curve, albeit operating at higher power ratings less frequently. however, this should be constrained against the installation costs as, while it may be possible to install a multi-turbine installation that can operate across the entire power duration curve, this would be costly and may be suboptimal. for this reason, the scenario assessment tool should be used in tandem with the lcca tool to determine the most cost-effective installation scenario. lcca tool the final tool in the up-rhes is the life cycle cost analysis (lcca) tool. the tool performs an economic assessment and determines, as a first-order assessment, the feasibility of the site. this is done by estimating the life cycle costs and benefits and, by using those values, calculating the net present value (npv), benefit-cost (b/c) ratio, levelized cost of energy (lcoe) and internal rate of return (irr) of the proposed project. the up-rhes is a pre-feasibility analysis tool; however, economic analysis and prediction at a pre-feasibility level are often inaccurate. this is due to the use of generalised costing functions and by assuming that economic drivers, such as the inflation rate, are constant throughout the project. however, accurately estimating the final costs and benefits of a project is not the point of a pre-feasibility analysis; rather a general estimation of the magnitude and proportions of the costs and benefits is desired. this allows for feasible sites to proceed to feasibility and detailed levels of analysis, wherein an accurate estimation of the costs and benefits can be developed. figure 1. power duration curve with corresponding energy curve 234water sa 49(3) 230–238 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.3980 therefore, the lcca tool was developed by calibrating the estimated costs using real values of retrofit hydropower projects undertaken in south africa as presented by van vuuren et al. (2011), namely sol plaatjie dam and the estimated costs of retrofitting the vaal dam according to the vaal hydro report. the values of these projects were brought forward using an inflation rate of 6%, and the costs generated by the tool were calibrated such that they underestimate the costs compared to the ‘real’ values, with minimal errors, while reporting similar project feasibilities based on the irr. by underestimating the costs of the project, the tool is more likely to suggest that the site is feasible. this was done to avoid a false negative error, where a feasible site is deemed unfeasible and does not proceed to more detailed levels of analysis. furthermore, retrofit hydropower is a relatively new field of interest, especially in south africa, with very few publications available on estimating costs and benefits, thus the calibration was applied to the broad costs of construction, planning and operation and maintenance. the electromechanical cost for each turbine is estimated according to the formulas proposed by cavazzini et al. (2016), shown in eq. 5 and table 2, brought forward 5 years with an inflation rate of 6% and converted to south african rands (zar) using the inputted zar/euro conversion rate, which by default is set to 17 zar/€, but can be adjusted by the user as needed. it was assumed that in retrofit hydropower installations, the civil works cost will be less than the cost of the electromechanical equipment. thus, the civil works are estimated at 77% of the electromechanical costs (eq. 6), using the cost breakdown illustrated by ogayar and vidal (2009). during calibration it was found that the cost functions by cavazzini et al. (2016) underestimated the total construction costs for south african projects, thus an adjustment factor was introduced, such that the total construction costs estimated by the tool matched those of the calibration sites, as shown in eq. 7. the adjustment that resulted in an underestimation of the costs with minimal errors was found to be a factor of 4, shown in eq. 8. the underestimation was likely due to the costing functions not considering the import, installation and escalation costs of the electromechanical equipment. cem = ah b + cq d + ep f + g (5) ccivil = 0.77cem (6) and: cconstruction = cem + ccivil + adjustment (7) adjustment = 4(cem + ccivil) (8) where: c = costs (zar; 2021) h = net head (m) q = design flow rate (l/s) p = design power (kw) a, b, c, d, e, f and g = coefficients using the electromechanical costs, the lcca tool estimates the planning costs of the project including design and licensing fees. the lcca tool assumes that a basic assessment report (bar) will be required for all sites, while only sites with a theoretical available power greater than 20 mw will be subject to an environmental impact assessment (eia). additionally, the tool assumes no water use licence will be required as a retrofit hydropower station would be an extension of a current operation that should already be in possession of a licence (or should only require general authorisation). annual operation and maintenance are calculated by the tool as the sum of the civil maintenance, electromechanical maintenance, operating costs, insurance and water use tariffs. the default unit sale price of the electricity generated is set to 1.2 zar/kwh, based on eskom’s current ruraflex rate (eskom, 2021), and may be adjusted by the user as needed. the annual revenue is then calculated as the unit sale price multiplied by the annual energy output of the site. finally, the tool calculates the npv of costs and benefits, respectively, by assuming the construction costs to take place in year 1, and operation and maintenance costs as well as revenue to begin in year 2. the estimates of the costs occurring in year 0 are inflated using the inputted inflation rate, while the annual revenue is increased using a separate energy escalation rate. the estimated costs and benefits for each year in the expected life of the project are brought back to a present value using a geometric annuity, as shown in eqs 9 and 10, for a distinct discount rate. figure 2. example of daily power variations over a month 235water sa 49(3) 230–238 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.3980 pv = 1 1 + 1 + a i r r i n n �� � � � � (9) in the case where r = g: pv = + a r n 1 (10) where: pv = present value of the annuity (zar) a = annuity ( zar annum ) i = growth rate of annuity (%) r = discount rate (%) n = years once the npv of costs and benefits are known, the npv, b/c, lcoe and payback period are calculated. the irr is then calculated by repeating the calculation using an increasing discount rate until the npv reaches a value of 0, with that discount rate being the irr. application of the up-rhes: methodology using the up-rhes, a first-order estimate of the retrofit hydropower potential of south africa’s dams was made. the approach was designed to estimate the total retrofit hydropower potential at south african dams, identify high-potential dams, and estimate the general feasibility of retrofitting south african dams with hydropower installations. the approach began by using the rapid assessment tool of the uprhes to estimate the total latent hydropower at south african dams. this was done by downloading the monthly volume datasets for each dam operated by the dws. datasets were downloaded for the downstream/w-component of each dam, as the flows over the w-component represent the outflows leaving the dam through either the spillway or environmental releases, which if passed through a turbine could generate hydropower, and were assumed to account for the majority of the outflow. however, several dams’ datasets were not available and therefore were excluded from the analysis. this left 118 dams suitable for analysis, which were spread throughout the country. from the rapid assessment, the 10 dams with the greatest potential were identified and included with dams shortlisted by the department of energy (doe) and presented in the national water resource strategy 2 (dwa, 2013). these dams accounted for most of the estimated total potential and as such were subjected to a second round of analysis using the scenario assessment tool. furthermore, the high-potential dams were grouped according to their respective river systems to identify high-potential dams that may be dependent on the performance of upstream dams. finally, the results of the scenario assessment tool were used to perform a lcca and sensitivity analysis on each of the highpotential dams to estimate the economic feasibility of retrofitting hydropower at south african dams. this was done by calculating the irrs and average lcoe of the high-potential dams and comparing the lcoe to those of alternative energy sources such as wind, solar and coal. dam wall heights are available from both dws and sancold registers; however, the heights presented vary between the two and are significantly different from those observable using satellite imagery. this was likely due to the depth of the foundation not being known. to account for this, the average monthly water levels for each dam were taken from the expected percentage of storage under very-low conditions, available from the dws website, and the heights of dam walls were taken from the sancold register. the efficiency was initially set to 100% to provide an estimation of the magnitude of power at a site, which was then used to select a general efficiency as per the ranges shown in table 1. during the scenario assessment, it was assumed that the height between the spillway crest and turbine centreline would be equal to the height of the dam and that a 2% head loss would occur. finally, the economic assessment was conducted for energy escalation, inflation and discount rates of 4, 8, 12 and 16%, and for each combination thereof, with additional assumptions, as follows: • a design life of 20 years • exchange rate of 17 zar/euro • an initial electricity sale price of 1.2 zar/kwh application of the up-rhes: results the initial analysis, assuming an efficiency of 100%, estimated the retrofit hydropower potential of south african dams to be 128 mw with a gross annual energy output of 567 gwh. once the efficiencies (table 1) relevant to each site were applied, the retrofit hydropower potential of south africa reduced to 108 mw with a gross annual energy output of 478 gwh. one of the main benefits of storage hydropower is its ability to provide peak clipping during periods of fluctuating demand. however, only two dams (boegoeberg and spioenkop) showed a potential greater than 10  mw. this suggests that there are no dams, among those that do not currently have hydropower installations, that can stabilise south africa’s power supply directly. furthermore, 19.5% of the dams analysed had a potential greater than 1 mw, which accounted for 88% of the total estimated retrofit hydropower potential. this is illustrated in table 3 and supported the decision to focus the energy and economic feasibility assessments on the top performing sites alone. the theoretical power and annual energy output of the 17 highpotential sites are listed in table 4. the 17 high-potential sites were table 2. costing function coefficients (adapted from cavazzini et al., 2016) coefficient pelton francis kaplan a 30 909 686 4 331 3 169 464 b 0.014 1.28 0.0216 c 193 142 32 796 395 1.45 d 0.515 0.0306 1.456 e 76 942 219 3 531 396 f 0.416 1.28487 0.11 g −33 650 653 −36 890 471 −6 871 319 236water sa 49(3) 230–238 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.3980 a combination of the 10 sites with the highest theoretical power outputs and the sites shortlisted by the doe in the national water resource strategy 2 (dwa, 2013). two dams were excluded from the shortlisted dams: ncora dam and de hoop dam. ncora dam was excluded as it has been fitted with a hydropower station and de hoop dam was excluded due to a poor dataset. next, the energy available at the high-potential dams was reevaluated using the scenario assessment tool for the turbine size (power rating) recommended by the rapid assessment tool. additionally, the scenario assessment tool produced an optimal turbine power rating that results in maximum energy generation for single turbine installations. however, 6 of the high-potential sites did not have the required datasets available and thus were excluded from the second round of the analysis. these dams were boegoeberg, driel barrage, welbedacht, bloemhof, elandsdrift and kwena. in 9 of the remaining 11 high-potential sites, the scenario assessment tool drastically reduced the theoretical annual energy available and at sites where an increase was found, it was slight. on average the energy reduced with a factor of 0.68, which would suggest that the total annual energy output of south african dams would be between 385 and 420 gwh. however, under the optimal power rating, the range rises to be between 447 and 469 gwh. the results of the scenario assessment are shown in table 5. table 4. high-potential hydropower sites (adapted from dwa, 2013) dam name height of dam wall (m) power (mw) energy (gwh/annum) boegoeberg 12 29.7 131.7 spioenkop 53 10.9 35.7 blyderivierpoort 71 6.1 29.3 vaal 63 6.0 34.4 pongolapoort 89 4.7 27.9 wagendrift 41 4.5 15.2 driel barrage 23 4.5 16.5 vaalharts weir 11 3.3 17.3 welbedacht 32 2.7 11.4 inanda 65 2.6 13.0 vygeboom 48 2.4 8.3 bloemhof 33 1.6 6.6 bergriver 60 1.1 4.7 goedertrouw 88 1.0 5.4 albert falls 33 0.79 3.4 elandsdrift 26 0.77 3.7 kwena 52 0.54 2.9 italics indicate dams shortlisted by the doe table 3. retrofit hydropower potential per hydropower size size efficiency range (%) count efficiency applied (%) pico (< 20 kw) 60 33 60 micro (20–100 kw) 60–70 26 70 mini (100–500 kw) 70–80 25 80 mini (500 kw–1 mw) 80–85 11 85 small (1–10 mw) 85 21 85 large (> 10 mw) 85 2 85 table 5. scenario assessment results dam name rapid assessment scenario optimal point power (mw) energy (gwh/annum) power (mw) energy (gwh/annum) spioenkop 10.9 15.7 25.6 18.7 blyderivierpoort 6.1 14.8 4.9 18.7 vaal 6.0 37.4 5.9 37.7 pongolapoort 4.7 19.0 4.2 22.2 wagendrift 4.5 5.5 3.7 5.7 vaalharts weir 3.3 4.6 20.2 8.7 inanda 2.6 5.5 7.9 6.9 vygeboom 2.4 5.6 5.2 7.0 bergriver 1.1 2.4 1.9 2.9 goedertrouw 1.0 5.8 1.4 6.6 albert falls 0.79 4.7 0.94 4.9 237water sa 49(3) 230–238 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.3980 plotting the location of each of the high-potential sites yielded fig. 3, in which 3 river systems were found to have highpotential sites that were upstream of each other. consequently, the hydropower potential of these sites may be dependent on the performance and demands of the upstream and downstream sites. further investigation is required to accurately predict the potential of these sites, which was outside the scope of this study. the three river systems were as follows: orange river, thukela river and mgeni river. the orange river contains 4 high-potential dams, beginning with the vaal dam and then followed by bloemhof dam and vaalharts weir before ending at boegoeberg, which is indirectly supplied by welbedacht dam. the thukela river contains 2 high-potential dams, starting with driel barrage and ending at spioenkop dam, with wagendrift being situated close to both, along a tributary of the thukela. the mgeni river contains 3 high-potential sites, beginning with albert falls dam and ending at inanda dam; however, midmar dam, upstream of albert falls, also showed a significant potential of 0.98 mw and 2.94 gwh per year, and thus was also included in the high-potential sites. finally, a lcca and sensitivity analysis was conducted using the up-rhes to estimate the economic feasibility of retrofit hydropower in south africa. the analysis was conducted on the high-potential sites for two alternatives: firstly, using the turbine size (power rating) recommended by the rapid assessment tool with the adjusted energy output suggested by the scenario assessment tool and, secondly, using the optimal single turbine scenario. this was then repeated for each combination of energy escalation, inflation, and discount rates of 4, 8, 12 and 16%. the first alternative resulted in only the pongolapoort and vaal dams being feasible under a variety of economic conditions, with irrs ranging from 7 to 38%. once the energy escalation rate exceeded 12% most of the sites were feasible, except for bergriver, inada, spioenkop, vaalharts weir and wagendrift, which were only feasible under ideal circumstances. however, most sites became infeasible once the inflation rate equalled or exceeded the energy escalation rate, with the only exceptions being the pongolapoort, vaal, blyderivierpoort and goedertrouw dams. the second alternative, for optimal single turbine installations, resulted in similar behaviours to the first alternative, with slight differences in irrs. plotting the trend of the energy escalation and inflation rates on the irrs, as shown in fig. 4, indicates that the feasibility is predominantly affected by the relationship between the energy escalation and inflation rates. usually this is irrelevant as the energy escalation and general inflation rates would behave similarly; however, in south africa the cost of energy has drastically increased compared to the general inflation rate, with energy escalation rates averaging 15% (eskom, 2021). this suggests that retrofit hydropower may be feasible at south african dams, under the condition that the energy escalation rate stays significantly higher than the general inflation rate. the high-potential sites had an average lcoe of 2.4 zar/ kwh, which is well above the global average for hydropower of 1.05 to 1.64  zar/kwh, as well as for the average cost of wind, solar and coal in south africa of 0.62, 0.62 and 1.03 zar/kwh, respectively (bofinger and stander, 2017). however, the feasible sites had significantly lower average lcoes of 0.65, 1.11, 1.6 and 1.68 zar/kwh for the vaal, pongolapoort, goedertrouw and blyderivierpoort dams, respectively. conclusions the assessment showed that south african dams have a significant latent hydropower potential, with a total estimated hydropower potential of 128 mw with a theoretical energy output of between 385 and 469 gwh/annum. however, most of this potential came from a minority of the analysed dams, with only 23 of the 118 analysed dams exceeding 1 mw in hydropower potential. furthermore, the feasibility of the high-potential sites is dependent on the energy escalation rate exceeding general inflation rates and, in comparison to alternative forms of renewable energy, retrofit hydropower seems to be prohibitively expensive in many cases. therefore, the doe’s focus on solar and wind power is warranted for widespread energy generation. figure 3. high-potential sites 238water sa 49(3) 230–238 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.3980 however, the vaal, pongolapoort, goedertrouw and blyderivierpoort dams were found to be economically feasible under a wide range of conditions, with a combined energy generation capacity of 77 gwh/annum. thus, retrofitting the vaal, pongolapoort, goedertrouw and blyderivierpoort dams may provide a substantial contribution to south africa, a country in dire need of additional generation capacity, and these sites should be analysed in greater detail. acknowledgements the authors would like to thank the south african water research commission (wrc), who funded the project, and the university of pretoria for their permission to publish this paper. the opinions and views presented in this paper are, however, those of the authors and do not necessarily reflect those of the wrc nor those of the university of pretoria. author contributions re schroeder: conceptualisation of methodology, data collection, interpretation of results, and writing of the draft. i loots: revision of methodology and draft. m van dijk: conceptualisation of the project and revision of the draft. gl coetzee: revision of methodology and draft. orcids reinhard schroeder https://orcid.org/0000-0002-9145-3632 ione loots https://orcid.org/0000-0003-0715-6852 marco van dijk https://orcid.org/0000-0002-3830-526x louis coetzee https://orcid.org/0000-0001-9616-6467 references bekker a, van dijk m, coetzee gl and hansen c (2021) the development of the south african hydropower atlas. in: sancold 2021 annual conference: resilient dams in a challenging environment, 2–4 november 2021, pretoria. bofinger, s. and stander, j.n (2017) lcoe estimation in aggregated wind/pv study. in: windaba 2017, 15–16 november 2017, cape town. bha (british hydropower association) (2005) a guide to uk minihydro developments. the british hydropower association, wimborne, uk. cavazzini g, santolin a, pavesi g and ardizzon g (2016) accurate estimation model for small and micro hydropower plants costs in hybrid energy systems modelling. energy. 103  746–757. https://doi.org/10.1016/j.energy.2016.03.024 chadderton ra and niece ja (1983) retrofit of hydropower capacity at conemaugh dam. water resour. bull. 19 (1) 101–106. https://doi.org/10.1111/j.1752-1688.1983.tb04564.x chadwick a, morfett j and borthwick m (2013) hydraulics in civil and environmental engineering (5th edn). crc press, boca raton. https://doi.org/10.1201/b14556 dwa (department of water affairs, south africa) (2013) national water resource strategy. june 2013 second edition. department of water affairs, pretoria. eskom (2021) tariffs & charges 2021/2022. eskom, south africa. gulliver js and arndt rea (1991) hydropower engineering handbook (1st edn). mcgraw-hill, united states of america. ogayar b and vidal pg (2009) cost determination of the electromechanical equipment of a small hydro-power plant. renewable energ. 34 (6) 6–13. https://doi.org/10.1016/j.renene.2008.04.039 sule bf, adunkpe tl and salami aw (2018) evaluation of the reservoir yield and hydropower potential of the doma dam, nasarawa state, north central nigeria. int. j. technol. 1 16–24. https://doi.org/10.14716/ijtech.v9i1.1194 van vuuren sj, blersch cl and van dijk m (2011) modelling the feasibility of retrofitting hydropower to existing south african dams. water sa 37 (5) 679–692. https://doi.org/10.4314/wsa.v37i5.5 world bank (2021) access to electricity (% of population). url: https://data.worldbank.org/indicator/eg.elc.accs.zs?end=2019& name_desc=false&start=2019 (accessed 16 september 2021). world bank (2022) electricity availability and economic activity: lessons from developing countries. url: https://www.worldbank. org/en/events/2020/09/22/electricity-availability-and-economic-act ivity#1 (accessed 9 september 2021). figure 4. internal rate of returns for different energy escalation and inflation rate combinations https://orcid.org/0000-0002-9145-3632 https://orcid.org/0000-0003-0715-6852 https://orcid.org/0000-0002-3830-526x https://orcid.org/0000-0001-9616-6467 https://doi.org/10.1016/j.energy.2016.03.024 https://doi.org/10.1111/j.1752-1688.1983.tb04564.x https://doi.org/10.1201/b14556 https://doi.org/10.1016/j.renene.2008.04.039 https://doi.org/10.14716/ijtech.v9i1.1194 https://doi.org/10.4314/wsa.v37i5.5 https://data.worldbank.org/indicator/eg.elc.accs.zs?end=2019&name_desc=false&start=2019 https://data.worldbank.org/indicator/eg.elc.accs.zs?end=2019&name_desc=false&start=2019 https://www.worldbank.org/en/events/2020/09/22/electricity-availability-and-economic-activity#1 https://www.worldbank.org/en/events/2020/09/22/electricity-availability-and-economic-activity#1 https://www.worldbank.org/en/events/2020/09/22/electricity-availability-and-economic-activity#1 water sa 49(3) 251–259 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4023 research paper issn (online) 1816-7950 available on website https://www.watersa.net 251 correspondence pfananani ramulifho email pfananani.ramulifho@gmail.com dates received: 18 september 2022 accepted: 19 june 2023 key words bioindicator ecological integrity mayflies reference condition water temperature copyright © the author(s) published under a creative commons attribution 4.0 international licence (cc by 4.0) with water quality deteriorating rapidly at a global scale, river sections suited to serve as reference sites are being increasingly lost. it thus becomes critical to develop rapid methods to confirm that previously monitored sites continue meet the requirements of reliable reference sites. in the absence of pristine sites, 9 near-natural sites, as defined by the kleynhans (1996) classification, were used as reference sites for the luvuvhu river catchment to compare the quality of physico-chemical factors against a biological metric. baetid mayfly community structure at a site was chosen as an index of water quality, since this family is common in all types of freshwaters, highly diverse and adapted to unpolluted running water. baetid larvae were sampled monthly from stones-in-current biotopes across 9 sites for over 1 year, between december 2016 and january 2018. a spearman’s correlation test was used to evaluate the relationship between physicochemical factors and identify redundant variables. water quality standards were measured against the national water quality guidelines for aquatic ecosystems. we used a generalized linear model to determine the effect of physico-chemical variables on baetid species, and canonical correspondence analysis to show the relationships between baetid species, sites, and physico-chemical variables. a total of 3 039 individuals belonging to 12 mayfly species were recorded. our findings indicated that while the physico-chemical factors were highly variable, they were within favourable ranges to reflect reference site conditions. while water temperature was the most important driver of baetid community structure in general, as it negatively affected their abundances, a subset of species (pseudoponnota sp., pseudocloeon sp., acanthiops varius and demoulinia crassi) showed clear responses to changes in tds and stream width. we conclude that specific baetid species show good potential as biological indicators of reference sites and chronic water temperature stress, making assessment of reference sites easier. relationships between reference site quality and baetid mayfly assemblages in mountainous streams of the luvuvhu catchment, south africa pfananani ramulifho1 , nick rivers-moore2,3 and stefan foord4 1department of environmental sciences, florida science campus, university of south africa, south africa 2centre for water resources research, university of kwazulu-natal, pietermaritzburg, south africa 3freshwater research centre, cape town, south africa 4chair in biodiversity value and change in the vhembe biosphere reserve, department of zoology, university of venda, thohoyandou, south africa introduction despite the recognized importance of rivers in providing critical services to both humans and natural organisms, their water quality is deteriorating at an alarming rate due to human activities (tampo et al., 2020). worldwide, the quality of water in rivers is increasingly threatened (dudgeon et al., 2006), most specifically those in developing countries, due to industrialization, urbanization processes, and constant changes in land uses (lópez-lópez and sedeño-díaz, 2015). the quality of river and stream water is very sensitive to anthropogenic influences (urban, industrial and agricultural activities, and increasing consumption of water resources), as well as natural processes like soil erosion and weathering of the earth’s crustal material (croijmans et al., 2020; rashid and romshoo, 2013; hamid et al., 2020). in south africa, extensive efforts of monitoring both the ecological and water quality conditions of rivers using nationally approved indices (e.g., river eco-status monitoring programme formerly known as the river health programme, also the rapid habitat assessment methods and models, etc.) is the responsibility of the resource quality information services directorate of the national department of water and sanitation (dws). in the 60-year long records, time-series data show a growing deterioration of water quality that needs to be addressed more vigorously (pitman, 2011). this is also reflected in the most recent national ecosystems and biodiversity status report, which indicated that the condition of natural river ecosystems has declined by 11% between 1999 and 2011 (skowno et al., 2019). from the 222 stream ecosystems assessed in south africa, 64% were found to be threatened and 43% among them were critically endangered. similarly, in some developed countries, such as australia, the united states of america, and some european countries, the monitoring of streams is a government obligation (lópez-lópez and sedeño-díaz, 2015; couceiro et al., 2012). sustained action needs to be taken worldwide to prevent further deterioration of rivers, failure of which might pose a health risk to aquatic life and people. a key issue in the management and biomonitoring of aquatic systems is the establishment of reference conditions against which to assess change and ecological trends over time (mcdowell at al., 2013). a practical definition of ‘reference condition’ is the chemical, physical and biological conditions that can be expected in streams and rivers with minimal or no anthropogenic influence (soranno et al., 2011). reference condition provides a baseline from which to compare changes in water quality parameters and biological composition. there is a range of methods used to estimate reference conditions, as mentioned in mcdowell at al. (2013). however, in all the methods, the https://www.watersa.net https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://orcid.org/0000-0002-1589-7899 https://orcid.org/0000-0002-6546-4215 https://orcid.org/0000-0002-9195-2562 252water sa 49(3) 251–259 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4023 biological community of a stressed or disturbed ecosystem is compared with that of relatively undisturbed reference sites that have similar environmental conditions, when assessing the impact of disturbance in multiple sites (kaboré et al., 2018). if the test-site community differs from the reference condition site, the conclusion can be drawn that the site is impacted (reece and reynoldson, 2001). stream sections that are best suited to serve as reference condition are increasingly challenging to locate because of increasingly widespread anthropogenic impacts across catchments (soranno et al., 2011). many studies make ecological inferences based on the degree of water quality as reflected by the presence or absence of aquatic organisms (aazami et al., 2015; varnosfaderany et al., 2010; venkatesharaju et al., 2010; beyene et al., 2009; sharma and rawat, 2009). there are several good reasons why macroinvertebrates are useful as indicators of the reference conditions of rivers. these reasons include their persistence across seasons, their species diversity, and ubiquitous occurrence in almost all types of the world’s freshwater ecosystems (buss and salles, 2007). amongst the macroinvertebrate taxa found in the tropics and the southern hemisphere, baetidae are more endemic and show more important adaptation traits to local afrotropical conditions than others (barber-james et al., 2008; gattolliat and nieto, 2009). several studies have demonstrated that baetid community structure reflects the environmental state of rivers effectively (kubendran et al., 2017; buss and salles, 2007; bauernfeind and moog, 2000). mayflies are characterized by narrow habitat tolerance and only occur in very clean freshwater, which makes them good bioindicators for very good water quality (alhejoj et al., 2023; buss and salles, 2007; kubendran et al., 2017). the interactions between environmental factors and baetid abundances is crucial since this nexus has potential to enhance ecosystem services that baetid species provide. available evidence shows that they provide many essential services that maintain and enhance ecosystem function, such as energy flow dynamics (boyero et al., 2011; jacobus et al., 2019). some baetid species are good manipulators of organic matter like periphyton and sediment (buss and salles, 2007; baptista et al., 2006). baetids process large amounts of organic matter, allochthonous carbon and nutrients from riparian vegetation and soil materials (moulton et al., 2004), which are used by organisms at higher trophic levels (wallace and webster, 1996; boyero et al., 2011). according to wallace and webster (1996), most baetid species are generally primary prey for invertebrate predators and they also contribute in various ways to energy flow and nutrient cycling. some filter feeders of mayflies (including most baetid species) contribute to water purification and are part of arguably the most important of these predatorprey relationships – as the diet of fish – which is also a driver of the domestic food and local economy (jacobus et al., 2019). to our knowledge, no exclusive studies have been undertaken on the relationship between reference conditions based on physicochemical parameters and baetid community composition. the similarities of baetid composition between reference condition sites have not been explored and it is unknown if the physicochemical composition differs across these mountainous rivers. furthermore, despite the widespread occurrence of this mayfly family, it is still unclear if this family is influenced by physicochemical parameters at these sites. we ask the question of whether the value of sites to still act as reference sites can be quantified using baetid species. in this survey, we used correlation models to assess the degree of similarity between physico-chemical characteristics and baetid species composition at reference sites. our objective was to quantify the relative role of physico-chemical factors in structuring baetid species assemblages, using the luvuvhu river catchment as a case study. methodology study area the study was conducted in the south-eastern streams of the soutpansberg mountains, limpopo province, south africa. nine sampling sites were selected along four streams (dzindi, mutshundudi, lutanandwa and tshirovha), all of which are major streams of the luvuvhu river catchment. these sites are located in the uppermost 5 km stream segment within their respective streams, and they hold both an instream and riparian zone habitat integrity of 60% and 90%, respectively (kleynhans, 1996). these streams have continuous flow of water throughout the year during both the dry and rainy seasons. all sites showed high similarities in their physical characteristics and biotopes and were in the foothill zone (rowntree and wadeson, 1999), with stream orders of 1 and at elevations of 622–1 022 m amsl. (fig. 1). the catchment experiences wet summers from october to april with peak rainfall in january and february. the mean annual precipitation is 608 mm, while the mean annual air temperatures are 17°c in mountainous areas and 24°c near the kruger national park (singo et al., 2012). the width of the active channel of the sampled sites ranged from 3.45 m at thathe waterfall to 11.42 m at tshirovha. these sites are near-natural, with intact vegetation cover and very little to no human impact. based on the habitat integrity assessment of kleynhans (1996), these sites have limited indigenous vegetation removal, little exotic vegetation encroachment and water abstraction. sites were chosen to represent a pristine gradient of physico-chemical and environmental conditions and macroinvertebrate community assemblages. biological and physico-chemical sampling all biological samples were taken from the ‘stones-in-current’ hydraulic biotope because sub-imagos (nymphs) of many baetid species inhabit this riffle section of streams and river (bauernfeind and moog, 2000). these sites were all well aerated (fig. 2) and provide a home to a variety of macroinvertebrate organisms (ramulifho et al., 2020). each site was sampled on a monthly basis from december of 2016 to january of 2018. all sites were sampled within the same single week at daylight during each sampling month to allow for consistency in weather and flow conditions across sites. six stones containing organisms were sampled at each site using a standard sass net. all contents from a net were emptied into a sample bottle and sorted in the laboratory, and baetid larvae were then identified. most of the material was identified to species level, while some early instar larvae were only identified to the genus or morpho-species level using taxonomic keys (de moor et al., 2003). specimens were preserved in 70% ethanol and are housed at the reference collection section of the sarchi offices, university of venda. at each site, one measurement of four physico-chemical parameters (water temperature, conductivity, total dissolved solids (tds), ph) was taken using a portable ph/ec/tds/ temperature multi-meter. other variables (environmental) whose single reading was measured include elevation, habitat area (stone size), flow depth, stream width, and flow velocity rate using a flow globe fp101 reader. data analysis the baetid composition was analysed using species richness and abundance metrics. baetid species abundance data taken from 6 sampling stones at each site was pooled to then represent a single monthly abundance sample at each site. biological data were tested for normality using the normal quantile-quantile (q-q) test which showed that the data were normally distributed. 253water sa 49(3) 251–259 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4023 physico-chemical data was standardized using log10 (x + 1) to achieve the assumed conditions of normality and homoscedasticity (buss and salles, 2007), while no species in the biological data was down-weighted. standardization of physico-chemical data was necessary to reduce the influence of large differences and double zeros, to normalize and render data homoscedastic (clarke and gorley, 2006). to avoid multi-colinearity between physicochemical variables, we calculated the non-parametric rank-based spearman correlation between these variables. the departure from reference condition of physicochemical variables was made by comparison with the corresponding standards prescribed for aquatic ecosystems in south africa (dwaf, 1996). water temperature should not vary (standard deviate) from the mean temperature for that specific site by > 2°c, while the mean tds should not vary (standard deviate) by > 15% (dwaf, 1996). most freshwaters in south africa are relatively well buffered and more or less neutral, with ph ranges between 6 and 8, and ph should not vary (standard deviate) from the mean values for a specific site by > 0.5 (dwaf, 1996). where no specific reference condition criteria were prescribed by national water quality guidelines (e.g. ec concentrations), peerreviewed reports and articles published from areas of similar geographic or climatic region to this study with such specification were used. figure 1. location of sampling sites in the upstream sections of the south-western side of the luvuvhu catchment in south africa figure 2. natural reference sites at tshirovha potholes (left) and thathe waterfalls (right) (photos: pfananani ramulifho) 254water sa 49(3) 251–259 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4023 we used generalized linear mixed model (glmm) with negative binomial regression from the ‘mass’ package and ‘glmer.nb’ function (nakagawa and schielzeth, 2013; jamil and ter braak, 2013) to evaluate the relative importance of each physico-chemical variable on the abundance of baetidae species from all nine sites combined. glmm is an extension to the generalized linear model (glm) in which the linear predictor contains random effects in addition to the usual fixed effects (venables and ripley, 2002). since no collinearity existed between physico-chemical variables, we ran one full model of glmm with all physicochemical variables. during the analyses, sites were used as a random factor to account for temporal pseudo-replication, while all physico-chemical variables were included as fixed variables (li et al., 2018). the goodness-of-fit of the models was assessed using the relations between the residuals (the differences between observations and predictions by the retained model) and physicochemical variables. we also determined the correspondence of physico-chemical variables, sites and baetid species during the sampling period, using the forward addition of correspondence variables technique in canonical correspondence analysis (cca) (ter braak and verdonschot, 1995). the statistical significance of each variable selected in cca was judged using a monte-carlo permutation test (klonowska-olejnik and skalski, 2014). all the statistical analyses were performed in r (r core team, 2022). results sites condition and correlation between physico-chemical variables the sampling sites (table 1) had a mean elevation of 781.09 m, with the highest at 1 022.94 m and the lowest at 622.38 m. conductivity ranged from 1.9 to 42 μs.cm-1, averaging at 21.30 μs.cm-1. water temperatures ranged from 13.7 to 26.3°c, with a mean of 18.84°c. tds ranged from 2.96 to 31.9 mg.l-1 with 6 of the 9 sites fluctuating by over 15% of a mean of 13.57 mg.l-1. the mean ph value of these sites ranged between 6.50 and 7.56, with some (55% of sites) having a change (standard deviation) of > 0.5 over time. stream flow velocities ranged from 0.2 to 6.4 m.s-1, with a mean of 1.76 m.s-1. mean stream flow depth was 13.93 cm and was highly variable, ranging between 2 and 48.5 cm. stream width varied between 2.1 and 20 m, with a mean of 8.03 m. stones had a mean size of 12.69 cm and ranged from 4.66 to 46 cm. no correlation between physico-chemical variables was ≥ 0.7 (table 2). more than 85% of these variables were positively correlated. as expected, highest positive correlation was found between conductivity and tds (r2 = 0.63), since these two water quality parameters are related and are used to describe salinity levels in water. there were highly significant correlations table 1. mean values and standard deviation (±) of physico-chemical parameters, total abundance, number of genus and species richness at the sampling sites during the period of sampling name upper lutanandwa tshirovha potholes tshirovha forest tshirovha thathe waterfall tea estate lwamondo lutanandwa bridge lutanandwa average elevation (m) 745.26 934.02 665.26 622.38 1 022.94 876.59 796.01 651.19 716.14 781.09 stone size (cm) 12.93 ± 3.24 11.46 ± 3.16 11.04 ± 3.16 13.35 ± 3.74 13.67 ± 1.94 13.46 ± 3.74 15.30 ± 3.68 10.87 ± 3.24 12.16 ± 3.64 12.69 stream flow (m³·s¯¹) 1.12 ± 0.61 1.31 ± 0.81 1.11 ± 0.83 1.95 ± 1.02 2.25 ± 1.03 2.11 ± 1.03 2.03 ± 1.00 2.10 ± 0.85 1.84 ± 0.99 1.76 stream depth (cm) 15.33 ± 4.50 14.93 ± 4.62 10.80 ± 4.50 15.18 ± 5.75 10.00 ± 3.16 15.88 ± 5.74 15.26 ± 5.61 13.62 ± 4.58 14.33 ± 5.47 13.93 stream width (m) 5.39 ± 1.93 10.49 ± 2.12 10.13 ± 2.12 11.42 ± 2.21 3.05 ± 2.16 8.42 ± 2.21 8.00 ± 2.22 9.45 ± 2.12 5.94 ± 2.25 8.03 water temperature (°c) 18.04 ± 3.36 17.78 ± 3.11 18.96 ± 3.00 18.11 ± 2.91 21.80 ± 1.61 18.26 ± 2.90 17.81 ± 2.79 19.57 ± 3.12 19.20 ± 2.84 18.84 tds (mg·l̄ ¹) 14.40 ± 1.15 14.71 ± 1.62 1.93 ± 1.61 14.57 ± 3.57 7.17 ± 9.03 13.74 ± 3.58 13.30 ± 3.59 15.24 ± 1.74 16.33 ± 3.60 13.75 ph 7.36 ± 0.45 6.76 ± 0.48 6.55 ± 0.46 7.14 ± 0.51 6.50 ± 0.52 6.96 ± 0.51 7.15 ± 0.51 7.56 ± 0.46 7.34 ± 0.51 7.04 conductivity (μs·cm¯¹) 26.97 ± 3.03 22.95 ± 2.70 22.71 ± 2.71 21.90 ± 6.17 9.83 ± 12.86 19.27 ± 6.13 20.53 ± 6.16 22.44 ± 2.96 25.09 ± 6.17 21.30 abundance (n) 233.00 ± 4.09 211.00 ± 4.48 31.00 ± 4.49 129.00 ± 4.53 4.00 ± 2.36 791.00 ± 4.53 620.00 ± 4.55 494.00 ± 4.48 526.00 ± 4.56 337.67 genera (n) 4 7 5 7 2 6 6 6 7 5.56 species (n) 5 8 6 9 2 7 7 7 9 6.67 table 2. correlation coefficients (r2) among physico-chemical parameters during the period of sampling. significance: *p < .05, **p < .01, and ***p < .001. tds (mg·l̄ ¹) stone size (cm) stream flow (m³·s¯¹) stream depth (cm) stream width (m) water temperature (°c) ph conductivity (μs·cm¯¹) elevation (m) tds (mg·l̄ ¹) 1.00 −0.24 −0.11** −0.27 −0.07 −0.27 0.32 0.63 0.14*** stone size (cm) −0.24 1.00 0.24 0.10** 0.01 0.04 0.18 0.23 0.12*** stream flow (m³·s¯¹) −0.11** 0.24 1.00 0.03 0.12*** 0.21 0.06 0.19 0.04 stream depth (cm) −0.27 0.10** 0.03 1.00 0.23 0.20 0.05 0.25 0.07 stream width (m) −0.07 0.01 0.12*** 0.23 1.00 0.21 0.20 0.10** 0.04 water temperature (°c) −0.27 0.04 0.21 0.20 0.21 1.00 0.28 0.21 0.14*** ph 0.32 0.18 0.06 0.05 0.20 0.28 1.00 0.25 0.36 conductivity (μs·cm¯¹) 0.63 0.23 0.19 0.25 0.10** 0.21 0.25 1.00 0.18 elevation (m) 0.14*** 0.12*** 0.04 0.07 0.04 0.14*** 0.36 0.18 1.00 255water sa 49(3) 251–259 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4023 (p < 0.001) between elevation and three variables (tds, stone size and water temperature; r2 < 0.15). similarly, stream flow and stream width were significantly correlated with r2 < 0.15. some significant correlations (p < 0.01) that were also observed included those between stream flow and tds, stream depth and stone size, and between conductivity and stream width. the lowest negative correlation had a coefficient of −0.27 and was between tds and stream depth, and between tds and water temperature. abundance of baetids and effect of physico-chemical factors a total of 3 039 individuals of baetidae belonging to 9 genera and 12 species were recorded in this study. the highest number of individuals caught was 28 specimens at lwamondo (during low-flow period), while the average catch across the sites was 6 specimens. the highest number of baetid species was recorded at mid-lutanandwa and the tshirovha confluence, with 9 species (table 1). the tea estate site had the highest number of individuals (791), and together with lutanandwa bridge and lwamondo sites had the third highest diversity, with 7 species after tshirovha potholes (table 1). the lowest number of species was recorded at thathe waterfall, with only 2 species. the most abundant species in the streams were baetis harissoni and dabulamanzia media, and these were also the most widespread species, occurring at 8 of the 9 sites. centroptiloides bifasciata and demoulinia crassi were each limited to 1 site, with low numbers of individuals at lwamondo and upper lutanandwa (3 and 4, respectively). the results suggest that, overall, the most significant drivers of baetid species abundance were water temperature (glmm: estimate = −0.26, p < 0.001), followed by conductivity (glmm: estimate = 0.12, p < 0.01) and stone size (glmm: estimate = 0.08, p < 0.05) (table 3). an increase in water temperature negatively affected the abundance of baetid species, as opposed to an increase of both conductivity and stone size, which had a positive population effect (fig. 3). non-significant drivers of baetid abundance included stream flow, stream width, stream depth, tds, ph, and elevation. amongst all these drivers, only stream width increased with a decrease in baetid species abundance (fig. 3). table 3. generalized linear mixed model analyses between baetidae species and physico-chemical variables at the sampling sites during the period of survey (significance: *p < 0.05, **p < 0.01, and ***p < 0.001) variables estimate std. error z-value p-value temperature (°c) −0.26709 0.04201 −6.357 2.06 x 10−10 *** conductivity (μs·cm¯¹) 0.12966 0.04073 3.184 0.00145** stone size (cm) 0.08074 0.03367 2.398 0.01647* tds (mg·l̄ ¹) 0.08446 0.04465 −1.892 0.05853 stream flow (m³·s¯¹) 0.01838 0.03483 0.528 0.59779 stream depth (m) 0.01206 0.03614 0.334 0.73861 stream width (m) −0.02987 0.06085 0.491 0.62357 elevation (m) 0.07218 0.13275 0.544 0.58665 ph 0.05846 0.04446 1.315 0.18861 figure 3. regression plots of baetid species abundance in relation to various physico-chemical gradients during the period of sampling 256water sa 49(3) 251–259 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4023 site preference of baetid species the percentage of variance explained by axes 1−4 of the canonical correspondence analysis amounted to 76.88%, with the 1st and 2nd axes explaining 32.4% and 28%, while only a small variation of 9.56% and 6.92% of the total variance was explained by the 3rd and 4th axes, respectively. according to the canonical correspondence analysis, there are two distinct patterns of baetid species preferences for sites. the first correspondence component (ca1) represented a gradient where most physico-chemical variables (temperature, elevation, stone size, stream flow) load strongly positively on this component, while tds and stream flow depth load negatively. this positive trend of physico-chemical variables is associated with the tshirovha site, and pseudocloeon sp. ca1 is also associated with a decrease in tds which is closely linked to the decline in abundance of pseudoponnota sp. at tshirovha forest site. ca2 showed a prominent negative loading of physicochemical variables such as tds, stream width, stream flow and stone size, associated with tshirovha, thathe waterfall, tshirovha potholes, and tshirovha forest. further observation showed that acanthiops varius is negatively affected, while demoulinia crassi abundance increases with an increase in temperature, elevation and stream depth, and is more closely related to the upper lutanandwa site. the majority of baetid species (8 of 12 species or 66.66%) showed no clear response to changes in physico-chemical parameters in the study area (figure 4). these species are clustered between the nine sampling sites. discussion physico-chemical variables and baetid community composition strong positive correlations between physico-chemical variables which were highly significant (e.g., elevation to tds, stone size and water temperature) were observed in this study at numerous sites (table 2). this was expected from sampling sites which are seemingly influenced by both closely related sources (the soutpansberg mountains) and land uses, as shown in abowei (2010). this low variation within physico-chemical variables was characteristic of all sampling sites. the absence of industrial activities at these sites is evident by ph levels for sampled sites which were all within the recommended south african aquatic system ph range of 6–8 (dwaf, 1996), and also as observed by monyai et al. (2016). acidic effluents from industrial activities are known to cause low ph levels in rivers (e.g., mine drainage, paper, tanning and leather industries). the visual evidence from stream water showed no black or brown (tea-coloured) water or any filamentous algae (fig. 2), which is usually caused by changing ph levels. the water temperature standard for sustaining aquatic life is 20–30°c (weldemariam, 2013). this study was dominated by sites with relatively lower temperature range within the accepted thresholds (table 1). this could be due to forest cover at the sites, which reduces light incidence keeping the stream water temperature at low values (siegloch et al., 2014; klonowska-olejnik and skalski, 2014), and the effect of altitude the concentration of tds and ec at the nine sites was well within the who standard for inland surface water of 1 000 mg.l-1 and 300 μs.cm-1 (who, 2011). this was expected at all these sites due to the absence of practices such as enrichment by soaps and detergents from people washing or bathing in streams, which would result in high levels of tds and ec, placing stress on aquatic species (monyai et al., 2016). this might also mean the absence of land-use practices such as overgrazing, non-contour ploughing, removal of riparian vegetation and forestry operations adjacent to these sites. these practices accelerate erosion or result in increased loads of suspended solids in rivers (monyai et al., 2016; adu and oyeniyi, 2019). most of the environmental variables recorded in this study were within levels prescribed by dwaf and who and should be able to support aquatic life (dwaf, 1996; who, 2011; weldemariam, 2013). it is evident from this study that not all species have the same response to environmental parameters (table 3 and fig. 4). water temperature explained the most significant amount of variation in relative abundance, as has been reported in other studies (ramulifho et al., 2020; buss and salles, 2007; jacobus et al., 2019; adu and oyeniyi, 2019; bauernfeind and moog, 2000). water temperature in these sites is driven by riparian vegetation. riparian vegetation is vital for maintaining and ensuring suitable water temperature and the amount of light available as it also forms a buffer area for the stream. a similar study of undisturbed sites by klonowska-olejnik and skalski (2014) found that the intactness of riparian vegetation is one of the most important factors structuring communities. another similar study of upper catchment sites by svitok (2006) concluded that mayfly abundance was most strongly related to elevation, which also relates to the climatic variable of air temperature. the findings of this signal important concerns regarding potential species movement and survival in the face of climate change predictions. figure 4. cca plot with axes 1 and 2 showing variation between sites, physico-chemical variables and baetid species. the contribution of each variable is proportional to the length of the arrow. temp = water temperature; elev = elevation; tds = total dissolved solids; width = stream flow width; depth = flow depth; flow = stream flow. 257water sa 49(3) 251–259 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4023 eight species of baetid did not show any conclusive response to physico-chemical variables and sites. only a few species were associated with specific sampling sites (fig. 4). pseudoponnota sp., pseudocloeon sp., and a. varius showed a considerable degree of preference for tds, temperature and stream width linked to tshirovha potholes, tshirovha forest, and thathe waterfall, which are sites found in close proximity each other and on the same stream. ubiquitous species such as baetis harissoni and dabulamanzia media showed no preference for measured conditions in streams. these species are generalist in their nature in the luvuvhu catchment as they tolerate a range of conditions (ramulifho et al., 2020). studies globally have largely used different species of baetids as valid biological indicators of water quality because they are highly sensitive to substrate changes (kubendran et al., 2017; buss and salles, 2007; bauernfeind and moog, 2000). in this study, it is evident that baetids showed varied tolerance levels to pollution, but generally are considered intolerant organisms and require water of good quality to survive, as also shown by alhejoj et al. (2014). benefits of baetids in confirming reference site quality results from this study further enhance the use of baetid species as a low-cost indicator for aquatic reference sites that allow quick, widespread, long-term, routine monitoring and direct comparison of sites, time periods and studies (butana et al., 2010). the use of natural variation of baetid species in reference conditions also helps to avoid the setting of quantitative limits or targets of physico-chemical factors (of reference sites) that are either too restrictive or impossible to meet in the face of changing land use and rapid industrialization (mcdowell et al., 2013). thus, even in areas where there is a deficiency of physicochemical and environmental data, by using baetid species there is still a possibility that reference conditions may well be established. this biological approach to reference site selection enables the measurement of a natural continuum of the substantial benefits of baetid species ecosystem processes, such as nutrient cycling, algal distribution, retention and distribution of organic matter, and predator-prey interactions (jacobus et al., 2019; sartori and brittain, 2015; wallace and webster, 1996). the usefulness of this research lies in its contribution towards closing an existing gap on a biological index of baetids species in reference sites in south africa. this research establishes preliminary baseline biological characteristics of the potential reference sites in mountain rivers, as opposed to widely used selection criteria like chemical and physical (i.e., abiotic) factors as surrogates (agboola et al., 2020). the biological indices are widely recommended and a valuable tool in monitoring macroinvertebrate response, reference conditions and anthropogenic disturbances in rivers in many regions including europe (lewin et al., 2013) and west africa (kaboré et al., 2018). if this is adopted for local streams, accurate estimation of reference conditions based on biological indices will provide information on anthropogenic impacts and stress for sites in upstream catchments and potential areas for restoration of reference conditions (mcdowell et al., 2013). conclusions our findings indicated that the physico-chemical factors at the selected sites are highly variable but are still in a favourable range for reference site conditions. direct effects of measured physicochemical factors on the entire baetid community were evident largely for pseudoponnota sp., pseudocloeon sp., demoulinia crassi and acanthiops varius. since the presence or absence of certain mayflies was strongly influenced by water temperature, tds, and stream width (as observed from the models), this study confirmed that these species are a powerful tool as descriptors of reference sites. these results are of relevance for protection of these species and reference sites in catchments in south africa. acknowledgments this study was supported financially and logistically by the national research foundation and the department of science and technology through the south african research chairs initiative (sarchi) chair on biodiversity value and change in the vhembe biosphere reserve, hosted and supported by the university of venda. we thank the department of zoology, university of venda, for providing laboratory and field work facilities. data availability statement data, models or codes that support the findings of this study are available from the corresponding author upon request. author contributions pfananani ramulifho conceived the study, wrote the initial draft of the manuscript and performed data analyses. nick rivers-moore and stefan foord edited and commented on the manuscript. all authors contributed to discussions that shaped the manuscript. conflict of interest the authors declare no conflict of interest. orcids pfananani ramulifho https://orcid.org/0000-0002-1589-7899 nick rivers-moore https://orcid.org/0000-0002-6546-4215 stefan foord https://orcid.org/0000-0002-9195-2562 references aazami j, esmaili-sari a, abdoli a, sohrabi h and van den brink pj (2015) monitoring and assessment of water health quality in the tajan river, iran, using physicochemical, fish and macroinvertebrates indices. j. environ. health sci. eng. 13 29. https://doi.org/10.1186/s40201-015-0186-y abowei jfn (2010) salinity, dissolved oxygen, ph and surface water temperature conditions in nkoro river, niger delta, nigeria. adv. j. food sci. technol. 2 (1) 36–40. adu bw and oyeniyi ea (2019) water quality parameters and aquatic insect diversity in aahoo stream, southwestern nigeria. j. basic appl. zool. 80 15 https://doi.org/10.1186/s41936-019-0085-3 agboola oa, downs ct and o’brien g (2020) a multivariate approach to the selection and validation of reference conditions in kwazulu-natal rivers, south africa. front. environ. sci. 8 584923. https://doi.org/10.3389/fenvs.2020.584923 alhejoj i, elias s and klaus b (2014) mayflies (order ephemeroptera): an effective indicator of water bodies conditions in jordan. int. j. sci. res. environ. sci. 2 (10) 361–370. https://doi. org/10.12983/ijsres-2014-p0361-0370 alhejoj i, hiasat th, salameh e, hamad aa and al kuisi m (2023) use of the aquatic mayfly (insecta: ephemeroptera) as environmental bio-indicator in jordan. int. j. design nat. ecodyn. 8 (1) 133–139. https://doi.org/10.18280/ijdne.180115 baptista df, buss df, dias lg, nessimian jl, da silva er, neto ad, de carvalho sn, de oliveira ma, andrade lr (2006) functional feeding groups of brazilian ephemeroptera nymphs: ultrastructure of mouthparts. int. j. limnol. 42 (2) 87–96. https://doi.org/10.1051/limn/2006013 bauernfeind e and moog o (2000) mayflies (insecta: ephemeroptera) and the assessment of ecological integrity: a methodological approach, (pp. 71–83). in: jungwirth m, muhar s and schmutz s (eds) assessing the ecological integrity of running waters. springer, the netherlands. https://doi.org/10.1007/978-94-011-4164-2_6 https://orcid.org/0000-0002-1589-7899 https://orcid.org/0000-0002-6546-4215 https://orcid.org/0000-0002-9195-2562 https://doi.org/10.1186/s40201-015-0186-y https://doi.org/10.1186/s41936-019-0085-3 https://doi.org/10.3389/fenvs.2020.584923 https://doi.org/10.12983/ijsres-2014-p0361-0370 https://doi.org/10.12983/ijsres-2014-p0361-0370 https://doi.org/10.18280/ijdne.180115 https://doi.org/10.1051/limn/2006013 https://doi.org/10.1007/978-94-011-4164-2_6 258water sa 49(3) 251–259 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4023 beyene a, addis t, kifle d, legesse w, kloos h and triest l (2009) comparative study of diatoms and macroinvertebrates as indicators of severe water pollution: case study of the kebena and akaki rivers in addis ababa, ethiopia. ecological indicators 9 381–392. https://doi.org/10.1016/j.ecolind.2008.05.001 boyero l, pearson rg, dudgeon d, graça ma, gessner mo, albariño rj and callisto m (2011) global distribution of a key trophic guild contrasts with common latitudinal diversity patterns. ecology 92 (9) 1839–1848. https://doi.org/10.1890/10 2244.1 buluta s, finau i, brodie g and hodge s (2010) a preliminary study into the potential of mayflies (ephemeroptera: baetidae and caenidae) as bio-indicators of stream health in fiji.  s. pacific j. nat. appl. sci. 28 (1) 82–84. https://doi.org/10.1071/sp10011 buss df and salles ff (2007) using baetidae species as biological indicators of environmental degradation in a brazilian river basin. environ. monit. assess. 130 365–372. https://doi.org/10.1007/s10661006-9403-6 christidis f, connolly nm, nolen ja, pearson rg, clair r, cairns a and davis l (2017) stream macroinvertebrate assemblage uniformity and drivers in a tropical bioregion. freshwater biol. 62 (3) 544–558. https://doi.org/10.1111/fwb.12884 clarke kr and gorley rn (2006) primer v.6: user manual/ tutorial. primer-e. couceiro sr, hamada n, forsberg br, pimentel tp and luz sl (2012) a macroinvertebrate multimetric index to evaluate the biological condition of streams in the central amazon region of brazil. ecol. indic. 18 118–125. https://doi.org/10.1016/j. ecolind.2011.11.001 croijmans l, de jong jf and prins hh (2020) oxygen is a better predictor of macroinvertebrate richness than temperature – a systematic review. environ. res. lett. 21;16(2):023002. https://doi. org/10.1088/1748-9326/ab9b42 de moor ij, day ja and de moor fc (2003) guides to the freshwater invertebrates of southern africa. vol. 7: insecta i (ephemeroptera, odonata and plecoptera). wrc report no. tt 207/03. water research commission, pretoria. dudgeon d, arthington ah, gessner mo, kawabata zi, knowler dj, lévêque c, naiman rj, prieur-richard ah, soto d, stiassny ml, sullivan ca (2006) freshwater biodiversity: importance, threats, status and conservation challenges. biol. rev. 81 163–182. https://doi.org/10.1017/s14647 93105006950 dwaf (department of water affairs and forestry, south africa) (1996) south african water quality guidelines. volume 7: aquatic ecosystems. department of water affairs and forestry, pretoria. edokpayi jn, odiyo jo, popoola oe and msagati tam (2016)  assessment of trace metals contamination of surface water and sediment: a case study of mvudi river, south africa.  sustainability 8 135. https://doi.org/10.3390/su8020135 gattolliat jl and nieto c (2009) the family baetidae (insecta: ephemeroptera): synthesis and future challenges. aquat. insects 31 (sup1) 41–62. https://doi.org/10.1080/01650420902812214 gustafson mp (2008) effects of thermal regime on mayfly assemblages in mountain streams. hydrobiologia 605 (1) 235–246. https://doi.org/10.1007/s10750-008-9357-5 haidekker a and hering d (2008) relationship between benthic insects (ephemeroptera, plecoptera, coleoptera, trichoptera) and temperature in small and medium-sized streams in germany: a multivariate study. aquat. ecol. 42 (3) 463–481. https://doi.org/ 10.1007/s10452-007-9097-z hamid a, bhat su and jehangir a (2020) local determinants influencing stream water quality. appl. water sci. 10 (1) 1–16. https://doi.org/10.1007/s13201-019-1043-4 heath rgm and classen m (1990) an overview of the pesticide and metal levels present in populations of the larger indigenous fish species of selected south african rivers. wrc report no. 428/1/99. water research commission, pretoria. jacobus lm, macadam cr and sartori m (2019) mayflies (ephemeroptera) and their contributions to ecosystem services.  insects 10 170. https://doi.org/10.3390/insects10060170 jamil t and ter braak cjf (2013) generalized linear mixed models can detect unimodal species-environment relationships. peerj 1 e95. https://doi.org/10.7717/peerj.95 kaboré i, moog o, ouéda a, sendzimir j, ouédraogo r, guenda w and melcher ah (2018) developing reference criteria for the ecological status of west african rivers. environ. monit. assess. 190 2. https://doi.org/10.1007/s10661-017-6360-1 karr jr (1999) defining and measuring river health.  freshwater biol. 41 221–234. https://doi.org/10.1046/j.1365-2427.1999.00427.x kleynhans cj (1996) a qualitative procedure for the assessment of the habitat integrity status of the luvuvhu river (limpopo system, south africa). j. aquat. ecosyst. health 5 41–54. https://doi. org/10.1007/bf00691728 klonowska-olejnik m and skalski t (2014) the effect of environmental factors on the mayfly communities of headwater streams in the pieniny mountains (west carpathians). biologia 69 (4) 498–507. https://doi.org/10.2478/s11756-014-0334-3 kubendran t, selvakumar c, sidhu ak, nair a and krishnan sm (2017) baetidae (ephemeroptera : insecta) as biological indicators of environmental degradation in tamiraparani and vaigai river basins of southern western ghats, india. int. j. curr. microbiol. appl. sci. 6 (6) 558–572. https://doi.org/10.20546/ ijcmas.2017.606.066 kusangaya s, warburton ml, archer van garderen e and jewitt gpw (2013) impacts of climate change on water resources in southern africa: a review. phys. chem. earth 67 47–54. https://doi.org/10.1016/j.pce.2013.09.014 lewin i, czerniawska-kusza i,  szoszkiewicz k,  ewa-lawniczak a and jusik s (2013) biological indices applied to benthic macroinvertebrates at reference conditions of mountain streams in two ecoregions (poland, the slovak republic). hydrobiologia 709 183–200. https://doi.org/10.1007/s10750-013-14 48-2 li l, zheng b and liu l (2010) biomonitoring and bioindicators used for river ecosystems: definitions, approaches and trends. proced. environ. sci. 2 1510–1524. https://doi.org/10.1016/j.proenv. 2010.10.164 li s, yang w, wang l, chen k, xu s and wang b (2018) influences of environmental factors on macroinvertebrate assemblages: differences between mountain and lowland ecoregions, wei river, china. environ. monit. assess. 190 152. https://doi. org/10.1007/s10661-018-6516-7 lópez-lópez e and sedeño-díaz je (2015) biological indicators of water quality: the role of fish and macroinvertebrates as indicators of water quality. in: armon r and hänninen o (eds) environmental indicators. springer, dordrecht. https://doi.org/10. 1007/978-94-017-9499-2_37 mangadze t, dalu t and froneman pw (2019) biological monitoring in southern africa: a review of the current status, challenges and future prospects. sci. total environ. 648 1492–1499. https://doi.org/10.1016/j.scitotenv.2018.08.252 mcdowell rw, snelder th, cox n, booker dj and wilcock rj (2013) establishment of reference or baseline conditions of chemical indicators in new zealand streams and rivers relative to present conditions. mar. freshwater res. 64 387–400. https://doi.org/10.1071/mf12153 monyai m, makhado ra and novhe no (2016) water quality of the luvuvhu river and its tributaries within the thulamela local municipality, limpopo province, south africa. afr. j. sci. technol. innovat. dev. 8 (5-6) 439–445. https://doi.org/10. 1080/20421338.2016.1219504 moulton tp, souza ml, silveira rml and krsulović fam (2004) effects of ephemeropterans and shrimps on periphyton and sediments in a coastal stream (atlantic forest, rio de janeiro, brazil). j. n. am. benthol. soc. 23  868–881. https://doi. org/10.1899/0887-3593(2004)023<0868:eoeaso>2.0.co;2 nakagawa s and schielzeth h (2013) a general and simple method for obtaining r2 from generalized linear mixed effects models. meth. ecol. evol. 42 133–142. https://doi.org/10.1111/j.2041210x.2012.00261.x okonkwo jo and mothiba m (2005) physico-chemical characteristics and pollution levels of heavy metals in the rivers in thohoyandou, south africa. j. hydrol. 308 122–127. https://doi. org/10.1016/j.jhydrol.2004.10.025 pitman wv (2011) overview of water resource assessment in south africa: current state and future challenges. water sa 37 (5) 659–664. https://doi.org/10.4314/wsa.v37i5.3 https://doi.org/10.1016/j.ecolind.2008.05.001 https://doi.org/10.1890/10-2244.1 https://doi.org/10.1890/10-2244.1 https://doi.org/10.1071/sp10011 https://doi.org/10.1007/s10661-006-9403-6 https://doi.org/10.1007/s10661-006-9403-6 https://doi.org/10.1111/fwb.12884 https://doi.org/10.1016/j.ecolind.2011.11.001 https://doi.org/10.1016/j.ecolind.2011.11.001 https://doi.org/10.1088/1748-9326/ab9b42 https://doi.org/10.1088/1748-9326/ab9b42 https://doi.org/10.1017/s1464793105006950 https://doi.org/10.1017/s1464793105006950 https://doi.org/10.3390/su8020135 https://doi.org/10.1080/01650420902812214 https://doi.org/10.1007/s10750-008-9357-5 https://doi.org/10.1007/s10452-007-9097-z https://doi.org/10.1007/s10452-007-9097-z https://doi.org/10.1007/s13201-019-1043-4 https://doi.org/10.3390/insects10060170 https://doi.org/10.7717/peerj.95 https://doi.org/10.1007/s10661-017-6360-1 https://doi.org/10.1046/j.1365-2427.1999.00427.x https://doi.org/10.1007/bf00691728 https://doi.org/10.1007/bf00691728 https://doi.org/10.2478/s11756-014-0334-3 https://doi.org/10.20546/ijcmas.2017.606.066 https://doi.org/10.20546/ijcmas.2017.606.066 https://doi.org/10.1016/j.pce.2013.09.014 https://doi.org/10.1007/s10750-013-1448-2 https://doi.org/10.1007/s10750-013-1448-2 https://doi.org/10.1016/j.proenv.2010.10.164 https://doi.org/10.1016/j.proenv.2010.10.164 https://doi.org/10.1007/s10661-018-6516-7 https://doi.org/10.1007/s10661-018-6516-7 https://doi.org/10.1007/978-94-017-9499-2_37 https://doi.org/10.1007/978-94-017-9499-2_37 https://doi.org/10.1016/j.scitotenv.2018.08.252 https://doi.org/10.1071/mf12153 https://doi.org/10.1080/20421338.2016.1219504 https://doi.org/10.1080/20421338.2016.1219504 https://doi.org/10.1899/0887-3593(2004)023%3c0868:eoeaso%3e2.0.co;2 https://doi.org/10.1899/0887-3593(2004)023%3c0868:eoeaso%3e2.0.co;2 https://doi.org/10.1111/j.2041-210x.2012.00261.x https://doi.org/10.1111/j.2041-210x.2012.00261.x https://doi.org/10.1016/j.jhydrol.2004.10.025 https://doi.org/10.1016/j.jhydrol.2004.10.025 https://doi.org/10.4314/wsa.v37i5.3 259water sa 49(3) 251–259 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.4023 ramulifho pa (2020) modelling flow and water temperature in the luvuvhu catchment and their impact on macroinvertebrate assemblages. phd thesis, university of venda. ramulifho pa, foord sh and rivers-moore na (2020) the role of hydro-environmental factors in mayfly (ephem peroptera, insecta) community structure: identifying threshold responses. ecol. evolut. 10 (14) 6919–6928. https://doi.org/10.1002/ ece3.6333 rashid i and romshoo sa (2013) impact of anthropogenic activities on water quality of lidder river in kashmir himalayas.  environ. monit. assess.  185  4705–4719. https://doi.org/10.1007/s10 661-012-2898-0 reece pf, reynoldson tb, richardson js and rosenberg dm (2001) implications of seasonal variation for biomonitoring with predictive models in the fraser river catchment, british columbia. can. j. fish. aquat. sci. 58 1411–1418. https://doi.org/10.1139/f01-076 rowntree km and wadeson ra (1999) a hierarchical geomorphological model for the classification of selected south african rivers. wrc report no. 497/1/99. water research commission, pretoria. sartori m and brittain je (2015) order ephemeroptera. in: thorp j and rodgers dc (eds) thorp and covich’s freshwater invertebrates: ecology and general biology (4th edn.). academic press, new york. 873–891. https://doi.org/10.1016/b978-0-12-385 026-3.00034-6 sharma rc and rawat js (2009) monitoring of aquatic macroinvertebrates as bioindicators for assessing the health of wetlands: a case study in the central himalayas, india. ecol. indic. 9 118–128. https://doi.org/10.1016/j.ecolind.2008.02.004 siegloch ae, suriano m, spies m. and fonseca-gessner a (2014) effect of land use on mayfly assemblages’ structure in neotropical headwater streams. an. acad. bras. ciê. 86 (4) 1735–1747. https://doi.org/10.1590/0001-3765201420130516 singo lr, kundu pm, odiyo jo, mathivha fi and nkuna tr (2012) flood frequency analysis of annual maximum stream flows for luvuvhu river catchment, limpopo province, south africa. in: 16th sanciahs hydrology symposium, 1–3 october 2012, university of pretoria. skowno al, poole cj, raimondo dc, sink kj, van deventer h, van niekerk l, harris lr, smith-adao lb, tolley ka, zengeya ta, foden wb, midgley gf and driver a (2019) national biodiversity assessment 2018: the status of south africa’s ecosystems and biodiversity. synthesis report. south african national biodiversity institute, an entity of the department of environment, forestry and fisheries, pretoria. 214 pp. svitok m (2006) structure and spatial variability of mayfly (ephemeroptera) communities in the upper hron river basin. biologia 61 (5) 547–554. https://doi.org/10.2478/s11756-006-0089-6 tampo l, lazar im, kaboré i, oueda a, akpataku kv, djaneye-boundjou g, bawa lm, lazar g and guenda wa (2020) a multimetric index for assessment of aquatic ecosystem health based on macroinvertebrates for the zio river basin in togo. limnologica 83 125783. https://doi.org/ 10.1016/j.limno.2020.125783 ter braak cjf and verdonschot pfm (1995) canonical correspondence analysis and related multivariate methods in aquatic ecology. aquat. sci. 37 130–137. thirupathaiah m, samatha ch and sammaiah c (2012) analysis of water quality using physico-chemical parameters in lower manair reservoir of karimnagar district, andhra pradesh environ. sci. 3 (1) 172–180. https://doi.org/10.6088/ijes.201203013 1017 varnosfaderany nm, ebrahimi e, mirghaffary n and safyanian a (2010) biological assessment of the zayandeh rud river, iran, using benthic macroinvertebrates. limnologica 40 226–232. https://doi.org/10.1016/j.limno.2009.10.002 venables wn, and ripley bd (2002)  random and mixed effects. in: modern applied statistics with s. statistics and computing. springer, new york, ny. https://doi.org/10.1007/978-0-387-217062_10 venkatesharaju k, ravikumar p, somashekar rk and prakash kl (2010) physico-chemical and bacteriological investigation on the river cauvery of kollegal stretch in karnataka. j. sci. eng. technol. 6 (1) 50–59. https://doi.org/10.3126/kuset. v6i1.3310 wallace jb and webster jr (1996) the role of macroinvertebrates in stream ecosystem function. annu. rev. entomol. 41  115–139. https://doi.org/10.1146/annurev.en.41.010196.000555 weldemariam mm (2013) physico-chemical analysis of gudbahri river water of wukro, eastern tigrai, ethiopia. int. j. sci. res. publ. 3 (11) 1–4. who (world health organisation) (2011) guidelines for drinkingwater quality (4th edn). world health organisation press, geneva. https://doi.org/10.1002/ece3.6333 https://doi.org/10.1002/ece3.6333 https://doi.org/10.1007/s10661-012-2898-0 https://doi.org/10.1007/s10661-012-2898-0 https://doi.org/10.1139/f01-076 https://doi.org/10.1016/b978-0-12-385026-3.00034-6 https://doi.org/10.1016/b978-0-12-385026-3.00034-6 https://doi.org/10.1016/j.ecolind.2008.02.004 https://doi.org/10.1590/0001-3765201420130516 https://doi.org/10.2478/s11756-006-0089-6 https://doi.org/10.1016/j.limno.2020.125783 https://doi.org/10.1016/j.limno.2020.125783 https://doi.org/10.6088/ijes.2012030131017 https://doi.org/10.6088/ijes.2012030131017 https://doi.org/10.1016/j.limno.2009.10.002 https://doi.org/10.1007/978-0-387-21706-2_10 https://doi.org/10.1007/978-0-387-21706-2_10 https://doi.org/10.3126/kuset.v6i1.3310 https://doi.org/10.3126/kuset.v6i1.3310 https://doi.org/10.1146/annurev.en.41.010196.000555 water sa 49(1) 64–72 / jan 2023 https://doi.org/10.17159/wsa/2023.v49.i1.3988 research paper issn (online) 1816-7950 available on website https://www.watersa.net 64 correspondence fb lewu email lewuf@cput.ac.za dates received: 9 march 2022 accepted: 4 january 2023 key words honeybush proline content relative water content tea plant water deficit stress copyright © the author(s) published under a creative commons attribution 4.0 international licence (cc by 4.0) cyclopia, generally known as honeybush, and belonging to the fabaceae family, originates from the cape floristic region of the eastern cape and western cape provinces of south africa. currently, 6 honeybush species are commercially cultivated but, to date, there have been limited trials attempting to study their agronomic water demand. a pot trial was conducted where cyclopia subternata plants were cultivated on different soil types (stellenbosch granite, stellenbosch shale and stellenbosch clovelly) and subjected to three different water-deficit stress levels (well-watered, semi-stressed and stressed). remarkably, irrigation treatments and soil types did not significantly affect the growth of the plants. however, the well-watered treatment consistently had higher yields compared to the other two treatments. the water-stressed (semi-stressed and stressed) treatments had lower relative water contents (rwc) with higher concen trations of proline, which signify water stress, compared to the control treatment. higher proline and lower rwc contents found in this study are indications of water stress. cyclopia subternata growth, yield, proline and relative water content in response to water deficit stress ms mahlare1, mn lewu2, fb lewu1 and c bester2 1department of agriculture, faculty of applied sciences, cape peninsula university of technology, private bag x8, wellington 7654, south africa 2arc infruitec-nietvoorbij, private bag x5026, stellenbosch 7599, south africa introduction south africa, a drought-prone country, is home to rooibos (aspalathus linearis), bush (athrixia phylicoides) and honeybush (cyclopia species) teas (joubert et al., 2011). the teas are sold as either black or green (fermented or unfermented, respectively) (horn, 2019). even though the commercialization of some of these remedial teas is still in its infancy stage, honeybush has gained recognition, while rooibos is the most well-known and well established in the industry (van wyk and gericke, 2000; joubert et al., 2008; joubert et al., 2011). studies state that these south african indigenous tea species have essential nutrients (iron, calcium, magnesium, copper, and potassium) that can improve wellbeing and/or prevent diseases, and have economic potential (rampedi and olivier 2005; mcgaw et al., 2007). these herbal teas are famous for their rich caffeine-free and organic antioxidant properties, which are helpful in colon, throat and lung illnesses, prevention of urinary stone and tooth caries and other medical problems (soni et al., 2015). the demand for honeybush tea has prompted concerns of over-exploitation of natural populations of the cyclopia species. the increased rate of wild harvesting diminishes the natural population, thus making the exploitation of cyclopia species unsustainable. harvesting practices have contributed to the decrease and even disappearance of populations of the wild cyclopia species (du toit et al., 1998). other factors threatening the growth of the honeybush industry include drought and veld fires. to ensure sustainable production, commercial honeybush plantations have been established (joubert et al., 2011). commercial production is therefore becoming increasingly important to save the natural populations from decline while ensuring consistent supply. cultivation of cyclopia species will not only contribute to sustainability and conservation of the species but will also improve the livelihoods of rural harvester communities. although cultivated honeybush plants receive water through irrigation in addition to rainfall, irrigation volume is at the discretion of farmers, without any understanding of the water requirements of the species. presently, the shortage of water has massively increased in some parts of the world, including some regions in south africa, due to a variety of reasons such as an ever-increasing population, industrialization, water pollution and poor management, climate change and others (wwap, 2012; connor, 2015; long and pijanowski, 2017). in addition, the south african department of water and sanitation (dws) has reduced agricultural allocations significantly, and irrigation volume for the agricultural sector is unlikely to increase anytime soon. for example, in 2015, dws restricted an irrigation water allocation in kwazulu-natal by 40–100% due to a water shortage caused by insufficient rain (rsa, 2015). also, agriculture in the western cape has had to cut its water use by 60% since 2017 (wwf, 2018). as a result, research that focuses on the sustainability of water-use in agriculture is gaining huge interest (velasco-muñoz et al., 2018). environmental factors, including water stress, tend to interfere with crucial physiological processes and biochemical mechanisms; resulting in yield loss (per et al., 2017). https://www.watersa.net https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ 65water sa 49(1) 64–72 / jan 2023 https://doi.org/10.17159/wsa/2023.v49.i1.3988 therefore, research on water-use and the effects of stress on plant growth is crucial for production sustainability in agriculture (harb et al., 2010). plants have proven to use protective mechanisms such as proline and carbohydrate accumulation to cope with water-deficit situations (mabizela, 2020). proline is a water-soluble amino acid and beneficial solute that accumulates in plants under different kinds of stresses, such as drought, cold, heat, heavy metal, nutrient, and salt stress (siddique and dubey, 2017). relative water content (rwc) is a useful measure of plant water status in terms of the physiological consequences of cellular water deficit and may indicate the degree of water stress expressed under drought and heat stress (surendar et al., 2013; soltys-kalina et al., 2016). it combines leaf water potential and the effect of osmotic regulation to quantify plant water status (lugojan and ciulcas, 2011; kardile et al., 2018). insufficient water in plants due to stress results in low rwc (chakhchar et al., 2015). a plant’s ability to retain turgor during water-deficit periods guarantees smooth metabolic processes for growth (čereković et al., 2013). several studies have stated that rwc determination is an efficient method of assessing drought tolerance and plant water status (slabbert and krüger, 2004; li-ping et al., 2006; jones, 2007; obidiegwu et al., 2015). to date, limited studies have been conducted to investigate the water needs of cyclopia species. therefore, the aim of this study was to evaluate the effects of 3 different irrigation treatments on growth, yield, proline and relative water content of cyclopia subternata species of honeybush. methods and materials experimental site and layout a greenhouse pot trial was conducted at the agricultural research council (arc), infruitec-nietvoorbij (latitude −33.914395° and longitude 18.861390°) in stellenbosch, south africa, to determine the effect of water stress on c. subternata. the experiment was conducted for 140 days (from end-july to mid-december 2020). the experimental design was a randomised block design (rbd) with 9 treatment combinations (irrigation x soil type) replicated at random in each of 4 block replicates. the treatment structure was a 3 x 3 factorial with 3 irrigation levels (well-watered, semistressed and stressed) and 3 soil types (stellenbosch granite, stellenbosch shale and stellenbosch clovelly). soil collection, preparation, and planting soil collection was carried out from three different sites at the arc nietvoorbij research farm. for each site, soil samples were collected from the 0–30 cm soil depth, sieved with a 3 mm sieve to remove large fragments, followed by baseline physicochemical analysis of the composited samples at a commercial laboratory (bemlab, strand). 14 kg of soil was weighed into a 30 cm plastic pot, using a digital scale. the soil in each pot was irrigated to pot capacity (pc) before planting. nine-month-old honeybush (c. subternata) seedlings were transplanted to one plant per pot. the plants were well-watered for 5 weeks to ensure good establishment before introducing the different irrigation treatments. irrigation and weed control from the 6th week after transplanting (wat), c. subternata plants were subjected to 3 different irrigation treatments for 105 days (september–december 2020). the well-watered treatment (control) received 500 ml of water 3 times a week, semi-stressed received the same quantity of water twice a week while the stressed treatment received 500 ml of water once a week until the end of the study. the plants were hand irrigated with an erlenmeyer flask. weeds that emerged in the pots during the trial period were mostly broad-leaved plants. the weeds were either hand-pulled or manually removed using a garden fork immediately after irrigation when the soil was still wet. data collection growth parameters measurement of growth parameters commenced at 6 wat on a monthly basis, until the trial was terminated in december 2020. plant height was measured from the soil surface to the tip of the longest shoot, using a tape measure, stem diameter was measured with a digital vernier caliper while the stem circumference was calculated from stem diameter values using the following formula: c = πd (1) where π = 3.14 and d = diameter total yield (shoot and root biomass) at the end of the study (20 wat), the above-ground biomass (shoot) was cut just above the soil surface using a pruning shear, placed in a labelled paper bag and then weighed using a sensitive weighing balance to obtain the fresh mass of the shoot. the fresh shoot was oven-dried at 70°c for 24 h. the dried samples were also weighed and recorded using a sensitive digital scale to 4 decimal places. the root biomass was determined by washing plant roots from each pot under running water using a 0.053 mm sieve in order to separate the roots from the soil and prevent loss of fine roots. the washed roots were air-dried overnight and weighed using a sensitive scale. total plant yield is the combined fresh weight of the above-ground biomass and the air-dried root biomass. estimation of proline content using the colorimetric method determination of the proline content of c. subternata commenced at 6 wat using the modified method of ábrahám et al. (2010). leaf samples were collected at 2-week intervals during the growth period. the extraction procedure was done by crushing 0.1 g of fresh frozen leaves in 0.5 ml of 3% sulfosalicylic acid (w/v), using a plastic test tube and pestle. the homogenised extracts were centrifuged for 5 min at a speed of 13 500 r/min. a reaction mixture of 0.1 ml of 3% sulphosalicylic acid, 0.2 ml of glacial acetic acid, 0.2 ml of acid ninhydrin buffer (1.25 g ninhydrin, 30 ml glacial acetic acid, and 20 ml of 6 m phosphoric acid) and 0.1 ml of centrifuged sample extract was made in a test tube with a pipette. the mixture was boiled for 30 min at 100°c then terminated in an ice bath at room temperature. after complete cooling, 1 ml of toluene was added to the mixture and mixed thoroughly, then placed on the bench for 5 min to allow separation of chromophore. the absorbance was read at 520 nm on the uv-visible spectrophotometer (ultrospec 2100 pro, amersham biosciences, waltham ma, usa) with a 10 mm quartz glass cuvette. from the proline standard curve, the proline concentrations of the c. subternata samples were determined. proline content was calculated using the formula: proline content (mmoles/g) proline (mg � //ml) toluene (ml) sample mass (g) � � 115 5 5 . (2) where 115.5 = molecular mass of proline 66water sa 49(1) 64–72 / jan 2023 https://doi.org/10.17159/wsa/2023.v49.i1.3988 determination of relative water content (rwc) an improved version of the method of sade et al. (2015) was used to determine the rwc of c. subternata leaves. leaf samples were collected fortnightly at midday (12:00) where 5 top-most leaves per plant were collected, cut into two halves and immediately stored in pre-weighed, labelled glass vials to minimize humidity or vapour loss. the samples were preserved on ice during sampling and quickly transported to the laboratory for rwc determination. fresh weight (fw) of each sample was determined using a sensitive weighing scale. 2 ml of distilled water was added to each vial, kept in a dark cupboard at room temperature for 4 h to facilitate re-hydration. thereafter, the turgid leaf samples were removed from the vials and slightly blotted with a paper towel to remove excess water. the blotted leaves were weighed to determine the turgid weight (tw) and later oven-dried at 70°c for 48 h. the dried samples were later weighed to determine the dry weight (dw). relative water content was calculated using the formula shown below: rwc fw dw tw dw � � � � ( ) ( ) 100 (3) statistical analysis data were analysed with the randomised block factorial anova using sas statistical software (version 9.4, sas institute inc., cary, nc, usa, 2013). anova was used for each observation time (harvest/month) separately, as well as with time as subplot factor (little, 1972). the shapiro-wilk test was utilized in testing for deviation from normality (shapiro, 1965). fisher’s least significant difference was calculated at the 5% level to compare treatment means (ott, 1998). a probability level of 5% was considered significant for all tests. results and discussion physical and chemical characteristics of the soils the results of the baseline physicochemical analysis of the soils on which the c. subternata plants were grown are shown in tables 1 and 2. stellenbosch granite soil had the highest coarse sand levels (0.5–2 mm) while the lowest was found in stellenbosch shale. stellenbosch clovelly had more clay content, with stellenbosch granite having the lowest (table 1). the textural classes for stellenbosch granite, stellenbosch clovelly and stellenbosch shale fall within the coarse sandy loam, fine sandy clay loam and sandy clay loam, respectively. soil ph and other soil nutrients were within the range for normal growth of most plants. growth parameters in general, water stress and soil type had no significant influence (p > 0.05) on plant height, stem diameter or stem circumference throughout the period of the trial (fig. 1, table 3). a summary of p-values for separate anovas of growth parameters per month is presented in table 4. when compared to the stressed plants, the well-watered (control) treatment had significantly taller plants with greater stem circumference in the first sampling month on stellenbosch clovelly soil. thereafter, growth and development of plants did not differ significantly among treatments. the results for the growth parameters of c. subternata in this study contrast with the findings of tshikhudo et al. (2019) where plant height, stem diameter and the number of leaves of bush tea (athrixia phylocoides dc). increased with increase in rainfall. stress experienced by crops during growth has a cumulative effect, which ultimately reduces the final biomass production (kamara et al., 2003). this may be the reason why there was generally no significant difference in the growth of c. subternata grown in this trial while the cumulative effects of water stress were only seen in the harvested biomass (table 5 and fig. 2). however, a study by habibi (2018) on aloe vera demonstrated that shortterm water deficit had no significant effect on the leaf biomass. the short duration of the present study may be responsible for the non-significant differences observed in the growth of both the drought-stressed (semi-stressed and stressed) and the wellwatered (control) plants. table 1. baseline physical characteristics of the three types of soil used in the study physical characteristics stellenbosch granite stellenbosch shale stellenbosch clovelly clay (<0.002 mm) 13 20 23 silt (0.002–0.02 mm) 17 13 6 fine sand (0.02–0.2 mm) 33 50 37.8 medium sand (0.2–0.5 mm) 3 5 13.0 coarse sand (0.5–2 mm) 35 12 20.4 stone volume (%) 0.22 7.72 0.00 soil textural class coarse sandy loam fine sandy clay loam sandy clay loam table 2. baseline chemical composition of the three soil types soil type ex. cations (cmol (+)/kg) macronutrients ph (kcl) resistance (ω) k (%) ca (%) na (%) mg (%) acid saturation (%) na k ca mg no3− p nh4+ k sg 0.14 0.52 4.4 1.6 31.3 23.9 3.2 203 5.3 800 6.97 58.99 1.88 21.45 10.71 sc 0.13 0.52 4.7 1.2 39.7 29.6 3.3 205 5.5 910 7.17 64.82 1.79 16.55 9.67 ss 0.07 0.32 2.8 0.59 10.6 16.9 13.4 124 5.5 1 400 7.59 66.38 1.66 13.99 10.39 sg = stellenbosch granite; sc = stellenbosch clovelly; ss = stellenbosch shale 67water sa 49(1) 64–72 / jan 2023 https://doi.org/10.17159/wsa/2023.v49.i1.3988 figure 1. effects of different irrigation levels on (a) plant height, (b) stem diameter and (c) stem circumference of c. subternata in different months. means with the same letters are not significantly different (p ≤ 0.05). whiskers = standard error bars. table 3. mean growth of c. subternata established on three different types of soil at different sampling times sampling time soil type plant height (cm) stem diameter (mm) stem circumference (mm) 1 stellenbosch granite 17.9083 ± 1.79 a 0.69659 ± 0.10 a 2.2632 ± 0.41 a stellenbosch shale 18.4510 ± 1.99 a 0.69737 ± 0.09 a 2.4456 ± 0.63 a stellenbosch clovelly 18.6031 ± 1.52 a 0.78639 ± 0.23 a 2.1376 ± 0.39 a lsd 1.38 0.13 0.36 2 stellenbosch granite 23.248 ± 2.58 a 1.3674 ± 0.26 a 4.3648 ± 0.54 a stellenbosch shale 22.801 ±2.75 a 1.3098 ± 0.25 a 4.3931 ± 0.86 a stellenbosch clovelly 23.729 ± 3.45 a 1.4395 ± 0.23 a 4.0709 ± 0.86 a lsd 2.51 0.22 0.61 3 stellenbosch granite 26.557 ± 4.54 a 2.7348 ± 0.52 a 8.8084 ± 1.12 a stellenbosch shale 25.897 ± 3.75 a 2.6197 ± 0.50 a 8.6203 ± 1.66 a stellenbosch clovelly 26.515 ± 5.61 a 2.8529± 0.41 a 8.3426 ± 1.71 a lsd 4.25 0.43 1.22 there is no significant difference (p ≥ 0.05) among treatments per sampling time. n = 12; lsd = least significant difference. data are mean ± standard deviation. table 4. summary of p-values for separate anovas of growth parameters per month effect df plant height stem diameter stem circumference 1 2 3 1 2 3 1 2 3 rep 3 0.6831 0.3165 0.5993 0.1744 0.6363 0.5498 0.1988 0.3037 0.1943 irrigation 2 0.1358 0.3525 0.7881 0.5454 0.4991 0.4634 0.0084 0.75500 0.8855 soil 2 0.5587 0.9875 0.9375 0.2916 0.4898 0.5370 0.2335 0.4934 0.7318 irrigation x soil 4 0.0948 0.6838 0.6838 0.7972 0.7724 0.7989 0.7940 0.0957 0.1535 1, 2, 3 = sampling months; n = 12 68water sa 49(1) 64–72 / jan 2023 https://doi.org/10.17159/wsa/2023.v49.i1.3988 yield the results of the effect of irrigation treatments and soil type on the yield of c. subternata are presented in fig. 2 and table 5, respectively. a summarised presentation of p-values for separate anovas on shoot and root biomass is shown in table 6. all three irrigation treatments significantly affected the yield (fresh and dry shoots) (p ≤ 0.05). highest shoot and root yields were recorded in the control treatment on stellenbosch shale soil, with a progressive yield decline observed with increase in stress level. however, there were no significant differences (p > 0.05) in the root yield of the well-watered (5.05 g) and the semi-stressed (4.33 g) treatments. stellenbosch clovelly consistently had poor shoot and root yields among the three soil types while there were no significant differences (p > 0.05) between the biomass yields from stellenbosch granite and stellenbosch shale. eziz et al. (2017) noted that plant growth and biomass production generally decrease with decrease in water availability. however, plants may behave contrary to this, where the cumulative effect of stress during growth may only be visible in the reduced biomass yield (kamara et al., 2003); which was also observed in this study. according to khan et al. (2018), water stress can cause a severe reduction in crop yield, and both the severity and duration of the stress are critical. water availability is a key factor for sustainable crop production. its scarcity can have an adverse effect on the physiological and biochemical processes of the plants, thereby causing low yield. the drought-induced yield (root, fresh and dry shoot) decline was comparable to the findings of zhao et al. (2006), who found that there was a severe reduction in the fresh and dry weights of brassica napus under water-limiting conditions. stress at the vegetative stage of plants may lead to reduced stomatal conductance, net photosynthesis and yield (kerepesi and galiba, 2000; fathi and tari, 2016). the observed yield reduction due to water stress in this study may, therefore, be attributed to impairment of physiological and biochemical processes like photosynthesis, respiration, translocation, ion uptake, and carbohydrate and nutrient metabolism (ali and anjum, 2016) during growth. during the period of stress, plants adopt coping mechanisms such as stomatal closure. however, stomatal closure prevents the intake of co2 into the plant cells, thereby interfering with the calvin cycle, which will eventually reduce the potential yield of the crop (ali and anjum, 2016). figure 2. effect of diverse water stress levels on the root and shoot biomass of c. subternata. fw = fresh weight; dw = dry weight. means with the same letter are not significantly different (p ≤ 0.05). whiskers = standard error bars. table 5. effect of different soil types on the yield of c. subternata soil type shoot weight (g) root weight (g) fresh dry stellenbosch granite 14.048 ± 6.20 a 5.0531 ± 2.12 ab 4.3146 ± 1.63 ab stellenbosch shale 15.625 ± 7.43 a 6.2229 ± 2.57 a 4.8604 ± 1.37 a stellenbosch clovelly 9.022 ± 5.27 b 3.8219 ± 2.03 b 3.6188 ± 1.38 b lsd 3.41 1.39 0.81 fw = fresh weight; dw = dry weight. n = 12; lsd = least significant difference; means with the same letter are not significantly different (p ≤ 0.05). data are mean ± standard deviation. table 6. summary of p-values for separate anovas on shoot and root biomass effect df shoots (fw) shoots (dw) roots rep 3 0.7772 0.7974 0.0002 irrigation 2 <0.0001 <0.0001 0.0013 soil 2 0.0014 0.0061 0.0145 irrigation x soil 4 0.3941 0.5658 0.3069 n = 12; fw = fresh weight; dw = dry weight 69water sa 49(1) 64–72 / jan 2023 https://doi.org/10.17159/wsa/2023.v49.i1.3988 relative water content (rwc) rwc is the proportion of water in a leaf, expressed as the percentage of its maximum volumetric water capacity at full turgor (blum, 2011). it has a direct connection with soil water content and is mostly used as an indicant of water stress in plant leaves. changes in leaf rwc due to the different irrigation levels in this study are depicted in fig. 3. at both sampling times, the well-watered treatment consistently had significantly higher (p ≤ 0.05) rwc (87% and 86%, respectively), while the stressed treatment recorded the lowest values (79% and 76% respectively), although there was no significant difference between the semistressed (81% and 82%) and the stressed treatments (p > 0.05). mabizela (2020) reported similar results, where the stressed and semi-stressed plants had lower rwc compared to the wellwatered treatment with the variance showing from the third day after stress initiation. the low rwc in the stressed treatment indicates a stressed plant population compared with the control. lower rwc in stressed c. subternata leaves used in this study is in accordance with the findings of studies on other species (arjenaki et al., 2012; kabbadj et al., 2017). a study on olives supports the outcomes of this research, where the lowest rwc values were reported for severely water-stressed olives (boussadia et al., 2008). higher rwc in plant leaves means that the plants had the least water stress, and vice versa. at the onset of drought, a reduction in stomatal conductance can reduce availability of co2 for photosynthesis, subsequently leading to inhibition of underlying biochemical processes such as rubisco carboxylation and electron transport activity, and reducing relative water content and even pigment content (khalil et al., 2020). the reduction in the leaf rwc due to the strain caused by limited water availability may be attributed to reduction in stomatal conductance after stomatal closure in response to drought stress. as a result of this, there is an observed decrease in the rwc of the stressed c. subternata plants compared to the well-watered plants (boussadia et al., 2008). for the three soil types, in the first sampling period, there were no significant differences in the leaf rwc of c. subternata grown on granite and clovelly soil types (p > 0.05). the same observation was made for the comparison between graniteand shale-derived soils. however, water stress significantly decreased (p ≤ 0.05) the relative water content of plants grown in stellenbosch clovelly when compared with stellenbosch shale (table 7). in contrast, the second sampling time showed no significant differences among the treatments. a summary of the p-values for anovas for relative water content per period is presented in table 8. soil texture is highly influential for water uptake, and may impede root elongation, availability of water, oxygen and nutrients (khalil et al., 2020). the high percentage of clay in clovelly soil may be responsible for the low leaf rwc in the first sampling period. high clay content in soil increases soil hardness and strength when soil is drying out. as soil strength increases, the more difficult it is for plant roots to access water and nutrients, hence, the lowest rwc in the leaves of c. subternata plants growing on clovelly soil. however, in the second sampling period, since this was a pot experiment, the packaging of the soil might have altered the actual field structure, allowing more macropores in the soils with high clay content than is likely to exist in the field (khalil et al., 2020). the presence of these macropores may have contributed to the non-significant effects observed among all treatments in response to the water treatment. figure 3. relative water content of c. subternata in response to three different irrigation treatments at different sampling times. rwc = relative water content. means with the same letter are not significantly different (p ≤ 0.05). whiskers = standard error bars. table 7. effects of soil type on relative water content of c. subternata at different sampling times sampling time soil type rwc (%) 1 stellenbosch granite 82.766 ± 7.31ab stellenbosch shale 86.362 ± 7.66a stellenbosch clovelly 78.400 ± 9.81b lsd 5.16 2 stellenbosch granite 84.764 ± 8.24a stellenbosch shale 80.241± 7.57a stellenbosch clovelly 79.450 ± 9.65a lsd 5.99 rwc = relative water content; n = 12; lsd = least significant difference. means with the same letter are not significantly different (p ≤ 0.05). data are mean ± standard deviation. table 8. summary of p-values for anova of relative water content per month effect df rwc (%) 1 2 rep 3 0.0445 0.4147 irrigation 2 0.0072 0.0062 soil 2 0.0145 0.1639 irrigation x soil 4 0.0146 0.1311 1, 2 = sampling time; n = 12; rwc = relative water content 70water sa 49(1) 64–72 / jan 2023 https://doi.org/10.17159/wsa/2023.v49.i1.3988 proline several abiotic factors, such as water stress, high temperatures and salinity, can cause protein modification, membrane injury and osmotic stress in plants (meena et al., 2019). plants respond to water stress by building-up osmolytes such as proline, glycine betaine, glycerol and many more, in order to minimize and tolerate cell injury (sharma et al., 2019). figure 4 shows that the stressed c. subternata plants in this study consistently had significantly higher proline contents in all sampling periods, while the lowest proline content was found in the well-watered (p ≤ 0.05) plants. significantly higher proline content was observed in the stressed plants compared to the other two treatments in the first sampling period. however, no significant difference was observed among all treatments in the second and third sampling periods (p > 0.05). the obtained results are comparable to those reported by mabizela (2020) on proline contents of c. subternata, where proline concentration increased massively in stressed treatments, increased slightly in semi-stressed plants, and was constant in control treatments. higher proline content were also reported in wheat, amaranthus species and achillea species after being subjected to water stress (keyvan, 2010; slabbert and krüger, 2014; gharibi et al., 2016). low proline content in plants indicates minimum water stress, and vice-versa. the high and significant levels of proline that were observed between treatments during the third sampling period may be attributed to the plants having reached the reproductive stage and having started flowering. proline can accumulate in plants under both stress and non-stress conditions, although it is produced at low levels in all tissues in unstressed conditions (kavi kishor et al., 2015). as a metabolite and signal molecule, proline plays a crucial role in the synthesis of protein and the response of plant cells to environmental stresses (mattioli et al., 2009). proline levels may increase during wounding and pathogen attack in some tissues, different stages of plant growth and development, nodule formation, fertilization, cytokinesis, apoptosis, senescence, and cell wall lignification. under normal physiological (un-stressed) conditions, plants accumulate high amounts of proline during the transition to flower initiation (kavi kishor et al., 2015), thus suggesting that proline may have a role to play in flower initiation and its subsequent development. soil type did not have any significant effect (p > 0.05) on the proline contents of the plants (table 9). a summary of p-values for anovas of the accumulation of proline per month is presented in table 10. conclusion from this study, it is evident that different deficit irrigation levels and soil type had no significant effects on growth parameters of c. subternata. likewise, soil type had no impact on the proline, rwc and the yield of the plants. water stress increased the proline content, resulting in lower rwc. however, deficit irrigation had a significant effect on the yield (root, fresh and dry shoot biomass). the higher the water stress, the lower the shoot and root biomass yield and vice-versa. although, the well-watered and the semistressed plants gave higher shoot yield, more research is still needed to determine the tea quality of the stressed and unstressed c. subternata plants. acknowledgments the department of science and innovation (dsi) of south africa for funding the project; the department of higher learning and training for supporting the study financially through nurturing emerging scholars programme (nesp); the staff of soil science division, arc infruitec-nietvoorbij for technical support and providing their facilities; dr m van der rijst for assistance with statistical analysis. figure 4. effects of three irrigation levels on proline content of c. subternata at different sampling times. means with the same letter are not significantly different (p ≤ 0.05). whiskers = standard deviation bars. table 9. proline content of c. subternata cultivated on three different types of soil at different sampling times sampling time soil type proline (µmol/g fw) 1 stellenbosch granite 25.818 ± 26.42 stellenbosch shale 21.996 ± 19.42 stellenbosch clovelly 33.053 ± 26.18 lsd 17.95 2 stellenbosch granite 24.258 ± 9.89 stellenbosch shale 22.562 ± 16.08 stellenbosch clovelly 30.284 ± 19.57 lsd 11.61 3 stellenbosch granite 37.616 ± 21.31 stellenbosch shale 31.220 ± 16.90 stellenbosch clovelly lsd 39.156 ± 26.20 18.77 there is no significant difference (p ≥ 0.05) among treatments per sampling time. n = 12; lsd = least significant difference. data are mean ± standard deviation. table 10. summary of p-values for anova of the accumulation of proline per period effect df proline (µmol/g fw) 1 2 3 rep 3 0.0724 0.135 0.2323 irrigation 2 0.0595 0.0287 0.5083 soil 2 0.4465 0.3688 0.6566 irrigation x soil 4 0.3799 0.3793 0.8046 1, 2, 3 = sampling months; n = 12 71water sa 49(1) 64–72 / jan 2023 https://doi.org/10.17159/wsa/2023.v49.i1.3988 contribution of authors mary-jane seji mahlare – data collection, sample analysis, writing the initial draft, writing revision; dr muinat n lewu – conceptualization, methodology, validation, student supervision, writing revision, project leadership, project management; prof francis b lewu – conceptualization, methodology, validation, writing revision, student supervision; dr cecilia bester – conceptualization, methodology, project leadership, project management, funding acquisition. conflict of interest the authors declare no conflict of interest. references ábrahám e, hourton-cabassa c, erdei l and szabados l (2010) methods for determination of proline in plants. in: plant stress tolerance. humana press, new jersey. 317–331. https://doi. org/10.1007/978-1-60761-702-0_20 ali n and anjum mm (2016) drought stress: major cause of low yield and productivity. austin environ. sci. 1 10–12. arjenaki fg, jabbari r and morshedi a (2012) evaluation of drought stress on relative water content, chlorophyll content and mineral elements of wheat (triticum aestivum l.) varieties. int. j. agric. crop sci. 4 (11) 726–729. blum a (2011) plant water relations, plant stress and plant production. in: plant breeding for water-limited environments. springer, new york. 11–52. https://doi.org/10.1007/978-1-4419-7491-4_2 boussadia o, mariem fb, mechri b, boussetta w, braham m and el hadj sb (2008) response to drought of two olive tree cultivars (cv koroneki and meski). sci. hortic. 116 (4) 388–393. https://doi.org/10.1016/j.scienta.2008.02.016 čereković n, pagter m, kristensen hl, pedersen hl, brennan r and petersen kk (2013) effects of drought stress during flowering of two pot-grown blackcurrant (ribes nigrum l.) cultivars. sci. hortic. 162 365–373. https://doi.org/10.1016/j.scienta. 2013.08.026 chakhchar a, lamaoui m, wahbi s, ferradous a, el mousadik a, ibnsouda-koraichi s, filali-maltouf a and el modafar c (2015) leaf water status, osmoregulation and secondary metabolism as a model for depicting drought tolerance in argania spinosa. acta physiol. plant. 37 (4) 1–16. https://doi. org/10.1007/s11738-015-1833-8 connor r (2015) the united nations world water development report 2015: water for a sustainable world, vol. 1. unesco publishing, paris. du toit j, joubert e and britz tj (1998) honeybush tea – a rediscovered indigenous south african herbal tea. j. sustain. agric. 12 (2–3) 67–84. https://doi.org/10.1300/j064v12n02_06 eziz a, yan z, tian d, han w, tang z and fang j (2017) drought effect on plant biomass allocation: a meta‐analysis. ecol. evol. 7 (24) 11002–11010. https://doi.org/10.1002/ece3.3630 fathi a and tari db (2016) effect of drought stress and its mechanism in plants. int. j. life sci. 10 (1) 1–6. gharibi s, tabatabaei bes, saeidi g and goli sah (2016) effect of drought stress on total phenolic, lipid peroxidation, and antioxidant activity of achillea species. appl. biochem. biotechnol. 178 (4) 796–809. https://doi.org/10.1007/s12010-015-1909-3 habibi g (2018) effects of mild and severe drought stress on the biomass, phenolic compounds production and photochemical activity of aloe vera (l.) burm. f. acta. agric. slov. 111 (2) 463–476. https://doi.org/10.14720/aas.2018.111.2.19 harb a, krishnan a, ambavaram mm and pereira a (2010) molecular and physiological analysis of drought stress in arabidopsis reveals early responses leading to acclimation in plant growth. plant physiol. 154 (3) 1254–1271. https://doi.org/10.1104/ pp.110.161752 horn a (2019) honey bush tea – small industry, big potential. farmer’s weekly 5 april 2019. 36–38. jones hg (2007) monitoring plant and soil water status: established and novel methods revisited and their relevance to studies of drought tolerance. j. exp. bot. 58 (2) 119–130. https://doi.org/10.1093/jxb/ erl118 joubert e, gelderblom wca, louw a and de beer d (2008) south african herbal teas: aspalathus linearis, cyclopia spp. and athrixia phylicoides—a review. j. ethnopharmacol. 119 (3) 376–412. https://doi.org/10.1016/j.jep.2008.06.014 joubert e, joubert me, bester c, de beer d and de lange jh (2011) honeybush (cyclopia spp.): from local cottage industry to global markets – the catalytic and supporting role of research. s. afr. j. bot. 77 (4) 887–907. https://doi.org/10.1016/j.sajb.2011.05.014 joubert edbd and de beer d (2011) rooibos (aspalathus linearis) beyond the farm gate: from herbal tea to potential phytopharmaceutical. s. afr. j. bot. 77 (4) 869–886. https://doi. org/10.1016/j.sajb.2011.07.004 kabbadj a, makoudi b, mouradi m, pauly n, frendo p and ghoulam c (2017) physiological and biochemical responses involved in water deficit tolerance of nitrogen-fixing vicia faba. plos one 12 (12) p.e0190284. https://doi.org/10.1371/journal.pone. 0190284 kamara ay, menkir a, badu-apraku b and ibikunle o (2003) the influence of drought stress on growth, yield, and yield components of selected maize genotypes. j. agri. sci. 141 (1) 43–50. https://doi.org/10.1017/s0021859603003423 kardile pb, dahatonde kn, rakshe mv and burondkar mm (2018) effect of moisture stress on leaf relative water content (rwc) of four cowpea (vigna unguiculata l. walp.) genotypes at different stages of growth. int. j. curr. microbiol. appl. sci. 7 2645–2649. https://doi.org/10.20546/ijcmas.2018.704.301 kavi kishor pb, hima kumari p, sunita msl and sreenivasulu n (2015) role of proline in cell wall synthesis and plant development and its implications in plant ontogeny. front. plant sci. 6 544 pp. https://doi.org/10.3389/fpls.2015.00544 kerepesi i and galiba g (2000) osmotic and salt stress‐induced alteration in soluble carbohydrate content in wheat seedlings. crop sci. 40 (2) 482–487. https://doi.org/10.2135/cropsci2000.402482x keyvan s (2010) the effects of drought stress on yield, relative water content, proline, soluble carbohydrates and chlorophyll of bread wheat cultivars. j. anim. plant sci. 8 (3) 1051–1060. khalil am, murchie eh and mooney sj (2020) quantifying the influence of water deficit on root and shoot growth in wheat using x-ray computed tomography. aob plants. 12 (5) 36 pp. https://doi. org/10.1093/aobpla/plaa036 khan a, pan x, najeeb u, tan dky, fahad s, zahoor r and luo h (2018) coping with drought: stress and adaptive mechanisms, and management through cultural and molecular alternatives in cotton as vital constituents for plant stress resilience and fitness. biol. res. 51. https://doi.org/10.1186/s40659-018-0198-z. li-ping bai, fang-gong sui, ti-da ge, zhao-hui sun, yin-yan lu and guang-sheng zhou (2006) effect of soil drought stress on leaf water status, membrane permeability and enzymatic antioxidant system of maize. pedosphere. 16 (3) 326–332. https://doi.org/10.1016/s1002-0160(06)60059-3 little tm and hills fj (1972) statistical methods in agricultural experimentation. university of california, davis. long k and pijanowski bc (2017) is there a relationship between water scarcity and water use efficiency in china? a national decadal assessment across spatial scales. land use policy 69 502–511. https:// doi.org/10.1016/j.landusepol.2017.09.055 lugojan c and ciulca s (2011) evaluation of relative water content in winter wheat. j. hortic. for. biotechnol. 15 (2) 173–177. mabizela gs (2020) metabolic and quality profiling of cyclopia subternata and c. genistoides in response to seasonal variation and drought stress. phd thesis, tshwane university of technology. mattioli r, falasca g, sabatini s, altamura mm, costantino p and trovato m (2009) the proline biosynthetic genes p5cs1 and p5cs2 play overlapping roles in arabidopsis flower transition but not in embryo development. physiol. plant. 137 (1) 72–85. https://doi.org/10.1111/j.1399-3054.2009.01261.x mcgaw lj, steenkamp v and eloff jn (2007) evaluation of athrixia bush tea for cytotoxicity, antioxidant activity, caffeine content and presence of pyrrolizidine alkaloids. j. ethnopharmacol. 110 (1) 16–22. https://doi.org/10.1016/j.jep.2006.08.029 https://doi.org/10.1007/978-1-60761-702-0_20 https://doi.org/10.1007/978-1-60761-702-0_20 https://doi.org/10.1007/978-1-4419-7491-4_2 https://doi.org/10.1016/j.scienta.2008.02.016 https://doi.org/10.1016/j.scienta.2013.08.026 https://doi.org/10.1016/j.scienta.2013.08.026 https://doi.org/10.1007/s11738-015-1833-8 https://doi.org/10.1007/s11738-015-1833-8 https://doi.org/10.1300/j064v12n02_06 https://doi.org/10.1002/ece3.3630 https://doi.org/10.1007/s12010-015-1909-3 https://doi.org/10.14720/aas.2018.111.2.19 https://doi.org/10.1104/pp.110.161752 https://doi.org/10.1104/pp.110.161752 https://doi.org/10.1093/jxb/erl118 https://doi.org/10.1093/jxb/erl118 https://doi.org/10.1016/j.jep.2008.06.014 https://doi.org/10.1016/j.sajb.2011.05.014 https://doi.org/10.1016/j.sajb.2011.07.004 https://doi.org/10.1016/j.sajb.2011.07.004 https://doi.org/10.1371/journal.pone.0190284 https://doi.org/10.1371/journal.pone.0190284 https://doi.org/10.1017/s0021859603003423 https://doi.org/10.20546/ijcmas.2018.704.301 https://doi.org/10.3389/fpls.2015.00544 https://doi.org/10.2135/cropsci2000.402482x https://doi.org/10.1093/aobpla/plaa036 https://doi.org/10.1093/aobpla/plaa036 https://doi.org/10.1186/s40659-018-0198-z https://doi.org/10.1016/s1002-0160(06)60059-3 https://doi.org/10.1016/j.landusepol.2017.09.055 https://doi.org/10.1016/j.landusepol.2017.09.055 https://doi.org/10.1111/j.1399-3054.2009.01261.x https://doi.org/10.1016/j.jep.2006.08.029 72water sa 49(1) 64–72 / jan 2023 https://doi.org/10.17159/wsa/2023.v49.i1.3988 meena m, divyanshu k, kumar s, swapnil p, zehra a, shukla v, yadav m and upadhyay rs (2019) regulation of l-proline biosynthesis, signal transduction, transport, accumulation and its vital role in plants during variable environmental conditions. heliyon 5 (12) p.e02952. https://doi.org/10.1016/j.heli yon.2019.e02952 obidiegwu je, bryan gj, jones hg and prashar a (2015) coping with drought: stress and adaptive responses in potato and perspectives for improvement. front. plant sci. 6. https://doi. org/10.3389/fpls.2015.00542 ott rl and longnecker mt (2015) an introduction to statistical methods and data analysis. cengage learning, boston. per ts, khan na, reddy ps, masood a, hasanuzzaman m, khan mir and anjum na (2017) approaches in modulating proline metabolism in plants for salt and drought stress tolerance: phytohormones, mineral nutrients and transgenics. plant. physiol. biochem. 115 126–140. https://doi.org/10.1016/j.plaphy.2017.03.018 rampedi i and olivier j (2005) the use and potential commercial development of athrixia phylicoides. acta. acad. 37 (3) 165–183. rsa (republic of south africa) (2015) no. 572. limiting the use of water for irrigation, domestic and urban purposes from goedertrouw, hazelmere, klipfontein, hluhluwe, lake merthley, umzinto, ej smith and buffalo systems in kzn. government gazette no. 38924, 03 july 2015. government printer, pretoria. sade n, galkin e and moshelion m (2015) measuring arabidopsis, tomato and barley leaf relative water content (rwc). biol. protoc. 5 (8) 1451–1451. https://doi.org/10.21769/bioprotoc.1451 sas institute, inc. (2013) statistical analysis software. users’ guide statistics version 9.4. sas institute inc., cary, north carolina. shapiro ss and wilk mb (1965) an analysis of variance test for normality (complete samples). biometrika. 52 (3/4) 591–611. https:// doi.org/10.1093/biomet/52.3-4.591 sharma hs, feng l, muresanu df, castellani rj and sharma a (2019) neuroprotective effects of a potent bradykinin b2 receptor antagonist hoe-140 on microvascular permeability, blood flow disturbances, edema formation, cell injury and nitric oxide synthase upregulation following trauma to the spinal cord. academic press. int. rev. neurobiol. 146 103–152. https://doi. org/10.1016/bs.irn.2019.06.008 siddique a and dubey ap (2017) phyto-toxic effect of heavy metal (cdcl2) on seed germination, seedling growth and antioxidant defence metabolism in wheat (triticum aestivum l.) variety huw234. int. j. bio-resour. 8 (2) 261–267. https://doi.org/10.23910/ijbsm/ 2017.8.2.1684 slabbert mm and krüger ghj (2014) antioxidant enzyme activity, proline accumulation, leaf area and cell membrane stability in water stressed amaranthus leaves. s. afr. j. bot. 95 123–128. https://doi.org/10.1016/j.sajb.2014.08.008 soltys-kalina d, plich j, strzelczyk-żyta d, śliwka j and marczewski w (2016) the effect of drought stress on the leaf relative water content and tuber yield of a half-sib family of ‘katahdin’-derived potato cultivars. breed. sci. 66 (2) 328–331. https://doi.org/10.1270/jsbbs.66.328 soni rp, katoch m, kumar a, ladohiya r and verma p (2015) tea: production, composition, consumption and its potential as an antioxidant and antimicrobial agent. int. j. food. ferment. technol. 5 (2) 95–106. https://doi.org/10.5958/2277-9396. 2016.00002.7 surendar kk, devi dd, ravi i, jeyakumar p and velayudham k (2013) water stress affects plant relative water content, soluble protein, total chlorophyll content and yield of ratoon banana. int. j. hortic. 3 (17) 96–103. tshikhudo pp, ntushelo k, kanu sa and mudau fn (2019) growth response of bush tea (athrixia phylocoides dc) to climatic conditions in limpopo province, south africa. s. afr. j. bot. 121 500–504. https://doi.org/10.1016/j.sajb.2018.12.012 van wyk be and gericke n (2000) people’s plants: a guide to useful plants of southern africa. briza publications, pretoria. velasco-muñoz jf, aznar-sánchez ja, belmonteureña lj and lópez-serrano mj (2018) advances in water use efficiency in agriculture: a bibliometric analysis. water 10 (4) 377. https://doi.org/10.3390/w10040377. wwap (united nations world water assessment programme) (2012) the united nations world water development report 4: managing water under uncertainty and risk. unesco, paris. https://doi. org/10.18356/cda9571e-en wwf (2018) agricultural water file: farming for a drier future. http:// awsassets.wwf.org.za/downloads/wwfwaterfiles19july2018.pdf (accessed 16 november 2022). zhao tj, sun s, liu y, liu jm, liu q, yan yb and zhou hm (2006) regulating the drought-responsive element (dre)-mediated signaling pathway by synergic functions of trans-active and transinactive dre binding factors in brassica napus. j. biol. chem. 281 (16) 10752–10759. https://doi.org/10.1074/jbc.m510535200 https://doi.org/10.1016/j.heliyon.2019.e02952 https://doi.org/10.1016/j.heliyon.2019.e02952 https://doi.org/10.3389/fpls.2015.00542 https://doi.org/10.3389/fpls.2015.00542 https://doi.org/10.1016/j.plaphy.2017.03.018 https://doi.org/10.21769/bioprotoc.1451 https://doi.org/10.1093/biomet/52.3-4.591 https://doi.org/10.1093/biomet/52.3-4.591 https://doi.org/10.1016/bs.irn.2019.06.008 https://doi.org/10.1016/bs.irn.2019.06.008 https://doi.org/10.23910/ijbsm/2017.8.2.1684 https://doi.org/10.23910/ijbsm/2017.8.2.1684 https://doi.org/10.1016/j.sajb.2014.08.008 https://doi.org/10.1270/jsbbs.66.328 https://doi.org/10.5958/2277-9396.2016.00002.7 https://doi.org/10.5958/2277-9396.2016.00002.7 https://doi.org/10.1016/j.sajb.2018.12.012 https://doi.org/10.3390/w10040377 https://doi.org/10.18356/cda9571e-en https://doi.org/10.18356/cda9571e-en http://awsassets.wwf.org.za/downloads/wwfwaterfiles19july2018.pdf http://awsassets.wwf.org.za/downloads/wwfwaterfiles19july2018.pdf https://doi.org/10.1074/jbc.m510535200 water sa 49(2) 117–125 / apr 2023 https://doi.org/10.17159/wsa/2023.v49.i2.3956 research paper issn (online) 1816-7950 available on website https://www.watersa.net 117 correspondence nisreen hoosain email nisreen.hoosain@capetown.gov.za dates received: 29 october 2021 accepted: 11 april 2023 key words bacterial genera 16s rrna next-generation sequencing water matrices copyright © the author(s) published under a creative commons attribution 4.0 international licence (cc by 4.0) supplementary material i https://watersa.net/article/ view/16030/19874 supplementary material ii https://watersa.net/article/ view/16030/19875 access to clean water, one of the united nation’s sustainable development goals, is challenged by an increase in the presence of emerging microbial and other contaminants due to urbanization, among other factors. traditionally, the presence of indicator microorganisms is determined using culturing methods. however, these classical methods cannot be used to determine the identities of ‘unknown’ bacteria and is limited to isolating the culturable state of microorganisms. thus with culturing, the identities of many bacteria, particularly novel or non-culturable, may remain unknown. the use of a dna-based method, 16s rrna next-generation sequencing (ngs), can assist with determining the identities of bacterial populations in a water sample. the objective of this 16s rrna ngs study was to investigate the bacterial community composition and diversity in a range of water sources. water samples comprising of potable, surface, ground, marine, aquaculture, rain, wetland and swimming bath water matrices were subjected to 16s rrna ngs using the illumina 16s rrna metagenomics analysis pipeline. operational taxonomic units were analysed and the identities of bacterial genera determined. in this study, genera of acinetobacter, mycobacterium, pseudomonas, legionella, burkholderia, yersinia, staphylococcus and vibrio were spread across the water matrices. alpha (within sample) and beta (between samples) diversities for each bacterial community within the tested samples were also determined. aquasens: exploring the use of 16s rrna next-generation sequencing to determine bacterial composition of various water matrices nisreen hoosain1, jeanne korsman2, peter o kimathi2, paidamoyo kachambwa2, rembu magoba1 and shane l murray2 1scientific services branch, city of cape town (coct ), wastewater avenue, athlone, cape town 7764, south africa 2the centre for proteomic and genomic research (cpgr), upper level, st peter’s mall, corner of anzio and main road, observatory, cape town 7925, south africa introduction approximately 70% of the earth consists of water. of this, about 68.7% is not available as it is present in glaciers and ice caps, and about 30.1% is in groundwater, while roughly 0.3% is found in surface water, which includes rivers, swamps and lakes (national geographic, 2022). water is the basis of all forms of life and is used for various purposes such as domestic (cooking and cleaning), farming, industry and recreation (evans, 2019). water is also an important habitat for bacteria and serves as a means for their dissemination in nature (vaz-moreira et al., 2014). some bacteria have been found to evade disinfection in the drinking water treatment process, either through resistance or via biofilm protection (simoes and simões, 2013; li et al., 2017). as a result, access to clean water has been adopted as one of the united nation’s sustainable development goals (united nations, 2023). in 2017, the world health organisation (who) published their guidelines for drinking water quality as a tool to ensure that drinking water of good quality is maintained. currently in south africa, drinking water is routinely monitored to ensure that it complies with the south african national standard for drinking water (sans 241:2015, sabs, 2015). however, exposure to waterborne bacteria is not limited to potable water. the human gastrointestinal microbiome, shed in faeces, consists of a mixed population of bacteria, some of which are commensals; others exhibit a mutualistic relationship, while some may cause harm in the host (almeida et al., 2019). worldwide, inadequate human hygiene practices, open defecation, lack of access to clean water, and inadequately treated water have notably contributed to various opportunistic infections (carr, 2001; who, 2019). several anthropogenic activities as well as human and animal waste can contaminate surface (rivers and streams), coastal and groundwater sources (páll et al., 2013; itchon and bruni, 2020). in south africa, wastewater treatment plants treat sewage according to licence agreements instituted by the national department of water and sanitation (dws) to reduce the pollution risk of effluents to the environment. growing populations, loadshedding or rolling blackouts, sewer line failures and blockages, sewer pump station overflows and breakages as well as increases in emerging contaminants could have an indirect effect on the efficacy of wastewater treatment (city of cape town, 2020). traditional culture-based techniques determine the presence and number of microorganisms such as bacteria in a tested sample. however, the method is limited to culturable microorganisms (verhille, 2013), is laborious and less sensitive than molecular techniques such as the quantitative polymerase chain reaction (qpcr). despite being a sensitive technique, qpcr can only detect and quantitate the target microorganisms such as bacteria that the reaction has been designed for. thus, unknown/nonsuspected bacteria may remain undetected. urban waters have a diverse array of microorganisms, many of which are still unknown (jin et al., 2018), thus identifying them using specific approaches such as culturing or qpcr is impractical. this could be overcome with the use of screening molecular techniques such as next-generation sequencing (ngs). 16s rrna ngs has transformed the field https://www.watersa.net https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://watersa.net/article/view/16030/19874 https://watersa.net/article/view/16030/19874 https://watersa.net/article/view/16030/19875 https://watersa.net/article/view/16030/19875 118water sa 49(2) 117–125 / apr 2023 https://doi.org/10.17159/wsa/2023.v49.i2.3956 of bacterial ecology (bautista-de los santos et al., 2016; brandt et al., 2018; zhang and liu, 2019). the composition of a bacterial population can be determined using the unique 16s rrnaencoding dna sequences in samples and through comparing it to all known 16s rrna sequences in a database to determine the presence, abundance and taxonomy level of the bacteria present. alpha (within sample) and beta (between samples) diversity can be calculated for each bacterial community giving an indication of the diversity and abundance within the bacterial community (bautista-de los santos et al., 2016). this study aimed to use 16s rrna ngs to investigate the bacterial composition in an array of filtered water samples such as potable, surface, ground, marine, aquaculture, rain, wetland and swimming baths. this study also determined the alpha (within sample) and beta (between samples) diversity for each bacterial community within the tested samples. methods sample collection water samples were mainly collected from the cape metropole area and consisted of municipal samples as well as citizen science samples. municipal potable water samples were collected in disposable 250ml pet sterile (gamma radiated) bottles with 3% sodium thiosulphate; while swimming bath samples were collected in pre-autoclaved bottles, transported on ice and immediately filtered upon arrival at the laboratory. citizen science samples were collected in a sterile manner at the water source using sterile disposable gloves. the stipulated instructions for water filtration and storage were supplied with the water collection kit. each water sample (three 60 ml aliquots) was aseptically filtered using a syringe-filtering unit (cellulose acetate membranes with 0.2 µm pores; gvs filter technologies, uk) and touching of the syringe and filter attachment points was avoided. all processed filters were placed in sterile plastic zip-lock bags and stored at −20°c until delivered to cpgr. frozen filters were transported on ice to cpgr and stored at −20°c prior to dna extraction. water samples were collected (50 from the municipality and 50 from a variety of water sources supplied by members of the public, see supplementary material i) between 2019/10/28 and 2019/11/26. in tandem, the municipal samples were subjected to standard microbial analyses and assessed according to the required guidelines (who, 2006; doh, 2015; sans, 2015). dna extraction and qc filters were sterilely removed and dna extractions carried out using the zymobiomics 96 magbead dna kit (zymo research, usa). as a negative control, dna was extracted from a sterile filter. dna quantification was carried out on the glomax multi detection system (promega, usa) using the fluorescent-based quantifluor dsdna system (promega, usa). sequencing in addition to all extracted dna samples, the zymobiomics microbial community dna standard (zymo research, usa) positive control and a no-template control were included in library preparation and sequencing. the 16s v3-v4 rrna amplicons were produced according to the illumina 16s metagenomics sequencing library preparation guide using kapa hifi hotstart readymix (roche, usa) and the nextera xt index kit v2 (illumina, usa). libraries were normalised to 5 ng/µl or left at their original concentration if lower than 5  ng/µl. up to 10 ng of each sequencing library was pooled. the concentration of the final library pool was confirmed by qpcr using the kapa illumina library quantification kit (roche, usa) and diluted to a concentration of 4nm, denatured, diluted to 5 pm and combined with the 10% phix control (illumina, usa). sequencing was performed on an illumina miseq (illumina, usa) using an illumina miseq reagent kit v2 (500 cycles). data analysis the illumina 16s rrna metagenomics analysis pipeline classified sequencing reads using an illumina-curated version of the greengenes database (desantis et al., 2006) and run on all samples using the miseq reporter software version 2.6.2.3 (illumina, usa). the resulting summary text files for each sample contained operational taxonomic unit (otu) classifications, the related number and percentage of otu reads. otus that were not assigned to a taxonomic classification were labelled ‘unclassified’, along with the related number and percentage of reads. programming scripts were used to (i) filter otus with less than 1% of the total number of reads; (ii) sum and list otus to genus level; while (iii) remaining otus with a classification higher than genus were labelled ‘other, level > genus’; (iv) identify bacterial genera based on who, 2006; usepa, 2012 and who, 2017 guidelines; and (v) calculate the shannon diversity index (h) as follows: h = ∑ − (pi x ln pi), where pi = proportion of the sample represented by genus i (spellerberg and fedor, 2003). further data analysis and graphical representation was carried out using excel, the on-line venn diagram tool (ghent university, 2023) or jamovi version 1.6.13 (jamovi, 2023). after testing for normality using the shapiro wilk test, welch’s one-way anova with a games-howell post-hoc test was used to determine statistically significant differences between shannon diversities of the different water matrices. fastq files were uploaded to the cyverse data store (cyverse, 2023) and analysed using the dna subway (cold spring harbor laboratory, 2023) metabarcoding pipeline with a simplified version of the qiime 2 pipeline (bolyen et al., 2019). the greengenes database was used for classification. beta diversity was analysed by principal component analysis (pca) of the unweighted unifrac distance which measures the community dissimilarity and incorporates phylogenetic relationships between the features (lozupone and knight, 2005). sequencing reads were deposited on the ncbi sequence read archive with project number prjna775828. results and discussion samples, dna extraction and library preparation a mixture of filtered water samples were received from the municipality and from members of the public, which included samples from an abalone farm, an aquaponics system, boreholes, bottled water, household taps, freshwater and marine tanks, harbour and sea samples, rainwater tanks, rivers, springs, an estuary, a vlei and wellpoints. municipal potable water and swimming bath samples were subjected to standard microbial analyses. all municipal samples tested were compliant (supplementary material i), except for two desalination plants which exceeded the sans241:2015 limits (supplementary material i). both swimming bath samples complied with the national and who operational guidelines for microbial testing (supplementary material i) (who, 2006; doh, 2015). dna concentrations from the extracted water samples ranged from <1 ng/µl to 37 ng/µl (supplementary material i). to test the utility of the dna across this concentration range, 16s rrna sequencing libraries were produced from all samples and quantified. the concentration of the sterile filter negative control library was 0.317 ng/µl (supplementary material i). thirteen filtered water samples had library dna concentrations <0.317 ng/µl 119water sa 49(2) 117–125 / apr 2023 https://doi.org/10.17159/wsa/2023.v49.i2.3956 and were therefore excluded from further analysis. thus only 87 of the 100 samples were subjected for further analyses in the study. these water samples were divided into 8 categories: potable water, surface water (from dams and rivers), groundwater (from springs, wellpoints and boreholes), marine water (from sea, harbour and marine water tanks), aquaculture samples (from abalone and aquaponics systems), rainwater tanks, wetland samples (vlei and estuary) and swimming baths (fig. 1, supplementary material i). sequencing and data analysis the miseq sequencing run resulted in 7.72  gb non-indexed sequence data. the q-score distribution plot generated a q30 score of 76.0% for the sequencing run, indicating that the quality of the sequencing data was acceptable. the sequencing output was run through illumina’s 16s rrna metagenomics pipeline. the number of sequencing reads for the detected genera based on who (2006), epa (2012) and who (2017) were identified (supplementary material i). supplementary material ii lists the genera identified in each water sample. a very low number of reads was obtained for the no-template and sterile filter negative controls (885 and 7 540 filtered reads, respectively). the percentage of filtered reads classified at the genus level with high confidence for the zymobiomics positive control are shown in fig. 2. the zymobiomics microbial community dna standard consists of 8 bacterial genera and all 8 genera were detected, ranging from 3.9% of filtered total reads (for salmonella spp.) to 16.2% of filtered total reads (for bacillus spp.). bacterial diversity of varied water sources the shannon diversity index was used to calculate an overall score of diversity for each sample at the genus level (supplementary material i). to compare diversity ranges within the eight water categories, the mean shannon diversity index was calculated (fig. 3). the potable water category had the lowest average shannon diversity. this was significantly lower than rain and surface water, whereas the rain tank category (reflecting samples harvested from rooves and stored prior to purification) had the highest shannon diversity (fig. 3). beta diversity of the sample types was determined using an unweighted unifrac pca. this measured bacterial community differences between the tested samples (lozupone and knight, 2005). the majority of the potable samples, together with the swimming bath samples, broadly separated from the other sample types based on the first component contributing to the variation (13.8% of the variation), whereas the rain tank and the majority of the ground and surface water samples grouped further from the other sample types based on the second component (5.338% of the variation) (fig. 4). figure 1. pie chart showing the percentage composition for 8 water categories included in the study figure 2. number and percentage of reads corresponding to the eight genera found in the zymobiomics microbial community dna positive control 120water sa 49(2) 117–125 / apr 2023 https://doi.org/10.17159/wsa/2023.v49.i2.3956 within the surface water category, 6 river samples were collected within a few days of each other from clearly defined river crossings along the otter trail, a hiking trail along the garden route coast of south africa. this dataset offered an opportunity to study the diversity of different genera in nearby rivers over a very short time. comparison of the genera identified for each sample (supplementary material ii, fig. 5) indicated that there was very little overlap between the different samples. this suggests that the composition of the bacterial populations in these river samples may be influenced by distance to the river mouth, localised geology and upstream farming practices (doherty et al., 2017; chen et al., 2018). identification of bacterial genera filtered sequencing data were further analysed to determine the genera based on who (2006), usepa (2012) and who (2017) guidelines, in each water category (table 1). sequencing reads corresponding to 8 genera (acinetobacter, mycobacterium, pseudomonas, legionella, burkholderia, yersinia, staphylococcus and vibrio) were detected in at least one matrix (table 1; who, 2017). in addition, sequencing reads corresponding to the genera streptococcus, clostridium, microcyctis, and arcobacter were detected in more than one water matrix (table 1; who, 2006; usepa, 2012). currently, the acinetobacter genus consists of 74 different species (lpsn, 2022a; parte et al., 2020), is considered to be ubiquitous in nature, and its presence in sewage, soil, water, food and clinical environments is noted (towner, 2006; who, 2017). acinetobacter spp. have been linked to enhanced biological phosphorus removal from wastewater (wagner et al., 1994; yang et al., 2015) and have bioremediation potential (paisio et al., 2016; al-hadithi et al., 2017) suggesting a further possibility for their presence in waterbodies. to date, acinetobacter spp. have been found in potable water (carvalheira et al., 2021), rivers (kittinger et al., 2018), wastewater (yang et al., 2015), groundwater (pindi et al., 2013) and seawater (yoon et al., 2007). in this study, acinetobacter was detected in 4 potable water samples (2 tap and 2 desalination water samples) and 1 surface (river) water sample (table 1; supplementary material i). figure 3. box plots of shannon diversity for the different sample types or sources. statistical significance is indicated by *p < 0.05; **p < 0.005; ***p < 0.0005. figure 4. unweighted unifrac beta diversity principal component analysis showing grouping of the sample types 121water sa 49(2) 117–125 / apr 2023 https://doi.org/10.17159/wsa/2023.v49.i2.3956 the mycobacterium genus consists of 3 groups: (1) obligate pathogens, (2) potential pathogens and (3) saprophytes (vaerewijck et al., 2005). group 1, the m. tuberculosis complex (mtc), causes disease in humans and animals and is generally not found in the environment. on the other hand, group 2 (potential pathogens) consists of the mycobacterium avium complex (mac) (hunter, 1997) and is found in terrestrial and aquatic environments. in comparison, group 3 (saprophytes) are rarely pathogenic (vaerewijck et al., 2005). groups 2 and 3 are also known as non-tuberculosis/atypical mycobacterium (ntm), are naturally occurring in a range of water environments, and are able to grow and persist if conditions are suitable (le dantec et al., 2002; who, 2017). to date, there are 195 validly published species of mycobacterium (lpsn, 2022b). in our study, the genus mycobacterium was identified in 1 sample in each of the following categories: aquaculture, marine, surface, wetland and swimming bath; as well as in 5 potable water samples (table 1; supplementary material i). these findings are in agreement with international studies where mycobacterium was found in aquaculture (yanong and pouder, 2010; gcebe et al., 2018; mugetti et al., 2020; mataragka et al., 2022), marine environments (hashish et al., 2018; mataragka et al., 2022), surface water (eun-sook et al., 2008), wetlands (kopecky et al., 2011; tortone et al., 2018), swimming baths (torvinen et al., 1999; d’ancona et al., 2014) and extensively found in potable water sources worldwide (bailey et al., 1970; von reyn et al., 1993; schwartz et al., 1998; vaerewijck et al., 2005; tortone et al., 2018; lin et al., 2020). furthermore, chlorine disinfection has been found to be ineffective for figure 5. venn diagram showing overlap of unique genera present in the jerling, geelhout, klip, kleinbos, elandsbos and bloukrans rivers found along the otter trail along the garden route coast of south africa. numbers are unique genera, while coloured shapes represent rivers: jerling = blue, geelhout = red, klip = turquoise, kleinbos = green, elandsbos = yellow and bloukrans = brown. table 1. bacterial genera* detected in various water categories genus water source potable (44) ground (11) surface (15) wetlands (2) marine (5) aquaculture (4) rainwater tanks (4) swimming baths (2) acinetobacter* 4 0 1 0 0 0 0 0 mycobacterium* 5 0 1 1 1 1 0 1 pseudomonas* 3 0 5 0 0 0 0 1 legionella* 12 1 2 1 1 2 1 0 burkholderia* 0 0 3 0 0 0 0 0 yersinia* 0 0 1 0 0 0 0 0 staphylococcus* 0 0 0 0 0 0 0 2 vibrio* 0 0 0 0 0 2 0 0 streptococcus* 0 1 3 0 0 0 0 0 clostridium* 1 1 2 0 0 0 0 0 microcystis* 1 0 1 1 0 0 0 0 arcobacter 2 1 3 0 2 2 0 0 *genus list was compiled using who (2006), usepa (2012) and who (2017) guidelines 122water sa 49(2) 117–125 / apr 2023 https://doi.org/10.17159/wsa/2023.v49.i2.3956 mycobacterium in potable water samples, with the presence of biofilms adding an extra mechanism for its persistence in water (simoes and simões, 2013; li et al., 2017). pseudomonas are free-living micro-organisms and ubiquitous in nature. the genus is found in moist environments, rivers and soils, therapy pools and surrounding areas, and is often associated with biofilm production (wingender and flemming, 2011; koeck et al., 2018). to date, there are 310 validly published species of pseudomonas (lpsn, 2022c). in our study, the genus pseudomonas was detected in 3 potable water samples, 1 swimming bath and 5 surface water samples, 4 of which were found along the otter trail (table 1; supplementary material i). of interest, 20 samples (23%) in this study contained legionella. twelve of these were potable water samples (2 from water treatment plants and 10 from distribution points or taps) (table 1; supplementary material i). this is possible as legionella can grow in water, pipe biofilms and soil. high levels of biodegradable organic carbon, warmer temperatures, stagnant water, low residual chlorine concentrations and biofilms may further exacerbate their growth in water (who, 2017). other water categories where legionella were detected in our study included: 2 samples from an abalone farm and 1 sample each from a dam and river (surface water), spring, wetlands, marine, and rainwater tank (table 1; supplementary material i). legionella is an environmental microorganism and may proliferate in suitable conditions (who, 2017). currently, there are more than 58 different legionella spp. with more than 70 serotypes, (ditommaso et al, 2021; legionella control international ltd., 2021). burkholderia was detected in 3 river samples; 2 of which were along the otter trail (table 1; supplementary material i). burkholderia was co-detected with yersinia in 1 river sample. the principle reservoirs of yersinia spp. are domestic and wild animals but they can also be found in sewage and polluted waters (who, 2017). in 2015, a study by prentice indicated that a species of yersinia could enter the viable but non-culturable state in water and could also persist in soil, thus emphasizing the importance for molecular monitoring over culturing for this genus. the presence of burkholderia spp. has been documented in soil and muddy water in tropical regions (who, 2017), coastal environments and mussels (maravić et al., 2012), a water treatment plant (inglis et al., 2000) and also maintained its culturable state after several years’ incubation in distilled water (wuthiekanun et al., 1995). in this study, staphylococcus was detected in 2 swimming bath samples (table 1; supplementary material i). staphylococci are ubiquitous in the environment and commonly found in mucous membranes and on human and animal skins (leroy et al., 2016). as a result of its presence on the skin, it can be transferred to swimming baths, recreational water and spa pools (koeck et al., 2018). although this microorganism has been detected in drinking water, there is no evidence that it can be transmitted through water consumption (who, 2017). staphylococci are occasionally found in the gastrointestinal tracts of humans; thus its presence in sewage is also possible (who, 2017). there are currently 138 validly published species of vibrio (lpsn, 2022d). these species are abundant in aquatic environments as well as in the organs and/or tissues of marine algae and animals, including corals, sponges, bivalves, abalone, shrimp, fish, squid, and zooplankton (nicolas et al., 2002; cai et al., 2006; pichon et al., 2013; economopoulou et al., 2017), which may negatively impact the infected species and may also have a zoonotic potential (economopoulou et al., 2017). in our study, the vibrio genus was detected in 2 aquaculture samples where abalone was farmed. although escherichia spp. sequencing reads were not reported in various water samples of this study (table 1), it was reported in the zymobiomics control (fig. 2). escherichia spp. and shigella spp. are closely related and belong to the enterobacteriaceae family (devanga ragupathi et al., 2017). of the municipal samples collected, one treated desalination plant sample (asv041) contained 1 cfu/100 ml e. coli (supplementary material i). additionally, poor correlation between 16s microbiome sequencing data and culture-based methods may reflect the limits of detection using 16s sequencing, as low numbers of sequencing reads associated with low concentrations of micro-organisms in communities may be removed during down-stream data analysis steps; alternatively deeper sequencing may be needed to detect micro-organisms in very low abundance (hamady and knight, 2009; schang et al. 2016). intestinal enterococci are also used to monitor water quality (who, 2017). they consist of 2 genera, enterococcus and streptococcus, and are used as indicators of faecal pollution. intestinal enterococci are highly prevalent in sewage and sewage spills as well as human and animal waste. they survive for longer periods in water compared to e. coli, and are resistant to chlorination and dry conditions (who, 2017). limayem et. al. (2019) found streptococcus to be the second-most predominant genus in influent and treated effluent samples collected at reclamation facilities in the usa. streptococcus were also found in the nile river (goja, 2013) as well as in a groundwater sample in south africa (ateba and moloantoa, 2013). in our study, enterococcus was not detected but streptococcus was identified in 3 river samples and 1 groundwater sample (supplementary material i). clostridium spp. are ubiquitous in nature and often found in the gastro-intestinal tracts of humans and animals. these species can enter surface water systems via runoff in agricultural settings or through treated wastewater effluents (fourie, 2017). the genus clostridium was detected in 4 samples in this study, consisting of 2 surface (river), 1 groundwater and 1 potable water sample (supplementary material i, ii); these surface and groundwater samples also contained streptococcus spp. the two surface water samples (asv005 and asv006) were submitted with a note of ‘may contain sewage’, suggesting that the presence of both streptococcus spp. and clostridium spp. may be linked to faecal contamination, while an explanation for the presence of both genera in a single groundwater sample (asv016) in our study is unclear. cyanobacteria are found in a range of environments, including hot springs, soil, artificially illuminated cave systems, ice layers in polar regions as well as in marine, brackish and freshwater systems (harding and paxton, 2001; who, 2017; usepa, 2020). these aquatic organisms produce pigments and generally occur in low numbers in most surface waters; however, eutrophication can result in bloom development. microcystis is a genus of freshwater cyanobacteria and is capable of causing harmful/toxic as well as non-toxic blooms in ecosystems globally (park et al., 2018; pérez-carrascal et al., 2019). in our study, microcystis was detected in 1 wetland, 1 potable water (citizen science sample) and 1 surface water (raw sample: water treatment plant) sample (supplementary material i, ii). all samples were colourless and odourless, suggesting low growth of microcystis. no sequencing reads corresponding to other cyanotoxic bacteria were detected. arcobacter, a genus of emerging concern, has been associated with 3 waterborne outbreaks and its persistence in wastewater is suggestive of an ecological reservoir (banting and figueras salvat, 2017). in our study, arcobacter was detected in 2 potable, 3 surface, 2 marine, 1 ground and 2 aquaculture water samples, all of which were citizen science samples. this finding is not new as arcobacter spp. have been identified in several water sources worldwide. these include: tap and river water in asia (marita et al., 2004) and europe (moreno et al., 2003), seawater in spain (collado et al., 2008), groundwater in south africa and turkey (diergaardt et al., 2004; ertas et al., 2010), and it has also been isolated from abalone in japan (mizutani et al., 2019). 123water sa 49(2) 117–125 / apr 2023 https://doi.org/10.17159/wsa/2023.v49.i2.3956 importantly, the viability status of the microorganisms detected in our study was not determined and was not part of the scope of the current study. rather, it was used to determine the bacteriological composition and diversity within and among the tested water samples. conclusion this 16s rrna amplicon microbiome sequencing study identified genera which included acinetobacter, mycobacterium, pseudomonas, legionella, burkholderia, yersinia, staphylococcus, vibrio, streptococcus, clostridium, microcystis and arcobacter. in addition, this study uncovered a wide range of bacterial diversity at the genus level, both within and between the different water types, with municipal treated potable samples and samples from rain tanks displaying the lowest and highest within-sample type diversity, respectively. of note, the limit of detection of 16s ngs compared to culture techniques is also an important factor to consider as the indicator micro-organism, e. coli, could be present in lower concentrations compared to the more abundant genera. thus e. coli may not be detected with ngs but could be cultured using selective media or detected using a rapid technology like idexx colilert. acknowledgements gratitude is extended to cpgr for funding and to members of the public for providing water samples to incorporate a citizen science component in the study. additionally, municipal staff are thanked for sampling, sample filtration and microbial analyses of the municipal samples. conflicts of interest the authors declare no conflict of interest. references al-hadithi ht, al-razzaq ea and fadhil gf (2017) bioremediation of polycyclic aromatic hydrocarbons by acinetobacter species isolated from ecological sources. j. environ. biol. 38 785–789. https://doi.org/10.22438/jeb/38/5/mrn-422 almeida a, mitchell al, boland m, forster sc, gloor gb, tarkowska a, lawley td and finn rd (2019) a new genomic blueprint of the human gut microbiota. nature 568  499–504. https://doi.org/10.1038/s41586-019-0965-1 ateba cn and moloantoa m (2013) isolation of group b streptococcus in groundwater in the north west province, south africa. life sci. j. 10 (3) 444–449. bailey rk, wyles s, dingley m, hesse f and kent gw (1970) the isolation of high catalase mycobacterium kansasii from tap water. am. rev. respirat. dis. 101 (3) 430–431. banting g and figueras salvat mj (2017) arcobacter. in: pruden a, ashbolt n and miller j (eds) part 3: specific excreted pathogens: environmental and epidemiology aspects – section 2: bacteria. in: rose jb and jiménez-cisneros (eds) water and sanitation for the 21st century: health and microbiological aspects of excreta and wastewater management (global water pathogen project). michigan state university, e lansing, mi, unesco. https://doi.org/10.14321/waterpathogens.22 bautista-de los santos om, schroeder jl, sevillanorivera mc, sungthong r, ijiaz uz, sloan wt and pinto aj (2016) emerging investigators series: microbial communities in full-scale drinking water distribution systems – a meta-analysis. environ. sci. water res. technol. 2 (4) 631–644. https://doi.org/10.1039/c6ew00030d brandt j and albertsen m (2018) investigation of detection limits and the influence of dna extraction and primer choice on the observed microbial communities in drinking water samples using 16 s rrna gene amplicon sequencing. front. microbiol. 9 (2140) https://doi.org/10.3389/fmicb.2018.02140 bolyen e, rideout jr, dillon mr, bokulich na, abnet cc, al-ghalith ga, alexander h, alm ej, arumugam m, asnicar f and co-authors (2019) reproducible, interactive, scalable and extensible microbiome data science using qiime 2. nat. biotechnol. 37  852–857. https://doi.org/10.1038/s41587-0190209-9 cai j, han y and wang z (2006) isolation of vibrio parahaemolyticus from abalone (haliotis diversicolor supertexta l.) postlarvae associated with mass mortalities. aquaculture 257 (1–4) 161–166. https://doi.org/10.1016/j.aquaculture.2006.03.007 carr r (2001) excreta-related infections and the role of sanitation in the control of transmission. in: fewtrell l and bartram j (eds) world health organization (who), water quality: guidelines, standards and health. iwa publishing, london. isbn: 1900222280. carvalheira a, silva j and teixeira p (2021) acinetobacter spp. in food and drinking water – a review. food microbiol. 95 103675. https://doi.org/10.1016/j.fm.2020.103675 chen w, wilkes g, khan iuh, pintar kdm, thomas jl, lévesque ca, chapados jt, topp e and lapen dr (2018) aquatic bacterial communities associated with land use and environmental factors in agricultural landscapes using a metabarcoding approach. front. microbiol. 9 2301. https://doi. org/10.3389/fmicb.2018.02301 city of cape town (2020) know your coast: key findings from over 10  000 sample bacterial tests at 99 sites along 307 km of coastline. url: https://resource.capetown.gov.za/documentcentre/ documents/city%20research%20reports%20and%20review/know_ your_coast_2020.pdf (accessed 30 june 2021). collado l, inza i, guarro j and figueras mj (2008) presence of arcobacter spp. in environmental waters correlates with high levels of faecal pollution. environ. microbiol. 10 1635–1640. https:// doi.org/10.1111/j.1462-2920.2007.01555.x cold spring harbor laboratory (2023) dna subway. url: https://dnasubway.cyverse.org (accessed 11 april 2023). cyverse (2023) the open science workspace for collaborative datadriven discovery. url: https://cyverse.org (accessed 11 april 2023). d’ancona fp, kanitz ee, marinelli l, sinagra jl, prignano g, cerocchi c, bonadonna l, tortoli e, capitanio b, cottarelli a and de giusti m (2014) non tuberculous cutaneous mycobacteriosis in a primary school in rome: epidemiological and microbiological investigation. ann. igiene med. prevent. comun. 26 (4) 305–310. https://doi.org/10.7416/ ai.2014.1990 doh (department of health, south africa) (2015) national environmental health norms and standards for premises and acceptable monitoring standards for environmental health practitioners. government gazette no. 39561. url: www.gpwonline.co.za desantis tz, hugenholtz p, larsen n, rojas m, brodie el, keller k, huber t, dalevi d, hu p and andersen gl (2006) greengenes, a chimera-checked 16s rrna gene database and workbench compatible with arb. appl. environ. microbiol. 72 (7) 5069–5072. https://doi.org/10.1128/aem.03006-05 devanga ragupathi nk, muthuirulandi sethuvel dp, inbanathan fy and veeraraghavan b (2018) accurate differentiation of escherichia coli and shigella serogroups: challenges and strategies. new microbes new infect. 21 58–62. https://doi. org/10.1016/j.nmni.2017.09.003 diergaardt sm, venter sn, spreeth a, theron j and brozel vs (2004) the occurrence of campylobacters in water sources in south africa. water res. 38 2589–2595. https://doi.org/ 10.1016/j.watres.2004.03.004 ditommaso s, giacomuzzi m, memoli g, garlasco j and zotti cm (2021) comparison of bcyeα+ab agar and mwy agar for detection and enumeration of legionella spp. in hospital water samples. bmc microbiol. 21 48. https://doi.org/10.1186/s12866-02102109-1 doherty m, yager pl, moran ma, coles vj, fortunato cs, krusche av, medeiros pm, payet jp, richey je, satinsky bm, sawakuchi ho, ward nd and crump bc (2017) bacterial biogeography across the amazon river–ocean continuum. front. microbiol. 8 882. https://doi.org/10.3389/fmicb. 2017.00882 https://doi.org/10.22438/jeb/38/5/mrn-422 https://doi.org/10.1038/s41586-019-0965-1 https://doi.org/10.14321/waterpathogens.22 https://doi.org/10.1039/c6ew00030d https://doi.org/10.1038/s41587-019-0209-9 https://doi.org/10.1038/s41587-019-0209-9 https://doi.org/10.1016/j.aquaculture.2006.03.007 https://doi.org/10.1016/j.fm.2020.103675 https://doi.org/10.3389/fmicb.2018.02301 https://doi.org/10.3389/fmicb.2018.02301 https://resource.capetown.gov.za/documentcentre/documents/city%20research%20reports%20and%20review/know_your_coast_2020.pdf https://resource.capetown.gov.za/documentcentre/documents/city%20research%20reports%20and%20review/know_your_coast_2020.pdf https://resource.capetown.gov.za/documentcentre/documents/city%20research%20reports%20and%20review/know_your_coast_2020.pdf https://doi.org/10.1111/j.1462-2920.2007.01555.x https://doi.org/10.1111/j.1462-2920.2007.01555.x https://dnasubway.cyverse.org https://cyverse.org https://doi.org/10.7416/ai.2014.1990 https://doi.org/10.7416/ai.2014.1990 http://www.gpwonline.co.za https://doi.org/10.1128/aem.03006-05 https://doi.org/10.1016/j.nmni.2017.09.003 https://doi.org/10.1016/j.nmni.2017.09.003 https://doi.org/10.1016/j.watres.2004.03.004 https://doi.org/10.1016/j.watres.2004.03.004 https://doi.org/10.1186/s12866-021-02109-1 https://doi.org/10.1186/s12866-021-02109-1 https://doi.org/10.3389/fmicb.2017.00882 https://doi.org/10.3389/fmicb.2017.00882 124water sa 49(2) 117–125 / apr 2023 https://doi.org/10.17159/wsa/2023.v49.i2.3956 economopoulou a, chochlakis d, almpan ma, sandalakis v, maraki s, tselentis y and psaroulaki a (2017)  environmental investigation for the presence of  vibrio species following a case of severe gastroenteritis in a touristic island.  environ. sci. pollut. res.  24  4835–4840. https://doi.org/10. 1007/s11356-016-8231-7 ertas n, dogruer y, gonulalan z, guner a and ulger i (2010). prevalence of arcobacter species in drinking water, spring water, and raw milk as determined by multiplex pcr. j. food protect. 73 2099–2102. https://doi.org/10.4315/0362-028x-73.11.2099 eun-sook l, lee m-y, han s-h and ka j-o (2008) occurrence of molecular differentiation of environmental mycobacteria in surface waters. j. microbiol. biotechnol. 18 (7) 1207–12015. evans m (2019) how we use water and why we should conserve more. url: https://www.thebalancesmb.com/how-do-we-use-water-andwhy-conserve-3157863 (accessed 19 december 2022). fourie jcj (2017) characterization of clostridium spp. isolated from selected surface water systems and aquatic sediment. msc thesis, north-west university. gcebe n, michel al and hlokwe tm (2018) non-tuberculous mycobacterium species causing mycobacteriosis in farmed aquatic animals of south africa.  bmc microbiology  18 32 https://doi.org/ 10.1186/s12866-018-1177-9 goja am (2013) bacterial genera and their some species of nile water.  asian j. biol. sci. 6 116–123. https://doi.org/10.3923/ajbs. 2013.116.123 ghent university (2023) bioinformatics and evolutionary genomics. url: http://bioinformatics.psb.ugent.be/webtools/venn/ (accessed 11 april 2023). hamady m and knight r (2009) next-generation dna sequencing/review: microbial community profiling for human microbiome projects: tools, techniques and challenges. genome res. 19 1141–1152. https://doi.org/10.1101/gr.085464.108 harding w and paxton b (2001) cyanobacteria in south africa: a review. wrc report no: tt 153/01. water research commission, pretoria. url: http://www.wrc.org.za/wp-content/uploads/mdocs/ tt153-01.pdf (accessed 12 august 2022). hashish e, merwad a, elgaml s, amer a, kamal h, elsadek a, marei a and sitohy m (2018) mycobacterium marinum infection in fish and man: epidemiology, pathophysiology and management; a review. vet. q. 38 35–46. https://doi.org/10.108 0/01652176.2018.1447171 hunter pr (1997) waterborne disease: epidemiology and ecology. new york, wiley. isbn: 978-0-471-96646-3 384. inglis tj, garrow sc, henderson m, clair a, sampson j, o’ reilly l and cameron b (2000) burkholderia pseudomallei traced to water treatment plant in australia. emerg. infect. dis. 6 (1) 56–59. itchon gs and bruni m (2020) pathogens and contaminants. url: https://sswm.info/arctic-wash/module-2-environment-pollution levels-implications/further-resources-environment-and/pathogens %26-contaminants(accessed 19 august 2022). jamovi (2023) open statistical software for the desktop and cloud. url: https://www.jamovi.org (accessed 11 april 2023). jin d, kong x, cui b, jin s, xie y, wang x and deng y (2018) bacterial communities and potential waterborne pathogens within typical urban surface waters. sci. rep. 8 13368. https://doi. org/10.1038/s41598-018-31706-w kittinger c, kirschner a, lipp m, baumert r, mascher f, farnleitner ah and zarfel ge (2018) antibiotic resistance of acinetobacter spp. isolates from river danube: susceptibility stays high. int. j. environ. res. publ. health 15 (1) 52. https://doi. org/10.3390/ijerph15010052 koeck de, huber s, hanifi n, köster m, schierling mb and höller c (2018) occurrence of antibiotic-resistant bacteria in therapy pools and surrounding surfaces. int. j. environ. res. publ. health 15 (12) 2666. https://doi.org/10.3390/ijerph15122666 kopecky j, kyselkova m, omelka m, cermak, l, novotna j, grundmann g, moënne-loccoz and sagovamareckova m (2011) environmental mycobacteria closely related to the pathogenic species evidenced in an acidic forest wetland. soil biol. biochem. 43 697–700. https://doi.org/10.1016/j. soilbio.2010.11.033 le dantec c, duguet j-p, montiel a, dumoutier n, dubrou s and vincent v (2002) occurrence of mycobacteria in water treatment lines and in water distribution systems. j. appl. environ. microbiol. 68 (11) 5318–5325. https://doi.org/10.1128/ aem.68.11.5318-5325.2002 legionella control international ltd (2021) how many legionella species exist and which ones cause legionnaires’ disease? url: https://legionellacontrol.com/legionella/legionellaspecies/ (accessed 11 april 2023). leroy s, vermassen a and talon r (2016) staphylococcus: occurrence and properties. in: caballero b, finglas pm and toldrá f (eds) encyclopaedia of food and health. academic press, oxford. 140–145. https://doi.org/10.1016/b978-0-12-384947-2.00656-5 li q, yu s, li l, liu g, gu z, liu m, liu z, ye y, xia q and ren l (2017) microbial communities shaped by treatment processes in a drinking water treatment plant and their contribution and threat to drinking water safety. front. microbiol. 8 2465. https://doi. org/10.3389/fmicb.2017.02465 limayem a, wasson s, mehta m, pokhrel ar, patil s, nguyen m, chen j and nayak b (2019) high-throughput detection of bacterial community and its drug-resistance profiling from local reclaimed wastewater plants. front. cell. infect. microbiol. https://doi.org/10.3389/fcimb.2019.00303 lin w, ye c, guo l, hu d and yu x (2020) analysis of microbial contamination of household water purifiers. appl. microbiol. biotechnol. 104 (10) 4533–4545. https://doi.org/10.1007/s00253 020-10510-5 lozupone c and knight r (2005) unifrac: a new phylogenetic method for comparing microbial communities. appl. environ. microbiol. 71 (12) 8228. https://doi.org/10.1128/aem.71.12.82288235.2005 lpsn (list of prokaryotic names with standing in nomenclature) (2022a) genus acinetobacter. url: https://www.bacterio.net/ genus/acinetobacter (accessed 28 october 2022). lpsn (list of prokaryotic names with standing in nomenclature) (2022b) genus mycobacterium. url: https://www.bacterio.net/ genus/mycobacterium (accessed on 31 october 2022). lpsn (list of prokaryotic names with standing in nomenclature) (2022c) genus pseudomonas. url: https://www.bacterio.net/ genus/pseudomonas (accessed on 03 november 2022). lpsn (list of prokaryotic names with standing in nomenclature) (2022d) genus vibrio. url: https://www.bacterio.net/genus/vibrio (accessed on 31 october 2022). maravić a, skočibušić m, šprung m, šamanić i, puizina j and pavela-vrančić (2012) occurrence and antibiotic susceptibility profiles of burkholderia cepacia complex in coastal marine environments. int. j. environ. health res. 22 (6) 531–542. https://doi.org/10.1080/09603123.2012.667797 marita y, maruyama s, kabeya h, boonmar s, nimsuphan b, nagai a, kozawa k, nakajima t, mikami t and kimura h (2004) isolation and phylogenetic analysis of arcobacter spp. in ground chicken meat and environmental water in japan and thailand. microbiol. immunol. 48 527–533. https://doi.org/10.1111/j.1348-0421.2004.tb03548.x mataragka a, tzimotoudis n, kolygas m, karavanis e and ikonomopoulos j (2022) diagnostic investigation for the detection of mycobacteria in samples of fish feeds and tissue from sea bream and sea bass with severe granulomatous lesions aquaculture 546 737283. https://doi.org/10.1016/j.aquaculture.2021.737283 mizutani y, iehata s, mori t, oh r, fukuzaki s and tanaka r (2019) diversity, enumeration and isolation of arcobacter spp. in the giant abalone, haliotis gigantea. microbiol. open 8 e890. url: https://doi.org/10.1002/mbo3.890 moreno y, botella s, alonso jl, ferrús ma and hernández j (2003) specific detection of arcobacter and campylobacter strains in water and sewage by pcr and fluorescent in situ hybridization. appl. environ. microbiol. 69 1181–1186. https:// doi.org/10.1128/aem.69.2.1181-1186.2003 mugetti d, varello k, gustinelli a, pastorino p, menconi v, florio d, fioravanti ml, bozzetta e, zoppi s, dondo a and prearo m (2020) mycobacterium pseudoshottsii  in mediterranean fish farms: new trouble for european aquaculture? pathogens 9 (8) 610. https://doi.org/10.3390/ pathogens9080610 https://doi.org/10.1007/s11356-016-8231-7 https://doi.org/10.1007/s11356-016-8231-7 https://doi.org/10.4315/0362-028x-73.11.2099 https://www.thebalancesmb.com/how-do-we-use-water-and-why-conserve-3157863 https://www.thebalancesmb.com/how-do-we-use-water-and-why-conserve-3157863 https://doi.org/10.1186/s12866-018-1177-9 https://doi.org/10.1186/s12866-018-1177-9 https://doi.org/10.3923/ajbs.2013.116.123 https://doi.org/10.3923/ajbs.2013.116.123 http://bioinformatics.psb.ugent.be/webtools/venn/ https://doi.org/10.1101/gr.085464.108 http://www.wrc.org.za/wp-content/uploads/mdocs/tt153-01.pdf http://www.wrc.org.za/wp-content/uploads/mdocs/tt153-01.pdf https://doi.org/10.1080/01652176.2018.1447171 https://doi.org/10.1080/01652176.2018.1447171 https://sswm.info/arctic-wash/module-2-environment-pollution-levels-implications/further-resources-environment-and/pathogens-%26-contaminantshttps://sswm.info/arctic-wash/module-2-environment-pollution-levels-implications/further-resources-environment-and/pathogens-%26-contaminantshttps://sswm.info/arctic-wash/module-2-environment-pollution-levels-implications/further-resources-environment-and/pathogens-%26-contaminantshttps://www.jamovi.org https://doi.org/10.1038/s41598-018-31706-w https://doi.org/10.1038/s41598-018-31706-w https://doi.org/10.3390/ijerph15010052 https://doi.org/10.3390/ijerph15010052 https://doi.org/10.3390/ijerph15122666 https://doi.org/10.1016/j.soilbio.2010.11.033 https://doi.org/10.1016/j.soilbio.2010.11.033 https://doi.org/10.1128/aem.68.11.5318-5325.2002 https://doi.org/10.1128/aem.68.11.5318-5325.2002 https://legionellacontrol.com/legionella/legionella-species/ https://legionellacontrol.com/legionella/legionella-species/ https://doi.org/10.1016/b978-0-12-384947-2.00656-5 https://doi.org/10.3389/fmicb.2017.02465 https://doi.org/10.3389/fmicb.2017.02465 https://doi.org/10.3389/fcimb.2019.00303 https://doi.org/10.1007/s00253-020-10510-5 https://doi.org/10.1007/s00253-020-10510-5 https://doi.org/10.1128/aem.71.12.8228-8235.2005 https://doi.org/10.1128/aem.71.12.8228-8235.2005 https://www.bacterio.net/genus/acinetobacter https://www.bacterio.net/genus/acinetobacter https://www.bacterio.net/genus/mycobacterium https://www.bacterio.net/genus/mycobacterium https://www.bacterio.net/genus/pseudomonas https://www.bacterio.net/genus/pseudomonas https://www.bacterio.net/genus/vibrio https://doi.org/10.1080/09603123.2012.667797 https://doi.org/10.1111/j.1348-0421.2004.tb03548.x https://doi.org/10.1016/j.aquaculture.2021.737283 https://doi.org/10.1002/mbo3.890 https://doi.org/10.1128/aem.69.2.1181-1186.2003 https://doi.org/10.1128/aem.69.2.1181-1186.2003 https://doi.org/10.3390/pathogens9080610 https://doi.org/10.3390/pathogens9080610 125water sa 49(2) 117–125 / apr 2023 https://doi.org/10.17159/wsa/2023.v49.i2.3956 national geographic (2022) earth’s freshwater. in: resource library. url: https://education.nationalgeographic.org/resource/ earths-fresh-water (accessed 2 june 2022). nicolas jl, basuyaux o, mazurié j and thébault a (2002) vibrio carchariae, a pathogen of the abalone haliotis tuberculate. dis. aquat. organ. 50 (1) 35–43. https://doi.org/10.3354/dao050035 paisio ce, talano ma, gonzález ps, magallanesnoguera c, kurina-sanz m and agostini e (2016) biotechnological tools to improve bioremediation of phenol by acinetobacter sp. rte1.4. environ. technol. 37 (18) 2379–2390. https://doi.org/10.1080/09593330.2016.1150352 páll e, niculae m, kiss t, şandru cd and spînu m (2013) human impact on the microbiological water quality of the rivers. j. med. microbiol. 62 1635–1640. https://doi.org/10.1099/ jmm.0.055749-0 park bs, li, z, kang y-h, shin hh, joo j-h and han m-s (2018) distinct bloom dynamics of toxic and non-toxic microcystis (cyanobacteria) subpopulations in hoedong reservoir (korea) microb. ecol. 75 163–173. https://doi.org/10.1007/s00248-017-1030-y parte ac, sardà carbasse, j, meier-kolthoff jp, reimer lc and göker m (2020). list of prokaryotic names with standing in nomenclature (lpsn) moves to the dsmz. int. j. of syst. evol. microbiol. 70 5607–5612. https://doi.org/10.1099/ijsem.0.004332 pérez-carrascal om, terrat y, giani a, fortin n, greer cw, tromas n and shapiro bj (2019) coherence of microcystis species revealed through population genomics. isme j. 13 (12) 2887–2900. https://doi.org/10.1038/s41396-019-0481-1 pichon d, cudennec b, huchette s, djediat c, renault t, paillard c and auzoux-bordenave s (2013) characterization of abalone heliotis tuberculata – vibrio harveyi interactions in gill primary cultures. cytotechnology 65 (5) 759–772. https://doi.org/10.1007/s10616-013-9583-1 pindi pk, yadav pr and shanker as (2013) identification of opportunistic pathogenic bacteria in drinking water samples of different rural health centers and their clinical implications on humans. biomed res. int. article id 348250. 10 pp. https://doi.org/ 10.1155/2013/348250 prentice m (2015) yersinia and yersiniosis. global water pathogen project. url: https://www.waterpathogens.org/node/126 schang c, henry r, kolotelo pa, prosser t, crosbie n, grant t, cottam d, o’brien p, coutts s, deletic a and co-authors (2016) evaluation of techniques for measuring microbial hazards in bathing waters: a comparative study. plos one 11 (5) e0155848. https://doi.org/10.1371/journal.pone.0155848 schwartz t, kalmbach s, hoffmann s, szewzyk u and obst u (1998) pcr-based detection of mycobacteria in biofilms from a drinking water distribution system. j. microbiol. meth. 34 (2) 113–123. https://doi.org/10.1016/s0167-7012(98)00081-5 sabs (south african bureau of standards) (2015) sans (south african national standard). drinking water: part 1: microbiological, physical, aesthetic and chemical determinants. south african bureau of standards, pretoria. isbn 978-0-626-29841-8. simoes lc and simões m (2013) biofilms in drinking water: problems and solutions. r. soc. chem. adv. 3 (8) 2520–2533. https:// doi.org/10.1039/c2ra22243d tortone ca, zumárraga mj, gioffré ak and oriani ds (2018) utilization of molecular and conventional methods for the identification of nontuberculous mycobacteria isolated from different water sources. int. j. mycobacteriol. 7 (1) 53–60. torvinen e, northrup j, arbeit r, ristola m, mattila l and reyn c (1999) isolation of mycobacteria from indoor swimming pools in finland. apmis 107  193–200. https://doi.org/ 10.1111/j.1699-0463.1999.tb01544.x towner k (2006) the genus  acinetobacter. in: dworkin m, falkow s, rosenberg e, schleifer kh, stackebrandt e (eds) the prokaryotes. springer, new york. https://doi.org/10.1007/0-387-30746-x_25 united nations (2023) the 17 goals. united nations department of economic and social affairs sustainable development. url: https://sdgs.un.org/goals (accessed 11 april 2023). usepa (united states environmental protection agency) (2012) microbial risk assessment guideline: pathogenic microorganisms with focus on food and water. epa/100/j-12/001. united states environmental protection agency, washington dc. usepa (united states environmental protection agency) (2020) health effects from cyanotoxins. url: https://www.epa.gov/ cyanohabs/health-effects-cyanotoxins (accessed 13 august 2021). united states environmental protection agency, washington dc. vaerewijck mjm, huys g, palomino jc, swing j and portaels f (2005) mycobacteria in drinking water distribution systems: ecology and significance for human health. fems microbiol. rev. 29 (5) 911–934. https://doi.org/10.1016/j.femsre.2005.02.001 vaz-moreira i, nunes oc and manaia cm (2014) bacterial diversity and antibiotic resistance in water habitats: searching the links with the human microbiome.  fems microbiol. rev. 38 (4) 761–778.  https://doi.org/10.1111/1574-6976.12062 verhille s (2013) understanding microbial indicators for drinking water assessment: interpretation of test results and public health significance. national collaborating centre for environmental health. url: https://www.ncceh.ca/sites/default/files/microbial_ indicators_jan_2013_0.pdf (accessed 11 april 2023). von reyn cf, waddell rd, eaton t, arbeit rd, maslow jn, barber tw, brindle rj, gilks cf, lumio j and lähdevirta j (1993) isolation of mycobacterium avium complex from water in the united states, finland, zaire, and kenya. j. clin. microbiol. 31 (12) 3227–3230. https://doi.org/10.1128/jcm.31. 12.3227-3230.1993 wagner m, erhart r, manz w, amann r, lemmer h, wedi d and schleifer k-h (1994) development of an rrna-targeted oligonucleotide probe specific for the genus acinetobacter and its application for in situ monitoring in activated sludge. appl. environ. microbiol. 60 (3) 792–800. https://doi.org/ 10.1128/aem.60.3.792-800.1994 who (world health organization) (2006) guidelines for safe recreational water environments. volume 2: swimming pools and similar environments. who, geneva. isbn: 92 4 154680 8. url: http:// apps.who.int/iris/bitstream/handle/10665/43336/9241546808_eng. pdf?sequence=1 (accessed 11 april 2023). who (world health organization) (2017) guidelines for drinkingwater quality: fourth edition incorporating the first addendum. who, geneva. isbn: 978-92-154995-0. who (world health organization) (2019) 1 in 3 people globally do not have access to safe drinking water. unicef/who, geneva. url: https://www.who.int/news/item/18-06-2019-1-in-3-people-globallydo-not-have-access-to-safe-drinking-water-unicef-who (accessed 12 august 2022). wingender j and flemming hc (2011) biofilms in drinking water and their role as reservoir for pathogens. int. j. hyg. environ. health 214 (6) 417–423. https://doi.org/10.1016/j.ijheh.2011.05.009 wuthiekanun v, smith md and white nj (1995) survival of burkholderia pseudomallei in the absence of nutrients. trans.  r. soc.  trop. med. hyg. 89 (5) 491. https://doi.org/10.1016/00359203(95)90080-2 yang l, ren y-x, liang, x, zhao s-q, wang j-p and xia z-h (2015) nitrogen removal characteristics of a heterotrophic nitrifier  acinetobacter junii  yb and its potential application for the treatment of high-strength nitrogenous wastewater. bioresour. technol. 193 227–233. https://doi.org/10.1016/j.biortech.2015.05.075 yanong rpe and pouder db (2010) association of mycobacteria in recirculating aquaculture systems and mycobacterial disease in fish. j. aquat. anim. health 22 219–223. yoon j-h, kim ig and oh t-k (2007) acinetobacter marinus sp. nov. and acinetobacter seohaensis sp. nov., isolated from seawater of the yellow sea in korea. j. microbiol. biotechnol. 17 (11) 1743–1750. zhang y and liu w-t (2019) the application of molecular tools to study the drinking water microbiome – current understanding and future needs. crit. rev. environ. sci. technol. 49 (13) 1188–1235. https://doi.org/10.1080/10643389.2019.1571351 https://education.nationalgeographic.org/resource/earths-fresh-water https://education.nationalgeographic.org/resource/earths-fresh-water https://doi.org/10.3354/dao050035 https://doi.org/10.1080/09593330.2016.1150352 https://doi.org/10.1099/jmm.0.055749-0 https://doi.org/10.1099/jmm.0.055749-0 https://doi.org/10.1007/s00248-017-1030-y https://doi.org/10.1099/ijsem.0.004332 https://doi.org/10.1038/s41396-019-0481-1 https://doi.org/10.1007/s10616-013-9583-1 https://doi.org/10.1155/2013/348250 https://doi.org/10.1155/2013/348250 https://www.waterpathogens.org/node/126 https://doi.org/10.1371/journal.pone.0155848 https://doi.org/10.1016/s0167-7012(98)00081-5 https://doi.org/10.1039/c2ra22243d https://doi.org/10.1039/c2ra22243d https://doi.org/10.1111/j.1699-0463.1999.tb01544.x https://doi.org/10.1111/j.1699-0463.1999.tb01544.x https://doi.org/10.1007/0-387-30746-x_25 https://sdgs.un.org/goals https://www.epa.gov/cyanohabs/health-effects-cyanotoxins https://www.epa.gov/cyanohabs/health-effects-cyanotoxins https://doi.org/10.1016/j.femsre.2005.02.001 https://doi.org/10.1111/1574-6976.12062 https://www.ncceh.ca/sites/default/files/microbial_indicators_jan_2013_0.pdf https://www.ncceh.ca/sites/default/files/microbial_indicators_jan_2013_0.pdf https://doi.org/10.1128/jcm.31.12.3227-3230.1993 https://doi.org/10.1128/jcm.31.12.3227-3230.1993 https://doi.org/10.1128/aem.60.3.792-800.1994 https://doi.org/10.1128/aem.60.3.792-800.1994 http://apps.who.int/iris/bitstream/handle/10665/43336/9241546808_eng.pdf?sequence=1 http://apps.who.int/iris/bitstream/handle/10665/43336/9241546808_eng.pdf?sequence=1 http://apps.who.int/iris/bitstream/handle/10665/43336/9241546808_eng.pdf?sequence=1 https://www.who.int/news/item/18-06-2019-1-in-3-people-globally-do-not-have-access-to-safe-drinking-water-unicef-who https://www.who.int/news/item/18-06-2019-1-in-3-people-globally-do-not-have-access-to-safe-drinking-water-unicef-who https://doi.org/10.1016/j.ijheh.2011.05.009 https://doi.org/10.1016/0035-9203(95)90080-2 https://doi.org/10.1016/0035-9203(95)90080-2 https://doi.org/10.1016/j.biortech.2015.05.075 https://doi.org/10.1080/10643389.2019.1571351 water sa 49(3) 239–250 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.3995 research paper issn (online) 1816-7950 available on website https://www.watersa.net 239 correspondence monica m correia email 4079100@myuwc.ac.za dates received: 4 june 2022 accepted: 19 june 2023 key words bibliometric analysis groundwater impacts publication-related trends record review science mapping south africa copyright © the author(s) published under a creative commons attribution 4.0 international licence (cc by 4.0) climate and land use change (cluc) impact studies on water and groundwater resources have evolved in recent years. to determine whether all research gaps have been or are being addressed through the current intellectual structure, a bibliometric analysis, as well as a record review, was enacted to determine the intellectual structure of cluc impacts on water resources, with a particular focus on the implications for groundwater resources research in the breede gouritz water management area (bgwma) in south africa. methods applied included publication-related trends and science mapping. this study found that cluc impact research being published has increased by 600% between 2014 and 2021, localised research is being done in 95 countries, and land use change (luc), specifically urbanisation, is being considered more often as a variable. however, a few gaps in the research remain, including smaller spatiotemporal scales in more locations, a stronger focus on luc in all its forms, luc versus climate change (cc) impact studies, and multimodal approaches to related research. cluc impacts on water and groundwater resources research have made significant progress over the years, but more research is necessary to make this a robust area of research. investigating the knowledge gap in research on climate and land use change impacts on water resources, with a focus on groundwater resources in south africa: a bibliometric analysis monica m correia1 , thokozani kanyerere1, nebo jovanovic1 and jaqueline goldin1 1institute for water studies, department of environmental and water science, university of the western cape, cape town 7535, south africa introduction the impacts of climate and land use change (cluc) on water resources, including groundwater resources, persist globally. global reliance on groundwater resources is increasing, albeit not always at sustainable rates, especially in areas where surface water availability is declining (amanambu et al., 2020; taylor et al., 2013). to understand the future of our water resources from a sustainability point of view, it is therefore imperative that impact studies, specifically cluc impacts on water and groundwater resources, be executed locally (for example, wang et al., 2018). the breede gouritz water management area (bgwma) is an important water management area (wma) in south africa (breede gouritz catchment management agency, 2020) and is currently being studied more intentionally regarding its groundwater resources. although effort has been made to delineate surface and groundwater quaternary catchments, and monitor water levels (dws, 2017; van der berg, 2017), no cluc impact study has been done in the catchment to determine the sustainable use of surface and groundwater in the future. this review is a starting point for cluc impact studies in the bgwma. although cluc impact studies have been on the rise in recent years, a knowledge gap, where the magnitude of these perturbations is studied on a local scale, is still evident from the research assessed. this is the case for the bgwma. cluc impact studies have been on the rise in recent years, especially since the international panel on climate change (ipcc) fifth assessment report, which published the latest knowledge, revealed new results on climate change (cc) research and called for papers on studies explicitly relating to cc and the groundwater system (smerdon, 2017). amanambu et al. (2020) wrote a review summarising over 300 articles about cc impacts on groundwater. they reviewed global cc, assessed the present impact of cc on groundwater, reviewed groundwater models, climate-induced future groundwater changes, and groundwater feedback to the climate system, and determined vital considerations regarding research in this field. regarding the sustainable use of groundwater, it is clear from the literature, according to amanambu et al. (2020), that the physical and socio-economic aspects must be incorporated and integrated into such research endeavours. what is also apparent from their findings is that cluc impacts the groundwater system and that land use change (luc) is intricately linked to cc. the main focus of cluc impacts on groundwater studies has been on the impact of cc. amanambu et al. (2020) recommend that luc be considered in future water resource-related studies. a few studies were found on a global scale that looked at the combined effects of cc and luc on some parts of the hydrologic system (cochand et al., 2021; nkhoma et al., 2020; van huijgevoort et al., 2020; olivares et al., 2019; osei et al., 2019; shrestha et al., 2018; tamm et al., 2018; zhang et al., 2018; ahiablame et al., 2017; and ponpang-nga and techamahasaranont, 2016). a number of these studies focused on the groundwater system specifically. to the authors’ knowledge, no cluc impact studies on the groundwater system have been conducted in south africa, although there are a few studies studying a particular aspect of the groundwater system. for instance, two indices were created; van rooyen et al. (2020) created a groundwater quantity and quality vulnerability model, which was applied to the 19 wmas in south africa. these authors found https://www.watersa.net https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://orcid.org/0000-0002-0074-9842 240water sa 49(3) 239–250 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.3995 that, in general, groundwater resources are more vulnerable in the west, with a few exceptions, including the breede wma. the central regions will likely experience higher vulnerability in the future, whereas groundwater resources in the western cape and southern coast will experience a moderate vulnerability increase. groundwater vulnerability is mainly sensitive to the following parameters, in decreasing order: mean annual temperature, aquifer type, terrain slope, mean annual precipitation, tritium distribution in groundwater, electrical conductivity, cultivated land use, and population density. a decade earlier, dennis and dennis (2011) created the dart index as a regional screening tool to determine the impact of cc on south african aquifers. dart is an acronym for depth to water level change, aquifer type (storativity), recharge and transmissivity. monthly dart index calculations revealed a robust spatiotemporal control on recharge. nkhonjera and dinka (2018) conducted a literature review of climate change’s direct and indirect impacts on groundwater resources in the olifants river basin. a significant study by albhaisi et al., (2013) was done where the impacts of luc on groundwater recharge in the upper parts of the berg catchment. the catchment had undergone many changes before the study; a dam was built, and non-native hillslope vegetation was cleared in the upper reaches of the berg river. albhaisi et al. (2013) used time-series land use data with the wetspa hydrological model and determined whether evapotranspiration would decrease and recharge would increase under the aforementioned land use changes. they found that the distribution and location of the different types of land use (or classes in the study) determined the quantity of groundwater recharge with significant spatiotemporal variability of recharge. furthermore, an 8% increase in recharge was observed over 21 years because of alien hillslope vegetation clearing. it was recommended that a similar study be repeated in other catchments and that the impact of luc is included. other studies conducted in south africa include the work by varet et al. (2009), who studied the impact of luc on groundwater resources in lake st lucia. these authors confirmed that groundwater is an essential contributor to streamflow during drought, especially in prolonged drought conditions, as was the case in this area. manipulation of vegetation was enacted to increase groundwater recharge and decrease groundwater use. pine plantations were replaced with grasslands; consequently, there was a rise in the water table and an increase in discharge. luc, however, is not the only reason for changes in groundwater resources; sea-level rise, saltwater encroachment, and a decrease in rainfall also play a role. furthermore, luc significantly affects the observed water table level more than precipitation. the introduction of grasslands around lake st lucia changed the vegetation’s rooting depth, consequently decreasing evapotranspiration rates. the rate at which groundwater is lost to evapotranspiration is a function of rooting depth to groundwater depth; changes in the water-table elevation will determine how much the root system is in contact with the groundwater zone and, therefore, the actual evapotranspiration. changes in the water table levels will determine how much groundwater will be lost through evapotranspiration, especially in shallow groundwater tables. the authors also reflected on removing the pine trees, which improved river water flow. a bibliometric analysis is becoming increasingly robust in most areas of research (donthu et al., 2021; meija et al., 2021; zhao et al., 2019). a bibliometric analysis is a general term (meija et al., 2021) for an objective study that includes a spatiotemporal analysis of large volumes of scientific data (hundreds to thousands) in a specific field (donthu et al., 2021). other terms like scientometrics and informetrics are used interchangeably with that of bibliometric analysis (meija et al., 2021). a bibliometric analysis, however, enables the author to do a quantitative literature study and explore the intellectual structure of a chosen field by investigating the emerging trends, article and journal performance, collaboration patterns and research constituents in this specific field (donthu et al., 2021a; verma and gustafsson, 2020). it allows the author to make sense of a more extensive data pool by evaluating and understanding collective scientific knowledge, exploring evolutionary trends, identifying knowledge gaps and making informed decisions regarding future research in a chosen field (donthu et al., 2021). with more accurate and comprehensive results on the intellectual framework of this field, a more informed decision on the research priorities in the bgwma can be made. this paper is the first in a series of papers pertaining to a cluc impact study on the groundwater system of the bgwma. the aim is to first analyse the global intellectual and research structure of cluc impact studies on water and groundwater resources by presenting a bibliometric analysis supported by a record review. from this, the current trends in the research can be determined, and a gap analysis can be performed. furthermore, the key findings of this study will serve as an indicator of research focus points for cluc in future groundwater studies in general and for the specific context of the bgwma. methods the methods applied to this study consisted of, firstly, the bibliometric analysis, which was followed by the record review. details regarding both methods will be discussed in the following paragraphs. bibliometric analysis a bibliometric analysis is an essential step in determining the intellectual framework of a specific field. a bibliometric analysis was conducted using mendeley as the reference database in this study. software packages that were used were excel, bibexcel and vosviewer. the data were obtained through a few steps (see fig. 1). references, including books, articles, conference proceedings, theses and reports, were downloaded in mendeley in two rounds using the following whole expressions, respectively: 1. ‘climate change and land use change impact analysis on groundwater resources.’ 2. ‘climate change and land use change impact analysis on water resources.’ articles on water resources in general and groundwater resources specifically were sourced for two reasons: to solicit a more extensive dataset including surface waters, and to verify whether surface waters or groundwaters are currently the focus point in cluc impact studies. regarding fig. 1, as stated above, 5 databases were consulted for academic references, 685 articles were found, 193 duplicates were removed, and 2 records were removed by an automation tool. next, each entry was scanned, and only entries with cc, luc, or both in the title were kept. furthermore, each entry was manually checked for data completeness and consistency (were all the individual items of each reference listed, i.e., authors, title, keywords and so forth?), and missing information was accounted for where applicable. lastly, 121 records were removed because the focus was more specifically on either water quality or bioenergy and other aspects of water resources that did not match the focus of this study (refer to fig. 1). a final database with 369 entries between 2001 and 2021 was used for the analysis (fig. 1). 241water sa 49(3) 239–250 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.3995 the following techniques were chosen (fig. 2) to determine the evolution of cc and luc impact research and which knowledge gaps still need to be addressed. publication-related trends pertain to the spatiotemporal trends of cluc impact studies on water and groundwater resources by determining the trends of publications over time, journals most frequently employed, most common authors in this field, countries where related research is undertaken, and keywords most frequently used (donthu et al., 2021). science mapping explores the content of publications to determine relationships amongst keywords and assumes that words that consistently appear together have a thematic connection to one another (donthu et al., 2021). figure 1. preferred reporting items for systematic reviews and meta-analyses (prisma) 2020 flow diagram (from page et al., 2021) figure 2. proposed techniques to perform bibliometric analysis 242water sa 49(3) 239–250 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.3995 record review an extensive literature search was conducted on various platforms. search platforms included the university of the western cape’s (uwc) online library, google scholar, sciencedirect, elsevier and scopus. other sources consulted were reports by the breede gouritz catchment management agency and the water research commission. the focus and keywords first used were ‘climate change and groundwater’. after that, the phrase ‘land use change and groundwater’ was added. articles that considered cc and luc impacts on water resources were part of the filtered results of the two main search phrases used and stated above. a few methods were applied to filter the substantial volume of material available. firstly, a cut-off date was selected. the most recent articles on cc, luc and groundwater-related research were mainly written after 2015; the chosen publications were published between 2015 and 2021. older articles were included if deemed to be bringing significant findings on cc and luc impacts that would contribute to this study. secondly, abstracts were read as the second round of filtering. thirdly, all articles on groundwater resources were selected, representing worldwide areas. the final list of articles was studied intently by summarising them in paragraph form according to the author, year, title, aims and objectives, data collection methods, data analysis methods, results, discussion, and conclusions. a summary of significant findings from these studies was included to support the results of the bibliometric analysis. results the results of the bibliometric analysis and the record review will be discussed separately in the following paragraphs. bibliometric analysis the bibliometric analysis has been performed by first exploring publication-related trends to determine the contributions to the field of cluc impact studies on water and groundwater resources. science mapping followed, in which any relationships between keywords were assessed. these methods were followed to determine if gaps in the research field remain. more information can be found in the following paragraphs. publication-related trends total publications per year the total publications per year for cluc impact studies on water resources have increased substantially since 2007 (fig. 3). almost zero studies were published in this field (before 2007) to 2020 and 2021, when 74 and 60 articles were published, respectively. a surge in publications was observed after 2014 (by 600% in 2021) when the ipcc called for more research on cc impacts on groundwater (bates et al., 2008; smerdon, 2017). it is evident that cluc impact studies have been given more attention in the last couple of years. frequently used journals and corresponding number of publications the journal that published the most related articles is water (table 1). the top 10 journals are based mainly in europe, america, and the united kingdom. most journals that published articles in this field pertain to water, hydrology, or sustainability. total publications per frequent authors the author with the most publications is sangam shrestha (table 2) from thailand’s asian institute of technology. shrestha has been focusing on the integrated impacts of cc and luc on water resources since 2016 (shrestha et al., 2018). he has published 152 documents, been cited 3 579 times and has an h-index of 32 (scopus, 2022h; orcid: 0000-0002-4972-3969). he is followed by bernd diekkrüger from bönn university in germany, who published 157 documents and co-authored many articles regarding case studies worldwide, including in east africa and thailand, for example (gabiri et al., 2020). he has been cited 3 462 times, and his h-index is 33 (scopus, 2022a; orcid: 0000-0001-9234-7850). four of the top 10 authors are from germany, but the countries in which most of the research has been done are china and uganda (table 2). the topics or subject areas most commonly contributed are streamflow and non-point source pollution, river basins and agriculture (scopus, 2022a–j). according to table 2, 4 authors also focused on climate change or climate models, whereas land cover is a contribution topic for two of the listed authors. figure 3. total publications per year regarding cluc impacts on water resources table 1. journals that are most frequently used to publish cluc impactrelated articles and their corresponding quantity of publications journals no. of publications water (switzerland) 38 journal of hydrology 22 science of the total environment 20 hydrology and earth system sciences 14 journal of water and climate change 14 water resources research 14 sustainability 13 journal of hydrology: regional studies 12 hydrological sciences journal 7 water resources management 7 https://www.scopus.com/redirect.uri?url=https://orcid.org/0000-0001-9234-7850&authorid=6603781218&origin=authorprofile&orcid=0000-0001-9234-7850&category=orcidlink%22 243water sa 49(3) 239–250 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.3995 table 2. frequently occurring authors, their countries of origin, the corresponding number of publications, focus countries or regions for their respective research and focus areas of research or common research topics per author (scopus, 2022 a–j). authors country originating from no. of publications country(s)/region(s) of research focus most contributed topics 2016–2020 shrestha, sangam thailand 7 thailand china cambodia bhutan india nepal pakistan myanmar river basins non-point source pollution streamflow climate change regional climate climate change adaptation urban climate resilience diekkrüger, bernd germany 6 burkina faso uganda east africa west africa tanzania togo climate models regional climate river basins non-point source pollution streamflow agriculture näschen, kristian germany 4 burkina faso tanzania uganda rice production seasonal wetlands agriculture river basins non-point source pollution streamflow döll, petra germany 4 global scale gravity recovery and climate experiment (grace) groundwater water storage water–energy nexus kløve, bjørn finland 4 iran afghanistan usable area instream flow ecosystems peatlands soil zhang, lu china 3 china australia streamflow sediment yield hydrologic models runoff nistor, mărgărit mircea united kingdom 3 china singapore united kingdom france climate change aridity evapotranspiration glacial lakes ice cover penman-monteith equation gabiri, geofrey uganda 3 uganda east africa rice production seasonal wetlands agriculture landsat land cover remote sensing river basins non-point source pollution streamflow leemhuis, constanze germany 3 uganda tanzania east africa rice production seasonal wetlands agriculture river basins non-point source pollution streamflow landsat land cover remote sensing sun, ge america 3 china america eddy covariance net ecosystem exchange ecosystems remote sensing latent heat flux crop coefficient streamflow sediment yield 244water sa 49(3) 239–250 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.3995 cluc research by country cluc impact studies on water and groundwater resources have been underway in many countries. however, cluc research in china supersedes research in other countries or regions (table 3). according to the countries mentioned in the references’ titles or abstracts in the final database, 95 countries are mentioned. thus, cluc impact studies on water and groundwater resources are ongoing in 95 countries. after china, articles with a ‘global’ focus follow, including articles with a general focus where no specific country was mentioned, articles with general observations, or where the findings are intended to be used as a general tool. in africa, a few ‘general’ articles and west and east africa are often mentioned in titles and abstracts, including countries like ethiopia, uganda and kenya (table 3). several references were pooled in a continent group since a mountain range or a river that cut across multiple countries was studied, for example, in asia or europe. the most studied regions in china included the loess plateau in the yellow river basin (yan et al., 2018). the results from tables 2 and 3 are consistent because china and east africa (uganda) are highlighted. popular keywords used the most common keyword used is climate change (table 4). groundwater recharge follows, on par with the swat model, consistent with the record review results (osei et al., 2019). emerging keywords are land use and luc and irrigation and urbanisation. these results confirm that more studies are starting to focus on the impact of land use and land use change. however, the focus is still predominantly on cc. studies have shown that it is crucial to incorporate the impacts of land use change in conjunction with cc; therefore, this finding demonstrated the prevailing research gap on land use change as a variable in water resource perturbations (adhikari et al., 2020). science mapping the co-word analysis confirms that cc is the most commonly used keyword (fig. 4). it further illustrates how often the term cc is used with other co-words such as groundwater and groundwater recharge, swat, land use change, and hydrological modelling. undoubtedly, cc has been the most studied variable regarding water and groundwater resources. record review extensive research has been undertaken regarding cc and groundwater, and many knowledge gaps have been addressed. clearly, from the literature, cc, in a general sense, will exacerbate the hydrologic cycle; typically cold places will become colder, humid and wet places will become more humid and wet, and so forth (for example, hegerl et al., 2019). these findings will consequently impact variables related to water resources, such as streamflow and recharge. cc generalisations or large-scale climate models are often too broad and sometimes irrelevant (trzaska and schnarr, 2014); the magnitude of the impact needs to be assessed on regional scales regarding cc (mcgregor, 2018; kundu et al., 2017). furthermore, cc impacts are rarely linked to luc impacts, and the combined impact of cluc is not often evaluated for groundwater resources (amanambu et al., 2020). across the board, according to reviewed papers, the recommendation is to include luc in groundwater impact studies and localise groundwater studies to a catchment level (amanambu et al., 2020; van huijgevoort et al., 2020). land use and land cover changes influence evapotranspiration rates and the interception of water, which will influence runoff and recharge in the case of groundwater (tamm et al., 2018). another good example is afforestation and deforestation, which affects streamflow, discharge, and runoff by decreasing (afforestation) and increasing (deforestation), respectively (nkhoma et al., 2020). this information is site-specific, and it is not easy to ascertain whether these findings would have similar or different outcomes elsewhere. in the context of groundwater research, groundwater recharge is the most widely understood variable and most studied (adhikari et al., 2020). recharge is generally directly associated with precipitation but can also be influenced by local geological formations, topography and land use (fu et al., 2019; mote et al., 2013; zhou et al., 2010; dragoni and sukhija, 2008); however, the rising temperature will increase evapotranspiration which could offset the role of precipitation in recharge (bellot and chirino, 2013; touhami et al., 2013; scanlon et al., 2005). groundwater recharge is expected to decrease up to 19.6%, depending on the area. it is still poorly understood as a groundwater variable (moeck et al., 2020). table 4. most popular keywords and their corresponding number of occurrences keywords frequency climate change 30 groundwater recharge + recharge 12 swat + swat model 12 land use + land use change 8 hydrological modelling 5 groundwater 5 water resources 3 modflow 3 irrigation 2 urbanisation 2 table 3. countries where cluc research is being enacted and their number of occurrences in the database used for this study1 countries count china 70 global* 39 america 36 india 23 ethiopia 17 africa* 15 italy 9 spain 7 canada 7 vietnam 7 iran 7 south africa 6 europe* 6 pakistan 5 united kingdom 4 kenya 4 uganda 4 bangladesh 4 taiwan 4 thailand 4 1global pertains to general research. continents (*) refer to general research on the specific continent or to regions such as mountain ranges or rivers that cut across multiple countries in the specific region. 245water sa 49(3) 239–250 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.3995 other sub-focus areas in groundwater research, such as discharge, groundwater flow and storage, groundwater quality, and groundwater-surface water interaction, are still poorly understood. what is known is that discharge is influenced by precipitation and temperature (kurylyk et al., 2013, 2015; gunawardhana and kazam, 2012). groundwater flow and storage are less vulnerable to the effects of cc (pohkrel et al., 2013; taylor et al., 2013); however, groundwater availability is expected to decrease, especially in arid and semi-arid environments (amanambu et al., 2020). moreover, shallow aquifers can be replenished, whereas deep-seated aquifers cannot (van rooyen et al., 2020). alluvial aquifers, for example, are influenced by the effects of surface vegetation cover (le maitre et al., 1999). both cc, luc and anthropogenic factors influence groundwater quality; anthropogenic influences include overabstraction of groundwater (tamm et al., 2018; bighash and murgulet, 2015; klove et al., 2014; schmidt and garland, 2012; earman and dettinger, 2011; gurdak et al., 2011; dragoni and sukhija, 2008; gurdak et al., 2007), but it is an area that is still poorly understood (amanambu et al., 2020). the groundwatersurface water interaction is influenced by cc and landform, geology, and other living biological factors (sophocleous, 2002); however, more information and research are needed. in conducting the record review, some other research gaps have been identified: • the scale of the study in terms of space should ideally be at the plot scale when it comes to assessing groundwater recharge (moeck et al., 2020) as opposed to catchment scale in the case of streamflow response (guzha et al., 2018). cc impact studies are best applied on a regional scale (mcgregor, h., 2018). luc studies should be done on a catchment to local/plot scale (wang et al., 2018). • the study’s time scale needs to be considered; shortto medium-term forecasts will best limit uncertainties (amanambu et al., 2020; moeck et al., 2020). • combining cc and luc effects on the groundwater system (adhikari et al., 2020). • variations below the surface also need to be included (amanambu et al., 2020), such as aquifer features, definition and quantification of boundary conditions, and a better understanding of the dynamics of an aquifer (viaroli et al., 2019). • feedbacks from the groundwater system to cc also need to be incorporated in future studies (amanambu et al., 2020), for example, vegetation feedback on the water balance. • using more field data (guzha et al., 2018), such as abstraction data and river flow information, is to be encouraged (touhidul-mustafa et al., 2019). • groundwater modelling also requires integrating surface-groundwater interaction in the unsaturated zone (amanambu et al., 2020). • a multi-model approach is strongly recommended when it comes to hydrological modelling (touhidul-mustafa et al., 2019). • future studies should use different calibration and validation techniques and perform a sensitivity analysis. the last step is necessary to identify and discriminate between the influential and non-influential parameters, which can help reduce uncertainty and simplify the modelling process (nkhoma et al., 2020; touhidul-mustafa et al., 2019). • multiple cc, regional climate models (rcms), and luc scenarios should be considered in the hydrological modelling phase (touhidul-mustafa et al., 2019). moreover, multiple emissions scenarios should also be considered (guzha et al., 2018). these methods are needed to make the best possible predictions for future water use under realistic scenarios. figure 4. a visually depicted co-word analysis. cc is the most common keyword in studies relating to cluc impacts on water and groundwater resources. 246water sa 49(3) 239–250 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.3995 discussion this review shows a positive development in cluc impact studies on water resources, focusing on groundwater specifically. the record review revealed a gap in the research where, amongst other gaps, more localised studies should be done, and fewer generalisations and extrapolations in terms of cc and luc should be made (moeck et al., 2020; guzha et al., 2018; mcgregor, 2018). therefore, a 600% increase in related publications from 2014 (to 2021) (fig. 3) and ongoing research in 95 countries is significant. the journals publishing the most cluc impact articles are primarily based in europe, america and the united kingdom (table 1). however, authors from countries like thailand, germany, finland and america are publishing cluc impact articles (table 2) that have been enacted all over the globe (tables 2 and 3). from the database used for this review, 95 countries were mentioned as sites for research. china has been doing the most local research, followed by india and ethiopia. furthermore, many cluc impact articles have a general or global focus. regional research in america, africa and, to a lesser degree, europe is also evident. east africa is a hotspot in africa, specifically uganda, ethiopia, kenya, and tanzania (table 3). the results from the authors’ details in table 2 and the listed countries in table 3 are consistent since china and east africa are popular areas for research evident from both searches. more attention is paid to local site-specific examples worldwide, which was identified as a literature gap. the localised experiments are now addressing the gap – moving away from very generalised discourse about cc and luc to more specific applications of cc and luc. however, localised research to plot scale for groundwater (moeck et al., 2020) and land use change studies (wang et al., 2018), catchment scale for streamflow (guzha et al., 2018) and regional scale for cc (mcgregor et al., 2018) still needs to be addressed in other places around the globe, predominantly arid to semi-arid environments. according to the authors’ most contributed research topics, streamflow, non-point-source pollution, river basins, and agriculture are the most researched (table 2). cc is a research topic for 4 of the top 10 authors listed, followed by luc, a topic of contribution for 2 listed authors (table 2). luc studies are becoming more important as a variable in water impact studies. hydrological modelling is frequently used to characterise hydrological processes, whether surface or underground, through physical models, mathematics, and computer technology (allaby and allaby, 1999). these developed models can subsequently determine future scenarios wherever they are implemented (osei et al., 2019; guzha et al., 2018) and inform mitigation and adaptation measures to prioritise groundwater recharge, for example (mamo et al., 2021). various existing models have already been developed and refined; for example, the most common swat model (osei et al., 2019). according to the record review, a multi-model approach is advised, which also considers variations below the surface, such as groundwater flow and storage (taylor et al., 2013; amanambu et al., 2020). as evident from the most popular keywords, swat and modflow are two models frequently utilised for hydrological modelling. these models have been applied separately in different scenarios or coupled, in which surface and underground water processes were considered. multiple hydrological models are highly recommended for the most accurate simulation and results (touhidul-mustafa et al., 2019). this finding is therefore encouraging. however, surface hydrological models like swat cannot always account for groundwater processes and are mainly used for surface hydrological responses to land use and land cover changes (yan et al., 2018), land degradation (da silva et al., 2018) and water balance (osei et al., 2018). in the context of modelling, there is a research gap regarding groundwater modelling, which is apparent from the lack of keywords in the literature revealed through this study. groundwater modelling is becoming more common, including variations below the surface and defining aquifer features, as mentioned in the record review results as a knowledge gap. aquifer features include defining and quantifying boundary conditions and understanding an aquifer’s dynamics (viaroli et al., 2019). the most common model, listed in the most popular keywords, is modflow, created by the united states geological survey (usgs) and can illustrate groundwater elements such as flow and storage (mamo et al., 2021; amanambu et al., 2020). other groundwater models include gsflow, prms (hunt et al., 2008; markstrom et al., 2008), and hydrogeosphere (maxwell et al., 2015; brunner and simmons, 2012). a newer version of swat, called swat+, is available for use. it is advantageous due to enhanced model performance (bailey et al., 2020). physically realistic groundwater flow gradients, fluxes and interactions with stream models (water supply and conservation applications) can be obtained through swat+ (bailey et al., 2020). additionally, a new groundwater flow model that can be coupled with swat+ was also recently developed, called gwflow (bailey et al., 2020). gwflow has many advantages, including not needing other groundwater modelling codes like modflow; for example, it does not increase the simulation run time in swat+ and is computationally not as complicated and compatible with swat+. it is used to understand groundwater flow in watershed hydrologic processes better. gwflow has been developed very recently, and although it has worked successfully in a case study in the u.s., it has not been calibrated yet (bailey et al., 2020). land use change modelling has been developed over the years but not readily incorporated into research endeavours, according to the lack of keywords. models such as dyna-clue (adhikari et al., 2020; shrestha et al., 2018), azure (van huijgevoort., et al., 2020) and fore-sce (ahiablame et al., 2017) can be used to generate relatively realistic future land use scenarios. depending on the research, they can also consider land use scenarios such as deforestation, afforestation or urbanisation. furthermore, land use change detection can be done with time-series satellite imagery that generates ‘change’ versus ‘no change’ maps (albhaisi et al., 2013). these maps are generated with historical data. the best data to use when it comes to collecting land use data is satellite remote sensing data (gautam et al., 2003), as it provides more layers of information and is a low-cost and time-saving manner to assess luc on a regional scale (albhaisi et al., 2013; rogan and chen, 2004; kachhwala, 1985). geographically weighted regression (gwr) models have been used in one study coupled with a hydrological model (wang et al., 2018), which made it possible to measure the hydrological response of a catchment to cc and/or luc down to each pre-defined hydrological response unit. this method takes local hydrological variations such as discharge (rennermalm et al., 2012), mean annual precipitation (yue et al., 2013), annual runoff (chang et al., 2014) and, lastly, surface water quality (chen et al., 2014; tu and xia, 2008) into account. however, no such study for groundwater has been found. as reflected in the bibliometric analysis, more recent studies show that cc and luc are now more explicitly linked with a focus on water (table 1). furthermore, a greater focus on luc linked with cc is evident (table 4 and fig. 4) from the keywords most frequently used, particularly land use and land use change, irrigation, urbanisation, and human activities. it seems that luc and urbanisation are most frequently linked, which is unsurprising given the rate at which built-up impervious surfaces are increasing around the globe. the urbanisation percentage is currently at 56% in december of 2021, which denotes the number of people living in urbanised areas, i.e. cities (szmigiera, 2021). this percentage is on the rise. 247water sa 49(3) 239–250 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.3995 there is still a prevailing gap in the research since urbanisation seems to be the main focus of luc, and other significant aspects of land change are being overlooked. for example, irrigation, or in other words ‘artificial discharge’, is considered to be field data, and was mentioned in the list of most popular keywords, and was also recommended to be incorporated into cluc impact studies on groundwater (guzha et al., 2018; touhidul-mustafa et al., 2019). even though this is a positive finding in light of emerging research trends, only two occurrences were mentioned, which is insufficient. a few implications for overexploitation of groundwater are that it affects recharge and groundwater levels negatively (berhail, 2019; touhidul-mustafa et al., 2019; mamo et al., 2021), can cause land subsidence in arid/semi-arid environments (andaryani et al., 2019), and a decline in the observed water table will render shallow boreholes, hand-dug wells and springs drying up, and increase the cost of abstraction (mamo et al., 2021). lastly, increasing abstraction rates causes seasonal fluctuations in the water table, which could also influence pumping costs, biodiversity of aquatic ecosystems and water quality (cochand et al., 2021). groundwater abstractions exhibit spatiotemporal controls that follow cropping seasons and precipitation signatures and are also more prevalent in farmlands and industrial areas than forests (touhidul-mustafa et al., 2019). local research incorporating irrigation and groundwater abstraction rates is crucial, which would also be the case of the bgwma due to the extent of irrigated agricultural activity in the wma (van der berg, 2017). other research gaps, particularly in the case of the bgwma, are afforestation and deforestation, which are critical aspects of luc. these forms of luc are critically important in many parts of the globe. we have seen, for instance, that removing invasive species could increase groundwater recharge (albhaisi et al., 2013; le maitre et al., 1999) and removing pine plantations can cause the water table to rise and increase discharge (varet et al., 2009). the deeper the rooting depths of trees, the more water will be extracted from the related groundwater stores (le maitre et al., 1999). furthermore, changes in vegetation can affect groundwater recharge rates and water-table depths (le maitre et al., 1999). more research on luc and aspects of afforestation and deforestation is needed. furthermore, even though luc is now being considered as a variable more frequently than cc, cc is still the main focus, and this is despite some of the latest research that has found there are cases where luc has a more significant impact on water resources than cc, especially around groundwater concerns (viaroli et al., 2019). the significance of luc cannot be underestimated. the results of a few studies focusing on both cc and luc impact on groundwater resources proved that both variables are important to consider when analysing the impact since their respective impacts have distinct implications. cochand et al. (2021) found that groundwater dynamics on the swiss plateau, east of lake biel, were more sensitive to luc than cc due to increased irrigation, and concluded that both cc and luc should be considered when it comes to water resource studies. the impacts of cc were outweighed by luc and abstraction impacts in the groundwater system of the veluwe, a large strategic groundwater reservoir in the netherlands (van huijgevoort et al., 2020). they also found that before the early 19th century, luc was the most significant contributor to a decline in groundwater recharge over the entire period, after which groundwater abstraction played a more significant role in the decline of the observed recharge. groundwater depletion due to cc, luc and population growth in the central valleys of oaxaca in mexico was studied by olivares et al. (2019). the authors found that climatic conditions mainly influenced groundwater recharge in the area and claimed that despite a projected increase in annual precipitation, a rise in temperature and evapotranspiration would cause a decline in recharge. furthermore, population growth leads to an increase in groundwater abstraction. groundwater is, therefore, a high-risk resource due to fluctuating recharge and human activities. these results are site-specific. in south africa and the bgwma, no cc and luc impact study on groundwater has been done. all the knowledge gaps need to be addressed, which include smaller scale studies in terms of time and space, and combining the effects of cc and luc. variations below surface and aquifer features need to be assessed and incorporated, more field data need to be incorporated, such as abstraction rates, multiple models need to be applied, and multiple cc, luc and emissions scenarios need to be accounted for. these steps are all essential for water planning and management for the future, especially since south africa is deemed a water-scarce country (population action international, 2012). conclusions the results of this study were beneficial in determining the bibliometric structure of the impact of cc and luc on water and groundwater resources and highlighting the current research gaps and recommendations for future research in this regard. publications are on the rise, and more recent literature has shown that luc is also being considered alongside or in place of cc. the literature also shows that more local research cases are evident since research is being enacted in more and more countries. however, despite more localised research, most of the research enacted is in china or a general context. more research is needed, keeping in mind more minor spatiotemporal scales. multiple hydrological models are also being incorporated into cluc impact studies, but groundwater and land use change models could be used more often. furthermore, the need for a stronger focus on luc has been identified; the diverse and multiple forms of land use are not yet adequately addressed. when luc is addressed, it is usually in the urban context, and the urban implications can vary significantly from that of afforestation or deforestation and irrigation demands. the impact of cc versus luc is relatively new, but it has been recommended to include both areas in water and water-related research. this bibliometric analysis picks up on the trend that cc and luc studies are becoming more common, but there is still a way to go before cc and luc become an established and robust area of research, especially in south africa and in the bgwma. all of the knowledge gaps identified in this study must be addressed in the bgwma and many other wmas in south africa. acknowledgements this study was funded by the national research foundation of south africa under grant number 129070. i acknowledge my colleagues at the university of the western cape and the nrf who made this research possible. author contributions dr kanyerere and prof jovanovic assisted as supervisor and cosupervisor, respectively. they assisted in the methodology and, with prof goldin, in writing, reviewing, and editing this paper. all authors have read and agreed to the published version of the manuscript. orcid monica m correia https://orcid.org/0000-0002-0074-9842 references adhikari rk, mohanasundaram s and shrestha s (2020) impacts of land-use changes on the groundwater recharge in the ho chi minh city, vietnam. environ. res. 185 109440. https://doi.org/10.1016/j.envres.2020.109440 https://orcid.org/0000-0002-0074-9842 https://doi.org/10.1016/j.envres.2020.109440 248water sa 49(3) 239–250 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.3995 ahiablame l, sinha t, paul mjij and rajib a (2017) streamflow response to potential land use and climate changes in the james river watershed, upper midwest united states. j. hydrol. reg. stud. 14 150–166. https://doi.org/10.1016/j.ejrh.2017.11.004 albhaisi m, brendonck l and batelaan o (2013) predicted impacts of land use change on groundwater recharge of the upper berg catchment, south africa. water sa 39 (2) 211–220. https://doi. org/10.4314/wsa.v39i2.4 allaby a and allaby m (1999) a dictionary of earth sciences (2nd edn). oxford university press, london. amanambu ac, obarain o, mossa j, li l, ayeni s, balogun o, oyebamiji a and ochege uf (2020) groundwater system and climate change: present status and future considerations. j. hydrol. 589 125163. https://doi.org/10.1016/j. jhydrol.2020.125163 andaryani s, nourani v, trolle d, dehgani m and asl am (2019) assessment of land use and climate effects on land subsidence using a hydrological model and radar technique. j. hydrol. 578 124070. https://doi.org/10.1016/j.jhydrol.2019.124070 bailey rt, bieger k, arnold jg and bosch dd (2020) a new physically-based spatially-distributed groundwater flow module for swat+. hydrology 7 (75) 1–23. https://doi.org/10.3390/ hydrology7040075 bates b, kundzewicz zw, wu s and palutikof j (2008) climate change and water. ipcc secretariat, geneva. bellot j and chirino e (2013) hydrobal: an eco-hydrological modelling approach for assessing water balances in different vegetation types in semi-arid areas. ecol. model. 266 30–41. https:// doi.org/10.1016/j.ecolmodel.2013.07.002 berhail s (2019) the impact of climate change on groundwater resources in north-western algeria. arab. j. geosci. 12 (770) 1–9. https://doi.org/10.1007/s12517-019-4776-3 bighash p and murgulet d (2015) application of factor analysis and electrical resistivity to understand groundwater contributions to coastal embayments in semi-arid and hypersaline coastal settings. sci. total environ. 532  688–701. https://doi.org/10.1016/j. scitotenv.2015.06.077 breede-gouritz catchment management agency (2020) annual performance plan (app) for the fiscal year 2020/2021, department of water and sanitation, pretoria. brunner p and simmons ct (2012) hydrogeosphere: a fully integrated, physically based hydrological model. groundwater 2 170–176. https://doi.org/10.1111/j.1745-6584.2011.00882.x chang h, johnson g, hinkley t and jung i (2014) spatial analysis of annual runoff ratios and their variability across the contiguous u.s. j. hydrol. 511  387–402. https://doi.org/10.1016/j. jhydrol.2014.01.066 chen cc, zhang yo and xiang y (2014) study on runoff responses to land use change in ganjiang basin. j. nat. resour. 29 (10) 1758–1769. https://doi.org/10.11849/zrzyxb.2014.10.011 cochand f, brunner p, hunkeler d, rössler o and holzkämper a (2021) cross-sphere modelling to evaluate impacts of climate and land management changes on groundwater resources. sci. total environ. 798 148759. https://doi.org/10.1016/j. scitotenv.2021.148759 da silva vr, silva mt, singh vp, de souza ep, braga cc, de holanda rm, almeida rsr, de sousa fdas and braga ar (2018) simulation of stream flow and hydrological response to land-cover changes in a tropical river basin. catena 162 166–176. https://doi.org/10.1016/j.catena.2017.11.024 dennis i and dennis r (2011) climate change vulnerability index for south african aquifers. water sa 38 (3) 417–426. https://doi. org/10.4314/wsa.v38i3.7 donthu n, satish k, debmalya m, nitesh p and marc lw (2021) how to conduct a bibliometric analysis: an overview and guidelines. j. bus. res. 133  285–296. https://doi.org/10.1016/j.jbus res.2021.04.070 donthu n, kumar s, pandey n and lim wm (2021a) research constituents, intellectual structure, and collaboration patterns in journal of marketing: an analytical retrospective. j. int. market. https://doi.org/10.1177/1069031x211004234 dragoni w and sukhija bs (2008) climate change and groundwater: a short review. geological society, london, special publications 288 (1) 1–12. https://doi.org/10.1144/sp288.1 dws (department of water and sanitation, south africa) (2017) determination of water resources classes and resource quality objectives for the water resources in the breede-gouritz water management area: status quo. department of water and sanitation, pretoria. earman s and dettinger m (2011) potential impacts of climate change on groundwater resources – a global review. j. water clim. change 2 (4) 213–229. https://doi.org/10.2166/wcc.2011.034 fu g, crosbie rs, barron o, charles sp, dawes w and shi x (2019) attributing variations of temporal and spatial groundwater recharge: a statistical analysis of climatic and nonclimatic factors. j. hydrol. 568  816–834. https://doi.org/10.1016/j. jhydrol.2018.11.022 gabiri g, diekkrüger b, näschen k, leemhuis c, van der linden r, majaliwa jm and obando ja (2020) impact of climate and land use / land cover change on the water resources of a tropical inland valley. climate 8 (7) 83. https://doi. org/10.3390/cli8070083 gautam ap, webb el, shivakoti gp and zoebisch ma (2003) land use dynamics and landscape change pattern in a mountain watershed in nepal. agric. ecosyst. environ. 99 83–96. https://doi.org/10.1016/s0167-8809(03)00148-8 gunawardhana ln and kazama s (2012) statistical and numerical analyses of the influence of climate variability on aquifer water levels and groundwater temperatures: the impacts of climate change on aquifer thermal regimes. glob. planet. change 86 66–78. https://doi.org/10.1016/j.gloplacha.2012.02.006 gurdak jj, hanson rt, mcmahon pb, bruce bw, mccray je, thyne gd and reedy rc (2007) climate variability controls on unsaturated water and chemical movement, high plains aquifer, usa. vadose zone j. 6 (3) 533–547. https://doi. org/10.2136/vzj2006.0087 gurdak jj, mcmahon pb and bruce bw (2011) vulnerability of groundwater quality to human activity and climate change and variability, high plains aquifer, usa. in: treidel h, martin-bordes jl and gurdak jj (eds.), climate change effects on groundwater resources: a global synthesis of findings and recommendations. crc press, london. guzha ac, rufino mc, okoth s, jacobs s and nóbrega rlb (2018) impacts of land use and land cover change on surface runoff, discharge and low flows: evidence from east africa. j. hydrol. reg. stud. 15 49–67. https://doi.org/10.1016/j.ejrh.2017.11.005 hegerl gc, black e, allan rp, ingram wj, polson d, trenberth ke, chadwick rs, arkin pa, sarojini bb, becker a and co-authors (2019) challenges in quantifying changes in the global water cycle. bull. am. meteorol. soc. 100 (10) 1097–1115. https://doi.org/10.1175/bams-d-13-00212.1 hunt rj, walker jf and doherty j (2008) using gsflow to simulate climate change in a northern temperate climate. in: modflow and more, may 2008, golden co. 109–113. https://doi. org/10.1139/a08-004 kachhwala ts (1985) temporal monitoring of forest land for change detection and forest cover mapping through satellite remote sensing. proc 6th asian conference on remote sensing, november 1985, hyderabad. 77–83. kløve b, ala-aho p, bertrand g, gurdak j, kupfersberger h, kværner j, muotka t, mykrä h, preda e, rossi p and co-authors (2014) climate change impacts on groundwater and dependent ecosystems. j. hydrol. 518 250–266. https://doi.org/10.1016/j.jhydrol.2013.06.037 kundu s, khare d and mondal a (2017) past, present, and future land use changes and their impact on water balance. j. environ. manage. 197 582–596. https://doi.org/10.1016/j.jenvman. 2017.04.018 kurylyk bl, bourque ca and macquarrie kt (2013) potential surface temperature and shallow groundwater temperature response to climate change: an example from a small forested catchment in east-central new brunswick (canada). hydrol. earth syst. sci. 17 (7) 2701–2716. https://doi.org/10.5194/hess-17-2701-2013 kurylyk bl, macquarrie kt, cassie d and mckenzie jm (2015) shallow groundwater thermal sensitivity to climate change and land cover disturbances: derivation of analytical expressions and implications for stream temperature modelling. hydrol. earth syst. sci. 19 (5) 2469–2489. https://doi.org/10.5194/hess-19-2469-2015 https://doi.org/10.1016/j.ejrh.2017.11.004 https://doi.org/10.4314/wsa.v39i2.4 https://doi.org/10.4314/wsa.v39i2.4 https://doi.org/10.1016/j.jhydrol.2020.125163 https://doi.org/10.1016/j.jhydrol.2020.125163 https://doi.org/10.1016/j.jhydrol.2019.124070 https://doi.org/10.3390/hydrology7040075 https://doi.org/10.3390/hydrology7040075 https://doi.org/10.1016/j.ecolmodel.2013.07.002 https://doi.org/10.1016/j.ecolmodel.2013.07.002 https://doi.org/10.1007/s12517-019-4776-3 https://doi.org/10.1016/j.scitotenv.2015.06.077 https://doi.org/10.1016/j.scitotenv.2015.06.077 https://doi.org/10.1111/j.1745-6584.2011.00882.x https://doi.org/10.1016/j.jhydrol.2014.01.066 https://doi.org/10.1016/j.jhydrol.2014.01.066 https://doi.org/10.11849/zrzyxb.2014.10.011 https://doi.org/10.1016/j.scitotenv.2021.148759 https://doi.org/10.1016/j.scitotenv.2021.148759 https://doi.org/10.1016/j.catena.2017.11.024 https://doi.org/10.4314/wsa.v38i3.7 https://doi.org/10.4314/wsa.v38i3.7 https://doi.org/10.1016/j.jbusres.2021.04.070 https://doi.org/10.1016/j.jbusres.2021.04.070 https://doi.org/10.1177/1069031x211004234 https://doi.org/10.1144/sp288.1 https://doi.org/10.2166/wcc.2011.034 https://doi.org/10.1016/j.jhydrol.2018.11.022 https://doi.org/10.1016/j.jhydrol.2018.11.022 https://doi.org/10.3390/cli8070083 https://doi.org/10.3390/cli8070083 https://doi.org/10.1016/s0167-8809(03)00148-8 https://doi.org/10.1016/j.gloplacha.2012.02.006 https://doi.org/10.2136/vzj2006.0087 https://doi.org/10.2136/vzj2006.0087 https://doi.org/10.1016/j.ejrh.2017.11.005 https://doi.org/10.1175/bams-d-13-00212.1 https://doi.org/10.1139/a08-004 https://doi.org/10.1139/a08-004 https://doi.org/10.1016/j.jhydrol.2013.06.037 https://doi.org/10.1016/j.jenvman.2017.04.018 https://doi.org/10.1016/j.jenvman.2017.04.018 https://doi.org/10.5194/hess-17-2701-2013 https://doi.org/10.5194/hess-19-2469-2015 249water sa 49(3) 239–250 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.3995 le maitre dc, scott df and colvin c (1999) a review of information on interactions between vegetation and groundwater. water sa 25 (2) 137–152. markstrom sl, niswonger rg, regan rs, prudic de and barlow pm (2008) gsflow-coupled groundwater and surfacewater flow model based on the integration of the precipitationrunoff modelling system (prms) and the modular groundwater flow model (modflow-2005). techniques and methods 6–d1. u.s. geological survey, reston, virginia. 2328–7055. https://doi. org/10.3133/tm6d1 maxwell rm, condom le and kollet sj (2015) a highresolution simulation of groundwater and surface water over most of the continental u.s. with the integrated hydrologic model parflow v3. geosci. model dev. 8 (3) 923–937. https://doi.org/10.5194/gmd-8923-2015 mcgregor h (2018) regional climate goes global. nat. geosci. 11 (1) 18–19. https://doi.org/10.1038/s41561-017-0046-8 mejia c, wu m, zhang y and kajikawa y (2021) exploring topics in bibliometric research through citation networks and semantic analysis. front. res. metrics anal. 6 https://doi.org/10. 3389/frma.2021.742311 moeck c, grech-cumbo n, podgorski j, bretzler a, gurdak jj, berg m and schirmer m (2020) a global-scale dataset of direct natural groundwater recharge rates: a review of variables, processes and relationships. sci. total environ. 717. 137042. https://doi.org/10.1016/j.scitotenv.2020.137042 mote p, snover ak and dalton mm (2013) climate change in the northwest: implications for our landscapes, waters and communities. island press, washington. https://doi.org/10.5822/ 978-1-61091-512-0_2 nkhoma l, ngongondo c, dulanya z and monjerezi m (2020) evaluation of integrated impacts of climate and land use change on the river flow regime in wamkurumadzi river, shire basin in malawi. j. water clim. change 12 (5) 1674–1693. https:// doi.org/10.2166/wcc.2020.138 nkhonjera gk and dinka mo (2018) significance of direct and indirect impacts of climate change on groundwater resources in the olifants river basin: a review. glob. planet. change 158 72–82. https://doi.org/10.1016/j.gloplacha.2017.09.011 olivares eao, torres ss, jiménez sib, enríquez joc, zignol f, reygadas y and tiefenbacher jp (2019) climate change, land use/land cover change, and population growth as drivers of groundwater depletion in the central valleys, oaxaca, mexico. remote sens. 11 1290. https://doi.org/10.3390/ rs11111290 osei ma, amekudzi lk, wemegah dd, preko k, gyawu es and obiri-danso k (2019) the impact of climate and landuse changes on the hydrological processes of owabi catchment from swat analysis. j. hydrol. reg. stud. 25 100620. https://doi. org/10.1016/j.ejrh.2019.100620 page mj, mckenzie je, bossuyt pm, boutron i, hoffman tc, mulrow cd, shamseer l, tetzlaff jm, akl ea, brennan se and co-authors (2021) the prisma 2020 statement: an updated guideline for reporting systematic reviews. brit. med. j. 372 https://doi.org/10.1136/bmj.n71 pokhrel yn, fan y, miguez-macho g, yeh p and han sc (2013) the role of groundwater in the amazon water cycle: 3. influence on terrestrial water storage computations and comparison with grace. j. geophys. res. atmos. 118 (8) 3233–3244. https://doi. org/10.1002/jgrd.50335 ponpang-nga p and techamahasaranont j (2016) effects of climate and land use changes on water balance in upstream in the chao phraya river basin, thailand. agric. nat. resour. 50 310–320. https://doi.org/10.1016/j.anres.2016.10.005 population action international (2012) mapping and climate change. population action international, washington dc. rennermalm ak, bring a and mote tl (2012) spatial and scale-dependent controls on north american pan-arctic minimum river discharge. geogr. anal. 44 (3) 202–218. https://doi.org/10.1111/ j.1538-4632.2012.00849.x rogan j and chen dm (2004) remote sensing technology for mapping and monitoring land-cover and land-use change. eval. program plann. 61 301–325. https://doi.org/10.1016/s0305-9006(03) 00066-7 rogers g, szomszor and adams j (2020) sample size in bibliometric analysis. bibliometrics 125  777–794. https://doi.org/ 10.1007/s11192-020-03647-7 scanlon br, reedy rg, stonestrom da, prudic de and denneby kf (2005) impact of land use and land cover change on groundwater recharge and quality in the southwestern u.s. glob. change biol. 11 (10) 1577–1593. https://doi.org/10.1111/j.13652486.2005.01026.x schmidt dh and garland ka (2012) bone dry in texas: resilience to drought on the upper texas gulf coast. cpl bibliography 27 (4) 434–445. https://doi.org/10.1177/0885412212454013 scopus (2022a) diekkrüger, bernd. url: https://www.scopus.com/ authid/detail.uri?authorid=6603781218 (accessed 7 april 2022) scopus (2022b) döll, petra. url: https://www.scopus.com/authid/ detail.uri?authorid=7005892719 (accessed 7 april 2022) scopus (2022c) gabiri, geofrey. url: https://www.scopus.com/ authid/detail.uri?authorid=56027784500 (accessed 7 april 2022) scopus (2022d) kløve, bjørn. url: https://www.scopus.com/authid/ detail.uri?authorid=6602979743 (accessed 7 april 2022) scopus (2022e) leemhuis, constanze. url: https://www.scopus.com/ authid/detail.uri?authorid=13402991200 (accessed 7 april 2022) scopus (2022f ) näschen, kristian. url: https://www.scopus.com/ authid/detail.uri?authorid=57195485426 (accessed 7 april 2022) scopus (2022g) nistor, mąrgąrit mircea. url: https://www.scopus. com/authid/detail.uri?authorid=56566329900 (accessed 7 april 2022) scopus (2022h) shrestha, sangam. url: https://www.scopus.com/ authid/detail.uri?authorid=13407729100 (accessed 7 april 2022) scopus (2022i) sun, ge. url: https://www.scopus.com/authid/detail. uri?authorid=7402760408 (accessed 7 april 2022) scopus (2022j) zhang, lu. url: https://www.scopus.com/authid/ detail.uri?authorid=55964161900 (accessed 7 april 2022) shrestha s, bhatta b, shrestha m and shrestha pk (2018) integrated assessment of the climate and land use change impact on hydrology and water quality in the songkhram river basin, thailand. sci. total environ. 643 1610–1622. https://doi.org/ 10.1016/j.scitotenv.2018.06.306 smerdon bd (2017) a synopsis of climate change effects on groundwater recharge. j. hydrol. 555  125–128. https://doi.org/10. 1016/j.jhydrol.2017.09.047 sophocleous m (2002) interactions between groundwater and surface water: the state of the science. hydrogeol. j. 10 (1) 52–67. https://doi.org/10.1007/s10040-001-0170-8 szmigiera m (2021) degree of urbanisation 2021, by continent. url: https://www.statista.com/statistics/270860/urbanization-bycontinent/ (accessed 18 march 2022). tamm o, maasikamäe s, padari a and tamm t (2018) modelling the effects of land use and climate change on the water resources in the eastern baltic sea region using the swat model. catena 167 78–89. https://doi.org/10.1016/j.catena.2018.04.029 taylor rg, scanlon b, döll p, rodell m, van beek r, wada y, longuevergne l, leblanc m, famigliette js, edmunds m and co-authors (2013) groundwater and climate change. nat. clim. change 3 (4) 322–329. https://doi.org/10.1038/ nclimate1744 touhami j, andrew jn, chirino e, sanchez jr, noutabir h and pulido-bosch a (2013) recharge estimation of a small karstic aquifer in a semi-arid mediterranean region (southwestern spain) using a hydrological model. hydrol. process. 27 (2) 165–174. https://doi.org/10.1002/hyp.9200 touhidul-mustafa sm, hasan m, saha ak, rannu rp, van uytven e, willems p and huysmans m (2019) multi-model approach to quantify groundwater-level prediction uncertainty using an ensemble of global climate models and multiple abstraction scenarios. hydrol. earth syst. sci. 23 2279–2303. https:// doi.org/10.5194/hess-23-2279-2019 trzaska s and schnarr e (2014) a review of downscaling methods for climate change projections. african and latin american resilience to climate change (arcc) project, tetra tech ard, burlington, vermont. tu j and xia z (2008) examining spatially varying relationships between land use and water quality using geographically weighted regression i: model design and evaluation. sci. total environ. 407 (1) 358–378. https://doi.org/10.1016/j.scitotenv.2008.09.031 https://doi.org/10.3133/tm6d1 https://doi.org/10.3133/tm6d1 https://doi.org/10.5194/gmd-8-923-2015 https://doi.org/10.5194/gmd-8-923-2015 https://doi.org/10.1038/s41561-017-0046-8 https://doi.org/10.3389/frma.2021.742311 https://doi.org/10.3389/frma.2021.742311 https://doi.org/10.1016/j.scitotenv.2020.137042 https://doi.org/10.5822/978-1-61091-512-0_2 https://doi.org/10.5822/978-1-61091-512-0_2 https://doi.org/10.2166/wcc.2020.138 https://doi.org/10.2166/wcc.2020.138 https://doi.org/10.1016/j.gloplacha.2017.09.011 https://doi.org/10.3390/rs11111290 https://doi.org/10.3390/rs11111290 https://doi.org/10.1016/j.ejrh.2019.100620 https://doi.org/10.1016/j.ejrh.2019.100620 https://doi.org/10.1136/bmj.n71 https://doi.org/10.1002/jgrd.50335 https://doi.org/10.1002/jgrd.50335 https://doi.org/10.1016/j.anres.2016.10.005 https://doi.org/10.1111/j.1538-4632.2012.00849.x https://doi.org/10.1111/j.1538-4632.2012.00849.x https://doi.org/10.1016/s0305-9006(03)00066-7 https://doi.org/10.1016/s0305-9006(03)00066-7 https://doi.org/10.1007/s11192-020-03647-7 https://doi.org/10.1007/s11192-020-03647-7 https://doi.org/10.1111/j.1365-2486.2005.01026.x https://doi.org/10.1111/j.1365-2486.2005.01026.x https://doi.org/10.1177/0885412212454013 https://www.scopus.com/authid/detail.uri?authorid=6603781218 https://www.scopus.com/authid/detail.uri?authorid=6603781218 https://www.scopus.com/authid/detail.uri?authorid=7005892719 https://www.scopus.com/authid/detail.uri?authorid=7005892719 https://www.scopus.com/authid/detail.uri?authorid=56027784500 https://www.scopus.com/authid/detail.uri?authorid=56027784500 https://www.scopus.com/authid/detail.uri?authorid=6602979743 https://www.scopus.com/authid/detail.uri?authorid=6602979743 https://www.scopus.com/authid/detail.uri?authorid=13402991200 https://www.scopus.com/authid/detail.uri?authorid=13402991200 https://www.scopus.com/authid/detail.uri?authorid=57195485426 https://www.scopus.com/authid/detail.uri?authorid=57195485426 https://www.scopus.com/authid/detail.uri?authorid=56566329900 https://www.scopus.com/authid/detail.uri?authorid=56566329900 https://www.scopus.com/authid/detail.uri?authorid=13407729100 https://www.scopus.com/authid/detail.uri?authorid=13407729100 https://www.scopus.com/authid/detail.uri?authorid=7402760408 https://www.scopus.com/authid/detail.uri?authorid=7402760408 https://www.scopus.com/authid/detail.uri?authorid=55964161900 https://www.scopus.com/authid/detail.uri?authorid=55964161900 https://doi.org/10.1016/j.scitotenv.2018.06.306 https://doi.org/10.1016/j.scitotenv.2018.06.306 https://doi.org/10.1016/j.jhydrol.2017.09.047 https://doi.org/10.1016/j.jhydrol.2017.09.047 https://doi.org/10.1007/s10040-001-0170-8 https://www.statista.com/statistics/270860/urbanization-by-continent/ https://www.statista.com/statistics/270860/urbanization-by-continent/ https://doi.org/10.1016/j.catena.2018.04.029 https://doi.org/10.1038/nclimate1744 https://doi.org/10.1038/nclimate1744 https://doi.org/10.1002/hyp.9200 https://doi.org/10.5194/hess-23-2279-2019 https://doi.org/10.5194/hess-23-2279-2019 https://doi.org/10.1016/j.scitotenv.2008.09.031 250water sa 49(3) 239–250 / jul 2023 https://doi.org/10.17159/wsa/2023.v49.i3.3995 van der berg e (2017) the determination of water resources classes and resource quality objectives in the breede-gouritz wma, knysna. department of water and sanitation, pretoria. van huijgevoort mhj, voortman br, rijpkema s, nijhuis khs and witte m (2020) influence of climate and land use change on the groundwater system of the veluwe, the netherlands: a historical and future perspective. water 12 2866. https://doi.org/10.3390/w12102866 van rooyen jd, watson a and miller j (2020) combining quantity and quality controls to determine groundwater vulnerability to depletion and deterioration throughout south africa. environ. earth sci. 79. 255 https://doi.org/10.1007/s12665020-08998-1 varet l, kelbe b, haldorsen s and taylor rh (2009) a modelling study of the effects of land management and climatic variations on groundwater inflow to lake st lucia, south africa. hydrogeol. j. 17 1949–1967. https://doi.org/10.1007/s10040-009-04 76-5 verma s and gustafsson a (2020) investigating the emerging covid-19 research trends in the field of business and management: a bibliometric analysis approach. j. bus. res. 118 253–261. https:// doi.org/10.1016/j.jbusres.2020.06.057 viaroli s, curzio dd, lepore d and mazza r (2019) multiparameter daily time-series analysis to groundwater recharge assessment in a caldera aquifer: roccamonfina volcano, italy. sci. total environ. 676 501–513. https://doi.org/10.1016/j.scitotenv.2019. 04.327 wang q, xu y, xu y, wu l, wang y and han l (2018) spatial hydrological responses to land use and land cover changes in a typical catchment of the yangtze river delta region. catena 170 305–315. https://doi.org/10.1016/j.catena.2018.06.022 yan, zhang x, yan s and chen h (2018) spatial patterns of hydrological responses to land use/cover change in a catchment on the loess plateau, china. ecol. indic. 92  151–160. https://doi. org/10.1016/j.ecolind.2017.04.013 yue t, xhao n, ramsey rd, wang c, fan z, chen c, lu y and li b (2013) climate change trend in china, with improved accuracy. clim. change 120  137–151. https://doi.org/10.1007/s105 84-013-0785-5 zhang l, chen l, chiew f and fu b (2018) understanding the impacts of climate and land use change on water yield. environ. sustainability 33  167–174. https://doi.org/10.1016/j.cosust.2018.04. 017 zhao l, tang z and zou x (2019) mapping the knowledge domain of smart-city research: a bibliometric and bibliometric analysis. sustainability 11 6648. https://doi.org/10.3390/su11236648 zhou y, zwahlen f, wang y and li y (2010) impacts of climate change on irrigation requirements in terms of groundwater resources. hydrogeol. j. 18 (7) 1571–1582. https://doi.org/10.1007/ s10040-010-0627-8 https://doi.org/10.3390/w12102866 https://doi.org/10.1007/s12665-020-08998-1 https://doi.org/10.1007/s12665-020-08998-1 https://doi.org/10.1007/s10040-009-0476-5 https://doi.org/10.1007/s10040-009-0476-5 https://doi.org/10.1016/j.jbusres.2020.06.057 https://doi.org/10.1016/j.jbusres.2020.06.057 https://doi.org/10.1016/j.scitotenv.2019.04.327 https://doi.org/10.1016/j.scitotenv.2019.04.327 https://doi.org/10.1016/j.catena.2018.06.022 https://doi.org/10.1016/j.ecolind.2017.04.013 https://doi.org/10.1016/j.ecolind.2017.04.013 https://doi.org/10.1007/s10584-013-0785-5 https://doi.org/10.1007/s10584-013-0785-5 https://doi.org/10.1016/j.cosust.2018.04.017 https://doi.org/10.1016/j.cosust.2018.04.017 https://doi.org/10.3390/su11236648 https://doi.org/10.1007/s10040-010-0627-8 https://doi.org/10.1007/s10040-010-0627-8