key: cord-010092-uftc8inx
authors: nan
title: Abstract of 29th Regional Congress of the ISBT
date: 2019-06-07
journal: Vox Sang
DOI: 10.1111/vox.12792
sha: 
doc_id: 10092
cord_uid: uftc8inx

nan

in the fin de siecle was heavily concentrated in Vienna. Freud, Boltzmann, Schr€ odinger and Mach might be the first names to find, whenever one cites Austrian scientists. But more related to transfusion are the Noble Prize winners Max Perutz and Karl Landsteiner. Landsteiner 0 s fate illustrates the brain drain beginning in the early 30 s escalating in 1939 with the "Anschluss", which lead to the forced emigration of many scientists. A loss which was not regenerated in the post war years and was further aggravated by dubious and often undisclosed relations and scandals in the Nazi-era. All together this leads to a severe loss of credibility and productivity of universities across decades. Opening university access in the early 80 s and intensive historical work-up of scandals transformed the Austrian universities to open and effective scientific institutions driving innovation in the country. Austria has achieved a great economic deal in recent decades, which was accelerated by the EU membership in 1995. As a result of strong long-term economic performance, the country's gross domestic product (GDP) per capita is the eighth highest among OECD countries and fourth in the EU28. Levels of poverty and income inequality are both below the OECD average. Investment in research and development (R&D) increased since the EU accession, when Austria's R&D intensity (aggregate R&D expenditure as a percentage of GDP) was well below the OECD average and significantly far lower than Switzerland -a country to which Austria prefers comparison. The EU target of 3% R&D intensity was first met in 2014 and is 2018 the sixth highest among OECD countries and the second highest in the EU28. Austria showed the second highest increase in R&D intensity of all OECD countries, exceeded only by Korea. The rapid expansion was matched by a similar increase in human resources and scientific output of universities. Austrian science in quantum mechanics, quantum communication and information is world renown. Vienna is a major biotech hub, as is Linz in mathematics and mechatronics and Graz in automotive and production technologies. Austria has been a net resource recipient in the Horizon 2020 and the preceding 7th Framework Programme. Small and mediumsized enterprises show a high propensity to co-operate with universities and other research organisations and more and more included in scientific grant schemes. Vienna is the largest student city in the German-speaking world and consistently ranks among the top cities in the world on quality-of-life indices. As Austria possesses globally recognised cultural attractions ranging from famed Salzburg festival to the Vienna New Year concert its inhabitants are not aware of the progress made in R&D and how thriving innovation is going on in their country. They still love to show their cultural heritage and events and impress the world with some kind of eternal Sound of Music. Patients with refractory B-cell malignancies as non-Hodgkin lymphomas (NHL) resistant to standard therapies have a dismal prognosis. The outcome is even poorer in patients relapsing after autologous stem cell transplantation. Most of these patients do not qualify for an allogeneic hematopoietic cell transplantation (HCT) due to refractory disease, lack of a suitable allogeneic donor, higher age or cumulative toxicity of previous chemotherapy. Despite patients undergoing allogeneic HCT normally profit from a graft-versus -lymphoma effect, overall survival in patients with NHL after HCT remains short. A similar situation can be observed for patients with acute lymphoblastic leukemia (ALL). Therefore novel treatment modalities are urgently needed. Chimeric antigen receptor (CAR)-T cells, a new class of cellular immunotherapy involving ex vivo genetic modification of T cells to incorporate an engineered CAR have been used in clinical trials. In the majority of studies B-cell malignancies treated with CD19 targeting CAR-T cells have been analyzed. Austria had the advantage to participate in two international trials in the past and is currently involved in further CAR-T studies. Recently, results from CD19 directed CAR-T cell trials with an increased follow-up of patients led to FDA (Food and Drug Administration) and EMA (European Medicines Agency) approval of tisagenlecleucel and axicabtagene ciloleucel. Common adverse events (AEs) include cytokine release syndrome and neurological toxicity, which may require admission to an intensive care unit, B cell aplasia and hemophagocytic lymphohistiocytosis. These AEs are manageable when treated by an appropriately trained team following established algorithm. In this presentation, results of four large phase II CD19CAR-T cell trials for patients with NHL and ALL and focus on AEs is summarized. Preoperative anemia is a known risk factor for increased perioperative morbidity and mortality in patients undergoing major surgery. Previous studies have not only shown higher in-hospital mortality, but also an increased hospital length of stay, greater postoperative admission rates to intensive care and prolonged use of mechanical ventilation and intensive care resources in patients with anemia compared to those with normal preoperative hemoglobin concentrations. About 30% of patients scheduled for major surgery suffer from preoperative anemia. This figure is even higher in patients requiring orthotopic liver transplantation, where up to 75% of all patients are diagnosed with anemia prior to surgery. Transfusion of packed red blood cells (PRBCs) is commonly used to correct anemic hemoglobin values. However, transfusion of PRBCs has been associated with increased morbidity and mortality in patients undergoing cardiac, orthopedic, and abdominal surgery. Additionally, transfusion of PRBCs is associated with a greater incidence of postoperative acute kidney injury in patients undergoing orthotopic liver transplantation. As preoperative anemia might increase the perioperative use of PRBCs, negative effects observed after PRBC transfusions might even be augmented. Data on the influence of preoperative anemia on morbidity and mortality after orthotopic liver transplantation are limited. Thus, we retrospectively analyzed the association of preoperative anemia and mortality in adult patients undergoing orthotopic liver transplantation at our institution. In addition, we examined the influence of anemia on perioperative parameters such as transfusion requirements, surgical complications, early allograft dysfunction, acute kidney injury, and the need for renal replacement therapy. Based on the results obtained in the retrospective analysis, an ongoing prospective randomized clinical trial was initiated. The two suspensive treatments in sickle cell disease (SCD) are hydroxycarbamide, inducing the production of the functional HbF, normally repressed at birth, and Red blood cell (RBC) transfusion, a critical component of SCD management. However, RBC transfusion is not without risk. Repeat exposure to allogeneic RBCs can result in the development of RBC alloantibodies which can make it difficult to find compatible RBCs for future transfusions. However, the main concern of alloimmunization is the development of hemolytic transfusion reaction, with in the most severe cases, hyperhemolysis, leading to multi organ failure and death in 4% of the cases. The prevention of this life threatening condition must be based on risk factors. However, although some risk factors, such as alloimmunization, have been identified, much of the mechanism underlying DHTR remains a mystery, particularly in severe cases presenting hyperhemolysis. Here we will describe the current and future development to prevent and treat this severe syndrome In order to decrease exposure to transfusion in SCD but also improve red blood cell quality, some new products are developed. Oxidative damage is one of the parameter that could be diminished. Some work is also ongoing to prevent filter blockage during leucodepletion of precious RBCs units from Afro-Caribbean donors carrying the sickle cell trait. Finally, in countries with higher risks of transmission of infectious disease, treatment of red blood cell units against infectious agents can be discussed. The only current curative treatment of SCD is hematopoietic stem cell transplantation (HCS). However, the occurrence, frequency, and effects of immune hematologic complications in HCS remain and will be discussed. Finally, gene therapy is a real hope as a definitive curative treatment. Clinical trials are ongoing in France and will be discussed as well as the remaining place of transfusion in this therapeutic. In the context of the Chronic Myeloid Leukemia (CML), we have hypothesized that quiescent Leukemic Hematopoietic Stem Cells (HSC) compartment, escaping to the current tyrosine kinase inhibitors (TKis) treatment, in part associated in the molecular relapse, may be targeted by CART-cells immunotherapy. Gene expression profiling studies have established that a cell surface biomarker IL-1RAP is expressed by the leukemic but not by the normal CD34 + /CD38-HSC. This talk will focus of the whole process of development of a CART-cells starting from recombinant IL-1RAP protein mice immunization to produce a specific monoclonal antibody (mAb), to the proof of concept demonstration, before moving into the clinic. We produced and selected a specific anti-IL-1RAP mAb (#A3C3 clone, Diaclone SA, Besanc ßon, France). After molecular characterization of antigen-binding domain, nucleotide sequences were fused with 3rd generation T cell activation coding sequences and cloned as a single chain into a lentiviral backbone comprising a safety switch suicide gene iCASP9 (inducible Caspase 9) and a monitoring/selection cell surface marker ΔCD19. We demonstrated in-vitro and in an in-vivo xenograft murine model that IL-1RAP CAR T cells can be activated in the presence of IL-1RAP+ cell lines or primary CML cells, secrete pro-inflammatory cytokines, degranulate and specifically killing them. We also demonstrated that multi-TKIs treatment over a 4-year period does not affect transduction efficiency of CML patient T-cells by IL-1RAP CAR vector and that autologous CART-cells are able to target IL-1RAP+ leukemic primary HSC. "Off-tumor-on target" toxicity prediction, by studying IL-1RAP expression on a tissue macroarray comprising 30 normal human tissues (3 donors) , with #A3C3, detected various IL-1RAP intensity staining in only few tissues. Regarding the healthy hematopoietic system, #A3C3 flow cytometry staining did not detect hematopoietic cells, except monocytes that express poorly IL-1RAP. As expected, monocyte subpopulation is targeted by autologous IL-1RAP CART cells (ratio E: T = 1:1), but at a lower level that IL-1RAP CML cell line. In-vivo investigation of specific toxicities of autologous IL-1RAP CART-cells against HSC and/or immune cells on a human-CD34 + cord blood cell engrafted/NOG murine model, but also by an in-vitro CD34 + colony forming unit assay didn't reveal any significant toxicities in immunocompetent cell subpopulations, suggesting that healthy CD34 + HSC are not affected. Finally, to overcome potential toxicity, functionality of the iCASP9/ Rimiducid â safety switch was demonstrated in-vitro but also in-vivo in a NSG tumor xenograft model, showing that, when activate, the system is able to eliminate more than 90% of CART-cells, after exposure to AP1903. In conclusion, based on CML model, we demonstrated that IL-1RAP is an interesting target for CART-cell immunotherapy, with a limited "on target, off tumor" predictable toxicity. Next step will be the up-scaling of the process in order to match with the use in human regarding also the regulatory requirements. This strategy may be applied, in the future, in other hematological malignancies. Mortality ranges from 20 to 30% for trauma victims with severe bleeding and is largely dependent on the transfusion therapy from which they can benefit. The nature of this therapy has an impact on prognosis with a halving of mortality when the plasma/pRBC ratio is greater than ½ and a decrease of about 20% when the proportion of platelets transfused is close to that of whole blood. The speed with which such therapy is actually administered has a major impact as well with an increase in mortality of 5% for each minute of delay in making the entire therapy available. This can be explained mainly by the fact that the probability of death of these patients is greater within minutes of their admission to hospital with a median time to death of 2 h after admission. To allow plasma, platelets and pRBC to be made available in a timely manner, North American trauma centers have mandated that trauma centers have massive transfusion packs at the patient's bedside within 15 min. To further simplify and speed up logistics from distribution to transfusion, several trauma centers now use whole blood stored at 4°C. This return of an "old" product is largely inspired by military experience where whole blood is mainly used "warm" immediately after collection with compelling evidence of its effectiveness. Its return to civilian practice requires the ability to deleukocyte it while preserving platelets and to store it while maintaining their hemostatic functions. Good quality data shows this is achievable and several clinical studies are planned to begin in the coming months. In France, the French Blood Establishment and the French Army are cooperating to initiate the prospective randomized non-inferiority STORHM trial (Sang Total pour la R eanimation des H emorragies Massives) which will be comparing whole blood to separate blood components in an 1/1/1 ratio in severely bleeding trauma patients. The primary endpoint will be a thromboelastographic parameter (maximum amplitude) assessed at the 6th hour after admission. Secondary endpoints will include early and overall mortality, lactate clearance (reflection of the effectiveness of resuscitation) and 24 h organ failure. This trial will be recruiting 200 patients in 6 French trauma centers and is planned to be initiated second half of 2019.

Local/Neighbours Day: Innovation in Germany 1C-03-01 MESENCHYMAL STROMAL CELLS FOR REGENERATIVE THERAPY BM-MSC / ASC obtained from these protocols have been characterized in detail in preclinical evaluations. Manufacturing licenses for MSC and ASC and a platelet-derived growth factor concentrate have been obtained and they have been explored in several clinical trials for treatment of bone defects (ORTHO-CT1: EudraCT Number: 2011-005441-13; ORTHO-CT2: EudraCT Number: 2012-002010-39; MAXILLO1: EudraCT Number: 2012-003139-50) . We will summarize results of completed clinical trials which confirmed feasibility and safety of autologous MSC /ASC treatment and provided evidence for efficacy (Gjerde et al, Stem Cell Res. 2018 Introduction: In vitro produced Megakaryocytes (MKs) may serve as source to produce platelets (PLTs) ex vivo or in vivo. We have established a strategy to differentiate MKs from induced pluripotent stem cells (iPSCs) in bioreactors. This study aimed at the large-scale production of MKs using microcarriers to increase the MK yield and to characterize their phenotype and functionality after irradiation as a method to decrease possible safety concerns associated to the iPSC origin. Methods: iPSCs were cultured in an aggregate form in presence or absence of microcarriers using 50 mL stirred flasks. Cells were differentiated into MKs using TPO, SCF and IL-3 in APEL2 medium for a period of 22 days. Non-irradiated or irradiated iPSC-derived MKs were analysed for polyploidy, phenotype and proPLT production using flow cytometry and fluorescence microscopy. Also, PLT-production was investigated in vivo. Non-irradiated or irradiated MKs were transfused to NOD/ SCID/IL-2Rcc-/-mice and blood was analyzed for human PLTs. Results: Differentiation of MKs in presence of microcarriers resulted in an 8-fold increase of MKs per iPSC in comparison to only aggregates. This resulted in mean of total MK harvest of 18.7 AE 6.8 9 10 7 in microcarrier-assisted bioreactors in comparison to 4.9 AE 1.3 9 10 7 MKs collected from bioreactors containing only aggregates. Interestingly, MKs produced in microcarrier-assisted bioreactors showed higher proPLT formation capacity than MKs derived from only aggregates bioreactors. MK phenotype and DNA content was comparable between MKs derived from both types of bioreactors. Irradiation of MKs did not affect their phenotype and capability to form proPLTs or PLTs after transfusion into NOD/SCID/IL-2Rcc -/mice. Conclusion: Microcarriers showed to significantly increase the yield of iPSC-derived MKs in stirred bioreactors to clinically relevant numbers. This may facilitate the use of iPSC-derived MK for ex vivo production of PLTs, direct transfusion or for innovative MK-based regenerative therapies. Although the Rosetta stone, found by the troops of Napoleon in Egypt near the city of Rosetta (Rashid) contains only a small amount of text in three languages it was key in deciphering Hieroglyphs. The Rosetta mission tried to achieve something similar: by looking at a tiny body its goal was to decipher the origin of the solar system, planets including Earth and life. After more than 12 years the Rosetta spacecraft softly crashlanded on comet Churyumov-Gerasimenko on September 30, 2016 . It has travelled billions of kilometers, just to study a small (4 km diameter), black boulder named 67P/ Churyumov-Gerasimenko. The results of this mission now seem to fully justify the time and money spent in the last decades on this endeavor. Where are we from? Where are we going? Are we alone in the Universe? these are some of the big questions. In this talk I will show which answers we got from Rosetta and comet Chury. We follow the pathway of the material which makes up our solar system from a dark cloud to the solar nebula and finally to planets and life. I will show that indeed we are the result of stardust and that what happened here may happen elsewhere in the Universe. Cells, tissues and entire organs can collectively be seen as "living drugs". Genetically unaltered cells are routinely used in clinical practice to treat diseases as diverse as anemia, bleeding disorders, leukemia and organ failure. Ground-breaking advances in genetic and genome engineering technologies are propelling cell therapies to the frontline of Medical research and practice. The hematopoietic system is particularly amenable to genetic engineering because specific cell types can be purified based on the expression of specific surface proteins and the ability to culture and expand cells ex vivo. The recent unprecedented clinical success of killer T cells reprogrammed by chimeric antigen receptors (CARs) to attack CD19 expressing tumor cells demonstrates the power of immunotherapy with genetically engineered immune cells. However, given the rapid development of novel genome engineering and synthetic biology tools we are likely only at the beginning of a new era of engineered cellular therapies. I will present recent progress in immune cell reprogramming, gene correction, safety aspects and remaining challenges such as manufacturing.

1D-04-03

Cell free nucleic acids (CFNA) circulate in the plasma of all individuals and are thought to be released by host and foreign cells into the circulation. After fractionation by centrifugation, CFNAs can be extracted from the supernatant of whole blood samples or manufactured blood products. These DNA or RNA sequences can be of human, bacterial, viral or fungal origin. Most of them are human double stranded DNAs. Research on CFNAs is increasing, thanks to technological advancements in molecular biology. Some of their results are already implemented in clinical practice in the areas of prenatal diagnosis, oncology and infectious diseases. The latter investigation focuses on the exploration of non-human CFNAs, the field of metagenomics. High throughput sequencing associated with bioinformatics, the so-called new generation sequencing (NGS), has sped up the investigations of non-human CFNAs. This tool provides the opportunity to classify CFNAs into a human or non-human category, and then to identify them. It is thus possible to explore simultaneously the whole landscape of bacterial, viral and fungal populations. Presently, NGS of human blood has already proven its feasibility and its value in identifying emerging viruses or investigating clinical cases of fever of unknown etiology. NGS of CFNAs is also particularly effective in analyzing the different genotypes of a virus in case of a co-infection (e.g. Hepatitis C virus). Studying CFNAs with the new molecular technologies is therefore of great importance in transfusion medicine, especially regarding security and clinical transfusion reactions. First, transfusion transmitted infections are the most feared adverse complications. Second, febrile non-hemolytic transfusion reactions are also the most frequently reported adverse events in hemovigilance systems and their physiological mechanism -if only one-remains not clearly elucidated. Investigating CFNAs could thus improve our understanding and strategy aiming at reducing those two clinical adverse events. Surveying comprehensively the composition of circulating infectious agents in a blood product by NGS technology could be very interesting for investigating a severe febrile transfusion reaction. Moreover, when the costs of analysis will be reduced, it might be possible to screen prospectively and regularly the whole metagenomics of asymptomatic blood donors, in addition to the classical epidemiological surveillance. For instance, in a study testing a NGS method on manufactured fresh frozen plasmas, an astrovirus (MLB2) has been identified. Finally, it is the responsibility of transfusion physicians implicated in the manufacturing of blood products to ensure that CFNAs within a blood product do not have a clinical impact on the innate immunity of the recipients. According to recent research in vitro, CFNAs purified from blood products can induce the transcription of inflammatory cytokines by mononuclear cells. As nonhuman CFNA have an effect on Toll-Like Receptors (TLR-linked inflammatory pathways), it would be also relevant to insure that donor's CFNAs have no significant effect on the immune system of the recipient. In conclusion, CFNAs are very diverse molecules contaminating blood products. Technological progress makes now their investigation more available. Besides being useful markers of infection in asymptomatic donors, their impact on the recipients' immunity should be further investigated. An active life and regular training is part of a healthy life style and for many this includes participation in endurance exercise competition at different levels. Thus, it is highly relevant to know how a blood donation affects exercise performance and how close this can done to an endurance competition. Endurance exercise performance is determined by many factors, but three of the primary are maximal oxygen uptake, the relative load that an individual can sustain over time and finally the efficiency of movement in the given discipline. Over the years, a number of studies have sampled blood volumes ranging from 450-1200 ml and applied different methodological approaches to measure maximal oxygen uptake over a recovery period ranging between 3-28 days. Overall, the general finding is a reduction in blood haemoglobin and an attenuated maximal oxygen uptake as well endurance performance after blood donation. In normal to well-trained men maximal oxygen uptake and performance was normalized after two weeks in one study after a normal blood donation (450/470 ml), but remained attenuated after four weeks in another study, despite the change in blood haemoglobin concentration was similar and the design and methodology also similar in the two studies. In addition to maximal oxygen uptake the relative load that can be tolerated during exercise is probably also attenuated, through a decreased arterio-venous oxygen extraction, but the available data is very limited. The first part of this talk will highlight the major findings and discuss some of the methodological issues that complicate interpretation and conclusions. There are sex differences in circulating blood volume, haemoglobin concentration, haematocrit and hormone levels and thus it is entirely possible that there is a sex difference in the effect of blood donation on physical performance and the recovery after blood donation. In addition to the basic physiological sex differences, there is also a higher prevalence of iron deficiency in premenopausal women, physically active women and women donating blood. Therefore, we studied the influence of a standard 450 mL blood donation on maximal oxygen uptake and endurance performance and the subsequent recovery in physically active women. We observed that in iron sufficient women blood haemoglobin concentration and maximal oxygen uptake were back to baseline 28 days after blood donation, but endurance performance was normalized already after 14 days. The second part of this talk will discuss the sex differences in the effect of blood donation on maximal oxygen uptake and endurance performance. Overall, the available data suggest that, with a careful conservative approach, 4 -5 weeks are needed after a normal blood donation to be fully recovered to participate in endurance exercise competitions. More than one in ten attempts to donate blood result in a temporary deferral, due to concerns about the impact of the donation on the donor or recipient. There is well established evidence that temporary deferrals impact negatively on donors, with a large proportion of those deferred failing to return at the end of the deferral period. This presentation provides an overview of deferrals from the donor perspective, describing the likelihood of receiving a deferral for different donor subgroups. The impact of temporary deferrals on the future donation of donors, considering both short-term and longer-term donation patterns, will also be reviewed, outlining which donors are at highest risk of non-return following a deferral, and what is known about the accumulative impact of multiple deferrals on donors. Several hypotheses have been proposed to account for the strong negative impact of deferrals on donor behaviour, and there is preliminary evidence of psychological factors, such as emotional reactions, predicting intention to return. Research is also beginning to emerge on the effectiveness of tailored interventions to mitigate the impact of deferrals on donor behaviour. The evidence for these preventative interventions, and for strategies to reactive donors once they have lapsed post-deferral, will be reviewed. Recommendations for blood centres will be made, as well as suggestions for future research to address continuing gaps in knowledge. In his influential study "The Gift Relationship" (1970) , Richard Titmuss coined the idea of voluntary, non-paid, blood donation being the gift of life for a fellow citizen. This metaphor has been powerful in mobilizing donors (Busby 2004) . It conveys a direct relationship between blood donation and patients' vitality, as well as a difference between gains and costs. As the gift of life, blood donation is seen to symbolize pure altruism and promoting solidarity between strangers. But can we apply the metaphor as successfully into donating blood for research? We asked a group of Finnish blood donors what they would think if the FRC Blood Service invited them to give a blood sample and personal information for research. The blood donors were usually willing to contribute to research for the public benefit, because they saw great potential in science to create solutions to help patients in the future. However, based on our interview data and previous research, we suggest that the analogy between gift of life and donation for research did not work all the way. The metaphor fails to address donors' questions on new types of relationships, interests and risks related to the use of personal data for research. Left unanswered these could discourage donating for research. Hence, we argue that the gift of life metaphor is not applicable to donor recruitment at the research context. In this presentation we wish to look for a better metaphor for donation for research that blood services collecting research data could apply.

Academy Day: Transfusion Challenges in Patients with Sickle Cell Disease 2A-02-01 IMMUNOHAEMATOLOGICAL FEATURES OF PATIENTS WITH SICKLE CELL DISEASE (LFA) should be considered as polymorphic antigens in the African population and these LFA are not present in most commercial panels. The situation is even more complicated when recipients lack high-frequency antigens, the most common ones being Hr-, Hr B -, Sec-, U neg , U+ var , Js(b-), (Hy-), and Jo(a-). Finally, there is a high Rh diversity among people of African descent. Because they harbor variant alleles and/or partial RH antigens, they are at risk of developing alloantibodies. In this setting, screening for partial RH antigens makes sense. The figures illustrating this diversity vary with the approach used. One of them is to take into consideration RHD or RHCE*ce variant alleles. In several American studies, their prevalence was estimated to be 29-36% and 53-72%, respectively. Other teams take into consideration D, C and e partial antigens. Their prevalence was estimated to be 8.4-14%, 12.5-27.7%, 3.3-3.5%, respectively, and the alloimmunization rates were 17.6%, 14.3-30%, 7.1%, respectively. As a result of these phenotype discrepancies, SCD patients are more likely to be alloimmunized. An overall immunization rate of 2-6% is commonly admitted in the general population. Depending on the unit selection policy and/or the study design, the immunization rate in SCD patients varies from 7% to 76%, the highest figures being established when an ABO/RH1-only matching policy is implemented. In a meta-analysis of 24 publications, the overall alloimmunization rates were around 20%. Alloimmunization is thought to be enhanced by an inflammatory state, which is often present in SCD patients. They are more prone to develop a new alloantibody. Using a stochastic modeling of alloimmunization, they have a 61% increased risk of producing additional antibodies versus 30% in the general population. Autoantibodies have been identified as a risk factor of alloimmunization. As a result, SCD patients often have complex mixtures of allo and autoantibodies. RH antibodies and those considered as irregular natural antibodies are present in a significant proportion. Another characteristic of the antibodies in SCD patients is their evanescence; up to 70% of alloantibodies become undetectable within a few years of their initial development. Relatedly, about a third of DHTRs are reported to happen in patients with no previous history of immunization. In addition, a third of patients will not develop an antibody after a DHTR. Identifying patients at risk of developing a DHTR is key to managing them properly. Alloimmunization is a serious risk of red blood cell transfusion in patients with sickle cell disease (SCD) and can result in severe (delayed) haemolytic transfusion reactions, exacerbation of clinical symptoms and life-threatening hyperhaemolysis. Once alloimmunized, the presence of alloantibodies in the patients' blood further complicates pretransfusion testing and hampers the selection of compatible blood products. Numerous studies have shown that SCD patients have a relatively high risk of alloimmunization as compared to the 'general' population. This is not only explained by the large number of transfusions given but also by the increased exposure to foreign antigens as a result of differences in the antigen make-up of the SCD recipients and the blood donor population. Other factors involved in the immune response such as age at first transfusion, inflammatory state, HLA typing are under investigation and are starting to unravel. Because blood transfusion is still one of the main treatment modalities for SCD and some patients have a life-long transfusion dependency it is important to minimize the alloimmunization rate. Theoretically, complete matching for all relevant blood group antigens would prevent alloimmunization. This however, is only possible when all donors are comprehensively. Matching strategies should be developed to minimize alloimmunization while balancing patients' need and donor availability and is cost effective. To develop a (preventive) matching strategy some factors need to be established; 1) which antibody specificities are clinically relevant 2) which antigens are most immunogenic 3) what is the availability of specific antigen typings in the donor population 4) how should recipients (and donors) be typed, phenotypically and/or genotypically and to what extent. The latter is especially important in SCD patients since they are of African descent and the prevalence of genetic variations in this population is relatively high. RhD and RhCE variants are common and can remain undetected when serological typing is used but can be discovered with high resolution molecular typing. Patients with partial Rh phenotypes are at risk for alloimmunization. Apart from special Rh phenotypes in individuals from African descent, the Fy(a-b-) phenotype related to the GATA-box mutation in the FYB allele and the U-or U var phenotype resulting from genetic variations in the MNS alleles are also common.

Several studies have shown that in SCD patients antibodies directed against RhD, RhE, RhC and K are most frequently found when unmatched transfusions are given. Preventive matching for these antigens has proven successful in reducing alloimmunisation. Extended matching for all Rh antigens Fy(a), Jk(a) and Jk(b) can further decrease the alloimmunisation rate. Currently, different countries have preventive matching strategies in place for this vulnerable patient group. As genotyping is more and more available and within reach, optimal antigen typing approaches for patients and donors, combining serology and genetics are being developed. In this lecture several aspects of antigen typing approaches and preventive matching strategies that will most benefit SCD patients of will be discussed. Artificial intelligence has become a buzzword that will appear about anywhere in the media. We can forget that AI, or the subfield in this computer science field machine learning, has been around for over 50 years. Improvements in computing power, abundance of data, progress in computer science, and the arrival of affordable cloud solutions have now brought it to our daily lives. Also in health care news about AI has become omnipresent. And some landmark papers have come out on algorithms outperforming (teams of) physicians in the diagnosis of all kinds of skin disease, eye disease from retina scans, and detect cancer in CT scans. However, little of these solutions have actually shown up in our clinical practice yet. In anaesthesia, we worked with the first algorithm to come to anaesthesia practice; Hypotension during surgery is associated strongly with poor outcome like myocardial ischemia, surgical complications, renal failure and even mortality. We worked on a machine-learning trained algorithm that predicts hypotensive events using the arterial blood pressure curve up to 15-30 min before the actual event.

To get FDA and CE approval, however, mere mathematic validation is required. This can be achieved on retrospective datasets. In reality, we need more before we can use these algorithms to support our decision-making; After internal (retrospective) and external (prospective but passive use) validation steps, clinical (i.e. RCT validation is needed. Moreover, we will need to assess the economic impact too. Ultimately this tool has now reached clinical practice and is starting to help us go from reactive to more proactive hemodynamic management. Like this, we have started to work on machine-learning tools to predict the incidence of specific types of patients coming into A&E and predicting infections after surgery. We will discuss our approach, essentials to start with machine learning, practical learnings. We will also discuss a first project design to use machine learning in managing bleeding patients to get the best therapy advice for blood product use like plasma, fibrinogen et cetera. How can we start using this tool in unison with our existing tools to improve science and clinical practice in our respective (bio)medical fields?

Thrombocytopenia is a very common hematological abnormality found in newborns, especially in preterm neonates. Two subgroups can be distinguished: early thrombocytopenia, occurring within the first 72 h of life, and late thrombocytopenia, occurring after the first 72 h of life. Early thrombocytopenia is associated with intrauterine growth restriction, whereas late thrombocytopenia is caused mainly by sepsis and necrotizing enterocolitis. Platelet transfusions are the hallmark of the treatment of neonatal thrombocytopenia. Most of these transfusions are prophylactic, which means they are given in the absence of bleeding. However, the efficacy of these transfusions in preventing bleeding has never been proven. In addition, risks of platelet transfusion seem to be more pronounced in preterm neonates. Because of lack of data, platelet transfusion guidelines differ widely between countries. In a recent randomized controlled trial (Planet-2/Matisse study) among preterm infants with severe thrombocytopenia, we found that those randomly assigned to receive platelet transfusions at a platelet-count threshold of 50 9 10 9 /L had a significantly higher rate of death or major bleeding within 28 days after randomization than those who received platelet transfusions at a platelet-count threshold of 25 9 10 9 /L. This presentation summarizes the current understanding of etiology and management of neonatal thrombocytopenia. Transfusion-associated circulatory overload (TACO) is a severe transfusion adverse reaction that is associated with increased mortality and morbidity. The incidence of TACO in adults varies from 1% to 8%, but is probably underdiagnosed and underreported. The incidence in the pediatric population is undetermined. TACO usually occurs in patients who receive a large volume of blood product over a short period of time. It is more common in patients with known risk factors such as cardiovascular disease, renal failure, and older or younger age (> 60 years or < 3 years). Hospitalised patients and intensive care patients are also more at risk. The typical presentation of TACO is respiratory distress (dyspnea, tachypnea) occurring within 12 h of a blood transfusion. Associated signs and symptoms are hypoxia, hypertension, tachycardia, positive fluid balance, high central venous pressure, and acute or worsening pulmonary edema on chest X-ray. Echocardiography and measurement of brain natriuretic peptide (BNP) or its N-terminal prohormone (NT-proBNP) is helpful for diagnosis. Several definition criteria have been proposed for TACO, but none are adapted for children, particularly critically-ill children who are more at risk. This is probably the main reason why TACO is even more underdiagnosed and underreported in the pediatric population. In a recent study, we compared the incidence of TACO in a pediatric intensive care unit using the International Society of Blood Transfusion (ISBT) criteria, with two different ways of defining abnormal values: 1) using normal pediatric values published in the Nelson Textbook of Pediatrics; and 2) using patients as their own controls and comparing pre-and post-transfusion values with either a 10% or 20% difference threshold. We monitored for TACO up to 24 h post-transfusion. A total of 136 patients were included. TACO incidence varied from 1.5% to 76%, depending on the definition used. With such wide variability, we conclude that a more operational definition of TACO is needed in pediatrics, particularly for critically-ill children. Differential diagnosis from other dyspnea-associated transfusion adverse reactions (e.g. transfusion-associated lung injury, anaphylaxis) is important because treatment differs, as do guidelines to the blood bank. Treatment for TACO is similar to that of any other cardiogenic pulmonary edema: oxygen, diuresis, ventilatory support. Prevention is possible by avoiding unnecessary transfusions, transfusing only the necessary amount of blood product, avoiding rapid transfusions, and using diuretics. Background: The risk and importance of transfusion-transmitted hepatitis E virus (TT-HEV) infections by contaminated blood is currently a controversial discussed topic in transfusion medicine. In particular, the infectious dose is a not finally determined quantity. The different countries have chosen different approaches to deal with this pathogen. One central question is the need of individual NAT screening (ID) versus minipool NAT screening (MP) approaches to identify all relevant viremias in blood donors. Aims: Comparison and evaluation of the available screening strategies in relation to the infectious dose to minimize the risk of TT-HEV infections. Methods: We systematically reviewed the presently known cases of TT-HEV infections and available routine NAT-screening assays. Furthermore, blood donation screening strategies for HEV EHEV in effect in the European Union were compared. We also describe our own experiences of HEV screening utilising an ID-NAT-based donor screening algorithm compared to MP-NAT in pools of 96 samples. From November 2017 to January 2018, a total of 10,141 blood donations were screened for the presence of HEV RNA using a MP-NAT (in house, RealStar HEV RT-PCR Kit) and an ID-NAT (cobas 6800 platform). Results: The review of the literature revealed a significant variation regarding the infectious dose causing hepatitis E. In the systematic case review, all components with a viral load (VL) greater than 5.00E+04 IU caused infection (definitive infectious dose (DIFD) . The lowest infectious dose resulting in TT-HEV infection observed in general was 7.05E+03 IU (minimal infectious dose (MIFD). The infectious dose of the different blood products is mainly influenced by the remaining plasma content. Our data comparing the two different HEV screening algorithms revealed eight HEV RNA positive donations using a MP-NAT (incidence 1:1,268) , whereas 17 HEV RNA positive donations were identified by ID-NAT (incidence 1:597); all ID-NAT only positive donations had VL < 25 IU/ml. Summary/Conclusions: Taken into account the current knowledge on the required MIFD, the DIFD, and the analytical sensitivities of the screening methods, we extrapolated the detection probability of HEV-RNA positive blood donors using different test strategies (NAT assay, ID vs. minipool with different pool sizes). We also considered the amount of plasma in the different blood products and calculated the infectious doses needed to be detected. Only ID testing would be sufficient to detect the minimum VL in the donor to avoid TT-HEV infections based on the currently known MIFD, but a highly sensitive MP-NAT should be adequate as a routine screening assay to identify high viremic donors and avoid TT-HEV infections based on the DIFD. We have also determined that the incidence of HEV infection was approximately 50 % higher if ID-NAT was used. However, VL were below 25 IU/ml and will most likely not result in TT-HEV infection taken into account the currently known MIFD or DIFD. The clinical relevance of and need of identification of these low level HEV positive donors still require further investigation.

In the last 25 years several pathogen inactivation (PI) technologies have been developed to be applied to blood components. Technologies for inactivating pathogens in plasma and platelets are available in the European Union, and some others are currently under development. The first PI technology introduced in the market was for plasma, and was based on the addition of methylene blue and the illumination with light (Theraflex MB-Plasma, MacoPharma and Gr ıfols). For platelets and plasma two technologies are licensed, one is based on the addition of amotosalen and the illumination with ultraviolet light (UV) (Intercept â , Cerus) and the other one combines the addition of riboflavin (vitamin B 2 ) and the illumination with UV light (Mirasol â , Terumo BCT). Currently another technology for platelet inactivation, based on the illumination with UVC light and strong agitation is under development (Theraflex, MacoPharma). For red blood cells one technology based on the addition of one molecule (amustaline, Cerus) is being developed. The mechanism of action, and the spectrum and level of inactivation of pathogens varies among the different technologies. In addition, the number of studies with clinically relevant endpoints and the number of patients included in the studies is not homogeneous. There is published evidence for most of them that show that the treated blood components are safe and efficacious for the patients although, for treated platelet concentrates some decrease in the posttransfusion recovery and survival of the transfused platelets occur, with differences between the different technologies. However, cumulative experience on the use in routine, for some of the technologies for almost 20 years, support the concept of the safety and efficacy of the blood components treated with pathogen inactivation technologies without a significant increase in utilization. The use of pathogen inactivation for blood components is not widespread. Differences in epidemiology between countries, infectious risk perception, concerns about potential adverse effects associated with its use and economical considerations might explain the differences observed in its implementation. The history of the P1 and P k antigens is complicated and sometimes confusing because of several changes to the nomenclature. The association between the antigens and their genetic home has raised many questions as well as the longstanding enigma regarding the molecular mechanism underlying the common P 1 and P 2 phenotypes. The system (ISBT no. 003) currently includes three different antigens, P1, P k and NOR. The P1 antigen was discovered already in 1927 by Landsteiner and Levine while P k and NOR were described in 1951 and 1982, respectively. As for the ABO system, naturally-occurring antibodies of IgM and/or IgG classes can be formed against the missing P1/P k carbohydrate structures. Anti-P1 is usually a weak and cold-reactive antibody very rarely implicated in hemolytic transfusion reaction (HTR) or hemolytic disease of the fetus and newborn (HDFN). However, some antibodies against P1 have been reported to react at 37°C, bind complement and cause both immediate and delayed HTRs. The P k antibodies can cause HTR and anti-NOR is regarded as a polyagglutinin with unknown clinical significance. A higher frequency of miscarriage is seen in women with the rare phenotypes p and P 1 k /P 2 k .

The RBC of the fetus as well as of the newborn express low amounts of P1, P and P k antigens but the placenta shows high expression and is consequently a possible target of the antibodies and the cause of the miscarriages. The P k and P1 antigens have wide tissue distributions and can act as host receptors for various pathogens and toxins. Furthermore, altered expression of P k antigen has been described in several cancer forms. A longstanding question has been why individuals with p phenotype not only lack P k and P expression but also P1. Recently it was clarified that the same A4GALTencoded galactosyltransferase synthesizes both the P1, P k and NOR antigens and in addition the P 1 and P 2 phenotypes was confirmed to be caused by transcriptional regulation. Transcription factors bind selectively to the P 1 allele in the 5'-regulatory region of A4GALT, which enhance transcription of the gene. It has been debated whether the P k and P1 antigens exist on glycoproteins in the human RBC membrane or if glycolipids are the only membrane components carrying these epitopes. A recent publication shows that the P1 antigen can be detected on human RBC glycoproteins and thus glycosphingolipids can no longer be considered as the sole carriers of the antigens. The blood group system which started out with one antigen, P1, has now gained two more members namely P k and NOR.

Step by step the biochemical and genetic basis underlying the antigens expressed in this system has been revealed but still many questions remain to be solved. Neither GATA1 nor KLF1 represent a blood group system but mutations in the genes encoding these transcription factors (TFs) have been shown to result in simultaneous altered expression of blood group antigens in certain rare blood group phenotypes. In particular, mutations in the KLF1 gene are responsible for the dominantly inherited In(Lu) phenotype, commonly referred to as Lu(a-b-) because of the gross reduction in Lutheran antigens expression. Red cells from In(Lu) individuals, though, have also weakened expression of other blood group antigens, like the high-incidence antigen AnWj, the antigens of the Indian blood group system (CD44) and P1, among others. Since the first description of KLF1 variants associated with the In(Lu) phenotype, many other variants of this gene have been reported with an impact on blood group antigen expression and they are listed on the KLF1 Table of Blood Group Alleles. Other than KLF1, a mutated GATA1 gene has also been found associated with the X-linked form of the Lutheran-mod phenotype and has likewise been registered in the GATA1 Allele Table. Besides the effect of TF variants on blood group antigen expression, there are transcription factor-binding site polymorphisms in regulatory regions of blood group genes, which also have an impact on the expression of the encoded antigens in red cells. The first example of such type of polymorphisms was described in 1995, when the disruption of a GATA motif in the ACKR1 gene promoter was found to abolish erythroid gene expression in Fy(a-b-) individuals of African descent. The impact of mutations affecting GATA1 binding sites has also been described in some ABO subgroups, like the Am and Bm phenotypes. A regulatory element with GATA binding sites in the first intron of the ABO gene has been found to be altered in individuals with these phenotypes, either by deletion or by a point mutation disrupting the GATA motif. Recent findings have also revealed that Xga expression on red cells is dependent on GATA1 binding to a control element located 3.7 kb upstream of the XG gene. A single nucleotide polymorphism (SNP) within this region was shown to correlate very well with the expected distribution of the Xga negative phenotype in different populations. Further work has demonstrated that this G>C SNP disrupts a GATA1 binding site and consequently abolishes erythrocyte Xg expression. Overall, these investigations have allowed to elucidate the underlying genetic basis for Xga expression and have made Xga genotyping possible. Similar to Xga, the P1 antigen has been known for a long time to be determined by the A4GALT gene but the molecular basis underlying the common P1/P2 phenotypes has remained elusive till recently. Several cis-regulatory SNPs had been identified in non-coding sequences around exon 2a, which showed a very good correlation with P1 antigen expression. Interestingly, potential binding sites for several hematopoietic TFs were identified in the same region. Finally, recent investigations have demonstrated the role of the RUNX1 TF in the expression of P1 antigen, by selective binding to a regulatory site present in P1 but not in P2 alleles. To summarize, variation in blood group antigen expression may result from mutations or polymorphisms in the regulatory region of blood group genes. Recent reports have unravelled the molecular mechanisms underlying the expression of P1 and Xga blood group antigens, which involves TF binding to allele-specific regulatory elements. Similar mechanisms may also regulate antigen expression in other blood group systems.

2C-06-03

Clinical Immunology, Copenhagen University Hospital, Copenhagen, Denmark

Since the discovery of cell-free fetal DNA (cffDNA) in pregnant women's blood, the development of noninvasive prenatal testing (NIPT) has provided new diagnostic applications in prenatal care. In transfusion medicine and clinical immunology, cffDNA is extracted from maternal plasma to predict fetal blood groups with the purpose of 1) guiding targeted Rh prophylaxis in non-immunized RhD negative women and 2) assessing the risk of hemolytic disease of the fetus and newborn (HDFN) in immunized women. I will give an overview of noninvasive prenatal testing of fetal blood groups. Based on the literature, I will summarize the current experience with noninvasive prenatal testing of fetal RHD and other blood groups. For RhD negative pregnant women, routine clinical testing is available in several countries world-wide to assess the risk of HDFN in D immunized women, and routine testing to guide Rh prophylaxis is now implemented as nationwide service in 6-7 European countries. Noninvasive prenatal testing for fetal RHD is highly accurate with sensitivities of 99.9%, as reported from clinical programs. In general, the sensitivity is challenged be low quantities of cffDNA, especially in early pregnancy. The specificity is challenged by the polymorphic Rh blood group system, where careful attention is needed to navigate among the many RHD variants. RHD variants may complicate cffDNA analysis and interpretation of results, especially in populations with mixed ethnicities. Despite these challenges, fetal RHD testing is very feasible when implemented with careful attention to these issues. For blood groups that are determined by SNPs, such as KEL or Rhc, the main challenge has been interference from the maternal DNA when analyzing the fetal DNA which has resulted in low accuracy and lower sensitivity, when using qPCR. With the application of more novel techniques such as next generation sequencing and droplet digital PCR, accurate noninvasive prediction of these fetal blood groups has been demonstrated. The success of predicting fetal RhD and its successful clinical implementation into national programs should encourage wide-spread use of cell-free DNA based analysis. Future work on noninvasive prenatal testing of fetal blood groups determined by SNPs may consolidate the application for cell-free DNA testing for such targets, including human platelet antigens. At ISBT, the newly formed cfDNA subgroup of the Red Cell Immunogenetics and Blood Group Terminology Working Party will work to facilitate clinical applications, implementation and evaluation of cell-free DNA testing. Blood banks in most of the Nordic countries all share a vein-to-vein approach which in short means that the collection of blood, the preparation of blood components, testing/release and storing is served by a single actor. On top of that recipient and donor blood grouping, crossmatching, delivery, registration of transfusion and of any complications is usually handled in a single blood banking information system (BBIS). This means that blood banks in the Nordics are traditionally operated by a single vendor.

The needs for process control in a single vendor BBIS, the present solutions, unsolved challenges and untapped possibilities of streamlining processes have been scrutinized with the intention to describe separate processes and to acquire best of breed or best of suite IT-systems. The aim for integrations, rather than building an integrated IT-system, to support the need for a vein-to-vein process is a precondition in the Nordic countries.

With multiple IT-systems supporting isolated processes, we intend to facilitate development in these and furthermore increase the flexibility in the whole process.

We set out to reveal any existing knowledge in the literature on IT vendor strategies for blood banks, but we didn't succeed in identifying any relevant literature. However, a systematic literature study on vendor strategies when choosing Health IT was based on the PRISMA method, and identified 837 studies, but only 10 was eligible for full text review and 5 met the inclusion criteria. Even this broader literature study reveals very little evidence. Two studies find single vendor strategies poor and conclude "best of suite" solutions to be optimal. One study was not able to correlate vendor strategies to the investigated productivity, but concludes that best of suite and best of breed strategies requires larger organizational changes than a single vendor strategy. In summary, the existing research is contradictory. This paper adds basic knowledge for breaking down the process control of blood banking in smaller processes. This adds the possibility for identifying best of breed or best of suite vendors, instead of relying on single vendor IT solutions. Furthermore it is a call for more research in the field of vendor selection strategies which this study didn't succeed in identifying.

2D-07-02 APPLYING DRONES TO SUPPLY BLOOD TO REMOTE AREAS: RWANDA'S EXPERIENCE

Biomedical Services, Rwanda-Ministry of Health-National Blood Services, Kigali, Rwanda

Background: In Rwanda, blood transfusion services started in 1976. During the 1994 genocide against the Tutsis almost all the socioeconomic fabric of Rwanda was destroyed as well as its health infrastructure. The healthcare system was suffering in its aftermath, and there were health inequalities between urban and rural areas, including access to blood for transfusion. From 1995, the government started to rebuild all courses of life including the health system and the blood service in particular. The National Center for Blood Transfusion (NCBT) was then mandated to provide safe, effective and adequate blood and blood components to all patients in need. This was pivotal in achieving health related MDGs 4, 5 and 6. Today, Rwanda has an ambitious vision to put all 12 million citizens within 30 minutes of any essential medical product. While every second matters in emergency management, the use of Drones was the perfect solution to many of the last mile challenges that have been traditionally difficult to overcome. It is impossible to forecast accurately down to the need of a single patient. The Government has provided an easy solution by centralizing supply and providing on-demand, emergency medical deliveries by drone. Doctors are now empowered to provide the quality care with all the supplies on hand, patients can now be treated close to home, and we eliminate waste from potential overstocking when health workers know that they have a quick and reliable source of supply.

Description: In 2016, the Government of Rwanda started to operate the world's first national drone delivery program for blood and other lifesaving medical products. These drones can carry two to six units of blood at a time and deliver in 15 -45 minutes depending on a hospital's location. The average duration was between 2 -4 hours round trip with the vehicle system, before the use of Drones. Drones currently deliver blood to 25 health facilities throughout the country and are set to reach 90% of transfusing health facilities outside Kigali by the end of the year. Within the first year, Healthcare workers saved an average of 3.1 hours per delivery and a total of 10,115 hours of lost time on road pick up they could instead dedicate to patient care. By March 2019, over 11,000 deliveries have been made, with 30% of those being emergency deliveries. A total of more than 19,500 blood units have been delivered. In February 2018, Zipline obtained the highest rating from the health facilities being served in a performance evaluation conducted by the National Center for Blood Transfusion. When a doctor or medical staffer needs blood, they place an order through the Hemovigilance order portal. They are then sent a confirmation message saying a drone is on its way. The drone flies to the health facility at up to 100 km/h. When it is within five minutes of the destination, the medical staffer receives a notification. The drone then drops the package, attached to a parachute, into a special drop zone. Conclusion: Supply is not a developing country problem, it is a global issue. Rwanda was just the first one to recognize the potential of this technology and decided to do something about it first and fast, to ensure access to universal access to all blood products.

2D-07-03

Scottish National Blood Transfusion Service, Edinburgh, United Kingdom

Supporting the provision of viable transfusion services in remote/rural areas is more than just a geographical challenge. Limited qualified blood bank resource; small throughput volumes; increased regulation are only three of the additional factors combining to threaten safe and sustainable transfusion service delivery. Inventory management and out of hours service provision were identified as essential areas where it was thought that technology, in the form of a remotely controlled blood fridge, could provide a key element of the overall solution. A Radio Frequency Identification (RFID) fridge racking system was installed in a standard blood bank fridge and connected to the Laboratory Information Management System (LIMS) common to both the remote and central blood bank. The central blood bank was enabled to test patient samples from the remote laboratory, identify components located in the remote fridge suitable for the patient and allow correct component issue, even when qualified staff were unavailable in the remote laboratory. Testing has concluded that installation of remote fridge management can play a major role in helping to maintain a remote inventory permitting patient compatible components to be issued. By sustaining transfusion services in remote communities we can avoid transportation of patients who require transfusion support to locations miles from home.

Antibodies to HNA-1b, FcgRIIIb and HNA-2 have been reported, too. Neonatal alloimmune neutropenia results from maternal antibodies transferred transplacentally to the fetus and is caused by all known HNA-antibody specificities, i.e. HNA-1a, -1b, -1c, -1d, HNA-2, HNA-3a, -3b, HNA-4a, -4b and HNA-5a specificity. HNA and HLA antibodies can induce mild febrile transfusion reactions and TRALI. Since the introduction of the male only plasma strategy, in many countries the TRALI incidence decreased but it is still one of the most common causes of severe transfusion reactions. Especially HNA-3a antibody containing plasma from female donors is responsible for severe or even fatal reactions. But also HNA-1a, -1b, HNA-2 and HLA class I and class II antibodies were reported. The latter activate monocytes to secrete soluble factors that act on the primed neutrophils in the narrow lung capillaries. Laboratory testing: Laboratory work-up requires the knowledge of the patient's clinical condition and the methods that are appropriate to detect the relevant antibodies.

The classical granulocyte agglutination test (GAT) in combination with the granulocyte indirect immunofluorescence test (GIFT) can detect nearly all relevant antibodies. HNA-1, -2, -4, -5 and HLA class I antibodies are clearly detectable in the GIFT while HNA-3 antibodies strongly agglutinate neutrophils in the GAT. The monoclonal antibody-specific immobilization of granulocyte antigens (MAIGA) test detects all HNAantibodies except for HNA-3 with high glycoprotein specificity and sensitivity but is time consuming and requires highly skilled personnel. For TRALI diagnostics laboratory testing is completed by methods like the indirect lymphocyte immunofluorescence test (LIFT) or ELISA for HLA class I antibodies and HLA class II specific ELISAs.

Since several years fluorescent bead based assays (Luminex) enable faster and more automated HNA antibody detection but to date not all specificities, especially HNA-3, can be reliably detected so that still the classical GIFT and GAT have to complete the methodological spectrum. Serological typing today is mostly reduced to the determination of HNA-2 in the GIFT because the molecular reason for the HNA-2-null phenotype is not completely understood. Establishing only one PCR-ASP reaction for the main CD177*787A>T polymorphism would comprise the risk to miss other molecular causes. However, for all other HNA allelotyping by PCR methods is the first choice. Summary/Conclusions: Granulocyte serology still today is widely based on a variety of manual methods and will be reserved to specialized laboratories as it requires experienced laboratory staff and profound knowledge of granulocyte immunobiology.

2D-08-02

Norwegian National Unit of Platelet Immunology, Laboratory Medicine, University Hospital of North Norway, Tromso, Norway

Maternal alloantibodies against antigens on human platelets can cause severe thrombocytopenia and bleeding in fetus or newborn, identified as Fetal/Neonatal Alloimmune thrombocytopenia (FNAIT) . Although most cases the thrombocytopenia is selfresolving within the two first weeks of life, some infants present bleeding symptoms and thus require platelet transfusion. A set of laboratory analyses are required to confirm the FNAIT diagnosis. In addition to guiding compatible platelets to the affected newborn, the correct diagnosis will be valuable to assess the risk of FNAIT in subsequent pregnancies.

In addition, platelet alloantibodies may also complicate platelet transfusions by immune-mediated platelet refractoriness, and require proper identification of the patient's antibody specificities prior to selection of donor platelets. The algorithm for laboratory investigations include both serological and molecular assays, and depend on the objective and timing: whether there is an urgent need for platelet transfusion, follow-up of a pregnancy with known risk, or to do full-scale laboratory testing to confirm diagnosis. Molecular genotyping should include all HPA systems relevant for the local population (in Caucasians HPA-1, -2, -3, -5 and -15), preferably with optional extended panels for systems for low frequency populations due to immigration/mobility and for less frequently seen alloantibodies (HPA-4, -6 to -11 are most commonly included). Serological testing of antibody binding to platelets is often initially tested by flow cytometry analysis (direct test and/or cross-match). However, the detection of platelet-specific antibodies is often complicated by the presence of anti-HLA class I antibodies and thus require sensitive platelet glycoprotein-specific assays. Serological testing for platelet-specific antibodies includes as a minimum panels of antigens on GPIIb/IIIa, GPIb/IX, GPIa/IIa and CD109 and preferably additional targets for populations with Asian/African origin. Several methods are available; i.e. bead-based assays and ELISA based methods. However, most reference laboratories perform variants of the monoclonal antibody immobilization of platelet antigens assay (MAIPA), as reported by the 19th International Platelet Immunology

Workshop of ISBT (2018) . The investigations also include measurement of the anti-HPA-1a by quantitative MAIPA if present, as this is reported to potentially predict the severity of FNAIT. For pregnancies with known risk of FNAIT, there are methods available to perform non-invasive prenatal typing from maternal plasma. The most feasible and so far appropriate for routine testing is fetal HPA-1 typing with quantitative PCR or by melting curve analysis. Other sophisticated, yet resource-demanding techniques have also recently been reported -importantly also for typing of other HPA-systems.

2D-08-03 MOLECULAR BASIS OF HNA-2 EXPRESSION

Justus Liebig University, Institute for clinical immunology and transfusion medicine, Giessen, Germany

Human neutrophil antigen 2 (HNA-2) is a neutrophil-specific antigen located on GPI-anchored glycoprotein CD177 (also known as NB1). HNA-2 is absent on the neutrophil surface of 3-5% of the healthy individuals that divided the population to HNA-2 positive and HNA-2 null individuals. Exposure of HNA-2 null individuals to HNA-2 positive neutrophils during pregnancy, after transfusion or transplantation, induces immunization against HNA-2 and consequently the production of iso-antibodies. The HNA-2 iso-antibodies are involved in the mechanism of neonatal alloimmune neutropenia (NAIN), transfusion-related acute lung injury (TRALI) and graft failure following bone marrow transplantation. Presence of CD177 on a neutrophil surface of HNA-2 positive individuals follows a bimodal expression that categorizes the circulating neutrophils to HNA-2 positive and negative subsets. The CD177 gene contains 9 exons encoding a protein of 437 amino acids. The lack of HNA-2 (in HNA-2 null individuals) is associated with the presence of a missense mutation, CD177*c.787A>T in exon 7 of CD177 gene inducing a premature stop codon in codon 263. This mutation alone or in combination with CD177*c.997delG has been introduced as the main reason for the absence of CD177 in HNA-2 null individuals. A pseudogene (CD177P1) highly homologous to exons 4-9 of CD177 gene is located downstream of the CD177 gene. Conversion of exon 7 of CD177P1 into CD177 gene is responsible for the generation of CD177*c.787A>T missense mutation. In addition, the heterozygosity or homozygosity of CD177*c.787A>T is accounted for regulation of HNA-2 negative and positive neutrophils subpopulations. Genotyping has revealed the HNA-2 null individuals, heterozygous for CD177*c.787A>T mutation without CD177*c.997delG, indicating the presence of a complementary mechanism regulating CD177 expression. Newly in HNA-2 null individuals and individuals with atypical CD177 expression a CD177*1291G>A polymorphism in combination with CD177*787A>T is described.

Altogether these data indicate a complex compound mechanism(s) for regulation of CD177 expression on the neutrophil surface. This presentation will summarize recent findings on CD177 expression and highlights the potential genotyping methods for genetic assessment CD177 expression of donors and patients.

blood products ordered, transfusion start and end times, whether patients experienced a reaction to the transfusion as well as vitals measurements taken before and during the transfusion, including temperature, oxygen level, blood pressure and heart rate. For the validation process, 100 transfusion nursing notes were sampled and reviewers assessed the accuracy of the information regarding 1) blood product ordered, 2) whether the patient experienced a reaction, and 3) the start and end times of the transfusion. For each of these fields across all 100 sampled notes, the ClarityNLP tool reproduced these data points with 100 percent accuracy. In addition, the tool supplied transfusion end times for numerous structured records that were missing this key data point. Summary/Conclusions: ClarityNLP can very efficiently digest a large number of transfusion nursing notes simultaneously and also does an excellent job of extracting the main characteristics of a transfusion, which can be used in partnership with structured data to produce a more accurate and more complete picture of patient transfusions. Immunohematology and Genomics, New York Blood Center, New York, United States

Antibody-based typing, with a positive result reflected in agglutination of the red cells (RBCs), has served the profession for nearly a century enabling safe and effective transfusion therapy. The power of RBC typing by serologic methods lies in the availability of standardized antibody reagents which target many of the specificities of significance for transfusion, and the ability to directly detect antigen expression on the RBCs. Hemagglutination has historically been relatively inexpensive, particularly for ABO and RhD as the most important blood groups in most populations. Serologic RBC typing is reliable, requires no sophisticated equipment, is generally straightforward to perform, and is fast requiring less than 1 h to results. Hence, antibody-based testing has been considered the "gold standard" for blood group typing.

With the age of genomics, DNA-based genotyping is increasingly being used as an alternative to antibody-based methods. Most antigens are associated with single nucleotide changes (SNPs) in the respective genes. Genotyping has been validated by comparison with antibody-based typing and has been shown to be highly correlated.

The power of genotyping of RBCs lies in the ability to test for antigens for which there are no serologic reagents, and to type numerous antigens in a single assay using automated DNA-arrays. This increases accuracy and weak antigen expression can be revealed. Fresh RBC samples are not required for DNA extraction, and there is no interference from transfused RBCs or IgG bound to the patient's RBCs. DNAbased typing is economical in that it provides much more information, but testing requires special equipment, training, and 24-h turn around. What then is the best approach to use? Will serologic typing be replaced by DNAbased typing? Indeed, genotyping will increasingly be used in the practice of transfusion medicine, especially with the growth of whole genome sequencing (WGS). However, because serologic typing for ABO and RhD is fast and accurate and often relied on for sample identification, genotyping will not be the sole means for routine typing. Genomic sequencing approaches will certainly reveal unrecognized changes and genetic variability in RBC membrane proteins, but not all variation will be immunogenic. A genetic polymorphism must be associated with antibody production to be considered a blood group antigen. The importance of an antibody, and antibody reactivity, then will continue to be the central defining principal in transfusion. As two sides of a coin, both are key to safe and effective transfusion therapy. Since the mid-1980s, research in the molecular basis of structural and functional aspects of proteins carrying and producing the antigens has led to an upgraded and modern understanding of blood group variation. Most commonly, single nucleotide polymorphism (SNP) based basic molecular typing techniques were utilized to test new findings on a smaller subset of samples, and resulted in concordant sero-and genotyping results in general. However, quite commonly a small number of all samples delivered discrepant results, triggering consecutive rounds of analysis and resolution, finally resulting in a better knowledge with respect to the underlying blood group variation. Such rounds of repetitions represented the synergistic incremental process of learning, learning for serologists and molecular biologists. Inheritance of public, presence of high frequency, or low frequency, or partial antigens and notice of weakly expressed, or almost undetectable antigens marked the path of incremental learning and may best be exemplified by discoveries within the blood group systems ABO, RhD and Kell. Naming for pheno-and genotypes coevolved alongside the permanent discovery of new antigens. At present, antigens and their antithetic counterparts (if tested and if existent), are more commonly reported independently, as exemplarily shown for the following Kell phenotype consisting of three antithetic antigen-couples: kk, Kp (a+b+), Js(a+b+). Alternatively, the same phenotype could be stated as: KEL:-1,2,3,4, (5),6,7. Genotypes, on the other hand, rather mirror the actual biological background, e.g. display the two parental alleles (or "haplotypes") present in an individuals' sample. Genotype of the above mentioned example would read: KEL*02.03/ 02.06 (italicized). In an idealized diagnostic environment and for most blood group systems encoded by proteins, every single blood group allele would be defined by its full genomic sequence, derived from one parental chromosome (including "some" 5'and 3'-untranslated regions). Thereby, every such "ideal allele" would fully declare presence or absence of all its public, low-and high-frequency antigens and possess its "ideal name". By trend, biallelic SNPs and their immediate relation to antithetic antigen couples might have distracted from the originally intended meaning of "blood group alleles", more recently. Finally, genotypes only dependent on (ideal) allele names, and considering Mendelian inheritance patterns (dominant, recessive), would allow for fully comprehensive phenotype predictions. More recently, blood group serology, e.g. the "second side of the coin", seems to gain momentum. Since the advent of whole genome sequencing and access to many more than 1000 human genomes, it seems that dozens of new blood group alleles are discovered, almost on a daily basis. Beside the challenge of naming this multitude of alleles, respective discoveries are frequently made in samples lacking any phenotypic blood group pre-values. Clear procedures will be needed to address naming and analyzing the phenotypes resulting from previously unknown alleles. As a consequence, questions asked 30 years ago have changed: Today, molecular biologists looking at hundreds of newly discovered blood group alleles find themselves not being asked by serologists any more: "Can you confirm my serology?", but instead, pose their question to the experts for the blood group phenotype: "Can you confirm my genotype?"

3A-S02-03

Background: The screening of blood donors and returning travelers from active transmission areas have highlighted the importance of diagnosis of acute arboviral infections. In the context of co-infections and similar clinical signs in endemic zones, the differential diagnosis of arboviruses is essential to discriminate the causative agent. The detection of viral nucleic acids in serum or plasma provides a definitive diagnosis, however, in most instances, viremia is transient within less than two weeks after the onset of clinical illness. In addition, the cross reactivity due to the high degree of structural and sequence homology between ZIKV and other flaviviruses is a significant concern. The combination of molecular (identification of viral genomes) and immunological assays (detection of the immune response) is a key challenge to follow the natural history of these infections and to improve the patient management and the epidemiological surveillance. Aims: In this context, we have developed an innovative platform based on agglutination of superparamagnetic nanoparticles (NPMag) covalently grafted either with nucleic or proteic probes to face the continuing emergence of arboviruses. Methods: Dengue (DENV) and ZIKA (ZIKV) viruses are selected as models in this study. A pan-flavivirus RT-PCR is used for the molecular assay to amplify the viral genomes. Then, biotinylated viral amplicons are captured specifically on complementary original polythiolated probes coated on NPMag. For the immunological assay, NPMag are grafted with viral NS1 proteins to capture anti-DENV or anti-ZIKV antibodies potentially present in the plasma samples. Both tests are performed in disposable cuvettes in a homogeneous format. A magnetic field generated by an electromagnet is applied to the reaction medium to align the NPMag into chains to enhance the capture of the targets between two NPMag. Aggregates formed are detected when the field is turned off. The optical density is measured in real-time at 650 nm during several cycles of magnetization / relaxation. Results: In this study, molecular analytical performances were evaluated on human samples from blood donors with no history of infections as negative controls, on viral standards and on clinical samples. Using viral references standards, we have observed sensitivities of 10 -10 2 TCID 50 /mL for ZIKV and DENV (serotypes 1/2/3/4) after a detection phase of around 5 min. The first results obtained on 16 ZIKV (+) clinical samples previously tested by commercial real-time PCR (Ct < 36, Altona) showed an 88 % correlation between the two detection methods. No false positive results or cross reactions were observed. Concerning immunological assays, commercial human plasma from donors tested positive for DENV or ZIKV antibodies were detected positive with our innovative approach in less than 10 min (sampling + detection) instead of 2 h with classical ELISAs. Further assays on clinical samples are planned to confirm these preliminary results. Summary/Conclusions: This innovative strategy combining molecular and immunoassays on the same analytical platform offers new opportunities for rapid blood testing to improve the surveillance and the prevention of arboviral infections.

Background: Zika virus (ZIKV) caused a dramatic epidemic in Puerto Rico (PR) during 2016, with up to~2% of blood donors reactive for ZIKV RNA in ID-NAT testing at the peak in June 2016. Aims: Perform a serosurvey for anti-ZIKV IgG using six panels of 500 donor specimens each collected in March 2015, at the beginning, peak and end of the 2016 epidemic, and from March 2017 and April 2018. Methods: We employed a commercially available ZIKV IgG ELISA antibody (Ab) assay based on the ZIKV NS1 antigen from Bio-Techne to characterize ZIKV seroprevalence in the 6 9 500 cross-sectional sample sets (anonymized with selected demographic information). Results: 500 PR donor samples collected in April 2015 were initially evaluated using the manufacturer supplied cut-off to confirm that the ZIKV Ab results were largely negative (3 positive, 3 equivocal) despite the high dengue virus seroprevalence (>90%) in PR that could potentially lead to false positive ZIKV Ab results. We then used this dataset, together with known positives collected 1-3 months postdetection from ZIKV NAT yield donors, to set a population-specific cut-off based on receiver operating characteristic (ROC) curve analysis. This cut-off yielded sensitivity and specificity values of > 99%, and an area under the curve (AUC) of 0.999, demonstrating a highly accurate assay. We used this new cut-off to calculate final rates of seroreactivity in the additional 5 sample sets (2500 samples) and estimate seasonal incidence. Rates of reactivity, together with mean net OD for only the reactives (shown in parentheses), were calculated for each sample set: Background: Sex hormone intake in blood donors occurs in three demographic groups: premenopausal women who take contraceptive drugs (progestins with or without estrogens), postmenopausal women who receive estrogen replacement therapies that may be combined with progestins, and testosterone therapies in men. We hypothesized that sex hormone therapies may modulate the quality of red blood cell (RBC) products via alterations of RBC function and predisposition to hemolysis during cold storage. Aims: The objectives of this study were to evaluate the association between sex hormone intake and RBC measurements of hemolysis, and to examine possible mechanisms by which sex hormones interact with RBCs. Methods: Self-reported sex hormone intake and menstrual status were evaluated in 6,636 female blood donors from the National Heart, Lung and Blood Institute's RBC-Omics study. The associations between hormone intake and donor scores of spontaneous storage, osmotic, or oxidative hemolysis were determined in all women and by menstrual state. The interactions between sex hormones and RBCs were determined by sex hormone (progesterone, 17b-estradiol, or testosterone) potency to inhibit calcium influx or hemolysis during incubations or cold storage. The calcium fluorophore, Fluo-3AM, was used to define RBC calcium influx in response to treatments with sex hormones or drugs that modulate transient receptor potential cation (TRPC) channel activity including Hyp9 (a selective TRPC6 activator).

Results: Sex hormone intake by menstrual status was higher in premenopausal women (25.3%) than in postmenopausal women (7.4%). Female hormone intake was significantly (all P < 0.0001) associated with reduced storage hemolysis in all females (0.32 AE 0.16% versus 0.35 AE 0.29% in controls), enhanced susceptibility to oxidative hemolysis (37.9 AE 9.3% versus 35.8 AE 9.9% in controls), and reduced osmotic hemolysis in postmenopausal women (23.1 AE 10.2% versus 26.8 AE 12.0% in controls). In vitro, supraphysiological levels of progesterone (10 or 20 lmol/L), but not 17b-estradiol or testosterone, inhibited spontaneous or Hyp9-induced calcium influx into RBCs, and were associated with lower spontaneous hemolysis after 30 day cold storage (0.95 AE 0.18% versus 1.85 AE 0.35%, progesterone 10 lmol/L versus solvent control (dimethyl sulfoxide, 0.1%), P < 0.0001). Co-incubations (2.5 h, 37°C) of RBCs in the presence of progesterone and a TRPC6 activator (Hyp9, 25 lmol/L) suggested that progesterone protected against Hyp9-induced hemolysis (1.45 AE 0.13% and 1.01 AE 0.09% versus 2.63 AE 0.19%; Hyp9 + progesterone at 10 or 20 lmol/L versus Hyp9 alone, P < 0.05 by one-way ANOVA). Summary/Conclusions: This study revealed that sex hormone intake in blood donors is capable of modulating RBC predisposition to hemolysis and led us to propose new mechanistic pathways by which progesterone regulates calcium influx and hemolysis in human RBCs. Pre-and postmenopausal women respond differently to hormone intake and its effects on RBC responses to osmotic or oxidative stress. Progesterone modulates calcium influx into RBCs via a mechanism that may involve interactions with membrane TRPC6 channels, activation of which is associated with pre-hemolytic events such as senescence and eryptosis.

3A-S05-01

International Cooperation, Swiss Red Cross, Wabern, Switzerland

Background: Red Cross and Red Crescent Societies were playing an important role in setting up blood transfusion establishments in many low resource countries. By the mid-1970s, the Red Cross was active in the national blood programs in approximately 95% of countriesmostly in blood donor recruitment and education. Today, major organizational developments in blood transfusion services were made in high income settings, where nearly 50% of all worldwide donations take place (home to only 17% of the population). WHO data shows that the median annual blood donation rate in high-income countries is 3.21% of the population compared to 0.46 % in low-income countries. The factors for this low turnout are multilayered, but it is well-known that most resource poor settings suffer from a low rate of regular donors and challenges to set-up and financially sustain a national blood donor program. The Red Cross and Red Crescent (RC) Societies assume a key role by reaching and retaining donors from the communities and contribute significantly to better safety and availability of blood. Partnerships and international collaboration, such as the Swiss Red Cross (SRC) program, are aiming to strengthen national structures to improve blood safety and to face today's epidemiological, demographical, and technological challenges. Aims: The present work aims to review the role, the mandate and the impact of RC Societies in improving blood safety through systematic "Voluntary Non-Remunerated Regular Blood Donor" (VNRBD) programming and international partnerships.

Methods: Data and evidence is drawn from the SRC International Cooperation projects over the last 30 years, more specifically partnering with three RC Societies, and the data from the Global Advisory Panel (GAP) of the IFRC including their 2018 Global Mapping.

Results: The promotion of VNRBD has been a specific objective in all SRC supported programs. Through the engagement of the RC Society, the training of volunteers and partnering with the health authorities, the projects significantly increased the blood donor rate by recruiting and retaining donors from the communities. For example, the RC Societies increased total donations by 25 % in Lebanon; VNRBDs by 71% annually in Kirgizstan, and from practically zero to 3'588 in South Sudan. The importance of RC Societies was also underlined in the 2018 published global mapping of GAP, which showed that 36 (19%) of them provide level A (Full Blood Service), 75 (39%) are Level B (Systematic Blood Donor Recruitment) and 47 (25%) are level C (VNRBD Blood Promotion) blood services. GAP has also commenced a new three year VNRBD support program aimed at establishing tools and materials for National Societies. Summary/conclusions: The Red Cross / Red Crescent Movement has a unique mandate and position in improving global blood safety at all levels; with its huge network of volunteers, even blood donors in remote communities can be reached and retained. RC Societies in low resource settings with a Level B or Level C role should further capitalize on partnerships with local and international actors to leverage technical assistance and funding for their activities. Background: It is essential to motivate and encourage the public to donate blood and be eager to help saving lives, in order to maintain safe and adequate national blood supply. Aims: "Technical Assistance for Recruitment of Future Blood Donors (EuropeAid/ 132420/D/SER/TR)" project aimed to avoid problems in supplying the safest blood to contribute to the improvement of public health by (i) increasing the knowledge of primary and secondary school students regarding blood donation, (ii) creating sensitivity in school principals and teachers regarding voluntary non-remunerated blood donation (VNRD), (iii) motivating family members of the students for blood donation and (iv) creating public awareness through media.

Methods: An effective coordination is established between Ministry of Health (MoH), Ministry of National Education (MoNE) and Turkish Red Crescent (TRC). The existing curricula and textbooks of primary and secondary schools were reviewed and revised, and corresponding materials on the importance of blood donation were created. The human resources capacity of MoH, MoNE and TRC to support raising awareness on blood donation were developed. To raise public awareness on blood donation nationwide, education and recruitment campaigns on were organized in 500 pilot schools. Additionally, media and public relation campaigns on blood donation were organized throughout the country. Results: (1) Existing curricula and textbooks relevant to promoting blood donation were reviewed, revised and reported to the Board of Education of MoNE. (2) Corresponding educational materials for students and teachers were developed and distributed. (3) Blood Donation Clubs were established in 500 pilot schools. (4) Trainings were conducted for 688 personnel of MoH and TRC on blood donation regarding their responsibilities. (5) Cascade trainings were conducted for 3218 personnel of transfusion centers and 4399 school principals in 81 provinces. (6) Information seminars were delivered to 251.475 students and 15.739 teachers and family members of students during school campaigns. (7) Four animation films on blood donation were produced and broadcasted on the national TV channel (TRT). (8) Three different computer games targeting different age groups were developed and uploaded to the web portal of the project and distributed to the pilot schools. (9) Media spots were produced and broadcasted 3.851 times in 33 different TV and Radio channels. (10) Billboard posters and brochures were prepared and distributed to 81 provinces for raising public awareness. (11) Advertisements about the project and the importance of VNRD were displayed 386 times on national and local newspapers, 1.117 times on online news, and broadcasted on 6 national TV channels.

(12) During the campaigns, 28.310 units of whole blood were collected in pilot schools. (13) Visibility kits to recruit future blood donors are prepared and distributed throughout the project activities. (14) Awareness and knowledge level of students and their teachers/parents on the importance of blood donation are increased to 32.07 % and 35.99 % respectively, assessed through pretest and posttest. Voluntary non-remunerated donation rate of national demand increased from 73.66% to 82.54 in two years. Summary/Conclusions: Training and campaign programmes successfully increased the knowledge on blood donation. To achieve national self-sufficient safe blood supply, efforts for recruitment should be continued.

Background: Despite 70% of Pakistan's population being under 29 years, only 10% of blood supplies come from voluntary donors while remaining blood is collected from 'Family Replacement Donors'. In Pakistan the system has outsourced the mobilization of blood donors to the patient families. As a result many people reach out to their networks including on Facebook to locate blood donors. There are thousands of posts each month in Pakistan seeking blood donors on Facebook.

To facilitate needy families, the global social media giant Facebook launched a special blood donation Feature for Pakistan in collaboration with SBTP, Pakistan. The Feature makes it easier for people to sign up to become blood donors and helps connect these voluntary donors with people and organizations in need of blood. Similar Features have been launched by Facebook in India, Bangladesh and Brazil to address the problem of blood shortages in those countries. However, among these four countries Pakistan has unique position because of the existence of a national counterpart, SBTP which can facilitate Facebook in promoting its Feature and provide the feedback on the impact of this innovative effort for continuous improvement of the Feature. Aims: To promote voluntary blood donations and blood safety in Pakistan through Facebook.

Methods: The Facebook and SBTP teams launched a pilot to study the impact and effectiveness of the Facebook Blood Donation Feature as a tool of community engagement. A six months plan has been chalked out to measure the impact of this tool in five selected blood centres. A checklist called "P0 checklist" was shared with these blood centres to fulfill some basic requirements for an official blood bank page including a display picture, cover photo, contact information, directions, etc. Regular Skype meetings are held between the teams of SBTP, Facebook (San Francisco and Singapore) and the blood centres to monitor the progress of the Pilot and generate feedback. Results: The Facebook Blood Donation Feature has recorded remarkable success with over one million signups within few months in Pakistan. The blood centres participating in the Pakistan study have experienced enhancement in the voluntary blood donations trend with 3-10 walk-in donors and an average of more than 20 telephonic queries regarding voluntary blood donation per month in each center. The trend is gradually surging as the Feature is being refined on the basis of feedback received. The Pilot will end in June 2019. The statistics generated since January 2019 are very encouraging and underscore the importance of social media in reaching out to the untapped potential blood donors. The study will be used to plan an effective nationwide strategy to increase donor mobilization, recruitment and retention. Background: In our region, an increasing number of patients of African or Asian origin with sickle cell disease (SCD) or transfusion dependent thalassemia (TDT) require red blood cell (RBC) transfusions, and many have RBC alloantibodies. Selecting optimally matched RBC units for these patients is essential for preventing not only acute hemolysis but also further alloimmunisation. Beside antigen-matching for ABO, Rh D, C, c, E, e and K, patients with SCD and TDT should ideally receive RBC units matched also for M, S, s, Fya, Fyb, Jka and Jkb (extended phenotype). This is the policy at our center, which currently provides RBC products to 31 patients with hemoglobinopathies.

Because the vast majority of our blood donors are Caucasians, the selection of matched RBC units for patients of different ethnic origin can be difficult. Therefore, expanding the number of available African and Asian blood donors is becoming increasingly necessary. Aims: Hereby the recruitment strategy of non-Caucasian blood donors introduced at our center is described and the results obtained during six years are reported. Methods: Since 01.01.2013, whenever a first-time blood donor of non-Caucasian origin is registered, an alert is entered in the donor file to trigger the determination of the extended RBC phenotype along with routine testing. RBC antigen determination is performed in our laboratory with serologic methods. In selected cases (i.e. suspected RhD or RhCE variant), samples are sent for molecular analysis (SSP PCR). Rare RBC phenotypes relative to ethnicity are, among others, Fy(a-b-), S-s-, Lu(b-) and those with uncommon Rh phenotypes. If a rare RBC phenotype is detected, a coded comment is entered in the donor data and the donor is listed in the national Rare Donor File. Results: From 01.01.2013 until 01.03.2019, an extended determination of RBC antigens was performed in 352 subjects presenting for blood donation. Twenty-nine rare donors (8%) were identified and included in the Rare Donor File: 25 Fy(a-b-), 1 Lu (a-b-), 1 Lu(b-), 1 Fy(a-b-) and S-, 1 CCddee (r'r'). Overall, these 29 donors provided 105 RBC units (range . To date, all donors are still active and 14 are reserved for dedicated donations. The internal price of RBC antigen testing per donor is approximately 100. -CHF, resulting in a total financial effort of around 35,200.-CHF in the time since the project was started. Summary/Conclusions: In our experience, a "passive" recruitment of non-Caucasian blood donors based on ethnicity has an overall low efficiency from a logistic and financial point of view. Moreover, African and Asian blood donors may require investigations for hemoglobin variants and serology for malaria in addition to routine testing. Nevertheless, a targeted determination of extended RBC antigen phenotype does allow the identification of persons with rare phenotypes. Currently, measures for the active recruitment of potentially rare blood donors are being implemented at our center. After a pilot phase, a project for a nationwide recruitment strategy will be elaborated. A further goal is to build a national registry of patients with hemoglobinopathies requiring transfusions.

Blood transfusion is an essential treatment. Transfusion safety consists of several components. Although all are important, ion richer countries the order of priority is typically: 1.) Avoidance of transfusion transmittable infections; 2.) Quality of the blood product with a strong focus on component therapy; 3.) Prevention of severe transfusion reactions; 4.) Avoidance of clerical errors; 3.) Sufficient availability of blood.

The keynote of this lecture will be that the order of priorities on transfusion safety should probably be different in resource limited environments. 1.) Sufficient availability of blood and proper utilisation; 2.) Avoidance of transfusion transmittable infections; 3.) Avoidance of clerical errors; 4.) Prevention of severe transfusion reactions; 5.) Quality of the blood product. Most important, in regions with limited resources patients suffer from under-transfusion because not enough blood is available. All efforts should be made to reduce wastage of the available blood either by inappropriate storage, handling, or nonindicated transfusions. In addition, prevalence and number of pathogens transmittable by transfusion is much higher than in the richer parts of the world. This is aggravated by the fact that rejection of blood donors based on their history is problematic when the blood bank is empty. The aim to develop centralized national blood services with few sites manufacturing cost effective (low personnel costs) high-quality blood products, which are distributed to regional hospitals is not matching the reality of infrastructure, governmental support, and functionality. In healthcare systems with limited resources usually available personnel (hands) is not a problem, while reagents, equipment and even electricity are precious resources. The lecture will propose to focus on staff training and education, establishing local hospital-based transfusion services, which provide the blood products for the region, based on donor recruitment campaigns adjusted to the available technology, local culture, including replacement donor programs, with retention of safe donors as highest priority. Fractionation of blood into components had been standard in transfusion medicine, but recently whole blood has experienced revival for patients with acute blood loss. Given main transfusion indications such as postpartum hemorrhage, or severe trauma, in regions with limited infrastructure, whole blood might be the more appropriate product. Most patients requiring transfusion in these regions are younger and volume overload by whole blood is not a major issue. In addition, frequent electricity failures do not allow prolonged storage of plasma at -20°C (this is therefore mostly wasted), although this issue can be overcome by solar powered freezers. Ideally whole blood should be pathogen inactivated for which two methods are currently available.

To reduce frequencies of acute hemolytic transfusion reactions again education and training to minimize clerical errors in the transfusion process are most important. Extended testing for other Rhesus antigens and K beside ABO and Rh-D in transfusion dependent hemoglobinopathy patients may help to reduce delayed hemolytic transfusion reactions. Currently a leukodepleted pathogen-inactivated whole blood product might mostly serve the needs for blood transfusion in regions with limited infrastructure . The developed world should invest research efforts to develop such a product available at affordable costs. Background: In modern transfusion medicine, serological investigations for blood cell antigens are complemented by genotyping arrays and PCR assays. Whilst these platforms are informative in the majority of reference investigations, they are limited in their ability to define nucleotide variants associated with rare antigens and unable to detect novel variants potentially affecting antigenicity. Next-generation sequencing is increasingly being employed in reference settings, providing information that cannot be obtained through these methods. Whole genome and whole exome sequencing have been successfully employed in many investigations of novel and rare antigens, however concerns remain regarding the collection of genomic data unrelated to reference investigations, and reporting clinically significant incidental findings. These concerns can be addressed through the use of targeted sequencing panels. We report on the design, testing and efficacy of a panel providing a comprehensive genotyping profile for red cell, platelet and neutrophil antigens in a single test. Aims: Design a customised targeted exome sequencing panel for red cell, platelet and neutrophil antigen genes, and benchmark the efficacy against a commercial medical sequencing panel (Illumina TruSight One -TSO).

-Test the panel and in-house genotype prediction script on sequence outputs from 51 samples with known red cell, platelet and neutrophil genotypes and phenotypes and determine whether predictions are concordant. Methods: The panel was designed with 2654 probes covering exons of 64 genes associated with red cell, platelet and neutrophil antigens. Using Illumina Nextera rapid capture technology, 51 samples were tested over five sequencing runs, on standard and micro chemistries, to determine optimal sample plexity per standard run, and the efficacy of smaller flow cells for lower throughput applications. An in-house python script was used to predict star-allele genotypes based on variants listed in ISBT and EMBL databases. These predictions were compared to results from serology, SNP array and previous TSO data.

Results: Coverage consistently averaged > 2509, with 94% of target at a quality of Q30. Optimal sample plexity for a standard run was determined to be 14 samples, allowing for sufficient coverage of all clinically significant variants. For red cell samples with previous typing data (excluding RH structural variants), the script correctly predicted 99.5% of SNP based red cell genotypes. Script predictions were 100% concordant for platelet genotypes, and four of five neutrophil antigen genotypes. HNA2 genotypes defined by CD177 could not be reliably determined. The increased target coverage of the panel allowed for detection of a clinically significant heterozygous variant in Scianna system, previously undetected by the TSO panel due to extremely low coverage. Additionally, a variant defining a potentially novel null allele was detected in the P1PK system. Summary/Conclusions: The panel demonstrates considerably higher coverage, quality and throughput compared to the TSO and allows for detection of variants previously overlooked due to low sequencing coverage. Up to 14 samples can be reliably sequenced in a single run. Our script correctly predicts over 99% of SNP based alleles; however, RH structural variants require further manual analysis. Background: To ensure the safety of a transfusion it is critical to identify the blood type of both donor and recipient. Serological methods for typing ABO, RH and KEL use monoclonal antibodies, however, typing reagents for rare blood groups are expensive, unavailable or unreliable. DNA-based identification of human blood groups has been used to overcome these limitations and its application has reduced rates of alloimmunisation in chronically transfused patients. However, to date, the cost per sample has prevented the universal application of DNA-based donor typing Aims: To achieve universal adoption of DNA based donor typing, the Blood transfusion Genomics Consortium (BGC) set out to develop an affordable DNA based platform, capable of typing all red cell antigens, HLA class I and II and Human Platelet Antigens. Methods: The UK Biobank Axiom array, previously used to type 600,000 UK citizens, was redesigned for donor typing using three approaches: i) Mining transfusion medicine knowledge, e.g. ISBT allele tables; ii) Inclusion of loci associated with donor health; iii) Extraction of all coding variants in relevant genes with a frequency > 1:20,000 identified in large-scale sequencing data. Samples from NHSBT and Sanquin blood donors (n = 7,871) were used for performance assessment. Red cell and platelet antigens for each donor were inferred from genotypes using the bloodTyper algorithm and concordance with clinical serological typing results assessed.

Results: Concordance between genotypic and serological typing results was 99.9% for 95,022 comparisons; 29 of the 89 discrepancies were serologically negative and genotypically positive for a given antigen (K/k, Fy[a/b], Lu[a/b]). In all cases DNA variants known to modify or weaken antigen expression were detected, displaying the power of genotyping to detect variant 'weak-antigen' expression. Across 48 antigens for which serology was available, genotyping provided a 3.6-fold increase in the number of typing results available per donor (47.9 vs 13.2). Furthermore, genotyping provided data on an additional 224 clinically relevant antigens, allowing identification of antigen-negative donors and blood group identification for which antibodies are not commercially available. The power of a genotyped panel of donors to support patient management was demonstrated by a retrospective analysis of clinical cases referred to NHSBT. From 3,146 patient referrals with > 3 alloantibodies between 2014 and 2018, 772 unique alloantibody profiles were identified. We found that there was a 2.6-fold greater likelihood of finding O negative compatible donors for these patients when using genotyping data from the 4,721 NHSBT donors. Importantly, the number of alloantibody combinations for which no compatible antigen-negative donor could be identified fell from 293 to 246, representing an additional 164 patients that could be provided with directly compatible blood using the same donors. Summary/Conclusions: Through the BGC efforts an affordable fully automated genotyping platform, including the processes for quality assurance and data analysis, has been developed. Furthermore, we have demonstrated the real-world benefits more extensive donor characterisation can provide when selecting blood for patients with multiple antibodies. The results of this international collaboration provide opportunities to introduce fully-automated genotype-based donor typing in a safe and cost-efficient manner in blood supply organisations.

3C-S06-04

Biobank performs whole-genome sequencing (WGS) from individuals nation-wide. These data are suitable for allele frequency analysis to demonstrate gene expression and genetic profile in our population, also to estimate the significance of each antigen in transfusion practice. Aims: We aim to provide and verify population-based blood group antigen profile using WGS and DNA samples from Taiwan Biobank. Methods: A near 1500 WGS and demographic data were analyzed. Annotations of blood group antigen were performed according to variants from ISBT allele tables, including 2 transcription factors; variants for the Lewis system were obtained from previous studies. Annotations of blood group variants were verified by 4 DNA samples with targeted sequencing on Illumina MiSeq, and specific variants were verified by 40 DNA samples with the commercial genotyping kit or Sanger sequencing. Allele frequencies from WGS analysis were compared with population serology data using two-proportion z test. Results: Population-wide blood group antigens were analyzed, revealed in-depth antigen expression profiles in all systems (except CH/RG). The antigen frequencies from WGS were similar compared with published serology data, except for the antigens and possible explanations listed as follow, 1) M, N: insufficient sequencing reads, 2) C, c: identical RHCE exon 2 with RHD exon 2 for C allele, 3) Mur: insufficient read length/depth for GYPA/GYPB hybridization calling and individuals from high prevalence of Mur antigen in aboriginal tribes were not enrolled. Blood group antigen predictions and variants from WGS were accord to DNA verification. Furthermore, 13 systems shown no genetic variations, predicting uniform antigen expression in our population, and we can manage transfusion with minimum concerns for antigen mismatch in these systems. Moreover, we found weak and null alleles in our population for blood group systems that we had previously no knowledge of, such as LAN, JR, and VEL. These variants were helped to identify a patient with anti-Jr a carrying homozygous Jr a null alleles. Summary/Conclusions: Taiwan Biobank WGS is suitable for full blood group antigen profile determination with few adjustments required for specific antigens. The population antigen allele frequency provides valuable insight to antigen significance in transfusion practice, matching strategy for our patients, and estimation of the likelihood to obtain for specific antigen negative blood from mass population. Also, the genetic variants revealed in this study can help us to locate rare donors, and to integrate variations into routine donor blood group screening to provide suitable blood at a low cost efficiently. Background: Providing adequate amounts of safe, appropriately matched blood to meet the demands of an expanding and aging patient population presents a challenging global problem. For these reasons, sustainable in vitro sources of red cells may offer a desirable alternative to reliance on donor blood. The first stable immortalized early adult erythroblast cell line, BEL-A2, has been shown to differentiate efficiently into mature, functional reticulocytes (Trakarnsanga et al., Nat Commun. 8:14750, 2017) and consequently could provide a readily available tool for diagnostic use and proof of principle for future therapeutic use. Aims: At IBGRL, next generation whole exome sequencing (WES) has been used previously to accurately predict blood group phenotype in a number of blood group systems, including ABO, Rh and MNS (Tilley & Thornton, Transfusion Medicine 27 (Suppl.2) :42, 2017). Here we have used it to analyse and document BEL-A2 blood group-related genotypes and predict blood group phenotypes. Additional genes involved in cell-growth and enucleation were also analysed in order to further elucidate the characteristics of the BEL-A2 cell-line. Methods: BEL-A2 cells (day 196) were cultured in expansion medium and genomic DNA (gDNA) was isolated from 1 9 10 6 cells on day 5. For WES, gDNA libraries were prepared using Nextera â Rapid Capture Exome enrichment and sequenced on Illumina â MiSeq. Sequence alignments for 41 genes encoding all 36 known blood group systems and 12 further genes encoding transcription factors and cell enucleation-associated proteins were visualised using Integrative Genomics Viewer, whilst Illumina â Variant Studio was used to identify observed mutations. Mutations in coding regions were used to determine BEL-A2 genotype and predicted phenotype.

Results: Good coverage of most of the selected genes was achieved. Alignment of homologous blood group genes including RHD/RHCE, GYPA/GYPB and C4A/C4B was problematic and additional analysis of coverage of these genes was required for accurate interpretation. Despite a number of polymorphisms observed across the tested genes, BEL-A2 did not express any novel or rare blood group antigens. Genotyping results predicted a common antigenic profile, in agreement with previous serological and genotyping results where available. Although a number of missense single nucleotide variations were detected in analysed genes, including CR1, CDAN1 and TMX4, these were common polymorphic variants and unlikely to be of any functional significance. Summary/Conclusions: WES was used to determine BEL-A2 genotype in relation to blood group genes and selected genes encoding transcription factors and proteins associated with cell enucleation. WES allowed accurate prediction of blood group phenotypes, showing full concordance with available serological data (Trakarnsanga et al, 2017) . A small number of mutations were identified which are of unknown significance and require further work to determine any potential phenotypic effects. This complete record of the BEL-A2 blood group-related exome will enable reliable gene editing strategies for future diagnostic and therapeutic purposes. Additionally, knowledge of the full cell line exome will allow analysis of any emerging genes of interest and provide better insight into the mechanisms of erythroid differentiation and enucleation. Background: Emerging evidence, especially in neonates, has shown potential harm associated with liberal platelet transfusion strategies. Very little evidence exists regarding optimal platelet transfusion thresholds in critically ill children. Randomized controlled trials may be difficult due to lack of equipoise from providers. If regional variation in practice exists, comparative effectiveness studies may be an alternative approach. Aims: To describe regional variation in platelet transfusion practices in critically ill children.

Methods: Secondary analysis of a prospective, observational study. Subjects were grouped according to region (North America, Europe, Middle East, Asia and Oceania) and nation. Transfusions were analyzed as prophylactic (given to prevent bleeding) or therapeutic (given to treat bleeding). The primary outcome was the total platelet count (TPC) prior to transfusion. Sub-groups analyses were performed in children with an underlying oncologic diagnosis and those supported by extracorporeal life support (ECLS). The dosing and processing of the platelet transfusions were analyzed as secondary outcomes. Results: Five hundred and forty-nine children from 16 countries were enrolled (67% in North America, 17% in Europe, 7% in Oceania, 5% in Asia, and 4% in the Middle East). Overall, the median (IQR) TPC prior to prophylactic transfusions (n = 360) differed significantly on a regional basis (P = 0.04) and ranged from 12 (8-41) x10 9 cells/L in the Middle East to 45 (20-66) x10 9 cells/L in Asia. The median TPC prior to prophylactic transfusions did not significantly differ between countries (P = 0.08), nor did the TPC prior to therapeutic transfusions (n = 189) differ on either a regional (P = 0.16) or national (P = 0.57) basis. For children supported by ECLS (n = 90), there were no regional (P = 0.06) or national (P = 0.40) differences for prophylactic transfusions. However, significant differences in the TPC prior to therapeutic transfusions were observed on both a regional (P = 0.02) and national (0.04) basis with the Middle East, in particular Israel, transfusing at the lowest median (IQR) TPC [28 (16-81) x10 9 cells/L]. For children with an underlying oncologic diagnosis (n = 233), no differences were seen in the TPC for prophylactic transfusions (n = 175) on a regional (P = 0.19) or national (P = 0.20) basis. Nor were differences seen in the TPC prior to therapeutic transfusions on a regional (0.86) or national (P = 0.33) basis. There was significant variability in the dosing of platelet transfusions on both a regional (P < 0.001) and national basis (P < 0.001). The median (IQR) dose based on volume ranged from 8.4 (5.0-11.2) ml/kg in North America to 12.6 (9.8-16.0) ml/kg in Europe. The vast majority of transfusions were leukoreduced and irradiated but significant variation exists in storage duration on both a regional (P < 0.001) and national (P < 0.001) basis. Summary/Conclusions: Regional and national variation exists in platelet transfusion practices among critically ill children, especially in those given therapeutic transfusions while supported by ECLS. Considering this variation, comparative effectiveness studies may be an appropriate approach to gain evidence to optimize platelet transfusion thresholds. Background: The optimal threshold for prophylactic platelet (Plts) transfusion in pediatric patients with cancer is still controversial and current clinical practice comes from studies on adults and on inpatient setting. The international guidelines (ICMTG, 2015) recommend, for all age patients, a prophylactic platelet transfusion when Plts count is ≤ 10 9 10 11 /L and a platelet dose of 1.1 9 10 11 per square meter (sm) of body-surface area (BSA) in inpatient and 2.2 9 10 11 /sm in outpatient setting.

Aims: In January 2018 we started in our Children's Hospital a prospective protocol in order to evaluate the impact on bleeding risk of current clinical practice of prophylactic platelet transfusion in inpatients and outpatients onco-haematological patients.

Methods: BSA was calculated from age-standardized weight. Inpatients received a dose per transfusion of 1.1 9 10 11 /sm and Outpatients a dose per transfusion of 2.2 9 10 11 /sm. Platelets were transfused when the count was ≤ 10 9 10 11 /L or in presence of bleeding signs; pediatric aliquots were obtained from Buffy coat derived pooled platelet concentrates or apheresis platelet concentrates, according disponibility.

Results: From January 2018 to December 2018 a total of 9839 platelet pediatric aliquots were transfused: 5534 (56.2%) were obtained from apheresis platelet concentrates and 4305 (43.8%) from Buffy-coat-derived pooled platelet concentrates. The majority of platelets pediatric aliquots (7505-76.3%) were transfused to onco-hematological patients undergoing hematopoietic stem cells transplant (HSCT) or conventional chemotherapy. Among them, 6365 aliquots were transfused in inpatient setting: 1675 (17%) in the hematology unit, 2772 (28.2%) in the oncology unit and 1918 (19.5%) in HSCT unit. A total of 1140 (11.5%) aliquots were transfused in outpatient setting: 840 (8.5%) to patients affected by hematological malignancies and 300 (3%) to patients with solid tumors. Five major bleeding events (WHO grade ≥ 3) were observed during the study period and all of them occurred in hospitalized patients. Two patients with solid neoplasm developed a WHO grade 3 bleeding event. Two patients with hematologic malignancies and a patient with neuroblastoma (n = 3, 1.2%) developed intracranial bleeding (WHO grade 4). The platelet count at the time of the event was 22 9 10 9 /L, 25 9 10 9 /L and 8 9 10 9 /L, respectively. Summary/Conclusions: Our results showed the efficacy, in onco-hematological pediatric patients, of a prophylactic platelet transfusion protocol based on international guidelines: a very low incidence of WHO grade 4 bleeding has been observed in inpatients setting only (1.2% vs 1% of PLADO Trial, SJ Slichter, NEJM, 2010) , while in outpatients setting the double platelet dose prevents the major bleeding event (WHO grade ≥ 3) occurrence. Background: The problem of blood-borne infections remains relevant in transfusion medicine. Pathogen reduction technologies (PRT) provide a preventive approach to a wide range of transfusion-transmitted infectious diseases. To date, PRT widely used for platelet concentrates and blood plasma, however, the use of these technologies for the treatment of red blood cell-containing blood products undergo research. Aims: The aim of our study was to evaluate the safety and efficacy of transfusions of pathogen-reduced (test group) red blood cell suspensions (RBCS) and compare these data with gamma-irradiated RBCS (control group).

Methods: The technology based on the combined action of riboflavin and ultraviolet (Mirasol PRT, Terumo BCT, Belgium) was used to reduce pathogens in whole blood. Subsequently, the RBCS of the test group were derived from pathogenreduced whole blood. The control RBCS were irradiated at the GammaCell 3000 Elite (Best Theratronics, Canada) at a dose of 25 Gray. All RBCS were used for transfusion for 14 days from the harvest day. 70 pediatric patients with various oncological and hematological diseases were randomized to 2 groups of 35 members in each group. The test group of patients received transfusions of a pathogen-reduced RBCS; the control group received transfusions of a gamma-irradiated RBCS. The next day after transfusion were assessed hemoglobin and hematocrit increment, the level of potassium and haptoglobin in the patients' serum, the frequency and severity of transfusion reactions. 3-5 days after the transfusion, the direct antiglobulin test (DAT) was performed and after 14-21 days the indirect antiglobulin test (IAT) was performed. The interval to the next need for transfusion was also evaluated.

Results: The increase in hemoglobin and hematocrit (P = 0.2), as well as the concentration of potassium (P = 0.44) and haptoglobin (P = 0.25) in the patients' serum after the transfusion did not differ between groups. None of the patients in both groups had hyperkalemia after transfusion. In each group, two patients had febrile non-hemolytic transfusion reactions of comparable severity (P = 1). All DAT and IAT tests were negative in both groups. The interval between transfusions were not significantly different between groups (P = 0.39). Only in the test group was found the correlation between the increase in the hemoglobin and hematocrit values with the volume of transfusion, with the dose and the adjusted dose of hemoglobin obtained for the transfusion on body weight. And in this group was found inverse correlation between the hemoglobin and hematocrit increment with the level of hemolysis in the RBCS. Summary/Conclusions: We found that the clinical efficacy and safety of RBCS of the compared groups did not differ. There was no evidence of immune elimination and allo-sensitization caused by pathogen-reduced RBCS. According to our data, the spectrum of efficiency and safety indicators of pathogen-reduced RBCS is no worse than that of gamma-irradiated RBCS, provided that RBCS is used for 14 days of storage. The founded correlation suggests that the efficiency of pathogen-reduced RBCS transfusions is more dependent on the characteristics of the RBCS.

Background: Patient blood management (PBM) programs are expanding at an international level. A recent nationally representative study from United States observed pediatric age group as the only age group showing lack of objective evidence of PBM initiatives (Goel et al, JAMA 2018) .

Aims: This study aims to identify trends in peri-operative blood utilization in children undergoing elective and non-elective surgeries over 5 years duration from 2012 to 2016. Methods: Using 5 years data (2012) (2013) (2014) (2015) (2016) Perioperative transfusions decreased steadily per year from 6.4% in 2012 to 5.5% (14% cumulative decline) in 2016 for children of all ages (OR 0.966; 95% CI 0.957-0.976; p trend < 0.001). The cumulative change in elective procedures was 9.2% versus 27.2% decrease in urgent/emergent procedures (p trend < 0.001). Summary/Conclusions: In this large prospective registry study of > 350,000 children undergoing elective/non-elective surgeries, a statistically significant decrease in utilization of peri-operative RBC transfusions was seen across 5 years from 2012 through 2016 with more significant decrease in urgent/emergent procedures than elective procedures While these findings need evaluation for non-surgical indications of transfusion, these results may provide first evidence of peri-operative pediatric patient blood management strategies being implemented to optimize transfusions in pediatric population.

Adverse Events -TTI, Immune Interactions and Risk 3C-S08-01

Transfusion-transmitted infections (TTI) are a long-standing and well recognized concern in medicine, which is tackled on the highest level to guarantee the safety of the transfusion procedure for all stake holders. These include the recipient patients, the donating volunteers, the health care workers involved, and their respective contact persons. Accordingly, current national and international guidelines including expert societies and the WHO provide medical, technical, and legal frameworks, which are the basis for the standard operating procedures. Nevertheless, there are important challenges, which render TTI a "moving target", and reflect the dynamics in three main areas. First, a change in the type and number of recipient patients with past or ongoing immunomodulatory / immunodeficiency component (examples being HIV/AIDS, SOT, allogenic HCT, monoclonal antibody therapies, small molecule inhibitors). Second, changing exposure to known agents in donors due to global travel, migration and displacement, as well as environmental/climate change. Third, discovery and diagnostics of old and new agents with their known or presumed impact as TTI. These aspects will require careful review of data and studies, and judicious discussion of the potential action such as selection versus close monitoring to keep TTI rates as low as possible, to deliver maximal safety of patients and stakeholders. Background: The implementation of nucleic acid testing (NAT) and the development of sensitive and specific serologic assays to detect HBsAg and anti-HBc antibodies significantly reduced the risk of HBV transfusion-transmission. The apparent redundant testing for two direct viral markers prompted debates on maintaining HBsAg screening, particularly in low endemic countries where blood donations are screened for anti-HBc. However, frequencies of 2-20% of HBsAg-confirmed positive/NAT negative donations have been reported depending on the sensitivity limit of the molecular assays used. The nature of this discrepancy between HBsAg and DNA remains largely unknown and it is essential to evaluate any potential negative impact on blood safety before considering removing HBsAg testing. Aims: The prevalence in blood donors and the molecular mechanisms responsible for a persistent undetectable or barely detectable level of viral replication in the presence of a sustained HBsAg production were investigated in a collaborative study including five laboratories/blood centers in Europe and South Africa. Discrepancy between viral DNA and HBsAg levels suggested the presence of mutations that may negatively affect HBV replication and/or infectious viral particle production. Methods: Donor samples from France, South Africa, Poland, and Croatia were selected for having HBsAg levels ≥ 100 IU/ml and being ID-NAT (Procleix-Ultrio Plus TM [95% LOD: 3 IU/ml]) non-reactive/non-repeatable reactive (NR/NRR) with undetectable viral load (VL) or < 6 IU/ml (n = 44) or NAT repeat reactive (RR) with VL < 6 IU/ml (n = 32). French samples initially tested NAT NR/NRR with Procleix-Ultrio (LOD 95%: 11 IU/ml) were retested with Ultrio Plus prior inclusion in the study. HBV DNA load was quantified (Cobas TaqMan HBV [LOQ: 6 IU/ml]). HBV DNA was purified from 5 to 12 ml of plasma after ultracentrifugation. The whole HBV genome, Pre-S/S, PreCore/Core and BCP regions were amplified and sequenced. Results: Following viral concentration, HBV DNA presence was confirmed in 79% of all samples with undetectable or VL < 6 IU/ml. HBV genotypes were A1 (33.3%), A2 (18.4%), A3 (3.3%), B (3.3%), C (1.7%), D (25%), and E (15%). All samples were anti-HBc positive and 73% of Ultrio-negative samples tested positive with Ultrio Plus. Unusual 1-2 nt insertions/deletions identified in BCP regulatory elements (TATA boxes, pgInr, epsilon domain) suggest altered viral replication. Amino acid substitutions (n = 16) or deletions (n = 4) at positions reported involved in nucleocapsid formation, particle envelopment and virion formation were observed in the core protein of 30 samples. The replicative properties of the BCP and core variants are currently evaluated in vitro as a surrogate model for direct infectivity testing. Preliminary results indicate that the variants tested so far have replicative capabilities similar to those of control viruses. Analysis of Pol, S, and HBx proteins is ongoing. Summary/Conclusions: These data confirmed the presence of extremely low level of circulating DNA-containing viral particles in ID-NAT non-reactive or nonrepeated reactive blood donations with concomitant high HBsAg levels and anti-HBc reactivity. Despite the presence of mutations in the viral genomes potentially affecting virion production, preliminary data indicate that some of the viruses in plasma retain the ability to replicate in vitro and to constitute a potential infectious risk.

3C-S08-03 Background: In Switzerland highly sensitive nucleic acid screening in an individual donation format for hepatitis B virus (HBV ID-NAT) and hepatitis B surface antigen (HBsAg) detection is mandatorily performed (guidelines of Swiss Transfusion SRC, Switzerland). Since 1998, HBV (HB) vaccination is recommended in Switzerland for children and adolescents until the age of 15 and for adults belonging to known risk groups.

Aims: To highlight that low anti-HBs titers several years following HBV vaccination still confer protection and enable the host immune system to clear HBV DNA without development of serologic markers of disease.

Methods: A retrospective donor interview was conducted to complete information not covered by the questions included in the standard donor questionnaire. Routine HBV serological donor screening was performed on a Quadriga system (Diasorin, former Siemens) with the Enzygnost HBsAg assay (Diasorin, former Siemens). Further HBV tests were performed on the Abbott Architect i1000 analyser (HBsAg neutralisation, HBeAg, anti-HBc IgG/IgM, anti-HBc IgM, anti-HBe and anti-HBs). Routine ID-NAT screening for HIV/HCV/HBV was performed with the Roche cobas MPX test on a Roche cobas 8800 platform. HBV ID-NAT positive samples were confirmed with a quantitative HBV NAT assay (Abbott). Background: Hepatitis B core-related antigen (HBcrAg) is a structural antigen of HBV, consisting in HBCAg, HBeAg and the p22cr precore protein. Quantitative HBcrAg measurement is a sensitive marker of viral replication reflecting the cccDNA content and persistence of disease. HBcrAg positivity was found to be a significant risk factor of HBV reactivation in HBsAg-, anti-HBc+, HBV DNA-patients (occult HBV infection, OBI) undergoing immunosuppressive therapy. Aims: No data about HBcrAg status in apparently healthy subject with OBI are available. The aim of this study was to analyse this marker in our cohort of OBI blood donors. Methods: HBcrAg was measured in 69 blood donors confirmed to be carriers of OBI (HBsAg-, HBV DNA+). Of them, 59/69 (85.5%) donors were anti-HBc positive, and 10 (14.5%) negative. 18 donors had both anti-HBc and anti-HBe reactivities. A group of 11 young blood donors vaccinated for HBV infection (HBsAg-, HBV DNA-, anti-HBc-), and 9 patients with chronic HBV infection (HBsAg+, HBV DNA+) were used as negative and positive controls group, respectively. Serum HBcrAg was measured using a chemiluminescent enzyme immunoassay on the Lumipulse G600 automated analyzer (Fujirebio, Tokyo, Japan). The lower limit of detection (LOD) of the quantitative assay is 2 logU/ml and the lower limit of quantification (LOQ) is > 3 logU/ml, due to nonlinearity results between 2 and 3 logU/ml. Levels of HBcrAg were tested in the three groups and analysed in comparison to the presence of anti-HBc and anti-HBe. Statistical analysis was performed by the IBM Statistics SPSS 19.0.0. Results: All donors in the negative control group had undetectable HBcrAg levels, whereas all patients in the positive control group have detectable HBcrAg (mean value: 3.0 logU/ml, range 2.0-4.9), confirming that individuals without prior exposure to HBV would not have detectable HBcrAg. HBcrAg was detectable in 34/69 OBI donors (49.3%), with a mean value of 2.21 logU/ml (range 2.0-3.20). HBcrAg could be measured only in 2 OBI donors (3.0 and 3.2 logU/ml), being below the LOQ of the test in the majority of OBI (32/34). Considering the presence of anti-HBc, HBcrAg was detected in 29/59 (49.1%) anti-HBc+ and in 5/10 (50%) anti-HBc-OBI, with no significant difference in their mean levels (2.21 AE 0.32 vs 2.14 AE 0.26; P = 0.44). Interestingly, the presence of anti-HBe (18/62) was independently associated with higher HBcrAg levels (2.38 AE 0.42 vs 2.14 AE 0.22; P = 0.03). Summary/Conclusions: Identification of donors with OBI is critical to prevent the risk of HBV transfusion-transmission. Being HBcrAg associated with the cccDNA content and replication, our results suggest that the presence of HBcrAg, even if not quantifiable, could be useful marker to confirm the occult infection status, even in anti-HBc negative donors. The association between HBcrAg, anti-HBc and anti-HBe could also be a useful marker to identify OBI donors with a higher risk of HBV reactivation.

3C-S08-05

HC group. Human peripheral blood mononuclear cells (PBMCs) from blood donors were stimulated with HBV polypeptides pool in vitro. T cell proliferation assays (CFSE) was used to detecting T cell proliferation, enzyme-linked immunospot assay (ELISPOT) was used to detecting the frequency of HBV-specific IFN-c secreted T cells. SPSS 20.0 statistical analysis software was used for statistical analysis. The measurement data of normal distribution were tested by two independent samples t test; and the comparison between multiple groups was analyzed by one-way ANOVA. Mann-Whitney U test was used for comparison between non-normal data sets. P < 0.05 was considered statistically significant. Results: 1. Proliferation characteristics of T cells. The proliferation of CD4 + T lymphocytes was mainly stimulated by specific HBV polypeptide pool, and the proliferation rates of OBI group and CHB group were significantly higher than those of HC group (3.0%, 3.3% vs. 1.7%), with significant difference (3.0% vs. 1.7%, P = 0.016, 3.3% vs 1.7%, P < 0.001). 2. The frequency of specific IFN-c secreted T cells. The response intensity of the OBI group (25 SFC/10 6 PBMCs) and CHB group (25 SFC/10 6 PBMCs) was higher than that of the HC group (5 SFC/10 6 PBMCs) under the stimulation of HBV polypeptide pool, and the positive rate of T cell response to the stimulation of HBV polypeptide pool was the highest in the OBI group (64.0%). Summary/Conclusions: Both OBI and CHB had higher rates of HBV-specific T effector cell proliferation and IFN-c secretion than the healthy control group. Compared with the CHB group, OBI group had a higher positive rate of T cell response, which may be one of the causes of host immunity resulting in OBI. Further studies on other immune factors are required. Background: Western blood transfusion practices are currently changing due to various drivers such as blood management policies, ongoing technological developments, and new therapeutic options. In the Netherlands, as in many high-income countries, these have resulted in a diminishing trend of red blood cells. Therefore, it is important for blood bank management to anticipate the future demand of blood products for the sake of medium and long term decision making. To support this decision making, we have employed scenario development, which is used in many other sectors (such as finance and transportation) and can also be applied to blood transfusion. Building upon a prior literature review and semi-structured interviews of international experts, we gathered experts together for scenario sessions to assess the opportunities and threats for Sanquin's medium-term (15-20 years) strategy using an online platform and face-to-face discussions. Aims: To assess for opportunities, threats, and the organizational implications thereof for the medium-term future of Sanquin, the Dutch national blood bank. Methods: Twenty-one multidisciplinary experts in blood transfusion agreed to participate and were separated into two groups for half-day interactive sessions. Using an iterative process through an online platform, experts brainstormed opportunities and threats for Sanquin, which were categorized into themes. These themes were ranked according to importance and certainty, and through consensus, experts chose two themes with high impact and high uncertainty. For these chosen themes, specific actions for the blood bank were listed to mitigate and/or enhance the threat or opportunity. Discussions were ample throughout. Results: With regards to opportunities and threats for Sanquin's medium term strategy, experts brainstormed many ideas and categorized them under 10 themes: political context/ changing legislation, novel products and alternative applications, donors, international markets, commercialization, digitalization, change in perceptions, research, demand, and organizational structure. After ranking for importance and certainty, six themes were chosen: change in perceptions, international markets, political context (opportunities), demand (opportunities), research (vulnerabilities), and donor (vulnerabilities). For each of these themes experts provided specific actions for the organizations to mitigate threats or stimulate opportunities accordingly. These actions included increased transparency and improved communication with the (donor) public, lobbying in political spheres, increased activities in educational institutes and large funding organizations, and creating and collaborating on novel blood products on an international level, to name a few. Summary/Conclusions: These results show that mapping and assessing a blood bank's future using a multi-disciplinary group of experts is conducive as an effective means of collection a diverse range of opportunities and threats. This provides an opportunity for blood bank management to become proactive towards these potential opportunities and threats and possibly evolve future strategies for the organization. showed that iron-deficient female blood donors were more likely to have depressive symptoms than non-iron deficient female blood donors. Among participants with depressive symptoms, females with low plasma ferritin levels had significantly increased odds for reporting a "feeling of lacking energy and strength" (OR = 2.11; 95% CI: 1.03-4.31). As it is known that blood donors are at an increased risk of iron deficiency, it is important to determine whether those genetically predisposed to lower plasma ferritin levels have a higher risk of experiencing the tiredness/lack of energy symptom. Aims: To investigate whether there is an association between polygenic risk scores (PRSs) based on plasma ferritin levels and the tiredness/lack of energy symptom in blood donors. Methods: The DBDS is an ongoing nationwide blood donor cohort, of which genome-wide genotype data are available for 72,000 participants. Genotyping was performed using the Infinium Global Screening Array (Illumina â ) and imputation was achieved based on a Scandinavian reference genome. Ferritin PRSs, based on an Icelandic ferritin GWAS (N = 150,000), were calculated for all DBDS participants. 12,903 female donors were available for the analysis. Data on depressive symptoms were obtained using the validated Major Depression Inventory scale (MDI), a selfreport mood questionnaire, which assesses the presence of 10 depressive symptoms. A donor was classified as "tired" if they responded "all the time" or "most of the time" to the question "how often do you feel that you lacked energy and strength?". Logistic regression analysis was performed, adjusting for age. For generating the quantile plots, the participants were distributed evenly into six quantiles based on their PRS, whereby quantile 1 contained the donors with the lowest PRSs (genetically predisposed to lower ferritin levels) and was set as the reference quantile with OR = 1 from the age-adjusted regression analysis (tiredness~quantile). Results: PRSs in females ranged between -0.42 and 0.50 (mean 0.01). A total of 12,523 female donors were classified as "not tired" and 380 (2.9%) were classified as "tired". No significant difference in ferritin PRS was found between "tired" and "not tired" female donors (tired mean PRS: 0.00; not tired mean PRS: 0.01). An age-adjusted logistic regression model found this to be insignificant (OR: 0.74, 95% CI: 0.33-1.66), P = 0.47). To visualise the lack of association, a quantile plot was created, separating the female donors into six equal quantiles based on their PRS. No clear trend was observed; donors with the highest PRSs (in quantile 6) had OR = 1.02 (P = 0.93) of being tired when compared to those in quantile 1 (OR set as 1). Summary/Conclusions: No significant association was found between the ferritin PRSs of female blood donors and the tiredness/lack of energy symptom. Further studies are needed to understand the effect of blood donation versus genetic constitution on tiredness among female iron-deficient blood donors. Background: Antiretroviral therapy (ART) is critical for the control of clinical progression of human immunodeficiency virus (HIV) infections. However, the outcome of ART could be limited by drug resistance-associated mutations (DRMs), even lead to the transmission of drug-resistant HIV to treatment na€ ıve patients such as blood donors, which is a huge concern to ART. DRMs surveillance in HIV infected groups is strongly recommended by World Health Organization. Characteristics of genetic diversity and DRMs of HIV among blood donors may provide comprehensive data to monitor viral evolution and optimize ART, play important roles in blood safety. Aims: Limited data concerning the epidemic of HIV-1 subtypes and DRMs of blood donors is available in China. This study is to investigate genetic characteristics and DRMs of HIV-1 infected blood donors. Methods: From 2016-2018, 177 blood donations collected from 24 blood centers, covering almost the whole of China, were confirmed as HIV-1 positive by National Centers for Clinical Laboratories using Abbott RealTime HIV-1 assay or COBAS Taq-Man HIV-1 Test, version 2.0. Then HIV-1 Gag (973 bp, HXB2: 1074-2044), pol genes (1454 bp, HXB2: 2068-3521) (encoding the whole protease (PR) and a part of reverse transcriptase (RT)) was sequenced after viral RNA extraction and amplification. HIV-1 subtype based on Gag and PR-RT regions was determined by comprehensive analyses of Los Alamos HIV BLAST tool, REGA HIV-1 Subtyping Tool, phylogenetic trees and online jpHMM program. DRMs analysis was performed in the Stanford HIV Drug Resistance Database. Results: Among 177 donations, Gag and PR-RT regions of 160 samples were sequenced successfully. The distribution of HIV-1 genotype was as follows: CRF_07BC = 66 (38.8%), CRF_01AE = 58 (36.3%), B = 9 (5.6%), CRF_08BC = 2 (1.3%), CRF55_01B = 4 (2.5%), CRF59_01B = 1 (0.6%), CRF65_cpx = 1 (0.6%), CRF67_01B = 2 (1.3%), CRF79_0107 = 1 (0.6 %), CRF85_BC = 1 (0.6 %), URF_0107 = 6 (3.8%) and URF = 9 (5.6%). 26 of 160 HIV-1 isolates were identified to have DRMs. There were 4 (15.4%, 4/26) Protease Inhibitors (PI) accessory DRMs, 3 PI major DRMs and 20 (76.9%, 20/26) Non-nucleoside Reverse Transcriptase Inhibitors (NNRTI) DRMs. Most of blood donors with DRMs were CRF01_AE and CRF07_BC (61.5%, 16/26). 3 of 4 PI accessory DRMs were Q58E. The PI major DRMs included M46L, M46I and N88S. N88S could result in HLR to atazanavir (ATV) and NFV, LLR to indinavir (IDV) and saquinavir (SQV). V179D/E is main NNRTI DRM (70.0%, 14/20). A combination of V179D and K103R among two samples acted synergistically to reduce efavirenz (EFV) and nevirapine (NVP) susceptibility. Furthermore, two blood donors with K103N mutation in reverse transcriptase gene had high level-resistance to EFV and NVP. Summary/Conclusions: Overall, the most prevalent subtypes among blood donors in the study were CRF07_BC (38.8%), CRF01_AE (36.3%). Besides, other rare CRFs and several URF_0107 and URFs were also found in these HIV-1 isolates, which suggested the epidemic of HIV has been shifted from high risk populations into general populations, including blood donors in China. DRMs were observed in 16.3% donors in the study, which may result in resistance to PIs and NNRTIs, especially the HIV-1 variants with N88S mutation in PR gene and K103N mutation in RT gene. In summary, our findings indicate that increasing diversity of HIV-1 in blood donors and remind us the necessity of timely genotypic drug resistance monitoring and molecular epidemiology surveillance of HIV-1 among blood donors. Background: Labeling of platelets is required to measure the recovery and survival of transfused platelets in vivo. Currently a radioactive method is used to label platelets. However, its' application is limited, due to safety issues and the inability to isolate transfused platelets out of the circulation. Biotin-labeling of platelets is an attractive non-radioactive option, however, no validated protocol to biotinylate platelets is currently available for clinical purposes. Aims: The aim of this study is to develop a simple, standardized, reproducible method to label platelets with biotin as a non-radioactive alternative to trace transfused platelets in vivo. Methods: Six pooled buffy coats derived platelet concentrates (PCs) stored in 100% plasma were biotinylated at day 1 and day 7 of storage. To distinguish the effect of the processing steps from the effects of biotin incubation, 'sham' samples were processed. For the biotinylation procedure, 50 ml of PCs was washed twice and incubated with 5 mg/L biotin, dissolved in phosphate buffered saline-PAS-E (1:9), for 30 min. Stability of the biotin labeled platelets after irradiation was tested. Annexin V and CD62P expression were assessed as measures of platelet activation. Applicability of this method to other platelet products was assessed in three pooled PCs stored in 65% PAS-E and three single donor apheresis PCs. Results: The method was reproducible performed in a closed system. After biotinylation, 98.4% AE 0.9% of platelets were labeled. Platelet counts, pH and 'swirling' were within the range accepted by the Dutch blood bank for standard platelet products. The number of annexin V positive cells was not significantly altered by the biotinylation procedure in both fresh and stored platelets. In contrast, CD62P expression was increased in biotinylated platelets 48.4% IQR(41.7-56.2%) compared to the control samples 12.3% IQR(9.5-12.7%) on day 1 of storage. However, biotinylated platelets were not more activated compared to sham samples 50% IQR(41.7-56.2%). Thus only the procedural steps led to increased CD62P expression and not the biotin label itself. All samples showed maximal response to thrombin receptor-activating peptide. For platelets labeled at day 7, a similar pattern was observed. Irradiation of biotin labeled platelets did not alter the stability of the biotin label nor cell quality. Furthermore this method is also applicable to pooled PCs stored in PAS-E and apheresis PCs, with similar patterns in annexin V and CD62P expression. Summary/Conclusions: We developed a standardized and reproducible protocol according to Good Practice Guidelines (GPG) standards, for biotin-labeling of platelets for clinical purposes. The procedural steps, which are similar to the steps used for production of hyperconcentrated platelet products, led to an increased CD62P expression, but did not alter the annexin V expression. This method can be applied as non-radioactive alternative to trace and recover transfused platelets in vivo.

blocking activity over the prototypic cHS4 insulator in cell lines and substantially reducing genotoxicity in a c-retroviral vector-mediated carcinogenesis mouse model. In contrast to cHS4, these insulators are small-sized (119-284 bp vs 1.2 kb) and can be easily accommodated in GT vectors without detrimentally affecting vector titers. Aims: We aimed to test whether A1, one of the newly discovered CIs, could reduce vector-mediated genotoxicity in the challenging context of SIN-LVs, by insulating a therapeutic globin-vector. Methods: We tested the genotoxicity effect in the IL-3-dependent 32D cells, which upon transduction with oncogenic vectors become IL-3-independent, leading to transformation. 32D cells were transduced with SIN-LVs: the b-globin-ΤΝS9.3.55-, the insulated b-globin-A1-TNS9.3.55and the oncogenic SFFV-GFP-vector. Transduced cells were expanded in 10% IL-3 and transduction efficiency was determined by vector copy number (VCN). Transduced 32D cells were seeded in methylcellulose with 10% or 0-1% IL-3 to detect the IL-3-independent and potentially transformed clones. The IL-3-independent clones were further expanded in 10% IL-3 and infused in partially myeloablated and IL-3-treated C3H/HeJ mice. WBC analysis, blood smears and bone marrow(BM) cytospins were performed. Results: The A1 insulator did not negatively affect vector titers (ΤΝS9.3.55, A1-TNS9.3.55, SFFV-GFP: 2.8, 1.8, 2.5X10^8 IU/ml, respectively). 32D cells were successfully transduced with all vectors (%VCN positive colonies: 40-100%) and expanded up to 400-fold. The A1-insulator decreased the number of IL-3-independent colonies by 78-93% over the uninsulated vectors. The uninsulated vector-transduced, IL-3-independent colonies, were greatly expanded in culture with 10% IL-3 over the A1-transduced colonies (SFFV, ΤΝS9.3.55, A1-TNS9.3.55: 48, 40, 10 fold change, respectively). IL-3 independence as a transformation event was confirmed in vivo by the development of overt leukemia (hyperleukocytosis, splenomegaly, BM-and extramedullary site-infiltration) in mice transplanted with the IL-3-independent and expanded colonies. Summary/Conclusions: Under forced oncogenic conditions, the A1 insulator effectively protected a therapeutic vector from vector-mediated genotoxicity. A1 may serve as a safety feature in the construction of globin-SIN-LVs. Background: Novel rare nucleotide substitutions are frequently identified in RHD, the gene encoding the immunogenic D antigen of the clinically-relevant Rh blood group system, resulting in D variant phenotype. So far, it has been commonly accepted that substitutions of amino acids located either in a transmembrane or intracellular domain of the RhD protein induce weak D phenotype, i.e. reduced D antigen density at the surface of red blood cells. Recently we showed by functional analysis using a "minigene splicing assay" (MSA) that a decrease in D antigen expression may be due also to alteration of cellular splicing. Aims: Here we pay attention to the general disruption of this mechanism and the related phenotypic consequences in novel and previously reported single-nucleotide variations in RHD. We then sought to characterize functionally by MSA novel candidate splicing variants in RHD. Then we extended the project by studying prospectively all single-nucleotide variations reported in RHD exons, in order to assess globally the correlation between in silico prediction and functional analysis and to gain insights into the reliability of bioinformatics tools in line with the available phenotypic and/or clinical data. Methods: Seventeen novel or uncharacterized RHD variations, including missense, synonymous and intronic substitutions, were selected for functional analysis by MSA in human cell models. A second set, including 46 missense variants reported in RHD exons 6 and 7, was further analyzed. Functional data were compared with an algorithm derived from the QUEPASA method and tools available in the Alamut suite. A published 3D protein model was used to visualize the location of missense amino acid substitutions and to assess potentially their respective phenotypic consequence. Results: A novel "universal" minigene was validated and used successfully to characterize eleven novel splicing variants. Those variants include six intronic and four missense substitutions close to the consensus dinucleotide splice sites, as well as the c.1065C>T synonymous variation associated with a weak D phenotype, which creates a de novo splice site. Very interestingly, c.1154G>T (Gly385Val; D-negative) disrupts totally normal splicing, while c.1154G>C (Gly385Ala; weak D) and c.1154G>A (Gly385Asp; D-negative) only partially alter the mechanism. Further visualization of amino acid changes in a 3D model suggests that Gly385Asp, but not Gly385Ala, dramatically impair RhD protein structure/folding. Subsequently the global analysis of mutations in RHD exons 6 and 7 by MSA showed that inclusion of whole exon sequence in the mature transcript is significantly reduced in 15/46 (32.6%) variants, which correlates well with the QUEPASA-like prediction (sensibility = 0.93, specificity = 0.94). Additionally, while normal exon inclusion is affected by c.1012C>G (weak D type 70), the associated Leu338Val substitution does not seem to be deleterious to the protein. Summary/Conclusions: On the basis of our functional data, this work shows that splicing disruption in the presence of RHD variants is a common and general mechanism that may act independently or synergistically with alteration of protein structure through amino acid substitutions, resulting in a weak D phenotype. It also illustrates the potency of combining functional tests and in silico tools towards the phenotypic/clinical interpretation of rare variants. Background/Aims: Monetary and non-monetary incentives may support blood services in recruiting blood donors but have also been criticized for violating ethical principles and threatening blood safety by attracting donors with a high risk for infectious diseases. Although incentives for blood donors have been discussed extensively over the past decades, empirical research on this topic remains limited. The aim of this study was to describe attitudes towards incentives for blood donors in Europe and show donor return rates of compensated and non-compensated blood donors in South-West Germany. Methods: First, we present results of a secondary analysis of the eurobarometer, a nationally representative survey in all member states of the European Union. In 2014, participants were asked to evaluate eight potential incentives for blood donations as acceptable or unacceptable. These incentives were refreshments (e.g. coffee), physical check-ups (e.g. blood pressure), free (testing) laboratory parameters, free medical treatment, complimentary items (e.g. first aid kits), monetary travel reimbursements, additional cash reimbursements, and release from work. Second, we conducted a retrospective analysis of donor return patterns of 6.210 compensated and 68.205 non-compensated donors who started donating blood at mobile and fixed donation sites. Compensated donors received either 25 EUR as a regular reimbursement for their expenses (at a fixed donation site), in accordance with the German transfusion law, or a singular free entrance for an amusement park (at a mobile donation site). These compensated donors were compared with noncompensated donors who started either at a fixed or mobile donation site. Chisquare statistics were used to test for differences in regular donor status after 24, 36, 48 and 72 months between compensated and non-compensated first-time donors. Results: Among German participants of the eurobarometer, physical check-ups (51.9%), refreshments (50.0%) and free (testing) laboratory parameters (38.3%) showed the highest acceptance as an incentive for blood donors. Travel reimbursements and free medical treatment were rated as acceptable by 28.6% and 25.3%, respectively. The lowest acceptance was for release from work (17.8%), complementary items (13.9%) and additional cash reimbursement (11.8%). Interestingly, the acceptance of potential incentives varies considerably across Europe. In South-West Germany, donor return of first-time donors differed significantly by type of compensation. Among compensated first-time donors, who received 25 EUR as a monetary reimbursement, the proportion of regular donors after 48 months (19.9%) was significantly higher than among comparable non-compensated donors (9.2%). However, a non-monetary compensation (free entrance) did not increase donor return rates. Conclusion: The eurobarometer survey indicates that in most European countries monetary incentives are only accepted by a small minority. Refreshments, checkups, free (testing) laboratory parameters and free medical treatment were most popular as incentives for blood donors. However, results of our four non-randomized donor samples from South-West Germany suggest that monetary compensation may increase the likelihood of donors returning to fixed donation sites. Regular monetary reward may therefore help to recruit regular donors especially in urban settings. Incidentally, non-monetary compensation by a free entrance, however, may not affect donor return. Background: Previous research showed that whole blood (WB) donors that are temporarily deferred on-site are at higher risk of lapsing, yet very little studies have focused on differentiating the effects that different deferral reasons (e.g., travel, hemoglobin [Hb]) may have on donor lapse. In addition, donor experience (i.e., firsttime or repeat donor) has also previously been found to affect donor lapse, yet novice (1-5 prior donations) and reactivated donors (returning after years of not donating) may respond differently. Finally, it is currently unclear how and why different deferral reasons and donor experience interact in influencing donor lapse. Aims: Our aims were to understand 1) how deferral reasons and donor experience jointly affect donor lapse, and 2) why donors may lapse after temporary deferral. Methods: A mixed methods approach was used. First, we used Sanquin's donor database for a quantitative analysis of return behavior of all Dutch WB donors between 2013 and 2015 (N = 343,564). The first WB donation for each donor was identified as the target donation. Lapse was defined as non-return within a followup period of two years after the target donation. Target donations included 25% new donors, 41% novice donors, 30% experienced donors, and 4% reactivated donors. Deferral reasons included travel, Hb, medical short-term (<28 days duration), medical long-term (>28 days duration), and miscellaneous. Next, we interviewed 31 temporarily deferred donors to understand the deferral process from their perspective. Semi-structured interviews were used to understand how these donors cognitively and emotionally experienced on-site temporary deferral. We analyzed the interviews (using the Framework approach, cf. Hillgrove et al., BMC Public Health, 2012) to identify key topics and underlying themes. Results: Of target donations, 11% were deferred, mostly for travel (40%), medical short-term (23%), and Hb (19%). Survival and time-to-events methods showed that the different deferral reasons and donor experience levels differentially impacted donor return or lapse. Importantly, experience and deferral interacted in influencing return (rate). For instance, deferred new donors were more likely to lapse than eligible or experienced donors (ORs < 0.75, p's<0.001). Even though deferral also affected return of experienced donors, this effect was smaller or even non-existent for certain deferral reasons (e.g., travel-and Hb-related deferrals). Qualitative results showed that almost all donors experienced temporary deferral as disappointing, particularly when it was unexpected (e.g., first-time deferral). Not all donors (fully) understood the aims of deferral or how to prevent on-site deferral. Donor beliefs about why deferral would lead to lapse were related to recurring deferrals, (mistakenly) interpreting deferral as permanent, or feeling all the effort did not pay off. Summary/Conclusions: Reasons for temporary deferral differently impact risks of donor lapse at different levels of donor experience. For new donors all reasons for deferral are related to higher risks of lapse, whereas some reasons for deferral seem not to affect lapse among more experienced donors. Unexpected or recurring deferrals may explain why donors lapse after temporary deferral. Blood banks may tackle disappointment after deferral by explicitly showing that the donor is still valued, for instance by using personalized communication or offering an alternative good deed. Background: Blood donors experience a temporary reduction in their hemoglobin (Hb) value after whole blood donation. In the Netherlands, the Hb value is measured before each donation, and a too low Hb value (cut-off values: 8.4 mmol/l (135 g/l) for men and 7.8 mmol/l (125 g/l) for women) leads to a deferral for donation, in order to prevent iron deficiency and anaemia. The minimum interval between two donations is internationally set at 8 weeks, but over time donors exhibit iron deficiency so that blood donors are temporarily deferred from donation each year. In the US 35% -75% of deferrals are due to low Hb, especially in women (Editorial, Transfusion, 2012) . Due to the recovery process after each donation and the unobserved heterogeneity of donors, advanced statistical methods are needed to model the longitudinal data of Hb values of blood donors. Aims: To estimate the shape and duration of the recovery process of Hb until the Hb value has returned to its pre-donation level, to assess whether one can distinguish between donors with fast and/or slow recovery of their Hb level and to predict future Hb values. Methods: The study is based on data of the Donor InSight study, which was a prospective cohort study performed by Sanquin in the Netherlands from 2007 to 2016. We employed three statistical models for the Hb value: (i) a mixed-effects models, (ii) a latent-class mixed effects model, and (iii) a latent-class mixed-effects transition model. In each model, a flexible function was used to model the recovery process after donation. The latent classes identify groups of donors with fast or slow recovery times, and donors whose recovery time increases with the number of donations. The transition effect accounts for possible state dependence in the observed data. All models were estimated in a Bayesian way, using data of a sample of 1000 new entrant donors (500 males and 500 females). Prior information from the clinical literature (Boulton, Vox Sanguinis 2004) about the recovery process three days after blood donation was incorporated into the analysis since these values were not identified in the observed data. Results: The results show that the latent-class mixed-effects transition model fits the data best. We also found that the recovery process shows a concave process (initially fast followed by slower recovery). The estimated recovery time is much longer than the current minimum interval of 58 days between donations. Namely, depending on the subgroup that the donor belonged to, males showed a recovery time of 100 to 419 days, while the estimated recovery time for females varies between 54 to 503 days. These results suggest that an increase of this interval may be warranted. Summary/Conclusions: The analysis shows the usefulness of the sophisticated statistical models that make use of historical information to model complex processes in time, in this case the Hb trajectory over time across repeated donations. In addition, our results suggest a (much) longer time lag between subsequent donations to avoid anemia. Background: Complications of blood donation are known to reduce donors' return for future donation. The EPISoDe study (Experience Success in Donation) showed that water drinking shortly before donation had an effect of 23% reduction of selfreported vasovagal reactions (VVR) in younger novice whole blood donors (Wiersum-Osselton, Transfusion, 2019) . Aims: In this study we analysed the return for a subsequent donation of the donors participating in the EPISoDe study. This was a predefined secondary outcome of the EPISoDe study. Methods: The EPISoDe study was conducted in young (<30 years) whole blood donors making their first, second, third or fourth donation in geographically selected collection centres. The study interventions were: 330 ml water drink, 500 ml water drink or squeezing a ball (placebo intervention) during the wait after the screening interview and before phlebotomy, and a control group without intervention.

Participating donors were sent an online questionnaire about their experience within a week following their donation attempt. In the Netherlands donors are usually invited for blood donation in accordance with hospitals' needs; the aim is to invite eligible donors at least once a year. Donors were included in the return analysis if they had received at least one invitation within 400 days after the index donation and we analysed their return for a donation attempt within 421 days. Associations with the interventions and donors' donation status, gender and reported symptoms at their index donation were analysed by calculating return percentage of eligible donors and by binomial logistic regression. Results: Out of the 8199 EPISoDe participants who had received an invitation, 6538 (79.7%) returned within the study period. There was no difference in donor return between the two water groups. The likelihood of return was significantly increased in both water and placebo intervention donors compared to the questionnaire group (OR 1.2, 95% CI 1.06-1.4 and 1.3, 1.12-1.5 respectively). Return was slightly lower in women (OR 0.88, ) and lower in first-time donors (OR 0.86, 0.77-0.96) than after a 2 nd -4 th donation. A staff-recorded or self-reported VVR at the index donation reduced donor return (OR 0.47, 95% CI 0.37-0.60 and OR 0.53, 0.46-0.61 respectively). Other symptoms following donation were also associated with a lower return percentage. Summary/Conclusions: In this cohort of younger new and novice blood donors, 79.7% returned for a subsequent donation. A VVR (either staff-recorded or selfreported) reduced donor return. Donors who received a study intervention, either water or placebo, were more likely to return, whether or not they had suffered a VVR. It is conceivable that the mere fact of study participation could also have increased donor return, even in de questionnaire group; this will be examined in the total population of target group donors. Background: The contribution of older blood donors to the blood supply is substantial. In Australia, donors aged > 50 years contributed 41% of all donations made in 2017. However, with ageing, the general health status of older donors changes relatively faster, thus progressively affecting their ability to donate. An indepth understanding of the relationship between older donors' health status, future donation patterns, and risk of iron-deficiency could be of a great value to inform the Blood Service to predict the number of future donations, and manage the risk of iron-deficiency. Aims: To understand the relationship between self-reported health, blood donation patterns, and the management of identified iron-deficiency in older blood donors. Methods: We linked the Sax Institute's 45 and Up study baseline data collected between 2006 and 2009 to the Blood Service donation records, inpatient records, and Medicare records*. The data-linkage was conducted by Centre for Health Record Linkage. Using these linked data, we examined the relationship between health, donation patterns, and iron-deficiency and its management. Results: We followed up 22,058 active whole blood donors for 200,403 eligible person-years (average age at recruitment 56.4 years, 56.3% female, average follow up 9.1 years per-person). After adjusting for the effect of age, sex, body-mass index, education, non-English language spoken at home, country of birth, smoking, physical activity, regular use of multivitamins, alcohol consumption at enrolment, and total number of whole blood donations in the 2 years prior to enrolment, participants with better self-reported health at recruitment showed significantly higher rates of donation. Excellent, very good, good, and fair/poor health status donors made 1066 (95% CI 1056-1075), 987 (981-993), 900 (891-909), and 710 (690-730) donations per 1000 person-years, respectively. Iron-deficiency was identified in 8.9% of donors in the study (n = 1964, 95% CI 8.5-9.3) . Sixty percent of those with iron deficiency (n = 1,175, 95% CI 57.6-62.0) visited their general practitioner (GP) within 60 days of the identification of irondeficiency, and 48.4% (95% CI 45.5-51.3) of those visiting GP underwent further iron status examination and monitoring. After adjusting for several potential confounders including the total number of donations made during the follow-up period, excellent self-reported health status was independently associated with lower risk of iron-deficiency (p for trend = 0.004).

Summary/Conclusions: Information on self-reported health status can be an effective indicator to estimate the future donation yield of an older blood donor panel, and risk of developing iron-deficiency. Donors with better self-reported health had a higher number of future whole blood donations and a lower risk of iron-deficiency. Donors referred to GPs for management of their iron status utilised the health services as expected, however there is an opportunity to improve their contact with their GPs. * Medicare records was provided by Australian Government Department of Human Services. Anaemia is a major public health issue, affecting 25% of the population worldwide according to the World Health Organization. Iron deficiency is responsible for approximately half of all cases globally, with other causes including anaemia of chronic disease, other nutritional deficiencies, haemoglobinopathies, renal impairment, malignancy and bone marrow disease. In the elderly, where anaemia is even more common, the cause is frequently multifactorial. Anaemia is associated with increased mortality, decreased cognitive and physical function, depressive symptoms and fatigue, particularly in older adults. Poor outcomes have also been reported in anaemic patients with underlying comorbidities such as cardiac and renal disease, and cancer. Within a hospital setting, anaemia is highly prevalent. Preoperative anaemia, affecting up to 30% of patients, is associated with poor clinical outcomes including higher in-hospital mortality, longer length of stay and higher ICU admission rates. Anaemia management requires a proactive and multi-faceted approach, typically involving a multi-disciplinary team in which the transfusion practitioner plays a vital role. This includes screening of high-risk patients and pre-admission clinics to identify and manage patients at high risk of peri-operative anaemia. Implementation of patient blood management (PBM) guideline recommendations has been shown to be effective to prevent and optimally manage anaemia within the community and hospital settings. The transfusion practitioner has key roles in the coordination, monitoring and auditing of PBM programs. Active patient involvement and engagement of all members of the multidisciplinary team, including primary care clinicians, are also key to enhance the success of such programs. TP01-02   THE ROLE OF THE TRANSFUSION PRACTITIONER IN  ANAEMIA ASSESSMENT AND MANAGEMENT: PROCESSES,  TIPS AND RESOURCES FOR CREATING Background: Patient blood management (PBM) is an evidenced based integrated multi-disciplinary approach aimed to improve clinical outcomes by effectively managing and conserving the patient's own blood, thus reducing unnecessary exposure to transfusion. PBM has the patient as the central focus with the aim being to improve their outcomes and include them in the process. PBM includes three pillars: 1) optimising the patient's own blood, 2) minimising blood loss and 3) optimising a patient's physiological tolerance of anaemia. Delayed assessment/management of anaemia contributes to increased health costs and unnecessary blood transfusions, and transfusion has been recognised to be associated with increase morbidity and mortality. The term Transfusion Practitioner (TP) includes those known as transfusion nurses, transfusion safety officers, haemovigilance officers, or patient blood management (PBM) coordinators. A key aspect of the role is driving and influencing clinical blood management activities to help align practice to internationally recognised guidelines and standards, including PBM. Aim: To demonstrate the TP role in anaemia assessment & management and discuss strategies, processes, tips and resources for creating organisational and cultural change to implement PBM. Context: Literature outlines the importance of a multidisciplinary team to implement PBM related changes, and TPs play a fundamental role within these teams to support 'buy in'. TPs are seen as enablers, pulling resources together, engaging with those involved, providing education and facilitating change. They are often the ones to conduct audits, collating data and evaluating outcomes. Approaches to implement PBM should be tailored to suit individual organisations. The authors will outline different approaches, highlighting where the TP can support or lead activities. One approach to anaemia assessment is to undertake an audit, examples of available tools will be shown. With this data, the TP along with the PBM team can explore options for corrective action. These could include interventions such as developing a pathway where all or a specific group of patients are assessed and or treated either at a preoperative clinic, or with their local general practitioner; through to more complicated strategies such as establishing anaemia clinics. The skills of the TP are a valuable asset to analyse clinical specialties/patient mix who should be targeted to achieve best outcomes, they know the organisation and as such are well placed to help develop a process/concept that will suit, and they can provide education and support to promote and embed these practices. Conclusion: Appropriate assessment and management of anaemia requires a multidisciplinary approach. The TP plays an active and crucial role in this team. Examples of processes, tips and resources to support change and embed a PBM culture across the clinical spectrum will be shared.

3D-S11-01

Department of Hematology and Central Hematology Laboratory, Inselspital Bern, Bern, Switzerland Immune haemolytic anaemia (IHA) is characterized by an increased breakdown of red blood cells (RBCs) due to allo-and/or autoantibodies directed to RBC antigens with or without complement activation. Clinical and laboratory signs of haemolysis in concert with the presence of a positive direct antiglobulin test characterize IHA. Alloantibodies formed during pregnancy and/or after prior transfusions may cause acute or delayed haemolytic transfusion reaction after transfusion of a RBC product incompatible with the specificity of the alloantibody. Autoantibodies to RBCs reduce the survival of endogenous and hamper the recovery of donor RBCs after transfusion. Lymphoproliferative disease, autoimmune disease, infection or drugs often cause autoantibodies to RBC, but frequently no obvious cause can be identified. Besides the antigen specificity, the isotype critically determines the biological activity of RBC antibodies in vivo. The isotype defines the affinity to Fc-gamma receptors on cells of the reticuloendothelial system as well as the capacity to activate the classical pathway of complement, IgM being the most effective. Antibody-mediated complement activation results in the opsonisation of RBC with C3bc/C3d with subsequent complement receptor-mediated removal by phagocytes (extravascular haemolysis). Occasionally, complement activation proceeds via the activation of C5 to the formation and insertion of the membrane attack complex resulting in intravascular haemolysis. There is growing evidence that the innate immune system plays an important role in the pathogenesis of IHA. The process of complement-mediated haemolysis results in systemic inflammation, which contributes to morbidity and mortality of patients suffering from IHA. Complement activation results in the release of anaphylatoxins, which are strongly vasoactive and mediate chemotaxis, inflammation and formation of radical oxygen species. Release of cell-free haemoglobin and cell-free haeme upon haemolysis induces endothelial cell activation, NO-depletion, cytotoxicity, ROS formation and neutrophil activation. Natural plasma scavengers, such as haptoglobin and hemopexin complex with their target molecules, cell-free haemoglobin and haeme, with subsequent removal of the complexes via CD163 and CD91-mediated phagocytosis. Although being positive acute phase proteins due to consumption the plasma scavengers become exhausted during chronic haemolysis thereby failing to prevent the adverse biological effects of cell-free haemoglobin and haeme in the circulation. Inducible haeme oxygenase-1 (HO-1) is an efficient cellular scavenger by breaking down haeme into biliverdin with subsequent formation of bilirubin, CO and ferrous iron with subsequent oxidation to ferric iron and storage by the ferritin H chain. HO-1 has an established role in the systemic protection from systemic inflammation induced by haemolytic and non-haemolytic diseases. The lecture will emphasise the role of innate immunity with a special focus on different plasma-and cellular systems involved in the pathogenesis of systemic inflammation in patients suffering from IHA.

3D-S11-02 UNDERSTANDING ERYTHROCYTE CLEARANCE C Roussel, P Amireault, P Ndour and P Buffet

Research and teaching, Institut National de la Transfusion Sanguine, Paris, France

The clearance of erythrocytes is essential in physiology, disease and transfusion. Elimination of erythrocytes altered because of senescence or pathological processes is expected to protect the microcirculation from obstruction by adhesive or rigid erythrocytes. It also contributes to the harmful consequences of anemia and hemolysis in hereditary and acquired red blood cells diseases as well as in conditions associated with auto-or allo-immunization. Immunobiology has explored in great details antibody-mediated clearance of erythrocytes but conventional approaches may not be fully operational to explain Delayed Hemolytic Transfusion Reactions. Some important clearance processes are independent from the recognition of molecules or antigens on the erythrocyte surface. Increased erythrocyte stiffness triggers their clearance in hereditary spherocytosis, malaria and possibly also in the context of autoimmune anemia. Knowns and unknowns on the mechanisms and sites of erythrocyte clearance will be presented based on a critical review of old and recent contributions.

3D-S11-03

Cardiovascular and Endocrine-metabolic Diseases and Aging, Istituto Superiore di Sanit a, Rome, Italy Existing literature indicates that red blood cells (RBCs), beyond gas transport, exert a complex role in human physiology, being involved in many functions essential to maintain ion, metabolic and immunological homeostasis. RBCs display an immunomodulatory activity on adaptive immune cells by promoting T cell growth and survival and inhibiting activation-induced cell death. The balance between cell death and survival controls T cell homeostasis and anomalies in this balance account for diseases linked to excessive or faulty T cell growth. RBCs are able to modulate innate immunity by binding endogenous molecules such as chemokines and mitochondria-derived DNA, as well as external agents such as pathogens. RBCs can also directly modulate innate immune cell activation or tolerance by controlling the maturation of the circulating pro-inflammatory subset of dendritic cells (DCs). These cells are potent inducers of primary antigen-specific T cell responses, produce TNF-a when stimulated by LPS and are the principal IL-12p70-producing cells among leukocytes. The pro-inflammatory capacity of circulating DCs is controlled by RBCs that are able to inhibit their maturation and IL-12 production. In diseases characterized by local Th1 inflammatory response such as psoriasis vulgaris and rheumatoid arthritis, pro-inflammatory DCs play a role in the induction and perpetuation of inflammation. Collectively, literature data indicate that RBCs exert important modulatory functions that may result in immune activation or quiescence, depending on the environmental conditions. When RBCs encounter a microenvironment characterized by an intense production of ROS, the RBC defenses get overwhelmed or are unable to counteract the new pro-oxidant status and become themselves a source of ROS, which cause the generation of senescent signals on RBCs. The major feature of oxidized RBCs is the clustering and/or the breakdown of Band 3. Other features are the complexation of Hb with spectrin, the loss of glycophorin A, the externalization of phosphatidylserine and the reduction of the "marker of self" integrin-associated protein CD47. A similar senescence phenotype has been documented in RBCs during the storage period. Oxidized, senescent or stored RBCs, due to surface antigen modification and to the release of pro-inflammatory molecules, fail to control immune cell homeostasis thus contributing to the perpetuation of inflammation and to the pathogenesis of immune-mediated diseases associated to oxidative stress, such as autoimmune diseases and atherosclerosis. Our research group demonstrated that RBCs from patients with carotid atherosclerosis presented a senescent phenotype similar to that acquired by RBCs from healthy subjects following to in vitro oxidation. Oxidized erythrocytes fail to control T lymphocytes apoptosis and lipopolysaccharide-induced monocyte-derived DC maturation, thus representing dangerous signals for adaptive and innate immunity and contributing to the pathogenesis of atherosclerosis. In conclusion, the crosstalk between RBCs and the immune system represents a mechanism to maintain immunological homeostasis. However, in high oxidative stress conditions, that can take place during a prolonged storage period or in particular diseases, RBCs can acquire a pro-oxidant behaviour and lose their functional and homeostatic features. By interfering in immune system homeostasis, RBCs become a potential tool that can be manipulated to improve or reverse pathological situations characterized by anomalies in the control of adaptive and innate immunity. Transfusion therapy remains an important treatment modality for patients with sickle cell disease (SCD). Transfusions are given to lower the percentage of circulating sickle RBCs, and to decrease blood viscosity and have been shown in clinical trials to reduce the risk of stroke by 90%. However, many indications for transfusion in SCD remain controversial partly due to insufficient randomized clinical trials data and in part because of our limited understanding of the complex pathologic networks leading to diverse disease complications in SCD despite the common single mutation. Similarly, we have incomplete mechanistic understanding of why chronic transfusion protocols must be continued for those indications supported by clinical data. The beneficial effects of transfusion therapy in SCD need to also be weighed against potential transfusion risks including alloimmunization associated with lifethreatening delayed transfusion reactions, increased iron stores associated with increased oxidative stress and exposure to infectious agents. We believe that a deeper understanding of the benefits as well as harmful effects of transfusions is crucial to optimize our current transfusion therapy protocols in SCD. This knowledge may provide highly needed guidance, which is currently lacking, for expansion or limiting existing indications for chronic transfusions in SCD.

3D-S12-02 TREATMENT OF THALASSAEMIA

Department of Pediatric Hematology, Ege University, Faculty of Medicine, Bornova/ Izmir, Turkey

Thalassaemia is a devastating blood disease with a significant worldwide burden. Annually, 60,000 children are born with a major thalassemia. Life-time RBCC transfusions and iron chelation remain standard of care treatment in thalassaemia. Transfusion therapy still account for significant iron overload related morbidity and mortality despite chelation therapy which is associated with poor adherence, safety concerns and varied efficacy. Higher risk for transfusion transmitted infections (TTIs) exists for thalassemia patients whose transfusion exposure sustains lifelong. Although, the risk of transmission for traditional viruses is exceedingly rare in the modern era, emerging infectious diseases continue to be recognized as potential threats to transfusion safety. The inadequacy of blood safety points to the necessity for an additional layer of security for the blood supply in the developing world. Pathogen reduction technologies for RBCC may imply a proactive, more generalized approach against new and re-emerging pathogens in the developed world and may be an ultimate safeguard for transfusion safety in the developing countries. RBC alloimmunization may become a major challenge in thalassaemia management. Prevention is the key reducing the burden of alloimmunization. While the recommendation is to transfuse thalassaemic patients with C/c,E/e,Kell compatible blood, it is not universally practiced. Extended molecular RBC typing may be an appropriate adjunctive test in addition to serological typing before embarking on transfusion therapy. If a complete RBC antigen profile has not yet been performed in an alloimmunized patient, genotyping is the only option for accurate detection of RBC antigens that may guide the antibody identification. Allogeneic stem cell transplantation (A-SCT) is the only available curative therapy in children with HLA matched sibling which is available to approximately 20% patients. In the absence of MSD, MUD transplant with high compatibility criteria has still limited experience. Mismatch related, cord blood and haploidentical donor SCTs are considered experimental. A-SCT carries a substantial risk of SAEs and mortality, both increasing with recipient age and disease severity. DFS is 88% in paediatric and 65% in adults. Gene therapy for correction of the a-globin chain imbalance overcomes the problems of donor availability and immunologic complications associated with A-SCT. Multicenter clinical studies on gene addition therapy by using self-inactivating lentiviral vector are currently underway. Recently, gene editing by either gene disruption or gene correction emerged as a potential alternative to gene addition therapy in beta-thalassaemia. A new era of novel therapeutics is unfolding in thalassemia management. Several targets have been identified that can improve alpha/beta chains imbalance, ineffective erythropoiesis, or iron dysregulation and a number of those now have agents in preclinical and clinical development. Hydroxyurea may improve globin chain imbalance and be beneficial for reducing or omitting transfusion requirement in selected group of patients. Ruxolitinib has shown the limited effect on pretransfusion haemoglobin and reduction in transfusion needs, but allowed steady decrease in spleen volume that may serve for avoiding splenectomy in beta thalassaemia. Luspatercept may restore normal erythroid differentiation and improves anaemia and hepcidin mimetics or TMPRSS6 inhibitors may modulates ineffective erythropoiesis by iron restriction and improves anaemia and organ iron loading. Background: Thalassaemia major (particularly b-type) and Sickle Cell Disease (SCD) are the commonest clinically important haemoglobinopathies, representing major sources of morbidity. Recommended therapy is regular transfusion of safe, good quality blood, and monitoring of related complications. Thalassaemia International Federation (TIF) guidelines, in place since 1987, include strategies for precautionary measures and use of scientific progress in detection, inactivation and elimination of transfusion transmissible pathogens. Antigen-matching strategies to avoid alloimmunization against RBC antigens and other measures including haemovigilance are key components for safe blood, alongside voluntary, non-remunerated blood donation and laboratory quality assurance programmes. Aims: We present the contribution of TIF and the Greek experience in ensuring safety and availability of blood for thalassaemia patients applying internationally accepted standards and recommendations.

Methods: TIF -a non-profit, patient-driven organization with 204 national thalassemia associations in 62 countries -promotes national control programmes for prevention and management contributing to the achievement of final cure. The main working methods are provision of education, expert support, networking, communications and projects to support improvements in the quality of health, social and other care. In Greece, technical standards for blood donor selection and testing are applied in compliance with Directive 2004/33/EC as well as haemovigilance programmes and traceability procedures for recording adverse reactions and events associated with the transfusion of RBCs (Directive 2005/61/EC). Pre-transfusion and transfusion measures recommended by the Council of Europe are applied. In particular, measures for transfusion of "the right blood at the right time for the right patient", leucodepletion, RBC washing and accurate cross-matching and antigen and antibody screening for an extended matching policy are practised. Fresh (up to 15 days old) RBCs are used. Molecular testing for ABO and Rh D is performed in cases with blood group discrepancies. Haemovigilance in Greece covers 95% of total blood supply. Data on TTIs in 3,067 patients with thalassaemia and SCD-thalassaemia in 2010-2017 are analysed. Results: TTI prevalence in thalassaemia syndromes was: HBV 1.8% (occult type 1.3%), HCV 54%, HIV 0.3%, HTLV 0.8%, WNV 0.5% and HEV 3%. Most frequent adverse reactions in 2015-17 were allergic (incidence 1:854), non-haemolytic febrile reactions 1:2,631, "Other" 1:5,883, alloimmunisation 1:6,667, TACO 1:100,013, TAD 1:50,006, TT-HEV 1:100,013. Hyperhaemolysis was diagnosed in two SCD patients, delayed haemolytic transfusion reaction in one thalassaemia intermedia patient. Trends in 2010-2017 show reduced incidence of alloimmunisation against RBCs. Rates of allergic and pyrexial ARs remained stable. No major ABO incompatibility case was reported and no fatal transfusion reaction of transfusion has been recorded. Summary/Conclusions: Blood safety in transfusion has significantly improved in high and upper-middle income but unfortunately not in lower and low income countries. Blood shortages and lack of stringent protective measures for thalassaemia patients is the reality for many developing countries. TIF focuses particular attention on the provision of support and the promotion of initiatives promoting the safety and adequacy of blooda key component of the lifelong management of patients with transfusion-dependent thalassaemia. Background: b Thalassemia is the most common group of hereditary hemoglobinopathy diseases. Affected people with major thalassemia are dependent on regular blood transfusion which leads to iron overload. Hepcidin is a peptide and an important regulator of iron homeostasis. Expression of this hormone is influenced by polymorphisms within the hepcidin gene, HAMP. Aims: This study aimed to analyze the association of three polymorphisms in promoter of HAMP, rs10421768, rs117345431, and rs142126068 with iron overload in major b thalassemia patients who do not respond to iron chelating therapy. Materials and Methods: a total of 102 samples from major b thalassemia patients were collected. Genomic DNA was extracted and sequenced for SNPs rs10421768, rs117345431, and rs142126068. Statistical analysis was performed on IBM*SPSS* STATISTIC 23 using Independent t test and Fisher test. Results: Our analysis revealed statistically significantly difference between the level of cardiac iron concentration and c.-582A>G variant (P = 0.02). For rs117345431 statistical analysis was on the edge of significant relationship between minor allele and serum ferritin (P = 0.058). All samples were homozygous for allele T of rs142126068. Summary/Conclusions: different factors affect iron overload in thalassemia. Our findings and others emphasize the role of hepcidin polymorphism as a key component in iron homeostasis. Ten to twenty years ago, countries in South Eastern Africa faced the peak of the devasting HIV/AIDS epidemic leading to an up to 20 years drop in general life expectancy. With the burden of HIV/AIDS falling mainly on the economically active population of young and medium-aged adults, the epidemic endangered social and economic stability in nations most heavily affected. Today, despite AIDS still being a major cause of death in South Eastern Africa, the epidemic has become an example of public health gains that can be achieved through programmatic, evidencebased approaches that are endorsed by globally aligned policy and funding strategies. Based on his work from Lesotho, where one out of four among adults is infected by HIV, Niklaus Labhardt will take the auditors through the history of HIV programs in South Eastern Africa and show how innovative, pragmatic and evidence based implementation brought the region to a stage where the goal to end the AIDS epidemic by 2030 might be in reach. Background: In France, the deferral for men who have sex with men (MSM) was reduced from permanent to 12 months in July 2016. Since this change has not impacted the residual risk (RR) of undetected HIV among blood donations, the Ministry of Health is considering a greater access of blood donation to MSM. Two scenarios have been studied: S1. deferral of MSM during the 4 months preceding the donation; S2. deferral of MSM who have had more than one sexual partner in the 4 months preceding the donation, similarly to all other blood donors in France. Aims: To assess the impact of these two scenarios on the HIV RR estimated over the period July 2016-December 2017 which is the baseline RR with the current 12month deferral for MSM. Methods: Baseline HIV RR was calculated with the classical Incidence-Window-Period method, where HIV incidence was derived from a detuned assay (EIA-RI) detecting recent infections (≤180 days) since all HIV-1 antibodies positive blood donations are tested with this test. The assessment of the impact of both scenarios on the baseline HIV RR was based on (i) data obtained from surveys among MSM in the general population and in blood donors (compliance survey), to estimate the number of additional MSM who would give blood in each scenario, and on (ii) HIV incidence estimate among these additional donors. This incidence was estimated: for S1, from MSM blood donors with the current deferral policy (12 months) and for S2, from monogamous MSM of the general population. Results: From July 2016 to December 2017, 8/28 (29%) HIV-1 positive blood donors tested with the EIA-RI were identified as recently infected, allowing to estimate the baseline HIV RR at 0.16 in 1 million donations [95% CI: 0.04-0.34], or 1 in 6,380,000 donations. For S1, the number of additional MSM donors was estimated at 733 and the number of additional HIV positive donations at 0.09, resulting in an HIV RR of 0.16 in 1 million donations [95% CI: 0.04-0.35] or 1 in 6,300,000 donations. For S2, the number of additional MSM donors was estimated at 3,103 and the number of additional HIV positive donations at 4.92, resulting in an HIV RR of 0.23 in 1 million donations [95% CI: 0.05-0.56] or 1 in 4,300,000 donations. Sensitivity analysis shows that if both the number of MSM and the HIV incidence were multiplied by 1.5, the risk would be 1 in 6,225,000 donations for S1, and 1 in 3,000,000 for S2. Summary/Conclusions: For both scenarios, the HIV RR remains very low. For S1 (4-month deferral), the risk is identical to the baseline RR and is very robust to variations in the model parameters. For S2 (no more than one sexual partner, 4 months), the risk is 1.5 higher than the point estimate of the baseline RR and sensitivity analysis shows that this estimate is less robust than for S1, since the risk could be 2 times higher than the baseline RR. For both scenarios, there was a modest increase in eligible MSM donating.

3D-S13-03

Background: Recruiting safe blood donors amongst the largest HIV-positive population in the world is a major challenge for South African blood transfusion services. South African donor deferral criteria and deferral periods for perceived high risk activities have evolved over time, but current risk factors for infection have not been formally assessed. In addition, most studies have reported risk factors for prevalent HIV infection whereas risk behaviours for incident infection are more informative as donations with these infections could occur during the window periods of available screening assays. Aims: To identify the demographic and behavioural risk factors associated with incident HIV infection among blood donors in South Africa. Methods: We conducted a case-control study with incident HIV-infected blood donors compared to infectious marker negative controls. Incident HIV cases and controls seronegative for HIV, hepatitis B and C viruses and syphilis were accrued from a donor pool covering 8 of 9 provinces in South Africa. Controls were frequency matched at a 3:1 ratio to cases on race, age and geography. Incident HIVinfections were HIV RNA positive by individual donation nucleic acid amplification testing (ID-NAT; Procleix, Grifols) but antibody (Ab) negative (PRISM, Abbott) as well as those RNA+/Ab+ donors with recently-acquired HIV based on Limiting Antigen Avidity (LAg) assay results with normalized optical density values of < 1.5. Eligible cases and controls completed a confidential audio computer assisted structured interview (ACASI) on motivations for blood donation and behavioural factors, including behaviours in the 6 months before donation. Frequencies and measures of statistical association for risk behaviours comparing cases and controls are reported after adjusting for multiple comparisons. Results: From November 2014 to January 2018, we enrolled 323 incident HIV cases and 877 controls; 202 (62.5%) cases and 544 (62%) controls were ≤ 29 years old. There were significantly more female cases 230 (71.2%) than female controls 439 (50.1%) (P < 0.0001). Significant HIV risk factors (all P < 0.0001) reported within the 6-months before donation included: having a primary sex partner who is male; reporting increasing numbers of male sexual partners for both females and males; frequency of vaginal sex; frequency of vaginal sex without condoms; use of methods to clean, dry, or tighten one's anus before sex; and having visited a traditional healer for medical care. Lack of medical aid (private health insurance) and reports of injury or accident with blood loss were also associated with an incident HIV infection. Summary/Conclusions: Our study has identified a set of novel, putative risk factors for incident HIV infection among South African blood donors while confirming a number of previously known sexual risk behaviours. Not having private health insurance and being injured may be markers of socio-economic context that place individuals at higher risk rather than behaviours that directly increase HIV transmission risk. The detection of risk behaviours by ACASI in donors who passed predonation questionnaires and interviews suggests that ACASI has the potential to improve risk behaviour identification. Background: In France from 2000 to 2016, among male blood donors (mBDs) found HIV-1 positive at blood donation screening, 31% did not disclose any risk factor for HIV infection during post-donation interviews, while 38% reported having sex with men (MSM), and 24% and 7 % reported heterosexual sex (HTS) and other risk factors, respectively. Aims: In order to gain new insights into the risk factors for HIV-1 infection in mBDs, we performed an HIV-1 genetic network analysis, including HIV-1 positive mBDs and patients included in the French primary HIV infection ANRS CO6 PRIMO cohort (PC). Methods: 284 mBDs, who donated blood between 2000 and 2016, and 1340 PCs, included between 1998 and 2014, were studied. Epidemiological data were collected by the French Blood Service (EFS) upon blood donation or post-donation interviews for mBDs, and upon inclusion for CPs. Viral strains were sequenced and genotyped in pol gene, and a recent infection assay was performed to date infection in mBDs (recent: <6 months). A partial transmission network was computed based on Tamura-Nei 93 nucleotidic distance (threshold for HIV-1 s/t B = 1.5%; for non-B s/ t = 0.8%) and assortative mixing was evaluated for mBDs epidemiological data, including risk factors for HIV infection (MSM, HTS, others and unknown). Selfreported data were then compared to assortativity-enhanced data. Results: HIV-1 strains from 81 mBDs and 126 PCs were linked into 54 clusters including at least one mBD. PRIMO-only clusters were excluded from the analysis. Compared to mBDs who did not cluster, those found linked to the network were younger (30 vs. 36 year-old; P < 0.01) and were more likely to have a recent infection (48% vs. 34%; P = 0.03). Assortative mixing indexes showed that paired individuals were more likely to live in the same area (P < 0.001) and to have the same risk factor for HIV infection (P < 0.001) compared to a random distribution. Imputing MSM risk factor to non-MSM individuals paired with MSM changed the distribution of risk factors as follows: MSM: 38% vs. 49%, HTS: 24% vs. 21%, other: 7% vs. 6% and unknown: 31 vs. 24%. Summary/Conclusions: After validating the assortativity of risk factors between paired individuals, and imputing MSM risk factor to individuals self-reported as non-MSM (including those with no identified risk factor), up to 18% (31/176) of mBDs could be reclassified as MSM. This is a worst-case scenario, as the network analysis does not exclude the possibility of one or several persons between two paired individuals (missing link). Altogether, these results could help reevaluate the HIV residual risk linked to MSM mBDs, especially in the frame of the evolution of blood donor deferral criteria. Background: Although most individuals remain asymptomatic, HTLV infection can lead to adult T-cell leukaemia/lymphoma (ATLL) and HTLV-1 associated myelopathy (HAM). The serious nature of these diseases, evidence of transmission via non-leucodepleted blood, and concern about a high prevalence among donors originating from endemic areas led to the UK blood services introducing universal blood donation screening in 2002. Monitoring through routine surveillance commenced and HTLVinfected donors were invited to participate in the HTLV National Register cohort study to assess disease progression. These data together with evidence from lookback to previously untested donations and cost-effectiveness analysis were reviewed by an expert working group in 2013 and 2015. Aims: To describe the epidemiology of HTLV among UK blood donors and evidence of disease progression from long term follow up of asymptomatic donors.

Methods: UK blood donations screened, and infected donors identified are reported to a national surveillance scheme. These donors are contacted, their results explained and information about clinical history and possible sources of infection are collected. Where appropriate, HTLV-infected donors are consented to the register, with participants completing a baseline questionnaire about their health, flagged in registries for cancer or death, and followed up about every 2-3 years. Results: In the UK 2002 -2017, 254 HTLV-infected donors were identified. Prevalence among new donors was steady around 5/100 000 donations. Prevalence among repeat donors peaked in 2002 (2.7/100 000 donations), with most in previously untested. From 2004 to 2016, prevalence of 0.07 per 100,000 donations (average of one positive/year) was recorded. In 2017, prevalence among new donors increased to 9.9/100,000 donations (17 positives), with increased numbers associated with Asian ethnicity and coinciding with an increase in collections from BAME groups. Overall, most were women (182/254, 72%), UK-born (125/254;49%) and HTLV-1 infections (228/254;90%). Mean age was 43 years. Almost all positive donations were from previously untested donors (240/254), with seroconversion within a year of previous donation confirmed for only 5 of the 14 previously tested donors. Typically, infections were associated with endemic countries (including Caribbean region, West Africa, Iran, India and Japan), acquired through breast feeding or from their heterosexual partner originating from these countries. Interestingly, three were thought to have been infected through self-flagellation. A total of 114 HTLV-positive asymptomatic blood donors have already been recruited to the HTLV National Register, and during over 800-person years follow-up, none had developed ATLL or HAM. Summary/Conclusions: Over 16 years of testing, few seroconverters were identified, suggesting very little ongoing transmission among UK blood donors. The lack of disease among the cohort study was also reassuring, although it is likely too early to detect associated symptoms of a slow progressing disease. Recruitment to this unique dataset continues, also outside of the blood donation setting. As a result of these surveillance data, evidence from lookback, and cost-effective analysis, in 2017 NHSBT ceased to test donations from previously tested donors unless the donation was being used to manufacture a non-leucodepleted component. Finland lies in Northern Europe between the 60°and 70°N latitude. The length of the country is 1150 km and width 550 km. By surface area it is the fifth largest country in EU. The population of the country is 5.5 million resulting in the lowest population density in EU (15.8 inhabitants/km3). The whole country is inhabited, although most of the population is packed in the south. The climate of Finland is influenced mainly by its latitude, but the warm waters of the Gulf Stream and the North Atlantic Drift Current also play a role. Due to Finland's northern location, winter is the longest season. The southern portions of the country are snow-covered about three or four months of the year, and the northern regions for about seven months. Long distances, low population density and the extreme climate give logistical challenges. It is estimated that these logistical costs can be as much as 10-20% of GDP in Finland. The Finnish Red Cross Blood Service (FRC BS) has been the nationwide blood service provider in Finland since 1948. FRC BS collects annually about 200 000 whole blood units of which 50 % are collected in 10 fixed sites and 50 % in mobile sessions around the country. Central activities (donor recruitment, medical support, production, testing, supply chain management, digital services and administration) are located in Helsinki. Management of transfusion is highly dependent on the logistical arrangements from blood donation sites to the central facilities and from the central inventory to the hospitals. The logistics is outsourced to three major partners all of whom have their roots in nationwide public transportation and logistics services. Posti Ltd is a state owned company having its roots in the national postal and telecom office. Today it is the leading postal and logistics service company having the widest network coverage in Finland. Blood units collected at different fixed sites and mobile sessions are transported overnight by Posti Ltd to the FRC BS central facilities by 8 am on the day following the blood donation. Posti Ltd is also used for the regular deliveries of blood products to the hospitals. The other important partner is Matkahuolto Ltd, which was founded in the 1930s to maintain bus stations and to serve as a common marketing company for the bus and coach services in Finland. It maintains a nation-wide package delivery system based on the scheduled bus route network. Matkahuolto LTD is used to transport donor testing samples from the donation sites to the central laboratory. By this arrangement it is possible to obtain most of the donor samples to the laboratory around midnight, which significantly speeds up the completion of laboratory results. The third logistics partner is JetPak Finland Ltd, which operates the air freight for the national flight company Finnair. Blood transfusion services can be managed centrally in a large sparsely populated country in a manner that is of high quality, safe and cost effective. However, the supply chain has to be planned carefully. Background: Elearning is a divisive topic. It is often criticised as an inferior form of education while simultaneously being promoted as a means to provide education to large numbers of people in a consistent, cost-effective manner. BloodSafe eLearning Australia (BEA) is a government-funded blood transfusion education program that commenced in 2007 and provides courses in clinical transfusion practice and patient blood management (PBM) including: -Clinical Transfusion Practice (4 courses) -PBM: General (7 courses) -PBM: Medical (6 courses) -PBM: Acute Care and Surgical (4 courses) -PBM: Obstetrics and Maternity (3 courses) -PBM: Neonates and Paediatrics (7 courses) Aims: To determine the engagement, outcomes and impact of learning of BloodSafe eLearning Australia courses. Methods: A retrospective analysis of user registrations, course completion records, course evaluation data and red cell usage in Australia to determine learner demographics, and the impact on acquisition of knowledge and application to clinical practice. Results: In the period from 1 July 2007 to 31 January 2019: -489,600 people registered as learners -1,072,299 courses were completed -These learners came from 182 countries, with 11,141 (2.3%) of them from outside of Australia. Analysis by profession shows that: -82.4% are nurses and/or midwives -11.2% are medical -6.4% are laboratory, anaesthetic technicians or other. Analysis of user evaluation data (n = 2,885) from 1 April 2015 to 31 January 2018 shows that these courses have a positive impact, with 88.7% of respondents stating they gained additional knowledge, 65.2% able to make changes to clinical practice, and 88.2% reporting that these changes will improve patient safety and outcomes. Analysis of international participants shows greater benefits with 93.5% gaining knowledge, 76.4% able to change their clinical practice and 91.9% believing this will improve patient outcomes. Analysis of red cell usage in Australia shows that since 2012 there has been a 21.1% reduction in red cells issued. This has been achieved through a number of PBM activities including development of guidelines, research and audits, education, waste reduction strategies, and promotional campaigns. BloodSafe eLearning Australia courses on PBM were released in 2012 and are one part of this PBM activity, and it is notable that these courses have the widest reach as they are undertaken by a large proportion of doctors, nurses and midwives in Australia who are not directly involved with the blood sector. Stakeholder feedback shows that the program provides credible, consistent education that is cost-effective, reduces duplication, is 'best-practice' elearning, is readily accessible, and allows institutions to focus on the development of practical transfusion skills.

Summary/Conclusions: This analysis shows that elearning is a well-accepted, wellutilised form of education for healthcare workers to learn about clinical transfusion practice and patient blood management, and learners gain knowledge that can change their clinical practice and improve patient outcomes. It is also likely that these courses have contributed to better utilisation of a scarce, freely-donated resource. This approach has global reach and availability, and is a cost-effective model for improving transfusion practice in the developing world by providing education for millions of healthcare workers.

3D-S14-03 PROSPECTIVE PLATELET AUDITING: ANALYSIS OF TRAINEE COMPLIANCE WITH GUIDELINES

Pathology, Columbia University, New York, United States Background: Apheresis platelets are a component product with high cost and limited supply. Furthermore, there is a potential for severe transfusion reactions associated with this product such as transfusion related lung injury (TRALI), and sepsis due to bacterial contamination. Therefore, transfusion guideline compliance is closely monitored by many centers. This quality assurance analysis describes our experience with prospective platelet auditing performed by physicians in pathology residency training. Aims: This study aims to evaluate the ability of physicians in training to perform prospective auditing and compare policy compliance for different levels of experience.

Methods: This is a quality assurance analysis of a prospective platelet audit program for a 12-month period (January 2018-December 2018). The blood bank paged the on call physician any time an order was placed for a patient with a platelet count of > 50,000/ll, ≥2 doses of platelets with no interim repeat count, or an unknown platelet count. Audit records created by physician trainees in their first post graduate year (PGY1) were compared to subsequent years (PGY > 1). Information collected included the total number of doses requiring approval, number of products approved, training year for the approving physician, and transfusion indication. Cost analyses assumed $500 for a dose of platelets. Descriptive statistics and comparative analysis using a Pearson's Chi-Square were used with a difference of P < 0.05 considered statistically significant. Results: There were 1446 platelet doses requiring approval with 670 (46%) routed to the PGY1 group and 776 (54%) to the PGY > 1 group. There were 847 (59%) ordered doses that were in compliance with hospital transfusion policy and 599 (41%) that were not in compliance with hospital policy. Of the 847 appropriately ordered doses, the PGY1 group declined release of 7 necessitating the clinical team to insist upon release without approval, and there were zero such instances in the PGY > 1 group. When paged by the blood bank, PGY1 physicians approved product release not in compliance with policy for 191/670 (29%) doses while PGY > 1 physicians approved not indicated products for 79/776 (10%) of doses (P < 0.01). Products not indicated by hospital policy were held from release by PGY1 physicians for 113/670 (17%) doses and 216/776 (28%) doses by PGY > 1 physicians (P < 0.01). The ordered doses not in compliance with hospital policy had an estimated cost of $299,500. Of this cost, there was a calculated $164,500 savings of products not released due to prospective auditing. There was an additional potential savings of $135,000 for products not indicated but released ($95,500 from the PGY1 and $39,500 from the PGY > 1 group). Summary/Conclusions: Despite a higher number of requests being routed to the more senior PGY > 1 group, there were a disproportionately higher number of out of compliance platelet orders being released by the PGY1 group in addition to withholding needed products on several occasions. Potential mitigation strategies for this could include a closer level of oversight for PGY1 physicians, and the potential monetary savings could justify a hiring a dedicated patient blood management team or quality assurance manager to monitor compliance and provide feedback to clinicians.

3D-S14-04 WHAT CAN WE LEARN FROM HOW ADVERSE EVENTS ARE DETECTED?

Norwegian Directorate of Health, Oslo, Norway Background: The primary aim of reporting systems, such as haemovigilance systems, should be learning and improvement and to identify risk areas, not simply counting errors. To understand and learn from adverse events the description of how, where and why they occur, and how they are detected, is important. To support our understanding, we use a predetermined classification that is required for reporting to EU, supplemented by classification suggested by IHN, WHO and ourselves. In 2015 we started asking the blood establishments what steps they would take to prevent recurrence of the event, and we added a simple classification to tell how the adverse event had been detected. Aims: This study aims to analyze how different types of adverse events reported to the haemovigilance system were detected, whether the current quality management systems used in Norwegian blood establishments had effective barriers and whether new barriers should be considered. Methods: Adverse events reported to the Norwegian haemovigilance system in 2017 and 2018 were analyzed with focus on how the adverse event had been detected. In all cases classification had been performed by the reporter of adverse events and were confirmed, or reclassified if necessary, by the haemovigilance team before analysis. For analysis based on classification we used PowerBI (Microsoft). Results: A total of 188 adverse events were reported from Norwegian blood establishments. All had been classified according to how the adverse event had been detected. Twenty (10.6 %) adverse events were detected because of alarms or warnings from IT-systems or equipment. Routine checks by blood establishment staff detected 39 (20.7 %) events and formal internal or external reviews detected one event. Seven (3.7 %) events were detected because the donor became ill shortly after donation, but the illness was not caused by the donation. Sixty-four percent of events were detected in a way that did not fit our present classification and hence were classified as "Other". Twelve out of 16 wrong blood in tube were detected by an alarm from the IT-system or routine check, as were six of 22 events related to blood ordering, two of seven errors in testing, six of 17 events where incorrect blood had been transfused, and eight of 64 events related to donor selection. In 80 reports human error was listed as the cause of the event and 27 of these were detected by alarms or routine checks. Summary/Conclusions: Detection of adverse events by alarms or routine checks are highly efficient when the blood establishment has historic data to check against, as exemplified with wrong blood in tube or a patient require irradiated blood components. When no historical data exists or when the quality management systems do not require routine checks, events are usually detected by chance. Further analysis is needed to see if and where the quality management systems should be improved. The wide variety of adverse events can make it difficult to select which area to prioritize in the improvement work.

Results: The Hb measurements from the finger prick were on average 1.2 g/L (0.9%) higher than from the venous blood samples. The range of the difference was -21 -+22 g/L. These results were used in order to add novel information to determine the measuring uncertainty of Hb measurement in FRCBS. In 1.4 % (12/845) of the donors in this study the venous hemoglobin measurements were below the cut-off point of donor eligibility. In those measurements the difference of the finger prick and venous hemoglobin measurement was at most + 9 g/L. 92 % of the hemoglobin results from the finger prick were in the range AE10 g/L compared to the venous hemoglobin results. 63 % of the results from the finger prick were between AE5 g/L (the precision of the device) compared to venous hemoglobin results. In 13 cases the difference between finger prick and venous measurements was outside 2 standard deviations from the mean i.e. 2.5 % from the bottom (n = 9) or top (n = 4) of distribution. Systematic errors were seen in some nurse's results both towards too low or too high Hb result in the finger prick measurement and some nurses had random errors in both directions. The batch of cuvettes, donors' age, gender or the time of sampling were not detected to have an impact on the difference between finger prick and venous Hb measurements in this study. Summary/Conclusions: The results of the POC measurements compared to the cell counter were in agreement with published data and with manufacturers' information on the device. The practical skill test is a workable way to develop competence and operations to measure the hemoglobin from the finger prick. It offers an opportunity to give personal feedback to nurses concerning their personal performance in the use of the current Hb measurement technic. It also provided data on the accuracy of the POC method in the everyday donor selection process. Background: Whole blood donation has frequently been related to iron deficiency. A blood donor loses per donation about 8% (men) to 81% (menstruating women) of iron stores. To replenish the iron lost by blood donation in a donation interval of 56 days, a donor needs to absorb 4.5 mg iron per day. This amount exceeds the reported maximal amount of absorbed iron of 3-4 mg/day, eventually leading to iron deficiency, with consequences such as donor deferral and possibly iron deficiency-related symptoms (decreased physical endurance, fatigue, pica, restless legs syndrome, and cognitive functions). Since Hb levels do not reflect donors' true iron status, measuring ferritin is a better way to detect low iron stores in whole blood donors. Studies from USA and Denmark showed that on the introduction of ferritin measurement with either extension of donation intervals or iron supplementation in case of low iron stores, deferral percentages for low Hb declined in both male and female donors. Aims: To gain more insight in iron status of whole blood donors during their donor career, how this affects donor health and which measures may prevent low iron stores in donors. Methods: In the Netherlands, Sanquin Blood Bank is currently implementing a policy with ferritin-guided donation intervals. In brief, ferritin levels are measured in all new donors and in repeat donors every 5th donation or in case of an Hb below the deferral threshold. Donation intervals are extended if ferritin levels are < 15 lg/ L, or ≥ 15 and ≤ 30 lg/L (for 12 and 6 months respectively). We anticipate that routine ferritin measurement will ultimately result in a lower prevalence of iron deficiency, less Hb deferrals and improved donor retention. This will be further evaluated in a stepped wedge cluster-randomized trial 'FIND'EM', which may also identify subgroups of donors prone to develop (symptoms of) iron deficiency. In addition, implementing ferritin screening may lead to a decreased donor availability. For this purpose, we modeled the impact of the implementation of our ferritin deferral policy on donor availability over time, which provides insight for both the expected size of the impact of the ferritin deferral policy and the time and rate at which this impact is expected to occur. This allows the blood bank to timely plan actions to counterbalance possible donor shortage and ensure an adequate blood supply. Lastly, iron supplementation can be an alternative measure instead of donation deferral. As the used and recommended dosage of iron supplementation varies widely across blood services, Sanquin is planning to start a new study in whole blood donors to gain evidence on the dosage and frequency of iron supplementation and its effect on ferritin and hemoglobin levels and donor health. Results: The before-mentioned studies are ongoing and results will be expected from 2020 onwards. Summary/Conclusions: Iron deficiency is a frequent side effect of whole blood donation. To prevent iron deficiency and its consequences, like donation deferral and health issues, more evidence-based insight in iron management of whole blood donors is being generated.

3D-S15-02 SUPERDONORS -GENETIC RISK PROFILE AND RISK OF LOW HEMOGLOBIN DEFERRAL Background: No reliable method exists for stratifying new blood donors into those who can maintain sufficient hemoglobin (Hb) levels and those who will be deferred because of a low Hb (<7.8 mmol/l [<12.57 g/dl] for women and < 8.4 mmol/l [<13.54 g/dl] for men). Polygenic risk scores (PRSs) have shown great promise in predicting complex disease risk. PRSs could also prove useful for identification of donors genetically predisposed to low Hb levels, and, thus, to an increased risk of deferral. Aims: The objective of the study was to evaluate the association between PRS (modelled to predict Hb level as a quantitative trait) and risk of deferral as a binary outcome. Methods: The Danish Blood Donor Study (DBDS) is an ongoing nationwide blood donor cohort since 2010 with more than 110,000 participants. Extensive genotyping has been performed on approximately 72,000 DBDS participants using the Infinium Global Screening Array (Illumina â ) and extended by use of imputing based on the pan-Scandinavian reference genome. Based on Hb and genetic data on more than 150,000 Icelandic individuals (an independent discovery cohort), we constructed 9 different weighted PRSs for individuals from DBDS. Information on the donors' whole blood donations following inclusion into DBDS unto end of 2017 was obtained from a nationwide donation database, SCANDAT. The best predictor of Hb among the nine PRSs was chosen and used in all subsequent analyses. We performed multilevel mixed-effects linear regression analysis with Hb as outcome, and PRS as factorized explanatory variable with cutoffs at 5, 10, 25, 40, 60, 75, 90 , and 95 th percentiles, respectively. Moreover, the models had a two-level clustering on donor ID and donation site and an ID-specific random intercept; and further adjusted for: sex(binary), age(continuous), year of donation(factorized), and time since last donation (continuous). Lastly, risk of deferral was evaluated in random effects logit models with similar covariables and clustering structure. Results: Mean number of donations per donor after DBDS inclusion was 6.9 donations. Generally, we observed a statistically significant positive association between PRS(Hb) and current Hb levels. Compared with donors in the 40-60 PRS percentile group, donors below the 5 th percentile had lower (-0.23 Hb mmol/L (95% CI: -0.25; -0.21)) and donors above the 95 th percentile higher (+0.19 Hb mmol/L (95% CI: 0.18; 0.21) Hb levels. In the random effects logit models we observed a marked increase in deferral risk with decreasing PRS percentile strata. With the 40-60 PRS percentile stratum as reference, donors below the 5 th percentile and donors above the 95 th percentile had odds ratios of deferral of OR = 2.58 (95% CI: 2.27; 2.93) and OR = 0.46 (95% CI: 0.39; 0.54), respectively. Summary/Conclusions: We found a statistically significant positive association between PRS(Hb) and Hb levels and a markedly increased risk of deferral with decreasing PRS(Hb). From a scientific point of view, it is unsurprising that a genetic score for Hb from an independent cohort is associated with Hb in another cohort. However, from a practical perspective, PRSs may be the first step in a personalized donation approach to donors and their risk of deferral.

Background: Individually calibrated inter-donation intervals for repeat blood donors have the potential to minimize the risk of iron related adverse outcomes (e.g., hemoglobin deferral or collecting a donation from a donor with low or absent iron stores) without unduly impacting the donated blood supply. Machine learning has shown promise for personalized clinical risk assessment. Aims: Our aim is to use machine learning to develop donor-specific, personalized inter-donation intervals that minimize the risk of adverse outcomes while maintaining or improving the adequacy of the donated blood supply. Methods: Using a public use dataset from the REDS-II Donor Iron Status Evaluation (RISE) study (Cable, Transfusion, 2012) we defined donor profiles with physiological measures including hemoglobin, ferritin and soluble transferrin receptor along with questionnaire responses regarding diet, reproductive health indicators, and demographics. We used these profiles (58 features, 3,162 donations from 1,025 repeat donors) and the time until the next donation attempt to predict iron-related outcomes of the next donation attempt. Possible outcomes were no adverse outcome, hemoglobin deferral, low-iron donation (ferritin < 20 ng/ml for women and < 30 ng/ml for men), or absent-iron donation (ferritin < 12 ng/ml for men and women). We trained multiple machine learning models on 2,543 of the donations and selected the model with the best performance (lowest cross-entropy loss in cross validation). We assessed the best model's performance on a hold-out test set of 620 donations, which were not used to train or select the model. We then used our model to generate risk estimates for these 620 test donors as a function of days since their last donation, which varied from 56 days to 250 days. To show individual variation, we generated graphical representations of individual donors' risk over time. Results: Ferritin, log ferritin, body iron, and time since last donation were most useful for predicting iron-related adverse outcomes at the next donation attempt. The estimated risk of adverse outcomes at the next donation attempt varied considerably across donors. As expected, the risk of adverse outcomes 250 days after the last donation was lower than the risk 56 days after the last donation for most donors (risk of hemoglobin deferral decreased for 84% of donors; risk for low-iron donation decreased for 61%; and risk for absent-iron donation decreased for 94%). Summary/Conclusions: The risk of iron-related adverse outcomes as a function of time since last donation varies considerably between donors. Machine learning models trained on relevant donor profiles can effectively estimate how an individual's risk will change over time. Individual risk estimates could allow blood centers to protect highrisk repeat donors while continuing to allow more frequent collections from low-risk donors. Further study is needed to ensure this approach works well for donor classes that are not well-represented by the RISE dataset, to assess risk prediction outside of the physiological measures collected in the RISE study, and to determine the viability of assigning an optimal inter-donation interval to a first-time donor using this approach. Background: Iron depletion is common among repeat blood donors, who contribute a large proportion of the blood supply in many countries. Exogenous iron from multivitamins with iron or iron-only supplements helps prevent donation-induced iron depletion, but whether dietary iron protects against iron depletion in repeat donors has not been rigorously evaluated. Available data from the REDS-II RISE study in the US (Cable, Transfusion, 2011) and from the Danish Blood Donor Study (Rigas, Transfusion, 2014) suggest minor impact of dietary iron consumption on blood donor iron status in multivariable regression models. Both studies, however, analyzed food items singly, such as beef or fish, rather than in aggregate, so precision was limited. Aims: To evaluate whether a composite measure of dietary heme iron consumption, weighted for frequency and iron content, was associated with incident iron depletion among repeat blood donors.

Methods: A re-analysis of the RISE cohort was undertaken to test the hypothesis that reported levels of animal protein consumption was associated with lower risk for incident iron depletion among repeat blood donors. The six blood centers participating in RISE enrolled first-time and frequent donors for 15-24 month follow-up of donation frequency and iron status. A brief checklist of 8 food categories was administered at baseline to assess frequency of consumption of several categories of animal protein that are rich in heme iron, the biochemical form of iron most readily absorbed. An Iron Composite Score (ICS) weighted for frequency and heme iron content was derived and subjects were grouped into tertiles (thirds) of ICS. Iron status was assayed at enrollment and study completion and at roughly one-third of donation visits in between. Modified Poisson regression with Generalized Estimating Equations was used to generate risk ratios controlling for donation frequency and other covariates. Results: Of 2425 enrolled donors, 1406 were iron replete at baseline and completed the food checklist. The median value of the ICS for each tertile (lowest to highest) was 7. 2, 13.1, and 22 .0 mg of heme iron weekly. These values are equivalent to approximately 3, 6, and 9 servings of beef per week, or alternately twice as many servings of chicken or pork. Across 2236 follow-up visits with iron outcomes assayed, almost 33% of donor visits were associated with intermediate iron depletion (serum ferritin < 26 ng/ml) and 8.5% with complete depletion of iron stores, representing serum ferritin < 12 ng/ml. After controlling for demographic factors and donation frequency, the lowest tertile of ICS was associated with a greater than 2fold higher risk for complete iron depletion during all follow-up visits (RR 2.40, 95% CI 1.51, 3.81, compared to the highest tertile). Summary/Conclusions: In this longitudinal evaluation of dietary iron and iron status, blood donors with low intake of heme iron had an elevated risk for developing advanced iron depletion. These results suggest that blood centers should continue to recommend iron-rich diets to repeat blood donors. Background: Blood donors lose approximately 250 mg of iron with every blood donation. As a result, frequent blood donors are at risk of iron deficiency and low hemoglobin (Hb) levels, which may affect their health and eligibility to donate. Lifestyle behaviors such as dietary iron intake and physical activity, may influence iron stores and thereby Hb levels. Gaining insight into associations between lifestyle behaviors and Hb levels is valuable for blood supply organizations, as lifestyle behaviors can potentially be considered to prevent Hb deferrals. Examining the mediating role of ferritin, a measure reflecting iron stores, in these associations will help to gain insight into whether iron stores could be the limiting or enabling factor that links lifestyle behaviors to Hb recovery after donation. Aims: To investigate associations between lifestyle behaviors (dietary heme and non-heme iron intake and physical activity) and Hb levels, and whether ferritin mediates these associations. Methods: Donor InSight-III (DIS-III) is a Dutch cohort study of blood and plasma donors and included 2,552 donors. Participants who were pregnant, had hemochromatosis, used iron supplements/medication, got a hysterectomy or bilateral oophorectomy were excluded (n = 292). Hb levels were measured in EDTA whole blood samples using a hematology analyzer (XT-2000, Sysmex, Japan) and ferritin was measured in plasma from lithium heparin tubes (Architect Ci8200, Abbott Laboratories, U.S.A.). Dietary heme and non-heme iron intake (grams/day) were assessed using a food frequency questionnaire adapted to measure iron intake. Moderate-tovigorous physical activity (MVPA, minutes/day) was assessed using the International Physical Activity Questionnaire (IPAQ)-Short Form. Results: In total, 2,260 (1,186 female) participants were included. Donors with higher intakes of heme iron had significantly higher Hb levels (regression coefficient (b) (95% confidence interval (95% CI)) in men and women respectively: 0.147 (0.069 to 0.225) and 0.094 (0.013 to 0.175) mmol/L), independent of age, smoking, menstruation, number of donations in previous two years, donation interval, sedentary behavior, the other lifestyle variable (i.e. (non-)heme iron intake or MVPA), and initial Hb level. Non-heme iron intake was negatively associated with Hb levels (-0.015 (-0.026 to -0.004) and -0.018 (-0.032 to -0.005) mmol/L for men and women respectively). Ferritin mediated associations between dietary iron intake and Hb levels (indirect effect in men and women respectively: 0.073 (0.046 to 0.107) and 0.065 (0.031 to 0.100) lg/L for heme and -0.003 (-0.008 to 0.000) and -0.007 (-0.013 to -0.002) for non-heme). More MVPA was negatively associated with Hb levels in men only (-0.004 (-0.008 to -0.001)), which was not mediated by ferritin. Summary/Conclusions: In conclusion, higher heme and lower non-heme iron consumption are associated with higher Hb levels in donors via higher ferritin levels, indicating that donors with high heme iron consumption may be more capable of maintaining iron stores to recover Hb levels after blood donation. More MVPA was associated with lower Hb levels, although effect sizes were small, independent of ferritin. Taking a donor's lifestyle behaviors into account may be useful in preventing low Hb levels in blood donors. Immune Thrombocytopenia (ITP) is still diagnosed by exclusion of other causes for thrombocytopenia. Sensitive and specific detection of platelet autoantibodies may support the clinical diagnosis and prevent misdiagnosis of ITP. For example, the direct monoclonal antibody immobilization of platelet antigens (MAIPA) assay, performed with in vivo sensitized patient platelets, offers platelet glycoprotein specific autoantibody detection with high accuracy. A drawback is that low platelet counts demand a large blood sample to have sufficient patient platelets available for analysis. Circulating platelet autoantibodies are more difficult to detect by MAIPA; and may demand more sensitive detection platforms, such as those using surface plasmon resonance. In general, the presence of anti-GPIIb/IIIa, anti-GPIb/IX and anti-GPV platelet autoantibodies is investigated. All these antibody specificities have been found in patients with ITP. In ITP, platelet autoantibody-mediated destruction via the spleen has been proposed; but also other mechanisms leading to low platelet counts in ITP may play a role. Inhibition of megakaryocytopoiesis by autoantibodies or by T cells has been suggested. In mice, GPIb-directed antibodies induce loss of platelet-sugar epitopes, inducing hepatocyte-medicated platelet destruction. Platelet autoantibodies can cause complement activation, which may contribute to platelet autoantibodymediated destruction. Interestingly, we recently found that lack of detectable platelet autoantibodies is correlated with non-responsiveness to rituximab (CD20 MoAb) treatment in ITP patients. In children with newly diagnosed and often transient ITP, platelet autoantibodies of IgG class or not often found, but of IgM class are present for short duration. In conclusion, testing for platelet autoantibody characteristics and their pathologic effect may be helpful in establishing the diagnosis of ITP and in choosing the best individualized therapy for ITP patients.

4A-S16-02 THROMBOPOIETIN RECEPTOR AGONIST (TPO-RA)  TREATMENT RAISES PLATELET COUNTS AND INDUCES  IMMUNOMODULATION IN IMMUNE THROMBOCYTOPENIA  (ITP) JW Semple 1 , R Aslam 2 , E Speck 2 , J Rebetz 1 and R Kapur 1 1 Lund University, Lund, Sweden 2 St. Michael's Hospital, Toronto, Canada Background: ITP is an autoimmune bleeding disorder in which autoantibodies and/ or autoreactive T cells target the destruction of platelets and megakaryocytes in the spleen and bone marrow. Several therapeutic options e.g. corticosteroids, intravenous immunoglobulins (IVIg), Rituximab and splenectomy are available for patients but inadequate efficacy, side effects and/or expense can make them undesirable. For the last 10 years, TPO-RA e.g. Romiplostim and Eltrombopag have made a substantial contribution to the treatment of ITP patient's refractory to first-line treatments. Of interest, approximately 30% of patients that are tapered from TPO-RA therapy show a sustained response (e.g. a stable higher platelet count than before treatment). The mechanism of how TPO-RA induce these sustained responses is unknown. Aims: To analyze the efficacy and immunomodulatory properties of a murine TPO-RA (AMP4, Amgen) in a well-established murine model of ITP that demonstrates both antibody-and T cell-mediated thrombocytopenia (Chow L et al., Blood 2010) . Methods: Platelet glycoprotein (GP) IIIa (CD61) knockout (KO) mice were immunized with CD61 + platelets and ITP was initiated by the transfer of their splenocytes into mice with severe combined immunodeficiency (SCID). The SCID mice were treated with either placebo or TPO-RA weekly and platelet counts and serum anti-platelet antibodies were measured weekly. Results: In an initial pilot dose escalation study, control na€ ıve SCID mice treated with a single subcutaneous bolus of different concentrations of murine TPO-RA (1, 10 and 20 ug/kg) had significantly higher platelet counts by 72 h post infusion. In addition, compared with untreated mice, bone marrow histology revealed significantly increased numbers of megakaryocytes. Maximal platelet count increases were observed with the highest TPO-RA dose and this dose was chosen to treat SCID mice suffering from ITP. When SCID mice were treated with weekly injections of TPO-RA, platelet counts began to increase after 2 weeks and were fully rescued to control levels after 3 weeks post splenocyte transfer. Of interest, compared with non-treated ITP mice, serum IgG anti-platelet antibody production in the TPO-treated mice was significantly reduced starting from two weeks post splenocyte infusion. Summary/Conclusions: These results suggest that murine TPO-RA is not only an efficacious therapy for murine ITP but also induces immunomodulation indicative of immunosuppression. Thus, this model may be able to elucidate the mechanism of how TPO-RA's induced immunosuppression in patients with ITP. Background: Desialylation, the loss of sialic acid content on platelets (PLTs) glycoproteins (GPs) was recently identified to contribute in immune thrombocytopenia (ITP). However, the potential impact of autoantibodies (AAbs) on megakaryocyte sialylation remains unclear. Aims: To investigate the effect of ITP AAbs on PLTs and megakaryocytes (MKs) sialylation and the subsequent impact on PLT survival. Methods: AAbs from well-characterised ITP patients induced GP-modifications were tested using a lectin binding assay. After incubation of MKs or PLTs with ITP or control sera, glycan changes were analysed by flow cytometry (FC). To investigate the impact of desialylation on PLTs life-span, the NOD/SCID mouse model was used. Results: 112 ITP sera were investigated in this study. 35 (31%) sera induced a significant increase in RCA signal on PLT surface compared to control sera from healthy donors (RCA-mean fold increase (RCA-FI): 3.23, range: 1.76-13.61, P = 0.0001). In addition, 23 (21%) sera caused higher ECL binding to test PLTs (ECL-FI: 2.31, range: 1.54-5.7, P = 0.0001). Injection of desialylating AAbs resulted in accelerated clearance of human PLTs from the circulation of the NOD/SCID mice which was significantly reduced by a specific neuraminidase inhibitor that prevents Background: Autoimmune hemolytic anemia (AIHA) is a rare autoimmune disease characterised by hemolysis associated with the presence of immunoglobulins (IgG, IgM, or IgA) and/or components of complement system on red blood cells (RBCs), which is usually demonstrated by a positive direct antiglobulin test (DAT). Depending on the presence of an underlying disorder, AIHA can be subdivided into primary and secondary and, by the temperature at which autoantibodies bind optimally to RBCs, into warm antibody AIHA (wAIHA), mixed AIHA (including both warm IgG and cold IgM antibodies), cold agglutinin disease (CAD), Paroxysmal Cold Hemoglobinuria (PCH) and DAT negative AIHA. A frequent finding in immunohematology is the presence autoantibodies on RBCs without clinical symptoms of hemolysis that may later develop. Aims: The aim of this study was to analyse serologic findings and transfusion support in patients with AIHA and also to analyse DAT positive patients without clinical symptoms. Methods: We included data for all adult patients with AIHA and DAT positive patients without clinical symptoms diagnosed and/or treated at the University Hospital Centre (UHC) Zagreb, Croatia in the period between 2014 and 2018. The diagnosis of AIHA was defined by anemia with features of hemolysis (elevated bilirubin and/ or elevated lactate dehydrogenase and/or low haptoglobin level) and a positive DAT. Results: The data from 64 patients (52% women) meeting the inclusion criteria was analysed. The mean age at the time of AIHA was 63 years (range 22-89 years). The mean Hg level at diagnosis was 68.60 g/L. DAT results were positive mostly with IgG+C3d (59%) or IgG (31%). Most patients had warm AIHA (70%). Other types of AIHA diagnosed were mixed AIHA (15%), CAD (11%), PCH (1.5%) and DAT negative AIHA (1.5%). In 6 cases alloantibodies were detected with autoantibodies in the patient's plasma. Patients were treated with corticosteroids as 1st line therapy and some with intravenous immunoglobulins (IvIG). In severe or refractory patients rituximab and/or splenectomy was applied. A total of 80% of patients were transfused at a mean hemoglobin level of 67.88 g/L. During this period we detected 136 DAT positive patients without clinical symptoms. Summary/Conclusions: Most patients from our study were diagnosed with warm type of AIHA, followed by mixed type AIHA and CAD. On the other hand, PCH and DAT negative AIHA were very rare, which is in concordance with relevant literature. Most patients were transfused despite therapy used, which is not desirable in patients with AIHA and should be better controlled, especially in moderate cases of anemias, where this is rarely necessary. A significant number of patients that were DAT positive without clinical symptoms may later develop AIHA and should be closely monitored. Background: Autoimmune haemolytic anaemia (AIHA) is a decompensated acquired haemolysis caused by the host's immune system acting against its own red cell antigens. AIHA is a rare disorder and although British Society of Haematology (BSH) guidelines for diagnosis and treatment were published in February 2017, there is little evidence for clinical practice in the United Kingdom. Aims: To investigate the approach to diagnosis, investigation and management of patients with AIHA in English NHS Trusts. Methods: A survey of diagnostic and management practice was designed, piloted and disseminated to clinical transfusion leads in all English acute NHS trusts from November 2017 to March 2018. Completion was by a consultant haematologist treating patients with AIHA but a response that represented a departmental consensus was encouraged. Results: Responses represented 42% (58/137) of English acute trusts. Median number of adults with AIHA diagnosed annually was 4-6. In the preceding 5 years, 31% (18/58) recalled at least one patient who had died due to AIHA. Although 7% (4/57) undertook a bone marrow biopsy in all patients, 93% required additional features, mainly: neoplasia, age over 60 or being treatment-refractory. For patients with suspected drug-induced immune haemolysis, 59% (34/58) would not organise confirmatory tests, either because it was considered unnecessary (29/34), or because clinicians were unsure how to access tests (5/34). When determining AIHA subtype, 29% (17/58) indicated there were no circumstances in which they would undertake cold antibody testing (antibody titre and/or thermal amplitude), with 12 considering this unnecessary and 5 unsure how to access tests. In 4 clinical scenarios of patients with AIHA and DAT positive to C3d AE IgG AE cold associated symptoms, up to 87% (47/54) of respondents would not test for cold antibodies. For first line treatment of primary warm AIHA, mean duration of prednisolone 1 mg/kg given before judging the patient refractory and reducing the dose was 3.5 weeks (SD 1.70, range 1-19 weeks). Second line treatment of choice was rituximab for 82% (45/55) of respondents and splenectomy for 5%. Intravenous immunoglobulin and splenectomy were the most cited rescue therapies. For primary cold haemagglutinin disease (CHAD), first line treatment was rituximab-based for 88% (49/56) but single agent steroid for 9%. We also explored the potential for future audit and research. 64% (37/58) of respondents were able to identify patients with AIHA who previously required transfusion. 96% (55/57) of respondents would consider supporting a registry of patients with AIHA requiring transfusion. The key questions that respondents thought a registry should address were: morbidity and mortality, treatment response, and differences in the diagnosis and treatment of AIHA subtypes. There was uncertainty over access to cold and drug-induced antibody tests and clinicians do not always conduct BSHrecommended cold antibody tests for AIHA with C3d positive DAT. Initial treatment of primary warm AIHA and CHAD broadly matched BSH guidelines although 44% (25/57) would continue prednisolone at 1 mg/kg beyond the recommended 21 days before starting a taper, with greater toxicity risk. Summary/Conclusions: The findings support the need for a range of research initiatives, including creation of an AIHA registry. Preoperative anemia is common and is associated with adverse outcomes in the peri-operative period. Preoperative anemia also increases the risk of allogeneic blood transfusions, which may lead to increased perioperative mortality, increased hospital length of stay and infections. Diagnosis and treatment of anemia is one of the tenets of patient blood management (PBM), along with reduction in unnecessary transfusions and diagnostic phlebotomy, as well as use of hemostatic agents to reduce bleeding among many others. Effective PBM is multi-disciplinary, multi-modal, timely, individualized and patient-centered. Early referral to PBM and multi-modal PBM interventions are associated with greater improvement in pre-operative hemoglobin. PBM has been shown to reduce transfusions and cost, while system-wide, multi-modal programs may also be associated with improvement in mortality. Using examples from our local research and practice, I will discuss three aspects of PBM. Iron and erythropoiesis stimulating agents (ESA) are effective, safe and used extensively in management of pre-operative anemia. Previous studies have questioned whether ESA leads to increased risk of thrombosis, however, recent systematic reviews do not support these concerns. Another PBM approach is to reduce bleeding during surgery by using hemostatic agents such as tranexamic acid (TXA). TXA reduces transfusion requirements in knee and hip arthroplasty, and is safe, widely available and relatively cheap. TXA is effective in both anemic and non-anemic patients, making it an attractive universal PBM strategy. Finally, recommendations and evidence-based guidelines on PBM exist, including the most recent international guidelines developed by the PBM International Consensus Conference. However, knowledge translation in PBM has been a problem and a number of barriers to its implementation have been identified. These include perceived or actual lack of expertise, time, and resources, as well as lack of physician and patient engagement. One way to address patient engagement is education through character driven animation and we are currently trying this approach.

4A-S17-02 LOW VS . HIGH HEMOGLOBIN TRIGGER FOR TRANSFUSION IN  VASCULAR SURGERY (TV): A RANDOMIZED CLINICAL  FEASIBILITY TRIAL (THE TV TRIAL) Background: Current guidelines advocate to limit red-cell transfusion during surgery, but the feasibility and safety of such strategy remains unclear as the majority of evidence is based on postoperative stable patients. Aims: We assessed the effects of a protocol aiming to restrict red-cell transfusion during elective vascular surgery. Methods: Fifty-eight patients scheduled for lower limb-bypass or open surgery of abdominal aortic aneurysm were randomized to a low-trigger (hemoglobin < 8.0 g/ dl, 5 mmol/L) vs. high-trigger (hemoglobin < 9.7 g/dl, 6 mmol/L) for red-cell transfusion throughout hospitalization. Intraoperative change in cerebral-and muscle tissue oxygenation was assessed by near-infrared spectroscopy. We used a nationwide registry to collect data on death and major cardiovascular events, which encompassed (1) severe adverse transfusion reaction, (2) acute myocardial infarction, (3) stroke, (4) new-onset renal replacement therapy, (5) vascular reoperation, and (6) amputation of the lower limb. Results: The primary outcome, mean hemoglobin within 15 days of surgery, was significantly lower in the low-trigger group: 9.46 g/dl vs. 10.33 g/dl in the hightrigger group (mean difference 0.87 g/dl; P = 0.022, longitudinal analysis) as were units of red-cells transfused ( Background: Controlled non-hemato-oncological studies have consistently demonstrated a single-unit red blood cell (RBC) transfusion policy as well as a stringent hemoglobin (Hb) RBC transfusion threshold to be safe and reduce blood product utilization. Yet, it is unclear whether these conclusions also apply to the hemato-oncological patient population. Aims: To quantify reduction of RBC blood product utilization by the introduction of a restrictive single-unit Hb-triggered RBC transfusion policy among the inpatient hemato-oncological population. Methods: Under the liberal transfusion protocol, applied up till November 1, 2017, standard double-unit RBC transfusion was indicated with a Hb threshold ≤ 8.1 g/dl and/or anemia-related symptoms. Following this date, the restrictive transfusion protocol was introduced involving a lowering of threshold to 7.3 g/dl and single-unit transfusion. For patients with an ASA-score of II-III and IV, a Hb threshold of respectively ≤ 8.1 g/dl and ≤ 9.7 g/dl applied. We evaluated RBC blood product utilization over a 6 month period starting December 1, 2016 (liberal protocol) and December 1, 2017 (restrictive protocol) in all hemato-oncological patients admitted for chemotherapeutic treatment including hematopoietic stem cell transplantation (HSCT) with an expected duration of neutropenia of ≥ 7 days. Analysis of categorical and continuous data was performed using the chi-square and Mann-Whitney test, respectively. Results: During both observational periods, 137 patients were admitted who in total received 164 therapy cycles, including 56 acute myeloid leukemia (AML) induction cycles and 69 autologous HSCTs. Distribution of indications of admittance, median age, duration of hospitalization and duration of neutropenia did not differ between both periods. During the restrictive period, in 303/402 (75.4%) of transfusions the assigned Hb trigger was adhered to. The percentage of single-unit transfusion episodes increased from 29/112 (29.0%) to 81/111(73.0%) with the introduction of the restrictive protocol. Overall, RBC blood product utilization per admittance did not reduce under the restrictive protocol (cumulative number of transfused RBC units 4.0 (interquartile range (IQR) 2.0-8.0) during the liberal versus 2.5 (IQR 0.0-9.0) during the restrictive period (P = 0.36)). However, RBC blood product utilization per neutropenic day demonstrated a trend towards reduction: 0.25 (IQR 0.11-0.33) versus 0.15 (IQR 0.00-0.32) units per day during the liberal versus restrictive period, respectively (P = 0.06). This reduction was mainly attributed to autologous HSCTs during which RBC blood product utilization decreased from 2.0 (IQR 0.0-2.0) to 0.0 (IQR 0.0-1.5) units (P = 0.06), corresponding to a reduction from 0.13 (IQR 0.00-0.21) to 0.0 (IQR 0.0-0.13) (P = 0.01) units per neutropenic day. Moreover, 14/38 (36.8%) patients during the liberal versus 21/31 (67.7%) during the restrictive period did not require RBC transfusion during admittance. Consequently, stringent Hb thresholds as compared to single-unit transfusions seem to more strongly impact RBC blood product utilization. Summary/Conclusions: A Hb-triggered single-unit transfusion policy results in a strong reduction of RBC blood product utilization in the setting of autologous HSCT. No utilization reduction was observed among other hemato-oncological inpatient populations receiving intensive chemotherapy. Further improvement of protocol adherence rates could potentially increase the benefit of this blood saving strategy.

4A-S17-04 ASSESSMENT OF HB CONTENT OF PACKED RED CELLS (PRBC): IS IT TIME TO LABEL EACH UNIT WITH HB  CONTENT? R Jain 1 , N Marwaha 2 and S Sachdev 2 1 Transfusion Medicine, Aiims, New Delhi 2 Transfusion Medicine, Pgimer, Chandigarh, India

Background: In the current era of evidence based medicine and individualized care of patients, RBC transfusion continues to be administered on the basis of conventional wisdom and the notion of an average benefit per unit. The existing blood transfusion practice based on the "number of units transfused" ignores the fact that the total Hb varies markedly among the individual RBC units. Aims: The present study was aimed at estimating the Hb content in packed red cell unit prepared by three different protocols from 350 ml and 450 ml whole blood collection in three types of blood donors: replacement blood donor (RD), first time voluntary donor (FTVD) and regular voluntary blood donor (RTVD). Methods: A total of 900 prospective blood donors were included in this study. Three hundred whole blood collections were performed in each of the three groups of donors (RD, FTVD, and RTVD). Within each group 100 collections were done in Double 350 ml, Triple 450 ml and Quadruple 450 ml blood bags respectively. A pre-donation venous sample was drawn from sample collection pouch for analysis in hematology analyzer as reference method for Hb concentration of donor. The Hb content of packed red cell units were estimated after collection of representative sample from the blood unit. Volume of PRBC unit was estimated by the formula of weight of blood in PRBC divided by specific gravity. The Hb content in unit was estimated by the formula: Hb content in unit = Hb value of the PRBC unit (g/dl) 9 volume of PRBC unit (dl). Results: In this study the Hb concentration (g/dl) was comparable among three types of blood donors except that RTVD had lower Hb values when compared to RD (P = 0.007). Hemoglobin concentration of PRBC ranged from 14.2-29.6 g/dl; mean Hb was 21.02 AE 2.90 g/dl. Net Hb content of PRBC bag was lower in PRBC prepared from RD as compared to FTVD (P = 0.0001) and RTVD (P = 0.008). The Hb content of PRBC units prepared from 450 ml collection ranged from 35.19-87.36 g and from 350 ml collection ranged from 30.77-65.78 g. We observed a wide range of net Hb content in the PRBC units and the correlation coefficient showed the strongest association of net Hb content of the PRBC unit with the overall volume of PRBC (r = 0.730, P = 0.0001).Higher volume PRBCs have more Hb content. Volume of PRBC bags in the study ranged from 155 ml to 370 ml (including both 350 and 450 ml collections). Summary/Conclusions: The present study shows that labelling Hb content of the PRBC unit help in better inventory management for patients. The Hb content may help in decision making for release of units for paediatric/low weight versus adults/ higher weight patients. Adopting a policy of optimizing dosage of RBC transfusion could have the potential to significantly improve RBC utilization and decrease patient exposure to allogenic blood. This would help further in the clinical transfusion practices based on evidence.

4A-S17-05

NV More, P Desai, S Rajadhyaksha, A Navkudkar and N Deshpande Transfusion Medicine, Tata Memorial Centre, Homi Bhabha National Institute, Mumbai, India Background: Red Blood Cell (RBC) transfusion is an important medical therapy benefiting the patient in a wide spectrum of clinical setting. Critically ill Intensive Care Unit patients in particular, as well as medical and hemato-oncology patients, are among the largest group of the user of RBC. Periodic review of blood components usage is essential to assess the blood utilization pattern in any hospital or health care set up. Our institute is a 639 bedded tertiary care oncology centre with approximately 18,000 to 20,000 RBC transfusions annually. These transfusions are required in various stages of patient treatment like chemotherapy, radiotherapy, surgical and palliative care and there are established guidelines by the institute to be followed by clinicians. Aims: To study clinical practices of RBC transfusions based on indications and to evaluate appropriateness of RBC utilization practices at the institute. Methods: This was a prospective observational study, started after approval from Institutional Ethics Committee. Total of 4413 RBC transfusion events in adult patients over a period of four months were included and analyzed as per institutional guidelines for their appropriateness. Details of transfusion events in form of pre transfusion hemoglobin, indication of transfusion, type of request, number of unit requested and issued, time of issue, site of transfusion and adverse reactions, etc were obtained from Department of Transfusion Medicine records. Overall statistical analysis was descriptive using SPSS software. Chi-square test in cross tables was applied to see the relationship between different variables and considered significant if p-value was < 0.05. Results: Total 4413 RBC transfusion events for 2012 patients were analyzed. There were 1877 (43%) events in 628 patients of medical oncology and 2536 (57%) in 1384 patients of surgical oncology. Maximum transfusions were received by patients in age group of 41 to 60 years (47%). Total 83% of transfusion events were appropriate as per institutional guidelines. All transfusions administered in operation theatre were found to be appropriate with p value < 0.05. Inappropriateness was more 53%(396/735) and significant in daycare setup (P < 0.05). Anemia was the most common indication of RBC transfusion observed in 90% of events (3971/4413). Total 62% RBC transfusions were given as planned and 38% as urgent transfusions. Most common adverse transfusion event observed was allergic reaction in 0.3% of total transfusion reactions. Summary/Conclusions: Clinical practice of RBC transfusions in our hospital was largely found to be appropriate and rational with adherence to institutional guidelines. Blood utilization audits should be conducted regularly by transfusion services and results should be discussed with clinician for ensuring judicious use of the scarce resource. The concept of Transfusion Safety Officer (TSO) can be introduced for better coordination between clinicians and blood transfusion services to improve practices.

4A-S18-01

Paul-Ehrlich-Institut, Langen, Germany On a global scale, blood services are quite diverse in regard to aspects like organisational structure, regulatory background, donor populations, donation rates or pathogen epidemiology. The World Health Organization (WHO) recognizes blood and blood products as essential medicines and provides guidance to member states for various aspects like blood regulation, best practices in blood collection and transfusion, or screening parameters. More recently a WHO guideline on residual risk of transfusion associated infections has been established which may facilitate decision-making for the most appropriate screening algorithms. It emphasizes the need for regional evaluation of screening assays and regulatory control of blood-associated IVDs. Background: Babesia, a protozoan parasite that infects red blood cells, is a leading infectious cause of mortality in U.S. transfusion recipients. Babesia is usually transmitted through the bite of an infected tick but may be transfusion transmitted (TT) or transmitted from mother to child during pregnancy. Babesiosis is a world-wide disease; the ticks that carry Babesia have a global distribution. Babesiosis has been reported throughout Europe and in Canada, Korea, India, and Japan. Prospective testing of blood donations in endemic areas of the U.S. revealed 0.38% of donors were positive for Babesia DNA or antibodies (Moritz, NEJM, 2016) Aims: -To report results of ongoing Babesia clinical trial -To explain significance of Babesia as a TT infection Methods: In cobas â Babesia for use on the cobas â 6800/8800 Systems, is a qualitative polymerase chain reaction nucleic acid amplification test, developed to detect in whole blood (WB) donor samples the 4 Babesia species that cause human disease: B. microti, B. duncani, B. divergens, and B. venatorum. Testing began in October 2017 under a U.S. FDA-approved Investigational New Drug Application. WB was collected into a proprietary medium that lysed red blood cells and stabilized Babesia RNA and DNA. Donations were collected in states with high, low, and no Babesia endemicity and screened as individual blood donor (IDT) samples. Reactive index donations were retested in simulated minipools of 6 (MP6), plus 3 IDT replicates with cobas â Babesia. Reactive index donations were also tested with 2 validated alternate Babesia NAT and for B. microti IgM and IgG antibodies. Donors with reactive results were invited to enroll in a follow-up study to test for additional evidence of infection. Results: To date, 256,802 valid donations have been screened with cobas â Babesia, and 15 (0.006%) were reactive. 13 of 15 (87%) initially-reactive donations were confirmed to be positive for Babesia with a positive alternate NAT or serology result. 1 of 13 (8%) confirmed-positive donations was collected in a state with low Babesia endemicity (Pennsylvania), and 1 (8%) was collected in a state where Babesia is not considered endemic (Iowa). 11 of 13 (85%) confirmed positive donations were collected in states with high endemicity. 8 of 13 (62%) confirmed Babesia-positive donations were detected in late fall or winter. All 13 (100%) confirmed Babesia-positive donations were reactive in MP6. Serology results are available for 12 of 13 confirmed-positive donations: At index, 6 of 12 confirmed Babesia-positive donations were only IgG-positive, while none were only IgM-positive; 3 were positive for both IgG and IgM. 3 of the confirmed-Babesia positive donations were negative for both IgG and IgM antibodies. cobas â Babesia showed an overall specificity of 99.999% (256,787/256,789; 95% Exact CI: 99.997%>100%). Summary/Conclusions: The cobas â Babesia test successfully identified 13 Babesiapositive donations, including 3 confirmed-positive donations with no IgM or IgG reactivity. 2 donations were collected in states considered low-or non-endemic for Babesia. 8 confirmed-positive donations were collected outside of the summer Babesia season, when most clinical cases occur. Screening with cobas â Babesia continues in several laboratories. cobas â Babesia is not FDA licensed or available commercially. Background: Babesiosis in humans is caused by the erythrocytic protozoan parasite, Babesia microti which is transmitted by tick bites, but is also transfusion transmitted. Although frequently asymptomatic or presenting with flu-like symptoms in a normal host, if immunocompromised infection can lead to severe complications and death. B. microti is endemic in the North Eastern/Upper Midwest United States where partial testing of donations has been implemented. In Canada, a 2013 study of~14,000 donors did not identify any B. microti antibody-positive samples, suggesting low risk at that time, but risk should be monitored. Aims: To evaluate the prevalence of B. microti-positive donations in potentially atrisk areas in Canada. Methods: Between July and November 2018, 50,752 blood donor samples were selected from sites near the US border. Minipools were tested for B. microti nucleic acid by Transcription Mediated Amplification (TMA) using the Procleix â Babesia Assay on the Panther â system with individual testing on reactive pools. Reactive donations were also tested by B. microti-specific: American Red Cross (ARC) IgG immunofluorescence assay [IFA] and IMUGEN IFA/PCR. A subset of 14,758 TMA-negative samples, primarily from the province of Manitoba and eastwards to Nova Scotia, were tested for B. microti antibody using the ARC IFA and if positive, the IMUGEN IFA/PCR. Donor age, sex, donation status, residential location and collection site location were recorded. Donors who tested reactive/positive were informed, deferred and asked about risk factors (possible tick exposure and travel within Canada, the USA and elsewhere, history of symptoms) and a follow-up sample was requested for supplemental testing (TMA, ARC IFA). Reactive donations were removed from inventory. Results: The 50,752 donor samples were proportional to collections in target geographic regions. Age group, sex and donation status were also similar to the donor base in the collection areas. One sample from Winnipeg, Manitoba was TMA reactive and antibody positive on supplementary testing. The donor did not remember symptoms or spending time in wooded areas. He visited the city of Fargo, North Dakota, USA. The subset of 14,758 samples tested for antibody were also proportional to collections in the targeted areas. Four antibody-positive samples were identified from mid-September to October 1, all in south western Ontario near Lake Erie. None were TMA reactive. Three were interviewed and none remembered any symptoms, any likely tick exposure, or relevant travel within Canada or the USA. Summary/Conclusions: This is the largest B. microti prevalence study in Canada.

The results indicate very low prevalence with only 1 TMA-confirmed-positive donation of 50,752 tested. The donor was from the only region in Canada where one autochthonous human case has been reported and active tick surveillance identified B. microti positive tick populations. Seropositive donations in south western Ontario may suggest low prevalence in that region, but interpretation is less certain due to lack of corroborating supplementary results or case history. Given the close proximity to the US border, forgotten US travel should not be ruled out.

4A-S18-04

Background: The protozoan parasite Toxoplasma gondii is prevalent in animals and humans worldwide. Wild and domestic felids are the definitive hosts, and homoeothermic animals serve as the intermediate ones. After primary infection, the parasite persists lifelong within latent tissue cysts. Transmission is by ingestion of undercooked or raw meat infected with cysts, by ingestion of food or water contaminated with oocysts, or transplacentally. However, it can also be acquired by blood transfusion and organ transplantation. Toxoplasmosis can be a severe disease in immunosuppressed people and neonates whose mothers have acquired primary infection during pregnancy.

Aims: There is no information about the specific epidemiology of T. gondii infection in blood donors in Portugal. Therefore, we sought to determine the seroprevalence of T. gondii and associated risk factors in the population of blood donors in Portugal. Methods: Between September 2015 and July 2017, 520 blood donors who attended the Portuguese Blood and Transplantation Institute blood banks located in Oporto, Coimbra and Lisbon, and also at regional blood collection meetings, were invited to participate in the study. A written informed consent was obtained and a questionnaire about socio-demographic and behavioural variables was answered. Sera were assessed for IgG antibodies to T. gondii by a modified agglutination test (MAT) commercial kit (Toxo-Screen DA â bioM erieux, Lyon, France). Results: Of the 520 blood donors (mean age 38.55 AE 11.14; range 18-65 years old), 38.1% were positive for antibodies to T. gondii. When questioned about toxoplasmosis, almost half the blood donors did not have any knowledge about the disease. The Centre of Portugal had the highest seroprevalence (55.1%) followed by the North (37.2%) and the South (25.3%). Blood donors living in rural areas had a significantly higher seroprevalence (P = 0.001) than those living in urban areas. Seroprevalence increased with age, with the highest seroprevalence (60.2%) found in the age group of 46-55 years old (multiple logistic regression [MLR]: OR = 7.68; CI: 4.08-14.46; P < 0.001), and decreased with educational level (P < 0.001). Engaging in soil-related activities (gardening or agriculture) was significantly related to T. gondii seropositivity (P = 0.02). Regarding water consumption, untreated sources (even though including mineral and tap water) was confirmed as a risk factor (MLR: OR = 2.72; CI: 1.27-5.86; P = 0.001). Other behavioural and eating characteristics, including cats in the household, eating raw or undercooked meat, processed pork products, or not washing raw fruit and vegetables before eating, were not associated with T. gondii infection. Summary/Conclusions: The risk of T. gondii transmission through blood transfusion is low, and serologic testing of antibodies, with exclusion of blood donors, appears not to be feasible. Immunosuppressed individuals, organ transplant patients and pregnant women, should receive T. gondii antibody-negative blood components for transfusion. This study explored the epidemiology of T. gondii in Portugal thus providing useful information on the seroprevalence and potential risk factors for T. gondii transmission. Information regarding toxoplasmosis and its prevention could be promoted by medical and public health authorities among blood donors, and also the general population, when addressing policies, and designing screening programs, for monitoring and controlling infection and disease in Portugal.

4A-S18-05 WHO IS SYPHILIS TESTING EXCLUDING? C Reynolds 1 , C Pearson 2 , K Davison 2 and S Brailsford 1 1 NHSBT/PHE Epidemiology Unit, NHS Blood and Transplant 2 NHSBT/PHE Epidemiology Unit, Public Health England, London, United Kingdom Background: Screening for treponemal antibodies to detect syphilis in blood donors has been in place in England since the 1940s. There have been no reported syphilis transfusion transmissions in England since records began in part due to sensitivity of the organism to cold storage. Since we have specific tests in place for other sexually transmitted infections such as HIV and hepatitis B virus (HBV), the utility of syphilis screening is often questioned. However, it may be a useful proxy for higher risk behaviours particularly following shortening of deferrals for higher risk sexual behaviours from 12 to 3 months in November 2017 and against a background of increasing infectious syphilis in the general population. Aims: Here we describe the epidemiology of recently-acquired syphilis in blood donors in England compared with HIV and acute HBV infection between 2009 and 2018. Methods: Monthly donation testing results are collected from the NHS Blood and Transplant (NHSBT) screening centres and reference laboratory. The demographics, possible sources of infection, and compliance to donor selection in confirmed positive donors are collected by proforma at post-test discussion with the NHSBT clinical team. Recent syphilis is classified as IgM positive and/or recent history including a negative donation within 12 months for regular donors. Results: Between 2009 and 2018 there were 153 recent syphilis cases, 121 HIV and 32 acute HBV infections identified by donation screening. Recent syphilis rates per 100,000 donations increased from 0.66 to 1.64 whereas HIV decreased from 1.04 to 0.19 with less than 5 positive donations in 2018. Acute HBV rates rose slightly from 0.28 to 0.38 in 2018. Males outweighed females accounting for 71.9%, 63.6% and 59.4% of cases of recent syphilis, HIV and acute HBV respectively. Nearly a quarter of cases of recent syphilis and HIV were seen in donors below 25 years old. Of the male donors with recent syphilis, 58.2% reported sex between men and women (SBMW), 19.1% sex between men (SBM) and 22.7% did not report a risk. This contrasted with HIV where 45.5% of male donors reported SBM, just 2.6% not reporting a risk. Overall 19, 32 and 3 males with recent syphilis, HIV or acute HBV respectively were non-compliant to the SBM deferral in place at the time of donation. In 2018, 26 donors with recent syphilis aged 23-65 years (median 36 years) were excluded from the donor pool, including 3 non-compliant to the SBM deferral. There were fewer than 5 HIV cases identified in 2018, all over 40 years old, all compliant, reporting SBMW. Of the 6 HBV acute cases in 2018, 5 were male, all but one in the 45 and over age-group. Summary/Conclusions: Over the 10 year period demographics of recent syphilis cases appeared similar to HIV with highest rates in young males, albeit lower proportions reporting SBM. Following the switch to a 3 month deferral, HIV case detection continued at low level, while syphilis screening continued to exclude higher numbers spanning all age-groups, potentially at risk of other sexually transmitted infections, including non-compliant donors. Background: Globally, an estimated 113 million blood donations are given annually. In the blood service we are obliged to monitor donor health and ensure that blood donation is safe. In recent years, large-scale blood donor cohort studies in several countries have increased our knowledge on health effects of blood donation. Health concerns relate both to immediate side effects like fainting and to possible long-term health issues related to repeated blood or plasma donation. The studies have provided us with data that can now help us introduce an evidence-based individualised donor care -a parallel to personalised medicine. Individualised donor care in the management of iron depletion: Studies have shown that a large percentage of our frequent whole blood donors, especially young women, are iron depleted. Iron depletion is a strong predictor of deferral for low haemoglobin but has also been associated with e.g. restless legs syndrome and lower birth weight in children of frequent donors. The risk of iron deficiency can be mitigated by ferritin-guided prolongation of interdonation intervals or by iron supplementation. Prolongation of interdonation intervals can challenge our inventories. Iron supplementation, on the other hand, may give gastrointestinal side effects and other effects have been proposed as well, e.g. the masking of malignant disease and increased iron availability with subsequent risk of infection. In a large study we found that iron supplementation is not associated with increased risk of infection. What is the optimal balance between iron supplementation and prolongation of interdonation intervals? A growing number of blood services have implemented various flavours of iron management regimens generating more results. Moreover, genetic studies in e.g. the UK, US, Holland, and Denmark can help us to find donors at high risk of iron depletion or low haemoglobin. We can use all these data in a Big Data approach in the pursuit of an individualised risk assessment model. Other risks for blood donors: The presentation will also cover other risks associated with donation. New studies identify predictors of fainting after blood donation and also new interventions to prevent fainting. The global demand for plasma derived medicinal products has increased severalfold the last 10 years. Plasma donors are bled up to 104 times per year in the US. Very little is known about the health effects of frequent plasma donation. We know that immunoglobulin levels decrease with frequent donation but how does this affect health? Summary/Conclusions: The precautionary principle mitigates risk through early intervention prior to evidence. We tolerate next to no risk of transfusion-transmitted infectious diseases. The health of the blood donors, however, has not been protected similarly. We owe to our whole blood and plasma donors to investigate health effects of blood donation and ensure their safety. While the first attempts may not be perfect, we now have the tools to construct models for individualised donor care. Background: In 2014, the ISBT, AABB, IHN and EBA jointly issued the Standard for Surveillance of Complications Related to Blood Donation which categorized Donor Adverse Events (DAE) into 6 categories (16 subcategories) defined by specific criteria. Severity and Imputability were briefly described but were optional. Subsequent validation of these categories demonstrated consistency in categorizing reactions, but wide variation in assignment of Severity. In 2018, with international input, the AABB Donor Biovigilance Committee developed a Severity Grading Tool (SGT) using a recognized medical adverse event grading system in which neutral Grades replace subjective terms (mild, moderate, severe). Aims: A large US blood collection establishment (BCE) applied the draft SGT to assess its use in real cases of DAE. Methods: We performed retrospective analysis of all allogeneic and apheresis needle-in donations between 1/1/2017 to 9/30/2018. Severity grading was assigned based on criteria defined by the SGT. Database review of DAE was performed, and each event was assigned a Grade based on the type of outside medical care (OMC), and on specific key search terms. Search terms for OMC included Emergency Room, Emergency Medical Response, Urgent Care, Healthcare Professional, and Hospital Admission. Additional specific key search terms included fracture, concussion, laceration, dental injury, surgery, and hospitalization. Since duration and activities of daily living (ADL) limitations were not captured in our DAE database, cases in our DAE claims' database were reviewed. Case files of events classified as Grade 2 or higher were individually evaluated by a physician for grading accuracy. Results: In 1,511,758 needle-in collections, 31,320 DAE were graded for severity. The majority (16,143, 51.5%) were vasovagal reactions (VVR), followed by 8,570 apheresis-related (27.4%), 6,572 needle-related (21.0%) and 35 allergic (0.1%) events. The majority of DAE were Grade 1 accounting for 98.6% of all DAE, followed by Grade 2 (1.2%), and Grade 3 (0.1%). There were 2 Grade 4 and no Grade 5 DAE. Among the VVR, 98.1%, 1.6%, 0.2% and 0.01% were Grade 1, 2, 3, and 4 respectively. Grade 3 VVRs included 14 concussions, 11 fractures, 1 dental injury, and 2 pre-faint and 8 fainting events requiring hospitalization for work-up. Two Grade 4 VVRs involved falls resulting in intracranial hemorrhage requiring immediate medical intervention. For allergic and apheresis DAE, there were only 6 and 5 Grade 2 reactions respectively, and no Grade 3 or 4 events. Needle-related DAE included 98.3% Grade 1, 1.6% Grade 2, 0.1% Grade 3, and no Grade 4 events. Of the six Grade 3 Needle-related DAE, 4 were nerve irritations lasting > 6 months, and 2 were DVTs requiring hospitalization. Summary/Conclusions: The SGT provided consistent assignment of severity for the majority of DAE, based on Outside Medical Care and Specific Key search terms. Assignment of severity based on Impact on Activities of Daily Living or on Duration of injury/condition requires tracking over time making such assignments more difficult; modification of our DAE tracking database and claims database to capture ADL and Duration should improve severity assignment for such cases. Background: The International Haemovigilance Network (IHN) has collected aggregate data on complications of whole blood and apheresis donations from member national haemovigilance systems (HVS) since 2006. Aims: We analysed the data collected in 2006-2016 in order to learn from the data and consider future improvement of data collection. Methods: National HVS entered annual data on donor complications in the passwordprotected "ISTARE" (International Surveillance of Transfusion Adverse Reactions and Events) online database. From 2008 the donor complication spreadsheet allowed entry of separate data for whole blood donation (WBD) and apheresis, but also provided an option for entering data for all donation types. Annual numbers of whole blood and apheresis donations were also collected. The harmonised international standard definitions were implemented in 2015. Reactions were captured according to severity level (mild, moderate, severe) but without distinction between donor sex or first time vs repeat donation. Extracted data were used to calculate national and aggregate donor complication rates (generally per 1000 donations). Results: Twenty-four HVS provided figures for donations and donor complications for one or more years (median years per country was 7, IQR 2-8). The total number of country years (CY) was 138, covering 155 million donations. The overall complication rate was 6.3/1000 donations and the median country rate was 3.2 complications/1000 donations (IQR 1.1-10.1). Rates were generally consistent within a HVS from year to year but showed considerable variation between HVS; this was also the case for reactions classed as severe. Not all countries differentiated between mild and moderate reactions and some reported all reactions under a single severity level. Vasovagal reactions were the most commonly reported complication: overall 4.6/ 1000 donations, median country rate 3.1/1000 donations (IQR 0.6-7.7). Rare and apheresis-related types of complications such as generalized allergic reaction (0.10 per 100,000, 40 CY), and major blood vessel injury (category available since 2015; overall 0.12 per 100,000, 6 CY) were only reported occasionally. Eighteen of the HVS provided separate data for complications of whole blood and apheresis donations in one or more years (total 89 CY, 101.6 million WBD and 26.3 million aphereses, total 128 million donations). For these HVS the median rate of vasovagal reactions was 3.4/1000 WBD (IQR 1.0-9.1) and 1.5/1000 apheresis procedures (1.0-4.2) . Reported haematoma rates were higher for apheresis than for WBD: the median per HVS was 0.39/1000 WBD (IQR 0.31-1.2) vs 4.2/1000 aphereses (0.69-5.6); rates of arm pain and/or nerve injury (not separated in 2006-2013) also tended to be higher: median 0.09/1000 with WBD, IQR 0.03-0.34, vs 0.39/1000 with apheresis, 0.05-0.57. Summary/Conclusions: International reporting allows HVS to study rates of blood donation complications, to distinguish between WBD and apheresis complication rates and capture information about very rare events. Variability of reporting and of severity assessment between countries impairs the feasibility of comparisons between HVS. Work is needed to improve harmonisation of classification of donation complications and severity assessment for data comparison and research. Background: To prevent iron related Hb loss, screening with ferritin testing was implemented in Stockholm county (approx. 52000 registered blood donors) during a two-year roll-out. Iron supplementation is offered to blood donors but has not prevented Hb deferrals resulting in 8000 control visits per year. Ferritin testing is hypothesized to increase iron compliance. Aims: Implementation of ferritin testing for surveillance of iron levels for the entire blood donor population with specific attention to new donors, women returning after pregnancy, donors with low Hb and at return visit after low Hb. Yearly testing of plasma and platelet donors. Methods: Ferritin testing, following a staff education program, was implemented for applicant donors, donors with low Hb, women after pregnancy, apheresis donors, followed by screening of registered blood donors per donation site. After initial screening, donors will be tested at each 4 th (women) or 8 th (men) donation, and with yearly testing of young adult blood donors below 25 years. Six nurses were educated to process ferritin and blood count results. Donors with aberrant ferritin were contacted by letter. Results: Establishment of cut-off levels and algorithms for ferritin testing and iron treatment was evidence based but met practical limitations such as number of analyses and results that could be processed per week, limitations in LISS set-up, blood demand contra preferred cut-offs, iron supplementation compliance. For applicant donors, Hb testing show that 20% of female and 9% of male applicants cannot be registered because of low Hb (125 and 135 mg/L respectively). Adding ferritin testing, a preferred cut-off level of 30 lg/mL (male reference level), would result in additionally 24% female and 1.3% male applicant donor loss. As this would threat the blood demand, cut-off was set to 15 lg/mL for women, above the female reference 10 lg/mL, with an acceptable 6% loss of female applicant donors. For registered blood donors, 4000 mg of extra iron tablets were offered at low ferritin (10-29 lg/mL). This was sometimes combined with prolonged intervals and often repeated before ferritin was restored above 30 lg/mL. Donors with ferritin below 10 lg/mL (in 0.6% applicant donors, 0.8% registered donors) or above 600 lg/mL (0.5% applicant donors, 0.1% registered donors) were deferred and recommended to see their physician. For Hb deferral, the interval was prolonged from 3 to 5 months, irrespective of ferritin levels. This, together with iron supplementation, resulted in an increase from 50% to 70% approved Hb at return. The team of nurses processing ferritin and blood count results (1½ nurse fulltime weekdays) reacted to approximately 40 donor results daily, representing 20% of test results. Summary/Conclusions: Many female donor applicants have suboptimal ferritin levels although they meet required Hb for donation. Iron treatment was added to retain donors with low ferritin as only prolonged intervals may danger the blood supply. For implementation of ferritin testing, it is necessary to have a well-functioning and agile organization to create and apply algorithms for testing, extension of intervals and iron treatment. Background: Since November 2017 a new donor screening regime is introduced in the Netherlands where serum ferritin levels in whole blood donors are measured periodically to further control potential iron deficiency in donors. Donor deferral thresholds are set at 30 and 15 ng/mL, and donors are deferred for six and twelve months respectively if ferritin levels are below these values. As limited information is available on ferritin recovery in whole-blood donors, the policy is introduced in parts such that adaptations to the implementation may be considered based on intermediate results and the impact of the measure on donor well-being can be evaluated. Aims: To assess the effect of donor deferral on donor ferritin levels. Methods: Ferritin levels are measured in new donors and at every fifth donation in repeat donors. Donors with ferritin levels below the indicated thresholds are deferred and ferritin is re-evaluated at their return for donation after six or twelve months. The policy allows estimating long term trends in ferritin levels post donation in repeat donors. As ferritin levels are measured in all new donors a reference distribution of ferritin levels in healthy individuals is obtained as well. Results: Among repeat donors 46% (44% of 16,433 male donors, and 48% of 13,525 female donors) have ferritin levels below 30 ng/mL and are deferred for their next donation. Furthermore, the distributions of ferritin levels in repeat male and female donors are similar and each has an average ferritin level of 43 ng/mL. In contrast, we found that only 27% of new female donors (n = 13,283) and 1.7% of new male donors (n = 6,334) have a ferritin levels below 30 ng/mL. The average ferritin level in new donors was 148 ng/mL for males and 60 ng/mL for females. Comparing the ferritin levels in new and repeat donors, a reduction in average ferritin levels between 1.5 and 2.0 was observed in female donors and between 3.2 and 4.4 in male donors. Both ratios increased with donor age. At the end of December 2018 2884 donors with low ferritin levels returned for donation after six or twelve months deferral. Repeat ferritin measurements show that on average the ferritin levels in female donors increased by 13 ng/mL per year whereas average ferritin levels in male donors increased by 34 ng/mL per year. Summary/Conclusions: In line with earlier findings in literature our results show that repeat donations substantially reduce ferritin levels in repeat donors. These range from 1.5 to 2.0 in female and from 3.2 to 4.4 in male donors, who generally have higher ferritin levels. Deferral of donors with low ferritin levels seems to be effective in increasing ferritin levels in donors, however, further monitoring of follow-up in repeat donors is warranted to see whether the proposed scheme allows for sufficient donor recovery over time. There are~7000 different rare diseases and the genes for half have been identified. Approximately 3.5 million UK citizens experience premature ill-health because of a rare disease. A conclusive diagnosis is generally not reached and on average the diagnostic odyssey lasts 2.2 years. The main aims of the 100,000 Genomes Project are to reduce the diagnostic delay by embedding whole genome sequencing (WGS) to accredited standards in the care path of patients with undiagnosed rare diseases. The project started in 2013 and DNA samples from 100,000 NHS patients and their close relatives have been analysed by WGS. Here we review the results from the NIHR BioResource pilot study for the 100,000 Genomes Project comprising phenotype and genotype data from 13,037 individuals recruited at 83 hospitals using approved eligibility criteria for 15 rare disease domains. We determined the population structure including ethnicity and relatedness estimation, high level phenotypes collected using Human Phenotype Ontology (HPO) terms and quality control and summary metrics for samples and variants. The sequence resource contains over 165 million unique variants in the 10,258 genetically independent samples, with 47% of variants previously unobserved in other large scale publicly available genome datasets. We summarise the curation of gene lists and pertinent findings in 2,000 unique diagnostic-grade genes for the 15 domains. Over 1,000 reports assigning pathogenic or likely pathogenic causal variants have been issued with diagnostic yields varying between domains from 0.5% to 55%, while the proportion of novel causal variants ranged between 25% and 73%. We show the power of the Bayesian association test, BeviMed, to recapitulate decades of clinical genetics discoveries and by identifying >30 novel genes and novel diseasecausing variants in the non-coding space of the genome. We show how typing data for all red cell, HPA and HLA class antigens can be extracted from WGS data. We mined the data from the 100,000 Genomes Project and similar sequence resources to re-version the probe content of the UK Biobank Axiom array. We genotyped 7588 donors from England and the Netherlands with this new array and observed a 99.92% concordance when comparing 92,387 blood centredetermined antigen typing results with genotype-determined ones. For the 48 red cell and HPA antigens that were available for 7,473 donors, the array typing provided a 3.6-fold increase in typing results per donor (13.2 vs 47.9) and 38 rare donors were identified. Using the genotyping data we identified 2.6 times more compatible units among this cohort of donors when blood demand was modelled using referral data from 3,146 English patients with more than three red cell alloantibodies. In conclusion the 100,000 Genomes Project has shown the feasibility of using WGS across a universal healthcare system to deliver a diagnosis for patients with rare diseases. Based on these results the NHS has commissioned the analysis of another 500,000 DNA samples from patients with cancer and rare disease. With analysis of DNA by WGS and arrays becoming part of routine clinical care, blood services must develop competencies to extract transfusion and transplant relevant information from clinical-grade genotyping data. Next-generation sequencing (NGS) enables the sequencing of thousands of genes, the exomes, and even entire genomes by single experiments at a reasonable price. There have also been advances in cytometry: Use of antibodies with different fluorescence tags enables simultaneous monitoring of the expression of dozens of antigens. However, immunological methods cannot detect every variant discovered by NGS. Genome sequencing reveals not only the exome but also the regulatory elements of transcription/translation, such as promoters and enhancers. RNA sequencing determines which genes and spliced transcripts are expressed. It is amazing to realize how much this novel technology has been contributing to the better understanding of various biological phenomena. Since the initial cloning of the human blood group A transferase cDNAs in the early 1990s, we have been studying the ABO genes, A and B glycosyltransferases, and A and B oligosaccharide antigens. Various scientific disciplines including genetics, immunohematology, biochemistry, enzymology, and glycobiology have been applied to their study. We have made several important scientific contributions. We demonstrated the central dogma of ABO: the A and B alleles at the ABO genetic locus encode A and B transferases, which synthesize A and B antigens, respectively. We elucidated the allelic basis of the ABO system. We found 4 amino acid substitutions between A and B transferases and inactivating mutations in O alleles. We became the first who succeeded in the ABO genotyping, discriminating the AA and AO genotypes, as well as the BB and BO, which was impossible by the immunological approach. We have taken a simple experimental strategy: preparation of eukaryotic expression constructs of A/B transferases and their derivatives, DNA transfection to human HeLa cells or their sublines, and immunological detection of the A/B antigen and/or biochemical examination of the enzymatic activity. We used this to show that the codons 266 and 268 are crucial in determining the sugar specificities of GalNAc/galactose of A/B transferases. We also identified mutations in several subgroup alleles causing restricted substrate use and diminished transferase activity. We also showed that cis-AB and B(A) alleles specifying the expression of both A and B antigens by single alleles encode A-B transferase chimeras. Since then, other scientists have characterized more than 250 ABO alleles. Recent human genome sequencings have identified many more single nucleotide polymorphism variations. The genome sequences of many species are also available. Taking advantage of those sequences and associated information, we have expanded our research to include evolutionarily related a1,3-Gal(NAc) transferases and their genes and scaled it up from the genetic to genomic level. In this talk, I would like to present the followings. 1: Our elucidation of the molecular genetic basis of the ABO blood group system (as requested by the organizer); 2:

Identification of novel ABO alleles by others; 3: More SNP data from genome sequences and potential problems for ABO genotyping; 4: Findings obtained from analysis of ABO genes from other species; bacteria, vertebrates, to primates; 5: a1,3-Gal(NAc) transferases and their genes and the crosstalk between A transferase and Forssman glycolipid synthase (FS); and 6: the potential causes of generation of ABO polymorphism and of species variations of the GBGT1 gene specifying the FORS polymorphism. In recent years, there has been a concerted effort to improve our understanding of the quality and effectiveness of transfused blood components. The expanding use of large datasets built from electronic health records allows the investigation of potential benefits or adverse outcomes associated with transfusion therapy. Together with data collected on blood donors and components, these datasets permit an evaluation of the effect of donor and blood component factors on transfusion recipient outcomes. Large linked donor-component recipient datasets provide the power to study exposures relevant to transfusion efficacy and safety, many of which may not otherwise be amenable to study for practicality or sample size reasons. Analysis of these large blood banking-transfusion medicine datasets allow for characterization of the populations under study and provide an evidence base for future clinical studies. Knowledge generated from linked analyses has the potential to change the way donors are selected and how components are processed, stored and allocated. However, unrecognized confounding and biased statistical methods continue to be limitations in the study of transfusion exposures and patient outcomes. Results of observational studies of blood donor demographics, storage age, and transfusion practice have been conflicting. This review will summarize statistical and methodological challenges in the analysis of linked blood donor, component, and transfusion recipient outcomes.

4C-S20-01 A LARGE DELETION SPANNING XG XG AND GYG2 GYG2 CONSTITUTES A GENETIC BASIS OF THE XG NULL PHENOTYPE, UNDERLYING ANTI-Xg a PRODUCTION Background: The XG blood group system comprises the homologous antigens Xg a and CD99. The CD99 gene resides within pseudoautosomal region 1 on the short arms of the sex chromosomes and thus mimics autosomal inheritance. XG, on the other hand, is X-linked and straddles the pseudoautosomal boundary; a truncated pseudogene composed of only the first 3 exons remains on the Y chromosome and therefore males carry a sole full-length copy of XG. This phenomenon manifests as asymmetric frequencies of the Xg(a+) phenotype between the sexes: roughly 11% of women and 34% of men are Xg(aÀ). Also, whilst Xg a immunization is rare, the vast majority of all anti-Xg a makers reported are men. Recently, we reported that the rs311103C variant disrupts a GATA motif between XG and CD99. This abolishes erythroid Xg a expression and causes the common Xg(a-) red cell phenotype. However, rare individuals who produce anti-Xg a cannot be accounted for by this finding. We hypothesized that a structural defect in the XG coding region causes the true Xg null phenotype underlying anti-Xg a production. Aims: We undertook to determine a genetic explanation for anti-Xg a production.

Methods: Genomic DNA (gDNA) was extracted from two whole blood samples and cell-free DNA (cfDNA) from 13 archived plasma samples from donors producing anti-Xg a ; one cfDNA sample was from a female donor and the rest from males. Polymerase chain reaction (PCR) experiments, Sanger sequencing, and database searches were performed to identify and confirm the deletion. Aliquots of gDNA from four males reported to carry a similar deletion in the 1000 Genomes Project were also tested. Results: In one gDNA sample, exon-specific PCR identified a deletion involving part of XG and the downstream gene GYG2. Database searches indicated that the most likely deletion was the infrequent genomic structural variant esv2662319 reported in the 1000 Genomes Project. Further analyses with a short (714 bp) and a long (3555 bp) PCR amplicon across the suspected breakpoint determined that this deletion was approximately 114 kb and corresponded well with esv2662319. This finding was confirmed in the second gDNA sample. Given the rarity of anti-Xg a producers, we decided to test for the same deletion in cfDNA extracted from old archived plasma samples. Of the 13 cfDNA samples, poor quality in four samples prevented amplification even from control reactions and one was contaminated with bacterial DNA. In the remaining nine samples, eight could be amplified for the deletion-specific 714-bp short amplicon while one was negative for the deletion. Sanger sequencing of the amplicons revealed a heterogeneous repetitive DNA element, LTR6B, hinting at a previously-reported recombination event. This deletion was not detected in the samples from the 1000 Genomes Project which reiterates the previously identified deficiency in data interpretation and reporting for deletions. Summary/Conclusions: A large deletion disrupting the XG and GYG2 genes accounts for the Xg null phenotype underlying the majority (10 of 11) of anti-Xg a makers. One sample remained unexplained, indicating further heterogeneity to be explored. Our data help to explain why anti-Xg a production is rare and has primarily been reported in men. Background: S and s antigens encoded by GYPB differ by one nucleotide (nt), c.143C>T, p.Thr48Met. Two different genetic backgrounds are associated with silencing of S antigen and a U+ w phenotype. These include the nt change c.230C>T (p.Thr77Met) causing partial exon skipping and designated GYBP*03N.01 (GYPB*NY) and c.270 + 5G>T, an intron change causing complete skipping of exon 5, designated GYPB*03N.03 (GYPB*P2). Aims: Samples from three individuals, a previously transfused African American sickle cell patient (P1), a blood donor of unknown ethnicity (P2), and an African American patient (P3) (Lapadat R. 2014 AABB abstract) were investigated for discrepant serologic and molecular results when determining S and s phenotype. Methods: Standard methods were used for RBC typing with licensed S and s reagents and RBCs from donor P2 were also tested with monoclonal and polyclonal anti-S and anti-s. DNA was isolated from WBCs and HEA PreciseType performed on P1 and P2. P1 was also tested by GYPB*S/s AS-PCR, exon 5 PCR-RFLP for c.270 + 5G>T and AS-PCR for c.230C>T. P3 was tested for GYPB*S/s and c.230 C>T and c.270 + 5G>T changes by a real-time PCR-fluorogenic 5' nuclease TaqMan chemistry. For all, GYPB exons 1-6 were amplified and Sanger sequenced and aligned to consensus using Clustal X. Results: RBCs of all three probands typed S-and strongly s+ while DNA testing indicated c.143T/C (GYPB*S/s). Assay for the two common GYPB*S silenced alleles, c.230C>T and c.270 + 5G>T, indicated all three samples had both silencing mutations previously reported to be independently associated with a SÀU+ w phenotype. HEA PreciseType could not interpret this novel allele combination and indicated GYPB*s as PV (possible variant). Samples were confirmed to be heterozygous for c.143C/T, c.230C/T and c.270 + 5G/T by exon specific sequencing and AS-PCR, PCR-RFLP and real-time PCR. By long range sequencing of GYPB, all three were heterozygous c.59T/G and c.60A/G (p.20Leu/Trp), c.67A/T (p.23Thr/Ser), c.71A/G and c.72G/T (p.24Glu/Gly), c.143C/T (s/S), c.208G/T (p.70Val/Leu), c.230C/T (p.77Thr/Met), and c.270 + 5G/T. All samples were also c.251G/G (p.84Ser) and heterozygous for several previously recognized silent changes in exon 2, c.87T/C, c.96T/C and c.102A/G. Summary/Conclusions: We report a novel silenced GYPB*S allele that can confound GYPB genotyping interpretation. The allele was found in three probands associated with a SÀs+ phenotype. In these samples, two changes previously reported to be inherited independently and both associated with silencing of S antigen are carried on the same allele. DNA-based testing could not rule out that c.230T or c.270 + 5T are separate and that GYPB*s was also silenced. Robust s+ RBC typing indicates both changes are on GYPB*S. Gene sequencing confirms the c.270 + 5T change is on a GYPB*03N.02 [GYP*He(NY)] background. c.230C>T (rs79492560) and c.270 + 5G>T (rs139511876) have a frequency of 0.0053 respectively 0.032 in the African population (ExAC). Although we identified 3 samples, the frequency of this novel allele is unknown. Background: The Lutheran blood group system currently consists of 25 antigens. These antigens are of low immunogenicity and may cause mild-to-moderate transfusion reactions and hemolytic disease of the fetus and newborn. The activation of Lu-glycoprotein/BCAM on red blood cells (RBCs) and its interaction with laminin-5a is thought to play a role in vaso-occlusion in sickle cell disease and other hematological disorders. The two glycoprotein isoforms Lu-glycoprotein and BCAM are encoded by the BCAM gene which consists of 15 exons located on chromosome 19q13.2. A number of rare Lutheran phenotypes have been previously recorded in Israel, including LU:-6,9 observed among Iranian Jews, LU:-20 in one thalassemia patient and one case of LU:-21. In this report, a previously transfused pregnant Arab patient with b-thalassemia intermedia was investigated because she presented with an antibody to an unknown high frequency antigen (HFA), potentially related to the Lutheran system. Aims: To characterize a novel Lutheran antigen through serological and molecular investigation of a patient with a Lutheran related antibody. Methods: Initially, the red cell phenotype and the presence of a Lutheran related antibody in the serum of the patient were detected by standard serological techniques, utilizing enzyme treated and chemically modified cells and rare cells and sera from the NBGRL collection. Further serological investigations were carried out using standard IAT (LISS tube and Bio-Rad gel) technique. Plasma inhibition studies were performed using soluble recombinant Lu protein (srLu). Eluates were prepared using acid elution method (Gamma Elu-kit II). Genomic DNA was isolated from whole blood and all exons of the BCAM gene were amplified by PCR and directly sequenced by Sanger sequencing. The impact of the identified mutation on Lutheran glycoprotein structure was studied by molecular dynamics calculations. Results: The patient's plasma reacted with all cells tested, except for three examples of In(Lu) cells and cells treated with 2-aminoethylisothiouronium bromide, trypsin and a-chymotrypsin. Inhibition studies with srLu protein showed complete inhibition of the antibody, thereby confirming the antibody to be directed toward an epitope on the Lu-glycoprotein. In addition, testing of inhibited plasma revealed the presence of underlying anti-E and anti-Fy a . An eluate was prepared to isolate the patient's Lu-related antibody and this eluate was found to be incompatible with examples of LU:-5, LU:-6, LU:-8, LU:-13, LU:-21, LU:-22, and LU:-23 cells, whereas In(Lu) were compatible. Results of serological typing of the patient's cells, for Lu system HFAs, could not be conclusively determined due to the patient having been recently transfused. However, results suggested (through absence of mixed field reactivity) the patient's cells to be LU: -1,2,8,12,13,-19,21 . BCAM sequence analysis confirmed the patient to be LU*02, LU*18 and revealed a novel homozygous mutation c.1351A>C in exon 11, encoding p.Lys451Gln in the Lutheran glycoprotein. Summary/Conclusions: A novel homozygous mutation c.1351A>C (p.Lys451Gln) in exon 11 of BCAM was identified in a patient with an antibody to a Lutheran HFA. Serological and genetic evidence presented here indicates discovery of a novel antigen of the Lutheran blood group system, which we propose to name LURA. Background: Lutheran glycoprotein and basal cell adhesion molecule antigen B-CAM are two isoforms of a type I membrane glycoprotein residing on red cell surfaces. Both isoforms are adhesion molecules with the main function of laminin binding, and both carry antigens of the Lutheran blood group system (LU). The system currently comprises 25 antigens, all encoded by mutations in the alternatively spliced single gene BCAM located on chromosome 19. Currently, ISBT lists 20 high incidence antigens in the system. Aims: We report a case study of an individual with an unidentified alloantibody to high incidence antigen present in her plasma. Samples from the patient and her family were investigated. We provide here serological and molecular evidence for a novel high incidence antigen of the Lutheran blood group system. Methods: Serological investigations were performed by standard IAT (LISS tube and Bio-Rad gel) technique. Plasma inhibition studies were completed with soluble recombinant Lu (srLu) protein. Genomic DNA was isolated from whole blood of the patient and her family members; all the exons of the BCAM gene were amplified by PCR and analysed by direct Sanger sequencing. The impact of the identified mutation on Lutheran glycoprotein structure was studied by molecular dynamics calculations. Results: Presence of a Lu-related antibody in the patient's plasma was confirmed, reacting moderate strength by LISS IAT with untreated and papain treated cells. Cells from the patient's mother, father and two siblings were all incompatible with her plasma, though weaker than panel cells, reflecting dosage. Only In(Lu) cells were compatible with patient's plasma. The antibody was successfully inhibited with srLu protein, thereby confirming the epitope recognised by the antibody resides on the Lutheran glycoprotein. The patient's cells were found to be LU: -1, 2, 3, 5, 6, 8, 13, 20, 21 . BCAM sequencing revealed a novel homozygous mutation c.121G>A in exon 2, encoding p.Val41Met in the Lu glycoprotein. The c.121G>A change appears to be an extremely rare mutation, listed in gnomAD database with a frequency of 3.98 9 10 -6 and with no known homozygous examples. Homology model of the novel Lutheran glycoprotein was subjected to all-atom molecular dynamics calculations to analyse potential conformational changes. Summary/Conclusions: We report serological and genetic evidence for a novel antigen of the Lutheran system, which we propose to name LUNU. The evidence will be submitted to the ISBT Red Cell Immunogenetics and Blood Group Terminology Working Party for consideration for allocation of antigen status. The absence of this high incidence antigen arises from a rare single amino acid change p.Val41Met in the Lutheran glycoprotein and the presence of anti-LUNU in the patients' plasma was presumed to have been made in response to previous pregnancy.

on native, papain-treated (Diagast) and trypsin-treated (Sigma) RBCs. Genomic DNA was extracted from peripheral blood cells by an automated method, amplified by SEMA7A exon-specific primers and sequenced. Results: The proband was a 32-year-old female patient of Moroccan origin, group A, D+C+E-c+e+, K-, without transfusion history. She was hospitalized at 27 weeks gestation for a blighted ovum requiring a manual vacuum aspiration, with a significant hemorrhage risk. A RBC antibody screening was performed by a first laboratory. The antibody reacted 1 + by IAT on all native reagent RBCs, with negative autocontrols, but was nonreactive on papain-and trypsin-treated cells. An anti-Ge2 was initially suspected, due to the pattern of reactivity and ethnic background. New blood samples were referred to our national immunohematology reference laboratory. The antibody showed the same profile. Anti-Ge2 and anti-Ch1 could be ruled out. The serum was nonreactive with two JMH:-1 and positive with two JMH:-3 samples. The patient was found to be JMH1 positive. In addition, a soluble recombinant JMH protein (JMH Imusyn/Inno-train) fully abolished the reactivity of the panagglutinating antibody. The antibody was an IgG4. Overall, these results were consistent with a probable JMH variant and prompted us to perform SEMA7A sequencing. Three nucleotide changes were found, in homozygous state: a rare nonsynonymous change in exon 7, c.709G>A (p.Asp237Asn, rs140707085, MAF < 0.01, SIFT score = 1); a common synonymous change in exon 12, c.1545A>G (p.Gln515Gln, rs741761, MAF = 0.5); a rare non-synonymous change in exon 14, c.1865G>A (p.Arg622His, rs140128092, MAF < 0.01, SIFT score = 0.36). The analysis of surface accessibility of Asp 237 and Arg 622 using the 3D structure of Sema7A (RCSB PDB-3NVQ https://www.rcsb.org/structure/3nvq) showed that only Arg 622 was predicted to be an exposed-epitope. Interestingly, all other reported JMH variant phenotypes correspond to an arginine substitution. Of note, we retrospectively found another individual of Algerian ancestry (pregnant woman) with a pan-agglutinating IgG4 antibody showing a similar pattern of reactivity, and with the same three changes in SEMA7A. We unfortunately could not perform a cross-compatibility testing with the proband (no material left and unsuccessful contact). Summary/Conclusions: Serological and molecular studies allowed us to provide evidence for a novel high-prevalence antigen in the JMH blood group system, very likely encoded by the p.Arg622His substitution in Sema7A. We propose to provisionally assign the name JMH7 for this antigen. Interestingly, our two unrelated JMH:-7 individuals were from North African ancestry. Background: The ABO system was discovered almost 120 years ago and the underlying structures later elucidated as carbohydrates carried by glycoproteins and glycolipids. The terminal trisaccharides GalNAca3(Fuca2)Gal and Gala3(Fuca2)Gal constitute the clinically important A and B epitopes, respectively. Clausen et al. (PNAS, 1985) showed that the A antigen could be extended to a repetitive glycolipid A epitope, GalNAca3(Fuca2)Galb3GalNAca3(Fuca2)Galb4GlcNAc-R. However, extended forms of B antigen have not been described. We encountered two related situations with unexplained serological reactivity. Firstly, enzyme-conversion to group O treatment of group B (B-ECO) red blood cells (RBCs) with a3-specific GH110 family exogalactosidase (Bzyme) abolishes B antigens as detected by hemagglutination and flow cytometry with all monoclonal anti-B tested. Despite this, 40% of group O plasmas have been reported to give positive crossmatch results with B-ECO RBCs. Secondly, plasmas from AB and B individuals of the globoside-deficient P k phenotype contain anti-P and anti-PX2 but react stronger with Bpp-RBC than with App/Opp-RBC. Based on these findings, we hypothesized the presence of a Bzyme-resistant, B-related glycolipid. Aims: To identify the molecular basis of the enigmatic serological observations outlined above. Methods: Plasma and eluates from an A 1 B individual with the P1 k phenotype were investigated by hemagglutination and flow cytometry, as were eluates from B P 1 k and O plasma. RBC membrane glycolipids were extracted from two batches of pooled, expired group B-RBC units (frozen 500-litre reference preparation and confirmatory preparation from 24 freshly collected units). Native or enzyme-treated glycolipid fractions were analysed by liquid chromatography electrospray ionizationmass spectrometry (LC-ESI/MS) and immunostaining of thin layer chromatography (TLC) plates. Antigen expression in the H+BÀ human erythroleukemia (HEL) cell line was analysed by flow cytometry following overexpression of selected glycosyltransferases. Results: Anti-P-depleted eluates made from A 1 B P 1 k plasma contained anti-PX2

and antibodies of unknown specificity that reacted stronger with native or papaintreated Bpp-RBCs compared to App/Opp-RBCs. Anti-PX2 was removed by adsorption onto Opp-RBCs but reactivity (here designated anti-ExtB) remained against B/Bpp/B-ECO RBCs. LC-ESI/MS of glycolipid fractions from group B units revealed an unknown HexNAc-Hex-(Fuc-)Hex-4HexNAc-Hex-4Hex heptasaccharide. Upon b-Nacetylhexosaminidase treatment of this candidate structure, a group B type 2 hexasaccharide was produced, demonstrating that the terminal HexNAc of the HexNAc-Gala3(Fuca2)Galb4GlcNAcb3Galb4Glc heptasaccharide was b-linked. Since the discovery of the anti-platelet effects of aspirin platelets have been a major therapeutic target for pharmaceutical companies and also a very profitable target. However, the effectiveness of aspirin has also been a challenge as it is an inexpensive drug and any new agent needs to show clear benefit over aspirin. Furthermore the risk of bleeding from anti-platelet agents, especially cerebral bleeds, has also presented challenges. In the 1990's orally active GPIIb/IIIa antagonists were considered to be the 'super aspirin' but clinical trials showed increased mortality and ultimately this class of drugs was relegated to iv use only in high-risk patients. GPIb/IX/V antagonists were also a promising drug target but no agent made it to market. The real breakthrough was the discovery of the P2Y12 antagonist clopidogrel which, in conjunction with aspirin, proved to be very effective at preventing thrombotic events and as a result it became the biggest selling drug in the world at the time. With clopidogrel now offpatent the combination of aspirin and clopidogrel is a formidable challenge to any new agent both in efficacy terms and pharmacoeonomic terms. So is there a future for new anti-platelet agents? With the growing awareness of the role of platelets in inflammation and an understanding of how the immune activation of platelets differs from the classical haemostatic activation of platelets it is now possible to develop novel anti-platelet agents that target inflammation without compromising haemostasis. It is here that we should look for the next generation of anti-platelet agent.

4C-S21-02

University Hospitals of Geneva, Geneva, Switzerland

Platelet function defects, either congenital or acquired, are associated with increased bleeding risk, particularly in a perioperative setting. The use of platelet function assays is therefore tempting in order to tailor transfusion and limit platelet transfusion to those bleeding patients with impaired platelet function, as assessed by those assays. However, the current guidelines provide only weak recommendations supporting the routine use of these assays. Indeed, there are numerous platelet function assays on the market that differ in their method of evaluation of platelet function and agreement between their results is at best moderate. The threshold values beyond which procedure-associated bleeding risk becomes worrisome is not standardized. Moreover, observational studies addressing the predictive value of platelet function testing in perioperative or spontaneous bleeding are not consistent. Finally, management trials with randomized patients assessing the benefit of platelet function testing are scarce. More recent data identified selected situations where platelet function testing may be useful though. I will review the different platelet function assays as well as selected clinical studies addressing the impact of platelet function testing to improve bleeding and transfusion-related outcomes. The latest recommendation will be addressed too. Background: Platelet refractoriness complicates the provision of platelet transfusions in management of thrombocytopenia in Oncology patients. Platelet refractoriness poses challenge due to alloimmunization to HLA and human platelet antigens and is associated with adverse clinical outcomes. Aims: A prospective study was undertaken to analyse result of platelet compatibility with post-transfusion platelet count increment and to ascertain presence of platelet antibodies as causative factor in platelet refractory oncology patients. Pulmonary complication after blood transfusion is the leading cause of transfusionrelated morbidity and mortality, with an incidence reported between 0.05 -15% of all transfused patients. The most important transfusion related pulmonary complications are transfusion associated circulatory overload (TACO), transfusion related acute lung injury (TRALI) and transfusion associated dyspnea (TAD). In this presentation the recent changes in the international definitions will be presented and discussed. Furthermore, insights in the different underlying pathophysiologic mechanisms will be highlighted. In the past decades only for TRALI prevention strategies have successfully been designed and implemented. Currently no evidencebased treatment strategy is available for any of these life-threatening syndromes. Insight in the pathogenesis of pulmonary complications after transfusion should pave the way for future prevention and treatment studies. The issue of the impact of iron overload / toxicity on the hematopoietic stem transplantation (HCT) outcome has been firstly addressed in the field of transfusion dependent thalassemia. Today the concept has been extended to other diseases characterized by periods of variable duration of transfusion dependence such as Myelodysplastic Syndrome (MDS) and myeloproliferative diseases. Patients requiring regular blood transfusions certainly develop iron overload leading to tissues and organ damage. Iron burden before transplant significantly impacts outcome and long-life posttransplant.

It is well known that iron overload is deleterious for organs such as liver, heart and endocrine glands and it has been postulated could also increases the risk of infections and severe Graft versus Host Disease early after HCT.

Recent preclinical data has shown how increased production of reactive oxygen species (ROS) resulting under iron overload condition, could impair the stem cells clonality capacity, proliferation and maturation. Also, microenvironment cells could be affected through this mechanism. For this reason, iron overload is becoming an important issue also in the engraftment period early post-transplant. High baseline Ferritin levels before HCT have been shown to negatively influence clinical outcome, but nowadays, ferritin is considered a steady and not biologically active form of iron, while free iron forms as non -transferrin bound iron (NTBI) and labile plasma iron (LPI) are considered the main trigger of cell damage more representative of the dynamic tissue damage. The scientific community is moving the iron disease from a "Bulky" disease, such as classically in thalassemia (based on quantitative iron parameters as ferritin, red blood cell transfusion number, MRI) to a "toxic" disease (based on active and dynamic biological markers as NTBI/LPI). At this time in all the studies published on HCT setting, only the correlation between direct or indirect estimates of iron overload (mainly serum ferritin) and outcome parameters has been explored, while the duration of exposure to toxic iron species has not been taken into account. The first study that explored the LPI role in relationship with outcome was published by Wermke and colleagues in malignancies. They investigated the predictive value of both stored (MRI-derived liver iron content) and non-transferrin-bound-iron, defined as enhanced labile plasma iron (eLPI) on post-transplantation outcomes in patients with acute myeloid leukemia or MDS. Their prospective, observational ALL-IVE study showed that patients who had raised eLPI concentration at baseline, also had significantly increased incidence of non-relapse mortality at day 100 (33%) compared with those who had normal eLPI at baseline (7%) (P = 0.00034).

Reinterpreting transplant predictive factors in the light of the current advances in understanding iron homeostasis further supports the concept that the key to successful transplantation is regular and life-long chelation therapy to consistently suppress tissue reactive iron species and prevent tissue damage in the years before HCT. In transfusion medicine, the role of donor sex was long considered to be limited to the increased risk of TRALI observed after transfusions from female donors. This risk has been shown to be limited to female donors with a history of pregnancy and to plasma rich products (i.e. excluding red blood cell products, typically containing < 50 mL plasma). Until, in 2011, we found that sex-mismatched red blood cell transfusions were associated with increased recipient mortality. Since then, several other studies have confirmed these findings, but some studies also did not find an association. All of these studies relied on the analyses of routinely collected health care data, which was not primarily intended to be used for research. As a result, analyses are complex and often difficult to properly appraise based on published descriptions. Therefore, the discussion about possible reasons for these discordant findings has largely focused on the methodological approaches of the different studies. Other potential explanations include differences in donor or patient populations, production methods, or storage time of blood products. The different potential explanations are expected to be associated with different underlying biological mechanisms. Therefore, further delineating which donor, patient, and product characteristics modify the observed association could provide more insight into the underlying mechanism.

In 2017, we observed that only transfusions from female donors with previous pregnancies were associated with increased mortality and only in male recipients under 50 years. This leads us to postulate that pregnancy induced long term changes in the female immune system are transferred during red cell transfusion, with negative consequences for young male recipients. The low amount of plasma present in red cell products further lead us to assume a cellular component, like passenger leukocytes, to be involved. It has been shown that micro-chimerism of passenger leukocytes can persist for decades after transfusion, even of leuko-reduced blood products, suggesting long term immune-modulation could play a role. We hypothesized that passenger leukocytes would die during storage of blood products and the negative effect of ever-pregnant female donors, on the survival of young male red cell recipients, would therefore be attenuated by increased storage time. However, our data seem to indicate the opposite. The risk of death was increased over three-fold for young male recipients of old (>24 days storage) red cells from ever-pregnant donors, compared to for young male recipients of fresh (<10 days storage) red cells from ever-pregnant donors (3-year cumulative incidence of death 15.4% versus 4.8%). The negative control group (i.e. young male recipients of red cells from male donors) showed a much weaker association of mortality with storage time (i.e. 7.2% versus 4.7%). These findings seem to falsify our hypothesis that mortality could be caused by passenger leukocytes, establishing long term immune-modulatory effects. Another potential mechanism that has been suggested could be the presence of cellfree DNA in transfused blood products. This cell-free DNA increases during storage. However, more research is needed both to establish if cell-free DNA can also be linked to previously pregnant blood donors and by which mechanism it could negatively affect young male transfusion recipients. Clinical trials (CTs), the gems in clinical research for generating robust evidence in medicine and public health, are costly and complicated undertakings. In resource limited setting like sub-Saharan Africa (SSA) where the health systems are sub-optimal and where capacity for research is limited, the conducting of CTs can be a daunting challenge. The challenges of undertaking CTs in RLs may be categorized based on the occurrence of the bottleneck(s) in relation to the ethics and regulatory approval process: Pre-approval: Protocol Development: In order to develop a context-specific protocol which is subsequently subjected to an ethics and regulatory approval process, investigators need to review and ensure that the protocol is pragmatic and feasible with respect to implementation. This results into a time-consuming reiterative process of reality-checking the protocol. Site Selection: In light of the limited research infrastructure, investigators in RLS and their developed world partners spend considerable time reviewing and selecting suitable sites for participation in the anticipated protocol for the CTs. Suitable sites are usually very few and with competing on-going studies.

Approval: Institutional Review Board (IRB) approval: The IRB approval process can be quite lengthy (6-9 months) with considerable unpredictability in the periods between the initial and subsequent IRB reviews. National regulatory approval: The requirements by national regulators are unusually innumerable with limited flexibility to accommodate specific CTs. Post-approval: The key post-approval challenges for CTs implementation in RLS are attaining appropriate participant enrolment and maintaining high retention rates. Specifically, for participant enrollment, the challenge may be unforeseen competing CTs targeting the same participant pool or community perspectives that may discourage participants from getting screened for the CTs. Retention may also be a challenge particularly where participants view enrollment as a chance to access healthcare services may therefore not have any incentive to keep in a study after the initial study visits.

In conclusion, CTS are complex undertakings wherever they are conducted but are doubly challenging in RLS like sub-Saharan Africa. The bottlenecks at the preapproval, approval and post-approval stages are considerable. Nevertheless, it is rewarding to perform CTUs in RLS given that the data generated therein is highly valued by national regulators and may hasten the registration process for medical products. Background: Interest in an appropriate and effective whole blood (WB) pathogen reduction technology (PRT) is growing, especially in sub-Saharan Africa where the residual risk of transfusion-transmitted infections (TTIs) remains unacceptably high and WB is still frequently used. Cerus Corporation, manufacturer of the INTERCEPT TM Blood System, and Swiss Transfusion SRC are collaborating on a clinical development program to adapt INTERCEPT PRT using amustaline (S-303) and glutathione (GSH) for red blood cells (RBCs) into an appropriate PRT for WB in resource-limited settings in Africa. Treatment with amustaline/GSH has been shown to inactivate a broad spectrum of transfusion-transmissible pathogens in RBCs. Studies with amustaline/GSH in WB have shown effectiveness against a duck hepatitis B virus (>5.3 log reduction) and Plasmodium falciparum (>7.5 log reduction), with future studies planned. A WB PRT system with amustaline/GSH also has the potential benefit of minimal electricity requirements. Aims: To describe the safety and clinical objectives for a Phase 1 clinical trial using the amustaline/GSH PRT system for WB in Africa, and describe research and development efforts to adapt the INTERCEPT PRT system for RBCs into a robust and appropriate WB system for settings with high burdens of TTI and limited resources. Methods: The protocol for a Phase 1 clinical trial using pathogen-reduced WB treated with amustaline/GSH in an African country is presented, as are current research and development activities related to the development of a PRT system for WB. Results: In the planned Phase 1 clinical trial in Africa, 20 clinically stable patients with anemia who require WB transfusion will be randomized into two study arms at a large medical center in a sub-Saharan African country. Enrolled patients will receive one unit of non-leucocyte-reduced WB treated with amustaline/GSH, or a unit of untreated control WB or RBCs. The primary safety endpoint will be the incidence of high-imputability transfusion reactions (Swissmedic ≥Grade 2) within the first 24 hours of transfusion. Data will also be collected on all adverse events and transfusion reactions (all grades) and the development of treatment-emergent antibodies to pathogen-reduced WB or auto-antibodies within 59 (AE3) days of the study transfusion. Clinical efficacy will be characterized by hemoglobin increment 24 hours after transfusion adjusted to hemoglobin dose and body weight. Summary/Conclusions: A PRT system for WB is being developed based on the INTERCEPT PRT for RBCs that is in advanced development in Europe and the United States. INTERCEPT-treated RBCs have met efficacy and safety endpoints in Phase 3 clinical trials. The amustaline/GSH PRT system used to treat INTERCEPT RBCs has demonstrated effective inactivation against a broad spectrum of agents that may result in TTIs. A Phase 1 clinical trial using an adapted PRT system for WB in Africa is the first step in a clinical development program that includes additional pathogen inactivation efficacy studies and improvements to the WB PRT implementation process. Together, these developments and evaluations represent progress toward a realistic and appropriate PRT for WB in Africa and other resource-limited settings. Background: In Australia, demand for plasma-derived products has increased dramatically, and there is a need to increase plasma collections. First-time donor retention, including the rate at which first-time donors return, is a pressing issue. A quick return is optimal as this increases the overall plasma yield and is associated with long-term retention. However, we lack evidence of effective interventions to encourage first-time donors, particularly those donating plasma, to return and to establish a higher frequency donation routine. Working from Schultz's (2014) framework, this intervention study was based upon insights from interviews with first-time plasmapheresis donors. Participants identified barriers such as time and lack of knowledge about plasmapheresis. Facilitators included being able to help more people and to donate more frequently than allowed with whole blood. Participants generally favoured donating at a frequency of every 4 weeks. Aims: The aim of this study was to test the effectiveness of three intervention conditions compared with the business-as-usual (BAU) procedure on the proportion of donors returning to donate plasma and the number of plasma donations. We report on the data from 2 months post-donation. Methods: Donors were randomly assigned to one of four study conditions. In Conditions 1 and 2, donors received an email one day after their initial donation. In the first condition, donors received the BAU 'thankyou' email. Donors in the second condition received an alternative email with content derived from the interview study. Donors in the remaining conditions received either the BAU email (Condition 3) or the revised email (Condition 4) coupled with a telephone call. The phone call was scripted to provide additional information about plasma, including how often plasma can be donated, a suggestion to donate every 4 weeks, and a prompt to forward-book appointments. Results: The final sample (N = 6788) comprised 3859 women (57%) and 2929 men (43%) aged 18-70 (mean = 32). After two months 37.2% of donors returned to donate plasma at least once. After controlling for gender, age, and blood group, donors in each of the intervention conditions were more likely to return to donate plasma than were donors in the BAU condition. The greatest effect was found between donors randomized to Condition 4 (revised email + phone call), OR = 1.305, CI = 1.128-1.510, and BAU. Donors assigned to the two telephone conditions (Condition 3 and 4) donated plasma at a higher frequency than BAU. Summary/Conclusions: This study tested the effectiveness of interventions designed to encourage first-time plasma donors to return to donate plasma and to establish a routine of donation. Early indicators suggest that the evidence-based email and phone call elements are more effective than BAU in bringing donors back to donate plasma, and the revised email combined with a phone call had the greatest positive effect on short-term plasma yield. Background: Healthy individuals with hereditary hemochromatosis (HH defined as hyperferritinemia and homozygous p.C282Y mutation), but also carriers of other HFE mutations (p.C282Y/p.H63D or homozygous H63D) with elevated serum ferritin (SF) are accepted as blood donors, if allowed by local regulations and if eligibility is fulfilled. Generally, blood components are released for transfusion at normal SF levels (< 200 ng/mL in females, < 300 ng/mL in males). Aims: Prospective, two-center, randomized study comparing the efficacy and tolerability of double-erythrocyte apheresis (2RBCaph) and whole blood phlebotomy (WBph) for iron depletion in asymptomatic subjects with HH or hyperferritinemia and other HFE mutations in the setting of routine blood donation. Methods: Eligibility criteria included age ≥ 18-60 years, total blood volume ≥ 5 L, BMI < 35 kg/m 2 , Hb ≥ 140 g/L, elevated SF levels and no end organ damage due to iron overload. 2RBCaph (360 mL RBC) were scheduled every 14 days and WBph (450 mL) every 7 days until SF was < 100 ng/mL. A complete blood count and SF were measured at baseline, at every visit and at follow up 8 weeks after completion of the study. Adverse events were systematically recorded. The treatment effect was tested by Poisson regression, with gender, HFE mutation, BMI and baseline SF as covariates. Results: 30 subjects (5 females; mean age 47 years) were randomized to WBph (n = 16; 1 female) or 2RBCaph (n = 14; 4 females). HFE mutations were p.C282/ p.C282Y in 17 subjects, p.C282Y/p.H63D in 9, and p.H63D/p.H63D in 4. At baseline, mean Hb was 149 g/L (SD 7.8) and median SF was 504 ng/mL (IQR 406-620 ng/mL). 222 procedures (WBph n = 146, 2RBCaph n = 76) were completed; 9 were interrupted (local hematoma, insufficient flow); 35 (16 WBph, 19 2RBCaph) were postponed because of low Hb and 15 for non medical reasons. There were 2 drop-outs in the WBph arm due to depression and poor compliance, respectively. Anemia (Hb < 130 g/L in males, <120 g/L in females) occurred after 15 visits in 8 WBph subjects and after 5 visits in 3 2RBCaph subjects. Fatigue was reported after 37 phlebotomies and 31 aphereses. Only 5 participants (17%) completed the study per protocol. 136 blood components (94 RBC concentrates and 42 plasma units) for transfusion were obtained. Overall, a median of 7.5 WBph (IQR 6.2-9.8) was needed to reach SF < 100 ng/mL, corresponding to 1.8 times of 2RBCaph (median 4.0, IQR 3.0-5.8) (P = 0.0001). Analyzing separately p.C282/p.C282Y and p.C282Y/p.H63D carriers, the relation WBph to 2RBCaph was 1.6 and 1.8, respectively. Treatment arm and HFE mutation were the covariates with significant effect on the primary endpoint (P = 0.0001 and 0.007, respectively). Summary/Conclusions: 2RBCaph is more efficient than WBph for iron depletion in healthy subjects with HH or other HFE mutations and moderate hyperferritinemia. Intensive treatment schedules, generally recommended for HH, are difficult to keep because of Hb drop and compliance. Less intensive treatment in asymptomatic individuals with HH and their inclusion in blood donation would avoid negative effects on quality of life and benefit blood collection centers in the long term. Background: Serum ferritin (SF) measurements in whole blood (WB) donors demonstrated that female sex and intensity of donation are major risk factors for iron deficiency. Approximately 200 mL red blood cells (RBC) and 200-240 mg iron are lost with WB donation. Double unit RBC (2RBC) collections of 360 mL (ca. 40 mL less than the RBC amount of two WB donations) lead to a loss of about 400 mg iron. In Switzerland, the maximal allowed donation frequency for male donors is once every 6 months for 2RBC and once every 3 months for WB donation. Aims: To describe and compare the course of hemoglobin (Hb) and SF in male subjects donating WB and 2RBC at our institution. Methods: We included 294 WB and 151 2RBC donors (n = 445) who donated with the maximal allowed donation frequency over 48 months between 2008 and 2013, yielding 4,704 WB and 1,208 2RBC donations. We excluded subjects with hyperferritinemia and known HFE mutations. Hb limits were 135 g/L for WB and 140 g/L for 2RBC donation. With 2RBC apheresis 360 mL RBC were collected. SF was measured on a predonation serum sample; Hb was determined from finger prick samples. The donors received no iron substitution. We used generalized estimating equation models for Hb and SF trajectories. Results: Mean age at the first blood donation was 53 (WB) and 48 years (2RBC), respectively. At the first donation, mean Hb was 153 g/L (SD 13) in WB and 159 g/L (SD 8) in 2RBC donors; mean SF was 44 (SD 52) and 73 lg/L (SD 56), respectively. On average, Hb and SF were higher in 2RBC donors (5.1 g/L and 26 lg/L, respectively; P < 0.001). There were 137 subjects with SF < 30 lg/L in WB and 19 in 2RBC group, and 85 with SF < 50 lg/L (but > 30 lg/L) and 40, respectively. In 2RBC donors, between the first and the last donation, mean Hb declined from 159 g/L to 157 g/L (P < 0.05) and mean SF from 73 lg/L to 66 lg/L (ns). In WB donors, mean Hb dropped from 153 g/L to 152 g/L (P < 0.05) and SF from 44 lg/L to 35 lg/L (P < 0.001). Similar results were found when adjusting for age and season. Hb values dropped from baseline until the 11 th donation for WB donors and until the 4 th donation for 2RBC donors with an upward trend thereafter. In both groups, no Hb value below the limits of blood donation and no anemia were observed. SF reached a nadir at the 4 th donation in both WB and 2RBC donors (37 lg/L and 60 lg/L) and increased thereafter in 2RBC donors. In WB donors, SF followed a parabolic trend that peaked at the 10 th donation, and then declined until the last donation. Summary/Conclusions: The maximal allowed blood donation frequency for WB and 2RBC male donors in Switzerland is not only protective for the development of anemia, but also for deferral of blood donors because of low Hb. This was observed even in subjects with low SF at baseline. Background: Granulocyte concentrate transfusion is a potentially lifesaving option for patients without functional neutrophils. However, recent studies have failed to demonstrate the anticipated clinical effectiveness of this procedure. Granulocyte concentrates are manufactured using sedimentation agents to separate granulocytes from red blood cells and enhance granulocyte collection efficiency. High-molecularweight hydroxyethyl starch (HES) is most commonly used for this. However, authorities recently restricted the use of HES due to its unfavorable risk-benefit-profile. Modified fluid gelatin (MFG) is an already used alternative sedimentation agent. As the granulocyte product contains these substances, any impact of the sedimentation agent on granulocyte function may affect the clinical effectiveness of granulocyte transfusion. Aims: We tested the hypothesis that MFG is not inferior to HES in terms of the functionality and viability of granulocytes. Methods: Granulocytes from ten healthy donors were isolated, aliquoted and incubated in parallel for 2 hours with either 0% (control), 7.5%, 15% or 30% MFG (Gelafundin 4%, B. Braun Melsungen AG) or HES (Hespan 6%/450/0.7, B. Braun Medical Inc.), respectively, and granulocyte migration, chemotaxis, reactive oxygen species (ROS) production, neutrophil extracellular trap formation (NETosis), antigen expression of CD11b, CD62L and CD66b, and viability were subsequently investigated in vitro. Testing was performed using live cell imaging of the cells embedded into a collagen I matrix for parallel testing of migration, ROS production and NETosis. In addition, flow cytometric (FACS) analysis was utilized for surface marker expression, viability and respiratory burst measurement. Results: Granulocyte migration decreased in a dose-dependent manner in response to HES and MFG. Relative to the controls, all three concentrations of HES lowered migration distances (P < 0.001 respectively), whereas only the higher concentrations (15% and 30%) of MFG showed lower relative migration distances (P < 0.001 respectively). Track straightness was reduced with both sedimentation agents at 15% and 30% to the same extent (P < 0.001 respectively). HES resulted in lower CD11b expression (P = 0.028) and higher CD62L expression (P = 0.007) compared to the controls, whereas the differences for CD66b did not reach statistical significance. MFG did not affect the expression of any investigated surface antigen mediating endothelial adhesion and transmigration in comparison to the controls. No significant differences in the timing of ROS production or NETosis, or in neutrophil viability or respiratory burst were observed. Summary/Conclusions: These results indicate that MFG is not inferior to HES in terms of granulocyte phenotype and function in vitro when used at equal concentrations, and that potential impairment of granulocyte function can occur with HES. Background: Plateletpheresis donation leads to a well-known transient decrease of donor's platelets. The question of long-term effects raised with the development of regular donations by some donors in order to satisfy a growing demand. A seminal work (Lazarus, Transfusion, 2001) stated that there is a sustained thrombopenia in frequent plateletpheresis donors, correlated with the total number of donations. Aims: French regulation authorizes up to 12 plateletpheresis donations per year, with a minimum 4 weeks interval between them. We tried to evaluate the risk of sustained thrombopenia under these conditions. Methods: We retrieved all plateletpheresis donations occurring between 01/01/2014 and 08/31/2018 from the French civilian blood donors' base and then selected a cohort of donors with at least 24 donations during that period. In order to minimize measurement errors, platelet counts analysed were means of three consecutive donations, i.e. 8 measures for each donor. Results: The cohort includes 2,186 donors (384 women and 1,802 men). Mean platelet counts fluctuate between 276.4 and 278.6 platelets/mL. Analysis of variance does not show any statistically significant difference (F = 0.462), even taking donor's sex or age in consideration. There is no difference if we consider the total duration of the 24 donations, either. Donors with the lowest first counts show a significant rise in subsequent measures and donors with the highest counts show a decrease trend, exhibiting a classical regression toward the mean. Summary/Conclusions: Plateletpheresis French regulation does not seem to be at risk of sustained donor thrombopenia. This conclusion is in agreement with recent literature data. The primary biological role of the Human Leukocyte Antigen (HLA) system is the regulation of the immune response to foreign antigens. Because of this role, HLA genes and molecules have an important role in transplantation, etiology of many autoimmune, non-autoimmune and infection diseases, but also in transfusion medicine. An increasing probability of an HLA non-compatible blood products, tissues or organs exists due to the extremely high polymorphism of HLA genes, with more than 20,000 described alleles to date, and their different frequency distribution in various worldwide populations. The HLA system, originally discovered as a result of a transfusion reaction in the 1950s, can cause detrimental immune reactions in transfusion therapy. HLA antibodies present in the patient are responsible for some of these reactions, while in other cases HLA antibodies or HLA reactive cells present in the transfused product are accountable for the immunoreactivity. HLA antibodies form as a result of exposure to foreign HLA antigens during pregnancy, transplantations and blood transfusions and can cause platelet immune refractoriness, febrile transfusion reaction, transfusion-related acute lung injury, and transfusion associated graft versus host disease. In order to avoid or reduce the development of these transfusion-related events, HLA antibody negative or compatible products should be used. Almost all existing methods presently used for molecular typing of HLA polymorphisms are based on polymerase chain reaction, but with different resolution levels (low resolution -two digits or high resolution -four digits). In addition to providing a more precise detection of polymorphisms at HLA classical loci (e.g. HLA-A, -B, -C, -DRB1, -DQB1), molecular methods can also determine polymorphisms at HLA loci which previously could not be typed by serology (e.g. HLA-DRB3, -DRB4, -DRB5, -DQA1, -DPA1). The most commonly used method for the detection of HLA antibodies was until recently complement-dependent cytotoxicity (CDC) technique, but it is increasingly being replaced by a more sensitive, solid phase based method (Luminex technology). In conclusion, an accurate and precise determination of both HLA gene polymorphism and HLA antibodies presence is essential for the safe and efficient administration of transfusion products. Background: In only a minority of pregnancies complicated with anti-HPA1a antibodies serious fetal/neonatal disease develops. The difficulty in predicting which mothers should be treated with IVIg hampers implementation of FNAIT screening. We found that Fc-core fucosylation and galactosylation are highly variable in anti-HPA1a IgG, and that these glycan features strongly affect binding to FccRIIIa receptor. The level of Fc-core fucosylation of anti-HPA 1a alloantibodies was found to correlate with platelet count and outcome of the newborn, suggesting that antibodyspecific fucosylation might serve as a biomarker in FNAIT screening. However, at present the Fc-glycosylation pattern can only be determined by complicated methods involving purification of the antigen-specific IgG, and analyzing trypticly released -IgG-derived-glycopeptides by tandem liquid chromatography-mass-spectrometry (MS) techniques. These methods, although powerful, are not yet suited for high throughput clinical screening. Aims: Our aim was to provide a simplified method to quantify the biological activity of anti-HPA-1a antibodies, and possibly other alloantibodies against blood cells.

Methods: Here we explored if cellular surface plasmon resonance (SPR) imaging can replace MS, resulting in less complicated handling of patient sera and donorantigen-bearing cells. The strength of the binding of platelets to FccR on SPR sensor was monitored under flow. The SPR sensor was equipped with both WT FccRIIIa (sensitive to Fc-glycosylation status) and mutant FccRIIIa-N162A (insensitive to Fcglycosylation status). In addition, the biosensor was prepared with anti-platelet CD61 (C17) and anti-IgG to calibrate the number of injected platelet as well as to quantify IgG-opsonization. The quality of the anti-HPA 1a glycosylation was monitored as the ratio of the binding of opsonized platelets to the WT and the mutant N162A-FccRIIIa. Platelets opsonized with recombinant glycoengineered anti-platelet antibodies with different levels of Fc-fucosylation were used as standards. For validation, 166 plasma samples with anti-HPA1a antibodies, already analyzed by mass spectrometry and with known clinical outcome were tested (Sonneveld, BJH, 2016) . Results: We found that the ratio between the binding to the WT FccRIIIa and to the mutant N162A-FccRIIIa correlated with the level of fucosylation of the HPA1a antibodies, as measured by mass-spectrometry (r = À0.524; P < 0.0001). Overall, a similar predictive value for disease severity was obtained as we previously reported for this retrospective cohort. In addition, quantitative information on antibody concentration can also be extracted using the FccRIIIa-N162A receptor as sensor on the chip, while anti-IgG gave aspecific signals, presumably because it recognized cytophilic platelet-FccRIIa-bound antibodies as well. Summary/Conclusions: In conclusion, the combined use of WT and mutant FccRIIIa in a label free SPR assay provides both quantitative and qualitative information of platelet bound anti-HPA 1a antibodies, which circumvents the need for purification of specific antibodies and laborious mass spectrometric analysis. This approach might be generally applicable to determine the biological activity of cell bound antibodies not only for anti-HPA1a in FNAIT, but also for anti-RhD alloantibodies in HDFN or anti-platelet antibodies in ITP. Background: Immunization against the human platelet HPA-1a alloantigen is the most common cause of severe fetal and neonatal alloimmune thrombocytopenia (FNAIT) in otherwise healthy term newborns. The screening for HPA-1a antigen in pregnant women is an important tool for identification of pregnant women at risk of having a fetus/neonate with FNAIT. Any targeted intervention depends on efficient screening methods as well as sensitive and specific methods for detection of anti-HPA-1a. Within the framework of the Polish-Norwegian project (PREVFNAIT) we have performed HPA-1a screening program in Poland. Aims: Our aim was to assess the frequency anti-HPA-1a antibody detection and the clinical outcome of newborns identified through the study. Women who joined the program due to the FNAIT in the previous child or in the current newborn are not analyzed in this study. Methods: HPA-1a screening of 24 244 pregnant women in 8-40 gestational weeks was performed by FACS phenotyping or RQ-PCR genotyping at IHTM in Warsaw. HPA-1a negative/HPA-1B/1B women were tested for HLA DRB3*01:01 and for anti-HPA-1a antibodies by MAIPA (followed up at week 17-20, 28, 32, 38-40 and 6 weeks after delivery). If anti-HPA-1a were detected, quantitative MAIPA was performed. All HPA-1a negative women were contacted for information concerning the newborn. If the baby had thrombocytopenia and anti-HPA-1a were not detected by MAIPA, the look back samples were tested retrospectively by PAKLx test (Immucor). Results: 554 HPA-1a negative women were identified (2.3%). Anti-HPA-1a was antibodies were detected by MAIPA in 44 women (two delivered tweens). In addition, anti-HPA-1a antibodies were later detected by PAKLx in further 3 women who delivered baby with severe thrombocytopenia and/or ICH. Total number of immunized mothers was 47 (8.5%). They delivered 49 babies; 35 were boys. Three women were treated by IVIg: two by 4 and 8 injections since 33 th and 26 th gw respectively. The anti-HPA-1a concentration in the 1 st one was 0.4; 0.1; 5.88 IU/ml in 17, 28, 32 gw respectively and in the 2 nd <0.05 IU/ml in all examined samples. The decision on treatment was based on the low PLT count~50 G/L in the fetus in cordocentesis. Their newborns (one delivered tweens) were healthy. The 3 rd treated woman entered the program in 35 gw (anti-HPA-1a concentration was high 22.64 IU/ml). She obtained one injection of IVIg. Her baby was born with mild thrombocytopenia with no ICH. Severe FNAIT occurred in 5/49 newborns: in 3 with anti-HPA-1a detected in PAKLx only and in 2 with antibody concentration in MAIPA -1 st : 6.86/12.91/ 23.36 at 28/32/38 th gw respectively; 2 nd : 8.85/17.58 at 32/38 th gw respectively. ICH was observed in all of them; PLT count was < 50x10 9 in four, 56 9 10 9 / in one. Summary/Conclusions: 1/ the severe thrombocytopenia due to anti-HPA-1a alloimmunisation in our prospective study occurred in 2/10 000 pregnancies 2/ The PAKLx could improve anti-HPA detection in the screening program and should be considered as an additional diagnostic test, if MAIPA result is negative 3/ The HPA-1a alloimmunisation frequency is higher in pregnancies with male than female fetus. Background: Foeto-maternal platelet alloimmunization (FMPAI) is mainly characterized by foetal and / or neonatal thrombocytopenia (FNAIT), sometimes revealed by intracranial hemorrhage (ICH) or even by foetal death in utero (FDIU). The experience of the PNIL Milwaukee (USA) reported in 2014 that the diagnosis of alloimmunization was carried in only 33% of neonatal thrombocytopenia cases with a clinical symptomatology highly suggestive of an alloimmune etiology. Aims: The aim of this two-year study was i) to determine the frequency of platelet incompatibilities in FNAIT, ICH and FDIU and ii) to evaluate the frequency of detectable platelet alloantibodies (alloAb) and their specificity in cases of incompatibility. Methods: Platelet genotyping was performed by HPA Beadchip Genotyping kit (BioArray Solutions, Immucor, Warren, NJ). Serology investigation was carried out by 3 different methods: Complete MAIPA Kit (apDia bvba, Turnhout, Belgium), Pack LxTM Assay (Immucor GTI Diagnostics, Waukesha, WI) and « in house » MAIPA. All 2017 and 2018 data were collected using the Laboratory Information Management System. Results: 544 patient files were analyzed. No incompatibility is demonstrated in HPA-1 to -9, -11 and -15 systems in 19.3% (n = 105). HPA-1 and / or 3 and / or 5 incompatibilities were found in 271 cases (49.8%), HPA-2 and / or 15 in 87 cases (16%). Platelet alloimmunization was globally confirmed in only 10.6% of the cases. 58 platelet alloAbs were identified regardless of clinical manifestations: 24 anti-HPA-1a (41.4%), 20 anti-HPA-5b (34.5%), 8 anti-CD109 (13.8%), 2 anti-HPA-5a and anti-HPA-15b (3.4% respectively) and 1 anti-HPA-1b and anti-CD36 (1.7% respectively). 40 alloAbs were found in the context of neonatal thrombocytopenia, 6 in ICH and 10 in FDIU, and 1 in a follow-up of pregnancy. Even if no anti-HPA-3 alloAb could be identified, the incompatibility in this system was highly associated with FNAIT, ICH and FDIU (n = 55, n = 32 and n = 17 on 114 cases). Summary/Conclusions: This study strongly confirmed the known immunogenicity of some HPA systems and highlighted overall the severity of HPA-3 and HPA-5 incompatibilities. The definite diagnosis of FMPAI is difficult to make due to the present technical difficulties in the detection of antibodies against the HPA-3 and HPA-15 systems. However, our results suggest that special attention should be paid to the management of pregnancies with these incompatibilities due to the frequency of severe foetal/neonatal adverse events. Background: Fetal and neonatal alloimmune thrombocytopenia (FNAIT) is a potentially life threatening disease caused by maternal alloantibody formation against fetal human platelet antigens (HPAs), of which anti-HPA-1a is accountable for the fast majority of the cases. Population-based screening for FNAIT has been topic of debate for over decades. Logistically as well as financially, the major challenge of such a screening is the typing of pregnant women to recognize the 2% HPA-1a negative women. At present, HPA-1a typing is mostly done by genotyping. For costeffective implementation of anti-HPA-1a screening there is need for a high-throughput, quick and low-cost phenotyping assay. Aims: The aim was to develop a high-throughput, quick and low-cost phenotyping assay in order to identify HPA-1a negative pregnant women. Methods: An automated sandwich ELISA was developed to perform HPA-1a phenotyping using a murine monoclonal anti-GPIIIa as coating antibody and horseradishperoxidase-conjugated recombinant IgG1 anti-HPA-1a as detecting antibody. To ensure the applicability for high-throughput testing in a potential screening setting, 20 ll of the uppermost plasma of 3 -6 days-old stored EDTA anticoagulated blood tubes was used, without first swirling or spinning them. In two phases, samples of pregnant women were tested and compared to an allelic discrimination polymerase chain reaction assay as golden standard. In the first phase, samples from unselected consecutive pregnant women were tested. The second phase was part of a prospective screening study in pregnancy and confirmatory genotyping was restricted to samples with an arbitrary set OD < 0.500 in the HPA-1a ELISA.

The developed ELISA was optimized to require no additional handling (swirling or spinning) of stored tubes. During phase I, 506 consecutive samples were tested. In phase II, the HPA-1a ELISA was performed in another 62,171 consecutive samples, with confirmatory Q-PCR in 1,825. The two phases combined, samples from in total 1,585 HPA-1a negative and 823 HPA-1a positive pregnant women were genotyped. The assay reached a 100% sensitivity with a cut-off OD between 0.075 and 0.200, leading to a specificity of 99.6%. Summary/Conclusions: A quick, low-cost and reliable assay for HPA-1a phenotyping was developed that can be used in a population-based screening setting to select samples that has to be tested for the presence of anti-HPA1a antibodies. Because plasma from non-mixed or spinned tubes of three to six day-old samples can be used, this assay is applicable to settings with suboptimal conditions. Background: Cytomegalovirus (CMV) sero-prevalence in Ireland is lower than that which is reported in many other European countries. A study of 1047 pregnant women in 2002 found that 30.4% of Irish women were CMV seropositive in comparison to 56% from Western Europe and 92% Eastern Europe and 97% from Africa. An internal study carried out by the Irish Blood Transfusion Service (IBTS) in 2010 indicated the rate of CMV seropositivity in Irish Blood donors was 21.97%. Therefore a significant proportion of the Irish donor and recipient population are susceptible to primary CMV. This is of particular concern for patients for certain at-risk groups such as very-low birthweight CMV seronegative neonates, CMV seronegative patients undergoing transplantation and other CMV seronegative immunocompromised patients. This results in a demand for the provision of CMV sero-negative blood components. In 2018 the IBTS evaluated the Abbott Alinity s CMV IgG assay as a replacement for the CMV Mastazyme EIA (Total AB EIA). Aims: To assess the performance of the Abbott Alinity s CMV IgG screening assay in comparison to the CMV Mastazyme EIA (Total AB EIA). Methods: Diagnostic sensitivity was determined by testing 48 confirmed CMV IgG positive donors from an external laboratory. Sensitivity was assessed using three seroconversion panels (n = 54). Analytical sensitivity was calculated using linear regression analysis of the WHO first international standard for anti-CMV IgG. Diagnostic specificity was determined by testing 6127 donors. Further evaluation of discordant results was carried out using the Architect anti-CMV IgG and IgM assays and VIDAS anti-CMV IgG and IgM assays. Results: The diagnostic sensitivity of the Alinity s anti-CMV IgG assay was determined to be 100%. The seroconversion sensitivity reported 42 out of 54 samples reactive. The analytical sensitivity of the Alinity s CMV IgG assay was determined to be 1.12 IU/ml. The validation reported 65 discordant results from 6127 donor samples tested with both the Alinity s CMV IgG assay and the current Mastazyme total assay. 60 discordant results were observed (Alinity s anti-CMV IgG positive/Mastazyme total negative). Further testing of these samples classified 27 discordant results as positive, 12 as negative and 21 as indeterminate. 5 discordant results were observed (Alinity s anti-CMV IgG negative/Mastazyme total positive). Further testing classified these samples as negative. Overall the diagnostic specificity was determined to be 99.80%. Summary/Conclusions: Both the seroconversion and analytical sensitivities are comparable between the Alinity s CMV IgG assay, the CMV Mastazyme Total AB assay, the Architect CMV IgG assay and the Vidas IgG assay. The slight variations can be attributed to the individual assay cut-off definitions, which can vary greatly between CMV assays. It must be noted that the determination of the diagnostic specificity (99.80%) does not include indeterminate discordant results. Further testing will be carried out to try to characterize all discordant samples in collaboration with Abbott. This evaluation did not identify any donors with isolated confirmed CMV IgM antibodies in a pool of 6127 donors. Based on this evaluation the Abbott Alinity s CMV IgG assay is a suitable replacement to the Mastazyme total AB assay for blood donor screening. Background: Africa has a unique set of challenges regarding safe blood transfusion. Two of the largest contributing factors are: 1) The most common disease states in Sub-Saharan Africa (SSA) require large amounts of blood as lifesaving interventions e.g. malaria, 2) the highest burden of infectious diseases transmissible through transfusion (Tapko, Toure, & Sambo, 2014) is found in SSA. This has often led to the binary donor base that exists in SSA, consisting of Voluntary Non-remunerated Blood donors (VNBD) and family or replacement donors (FRD) as transfusion centres are unable to supply the demand when relying only on VNBD. Voluntary non-remunerated donors are the safest blood donors as they have no incentive (other than altruistic motives) and are not under social pressure to donate, both factors that may induce individuals knowing or suspecting themselves to be infected with a blood-borne agent to donate blood. Nucleic Acid Testing (NAT) in conjunction with serological testing is the gold standard for testing, however, the vast distances and high temperatures of Africa makes transport of traditional plasma samples a logistical challenge. Many publications evaluating the stability, suitability, and ease of use of dried blood spots (DBS) for NAT have been published. Generally, results have been shown to be comparable to traditional plasma samples. DBS is being used successfully in the early infant diagnosis (EID) programs for HIV by means of PCR testing, especially in Africa. Aims: 1. To demonstrate that DBS and/or dried plasma spot (DPS) testing is suitable for blood donor screening and can make NAT testing more widely available in Africa 2. To determine the diagnostic sensitivity and specificity of testing DPS and DBS samples, in comparison to testing of plasma samples. Methods: 900 negative new donor samples and 100 confirmed positive donor samples, as defined by routine blood safety screening done at Western Cape Blood Service, were screened using a dried blood spot kit. After routine testing was completed, one DBS sample and one DPS sample for each blood donor were prepared and analysed with the Ultrio Elite Assay on the Panther analyser. Summary/Conclusions: DBS/DPS can be used as a sample for screening blood donors as the invalid rate was 0.56%, and only found on DBS samples. Logistically DBS/DPS is well suited for the resource-poor countries as samples are: -Easy to obtain (fingerpick samples could be used.) -Transport is simplified as samples will not leak or haemolyse due to high temperatures. -Samples can be stored at room temperature DBS/DPS demonstrated acceptable specificity. The Ultrio Elite performed well with regards to HIV and HCV sensitivity. Sensitivity with regard to HBV was not as high but this could be due to very low and erratic viral loads. Background: Sanquin Blood Supply is responsible for the blood transfusion services in The Netherlands. At the National Screening laboratory Sanquin (NSS) annually more than 750.000 blood and plasma donations are tested, on average 3.000 samples per day. For more than 10 years, infection serology testing was performed using the PRISM (Abbott Diagnostics), but since mid of July 2018, serological testing for the HBsAg, HIV Ag/Ab, Anti-HCV and Anti-HBc is done with Abbott's Alinity s system. Aims: To compare the numbers of initially and repeatedly reactive results of whole blood and plasma donation samples and the rate of non-specific results leading to deferral of donations and donors for PRISM and Alinity s assays using data from 6 months before and 5 months after implementation of the Alinity s systems at NSS. Methods: Initial and repeat reactive rate of the assays run by either PRISM (HBsAg, HIV O Plus, HCV) or Alinity s (HBsAg, HIV Ag/Ab Combo, Anti-HCV,) were calculated for January to June 2018 (PRISM) and August to December 2018 (Alinity s). Due to the lack of a true confirmatory method for Anti-HBc, we only compared the rate of repeatedly reactive results for PRISM HBc and Alinity s Anti-HBc. Results: The rate of repeat reactive results for PRISM (P) and Alinity s (A) assays were as follows: 1) HBsAg P 0.01 % (42/390.736) versus A 0.03 % (87/322.394); 2) HIV P 0.07 % (262/390.735) versus A 0.06 % (201/322.470); 3) Anti-HCV P 0.11 % (427/390.737) versus A 0.03 % (109/322.476). The rate of anti-HBc reactive samples was not significantly different between PRISM (0.39 %) and Alinity s (0.42%). Over the study period, the rate of initially reactive samples for the three main screening assays (HBsAg, HIV, HCV) was also comparable between Alinity s (0.39 %) and PRISM assays (0.34 %), mainly attributable to a rather high number of initially reactive Alinity s HIV Ag/Ab results. This was due to initial issues with blood collection tubes that were resolved. As a result in December, the rate of initially reactive samples decreased to 0.16 %, which was significantly lower than for the three PRISM assays (0.33%). Summary/Conclusions: The introduction of the Alinity s assays lead to a decrease of the average repeat reactive test results (HBsAg, HIV, HCV) by 0.17 % as compared to the PRISM, mainly due to a lower false reactive rate of the Alinity s Anti-HCV assay. This will be further investigated for first time and multiple time donors. With the implementation of the Alinity s at Sanquin we aimed to improve not only the operational efficiency but also to further minimize unjustified disapproval of donors. These first data show that the low initial and repeat reactive rates of the Alinity s assays indeed have a positive impact on unnecessary deferrals of donations and donors. Background: In blood banks, testing all blood donations for markers of infectious diseases plays an important role in maintaining the safety of blood transfusions. Mandatory serological testing in Switzerland is performed for anti-HCV, HIV Ag/Ab, HBsAg and Syphilis. Highly specific and sensitive tests with corresponding automation are essential for this purpose. Aims: A comparative study was carried out to evaluate the usability of the newly launched Alinity s System (Abbott) and the specificity of the infectious disease parameters HBsAg, Anti-HCV, HIV Combo and Syphilis (Abbott) with the currently used ELISA methods on the Quadriga BeFree System (all DiaSorin, formerly Siemens Healthcare Diagnostics). Methods: The study took place at the Interregional Blood Transfusion Service in Berne, Switzerland. The specificity of the parameters was studied on 2,748 blood donor sera from both first time and repeat donors. The samples were tested first on the Quadriga Be Free System with Enzygnost HBsAg 6.0, Enzygnost Anti-HCV 4.0, and Enzygnost HIV Integral 4 assays and on the PK7300 with the newbio-pk TPHA assay (Newmarket Biomedical). All samples were retested on the same day with HBsAg, Anti-HCV, HIV Combo and Syphilis on the Alinity s. Initial reactive samples were repeated in duplicate. Discriminatory tests were carried out for repeatedly reactive samples using alternative screening tests and neutralisation (for HBsAg) on an Abbott Architect i1000 system and immunoblots (HIV-, HCV-, Syphilis-INNO-LIA, Fujirebio). For all samples, results from our routine individual donation nucleic acid testing (HCV, HIV, HBV, Roche cobas 8800 system) were available. Results: Based on the results from testing 2,748 blood donations, the observed specificities of Alinity s assays (A) and Enzygnost assays ( Summary/Conclusions: The Alinity s System was easy to use by the operators after a very short introductory training and provides good operational efficiency such as high throughput even when selective testing for samples is needed. The observed specificity of Abbott Alinity s versus Siemens Enzygnost assays is comparable in a blood donor screening setting. Unfortunately, we were not able to analyse statistically the specificity data due to the insufficient number of donor samples tested in parallel. It is worth mentioning that around 90% of the samples included in the study derived from repeat donors who had been previously tested with the Enzygnost assays but were "first time donors" for the Alinity s assays. All four assays from both systems exhibit a very good specificity and are highly suitable and practicable for routine blood donor screening. Background: Effective screening for transfusion-transmissible infections is essential to ensure safe blood transfusions. The World Health Organization recommends mandatory serological testing of blood donations for human immunodeficiency virus (HIV), hepatitis B (HBV)/C (HCV), and syphilis. Due to increasing demands on clinical laboratories, there is a need for reliable and accurate automated blood screening tests. The fully automated cobas e 801 analyser can be used with Elecsys â infectious disease parameters to screen donor blood samples. Aims: To compare the performance of Elecsys â infectious disease parameters on the cobas e 801 analyser (Roche Diagnostics) with other commercially available assays for routine first-time blood donor screening. Methods: We provide results from Etablissement Franc ßais du Sang (Montpellier), a blood bank which participated in a large, multicentre study of the cobas e 801 analyser. The following infectious disease marker assays were compared: HIV, Elecsys â HIV Duo versus PRISM HIV O Plus; HCV, Elecsys â Anti-HCV II versus PRISM HCV; HBV surface antigen (HBsAg), Elecsys â HBsAg II versus PRISM HBsAg; HBV core antigen antibodies (anti-HBc), Elecsys â Anti-HBc II versus PRISM HBcore; syphilis, Elecsys â Syphilis versus newbio pk TPHA assay. Specificity was tested using residual fresh serum samples from unselected first-time blood donors, and calculated according to assay package inserts and site-specific cutoffs. Samples were tested using comparator assays, then retested the same day using Elecsys â assays. Initially reactive samples were repeated in duplicate; confirmatory tests were conducted on repeatedly reactive samples. Confirmatory tests: HIV, nucleic acid testing (NAT), ARCHITECT HIV Ag/Ab and INNO-LIA â HIV I/II Score assays; HCV, NAT, ARCHI-TECT HCV and INNO-LIA â HCV Score assays; HBsAg, NAT, ARCHITECT HBsAg and Elecsys â /PRISM HBsAg Confirmatory assays; anti-HBc, NAT, HBsAg, Anti-HBs, and ARCHITECT Anti-HBc assays; syphilis, ARCHITECT Syphilis TP and INNO-LIA â Syphilis Score assays. Sensitivity was tested using 30 preselected, anonymised, positive, citrate-phosphate-dextrose-plasma samples (Plasmatec Laboratory Products) and compared with archived data for comparator assays. Sensitivity was calculated according to the final NAT result. Results: Across all infectious disease markers, specificity to detect repeatedly reactive samples using Elecsys â versus comparator assays was similar (99.81-100.00% versus 99.79-99.98%; n ≥ 5195). In specificity analyses, there were 14 discrepant results for HIV testing, 27 for HCV, two for HBsAg, eight for anti-HBc, and five for syphilis. Sensitivity of the Elecsys â HIV Duo assay (83.33%; 95% CI 65. 28-94.36) was higher than the PRISM HIV O Plus assay (76.67%; 95% CI 57.72-90.07), but the difference was not statistically significant. Sensitivities of Elecsys â and comparator assays were the same for HCV (85.19%; 95% CI 67.33-95.97), HBsAg (70.00%; 95% CI 50.60-85.27), anti-HBc (100.00%; 95% CI 85.75-100.00), and syphilis (100.00%; 95% CI 88.43-100.00); three HCV and six anti-HBc samples were classified negative/ indeterminate and excluded from the analyses. In sensitivity analyses, there were two discrepant results for HIV testing, three for HCV, and five for anti-HBc. Summary/Conclusions: Elecsys â infectious disease parameters on the cobas e 801 analyser demonstrate high specificity/sensitivity for screening first-time blood donor samples, with similar clinical performance to other commercially available assays. Background: Individual plasma and serum specimens from whole blood or plasmapheresis donors are tested for absence of infectious agents by serological assays prior to use for transfusion or production of blood derived therapeutics. The Department of Plasma Analytics (PA), Takeda (Austria), and Haema AG, Grifols (Germany), both labs with high throughput and a high level of automation, were seeking for alternatives to replace their current serological test systems (Abbott PRISM Next). Aims: To allow a direct comparison of the two final candidate analyzers Alinity s (Abbott) and cobas e801 (Roche Diagnostics GmbH), a side by side evaluation was carried out by the PA and Haema with support from Abbott and Roche (provision of instruments and reagents). The aim was to compare assay specificities as well as handling and performance of the instruments. The outcome should be used to better understand potential specificity differences and practical handling aspects (throughput, etc.) of a next generation serological analyzer. Methods: The two candidate instruments were installed in the PA. From March to June 2018, close to 10,000 aliquots from routine preselected repeat donors, provided by Haema, were run on both study instruments in parallel. Plasma samples were tested for HBs antigen (Ag), HCV antibody (Ab), HIV Ag/Ab, and partially for Syphilis Ab. Serum samples were additionally tested on HBc Ab. Samples with repeat reactive results ("RR", two reactive results out of three tests) not confirmed by confirmatory tests were counted as false reactive. The necessary sample size was calculated based on a one-sided comparison of proportions with the aim to detect potential specificity differences (a = 10%) in the size of those specified by the manufacturers' instructions. Two different lots were tested for the three main assays. Results: Out of 7,389 plasma and 2,242 serum samples, 41 test results representing 37 individual donations were found RR on one or both instruments. Two samples were confirmed positive (1 9 HBsAg, 1 9 HCV), two others were indeterminate. The sample containing low level antibodies against HCV was PCR negative and only detected by the Roche system. The percentage of false reactive results for the five assays on the two systems were (Alinity s/e801): HBs Ag: 0.04/0.03 % in a total of 9590/9589 samples tested; HCV Ab: 0.01/0.09 % in 9620/9585, P < 10%; HIV Ag/Ab: 0.03/0.09% in 9362/9329, P < 10%; Syphilis Ab: 0.1/0.07% in 2971/2987; HBc: 0/0% in 1531/1549. No significant difference was found between the calculated specificities in our study and the manufacturers' data. A potential influence of sample matrix and kit lots was assessed. A trend towards more false reactive results in serum vs plasma was found for nearly all assays. No clear-cut statistical difference was seen between lots. Summary/Conclusions: The study results are in line with the manufacturers' specificity data, showing that the Alinity s HCV Ab and HIV Ag/Ab assay show a slightly higher specificity in a population of plasma and serum samples from repeat donors prescreened by PRISM. A possible influence on the test specificity by the sample matrix was detected but needs further investigation. The possibility to edit complex genomes in a targeted fashion has not only revolutionized basic research but biotechnological and therapeutic applications as well.

With the rapid development of genome editing tools, in particular zinc-finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and the CRISPR-Cas system, a wide range of therapeutic options have beenand will bedeveloped at an unprecedented speed. Therapeutic genome editing in hematopoietic cells enable new interventions in the blood and immune system, including novel approaches to treat immunological disorders, infectious diseases, and cancer. We have developed GMP-compliant protocols to manufacture gene edited CD34 + hematopoietic stem and precursor cells (HSPCs) as well as chimeric antigen receptor (CAR) T cells, with the final goal to provide novel cell therapies for patients suffering from primary immunodeficiencies, chronic infection with human immunodeficiency virus type 1 (HIV-1), and some tumor entities. Despite great success in improving their specificity, engineered designer nucleases can induce genotoxic side effects by introducing mutations or chromosomal aberrations. We have established novel genome-wide assays that enable us to detect chromosomal aberrations induced not only by off-target activity but also by on-target activity, such as micro-aberrations and translocations, with unparalleled sensitivity. In toto, our developed protocols allow us to achieve genome editing in hematopoietic cells with high efficiency and to assess the genotoxic risk associated with the expression of CRISPR-Cas nucleases and TALENs in clinically relevant human cells, so forming the basis for planned phase I/II clinical studies.

Adoptive T cell therapy (ACT) has proven a potent means to treat blood-borne tumors and solid tumors. Adoptive cell therapies include T cells that are genetically engineered with tumor specific T cell receptors (TCRs), or with chimeric antigen receptors (CARs). In addition, tumor infiltrating cells (TILs) can be isolated from tumor lesions, which are then expanded and reprogrammed in vitro prior to transfusion into the patient. The anti-tumoral efficacy of ACT products depends on several parameters, including the capacity of CD8 + T cells to produce cytokines, chemokines and granzymes, a feature that is critical for effective anti-tumoral responses. Here I will discuss our efforts to develop and improve ACT products for future clinical use. I will present pre-clinical work on developing TIL therapy for non-small cell lung cancers. In addition, I will show that human CD8 + T cells can be divided into different subsets, and that only one of those subsets is highly cytotoxic. This finding may help improve the quality of genetically engineered T cell products, like TCR and CAR T cell products. Background: The Baltic States -Estonia, Latvia and Lithuania have a lot in common. We are located side by side, share the Baltic Sea as a gate to the West, and more importantly, a common history. We were members of the USSR and suffered 50 years of Soviet occupation. We held hands in a 600 km long human . . .chain" across the three States to express our mutual support, and later on, even joined the European Union on the very same day -June 1 st , 2004. The three differ a bit in size, population and more in the languages spoken in each one, but that does not explain why the path towards voluntary unpaid donation varies as it does. Aim: The aim is to describe the journey towards voluntary non-remunerated blood donation in the Baltic States after regaining independence from the Soviet Union. Methods: The information was collected from published and unpublished memories, annual reports and written interviews with Latvian and Lithuanian colleagues. Results: In Soviet times, all orders came from Moscow and quality control was conducted from the capital city of Latvia, Riga. Donors were mostly paid and given an extra vacation day. Big factories were the best places to collect blood and people were queuing to donate. In 1991, the Soviet Union fell apart and the Baltic States suddenly got the freedom and responsibility to decide. In Estonia the first edition of "Guidelines for the Preparation, Use and Quality Assurance of Blood Components" was taken as guidance in 1992. A lot of advice came from Finnish colleagues. In 1997, it was decided to move towards non-paid voluntary donations. The process took 6 years. The first couple of years were economically difficult for the reborn state, as money had less value than food. Instead of cash, donors were given rapeseed oil, sugar and pasta, for example. As the situation improved, food items were replaced by small symbolic gifts that carry sentimental value. It has been this way for more than 15 years by now. In Lithuania, the process started later, the first program for developing a framework for voluntary non-remunerated donations being carried out in 2006-2015. It resulted in 51% of the donations being unpaid. The second program initiated in 2016 is still ongoing, aiming towards 100% non-remunerated donations by 2020. By the end of 2018, they had reached 99.2%. In the beginning, the main obstacle was a private blood center creating unfair market conditions. In Latvia, monetary compensation for blood donations still exists, but the younger generation has been encouraged to donate blood for free and some results can already be seen. Summary/Conclusions: A common starting point does not guarantee the same results, at least not at the exact same time. Examining the circumstances leading to the different outcomes could benefit countries yet to start moving towards non-remunerated donations as well as those considering the opposite. Haemoglobin (Hb) was as expected significantly different between women and men (meanAESEM: 13.8 AE 0.01 vs 15.5 AE 0.01 g/dl; P < 0.000). Percentage of females with low Hb < 12.5 g/dl were 7.1%, 4.9%, 5.2%, 6.7% and 4.2%, percentage of males with Hb < 13.5 g/dl were 0.5%, 0.6%, 0.7%, 1.7% and 1.2% for the age groups 1-5 respectively. Ferritin values were higher in males compared to females (median; 25 th -75 th %>tile: 51;31-79 vs 157;106-231 lg/l; P < 0.000) and in older age groups compared to younger age groups (median; range in age groups 1-5 in females: 40;3-702, 52;6-619, 60;6-480, 60;8-725, 98; 10-604 and in males: 99;8-661, 161;18-1080, 206;15-1090, 220;26-1430, 221;33-981 respectively) . Percentage of females with ferritin ≤ 15 lg/l were 8.6%, 3.8%, 3.7%, 6.7% and 2.0%, while percentage of males with ferritin ≤ 15 lg/l were 0.2%, 0.0%, 0.1%, 0.0% and 0.0% for the age groups 1-5 respectively. White blood cell counts (WBC) were slightly higher in females compared to males (meanAESEM: 7.2 AE 0.02 vs 6.6 AE 0.03; P < 0.000). Percentage of females with WBC > 12x10 9 /L were 1.8%, 1.3%, 1.7%, 1.4% and 0.3%, while percentage of males with WBC > 12x10 9 /L were 1.4%, 0.9%, 0.5%, 1.2% and 0.9% for the age groups 1-5 respectively. None had WBC < 2x10 9 /L. Platelet counts (PLT) were higher in females compared to males (meanAESEM: 257 AE 0.6 vs 222 AE 0.6; P < 0.000).Percentage of females with PLT < 150x10 9 /L were 1.0%, 1.5%, 2.2%, 2.4% and 1.0%, while percentage of males with PLT < 150x10 9 /L were 2.6%, 3.6%, 2.7%, 2.4% and 1.6% for the age groups 1-5 respectively. Among the low PLT counts most were caused by EDTA-dependent Pseudothrombocytopenia. Extreme deviations from normality were seldom and referred to GPs for further investigations. Summary/Conclusions: First time donors are young with 75% younger than 30 years of age and the female/male ratio was 58/42. Of the 16 583 first time donors with data on ferritin available, 14% had low ferritin (≤ 30 lg/l). The typical male first time donors neither had low Hb nor low ferritin, even with a significantly lower ferritin in younger donors. In female first time donors the prevalence of low Hb (6%<12.5 g/dl) and low iron stores (23%≤30 lg/l) is high. In all, while all first time donors are highly appreciated, campaigns could target the male population to even out the gender imbalance. Blood Centers must be aware of the higher prevalence of low iron stores in the youngest donors. Background: The aim of assessing suitability of prospective blood donors is protection of their health and the safety of transfused patients. Selection process is not always effective in obtaining all relevant information from blood donors in a timely manner. For several reasons, some risks remain undetected or they are disclosed at a future donation(s). Therefore, recording and management of post-donation information (PDI) are of great importance for improvement of transfusion safety, donor counselling and education as well as overall improvement of the selection process. Aims: The aim of the study was to present results of PDI management at Croatian Institute of Transfusion Medicine (CITM) and the effect of education activities on their trends. Methods: We have analyzed reports on PDI recorded in two-year period (2017-2018), according to the types of information obtained, age and sex of blood donors, total number of their donations preceding PDI, and the time of receiving the information. The effect of an information leaflet on PDI launched in November 2017 was assessed by comparing results in two study years. Results: A total of 491 PDI were recorded: 266 in 2017 (1/396 donations) and 225 in 2018 (1/452 donations) with the following distribution: nonsexual risk as tattoo and piercing (17.5%), surgical procedures (17.1%), travel history (16.1%), infections/ contact (15.3%), other medical reasons (13.4%), endoscopy/invasive diagnostic procedures (12.2%), malignancy (4.3%), autoimmune diseases (3.7%) and sexual risks (0.4%). Majority (76.4%) were late PDI, revealed on the future donation(s): 58.7% on the first next donation, 28.9% on the second and 12.3% after more than 2 subsequent donations. The mean age of blood donors associated with PDI was 40 AE 12 years (median 39 years), while the mean age of all donors in 2017/2018 was 38 years (median 37 years). Of all PDI, 81.1% were related to male donors (84% in total pool of CITM donors). Using Chi-square test there were no significant difference between female and male donors in total PDI frequency and in their distribution to early and late PDI (P > 0.05). The median number of all donations preceding PDI was 6 for female donors and 19 for male donors. Implementation of education leaflet for blood donors resulted in 15.4% reduction of PDI in 2018 compared with 2017 (P > 0.05). The effect is more pronounced (P < 0.05) when comparing second and first half of 2018 (-25.6%). Reduction is observed in all types of PDI with the exception of infections/contact (because they are mostly early PDI) and malignant diseases. The share of early PDI increased from 21.1% in 2017 to 26.7% in 2018, which may suggest better awareness of blood donors on the importance to inform blood bank on changes in their health status. Summary/Conclusions: Our study points to the importance of systematic recording and management of PDI, including education of blood donors about the need of providing all relevant facts related to their health and the safety of donated blood in a timely manner. We are planning further improvements by providing information on this topic on posters and screens on donation sites. Background: Currently, the transfer of data between organizations and/or computer systems is very limited, and where present is typically proprietary. In the absence of a standardized reference format individual organizations and vendors attempting to integrate disparate databases must develop unique solutions. Aggregation of information from multiple sources is complex and costly, constituting a significant barrier to effective analysis of data to improve practice and inform policy. Aims: To standardize the definitions and facilitate integration of key data items used in blood donation and transfusion. We report here on an initial effort to map internationally harmonized critical steps in the blood collection/donation process in order to test the approach. Methods: Through a collaborative process of serial conference calls and correspondence, an informal multi-national consortium of experts across the transfusion industry are attempting to create a vocabulary with sufficiently precise definitions to be usable by automated systems and that can be the foundation of a Blood Collection/Transfusion Medicine Common Data Model (CDM), using the following steps: -Define the scope of activity to be addressed and segment into key processes.

-Identify the set of data elements in each segment that are common to all systems. -Review and consider existing standards and definitions for each data element.

-Develop draft definitions for each data element.

-Release draft to public domain for critical review and refinement with long-term goal of gaining widespread endorsement. Results: A standardized approach to blood donation was mapped through identification of common pathways and core mappable data elements. Denominator data associated with donor characteristics and blood collection was selected as the first segment to address. A dictionary (or vocabulary) of common terms has been created and will be presented for international comment. Summary/Conclusions: Developing an international consensus on the core elements and their definitions across the transfusion chain is critical for data integration and automation efforts. The expected benefits of this endeavor include that it allows the establishment of algorithms to automate reporting and thus reduce hands-on staff time; reduces time and resources needed to integrate new databases; allows systems to continue to use existing concepts and definitions internally while also providing data output in a standardized format; supports the ability to consistently analyse, interpret and present information regardless of the data source; establishes data definitions against which new systems can be developed; helps to improve comparability of results by providing a common data model for researchers and policy makers; improves confidence in data integrity and reliability of the derived information as a © 2019 The Authors Vox Sanguinis © 2019 International Society of Blood Transfusion Vox Sanguinis (2019) 114 (Suppl. 1), 5-240 basis for rational decision making; and reduces data gathering effort and cost thus improving opportunities for more efficient/complex data analysis. Standardizing the transfusion medicine dataset is the first step in achieving the automation of data transfer and analysis needed globally to drive patient safety, research innovation, and best business practices. Further steps must address the precise methods of data exchange, identification of responsible entities for maintenance and further development, and engagement of computer system developers. Red blood cell (RBC) alloantibodies develop in a subset of individuals following exposure to non-self RBCs through transfusion, pregnancy, or other activities; these antibodies can lead to difficulty locating compatible RBCs, acute or delayed hemolytic transfusion reactions, or hemolytic disease of the newborn. Alloimmunization is underestimated due in part to antibody evanescence, the random nature of posttransfusion antibody screens, fragmented medical care, and the lack of widespread antibody registries. Factors that influence who will develop detectable alloantibodies are not well understood. Transfusion burden is one risk factor for alloimmunization, though many highly transfused individuals never form alloantibodies despite exposure to many RBC units (and many non-self ABO blood group antigens). Individuals with sickle cell disease (SCD) and myelodysplastic syndrome (MDS) are more likely to form RBC alloantibodies than most other patient populations. Individuals with rheumatologic and other forms of autoimmunity, though not chronically transfused, are also at higher than average risk of forming RBC alloantibodies. Inflammation, in a broad sense, is one common thread among these diagnoses associated with high prevalence rates of RBC alloimmunization. Reductionist murine models support some types of inflammation (including viral-like stimuli) around the time of RBC exposure as being associated with an increased likelihood of alloantibody formation. Strategies other than transfusion avoidance or extended antigen matching beyond ABO/ Rh would be beneficial to prevent new RBC alloantibody formation, especially in patients at highest risk. Background: The unique genetic makeup of the Omani population makes them rich in the genetic blood disorder. 45 % of Omani populations are Àa/Àa gene carriers, 44% Àa/aa, and 11% of the population are aa/aa. Around 10 % of Omani nationals carry the gene for HbS, and 2 -3 % carry the gene for b-thalassaemia. Recent statistics show that there are around 400 patients with thalassaemia major and 3000 with SCD in Oman. The other RBC abnormality that is common in Oman is G6PD deficiency which is found in 28 % of males and 12 % of females. Omanis are known to have the highest frequency of a thalassaemia and G6PD reported so far in any race. Although blood transfusion is one of the supporting treatments of SCD, it can cause some serious complications for the patients. Alloimmunization of red blood cells is one of the consequences of blood transfusion. Alloimmunisation of the RBCS can cause haemolytic transfusion reactions and may trigger hyperhaemolysis, in which transfused and patient's own RBCs are destroyed. Alloantibodies can cause delay in the process of transfusion, it can be costly and time consuming. High number of patients developing alloantibodies may indicate a major difference in the patient and donor population. It may also indicate lack of a controlled, generalised sickle patients management policy. In Oman the decision of transfusing SCD patient is left to physicians attending the patient. Aims: This study is aimed to highlight the increasing number of alloimmunised sickle cell patients. In the Royal Hospital we get 40 new cases of sickle patient with alloantibodies each year. The acknowledgement of these cases may help in is assessing the current practice of transfusing SCD patients, or will help to define the donor and patient population difference. Methods: 418 patients were recruited in the Royal Hospital for this study. EDTA blood samples were taken for antibody screening test and in the positive cases antibody was identified, all tests done by capture technique using Immucor Neo machine. Results: Of the 418 SCD patients, 49% of the patients were male and 51% female, mean age was 17 years, in the range of 1-72 years. 38 % of the SCD cases were positive for the alloantibodies, 72% were Female and 28% were male, the age range was from 6-68 years. 78% of the positive were SCD, 19% S trait and 3% were S/ bthal. Most of the patients developed one antibody, however cases of multiples antibodies were also detected. 51% of the patients were with single alloantibody, 30 % of them with two antibodies, 10 % with three antibodies, 7 % with four antibodies and 2 % with five antibodies. The majority of the cases were IgG against Rh antigens anti-E is being the majority 23%, followed by anti-D 13%, anti-K 17%, anti-C 14%, anti-c 8%, anti-Jk a 5%, anti-Jk b 5%, anti-Fy a 5%, anti-e 3%, anti-S 3%, antis 1%, anti-Kp a 0.7%, anti-Fy b 0.3% and IgM being 2%. Summary/Conclusions: RBC alloimmunisation rate is high in Oman majority of the patient affected are female. Interestingly sickle trait patients were also transfused and 19% of them developed alloantibodies. The practice of transfusing Rh and Kell matching blood unit is implemented four years ago and still high alloimmunization percentage is achieved. Background: In Ghana, routine pre-transfusion investigations for patients with sickle cell disease (SCD) involve only ABO-D typing and immediate spin crossmatch, without screening for irregular RBC antibodies Aims: Determine the prevalence and specificities of and risk factors for RBC alloantibodies in multi-transfused patients with SCD Methods: In 2018, a cross-sectional study in multi-transfused patients with SCD, from two tertiary hospitals in Ghana was performed. Participants' data on demography, transfusion and medical history were recorded. Antibody screening and identification tests were done at Sanquin, the Netherlands, with standard serology using LISS as enhancer and with papain treated RBC panel cells ('enzyme only'). Characterization of RHD genes was done by Multiplex Ligase Amplification Assay. Logistic regression was used to determine the association of patient characteristics, i.e. sex, age at enrollment (continuous), age at first transfusion (categorized as ≤ 1, 2-5, 6-9 and ≥10), previous pregnancy, number of transfused units (2, 3-5 and 6-10 and > 10), and years after last transfusion (<1, 1-2, 2-5, >5y) with presence of alloantibodies Results: 226 patients (100 males and 126 females, median age 17 years, range 1.7-66) were included. The median number of transfusions was 3 (range 2-40). The median years after last transfusion was 2 (range 2 weeks-55.5 years). In 56 patients, anti-RBC antibodies were detected. In 14 of them the antibodies were weakly reactive with enzyme treated cells only or pan-reactive, possibly some of them representing autoantibodies or antibodies against high frequency antigens. In seven patients enzyme-only anti-Le a was demonstrated, likely naturally occurring antibodies. Thus, in at least 34 patients (15.0%) alloimmunization was demonstrated or suspected; in 11 patients the alloantibodies were 'enzyme only'. Besides, the 36 alloantibodies of known specificity (8 anti-D, 2 anti-D+C, 16 anti-E, 1 anti-C, 3 anti-e, 1 Anti-K, 1 anti-s, 1 anti-Le a , 1 anti-Go a ), three antibodies reactive only with Fy(a-b-) cells and two antibodies of yet unidentified specificity were detected. In six D-patients (3 had been pregnant) anti-D (together with anti-C in two patients) was found. In three out of four D+ patients with anti-D, an RHD variant gene was demonstrated (2 DAU-alleles and 1 DIII type 4 or DIVa-2). Logistic regression revealed that none of the risk factors analysed was associated with the presence of antibodies in the 34 patients. Immunobiology -Red Cell Alloimmunity 65

Fifty-eight patients, had experienced an adverse reaction during or shortly after transfusion (12 patients had dark urine). Adverse reactions were associated with the number of units received (OR 1.71 (95% CI, 1.25-2.33; P = 0.001), but not with the presence of antibodies (P > 0.7) Summary/Conclusions: In at least 15% of multi-transfused patients with SCD alloimmunization could be demonstrated, mainly (80%) directed against Rh antigens. The enzyme only reactivity, coupled with absence of antibodies in seven of 12 patients with probable haemolytic reaction and known evanescence of especially non Rh antibodies suggest possible low titre and disappearance of some clinically relevant antibodies. Given the high immunization rate together with the high frequency of adverse transfusion reactions, pre-transfusion screening for RBC antibodies should be considered for patients with SCD. Background: Rh blood group system and mainly antigen D is one of the most immunogenic, diverse and clinically important protein-based blood group. Antibody anti-D may induce hemolytic transfusion reactions and hemolytic disease of the fetus and newborn. Anti-D prophylaxes become ineffective if an anti-D immunization has occurred. Approximately 1% of the D+ population carries RHD alleles associated with reduced D antigen expression. Qualitative variants, in which some epitopes are lacking and can produce anti-D antibody, are usually termed partial D. By contrast, D weak is commonly defined as a quantitative variant that have all D epitopes and should not make anti-D. Del is a very weak form of D antigen and cannot be detected by routine serological tests. Because some of Del individuals have already developed an anti-D antibody whereas others did not this group contains both qualitative and quantitative changes. Aims: Investigation was prompted by finding discrepant results in typing of D antigen in a pregnant woman /3 rd pregnancy, 1 st delivery, 2 abortions in 1 st trimester/. Routine serological techniques detected D negativity and the presence of antibody allo-anti-D in clinically significant titre. The non-invasive testing of D status of the foetus from maternal peripheral blood was indicated, but this was not applicable due to presence of the RHD gene in the woman's DNA sample isolated from buccal swab. Our aim was to investigate the discrepancy and determine the underlying RHD genotype.

Methods: Blood samples, DNA from peripheral blood and buccal swab of the pregnant woman were investigated. Routine blood grouping and antibody testing were performed by column agglutination. Two anti-D sera (ID-DiaClon anti-D IgG (cell line ESD1) by BioRad and Anti-D duo IgM+IgG, clone: TH28 + MS26 by Immucor) were used for adsorption/elution test for identification of Del phenotype. Initial RHD genotyping was performed by RT-PCR (exons 5,7,10) with the DNA from buccal swab; further resolution was performed using PCR-SSP (FluoGene; Inno-train Diagnostik GmbH); Sequencing was performed by Sanger analysis (Inno-train Diagnostik GmbH).

Results: Genotype was identified as RHD positive by CE-certified PCR-SSP kits (FluoGene). Sanger sequencing of RHD from exon 1 to 9 revealed presence of a nucleotide deletion in position c.147delA, which is specific for allele RHD*01EL.04. This nucleotide change results in the amino acid change p.Val50Leufs*5 causing the Del phenotype. Presence of antigen D was proved by adsorption/elution technique. Titre of the anti-D was rising during the pregnancy to the 2000 level two weeks before the delivery. The newborn was delivered by S.C. without a sign of hemolytic disease. Blood grouping of the newborn revealed blood group A, D negative, DAT negative, testing for Del was not performed. Summary/Conclusions: The case reported here shows that females with RHD*01EL.04 allele are able develop strong anti-D immunization, so this type of Del phenotype belongs to the "Partial Del subgroup". Presence of variant RHD gene in mother disabling antenatal fetal genotyping from maternal blood by current methods requires a more attentive approach to care for such pregnancies. Supported by MH CZ-DRO UHKT 00023736 and RVO-VFN 64165.

5A-S29-05

EA Scharberg 1 , S Rothenberger 1 , A St€ urtzel 1 , N Gillhuber 1 , S Seyboth 1 , E Richter 1 , G Rink 2 and P Bugert 2 1 Institute for Transfusion Medicine and Immunohematology, DRK-BSD Ba-W€ u-He, Baden-Baden 2 Institute for Transfusion Medicine and Immunology, Heidelberg University, Medical Faculty Mannheim, Mannheim, Germany

Background: Rb a (DI6) is a low prevalence antigen of the Diego blood group system. It has been found in few families only. The clinical significance of anti-Rb a is unknown so far. The SLC4A1*c.1643C>T (p.Pro548Leu; ISBT allele name: DI*02.06) allele is the molecular basis of the Rb a antigen. In the gnomAD database this gene variant was found in only one of 125,742 sequenced genomes (allele frequency: 0.000004). Aims: To prove the frequency of the allele in our population and gain an Rb a positive donor we performed a molecular screening for DI6 in 1,700 blood donors. After our antibody screening test accidentally contained an Rb a positive test cell we found out that anti-Rb a is a very common antibody specificity. The frequency of the antibody in patients and blood donors was proved.

Methods: For the molecular screening of the blood donors we developed a PCR-SSP method. The antibody screening test in 3,652 patients and in 964 blood donors was performed in the gel technique (BioRad AHG ID-Cards) using a 3 cell screening panel (DRK-BSD SRC) including an Rb a positive test cell. Positive reactions with the Rb a positive cell were confirmed by an additional Rb a positive test cell of different source. Additional antibodies were excluded or identified in the same method using an antibody identification panel (DRK-BSD IRC).

Results: The molecular screening for the DI*02.06 allele in 1,700 blood donors revealed no single positive individual. Within the first 2 weeks of usage of our antibody screening test which accidentally contained the Rb a positive test cell 84 patients with anti-Rb a were found. It was 2.3% of 3,652 patients tested in 21 laboratories in different parts of Germany. Some laboratories stopped using the Rb a positive lot to avoid expensive and time consuming identification and conformation tests.

In 18 of 964 randomly tested blood donors (1.9%) anti-anti-Rb a was also present. Summary/Conclusions: Despite the very low frequency of the DI*02.06 allele, anti-Rb a is a very frequent unexpected antibody in patients and blood donors in Germany. It is obviously naturally occurring and is even more frequent than anti-Wr a and anti-Vw we found in previous studies in around 1% of patients and donors.

5A-S30-01

National Blood Center, Ministry of Health and Sports, Yangon, Myanmar

Hemovigilance which detects every event not only for patient' reactions and donor's complications but also incidents and near misses definitely improve quality of blood transfusion services especially for those situations where implementation of all the standards in one time is not possible.

Healthcare system in Myanmar is still in the stage of requiring priority for clinical professions and has limited resources for supportive roles. Supportive services including transfusion service are still not a center of interest from prioritization of health care system. Blood Transfusion service has been practiced in Myanmar since 1935. Real essence of transfusion service is hidden behind laboratory practice and transfusion is regarded as part of laboratory investigation. Hospital laboratories take care of testing of blood donated by replacement donors. This kind of transfusion services under laboratory umbrella is still being practiced in Myanmar except National Blood center (NBC) which was established in 2003 in accordance with Blood and Blood Product law. This Law was formulated cohesively with WHO strategies of blood safety. In 2002, WHO global data-based study sent questionnaires for assessment of safety status of transfusion service. NBC noticed that there was no data which can support corrective actions for safety. From that time onward, active retrospective review of existing data and introduction of records, prospective finding of process errors and any events from hospital blood banks were recorded and taking into actions at local level. Cost of every unit of blood is supported by Government. In 2017, National blood and Blood Product committee was established. The steering committee is working hard to get cooperation from every service by aiming to prevent those undesirable events before establishment of national level policy, standards and guidelines for sustainable service quality.

In conclusion, by using essence of hemovigilance as a tool, quality of transfusion service can be improved step by step to fulfil the gap in spite of limited resources.

The system started in local, extends to regional level by getting agreement of importance from hemovigilance results and is finally approaching to National level endorsement. Background: Erroneous transfusion of ABO-incompatible(ABOi) blood almost always reflects a preventable breakdown in transfusion protocols and standard operating procedures and can have disastrous consequences, with significant morbidity and mortality. These incidents need to be investigated in a systematic manner to identify system vulnerabilities to mitigate risks and improve patient safety. Since 2016, reporters to SHOT have been asked to score(0-10) the extent to which the cause of incidents can be attributed to key factors: staff, environmental, organisational and government/regulatory which helps recognise the key factors identified whilst investigating these incidents. Aims: To understand why unintentional transfusion of ABOi blood components continue to happen despite standard procedures and national guidance available.

Methods: Retrospective analysis of unintentional transfusion of ABOi blood components reported to SHOT between 2010-2017(inclusive) was done to identify common themes and recognise areas of improvement. Information provided using the SHOT human factors investigation tool (HFIT) between 2016-2017 was reviewed to understand more about why the errors occurred.

Results: Sixty-seven unintentional ABOi transfusions were reported between 2010-2017; majority (56/67, 83.6%) were red cell transfusions but ABOi plasma (9/67) and platelet transfusions (2/67) were also seen. Most errors occurred in the clinical area (45/67, 67%), and could have been detected at point of administration. In 21(31%) cases, the error could not have be detected at the point of administration with a primary laboratory error in 10/21(48%) incidents. Reviewing data from HFIT for cases in 2016-2017 (13 ABOi cases), the total score for staff culpability was 100, compared to a total score of 99 for all the other three organisational and system factors. This disparity is most obvious for the 4 ABOi red cell cases, all of which scored the maximum 10 for staff culpability, i.e. 40/40 compared to 8/120 as the combined total score given to the other factors. In the preceding years (2010 to 2015), there were no HF scores available; however, the emphasis on staff-related culpability is demonstrated by 37 cases that included an outcome of the local case review and 14 (37.8%) mentioned staff-related retraining or disciplinary procedures. The risk of haemolysis and serious harm is more likely with ABOi red cells than with other components with 2/56(4%) that resulted in death, 14/ 56(25%) major morbidity and 40/56(71%) no or minor adverse reaction. Of these cases, one resulted in conviction for manslaughter and at least two staff dismissals. Summary/Conclusions: Transfusion never events continue to occur, and it is evident that investigations into such incidents focus mainly on staff failings and do not consistently identify system wide changes that need to be incorporated to address prevalent issues. National recommendations and a safety alert to 'use a bedside checklist' immediately prior to administration were issued between 2015-2018 to support prevention of such errors but never events continue to persist. Current approach is ineffective because it often leads to apportioning blame, rather than understanding the often-complicated and multidimensional factors contributing to the error. This must be replaced by a holistic approach which addresses local work pressures and embraces advances in automated technology like electronic prescribing and barcode scanning. Of the confirmed TRARs, n = 27 were possibly related to treatment, n = 2 TRARs were probable, and n = 2 were definitely related to treatment; n = 37 TRARs were Grade 1, n = 4 were Grade 2, and none were Grade 4. In recipients of conventional WB, there were n = 13 (1.12%) ARs, n = 32 (2.75%) FNHTRs, n = 1 (0.09%) TACO, n = 0 TRALI, and n = 16 (1.38%) unclassified transfusion reactions. Of the confirmed TRARs, n = 55 were possibly related to treatment, n = 1 TRAR was probable, and n = 8 were definitely related to treatment; n = 54 TRARs were Grade 1, n = 1 was Grade 2 and n = 1 was Grade 4. There were 21 Mirasoltreated WB transfusions in pregnant women and 2 TRARs (9.5%), both Grade 1 and probably related. There were 80 transfusions of Mirasol-treated WB and 84 transfusions of conventional WB in patients < 18 years old resulting in n = 7 (8.33%) TRARs in recipients of Mirasol-treated WB and n = 10 (11.90%) in recipients of conventional WB. Summary/Conclusions: Timely data reporting of TRARs and expanding the HV infrastructure has helped to improve the HV system in Ghana. Of 2181 WB transfusions in routine use in Ghana, there were 4.02% TRARs in recipients of Mirasol-treated WB and 5.59% in recipients of conventional WB. Additionally, Mirasol-treated WB was safely transfused in pregnant women and pediatric patients.

Haematology, Monash Health, Melbourne, Australia

Background: Transfusion-associated graft-versus-host disease (TA-GvHD) is rare and usually fatal. It can be prevented by provision of irradiated blood products to at-risk individuals, such as those receiving nucleoside analogues, alemtuzumab, bendamustine or with Hodgkin lymphoma (HL). Duration of risk is uncertain, so ensuring these individuals correctly receive lifelong irradiated blood components, as currently recommended by ANZSBT and BSH guidelines, is challenging. In Australia, platelets are routinely irradiated, but red blood cells (RBC) are not. Aims: To determine whether patients receiving fludarabine, cladribine, bendamustine, alemtuzumab, or dacarbazine (for HL), appropriately received irradiated RBCs. Secondary outcomes included rates of TA-GvHD after unintended exposure to non-irradiated components, factors influencing correct issue of irradiated RBCs such as transfusion management plans, and provision of adequate clinical information on blood requests. Methods: We performed a retrospective audit to identify patients receiving therapies indicating risk for TA-GvHD using pharmacy dispensing records from January 2008 to October 2018 at Monash Health, a multi-campus university hospital in Melbourne, Australia. Diagnosis, treatment dates, group and hold (G&H) requests, RBC transfusions, and follow-up information were sourced from laboratory and medical records. Results: We identified 310 patients who received fludarabine (n = 52, 17%), bendamustine (n = 29, 9%), cladribine (n = 17, 5%), dacarbazine for HL (n = 164, 53%) and alemtuzumab (n = 48, 15%). The median age of patients was 46 years (range 8-92) and 171 (55%) were male. Median follow-up was 30 months (range 0-132). Post-exposure, 42 patients (14%) received transfusions with 33% correctly receiving irradiated RBCs. The remaining 28, all from haematology/oncology, received a total of 192 unirradiated RBCs. In 8 patients, this was rectified on subsequent transfusions. There were no cases of TA-GvHD at median follow-up of 14.5 months (range 0-75) from first RBC transfusion. After medication administration, 99 patients had G&H requests after a median of 3 months (range 0-129). Only 23% of requests had sufficient clinical information to prompt irradiation, such as HL or medication details, and only 20% asked for irradiated components. Preventive strategies have now been employed. Transfusion management plans for haematology patients were implemented in March 2017. For audited patients, these were written from 38 days prior to 104 days after medication exposure. Two were written following inadvertent unirradiated RBC transfusion. Patients identified in this audit will have a laboratory flag generated and prospectively, pharmacy dispensing records will be sent to blood bank to identify at-risk patients. Our hospital is transitioning to electronic medical records (EMR). An alert will be generated in EMR when ordering transfusions if there has been exposure to these medications. However, clinical awareness and documentation remain vital. Additional measures include patient education, alert cards, and ongoing collaboration with medical staff to encourage transfusion planning. Summary/Conclusions: Recognition of patients at risk for TA-GvHD remains low, even among haematology units. We are making progress on ensuring provision of lifelong irradiated blood components in patients exposed to nucleoside analogues or alemtuzumab, as well as HL patients. Implementation of an EMR and additional strategies in this domain is important to prevent TA-GvHD. Background: Blood transfusion is considered an essential element in the management of patients globally. It might be risky and transfusion related adverse reactions may occur with the less adherence of transfusion policies. Standard guidelines regarding the screening of blood for infectious disease, genuine need of transfusion and ABO compatibility are followed and monitored drastically. However, patient assessment during transfusion especially at patient bedside and post transfusion is also equally important. Aims: We are a newly established hospital and are working towards the best possible management of patients. In this regard to minimize the transfusion errors and to highlight if any lacking being practiced during transfusion, we conducted this study to observe the compliance rate of documentation of transfusion form by the healthcare staff and also to observe the compliance of line of action taken in case of occurrence of transfusion reactions.

Methods: This was a observational study conducted at NIBD and BMT, PECHS campus from February 2018 to February 2019. Ethical approval was obtained prior to the study. Transfusion form for each transfusion was filled. The form provided information on documentation of blood product receiver name, employee identity number, date and time of receiving blood product, patient name, medical record number on units, on patient's wrist band and on transfusion form. ABO compatibility on the unit and on form, medical record number from wrist band, name and employee identity number of two healthcare staff started transfusion, transfusion start and completion time. Time, temperature, blood pressure, pulse and initials of staff at the time of order, onset, after 15 minutes and at the completion of transfusion were also included. Transfusion reaction form was also filled by the healthcare staff. Data was analyzed by using SPSS version 23.0.

Results: A total of 500 transfusions forms were analyzed. Over all compliance rate was 18%. Out of 500, 115(23%) forms were available in source notes and of 115, 88 (76%) were partially and completely filled. Higher compliance was seen in the initial months of hospital establishment than later months (P-value = 0.000). Highest non compliance was seen in documentation of initials of duty doctors on transfusion form at the completion of transfusion(3%) and highest compliance was seen in documentation of name by healthcare nursing staff at the start of transfusion(89%). A total of 02(0.4%) adverse events were reported from red blood cells and platelets. Mean time of start of symptoms was 2 hours and 30 minutes for red blood cells and for platelets it was 1 hour and 13 minutes. Transfusion was instantly stopped as the symptoms appeared with no delay of time and actions were taken to resolve the reactions. Time of appearance of symptoms and time of start of medication were documented and error free. All blood bags were returned to the blood bank and discarded after 6 hours as per the policy of hospital. Summary/Conclusions: The study was conducted to highlight the scarce practices that are being implemented by healthcare staff in context of documentation and reporting of transfusion reactions at our hospital. Stringent actions should be taken for the adherence of compliance by healthcare staff to avoid morbidities and mortalities. We believe that it will also be helpful to provide baseline information in the process of preparation of a national guidelines and protocol on blood transfusion procedures.

5A-S31-01

AS Buser, A Holbro and L Infanti

Regional Blood Transfusion Service, Swiss Red Cross, Basel, Basel, Switzerland

To make blood supply safer, pathogen inactivation (PI) technologies have been developed. They are based on photochemical (amotosalen/UVA or riboflavin/ UV) or UV-C light treatment to reduce potential pathogens in blood components. This gain of safety might however be offset by "off target" effects of these technologies. In virtually all clinical platelet transfusion trials, it has been demonstrated that post transfusion increments with PI platelet (PLT) components are lower as compared to conventional components, indicating different biological behaviour such as survival/ clearance of nontreated and treated PLT. Published studies have also suggested shorter survival of platelets in vivo in animal studies. Additionally, data of the rates of alloimmunization and refractoriness after transfusion of PI platelets are show discrepant results. Animal studies suggest a reduction of the rates of alloimmunization when transfusing (leukoreduced) PI PLT as compare to conventional PLT. In the clinical setting, published data, including very recent reports, showed different rates of HLA class I and II alloimmunization with the two currently available photochemical based PI technologies. While PI of PLT components surely benefit patients regarding pathogen safety, the impact of potential off target effects possibly impairing efficacy of PI PLT transfusions need more investigation. Background: Brucellosis is an endemic disease and still a major health problem in Saudi Arabia. Ministry of Health in Saudi Arabia listed Brucellosis as a notifiable disease due to its endemicity. In the last ten years, the incidence has decreased significantly to approximately 15 cases per 100,000 but is still higher than that in developed countries. Human-to human transmission is extremely rare including breast feeding, transplacental, sexually and blood transfusion. Five cases of Brucellosis through blood transfusion have been reported in the literature. Brucella transmission through blood transfusion is likely underreporting due to the long incubation time of 2-4 weeks (range, 5 days to 5 months),vagueness of clinical presentation and lack of hemovigilance systems in endemic areas. (alloHSCT) and 130 (4.6%) autologous (autoHSCT) HSCT patients, with mean corrected count increments (CCI) of 8.7 9 10 3 , 8.0 9 10 3 and 7.2 9 10 3 , respectively. Mean CCI decreased in a linear fashion between Day ≤ 2 and Day 7 PCs (9.0 9 10 3 , 9.1 9 10 3 and 8.5 9 10 3 at ≤ 2 days; 6.7 9 10 3 , 5.8 9 10 3 and 4.9 9 10 3 at 7 days, respectively), although the number of PC transfused on Day 7 to autoHSCT patients was small (n = 71). Background: Nipah virus (NiV) is a paramyxovirus (genus Henipavirus) that emerged in the late 1990s in Malaysia and has since been identified as the cause of sporadic outbreaks of severe febrile disease in Bangladesh and India. NiV infection is frequently associated with severe respiratory or neurological disease in infected humans with transmission to humans through inhalation, contact or consumption of NiV contaminated foods. Nipah virus (NiV) belongs to the list of pathogens identified by the WHO to have the potential for a global pandemic.

Aims: This study aimed to investigate the efficacy of the THERAFLEX UV-Platelets system to inactivate NiV in platelet concentrates (PCs). The THERAFLEX UV-Platelets system (Macopharma) uses UVC light without the need of any additional photoactive compound.

Methods: Plasma reduced PCs from 4 BCs (35% plasma in additive solution SSP+) were spiked with virus suspension (10% v/v). PCs (n = 2, 375 mL) were then UVCirradiated on the Macotronic UV machine (Macopharma) and samples were taken after spiking (load and hold sample) and after illumination with different light doses (0.05, 0.1, 0.15 and 0.2 (standard) J/cm 2 )). The titre of the NiV (Malaysia) was determined as tissue culture infective dose (TCID 50 ) by endpoint titration in microtitre plate assays on Vero 76 cells (ATCC â CRL-1587 TM ).

The results of the infectivity assay demonstrated that UVC irradiation dosedependently inactivated NiV. After spiking a NiV titer of 6.2 (bag no. 1) and 6.5 (bag no. 2) log 10 TCID 50 /mL was received in the PCs. At a UVC dose of 0.10 J/cm 2 and higher NiV was inactivated down to the detection limit of the system (1.9 log 10 TCID 50 / mL), resulting in log 10 reduction factors of ≥4.3 (bag no. 1) and ≥4.6 (bag no. 2). Summary/Conclusions: Our results demonstrate that the THERAFLEX UV-Platelets procedure is an effective technology to inactivate NiV in contaminated PCs. vs. 364 AE 20.6 9 10e11 platelets/unit, P < 0.001), whereas the platelet content of apheresis PC did not change (305 AE 9.9 vs. 300, AE16.1, P = 0.57). Summary/Conclusions: Pathogen reduction resulted in the transfusion of older PC on average, but without altering the number of PC ordered or the use of PC per patient. Pathogen reduction has improved PC stock management without an increase in platelet demand, despite lower platelet content of buffy coat PC after PR implementation.

Donors and Donation -Donor Adherence -are we doing the Right Thing?

The transfusion procedure is the last step in a multi-process supply chain. The task of matching supply with demand requires donor managers to consider average consumption rates on a weekly or monthly basis, but to also have insight into variability in order distribution and possible attribute (blood groups) requirements. Since hospitals and blood banks are usually not deeply interwoven and often only ex-post data is available, forecasting methods should be implemented. A thorough analysis of order pattern to set weekly target inventories and safety levels is required to close the information gap. A collection plan needs to identify possible bottlenecks which can be prevented through the planning of inter-shipping, changes in message urgency and building of reserve donor pools. Constant analysis of collection and mobilization KPIs allows donor managers to implement the rolling-wave planning approach and continually adapt to changing requirements, unexpected events and overall systematic variability. The variability happens on the demand side, as order quantities and their attributes, such as blood group distribution, are subject to change. However, also the supply is subject to significant variation, as donor response rates, attrition, deferrals and overall availability of donors are not constant. The data was collected with the face-to-face interview method right after the donation. 1478 first-time donors has attended to the study in 18 Regional Blood Centres in 29 cities in Turkey. The survey included items in accordance with the standard TPB predictors of attitude, self-efficacy, and intention. Self-identity, anticipated regret, donation anxiety, paraphernalia anxiety, personal moral norm, descriptive norm, satisfaction, motivation also assessed for the first-time donors. The relation between the predictors and intention confirmed with correlation analyses. The predictors' distribution analysed by multiple linear regression. A number of goodness-of-fit indices were calculated and examined for each tested models (IBM, AMOS SPSS). The results of goodnessof-fit tests for proposed model provided a better fit to the data than these models (Cmin/Df = 14). Moreover, this result indicated that the fit between the proposed model and the data could be improved with further modifications with the inclusion of paths between motivation and attitude, self-identity and intention. Moreover, inclusion the paths between donation anxiety and intention and between self-efficacy and attitude, on contrary to recent analyses suggesting opposite paths. Evaluation of goodness-of-fit tests showed good result for revised model with a value of Cmin/Df = 3.55, close to perfect fit. The revised model revealed that attitude was the strongest positive direct predictor of intention followed by personal moral norm, self-identity, motivation and anticipated regret (path coefficients: 0.47, 0.28. 0.19, 0.17, and 0.5, respectively). Donation anxiety was the negative direct predictor of intention (-0.05). Satisfaction was the strongest positive indirect predictor of intention via attitude and followed by self-efficacy (0.90 and 0.08). Paraphernalia anxiety was the negative indirect predictor of intention (-0.03). Descriptive norm did not show any significance. Our model accounted for 75.3% of the variance in intention. Summary/Conclusions: These findings suggest several potential avenues for enhancing donor retention. The results obtained with this study provide important data from the standpoint of donor retention, which should be, implemented in the future strategies of Turkish Red Crescent. 

Background: TRANSPOSE-TRANSfusion and transplantation: PrOtection and SElection of donors, is a European consortium project, including partners from 16 countries, reviewing donor selection and protection policies for substances of human origin (SoHO).One of the main issues in the current donor selection system, which TRANSPOSE aims to tackle, is that for many, if not most criteria, is not evidence based. The TRANSPOSE consortium therefore tries to re-assess selection criteria, revised them where needed and provide recommendations as evidence-based as possible. TRANSPOSE additionally adds to the current European Directorate for the Quality of Medicines & HealthCare (EDQM) Guidelines by emphasizing donor safety.

Aims: The aim is to compare existing donor eligibility criteria throughout Europe, and to compile a list of risks to consider, with evidence-or consensus-based deferral criteria to provide more uniform donor screening criteria.

Methods: There are three horizontal work-packages (WPs); WP1 Coordination, WP2 Dissemination, and WP3 Evaluation of the project, and four technical ones with specific deliverables and milestones to be regularly produced: -WP4 Inventory of Donor Selection & Protection Practices; -WP5 Development of risk-based Guidelines for donor selection and protection; -WP6 Development of a Standard Donor Health Questionnaire (DHQ); -WP7 Training Course/Workshop on the Use of the Guiding Principles, Guidelines and the DHQ. The TRANSPOSE project launched in September 2017 and will complete in Spring 2020. WP4 has completed its work in October, WP5 will complete its work in June 2019, and WP6 and WP7 have recently commenced. Results: With the use of the deliverables created by WP4, we have created an indepth inventory of current practices in donor selection and protection, including overview of similarities and differences across European countries and across SoHO types. There is an agreement amongst experts that existing guidelines are often based on the precautionary principle rather than on risk assessment. Consequently, in the development of WP5's Guidelines for donor selection and protection, we now make an effort to also emphasize donor safety, in a more evidence-based way via the use of risk-based assessments. This will result in a standardized DHQ with a common trunk and more in -depth questions per SoHO. Summary/Conclusions: The impact of the outcomes of TRANSPOSE will be threefold. First, outcomes are expected to be of help in revising donor selection and protection related EU Directives. Second, the set of guiding principles and Donor Selection & Protection Guidelines will facilitate EU member states to take a next step in implementing donor selection and protection policies in a consistent and clear-cut way to the benefit of both donors and recipients of SoHO. Third, a standard Donor Health Questionnaire with carefully guided local/regional/national adjustments will become available per SoHO which can be used widely and will consequently enable comparisons of the prevalence of certain risks and risky behaviours throughout Europe. Background: TRANSPOSE-TRANSfusion and transplantation PrOtection and SElection of donors is a European consortium project, including partners from 16 countries, that reviews donor selection and protection policies for blood, plasma, tissues, assisted reproductive technology (ART) and stem cells (together SoHO). Donor selection criteria (DSC) in Europe are based on EU-directives, guidelines and countries' own additional criteria. Literature shows that particular criteria are outdated or not risk-based, often leading to unnecessary donor deferral or an underestimation of risks for donors. Aims: To 1) provide a comprehensive inventory of current systems for selection and protection of donors and donations, 2) critically review them and 3) recommend an over-arching Donor Health Questionnaire (DHQ) including all necessary criteria currently used by different EU-Member states (EU-MS). Methods: In-depth semi-structured interviews with key stakeholders in blood collection were conducted to identify main topics for improvement in the current DSC. These formed the basis for a survey sent to professionals from collection institutions of all SoHO to get feedback on current systems from as many EU-MS organisations as possible. Questionnaires were sent to a total of 163 experts (40 blood; 40 plasma; 27 tissues; 47 stem cells; 9 ART) and 39 (24%) completed questionnaires were received. Where information was lacking, additional experts were asked to recommend upon DSC. Results: For blood and plasma donation four main areas of concern in DSC were identified: risk-based selection, adaptability, flexibility and consistency. The stakeholders agreed that DSC are often outdated and lack evidence, hence leading to unnecessary deferral of donors and underestimated risks for donors. They suggested to base DSC on group risk-assessment (risk-based selection) and on conducting more research to achieve standardized risk perceptions and evidence-based deferrals, either for safety of recipient or donors. Criteria could be made more detailed to fit specific groups to defer less donors (adaptability). Furthermore, implementing criteria was considered easy, but abolish criteria when not regarded as a risk anymore seems almost impossible (flexibility). Additionally, deferral periods are perceived too long, seen as both negative, i.e. jeopardizing donor return intention and positive, i.e. no risk for safety (consistency). Changing legislation into guidance was an often-mentioned suggestion to improve DSC. Specific feedback on plasma donations revealed that many whole blood topics are not applicable to plasma-only donors, e.g. parasite infections such as malaria (no deferral needed); travel history (no deferral needed), and recent bacterial and viral infections (deferral periods currently too long). A clear need for more research on plasma collection-related issues was identified. Summary/Conclusions: DSC are perceived redundant on a substantial number of aspects by most stakeholders. Besides achieving the goal of save and sufficient SoHO for patients, many regulations could be improved to diminish deferrals and decrease donor risks. TRANSPOSE will add to reviewing, improving and harmonising these regulations and criteria. Furthermore, TRANSPOSE will provide suggestions to improve directives and guidelines and a DHQ, focusing on both donor health protection and safety of donations, but also removing deferral criteria that are not relevant (anymore), and offer a future research agenda to make DSC more evidence-based. Background: TRANSPOSE -TRANSfusion and transplantation: PrOtection and SElection of donors, is a European Commission co-funded project with participation of 24 stakeholders from both not-for-profit and private blood collecting organizations as well as researchers and officials. The project aims to create new evidencebased donor selection criteria as well as guiding principles for risk assessment of threats to the safety of all substances of human origin (SoHO) except solid organs. As part of this, an inventory of current donation-related risks was performed, including an investigation of both type and number of adverse events reported. Aims: We here aim to present an overview of reported adverse events in plasma and whole blood donation in Europe and to compare this to the anticipated risks rated by TRANSPOSE stakeholders. Methods: National or local data on adverse reactions from the years 2014-2017, both serious and mild, in whole blood and plasma donors was collected from the relevant stakeholders (eighteen and nineteen respectively). Stakeholders were also asked to grade the most important anticipated donor risks according to severity, level of evidence and prevalence. We then compared the relevant risk categories as evaluated by the stakeholders with the categories of the provided data, as well as the heterogeneity of category numbers. Results: Thirteen stakeholders provided data on adverse events during whole blood donation in a given year, including in total thirty-three different categories of adverse events, ranging from only one unspecified reaction to seventeen different categories, with an average of nine categories per stakeholder. The most frequently used categories were hematoma (included by 77%), arterial puncture (77%) and nerve damage (54%). Vasovagal reactions were also frequently included (75%); however, this was being done variably as vasovagal reactions unspecified, and acute and/or delayed vasovagal reactions. Only one stakeholder reported iron deficiency. For plasma donation, seven stakeholders provided data on adverse events. A total of twenty-seven different categories were reported, ranging from one to seventeen per stakeholder, with an average of nine. The most frequently reported adverse events were hematoma (86%), citrate reactions (86%) and arm pains and nerve damage (both 57%, respectively). Anticipated risks in blood donation were rated by nine stakeholders rating iron deficiency, vasovagal reactions and hematomas the greatest risks to donors. For plasmapheresis, six stakeholders rated vasovagal reactions, hematomas and citrate reactions as highest risk. Summary/Conclusions: As shown, categories used to describe adverse events in blood donation vary tremendously across Europe, with some countries only being able to provide total numbers of adverse events without further specification. Furthermore, there is a gap between perceived high donor risks and reported adverse reaction categories in donor vigilance for whole blood, as reports on iron deficiency are virtually absent despite being considered the most significant risk. Our findings show the need for international collaboration on creating an international standardized donor vigilance system, to gather more insight into donor risks to protect the health of donors.

Plenary Session -A Glimpse of the Future PL-03-01

Modern transplantation medicine has made significant progress within the last decades due to a better immunological understanding of rejection and advances in immunosuppression. However, the severe side effects of long-term, typically lifelong, immunosuppression and the shortage of donor organs remain the major restrictions in transplantation. The idea behind all research to improve transplant outcome has always been the modification of the recipient's immune system to ideally induce a specific tolerance towards the donor's graft. In fact, the immunological blindness of the recipient towards the donor's graft is achieved by a general reduction of the immune system's competence and represents a major burden for transplant patients. The idea of invisible organs is an entirely different approach to solve the problem: instead of inducing an immunological blindness of the recipient's immune system an immunological invisibility of the donor's organ is created. This is achieved by genetically engineering the transplant to eliminate the organ's immunogenicity defined by the gene products of the major histocompatibility complex (MHC) and minor histocompatibility antigens. In addition to manipulating the expression of MHC genes required for immune recognition, immune cloaking strategies are used to evade immune rejection. These approaches take advantage of creating an immunosuppressive environment and expressing immune suppressive molecules by immunomodulatory transgenes. MHC engineering and immune cloaking in an entire organ is achieved during ex vivo perfusion by lentiviral transduction of gene expression modifiers and transgenes to induce a permanent immunological invisibility of the organ. Importantly, MHC engineering also prevents the presentation of minor histocompatibility antigens, which usually are not possible to match between donor and recipient, but which trigger potent immune responses and graft rejection. Eliminating the targets of cellular and humoral rejection as well as creating an allograft-specific immune environment through immune cloaking camouflages the organ and equips it with a powerful set of defense weaponry. Immune-engineering of transplants achieved during the inevitable ex vivo period of the allograft after explantation without the need to accept off-target effects allows keeping the recipient's immune system fully functional and capable to combat infections and cancer. In pre-clinical in vivo studies from rodents to minipigs a clear survival advantage of ex vivo engineered transplants could be demonstrated. This approach has the potential of eliminating the burden of organ rejection and immunosuppression, thereby sustainably increasing transplant survival, organ availability and quality of life.

Gene editing for sickle cell disease: Re-expression of the fetal c-globin genes (HBG1/2) could be a universal strategy to ameliorate the severe b-globin disorders sickle cell disease (SCD) and b-thalassemia by induction of fetal hemoglobin (HbF, a 2 c 2 ). We have previously identified BCL11A erythroid enhancer sequences, marked by HbF-associated common genetic variants, that are required for repression of HbF in adult-stage erythroid cells but dispensable in non-erythroid cells. Recently we have optimized conditions for selection-free on-target CRISPR-Cas9 editing in human HSCs as a nearly complete reaction without detectable genotoxicity or deleterious impact on stem cell function. We demonstrate that Cas9:sgRNA ribonucleoprotein (RNP) mediated cleavage at core sequences of the + 58 BCL11A erythroid enhancer results in highly penetrant disruption of GATA1 binding motif, reduction of BCL11A expression, and induction of fetal c-globin. Erythroid progeny of edited engrafting SCD HSCs express therapeutic levels of HbF and resist sickling, while those from b-thalassemia patients show restored globin chain balance. Moreover we find that HSCs preferentially undergo nonhomologous as compared to microhomology mediated end-joining repair. NHEJ-based BCL11A enhancer editing approaching complete allelic disruption in HSCs appears to be a feasible therapeutic strategy to produce durable HbF induction. In this presentation, I will compare and contrast BCL11A enhancer editing to other autologous curative gene therapy and gene editing approaches at various stages of clinical and pre-clinical evaluation.

Oxygen is vital for life. Without oxygen death is assured for aerobic organisms. Although everybody knows this fact a lot of medical acts forget to take care of it, leading to a lot of potential troubles. Indeed, during cell respiration the glucose oxidation by oxygen gives carbon dioxide, water and energy. This energy also called ATP is necessary for cellular metabolism and consequently for life. We have identified an extracellular hemoglobin coming from a marine worm, called Arenicola marina, which is able to deliver oxygen to this animal living in the intertidal areas on the Atlantic coast in France between the North Sea and Biarritz. This molecule called M101 was developed in the medical device named HEMO 2 life â . We have showed that this product was very efficient to protect organs before transplantation. A multi centers clinical trial performed under the supervision of Pr. Le Meur from the CHU of Brest, on 60 patients waiting kidney grafts showed a delay graft function reduced roughly by three between the two kidneys harvested on the same donor with and without HEMO 2 life â and grafted on recipients. In 2018, a world first was realized in France by the Pr. Lantieri to Georges Pompidou hospital in Paris, France. Indeed, it was the first time that a patient received a second graft face. This surgery was realized with HEMO 2 life â and showed a very nice result according the Pr Lantieri, the anastomosis were very easy and no edema was observed. Furthermore, we have developed dressing incorporating M101 making a product called HEMHealing â . Preclinical data on diabetic mice showed an increase of healing process. HEMOXYCarrier â , a therapeutical oxygen carrier, is also in progress of development in order to address ischemic diseases such as the sickle cells disease, myocardiac infraction and stroke. This universal oxygen carrier without blood typing, which is the ancestor of our Red Blood Cell containing hemoglobin showed that it is able to deliver oxygen at different biological levels, cellular, tissues and organs and could address a multitude of medical applications. Background: Main goal of transfusion is saving life and/or improve the health status of human by "safe blood" which needs regular, voluntary, unpaid blood donors. Donor recruitment is being more sensitive and challenging part of the blood supply system in actual global socio-economic conditions. Achievement to enough voluntary non-remunerated blood donation (VNRBD) can be established by an efficient donor recruitment. Efficiency of the donor recruitment has still close relation with blood donor recruiter although there are so many new tools. Occupational specifications, rights and responsibilities of blood donor recruiter have wide range differences between countries which cannot be explained completely by the specific conditions of each country. Also, a concrete document which has an international consensus was not existing on this subject. Turkish Blood Foundation (TBF) has been organizing an international workshop since 2012; Anatolian Blood Days (ABD). "Who is a blood donor recruiter?" was the topic of ABD-VII at 9-11 March 2018. Aims: Main aim of the workshop was to check and evaluate the existing systems of the participant countries. Than create a model for clearly defining occupational specifications, responsibilities and rights of blood donor recruiter. Methods: Experts from 25 countries participated in the workshop. Those countries are Albania, Algeria, Bosnia-Herzegovina, Estonia, France, Germany, Hungary, India, Kazakhstan, Lithuania, Macedonia, Montenegro, Oman, Portugal, Qatar, Romania, Russia, Saudi Arabia, Serbia, Slovenia, Sri Lanka, Tajikistan, Turkey, Uganda, Uzbekistan. These countries reflect almost all religious, ethnical, social, cultural and economic situations of the world. A questionnaire which was analyzing existing systems at participant countries sent before the workshop. After country presentations 4 different discussion groups were organized. Below listed topics were announced at final declaration. Results: Donor recruiter:

1. should have University degree preferably in Marketing and Business Administration field. 2. should have a certificate and/or professional experience in Public Relation 3. should have efficient skill in conversation, sociability, independence, self-confidence, reliability, resilience and conscientiousness as well as to work in a team 4. should get a special training which includes not only social topics such as public relation, marketing, etc. and medical topics related BB&TM before practicing alone as a donor recruiter 5. should be a permanent staff 6. should have basic salary and performance bonus might be given 7. is eligible to monitor and modify mobile team working period at blood drive 8. should participate the mobile blood drive which he/she has organized 9. should participate the group who will create promotional materials for national blood service 10. number at each blood establishment should be defined based on annual blood collection such as 5 staffs for 50,000 whole blood collection annually in Germany. Summary/Conclusions: In conclusion; both donor recruitment and retention are not easy tasks to undergo while public are aging, and birth rates are decreasing all around the world. Dedicated blood donor recruiter whose occupational specifications, rights and responsibilities are clearly defined will be the corner stone of the success for providing enough safe blood for transfusion.

CT Smit Sibinga 1 and J Emmanuel 2

Background: Africa is a large continent with 55 independent States and a total population of 1,275,710,034 (February 2018) . Healthcare policies and strategies are developed through WHO's advocacy, guidance, and support from HQ in Geneva and the 2 WHO Regional Offices; Eastern Mediterranean Regional Office (EMRO) supporting 8 Arabic speaking countries and the African Regional Office (AFRO) responsible for 47 Sub-Saharan Countries. Population distribution is approximately 40.6% urban. There are a large number of different local dialects and languages spoken. The main languages spoken are English, French, Portuguese, Spanish and Arabic. Countries are mainly classified by UNDP as being of low and medium Human Development Index The Africa Society for Blood Transfusion (AfSBT) has Members in most countries, advocates for the development of sustainable and effective blood services, and has developed a stepwise 3 level accreditation program. In 2016 EMRO held a consensus meeting developing a "Strategic Framework for Blood Safety and Availability for 2016-2025" with a set of priority interventions focusing on Leadership and Governance, Cooperation and Collaboration, Provision of Safe Blood and Blood Products, Appropriate Clinical Use of Blood, and Quality System Management. In 2001 all 54 Member States of the African Union (AU) countries, in Abuja, Nigeria, pledged that national budget for Health should be at least 15% of the National Fiscal Budget.

In 2013 Ministers of Health of WHO Member States endorsed that blood and blood products be included in the Essential Medicines List; these endorsements and WHO's Universal Health Coverage (UHC), have yet to be fully implemented. Aims: To analyze (gap-analysis) to what extend countries in Africa implement the World Health Assembly Resolution WHA63.12 on Availability, Safety and Quality of Blood Products, which urges governments to ensure safe, accessible, affordable and available supplies of blood and components from voluntary non-remunerated blood donors, which meet clinical transfusion requirements and achieve national self-sufficiency, following WHO guidelines and recommendations. Methods: To provide an overview of the current status of the blood supply in Africa strengths and weaknesses, data from WHO's 2016 Global Status Report on Blood Safety and Availability were analyzed and used. The study has been descriptive and explorative. Results: The 2016 Report identified a number of areas requiring attention; principle amongst these were -inadequate funding; -lack of governance and leadership; -ineffective public education on blood donation; -absence of capacity building for clinicians on rational use of blood; -lack of Haemovigilance and implementation of quality management systems; -the need for regulatory or oversight mechanisms. Summary/Conclusions: National Authorities should address areas requiring attention if progress towards ensuring a sustainable safe and sufficient supply of blood products is to be achieved. Key is the commitment and support of National Governments, which should implement Resolutions and Recommendations agreed by Ministers of Health at WHA and African Union. Background: The core function of the Blood Donation Testing (BDT) Laboratory is to screen every unit of blood collected from a donor for blood group type and infectious disease markers to ensure safety of the national blood supply prior to transfusion. The lab operates daily on two work shifts, comprising of 4 staff on the morning (AM) shift (from 8:00 to 17:30) and 5 staff on the afternoon (PM) shift (from 13:00 to 22:00) on weekdays and 3 staff on the AM shift and 5 staff on the PM shift on weekends. BDT Lab has a staff strength of 15 to be rostered for the 2 work shifts. Each staff is on a five-day work week and has to work 11 PM shift and 9 AM shift per month on average. The higher number of PM shift leads to staff feedback that they do not get sufficient time in the evenings for family and social or leisure activities. A Lean Six Sigma project was initiated to review the work rostering to improve the work-life balance of the staff. Aims: The project aims to reduce the number of staff working on the PM shift without affecting the downstream processes and continues to meet the timely release of blood supply to the hospitals. Methods: Lean Six Sigma tools were used to study the BDT Lab workflow process and to identify factors that contributes to the higher number of PM shifts that the staff has to take on. Data on the turn-around time and the man-effort required for each screening tests performed was analyzed. A survey was also conducted to understand the preference of the staff on the acceptable number of PM shifts per month. Results: The main contributing factor for more staff required to perform the PM shift is due to majority of the daily donation samples being received only in the evening. As this factor is beyond the control of the BDT Lab, redeploying work from the PM shift to the AM shift was eventually selected as the solution to reduce the number of staff needed for the PM shift. The screening test that was shifted was determined based on the test system that has the shortest turn-around-time and is able to allow continuous release of results. At the same time, most of the staff must be trained for that test system. A trial on the new roster involving 5 staff on AM shift and 4 staff on PM shift was conducted. The total number of PM shift per month was reduced from 124 to 112 using the re-defined process. The 10% reduction translates to fewer number of PM shifts that the staff has to undertake and was able to meet the staff's expectation. Summary/Conclusions: With the adoption of the new process workflow, BDT Lab was able to reduce the number of PM shifts that the staff needs to be rostered using evidence based process improvement method. Most importantly, the lab has a satisfied team of staff with better work-life balance. Background: Preparedness of blood transfusion services for emergencies and crisis situations is an important issue concerned with patient and transfusion safety. Aims: Having an experience of delay in blood component supply in an emergency situation due to partial interruption of Hospital Information System (HIS), it is aimed to create a crisis kit and constitute an alternative work flow for emergency in crisis situations. Methods: It is stipulated that the failure of HIS which is normally conducts all process for transfusion would be disabled in a disaster or crisis situation. A brain storm was made on possible challenges associated with disability of HIS during transfusion emergencies. According to the scenarios a kit was developed for the process management of transfusion emergencies. Results: A flow chart was designed in proper with transfusion emergency definitions of WHO and instructions were written to explain the flow chart. All forms categorized with different colour codes are designed to fill with handwriting. The kit consists of flow chart and instructions, Analysis Request Forms (blue coloured), Blood Component Request Forms (pink coloured), Proceeding Forms (green coloured), pens and blood sample tubes with EDTA were put into a plastic folder labelled as Transfusion Emergency Disaster & Crisis (TEDC) Kit. Additionally, the kit is placed in a sealed clear plastic bag and delivered to all inpatient and intensive care units of pediatrics and pediatric surgery. A training programme concerned with transfusion emergency situations and usage of the TEDC kit was developed for health care workers involved in blood transfusion process. Pre and post-assessment tests were developed for the evaluation of effectiveness of the training programme. Summary/Conclusions: It's challenging to improve the response capacity of blood transfusion services during emergencies and crisis situations.

Abstract withdrawn. Background: India is a developing country having 2760 licensed blood banks Majority have manual documentation which causes inaccuracies and errors in blood bank activities. Monitoring is a herculean task. Computerisation is the need of the hour but this goal involves many hurdles and challenges Aims: The aim of this study is to discuss the challenges faced during computerisation of blood bank activities and the remedial solutions for it Methods: Department of Transfusion Medicine, King George medical University, Lucknow is one of the biggest blood bank of the country with annual collection of 70,000 blood units. Two years ago, the blood bank worked on totally manual system. Computerisation involved challenges associated with hardware and software installation and personnel training. Hardware was installed in two phases. Initially HP system but later shifted to Apple iMac due to frequent breakdowns. With HP server. Software installation (Easy software) involved erratic internet connectivity hence changed to LAN. Customisation involved radical changes according to our needs. At times we had to change our way of working to suit the software. Biometrics linking, medical registration, cash id generation, donation, serological crossmatch, automated blood grouping, labelling, chemiluminescence & NAT testing, blood component preparation and camps were all included with challenges at every level. Remedial actions were taken from small to big. Training of the staff was the most essential part of the implementation of computerisation who initially showed considerable resistance and at time faking ignorance due to apprehension that their mistakes will be highlighted and they will be penalised for it. It was a herculean task in creating their password protected identity and enforcing them to use it. Gradually the staff realised that computerisation made their task easier as it cut down on paper work and repetition and also prevented serious mistakes from happening. Hard copies at certain essential areas were still maintained to continue work in the event of major breakdown of computer Results: Computerisation aided us in regulating the movement of the donor which at times was repetitive due to manual entry. Transfer of data ensured a safe supply and the mistakes could be retraced very easily. Implementation which included installation, training and enforcement took a period of 6 months. After overcoming all the challenges we minimised hard copies to 6 registers and started taking printouts of the other necessary details. The turnover time for the employees due to computerisation decreased by 20%. Waiting time for attendant decreased by 10%. Traceability of all the units became 100%.Supervision of the activities being carried out was 90% accurate. Identification of the donors was easy due to biometrics which included thumb impression and iris scanning. The decision making time for donors decreased by 50% thus making the system more efficient. Summary/Conclusions: Manual to computerisation involves involvement from source to supply and it is essential to anticipate the challenges and be prepared for solutions in order to make its implementation successful P-007

CT Smit Sibinga 1 , Y Abdella 2 and F Konings 2 1 IQM Consulting, ZUIDHORN, Netherlands 2 WHO Eastern Mediterranean Office, Cairo, Egypt Background: WHO defined essential medicines (EMs) as medicinal products that satisfy health-care needs of the majority of a population. They should be available at all times, in adequate amounts, in appropriate dosage forms, with assured quality and affordability. In 2013 blood and blood products (whole blood, red cells, platelets, plasma, and plasma-derived products) were added to the WHO Model List of EMs. Appropriate and effective regulatory framework (legislations, regulations, etc.) and a functioning regulatory authority (RA) is crucial for management of blood products as EMs. However, particularly in the less developed world, these prerequisites have barely been implemented. Aims: To analyze and advise on existing legislation and regulations. Existing legislative instruments of the 22 Member States of WHO Eastern Mediterranean Region (EMR) were collected and analysed for relevance and appropriateness for preparation and use of blood and blood products as well as use of associated substances and relevant medical devices. A literature search was done on matching combinations of regulatory system, regulatory framework, legislation, regulation, with production and use of blood and blood products, which resulted in almost exclusively references with respect to national and international legislation. Benchmark: WHO recommendations (Aide M emoires) and EU Directives. Methods: Existing legislative instruments of the 22 Member States of WHO Eastern Mediterranean Region (EMR) were collected and analysed for relevance and appropriateness for preparation and use of blood and blood products as well as use of associated substances and relevant medical devices. A literature search was done on matching combinations of regulatory system, regulatory framework, legislation, regulation, with production and use of blood and blood products, which resulted in almost exclusively references with respect to national and international legislation. Benchmark: WHO recommendations (Aide M emoires) and EU Directives. Results: Various formal legislative documents of only 9/22 countries are put in force by Governments [1960 (Egypt) till 2017 (Pakistan -Sindh)]. Most are detailed descriptions of RA, operational establishments, and specific requirements. However, none of these legislations complies with WHO and EU recommended formats and contents, and will not support effective regulatory oversight to promote and enhance quality, safety and availability of these EMs. Summary/Conclusions: Government should provide effective leadership and governance in developing a national blood system (NBS, fully integrated into the national health-care system. Essential functions of a NBS include an appropriate regulatory framework with legislations, regulations and other non-legislative instruments administered by a RA. These documents should spell out principles and cadres, standard setting, and organization of the blood system to ensure an adequate supply of blood and blood products and safe clinical transfusion for which a Model was designed. The structure of NBS will depend on organization and level of development of the health-care system. However, all critical activities within NBS should be coordinated nationally to promote uniform standards, economies-of-scale, consistency in staff competency, quality and safety of these EMs, and best transfusion practices. Key is formulation of an appropriate regulatory framework administered by a RA responsible for regulating the vein-to-vein chain in the preparation and use of these EMs. Background: The capacity of blood transfusion service to provide adequate supplies of blood components is the issue of concern for health providers worldwide; longer term observations of trends in this respect are therefore of crucial value. Aims: The study aim was analysis of some basic activities of the Polish Blood Transfusion Service in 2008-2017 including organizational changes, numbers of donors, donations and blood components as well as activities directed at increasing their safety. Methods: Retrospective analysis of data supplied by the regional Blood Transfusion Centers (BTCs). Results: In the discussed period, blood and blood components were collected in 21 regional BTCs and local collection sites as well as during mobile collections. Although the number of local collection sites decreased from 170 in 2008 to 133 in 2017 in favor of mobile collections, which increased from 8,672 to 13,189, the former is still the number one location for donating blood. On average 47.36% of all donations were performed in local collection sites. The total number of blood donors both at the beginning and the end of the discussed period was similar (583,908 in 2008 and 588,184 in 2017); over 99% of all donors were non-remunerated. However, the number of first-time donors dropped significantly (from 237,658 in 2008 to 143,038 in 2017). The total number of donations increased from 1,076,655 in 2008 to 1,249,655 in 2017; most frequent were whole blood collections (from 1,016,411 in 2008 to 1,171,302 in 2017) . Some blood components (mostly plasma and platelet concentrates) were also collected by apheresis. Most frequently prepared blood components were red blood cell concentrates -RBCs (996,678-1,154,239 units per year), fresh frozen plasma -FFP (1,090,369-1,289,021 units) and platelet concentrates -PCs (81,692-129,143 units, with significant increasing tendency). Additional processing methods such as leukocyte depletion and irradiation were more frequently applied to PCs (52-57.6% in respective years irradiated, 75.18-92.07% leukocyte-depleted), than to RBCs (4.46-8.46% irradiated, 7.65-20.7% leukocyte-depleted). In 2010, the pathogen reduction technologies in plasma and the PCs were implemented. Up to date however the use of these technologies is limited in most BTCs. In 2017 approximately 11.5% of PCs and 8% FFP units issued for transfusion were subjected to pathogen reduction technologies. Summary/Conclusions: Our study data may contribute to the assessment of some long-term tendencies observed in Polish Blood Transfusion Service and may serve practical-benchmarking. This in turn may prove beneficial to the transfusion community as a whole. Background: In Poland 80% of hospitals depend on blood for the treatment of patients; over 1.5 mln units of blood components are annually transfused. It is therefore purposeful to expand the knowledge on factors impacting on blood transfusion service (BTS). The Institute of Hematology and Transfusion Medicine (IHTM) as competent authority is responsible for collection of data related to the activity of all Polish Blood Transfusion Centers (BCTs). This data is exploited to a much lesser degree than the recently available statistical methods and data processing tools would allow. Moreover, survey of research in the field of public health indicates a negligible share of issues related to BTS. It seemed therefore necessary to "fill in the gap" with true assessment of performance of the Polish BCTs for improvement of BTS activity. 1 st stage of our investigation refers to collection, merging of data from different sources, their unification and preparation (big data) for further analysis to be performed using multidimensional statistical analysis and data mining methods. Aims: Assessment of the activity of the Polish BTCs over the 20 year-period in two stages. Goals at 1 st stage: 1. Data digitalization; scanning of paper documents. 2. Development of a uniform template for collecting digital data from various sources. 3. Standardization, unification and quality improvement of available data: filling in missing data, elimination of errors, duplicate records etc, that may distort the outcome of analyzes. 4. Selection of data for analysis. Methods: Digitalization and big data methods for processing various types of data: a) stored in paper form (1997) (1998) (1999) (2000) (2001) (2002) (2003) (2004) , b) digital stored in two file types (.doc and .xls, for the years 2005-2010 and 2011-2017, respectively). For each data-type, a separate Excel file model was created. The models were then merged into one analytical table with data processing methods. Results: 1. 1344 pages of paper documents were scanned. 2. Models developed for data from 3 different sources:

a. Paper-data were rewritten and ascribed to its model; outcome -3 tables, 272 columns, 10,400 rows. b. .doc and .xls. filesdata were ascribed to 2 other models; outcome -6 tables, 1656 columns, 788 rows. 3. The 3 models were merged into 1 analytical table to create a 588 MB database (comparable to approx. 784 min of music). 4. The data was subjected to standardization, unification and quality improvement: filling in missing data, elimination of errors and duplicate records that may distort the results of analyzes. 5. Selection of data for analysis at 2 nd stage. Summary/Conclusions: The 1 st stage provided a set of selected data for analysis in the 2 nd stage which will rely on multidimensional statistical analysis and data mining methods.

The outcome of such analysis will contribute to optimal realization of objectives: a) gaining in-depth knowledge about the fundamental phenomena that shape Polish BTS, b) identification of potential changes BCTs, c) development of overall guidelines for change management. aimed to touch untouched or less touched topics of BB&TM. So far 8 workshops were organized and each year around 30 countries were participated from almost all religious, ethnical, social, cultural and economic situations of the world. 6. Supported realization of major changes in BB&TM in Turkey; a convincing medical individuals and agencies mainly MoH to give the deserved consideration to BB&TM b encouraging the recognition and establishment of national blood program c issuing a new blood act and numerous necessary bylaws, etc. d creating an appropriate standard donor questionnaire form e changing blood transfusion practice from %96 whole blood (at 1996) to 5%. f changing donated blood screening criteria; while anti-HCV screening became obligatory Malaria, screening cancelled g preparing national guidelines h promoting Haemovigilance nurse post i promoting Patient Blood Management 7. Around 11,000 blood bankers attended national courses, 7,000 attended national congresses, 18,000 attended nationwide symposiums. Summary/Conclusions: BBTST can be accepted as a sample how a scientific nongovernmental organization may give a very positive impact on developing and progressing BB&TM activities with close collaboration MoH and other related organizations

Abstract withdrawn. Background: Globally there is growing investment in information technology (IT) in business. This similar trend has been observed in blood establishment computerized systems (BECS). The IT investment can be high hence IT decisions need to be properly informed. The Africa Society for Blood Transfusion (AfSBT) encourages the use of ITs in African blood services as this optimize quality blood services, thereby improving patient's outcomes. AfSBT established in 2016 an IT working group (AfSBT ITWG) with the support of the Swiss Red Cross (SRC) to spearhead the IT standards among member blood services. A number of priority IT thematic areas were identified. These includes IT governance which focuses on creation (strategic alignment) and preservation (risk management) of business value. There is absence of published literature on how a structured IT governance framework can be implemented in a resource constrained setting. A review of the National Blood Service Zimbabwe (NBSZ) IT governance was done based on published IT governance framework. Aims: To explore how a structured IT governance can be developed, implemented and monitored in a resource constrained setting. Methods: A published MIT-CISR framework which has six components was used to assess the strength, gaps and opportunities of the IT governance. Results: NBSZ has been implementing an evolving structured IT governance system. In terms of Service strategy and organization there is a well-established IT function which is reflected in the NBSZ strategic plans. This ensures IT annual budgetary support, which averages 4.3% of the total budget. The IT governance arrangements are such that decision rights are assigned to different IT staff (executives, IT specialist, and users). A range of IT solutions have been embedded within the NBSZ operations such as BECS, financial, donor mobile application, social media, temperature monitoring, and human resources. The business performance goals are defined and are congruent across the various business units. IT organization and desirable behaviors are documented in the ICT policies and procedures and were needed remedial actions are available through the code of conduct. The IT metrics are included within the NBSZ monitoring and evaluation system which use a four colored traffic lighting reporting system. It was noted that the IT accountabilities are undesirably tilted to the IT specialist only hence some ICT projects tend to have delayed deliverables. The IT governance mechanisms are supported with tools such as service level agreements and established communication approaches. Simple excel based solutions are used to track critical performance metrics such as on the interactive blood supply management status, which averages 122.8% (2018) based on a 5-day projected stocking and supply levels. NBSZ need to properly document the return on investments on all these ICT initiatives, which is estimated (2016/2017) to be at 3.2% of annual savings. Summary/Conclusions: Blood services in resource constrained settings can implement a properly structured IT governance and this will ensure maximum return on IT investments. The NBSZ approach will be shared and further developed in the AfSBT ITWG to support other blood services in improving their IT governance.

Haematology/Blood Transfusion, Alfred Health, Melbourne, Australia Background: In October 2018, an integrated electronic medical record (EMR) was implemented at an Australian metropolitan multi-campus heath service using Cerner Millennium TM , aiming to achieve HIMSS (Healthcare Information and Management Systems Society) level 6. Prior to implementation, large numbers of blood specimens were collected from patients unnecessarily and sent to Pathology without a test request attached (no blood test requested -NTR). These specimens required additional processing in the laboratory. Electronic specimen collection using Cerner Specimen Collect TM allowed streamlining of specimen processing by eliminating paper requests. As part of the new workflow, individual specimen labels are printed with the specified blood test and correct tube type. This helps prevent the practice of collecting additional specimens due to uncertainty of the collection requirements. Aims:

• To quantify the expected reduction in NTR specimens following introduction of electronic specimen collection, and outline the benefits • To determine the impact on collection errors and Wrong Blood In Tube (WBIT) events Methods: Data was obtained directly from Cerner Millennium TM using a CCL (Cerner Command Language) query which is run monthly by Pathology IT staff. This data includes all specimens registered for the month with indication of rejected specimens, WBIT & NTR samples. 'Rejected specimens' includes incomplete specimen and/or request certification, unlabelled specimens/requests and mismatched specimens. Further information about WBIT events was collated from Riskman reports and staff interviews. Results: Data from the 12 months prior to EMR implementation was compared with 3 months post. NTR numbers reduced from 4220/month to 2019/month (52% reduction), freeing up more storage space in fridges. Rejected specimens due to inadequate patient request labelling reduced from a mean of 27/mth to 6/mth. WBIT numbers have increased slightly: before having median 1 (range 0-2), after with median 2 (range 0-3). Although it was hoped that WBIT incidence may reduce with the new EMR, 4 of the post implementation 6 WBITs involved electronic specimen collection. Departure from planned protocols involving a lack of working printers, causing staff to print patient labels away from the patient's bedside, as well as multiple patient labels printing on individual printers appear to be a main cause of the EMR WBITs. Summary/Conclusions: EMR implementation has led to a reduction in NTR, and rejected specimens due to inadequate request labelling, as well as increased storage space in laboratory refrigerators. Associated benefits include: • Decreased financial costs of the wasted equipment • Decreased staff time collecting and processing unusable specimens • Decreased environmental impact of manufacture and disposal of unused specimens • Decreased potential of iatrogenic anaemia Work in preventing the occurrence of further WBITs is ongoing, by ensuring that label printers are in working order, are in plentiful supply and easily accessible to staff; and also ensuring positive patient identification and blood collection by the patient's bedside remains a priority.

JM Mustaffa 1 , K Teo 2 , S Tsai 1 , P Heng 1 , R Sagun 1 and M Wong 1 1 Laboratory Medicine 2 Khoo Teck Puat Hospital, Singapore, Singapore Background: Khoo Teck Puat Hospital (KTPH) is a 761-bed general and acute care hospital, opened in 2010, serving more than 800,000 people living in the northern sector of Singapore. The Blood Bank of KTPH Department of Laboratory Medicine provides specimen testing and blood transfusion services for KTPH as well as the neighbouring Yishun Community Hospital (YCH), one of the largest community hospitals in Singapore providing intermediate care for recuperating patients including rehabilitative services. The process of ordering transfusion-related test requests in both hospitals is through printed forms. Aims: In line with the hospital directive to move towards electronic patient management, the KTPH Blood Bank intended to implement an electronic Type and Screen (e-T&S) system. The goal of the project is to ensure zero patient identification errors and maintain full traceability and accountability for the blood collection process in all transfusion-related testing. Another aim of the system is to reduce repeated venepunctures when specimens are rejected due to missing essential patient information on the printed forms by implementing mandatory fields in the e-T&S form.

Methods: The e-T&S was implemented in phases. Phase 1: an online version of the printed form was signed electronically by the ordering doctor and a witness within the electronic medical record system, Sunrise Clinical Manager (SCM) system with the doctor counter-checking by signing on the specimen label to ensure correct patient identification. Phase 2: the ordering doctor is not required to sign on the specimen label since fingerprint biometrics are required for the electronic signin. Phase 3: elimination of the witness step for blood collection. Specimen collection and rejection data from 2016 to 2018 was analysed. Specimen rejection rate was presented as percentage of rejected specimens (mislabelled, unlabelled and clerical errors) over total specimen count for each month.

Results: Between January 2016 and March 2017, before the implementation of the e-T&S phase 1, the average rejection rate for blood bank specimens was 0.16% and 1.14% for identification and clerical errors respectively. During phases 1 and 2 of implementation, rejection rate increased due to unfamiliarity to the new work processes. By February 2018, with the implementation of the final phase of the e-T&S system the specimen rejection rate was 0.38% and 0.12% for identification and clerical errors respectively. Rejected specimens were mostly from the few locations that had to use paper requisition due to workflow or infrastructure limitations. Summary/Conclusions: The e-T&S system was implemented successfully in KTPH. Full traceability and accountability of the blood collection process was maintained with the fully electronic system. The adoption of electronic documentation has also reduced the number of preventable repeated venepunctures that were due to incomplete order information on the printed forms. Future developments in technology and full implementation of e-T&S system in all hospital locations may make zero patient identification error achievable and ensure transfusion safety in all patients in the near future. Background: Blood component administration represents a critical phase due to the possible occurrence of errors during the different steps from the identification of the patient to the infusion of the product. Error occurrence can be reduced by the implementation of validated information systems. We tested the SCWeb â System at the bedside in a transfusion outpatient clinic. Aims: The aim of the study is to validate a system designed to assist and to control blood administration step by step using electronic devices to ensure traceability and documentation of the process Methods: The SCWeb â System is based on IT monitored checklists which guide the personnel to follow the procedure, according to best practices; the system must initially be activated by the operator which is recognized by an auto-signing system based on Bluetooth Low Energy which avoids the operator having to identify himself/herself beforehand. Appropriate privacy protection is provided. Thereafter the system takes up the task to give instructions and to verify the adherence, by asking an active confirmation of the proper fulfillment of the activities; a continuous registration and documentation is made by the system. Standards and specifications for each step of the procedure have been configured on SCWeb â System to track in detail operator and patient identification, presence of informed consent to transfusion, blood pressure, pulse and temperature recording, vein access, verification of the blood unit. An alarm has been set after 15 min, to ensure the control of patient's conditions. For each step, an active confirmation of the action is required and nurse and doctor direct involvement must be actively confirmed on the device by both operators. The system has been tested at the bedside on 30 patients admitted to the outpatient clinic for 45 red cell concentrate transfusion; compliance of the personnel and organizational impact has been recorded. Results: The System required a very short training: ease of SCWeb â system allows its implementation without negative impact on organization of transfusion outpatient clinic and without difficulties by operators (nurses and doctors), who appreciated the help given by the IT check system. The registration of the electronic check list offered a reliable tool for the traceability of the transfusion procedure, also granting a paperless and timely available documentation of the entire process through a registration in electronic format of all the operator's action in every single phase of the transfusion process. When prescribed, confirmation of the checklist was only possible in the presence and with the active confirmation of two operators (doctor and nurse). Summary/Conclusions: The SCWeb â system is useful as a barrier against the mismatch of transfusion (preventive measure), as a traceability and documentation measure and as a tool for training of personnel in blood transfusion administration; it avoids paper registration during the transfusion process, due to the timely registration of the activities performed by operators recognized by the system thanks to the Bluetooth Low Energy auto-signing device. The SCWeb â system will be connected to the transfusion data management system, to monitor all the process from the arrival of the unit from the blood bank. Background: he blood banks aims at reducing cost and increasing customer satisfaction by providing quality in service. The quality in service can be attained by streamlining the processes and restructuring the supply chain of the organization by implementing IT tools. Aims: Aim is to understand the complex flow of information and processes within the supply chain of the blood bank. The requirement of such a study is a part of the integrated ERP modeling for the integrated functioning of a blood bank. Methods: he approach used to understand and map the sequence of processes, and the work responsibilities of each process and the operational decisions involved at each step is process mapping and data flow diagrams for front end system modeling and analysis. The processes are mapped and represented in a schematic diagram. DFD (Data Flow Diagram) are constructed for representing the system. A context diagram is also constructed for understanding the entities interacting with the system. The EMR systems aim at replacing (or supporting) the paper based medical records. The whole model of the system is divided into two parts-Front end and Back end. The front end design and analysis is done using EPC (Event-Driven Process Chains), Resource Views, Data flow Diagram for Data view. Reporting was on Donor Selection, Finance and Collection of Blood Bag, Blood Collection Process, Component Preparation, Blood Testing and Blood Distribution Results: Process mapping using Event Driven process Chain generated a whole view of the processes involved. The resource view gave an organizational structure and the personnel involved. The data view using context diagram and data flow diagram gives a flow of data and amount of data involved. This framework can be used for business process reengineering for the blood banks by conducting a time study and removing non value added activities. Data view helps analyze redundant data in each process. It also helps in staff training and orientation within the department. Summary/Conclusions: A systematic overview presented in this paper facilitates in removal of non value added processes, duplication of data, bottlenecks, reduction of cycle time and thereby improving service quality in blood banks. Background: The transfusion of blood components, one of the most prevalent interventions in clinical practice is a major expenditure item in healthcare services which tend to increase in recent years. Aims: It is intended to investigate the impact of transfusion associated costs to hospital costs in Pediatric Intensive Care Unit (PICU) patients. Methods: During a year period (January 2017-December 2017) 76 patients, 40 females and 36 males receiving transfusion with blood components along the stay in PICU were included in the study. Transfusion associated costs and total costs for healthcare services for children treated in PICU was collected by using Hospital Information System (HIS). Statistical analysis of data was performed by SPSS software (version 22.0, SPSS Inc., Chicago, IL, USA). Mann-Whitney U test and Kruskal-Wallis test was performed for comparison of independent categoric variables and numeric data; Chi-square analysis was performed for comparison of two numeric variables and Spearman correlation analysis was performed for associations. Results: The median age of patients was 12.0 months (interquantile range-IQR 26). The median length of stay was 16 days (IQR 30). In total 400 blood components were transfused in which of 227 red blood cell concentrates, 114 apheresis platelet concentrates, 6 granulocyte concentrates, 51 fresh frozen plasmas, and 1 cryoprecipitate and 1 whole blood. The ratios of transfusion associated expenditures to hospital costs were categorized in intervals of percentages as < 5%, 5-10%, 11-15% and > 15%. Most of the patients (63.2%) were ranked in the lowest interval. The medians for hospital cost and transfusion associated cost were 5478.76 euros (IQR = 11280.02) and 130.57 euros (IQR = 354.86), respectively. A significant strong positive correlation between numbers of transfusions and hospitalization cost of PICU was detected (r: 0.674, P < 0.01). While it was found a significant weak positive correlation between transfusion associated cost and hospital cost (r: 0.247, P = 0.032) there was also a significant weak positive correlation between the age and transfusion associated cost (P = 0.048, r: 0.227). A significant difference was found between the patients with and without hematological malignancies (P < 0.01) for transfusion associated cost. The reason why pediatric dosages are mostly prefer is that the hospital provides healthcare for only children and splitting of the blood components was common in the hospital. But unexpectedly a significant increase on the transfusion associated costs which is related to split blood components was detected (P < 0.05). Summary/Conclusions: Studies on the economics of blood transfusion have been conducted mostly in patients who require chronic or multiple transfusions. PICUs, specialized facilities that provide care for patients with severe life-threatening diseases are major departments often necessitate multiple transfusions. There are many variables to evaluate the impact of transfusion associated cost to hospital cost in PICU patients, but the major factors are underlying conditions, admitting diagnoses and transfusion strategies. Although there are unexpected data in our study demonstrated the increasing impact on transfusion associated cost originated from blood components split for pediatric usage no significant relationship was determined to explain this situation. Further studies on the economics of blood transfusions have to be carried out to clarify the variables of transfusion associated costs. Background: Approximately 55.7% of the transfused blood component is packed red cell (PRC). Over ordering of PRC unit is a common practice and excessive pretransfusion testing was being wasteful of resources and have adverse consequences on cost. High crossmatch to transfusion (C/T) ratio as quality indicator of blood bank implies that crossmatches were performed unnecessarily. Aims: The aims of this study were to evaluate the cost effectiveness of strategies for limiting the number of pretransfusion testing of ordering PRC. Methods: All PRC units who ordered from Dr. Hasan Sadikin Hospital from January 2016 to December 2018 were collected in this retrospective study. Number of ordering PRC unit, completed pretransfusion testing of ordering PRC units, and PRC units that were transfused were recorded. Restrictive pretransfusion testing strategies were done based on the hemoglobin level and diagnosis as transfusion indication criteria. Cost effectiveness was measured by multiplying the unit cost of pretransfusion testing and number of PRC unit. Results: Out of total 177,370 ordered PRC unit, 166,910 (94.1%) were subjected to pretransfusion testing and 63.1% (105,260) of ordering PRC unit which are pretransfusion testing were transfused. This means that 5.9% (10,460) of ordering PRC unit were not subjected to pretransfusion test. This showed savings of 1,098,300,000 Rupiah. C/T ratio was 1.6 which demonstrate a good ordering pattern. However, 16.4% (27,451) of completed pretransfusion testing of ordering PRC unit were not transfused, leading to blood bank loss of 2,882,355,000 Rupiah. Summary/Conclusions: Strategies for limiting the number of pretransfusion testing on the good C/T ratio was still associated with saving cost effective Background: Blood is a precious resource for saving patient lives. The purpose of blood and blood component therapy is to provide suitable and safe blood products to achieve best clinical outcomes. Nurses have an important role in ensuring safe blood transfusion. It is crucial for nurses to have sufficient knowledge about blood donation and collection, storage, component preparation, possible adverse effects of blood transfusion and necessary management and care. Aims: The aim of this study was to assess the impact of an educational intervention on knowledge and awareness of nurses regarding blood transfusion services and practices. Methods: The baseline study to assess the knowledge and awareness regarding blood transfusion services and practices of the nurses posted at various areas of the hospital including wards, operation theatres and critical care areas was carried out at our institute hospital which is a tertiary care teaching centre. The nurses were then sensitized and educated regarding blood transfusion services and practices during their day to day activities by referring them to the blood transfusion guidelines of the institute. Subsequently, a self-developed questionnaire which was used for the baseline assessment of knowledge and awareness of the nurses was again used to reassess them. A total of 19 questions were included in the questionnaire pertaining to: general awareness (two questions), blood donation (two questions), testing and blood component preparation related (two questions), storage of blood/blood components (two questions) and pre-transfusion checks and bed side transfusion practices (eleven questions). Fifty nurses each were included for both the baseline as well as post-sensitization assessment. For different category of questions, the correct response rates were compared with those obtained in the baseline study using Mann-Whitney test. The entire study duration was spread over a period of three months (December, 2014 to February, 2015 . Results: The overall mean percentage of 'correct' responses for 19 questions in the baseline study was 61.75%, whereas post sensitization it was 77.21%. The mean percentage increase in general awareness related questions was 21.49%, 13.95% for storage of blood/blood components related questions, 17.37% for pre-transfusion checks and bedside transfusion practices related questions, 21.33% for testing and blood component preparation related questions and 27.27% for blood donation related questions. The percentage increase in correct response was found to be statically significant for each of the five categories of questions. The overall mean percentage increase in correct response rate was also statistically significant (P < 0.001). Summary/Conclusions: This study revealed that after sensitization and educational intervention there was a significant improvement in the knowledge and awareness of nurses regarding the blood transfusion services and practices.

Abstract withdrawn.

Background: TACT, introduced in the UK in 2014 to support managers, provides resource-saving, continual, 'real-time' monitoring of knowledge-based competency of staff in transfusion laboratories. TACT is available online 24/7, complementing existing practical competency schemes and external quality assessment. Multiple variations on a standard pre-transfusion testing scenario are generated using constrained randomisation; logic rules for automatic assessment of sample acceptance, ABO/D, antibody screen and identification (AS/ID), and component issue are based on BSH guidance. During 2018, TACT was offered internationally to transfusion laboratory managers to trial, and saw uptake in five countries. The core TACT programme, based upon UK guidelines, is under review for programming conversion, to be customisable for the international community. Aims: To assess the feasibility of TACT programming conversion to meet the requirements of country-specific pre-transfusion testing guidelines, and to direct future programming in line with feedback from international users. Methods: Guidelines from 3/5 international users were obtained and translated where necessary. These were compared against the core assessment elements of current TACT programming. International users were approached for their feedback on the current version of TACT, as it compared to their local policies and practices. Results: The following criteria were cross-referenced: specification of transfusion request forms, sample label acceptance criteria, reagents used for ABO/D and AS/ID, resolution of grouping anomalies, alloantibody confirmation/exclusion, and selection criteria of blood components for transfusion-dependent patients and women of child-bearing potential. Apparent differences included:-Australia:--Selection of red cells for patients with immune anti-D. Greece:--Inclusion of the name of the patient's father on the transfusion request. Italy:--Testing of all new patients with an anti-A,B reagent and two different monoclonal anti-D reagents. International users in the same three countries supplied feedback. This included suggestions for:-greater complexity of cases presented, provision of patient history, inclusion of follow-on tests e.g. phenotyping and cells for antibody confirmation/exclusion, broader range of reaction strength grading, and official professional CPD credits. The following differences were noted:-nomenclature used, the format and content of the request form, use of English abbreviations of patient clinical details, and the availability, provision and specification of blood components. Summary/Conclusions: This analysis has shown very few instances where the current TACT iteration differs from the guidelines reviewed, and that it is feasible to expand the use of TACT on a more international basis. The current iteration of TACT has been developed to represent an abbreviated scope of pre-transfusion testing practices, which can be applied to laboratory practice outside of the UK without difficulty. Further work is required to enable international users to configure TACT such that the system represents all laboratory practice on an international basis. Aims: These courses provide education to clinicians on patient blood management and safe transfusion in neonatal and paediatric settings in order to improve patient outcomes and increase awareness of the national patient blood management guidelines. This analysis aimed to investigate the uptake, practical use, and perceived value of the courses by learners. Methods: A retrospective analysis of course completion statistics and course evaluation data. Results: There have been 2,376 paediatric and neonatal courses completed from 6 March 2018 to 28 February 2019 with 89.6% of learners being nurses and/or midwives. Analysis of course evaluation data (n = 33) showed that these courses: -Provide knowledge (96.9%) -Improve patient safety and outcomes (84.9%) -Result in change to clinical practice (69.9%) -Are relevant to clinical practice (70.9%) -Are easy to use (67.7%) -Are readily accessible (58.1%). Examples that learners provided of how they can apply this learning to their clinical practice include: -"[I am now] more aware of special requirements for neonatal blood transfusion" -"[I] feel more confident especially when talking with parents" -"[I will now be] checking the patient's blood results and will speak up for unnecessary blood sampling" -"[It's good that] when there is ambiguity in clinical practice [this is] very well shown by explanation from experts in the field" -"We don't do a lot of transfusions [and this is] a reminder that transfusions are not always the first answer to the baby's clinical picture". Summary/Conclusions: Analysis of course and user evaluation data demonstrates that these courses are being used by nurses and doctors working in the neonatal and paediatric settings and that they provide knowledge of PBM that can be applied to clinical practice, thereby contributing to improved patient care. Background: Blood transfusion is a high-risk clinical activity that must be mastered both theoretically and practically in order to guarantee the required result without any incident or complications. The mastery of transfusion knowledge among nurses represents a very important link in the transfusion chain. The objective of this work is to compare the theoretical and practical knowledge of transfusion among two groups of nurses divided according to their seniority. Aims: This is a cross-sectional descriptive study conducted over a period of 1 month [1 st April-30 th April] 2017. We selected two groups of care staff: the 1 st group consists of 50 students at the end of their training at the higher Institute of Nursing Sciences. The 2 nd is made up of 50 nurses working in 5 university hospitals of Tunis, currently practicing blood transfusion. The evaluation's tool used was a questionnaire of 15 simple or multiple choice questions, 7 were related to theoretical knowledge of labile blood products and 8 to transfusion practice. Ten questions were considered "life-threatening" if their answers were false. A comparative study was made between the two groups. Methods: This is a cross-sectional descriptive study conducted over a period of 1 month [1 st April-30 th April] 2017. We selected two groups of care staff: the 1 st group consists of 50 students at the end of their training at the higher Institute of Nursing Sciences. The 2 nd is made up of 50 nurses working in 5 university hospitals of Tunis, currently practicing blood transfusion. The evaluation's tool used was a questionnaire of 15 simple or multiple choice questions, 7 were related to theoretical knowledge of labile blood products and 8 to transfusion practice. Ten questions were considered "life-threatening" if their answers were false. A comparative study was made between the two groups.

Results: The participation rate in the survey was 100%. The 2 nd group participants had an average seniority of 9 years . More than half of them (64%) had seniority of less than 10 years. Only 12% had more than 20 years of experience. The rate of correct answers for all items combined was 44.4% for students versus 42.5% for practicing nurses. The theoretical knowledge part was more mastered in the 1 st group than that of practicing nurses (44.8% vs 33.4% of correct answers). On the other hand, the control of the transfusion act was better in 2 nd group (44% vs 50.5%). The overall "dangerous" response rate was 47% for students and 41.7% for practicing nurses. False practical knowledge was more common in group 1 (59.5% vs. 41.5%). Summary/Conclusions: The theoretical as well as the practical knowledge remains not well mastered by the care staff. Our study highlighted the best theoretical mastery for young students and practical for practicing nurses. This could be explained by the freshness of knowledge in the first group and the daily practice in the second group. Background: The European Commission (EC) Directive 2004/33/EC on blood donor selection criteria is 15 years old. In the meantime, knowledge on risks related to blood donor selection has progressed and challenged several obligatory rules. TRANSPOSE -TRANSfusion and transplantation: PrOtection and SElection of donors, is a European Commission co-funded project with participation of more than 24 stakeholders from both not-for-profit and private organizations providing substances of Human Origin (SoHO). The project aims to provide evidence-based donor selection criteria and guiding principles for risk assessment of threats to the safety of SoHO. As part of this work, an inventory of current blood donor selection criteria in Europe and an evaluation of the evidence behind current practice was performed by experts working on this project. Aims: To identify the gap between the EC Directive 2004/33/EC on whole blood donor selection criteria and a current evaluation of the clinical relevance of the criteria based on scientific literature by a panel of European experts within the Transpose project. Methods: In 2018, we performed an inventory of blood donor and transfusion recipient risks in participating European countries. Project members were asked to provide the existing donor selection criteria related to these risks and to carry out a risk-based evaluation for each of them. The evaluation was based on the available scientific literature and on a risk assessment template based on the ABO Risk-Based Decision-Making Framework, developed by Transpose. All risks with divergent assessments within the panel were resolved through discussion; in all cases an expert consensus was established. Subsequently we compared the results with the content of the EC Directive 2004/33/EC for every risk, thereby identifying discrepancies and missing items in the Directive. Results: The panel identified 64 risks considered to be significant, distributed between donors and recipients. For 35/64 (55%) of them the expert evaluation deviated from the content of the EC Directive, or the EC Directive provided no information about the decision making. In particular, a discrepancy was observed for 9/20 criteria concerning general health and medication, 12/22 for transfusion transmissible infections, 10/13 for high-risk behaviour and travel, and 4/9 for other diseases. Summary/Conclusions: Our results highlight a significant gap between the whole blood donor selection criteria stated in the EC Directive 2004/33/EC and the scientific evaluation performed by a panel of Transpose participating experts. This gap includes both new risks not addressed in the EC Directive and addressed risks that are however evaluated differently. This involves both blood donor and transfusion recipient safety, and various medical and epidemiological topics covering several aspects of the blood donation criteria. We strongly recommend a change in the European legislation, allowing a procedure to guarantee that blood donor selection criteria are updated regularly within the framework of the European institutions, to keep aligned with scientific progress, epidemiology and changes in medical practice, in order to enable an updated risk-and evidence-based framework for donor selection criteria. The risk-assessment method elaborated in the TRANSPOSE Project is a valuable instrument for this purpose. Background: The Brazilian Health Regulatory Agency -Anvisa has developed the Method for Assessment of Potential Risk in Hemotherapy Services (MARPSH) which is based on the data collected during the inspections of blood services carried out by regulatory authorities. Using MARPSH any blood service can be classified in one of 5 possible potential risk categories: High, Medium-High, Medium, Medium-Low and Low Risk. Each category represents a different potential risk level, according to the proportion of compliance with the established regulatory requirements. MARPSH has been used since 2007, showing a trend of risk reduction on blood services evaluated all over the country. Aims: This work aims to describe the utilization of MARPSH as a tool for an integrated risk management model. Also, it shows the main results obtained after 10 years of data monitoring and coordination of regulatory actions and policies by Anvisa, targeting quality and safety of blood products. Methods: The utilization of MARPSH follows a network risk management model since the inspections are carried out by decentralized organs in all 27 states and some municipalities. The inspectors fulfill a standardized inspection guide containing the regulatory requirements, where each item is associated with a level of risk, varying from I to III as the risk increases. At the end of the inspection, after a statistical calculation, the service is categorized. This classification gives an estimate of its quality profile, guiding the adoption of suitable measures for risk management by local authorities and services. These data are send to the states (if realized by municipalities) and to Anvisa that perform consolidation in a national level. Either states or Anvisa use data to coordinate risk management measures in a broader spectrum. Data are continuously monitored by Anvisa as part of its strategical panel of indicators. Anvisa follows up specially blood services in High and Medium-High Risk with the aim of helping or complementing local authorities' actions. Additionally, Anvisa periodically sends this information to the Brazilian Ministry of Health and local governmental organs from Brazilian National Blood System that also support actions to improve quality in their blood services networks. Results: Since 2007, when the assessment covered 109 blood services, MARPSH reached 1218 blood services in 2017 (57% of the blood services registered) what corresponded to almost 100% of the inspection cover in this year. Over this period (2007) (2008) (2009) (2010) (2011) (2012) (2013) (2014) (2015) (2016) (2017) it is possible to notice a dramatic decreasing in trend for proportion of blood services classified as High and Medium-High Risk, varying from 26% to 9%. Summary/Conclusions: MARPSH generates data necessary to the categorization of blood services into five levels of potential risk. As a result, the regulatory actions are applied by local organs with the purpose of reducing or eliminating risks involved in the production and use of blood components. Data have shown a significant risk reduction over 10 years of MARPSH's utilization. Additionally, monitoring of this data at a national level has been permitting appropriate planning and prioritization of integrated strategies directed to risk management and strengthening of blood services in Brazil. Background: Sub-Saharan Africa has the highest need of blood transfusion in the world, mainly for childbearing women and children suffering from malaria. Meeting basic quality and operational requirements to provide patients with safe blood remains a challenge in these settings. Aims: The aim was to identify and prioritize potential hazards for patients in blood bank practices in the Democratic Republic of the Congo (DRC). We focused on two subsets: (i) sensibilisation and selection of donors, and (ii) qualification and production of blood products, using Failure Mode Effect Analysis (FMEA). Methods: Two risk analysis workshops were organized at the National Blood Transfusion Centre in Kinshasa, the Democratic Republic of the Congo. In both workshops, a multidisciplinary team was invited to represent different hospitals and profiles in transfusion management in DRC: quality coordinators (n = 2), training coordinator (n = 1), medical doctor for donor selection (n = 2), hemovigilance officer (n = 1), laboratory technicians performing donor sampling, blood qualification and production (n = 7), biomedical scientists (n = 3), microbiologist (n = 1), clinical biologist (n = 1), nurse (n = 3). The principle of FMEA was applied, which implies identification of possible hazards (failures) in a process flow, followed by scoring each hazard according to their impact, probability, detection and feasibility. In the both workshops, participants were guided by an external facilitator who guaranteed common understanding of the methodology. Main focus of the risk analysis was potential harm to the transfused patient in the process of (i) sensibilisation and selection of donors, and (ii) qualification and production of blood products. All ideas were written on coloured cards and mapped on a chart according to their impact, probability, detection and feasibility score. Hazards were ranked according to their final risk score by multiplying these four scores. Results: In the process of sensibilisation and selection of donors, the three hazards with the highest final score for impact, probability, detection and feasibility were: (i) a paid donor is recruited after sensibilisation by family members of the patient, (ii) donor selection staff approves a non-eligible donor for blood donation because of personal/financial motivation, (iii) blood donors are not correctly informed about blood donation during sensibilisation by family members of patients. In the flow of qualification of blood products, highest scores were made for: (i) no double check for validation and sorting of qualified blood products, (ii) stock-out of reagents, (iii) no check for match between registered test result and tested blood tube. Regarding production of blood products, the top three consisted of: (i) transport time between blood collection and processing is >8 h, (ii) storage of qualified and quarantined blood products in the same fridge (some sites only), (iii) power cuts. Summary/Conclusions: The risk analysis resulted in three prioritized hazards in the process of donor selection/sensibilisation and blood product qualification/production. Some are very specific to the sub-Saharan African setting and have been described before (power cut, family and paid donors, stock rupture,. . .). An action plan needs to be put in place to reduce their final risk score. The risk analysis needs to be continued for the remaining blood transfusion flows. Background: 19.3 million of Germany's population, so just under a quarter of residents, have a migration background. The majority of these has roots in regions where the population has a distribution pattern of blood group and HLA-antigens that differs considerably from the predominant one in the German population. Sufficient supply of these individuals with red blood cell (RBC) and platelet concentrates (TC) will continue to be a major challenge in the future, as blood donors with compatible blood group antigens are dramatically underrepresented in the local donor pools. Many migrants suffer from severe hematological disorders such as b-thalassemia or sickle cell disease and will not only need compatible blood transfusions, but an allogeneic stem cell transplantation in the foreseeable future. As healthy family donors often are not available, at present suitable stem cell donors with a similar genetic background can only be found in international donor registries. Aims: This project was initiated to recruit new donors with a migration background for blood donation and to increase the number of blood stem cell donors among this group. Methods: Serological extended blood group phenotyping was performed by automated gel card technique (Fa. Grifols, Erytra) and included AB0, Rh (CcDEe), Kk, Fy (ab), Jk(ab), Lu(ab), M, N, S, s. HLA typing for HLA-A, -B, -C, -DR, -DQ, and -DP was performed by Next Generation Sequencing. Allele frequencies were analysed using Genepop Version 4.2; the rare and very rare alleles were defined according to the Allele Frequency Database (www.allelefrequencies.net) RBC genotyping using Next Generation Sequencing is currently being established and will include additional antigens with the most frequent distribution pattern differences between migrant and resident populations according to literature. Results: So far, more than 8800 blood donors with a migration background have been recruited for a blood donation in this project. Amongst this group, over 1000 blood donors from more than 20 non-European countries enrolled as potential stem cell donors. An initial evaluation of the data revealed a very similar distribution of blood groups compared to the current blood donor population in North Rhine-Westphalia. Of 600 migrant donors, ten Fy(a-b-) donors were identified, which corresponds to a percentage of 1.6%. Amongst 509 HLA-typed potential stem cell donors, we found 28 (5.5%) with rare and very rare alleles. Summary/Conclusions: Blood donors with rare blood group and HLA phenotypes (e.g. null types such as Fy(a-b-)), are in demand for adequate medical care of people with a migration background. The technological development of blood group determination by Next Generation Sequencing will significantly improve the supply for all blood transfusion recipients in Germany. This project is funded by the European Development Fund 2014-2020 (ERDF) and the European Union. Background: Mortality due to uncontrolled haemorrhage following trauma is the most important cause of potentially preventable deaths. Trauma care systems in Low and Middle Income countries like India, are still in developing phase. Also, the role of blood component therapy in improving patient outcomes has been mostly derived from combat settings. Application of these protocols in an urban setup has not been well established and marked variation in practice exists. Hence this study aims to identify the key components of transfusion practices to optimize the transfusion protocol in trauma settings. Aims: To study the current transfusion practices in severely injured trauma patients, admitted to the red area/resuscitation bay after initial triage in ED Methods: This prospective observational study was conducted over a period of 1 year starting from June 2017 to May 2018 at the Department of Transfusion medicine in collaboration with Emergency Department at JPNATC, AIIMS, New Delhi. The study included severely injured patients (ISS ≥ 16) that were admitted within 24 h to the red area/resuscitation bay after triage. Data collected included the demographics, injury, laboratory and transfusion details for these patients Results: During the study period 885 patients (83.5% males) were enrolled. Mean ISS scores was 21.89 . Mean time to hospital admission after injury was 9:03 (IQR 3.38-13:48) hours. Mean time to first RBC transfusion following admission was 2:09 (IQR 0:27-2:45) hours. Approximately 49.3% (436) patients were in shock (SBP < 90 mm Hg &/or pulse rate > 110/min). Whereas, 160 (18.1%) patients were coagulopathic (PT ≥ 1.5 times of normal). During initial 24 h of admission, these patients were transfused with 2929 (69.7%) RBC, 1986 (51.8%) FFP, 2327 (42.9%) RDP and 384 (81.5%) cryoprecipitate of total blood components utilized for these patients. Massive transfusion (defined as transfusion of ≥ 5 units/4 h) was given to 190 (21.4%) patients. Summary/Conclusions: Significant quantity of blood components were required during initial resuscitation in severely injured patients. Pre-hospital transfusion can significantly reduce the time to transfusion. Further studies are needed to assess utility of Pre hospital transfusion in severely injured patients. Background: Allogenic stem cell transplantation recipients are known to be the main consumers of platelet concentrates (PC). The Geneva university hospital is one of the three allogeneic hematopoietic stem cell transplantation (HSCT) centers in Switzerland. Since the blood center is also part of the hospital, data of PC consumption are easily available. As needs rose steadily since several years, with an average increase of 9% per year, PC supply is a serious concern for our center. Aims: In this study we tried to evaluate if any pre-transplant indicator could help to forecast the number of PC needed after an allogeneic hematopoietic stem cell transplantation.

Methods: This observational retrospective study was conducted in Geneva hospital on 78 patients suffering from various inherited or acquired disorders of the hematopoietic system who were treated by HSCT in 2016. PC consumption was examined from January 2016 to December 2018. The five indicators were: gender, stem cell source (Bone Marrow (BM) vs Peripheral Blood Stem Cell (PBSC)), donor type (HLA matched (10-8/10) vs haploidentical), conditioning regimen (standard vs reduced intensity), and CMV serology of the recipient. Results: Data for a total of 78 patients aged from 3 to 74 years were analyzed; 48 (62%) were male and 30 (38%) female; 35 (45%) were CMV-negative and 43 (55%) were CMV-positive. Out of a total of 78 transplants, 14 (17.9%) were haploidentical and 64 (82.1%) HLA-matched. According to the stem cell source, BM was transplanted in 22 cases (28.2%), and PBSC in 56 cases (71.8%). Two patients also received a CD34 + stem cell boost.

Our analysis showed that, with a mean follow-up of 652 days, the number of PC transfused to our patients treated by HSCT ranged from 0 to 383 units, with an average of 37 and a median of 15, illustrating a high variability. The results indicated that gender, stem cell source (BM vs PBSC), conditioning regimen (standard vs reduced intensity), and CMV serology of the recipient do not have any statistical impact on platelet consumption. However, we observed a tendency of an increased need for platelet transfusion when patients were CMV positive. Our results also showed a statistically significant (P = 0.034) higher number of PC transfused for patients treated with a haploidentical (89) versus HLA-matched (26) transplant. Summary/Conclusions: This study points out the high variability of platelet consumption after HSCT, which limits the forecast of platelet production needed to support allogeneic HSCT recipients. A larger cohort would be required to confirm a potentially higher platelet consumption in CMV positive patients, and to consolidate our results showing a higher PC consumption for patients treated with haploidentical transplant.

Abstract withdrawn. Background: Historically at our institution, a minimum of four red blood cell (RBC) units were crossmatched for all cardiac surgery cases regardless of surgical case-type or patient characteristics. Two RBC units were packed in validated blood product coolers and brought to the operating room (OR); the balance of crossmatched units remained in the blood bank. A retrospective review revealed that very few RBCs were transfused (2016: 20% (371/1813), 2017: 19% (322/1742)). Moreover, approximately 8 products were wasted each month as a direct result of this practice. Thus, we recognized an opportunity to improve inventory management in terms of personnel activities and blood component utilization. Aims: The goal of this study was to reduce advance preparation of coolers in cardiac surgery cases without compromising patient care and safety. We limited our intervention to those patients who were eligible for electronic crossmatch. We maintained the aforementioned historical practice for those patients with history of and/ or those who currently demonstrated clinically significant red blood cell alloantibodies. Methods: A multidisciplinary group consisting of representatives from the blood bank, cardiac surgery, cardiac nursing, cardiac anesthesia and surgery quality department was assembled in October 2017 to determine whether a modification of practice was reasonable and safe. Group members evaluated site specific Society of Thoracic Surgery (STS) cardiac surgical data between July 2014 and December 2016 to establish intraoperative red cell transfusion rates classified by type and urgency of surgery. The group's main goal was to discontinue preparation of default coolers for patients eligible for electronic crossmatch who were scheduled for all types of non-emergency cardiac surgery cases in which ≤ 25% of historical cases required at least one red cell transfusion. Additionally, team members simulated the multiple protocols by which red blood cells could be prepared and delivered to the OR and estimated the time for each scenario. Results: Review of STS data showed that the following cases met the criteria of ≤ 25%: elective primary coronary artery bypass graft (CABG), urgent primary CABG, elective mitral valve repairs, and elective aortic valve replacements. Simulation showed that, in patients eligible for electronic crossmatch, preparation from receipt of order to completion of unit packing for delivery took 2.5 min using the pneumatic tube system (maximum of 2 units per tube) and 4.5 min using delivery of a cooler using a human courier. Summary/Conclusions: Based on the simulation results, and with consensus agreement from the multidisciplinary group, default cooler preparation for elective primary CABG, urgent primary CABG, elective MVR, and elective AVR was discontinued in December 2017. One year following implementation of the change in policy 940 RBC units were issued to the OR (a 54% reduction); 38% (361) were transfused, compared to 19% in 2017. Wastage rates decreased from 8 products a month to 1 per month on average. Summary/Conclusions: The most obvious drawback of PABD is the higher cost in running the program in comparison with collection of allogeneic blood in the areas of additional patient attention and clerical input in labeling, separate storage and so on. In this audit, 34% of the autologous blood components were not transfused into the intended recipients and wasted; in this context, the PABD program could not be considered as a cost-effective approach in protecting blood safety. Background: The National Blood Service Zimbabwe (NBSZ)'s Blood Supply Management Status (BSMS) is an integral process of ensuring the availability of a safe and sufficient blood supply provision. NBSZ introduced a new daily blood bank statement with improved metrics from 1 May 2018. The new analytics approach focuses on three interactive components of the blood bank statement; the available stock, quarantine stock (as per the desired 5-days stocks level), and the demand versus supply. It is imperative to have a closely monitored blood supply chain because blood has limited shelf life with uncertainties in both supply and demand. The 'blood-for-free' proclamation by the Government of Zimbabwe in July 2018 set more pressure on the blood demand. These metric-based analytics seek to assess if the NBSZ's improved blood bank statement is a realistic model for the BSMS.

Aims: To assess the use of the interactive metrics in monitoring the blood supply management status. Methods: A prospective cross-sectional study was conducted. A total of 704 daily blood bank statements which were submitted between May and December 2018 from each of the five branches were analyzed. The BSMS which is calculated as the average of the three interactive measures of quarantine stock, available stock and demand versus supply was determined. Sub-analysis of branches was done to determine individual branch performance. Analysis by month was done to assess seasonal variations. Findings and recommendations were shared among key stakeholders to validate the BSMS methodology. Results: Overall the quarantine stock average was 130.4% (SD +/-101.6), the available stock was 142.3%: (SD +/-118.8) and the demand versus supply was at 95.6% (SD +/-11.3).The overall BSMS was 122.8%; (SD +/-77.2) for the study period. Gweru and Masvingo nearly supplied all the demanded blood with 99.2%, overall BSMS of 118.1% and 99.7%, overall BSMS of 144.3% respectively. Bulawayo supplied 98.3% of the blood demanded with an overall BSMS of 99.1%. Mutare supplied 97.8% with a BSMS of 180.1% and Harare 85.6% and a BSMS of 78.0%. There were monthly variations but the Service could supply above 90% of the blood demand. In the Month of May the Service met 91.6% of the demand and a BSMS of 87.8%. In November and December it supplied 92.6%, BSMS of 100.8% and 92.8%, BSMS 131.8% respectively. August also had a below average supply of 93%, BSMS -98.2%. June, October and September recorded above the average values; 97.3%, BSMS of 126.8% and 98.7%, with a BSMS of 117.2% respectively. Summary/Conclusions: The overall BSMS performance was satisfactory and it was noted that branches capacitated according to demand. The new interactive analytics approach is appropriate for showing the blood bank status and assessing the performance of the branches. This new approach has optimized the decision-making process in blood supply management. The metrics are tracked using excel based model hence this approach is suitable for resource constrained settings with limited ICT infrastructure . St Vincent's Hospital Melbourne (SVHM), a tertiary hospital supporting medicine, surgery and non-major trauma emergency and ITU services implemented a MTP in 2008. Subsequent MTP reassessment has led to implementation of regular multi-disciplinary review of all MTs to identify areas for improvement in transfusion and other aspects of support for critically bleeding patients. Aims: To implement a systematic service-wide stakeholder review of MT events at SVHM aiming to identify deficiencies and implement improvements in MT management. Methods: A multi-disciplinary MT review team was established as a subcommittee of the hospital Transfusion Committee (TC) to update the organisational MTP in 2016 and subsequently continued to meet quarterly as the MT review subcommittee (MTRS) of the TC, systematically reviewing all aspects of MTs at SVHM. Instances where 4 or more red cell units are transfused in <4 h are identified from the laboratory information system and reviewed by the MTRS which includes representatives from Accident and Emergency, Intensive Care, Operating Suite (OS) and Transfusion Laboratory staff; the Head of the patient's treating unit is also invited to contribute. Reviews include: demographics, clinical details, comorbidities, time from patient arrival to pre-transfusion specimen collection/receipt, time from blood request to release/transfusion, regularity of full blood examination (FBE)/coagulation (coag) testing, timing of blood component transfusion, total component provision/ratios, component waste, patient outcome, and communication between various clinical areas and also the laboratory. A discussion summary with actions/ recommendations is provided to the TC and some cases referred to the hospital Mortality/Clinical Review Committee. Results: Cases reviewed: 65 from 10 treating units including Cardiothoracic surgery (18) Hepatobiliary/Gastrointestinal/Colorectal surgery (24), Vascular surgery (6), Neurosurgery (4), Orthopaedic surgery (3), Endocrine (2) and "other" (encompassing General Surgery, Urology, General Medicine and Oncology -8).

Areas for monitoring/improvement identified: transfusion documentation, regularity of FBE/coag specimen submission, reducing time between patient arrival and specimen collection, reducing specimen transport time, interfacing point of care bloodgas analysers to the central pathology result management system as well as component management/waste reduction and the introduction of viscoelastometry assessment in the OS. 18 of 65 reviewed cases involved the transfusion of emergency uncrossmatched O RhD negative red cell units. The appropriateness of the use of this precious resource is also reviewed by the MTRS. Summary/Conclusions: The SVHM MTRS meets regularly to review MT events and formalise multidisciplinary collaboration in identifying possible improvements to support these often critically ill patients. Matters highlighted include communication issues, delays in specimen delivery and blood component waste minimisation. Areas for further work include minimising delay between MT events and review, and formalisation of key performance indicators for MTs. Background: The use of Radio Frequency Identification (RFID) technology to manage the blood supply chain is recognized as a major enhancement to the operations of Blood Banks and Hospital Transfusion services. To facilitate optimal blood supply management, it is crucial to guarantee the integrity of RFID tags throughout the transfusion chain. Since RFID tags can be affixed to blood products very early in the process, these tags undergo the same process-steps as the blood products themselves (e.g. centrifugation, label printing, shock-freezing and irradiation). Aims: The goal of this study was to validate the mechanical and functional resistance of Biolog-id RFID tags through different blood related processes: centrifugation, label printing, shock-freezing, intensive reading at À40°C, and irradiation. Biolog-id tags are passive HF (13.56 MHz) tags. They are compliant with IS0 15693, ISO 18000-3 and follow the Guidelines for the Use of RFID Technology in Transfusion Medicine (Vox Sanguinis, 2010). Methods: Biolog-id tags were evaluated using a series of RFID encoding and reading tests. Before each of the processing steps, each tag was encoded with Donation Number, Site ID, Product Code, Blood Group and Expiry Date. The data was encoded using the ISBT 128 format. The different processing steps and conditions tested were: -Centrifugation: Quintuple whole blood bags, filled with 450 ml water. Centrifugation at 4,500 rpm for 10 min. 270 tags processed, 15 tags per kit affixed at different positions. -Shock-Freezing at À80°C: Shock-freezer (Angelantoni, SF40), 50 units processed, reading immediately after removal from shock freezer. water, 30 tags irradiated at 30 Gy and 30 tags at 50 Gy Results: All Biolog-id tags were encoded and read with a 100% success rate in all series of tests. Summary/Conclusions: Biolog-id RFID tags can be encoded and read through common processes used throughout the blood transfusion chain. Their mechanical and functional integrity is not affected by centrifugation, shock-freezing, intensive reading at À40°C, printing, ETO sterilization and irradiation. Background: The provisioning of compatible red blood cells by international cooperation is presented. The units were meant for an 18-year old female, with homozygous sickle cell disease (SCD) and multiple complications. Patients' blood group was A positive with anti-C, -e, -Wr a and an antibody to a high prevalence antigen in the Rh system, anti-hr B possibly combined with anti-Hr B (Rh34). The antibody was not reactive with Rh null , -D-or Hr B negative cells. The donor center put out an international request for group A or O, Rh null or -D-units lacking Wr a and possibly K, Fy a , Jk a , Wr a , Do a and S (the latter antigens for prophylactic matching). The patient sample had been genotyped for RHD and RHCE using MLPA and Sanger Sequencing and the patient was found to carry RHD*01/RHD*03N.01 and RHCE*ceVS.01/ RHCE*ceVS.03. Aims: The request was sent to the American Rare Donor Program (ARDP). The ARDP working with the American Red Cross National Molecular Laboratory, used the RH genotype information to identify donors carrying the same or similar RH variant alleles using the RH allele matching approach described previously (Keller et al. Transfusion 2013 53(2S):174A). Methods: A recent blood sample was used to confirm anti-hr B ; no anti-Hr B was detected. The patient RHD and RHCE alleles were used to build Punnett squares for both genes with donors carrying the same and similar alleles that would be predicted to be compatible. Tier 1 donors are those predicted to carry the same combination of RHD and RHCE alleles as the patient. Tier 2 donors are those predicted to be homozygous for one of the allele combinations carried by the patient. Tier 3 donors are those predicted to carry alleles similar (but not identical) to those carried by the patient, with similar predicted phenotype. The database of donors in the ARDP carrying RH variant alleles was queried against the alleles in the patient-specific Punnett Square. Results: Donors of group A or O and matched for RH alleles were identified as follows: 102 Tier 1, 357 Tier 2 and 100 tier 3 donors. After the clinical team agreed to drop one or more of the prophylactic antigen matches, one tier 2 unit lacking S and Jk a was identified at the American Red Cross. While the request was being processed, the patient experienced a sickle cell crisis, red cell aplasia and recurrent AIHA and her hemoglobin level dropped from 7 to 1.9 g/dL. At that time, she was transfused the only compatible units available -2 of the rare -Dphenotype and her Hb increased to 3.8 g/dL and eventually to 7 g/dL. The Tier 2 RH allele matched unit was shipped to Amsterdam where it was frozen, and reserved for the transfusion care of this patient. Summary/Conclusions: This case illustrates how RH allele matched blood can be found for a highly Rh alloimmunized patient, and can avoid use of the exquisitely rare -D-or Rh null blood. Background: Blood transfusion has been a complicated and high-risky clinical procedure. Any error could cause serious injuries to patients. To better assure the procedure safety. Aims: We enhanced and built a blood transfusion database platform and develop inventory management strategies to better guarantee the patient transfusion safety. Methods: We designed six new features of the platform (1) assuring the patient identification with barcode techniques; (2) designing a structured order entry; (3) proactively reminding the physicians with patient's previous blood transfusion reaction with related precautions including the use of leukoreduction filter; (4) automatically reminding physicians the happening of reaction and suggesting relevant test; (5) building a complete traceability log system; and (6) supporting data analysis. The blood transfusion safety team includes medical technologists, nurses, physicians, system analysts, and blood transporter and the whole process is electronic management.

The new blood transfusion platform integrated the workflow, reduced the incidence of abnormal blood samples collected (0% after implementation, P < 0.01), reduced the time of call for medical technologists with blood component preparation and improved the achievement rate of emergency 30-min blood crossmatch (98.1% after implementation, P < 0.05). The barcode correctly identified patients and monitored the entire transfusion process to reduce the error rate of blood component supply (0% after implementation, P < 0.01). Summary/Conclusions: After the Transdisciplinary Team Approach with E-monitoring and a better design of clinical decision support module with barcode technology, blood transfusion database platform improve the blood supply efficiency and assure blood transfusion safety. Background: In the modern world, terrorist acts are characterized by a multiplicity of combined injuries to a large number of victims. Qualified medical care is urgently required for a large number of patients in one locality at the same time. It leads to increase in emergency demand for blood components, mostly red blood cells. The desire to donate blood to the victims is a natural manifestation of society's solidarity in response to tragic events. However, donor activity and patient needs do not always correlate. Aims: To analyze the donor activity during the terrorist attacks. Methods: A retrospective analysis of donation activity in periods of terrorist attacks in Moscow (2004 Moscow ( -2011 . The average daily blood donations' number (DBDN) before TA compared with the number of donations in day after TA and with the DBDN during 7 days after TA. Also the number of delivered RBC units (D-RBCU) daily before TA and daily in 7 days after were compared. Results: In 2004-2011, 5 terrible TA occurred in Moscow: 141 people died and more than 629 were injured. With the explosion in subway in 02/2004 42 people died, 250 were injured. The number of D-RBCUs increased by 10% on TA-day, and by 30% during next 7 days. DBDN in the 1st day after TA increased 6,7 times, and in the next 7 days -1,6 times. Second explosion in subway in 08/2004 resulted in 10 died, 50 injured. The number of D-RBCUs increased by 80% on TA-day, and by 0% during 7 days. DBDN in the 1st day after TA increased 1,1 times, and in the next 7 days -2,2 times. In 2006 (explosion on market) resulted in 14 died, 61 injured. D-RBCUs delivery increased by 20% on TA-day, and by 10% during 7 days. DBDN in the 1st day increased 2,0 times, but decreased to 0,6 times during the next week. With subway explosion in 2010 40 people died, 88 were injured. The number of D-RBCUs increased by 10% on TA-day, and by 0% during 7 days. DBDN in the 1st day after TA increased 6,5 times, and in the next 7 days -1,6 times. With the explosion in airport in 2011 35 people died, 180 were injured. RBCUs delivery increased by 50% on TA-day, and by 40% during next 7 days. DBDN in the 1st day after TA increased 6,1 times, and in the next 7 days -2,0 times. Summary/Conclusions: An increase in donor activity is observed already the next day after TA and usually lasts for 7 days, but does not correlate with the number of victims. The RBCs' delivery from blood bank increases in all cases on the day of the TA. Therefore, the guarantee for patients is the maintenance of RBCs' stock, including cryopreserved ones. It is also necessary to promptly send excess of red blood cells harvested at the peak of activity to the cryobank. Background: Rh system is the major blood group system besides ABO system. Even after proper blood grouping and cross matching there is a possibility of alloimmunisation in recipients against the Rh or minor blood group antigens like Kell, MNSs, Duffy etc. In medical colleges which cannot bear the financial burden of complete Phenotyping of patient and donor, implementation of Rh & Kell phenotypes match blood transfusion can play a major role in preventing alloimmunisation and adverse events in multitransfusion patients Aims: To evaluate the efficacy of Rh & Kell phenotyping as a cost effective measure instead of extended phenotyping in multitransfused patients Methods: Study was carried out in the Department of Transfusion Medicine, one of the biggest blood bank of the country with annual collection of 70,000 blood units. 2000 patients of thalassemia, aplastic anemia and leukemia were taken who required multiple transfusions. Complete Phenotyping was done initially of all the patients before transfusion. 1000 patients were taken as control and the other 1000 were taken as cases. 2482 Blood units of healthy donors were chosen (2442 were males and 40 were females). In all the donor units, identification of Rh & Kell Phenotyping was done by the antigen antibody agglutination test by the Erythrocyte Magnetize Technology on fully automated Immunohaematology analyzer Qwalys. These blood units were transfused to 1000 patients who had been selected as cases. In the control group, patients were transfused blood units which were not phenotyped for Rh & Kell but gel crossmatching was done. Follow-up was done on these patients for transfusion reactions and at the end of six months they were evaluated for any alloimmunisation. Results: At the end of 6 months, no reactions were reported in cases receiving Rh & Kell phenotype blood and no alloimmunisation was seen on repeat phenotyping. The control group on the other hand reported reactions in 5 cases (0.5%) and phenotype at the end of three months showed alloimmunisation with 'E' antibody. The phenotypic frequencies of Rh & Kell blood groups in the population were comparable with other published studies. Amongst the Rh antigens (e) was the most common (99.44%) followed by D (95.45%), C (89.65%), c (53.1%) and E (17.65%). Thus 'e' was the most common and E was the least common of all the Rh types. Background: The prevalence of a particular blood group has an uneven distribution in different geographic areas and is largely determined by the national composition of the population. Moscow is one of the largest city of Europe with population of 12.5 million. The understanding of prevalence of red blood cells antigens (RBC-Ag) among the population has great importance for blood banking planning. Aims: To determine frequency and distribution patterns of transfusion-significant RBC-Ag among donors in the Moscow region. Methods: The results of immunohematological studies on AB0, Rhesus and Kell systems were analyzed retrospectively in 352362 blood donors for 14 years (2004) (2005) (2006) (2007) (2008) (2009) (2010) (2011) (2012) (2013) (2014) (2015) (2016) (2017) (2018) in Moscow. Data collection and processing was carried out using the regional information system for transfusiology. RBC-Ag detection (AB0, Rh, Kell) systems was performed using microplate method (automatic immunohematological analyzer "Galileo Neo" (Immucor, Inc., USA)) and "IH-1000" (Bio-Rad Laboratories, USA) with diagnostic cards. Results: The most frequent blood group is A (II) 35.8%, 0 (I) blood group 34.3%, B (III) 21.3%, AB (IV) 8.6% (n = 352362). Rh(D+) was established as positive in the presence of antigen D and as Rh(D-) negative in its absence. Donors with weak variants of antigen D (Du) were determined as Rh (D+) positive. The ratio of Rh (D+) and Rh (D-) was 82.8% and 17.2%, respectively. Donor's phenotype detection was routinely conducted from the 2013 year, therefore the number of donors was 152883. The most common phenotype among donors CcDee (32.61%), the second in frequency CCDee (19.33%), the third in frequency rhesus negative phenotype ccddee (15.42%) in the studied population. The CcDEe and ccDEe phenotypes were 14.04% and 12.17%, respectively. The most rare are ccDEE (2.65%), ccDee (1.86%), Ccddee (1.54%). Other options: ccddEe, CCDEe, CcDEE, CCddee, CcddEe, CCDEE, CCddEe were detected in single cases and amounted to a total of 0.37% (n = 152883). Cw antigen was tested in 104230 donors and was detected in 5.28%. Cw is most commonly found in donors with CCDDee phenotypes (2.36%), CcDee (2.03%) and CcDEe (0.79%), with other variants of the data phenotype, the antigen was detected in 0.1% of the examined (n = 104230). Antigen K was detected in 6.8% of donors, in 93.2% of this antigen is absent (n = 352362). Summary/Conclusions: The study of transfusion-relevant antigens distribution in population is necessary for building of effective and flexible model for blood service managing. A differentiated approach in choosing a strategy to form a long-term bank for storing blood components, taking into account the frequency of various antigen variants, contributes to improving the quality, accessibility and safety of medical care.

of dislocated division of our Blood establishment in Orthopaedic hospital Valdoltra (OBV) in 2014 the number of outdated units at the hospital side dropped considerably. Results: Since 2008 when the issued number of red blood cell units (RBC) was 5170 the amount of issued units rose to 5678 in 2011 and then dropped more or less steadily to 4850 in 2018. In this period the hospitals' programmes rose for 10% in all areas. Number of donated units declined from 6330 in 2011 to 4820 in 2018. After reorganization in 2009 the number of outdated units fell from 3% of stocked units to 1.5%. After setting a dislocated unit of CTDIZ on OBV location the number of discarded RBC fell from 397 to 41 in 2018. For transfusion specialist who is constantly in contact with the clinician in the hospital the most important day routine is when the stock availability is displayed. It happens 4 times a day; at 10 a.m. when the previews' day collection is released and another three times a day when the updates occur. The central base is led in Ljubljana (the capital) and all centres are able to control and order the stock for the blood banking. Blood wastage remained low and the traceability of the blood usage in south-western region remains high (99%). Though it is not supported by an informational system the traceability form the blood bank to the patient is done on paper. This issue demands a big effort by the staff in blood bank and in hospitals. Summary/Conclusions: Reorganization enabled better stock utilization and traceability of issued units. Sometimes it is impossible to predict the peak demand of RBC especially during the summer season when the population of the area doubles and car accidents as well. Transfusion specialist's effort in assuring the optimal blood stock represents the crucial daily routine.

Blood Bank, Grande International Hospital, Kathmandu, Nepal

Background: Voluntary non-remunerated blood donor consists of 78% blood donor's population in Nepal. Therefore demographic about the distribution of blood donors according to the age group is important to achieve 100% Voluntary nonremunerated blood donors in Nepal. Aims: To explore the demographic distribution of the blood donor in different age group in the Kathmandu Nepal.

Methods: This is retrospective study conducted at Nepal Red Cross Society Central Blood Transfusion Service. Data from January 2013 to January 2017 were collected from donor management software. The data includes socio demographic data. Data has been process with SPSS version -17 Results: During 4 years study period, total of 276,290 Blood donation happened from both mobile blood collection and in-house blood collection. Out of 276,290 Collection, 48351 (17.5%) are from 18-24 age group; 106924 (38.7%) are from 25-31 age group 53324 (19.3%) are from 32-38 age group; 34536 (12.5%) are from group 39-45 age group; 23761 (8.6%) are from age group 46-52 and 9394 (3.4%) from age group above 53 respectively. Summary/Conclusions: The distribution of ABO blood group varies regionally and from one population to another. In Kathmandu, Nepal 18-38 years age group is the most common age group encountered donating blood. The data generated in the present study and several other studies of different geographical region of India will be useful to health planners and future health challenges in the region. Background: The Information System on Hemovigilance SIHEVI-INS©, coordinated by the National Health Institute was available in 2018 to all blood banks in the country. This software allows to centralize and record the identification data of a donor, its infectious and immunohematological tests, as well as the fractionation and final destination of each blood component obtained from a donor. Aims: To describe the ABO and RhD typing discrepancies in blood donors found in the blood group variables registered by each blood bank to SIHEVI-INS©. Methods: Retrospective analysis of the information registered by 80 of the 81 blood banks authorized nationwide between January and December 2018. Results: SIHEVI-INS© received information of 854,462 accepted donors, 33% of them with more than one donation in the same blood bank in a period of 12 months. A total of 72 ABO or RhD discrepancies were identified in 69 people, who made donations in 20 blood banks (estimated risk: one discrepancy per 11,876 accepted donors). Five of the blood banks implicated in these discrepancies are hospital-based (annual average collection of 6,086 AE 3,785 units, representing 3.6% of the national collect). The remaining blood banks are distributors (average collection: 31,389 AE 25,704 units per year, representing 44% of the national collect). 75% of blood group typing discrepancies (n = 36) were related to the ABO group. The most common discrepancy was between A typing group and AB typing group (67%) . In 25% of the cases, the same blood bank initially registered in the same donor, an O blood type donation and later an A blood type (n = 10) or B type (n = 4). RhD typing discrepancies account for 25% (n = 18) of the total. Additionally, in three donors, a simultaneous discrepancy between ABO and RhD typing was detected in the same blood bank. The results could be due to: a) failure in the warning mechanism before the release of the blood component; b) errors in typing the information of the donor registered in the system or c) failures in the identification of the donors at the time of selection. The above shows risk in the process of control of blood components release, which can impact patient safety unless ABO and RhD typing blood groups are systematically verified before transfusion. Summary/Conclusions: Despite blood banks have a verification and validation process through software to release blood components, flaws were detected. Although SIHEVI-INS© is not a software to validate the information before the release of blood components, it was through this program that ABO and RhD typing discrepancies were identified in donors who attended the same blood bank multiple times. This finding implies increasing the controls that should be used in each blood bank, to avoid lose traceability of the processes and to put at risk the life of the recipients.

Blood donor testing department, Blood transfusion institute of Nis, Nis, Serbia Background: The ability to automate blood grouping and antibody detection procedures is a requirement for blood donor testing laboratories. Mistakes in the sample identification and testing procedures could be prevented by testing on automated immuno-hematology systems. Irregular antibody screening and ABO/RhD grouping of blood donors are tests performed routinely in Blood transfusion institute of Nis. NEO Iris (Immucor, USA) is a fully automated instrument for the ABO and Rh D grouping using microplate hemagglutination technique and antibody screening and identification using Solid Phase Red Cell Adherence (SPRCA). Aims: Evaluation of the automated NEO Iris system for ABO and D grouping and irregular antibody screening of blood donors in Blood transfusion institute of Nis. Methods: During the evaluation period a total of 4417 EDTA-anticoagulated samples for ABO and D forward and reverse grouping using microplate anti-s, 1 anti-S, 1 anti-Jka and 6 anti-K. In one case IH-1000 failed to identify anti-C antibody in very low titer in sample with anti C+D antibody presence. In two samples (0.045%) false-positive result were observed both on IH-1000 system and NEO Iris and in two cases (0.09%)only on Neo Iris due to nonspecific reasons. Summary/Conclusions: ABO/RhD grouping results obtained on NEO Iris system, using microplate method, have a good correlation with results on IH-1000 system as our routine column agglutination method. For antibody screening and identification NEO Iris showed high sensitivity for detection of clinically significant antibodies which is important step for increasing blood transfusion safety. Background: Continuing improvement of laboratory quality to provide accuracy test results for precise diagnosis and treatment is the mission of advanced laboratory. Immunogenetic testing for Histocompatibility including human leukocyte antigen (HLA) typing, HLA antibody detection and Cytotoxicity test is critical for diagnosis and evaluation of transplantation and prognosis monitoring. In order to improve the quality of experiment competency, an external quality assurance schemes with review and education per year program was established and performed during the period from 2017 to 2018 in Taiwan. Aims: The proficiency testing (PT) held semiannually from 2017 to 2018 were reviewed to investigate the outcome of competency improvement of laboratories participated in the program. Methods: The Test items in the exercises were classified into 4 groups, HLA genotyping (including pharmacogenetics HLA typing), Cytotoxicity test, HLA and Platelet antibody. The methods of HLA genotyping include SSP (Sequence Specific Primer), SSO (Sequence Specific Oligonucleotide), SBT (Sequence Based Typing) and either SSP+SSO or SSP+SBT were used, the methods of HLA antibody including ELISA, flow cytometry and Luminex were used and the methods of Platelet antibody including SPRCA and Elisa were used. There are four shipments of exercise materials in two years and each shipment include two positive and one negative samples for antibody detection, two each of whole blood and serum for cytotoxicity of T and B cell and three whole blood for HLA genotyping. Aims: This study aims to survey transfusion related laboratory tests for the quality improvement of hospital's blood bank management. Methods: We analyzed survey results of 11 kinds of routine work categories of 841 blood banks that were registered on Korean association of external quality assessment service. Blood bank worker voluntarily replied this electronic survey. The 11 categories were as follows: 1. Characteristics of institution 2. The equipment of blood bank 3. The kinds of tube in blood bank 4. The present kinds of blood bank tests 5. ABO and Rh type tests 6. The cross-match tests 7. The irregular antibody tests 8. Hemovigilance system 9. Other blood bank tests 10. Massive transfusion protocol 11. Quality control issues We analyzed and compared each category data according to considering characteristics of hospitals. Results: There were consensus and some differences of current blood bank tests. We presents the result of a pilot survey. Especially the cross-match tests were divided by saline phase method added with irregular antibody tests or completion of 3rd step anti-human globulin phase according to institutional environment. Automated typing machines or automated irregular antibody test devices were more increased in large-scale hospitals than small-scale hospitals. Different kinds of tubes were used such as EDTA tube for ABO and Rh typing, plain tube for cross-match test. The retention segments of RBC were reserved for minimum 7 days. Most blood bank were registered and regularly listed up transfusion events to Korean hemovigilance system for safety transfusion. Also, a lot of institution have none or underdeveloped massive transfusion protocol. More specific survey results will be analyzed in further poster presentation. Summary/Conclusions: This survey will show the current status of transfusion related blood bank test. This institutional blood bank comparison will be helpful to assess the currency of individual blood bank environments.

Abstract withdrawn. Background: We know that quality management is a continuous process, involving implementation, maintenance and improvement. Aims: Our purpose is to show our experience in implementing the quality management system in the whole institution and our first steps in achieving the JACIE accreditation in the Stem Cell Collection Facility in order to provide our patients and donors the best possible care. Methods: The Institute for Transfusion Medicine of the Republic of Macedonia (ITM) is the main institution in charge of Blood Transfusion Service (BTS) in the whole country, which is the national unified system. The Stem Cell Collection Facility is a part of the ITM. This Facility is operational since 2001 year with 844 collections of stem cells (686 in patients and 159 collections in sibling donors) till now. We are obtaining the implementation and maintenance of QMS through the establishing of the ISO standardization for the whole institution (ITM), as well as of implementing JACIE standards in the Stem Cell Collection Facility. The two of our colleagues became the JACIE Inspectors and the standard operating procedures (SOPs) were developed, followed by regular meetings, trainings and self-evaluation of the personnel. We asked for the orientation visit from the independent JACIE inspector in order to come one step closer to the JACIE accreditation and to improve our overall QMS. Results: The Institute for Transfusion Medicine of RM was a part of the IPA project "Strengthening the Blood Supply System". This project aimed to ultimately bring the Blood Transfusion Service to European Union standards allowing the exchange of blood components and all other types of collaboration with other European Union countries in future. The project put the basis for unification of blood transfusion standards and operating procedures in the whole country as well as set up essential education of blood transfusion personnel. Although a lot of strengths were found during the orientation visit from JACIE inspector, there are still a lot of areas for improvement. Our strengths are motivated team and supportive institutional leadership including Macedonian Ministry of Health. Areas for improvement are: labeling of cellular therapy products and lack of laboratory for quality control. There is a national regulatory framework in place and WHO and World Bank initiatives in Macedonia which support quality in health care and accreditation. Summary/Conclusions: Our institution has in plan to implement ISBT 128 standards for labeling of cellular therapy products and to establish a laboratory for quality control of cellular therapy, as well as to meet all the requirements to become JACIE accredited facility. Working by standards, following the rules and regular self-evaluations will help us to maintain the strong quality management system. Every institution will benefit from a quality management system that brings you into line with international standards. Ensuring the quality of our services and products is essential to keep safe and strong blood transfusion service. Background: Implementation of robust quality assurance program is key to high performing blood establishments. Quality control and quality assurance systems together constitute the key quality systems and are parts of quality management. Effective and efficient quality control policies not only provide guidance that help to increase the reliability of results but also maintains the laboratory's consistence performance overtime. Aims: Therefore, we established a set of QC limit using historical data which can timely identify unexpected variation in the testing systems and trigger a review of test processes in blood screening laboratories as part of quality assurance system. Methods: Last two consecutive years (Jan, 2017 to Dec, 2018) QC data from ARCHI-TECT i2000SR (Abbott Laboratories, Chicago) was extracted using AbbottLink for Philippines Red Cross Tower National Blood Center Total of 6532 data points (3523 data points in 2017 & 3009 data points in 2018) were obtained for 10 different QC levels for four serological blood screening assays (HIV combo, HBsAg, anti-HCV, Syphilis). The data was sorted for each assay/Lot and QC level combination by year. QC limits were calculated using simple mean, standard deviation (SD) and coefficient of variation (CV%) and were validated and compared with manufacturer's recommendation. Results: All the six positive quality control levels CV% (5.70-12.05) were within manufacturer's precision recommendation (within lab precision HBsAg ≤ 10%, Anti-HCV ≤ 15%, Syphilis ≤ 15%, HIV ≤ 14%) in 2018. Five out of six positive quality control levels CV% (5.72-15.80) showed within manufacturer's precision recommendation (within lab precision HBsAg ≤ 10%, Anti-HCV ≤ 15%, Syphilis ≤ 15%, HIV ≤ 14%) in 2017 except Syphilis TP positive control (15.8%). All four negative quality control levels showed the SD values within 0.009-0.41 in 2017 and 0.009-0.41 in 2018 respectively. Summary/Conclusions: Excellent QC performance was observed in Philippines Red Cross Tower National Blood Center blood screening laboratory based on historical data and evidence-based laboratory QC limit for blood screening assays were established using historical data which takes into account total variation expected in a test system and offers a more robust and meaningful mechanism for setting control limits, for the first time. Background: Quality Indicators (QI) in Transfusion Medicine (TM) are 'Critically important aspects of Transfusion Medicine practice that are measured and utilized to gain insight for continuous quality improvement, into the degree to which the TM is capable of providing quality TM care, products or services for the aspect of practice measured following comparison of the measurement against acceptable local or international reference thresholds, benchmarks, standards, or practice guidelines'. The critical control point (CCP) selected for this study is 'Administration techniques and monitoring of key elements'. This has been selected since the clinical fraternity plays a larger role in ensuring quality services in administration of blood components. There was a need to follow up compliance to standard protocol for bedside transfusion practices hence was decided to study the same with four selected quality indicators and introduce corrective measures if necessary. Aims: 1. To assess the existing transfusion practices in the institute with specific quality indicators 2. To introduce corrective reforms to improve the existing practice 3. To assess the transfusion practices after interventions using the same quality indicators Methods: To assess the existing transfusion practices in our centre, 295 transfusions were prospectively followed up with a structured checklist. The quality indicators used were (i) Verification of blood components prior to transfusion (ii)Initiation of transfusion within 30 min of release from the blood bank (iii) Close observation of transfusions for the first 15 min (iv)Completion of transfusion within the right time frame for each component. As a corrective measure, a Transfusion monitoring format was designed which was distributed in every ward and the nursing officers were informed to monitor and document transfusions using that. In addition, the blood bank staff was made to call up the wards and ensure that the transfusions of every component had been initiated within 30 min of issue. Transfusion practices were once again monitored by following up 306 transfusions using the same quality indicators. Results: There was significant difference in all the four variables between the two phases. 57.3% transfusions were verified in Phase I while 73.6% were verified in Phase II (P < 0.001). 69.5% transfusions were started within half an hour of issue while in the second phase, it rose to 83.1% (P < 0.001). 47.8% transfusions were observed in the first 15 min in Phase I and 88.6% were observed in the second phase (P < 0.001). In Phase I, 54.6% transfusions were completed within right time while the same in Phase II was 73.9% (P < 0.001). Summary/Conclusions: We recommend the following as quality indicators for bedside transfusion practices: Background: Antibody titration consists in performing antibody detection with selected red cells of different sample dilutions. The titer is reported as the reciprocal of the highest dilution that induces macroscopic agglutination. The usual applications of titration are prenatal studies and complex antibodies identification. Some publications have demonstrated that more variation in antibody titer and titration score are noted upon repeat testing of the same sample when testing was performed in tubes as compared to repeat testing in gel. Aims: To evaluate the efficacy of automated antibody titration versus manual method by using gel microcolumn technology.

Methods: EDTA-anticoagulated whole blood donors' and plasma frozen samples containing a known irregular (Rh, Kidd, Duffy, MNS, etc.) and regular (A1 & B) antibodies were selected. The titers of 126 samples were determined in parallel by using Grifols analyzers (Erytra and Erytra Eflexis) and compared versus Grifols Gel manual method by using Grifols Gel microcolumn technology and Grifols red blood cell reagents. Sixty of these also processed in parallel in Erytra and Erytra Eflexis analyzers for comparison. For the precision study, 12 of these samples were tested in the 2 automated systems for 5 times (120 datapoints for each analyzer) on different testing days. The hands-on (manual intervention) average time required to complete a titration was measured (3 expert technicians) in 2 different sample workload (1 and 10 samples testing). These results were compared with the same number of independent titrations performed in Grifols analyzers. For the walk-away time, 2 different sample workload (1 and 10 samples testing) were assessed in manual method (3 expert technicians) and compared to timings obtained when reproduced in Grifols analyzers. Results provided by analyzers were reviewed and compared to manual method. Results: Titer obtained by Erytra or Erytra Eflexis was equivalent to the titer obtained manually (differences ≤ 1 titer: 73% ≤0.5 titer). The results proved that both instruments were equivalent in performing titration (differences ≤ 1 titer; 85% ≤0.5 titer). The precision results showed no difference between titers obtained through the 100% of the runs performed with the Grifols analyzers (differences ≤ 1 titer: 75% ≤0.5 titer). The manual hands-on in automated system was reduced in a 15% compared to manual method for 1 sample. When the number of samples was increased (10 samples), the difference in hands-on in was even more reduced (65%).

In addition, the walk-away was 46% higher in automated system compared to manual method. Furthermore, when the number of samples was increased (10 samples), the walk-away difference was increased even more (78%). Finally, automated system software demonstrated to increase the standardization of the test as all samples, results and reagents traceability were automatically managed. Summary/Conclusions: Grifols Gel System including Erytra and Erytra Eflexis analyzers provided a scalable and efficient solution to perform standardized titrations in the immunohematology lab. The study proved that using Grifols Gel System, titrations can be run in an automated reliable way (less than one-fold differences versus manual gel), thus reducing at least 15% the hands-on, increasing at least 46% the walk-away, rising the standardization and automating all testing traceability. , and fourth case of use (Results) scenarios, tasks were considered "very easy" by 30%>50% of users and "easy" and by 50-80% of users; 90%>100% of the users considered "sufficient" the design to ease the interaction; and 60%>80% of users never founding any situation of not knowing how to proceed. For the fifth case of use (User roles), 40% of users considered tasks "very easy" or "easy"; 40% of users considered "sufficient" the design to ease the interaction; and 40% of users never found any situation of not knowing how to proceed. For the sixth case of use (Maintenance Plan), 100% of users considered tasks considered "very easy" or "easy"; 90% of users never found any situation of not knowing how to proceed; and 100% of users considered the maintenance Plan similar or better than other instruments. Reliability analysis ( Background: Quality control procedures in blood group serology for reagents, techniques, personnel working and automated equipment are essential for the accuracy of the laboratory results. The observation of high number of uninterpreted results during blood donor grouping was a motive for investigation and possible targeting the problem. Aims: To identify blood group interpretation problems by analyzing the testing results obtained with the commercial quality control samples routinely used during blood grouping. Methods: A microplate (MP) system for performing ABO and RhD, as well as Rh phenotype and Kell blood group determination with two automated analyzers Techno (1 and 2) and correspondent two MP-readers Lyra (1 and 2) using Maestro software from DiaMed is currently in use for blood donor typing. Three types of MP are being used such as: A, B, AB, DVI-, DVI+, ctl/A1, B profile for first time donors, then A, B, D ctl for repeat donors and finally, the C, c, E, e, K, ctl profile. The accuracy and safety of the blood grouping results is ensured by using the DiaMed Q.C. System which consists of 4 + 2 tubes of whole blood and 2 tubes containing serum with known specific antibodies. We analyzed and compared the interpretation of the Q.C. whole blood samples' results from both of the analyzers after a new optic camera was installed on the Techno 1/Lyra 1 system. Ward to Ward. Methods: A prospective observational pilot study was done for around 140 PRBC unit issues which were followed in real time for understanding the TAT within blood bank & from ward to ward. As per the definitions, the areas where the times are documented perfectly are understood and considered for calculations. Based on the conclusions of pilot study a monitoring form has been designed and utilised to monitor the TAT within BB & WTW. The data is analysed monthly and an avg TAT for BB & WTW is calculated. The common causes of delay in providing the blood components were analysed and strengthened to both reduce & control the TAT. Results: In pilot study, total WTW TAT averaged to 90 min, with highest time taken 795 min, where there were additional processings like leukodepletion, irradiation, Saline washing of red cells and holding the transfusion. Lowest WTW TAT was found to be 10 min where there was a prior information for crossmatch. After the surveillance form has been started, the average time taken for WTW TAT came down to 70 min, maximum being 310 min (Jan 2019), The areas where delay happened were identified as internal courier delays, Technician delays, billing & other logistics delay. The concerned staff are put on regular training to maintain the TAT. Summary/Conclusions: Although ethically all the staff work for providing better care for patients, there will be few areas that delay the life supporting blood transfusion. Monitoring using TAT surveillance forms help in avoiding the delays and hence provide better & timely transfusion support.

Blood donation -Blood donor recruitment P-059 HEMATOLOGICAL AND PHYSIOLOGICAL CHARACTERISTICS OF REGULAR BLOOD DONORS WITH BETA-THALASSEMIA TRAITS Background: According to recent evidence, the physiological variability observed in the hematological characteristics of regular blood donors (linked -in certain caseswith genetic factors or the donor's lifestyle) may affect red blood cell (RBC) storage lesion. Beta-thalassemia heterozygous (b-thal-het) blood donors represent a group of particular interest because of a) the high frequency of thalassemia mutations in specific geographical areas b) the physiology of the b-thal-het RBCs, which predisposes towards more effective management of storage-associated stress.

Aims: The goal of the present study was the comparative examination of the hematological and RBC physiological features of regular blood donors with or without beta-thalassemia traits before blood processing for transfusion purposes. Methods: 204 healthy blood donors of Greek origin (18-24 years old), who met the blood donation criteria were recruited in this study. Plasma/serum (uric acid, electrolytes, extracellular hemoglobin, antioxidant capacity), cellular (RBC indices) and biological parameters (corpuscular fragility, proteasomal activity etc) were measured. The results were statistically analyzed and topologically represented in biological networks for both donor groups (+/-b-thal-het). Significance was accepted at P < 0.05. Results: b-thal-het represented 9% of the donor cohort. No differences in lifestyle (smoking, alcohol consumption, physical exercise) were observed between the two groups. Nevertheless, regardless of sex and sex-dependent parameters (e.g. Hct, Hb concentration), b-thal-het demonstrated: a) reduced Hct, MCV and MCH (11% P = 0.039, 26% P = 0.008 and 30% P = 0.006, respectively) and b) increased RBC count (20%, P = 0.042) compared to the average donors. Moreover, MPV platelet index was found slightly elevated (P = 0.053) and serum total protein concentration slightly reduced (P = 0.054) in the same group. A trend for higher plasma antioxidant capacity (P = 0.052) was evident in the group of b-thal-het, in addition to statistically significant lower levels of osmotic fragility (by 13%, P = 0.022) and hemolysis (by 41%, P = 0.001) compared to controls. Finally, analysis of the three proteasome-associated enzymatic activities (N = 10 per group) in the RBC cytosol and the membrane, revealed similar levels in the two groups (P > 0.05). The b-thalhet and control biological networks showed insignificant variations in respect to the amount of connections and their hub profiles. However, differences were observed regarding the number or type of connections, or even their topology in the network, in the cluster of lipids (triglycerides, LDL etc), nitric oxide, clusterin, carbonylated plasma proteins and RBC osmotic fragility (correlated with the concentration of electrolytes selectively in b-thal-het donors) between the two groups. Summary/Conclusions: b-thal-het who meet the criteria for blood donation are a non-negligible sub-group of the total donor population in Greece. They exhibit several similarities to the general cohort, but differ in fine characteristics of RBC physiology, including resistance to hemolysis and extracellular antioxidant capacity. The differential network profile of hematological and redox parameters may be important in respect to the subsequent blood processing and storage of b-thal-het erythrocytes for transfusion purposes. Background: Blood service in Poland is based on voluntary and non-remunerated donations. Regional Blood Donor Centre in Poznan as well as other regional centres (total of 23) are the only entities authorized to collect, process, store and distribute blood and its components to hospitals in the region of their activity but they are also responsible to provide sufficient amounts of blood and its components. Regional Blood Donor Centre in Poznan is one of the largest blood centers in Poland with the total number of donations exceeding 100,000 per year. In the recent years we have observed a growing popularity of tattoos among various age groups as well as among people registering to donate blood (first time and repeat donors) hence, it is critical to introduce suitable measures to ensure the safety of blood and its components. Aims: The aim was to analyse the correlation between the increasing number of donors deferred from donating blood due to having tattoos made and the number of recorded confirmed HCV infections and the effect it may have on the safety of blood and its components. Methods: The analysis was made using the data for the years 2010-2017 obtained from the computer system 'Blood Bank' which is in operation in Regional Blood Centre in Poznan, Poland. We have analysed the total number of deferrals of donors due to recently acquired tattoo and the total number of recorded confirmed hepatitis C infections. We must note that the category of temporary deferrals due to tattoos is a broad one: it includes so called regular 'artistic' tattoos, permanent make-up procedures as well as medical tattoos. Results: We have recorded a significant increase in number of deferrals due to tattoos from 400 in 2010 to 716 in 2017 (+79%). In the group of male donors this trend remained rather stable with a slight decrease: from 181 in 2011 to 151 in 2017 (À16.6%). In the group of female donors the growth was more prominent: from 219 in 2010 to 565 in 2017 (+158%). In terms of the recorded confirmed HCV infections a downward trend can be observed: from 63 in 2010 to 16 in 2017 (À74.6%). In the group of male donors from 43 in 2019 to 12 in 2017 (À72%), in the group of female donors from 20 in 2010 to 4 in 2017 (À80%). Summary/Conclusions: As we can conclude from the analysis the applied policy of temporary deferrals of donors with recently acquired tattoos (in the last 6 months) proves to be a reliable method of increasing the safety of blood and its components. Nevertheless, the current conduct of the qualification of the donors which requires a 6 month deferral following the new tattoo must be complemented by various and numerous educational activities regarding the means of HCV transmission (and other bloodborne viruses such as HBV, HIV) and ways of protection from possible infections. Special emphasis must be put on the group of female donors as the growth of deferrals was more prominent among them. At the same time it is vital to ensure for constant availability for all donors of well designed, concise educational materials (hard copies on the premises, articles, infographics, downloadables etc. on the website). Background: A temporary deferral has a negative impact on donor retention, with many donors failing to return at the end of their deferral period. Anecdotal evidence collected by the Australian Red Cross Blood Service suggested that many donors do not know when they are eligible to return to donate, suggesting that a reminder message may be effective at promoting donor return once the deferral has ended. Aims: The aim of this study is to evaluate the effectiveness of a reminder message on the return rates of deferred donors at the end of their deferral period. This reminder message notified donors that their deferral period was ending and encouraged them to make an appointment to donate. This study also aimed to determine the most effective time to send the message, message content, and mode of communication (SMS vs email) in optimising donor retention post deferral. Methods: Three separate randomised controlled trials were conducted to answer these questions. Data on donors' attempted return behaviour and subsequent deferrals, appointments and donations made one month after the deferral end date were collected and analysed. Results: Overall, 18.3% of donors who received a reminder message attempted to return compared to 12.8% of donors in the control group (P < 0.05). Looking at each time point, donors who received the message 1 week before their deferral ended were 64% more likely to attempt to return compared to the control group (P < 0.05). The 1 week prior reminder message was particularly effective with males, with 30.3% attempting to return to donate, compared with 25.2% of females (P < 0.05). There were no significant differences in the return rates of donors who received the recipient versus non-recipient focused message, or donors who received the message via email or SMS. Summary/Conclusions: A reminder message sent to deferred donors at the end of their deferral period is a simple, cost-effective way to promote donor retention, providing clear information regarding the date on which the donors can return to donate as well as a prompt to make an appointment Background: Our challenge is to provide 100% voluntary donation for safe blood, thus taking into account the current history of family donation, promotion of blood donation, level of awareness and voluntary donations from various institutions, the opinion of 1000 interviewees will give us a clearer idea of what we want to achieve and what needs to be improved in the future. Aims: 1. Provide 100% voluntary donation for safe blood. 2. Establishing a special department within the National Blood Transfusion Center responsible for marketing and promotion of voluntary blood donation. Methods: This study was conducted as a combination of qualitative and quantitative methods. The study was a combination and identification of existing data, direct interviews with persons of different age groups, preparation and dissemination of questionnaires and analytical processing of the collected information. The study questionnaire with 60 questions in total was divided into 6 sections out of which 14 questions on blood practices were answered by all 1000 interviewees. 416 people answered 9 questions on the blood transfusion service. 5 questions on blood knowledge were answered by 270 people. 5 questions on the knowledge of the blood transfusion were answered by 220 people, 17 questions on blood donation were answered by 420 people and 10 questions on the communication channels were answered by 500 people. Results: Out of 1000 interviewees, 19% have never donated and did not intend to donate, due to the fact that most of them were afraid of needles and infections, while the smallest part didn't donate blood because it was not allowed by the religion, 40% did not donate, but expressed the readiness to donate in the future, 10% have donated voluntarily only once, 24% were family donors, 3% regular volunteer donors, and 4% have donated voluntarily several times and did not want to donate anymore. From those who have donated, 59% have donated for one of their relatives, 28% have donated for thalassemic children, 10% have donated to benefit free check-up and 3% have donated because it was valuable for their health. The question as to whether they would voluntarily donate again, 57% have answered yes, 22% no and 21% were still not sure. This means that donation of those who have donated once did not leave a positive impression, did not increase the desire to repeat the donation once again, rather it has restrained or made it unsafe for them to repeat donation. Among the causes mentioned by the interviewees were bad conditions in the donation facilities, staff behavior, inadequate treatment, they did not feel good after donation and had hematoma at the venipuncture. Summary/Conclusions: Based on the results obtained from the study, the National Blood Transfusion Center needs the establishment of a genuine promotion department where there is a need for a transfusion doctor who should be an active part of it. The National Blood Transfusion Center should build up and implement a rigorous retention policy for voluntary blood donors, as the study found out that around 60% of donors who have donated once would like to donate again. Their attraction through a donor retention policy will surely lead to self-sufficiency with safe blood. The safe blood is a public good and for this reason it is the duty of all state instances, the media and non-governmental organizations to give their support in the promotion of voluntary blood donation. Background: Smoking, unhealthy diet, sedentary behavior and inability to maintain adequate exercise have significant consequences for several chronic disorders, including obesity. A balanced and equilibrate nutrition may prevent the negative consequences associated to the status of obesity. In Italy, overweight and obesity is increasing with 3 adults of 10 overweight and 1 of 10 obese in 2017 with a higher frequency in the South. Blood centers can play a public health role in obesity surveillance and interventions. Aims: Since the quality of life, self-reported by the patient, related to health and adequate quali-quantitative nutrition, are becoming necessary and relevant in the field of nutrition, we conducted a demographic study to evaluate the health status of the blood donors by monitoring the nutritional habits and lifestyle. Methods: A descriptive cross-sectional face-to-face questionnaire was developed. It included a 41 item dietary assessment, reporting semi-quantitative food frequency, dietary behavior and questions on self-rated health status. Normal weight was established with BMI < 25 kg/m 2 , overweight with a BMI ≥ 25 and < 30 kg/m 2 , and obesity with BMI ≥ 30 kg/m 2 . Obesity prevalence was standardized by sex. Donors were repeat blood donors, who had made at least 3 donations in the last 2 years, and were eligible to donate. Results: Of the 2468 blood donors enrolled between July 2017 and January 2018, 1390 were regular repeat donors, 1102 did not wish or chose not to respond at survey for several reasons (i.e. lack of time or privacy) and 288 accepted, of which 83 were deferred from blood donation and were excluded from the analysis. Among the 205 included participants 68.3% (n = 140) were male, age ranged from 19-61 years with a mean age of 39.8 AE 11.1 SD and 31.7% (n = 65) were female age ranged from 20-62 years with a mean age of 37.7 AE 11.0 SD. Data showed that donors followed mainly a Mediterranean diet and had more awareness to lifestyle, women more than men, in comparison with general population. The prevalence of overweight was found 50.7% in men and 16.9% in women. Our survey showed that 84.4% of the participants evaluated their health as "good", without gender difference (men, 86.4% vs women, 80.0%). Besides, 14.6% reported their health as "very good". Summary/Conclusions: Overweight and obesity are common among regular blood donors and it is more frequent in men than women. Our preliminary data showed that women have a better knowledge of the nutritional properties of food and consequently adopt a more balanced and proper diet. Furthermore, it is clear that they are aware about the relationship between lifestyle and health putting into practice their information. Unfortunately, the survey structure, of observational nature, does not make it possible to establish whether women are more alert to health to participate more in donation programs or if, on the contrary, the status of regular donor could help the improvement of knowledge and healthy lifestyle. Background: Donor recruitment pose an ongoing challenge to blood banks worldwide. One approach to improve the effectiveness of donor recruitment is to target influencing factors. A yearly league is conducted at the Sultan Qaboos University (SQU) to encourage university students and faculty to donate blood. During this, the colleges are evaluated based on different measures including the number of donors recruited from each college and the efforts made by the students in increasing the awareness of blood donation in the colleges and in the society via different means including the utilization of the social media. The whole competition is organized and ran by an independent group of students. Aims: This study aims at studying the impact of the yearly SQU college competition on the perception of blood donation among SQU students. Methods: A comprehensive anonymous voluntary survey was developed and used to assess perception of students aged 18-25 attending SQU and other universities (non-SQU) over a two years' period. Analysis was performed using IBM SPSS Statistics 22.0. Categorized variables were presented in numbers with percentages and associations between the groups were analyzed using Chi-square test. A P-value of < 0.05 was considered statistically significant. Results: A total of 600 students were surveyed (300 SQU, 300 non-SQU). There was no statistical difference between SQU and non-SQU students with regard to past history of blood donation and the number of donations made. When comparing between both cohorts, 73% of the SQU and 25% of non-SQU students reported the university as the main source for information (P < 0.001), while 56% of SQU and 45% of non-SQU students reported that the social media was the main source respectively (P = 0.048). There was no statistical difference between male and female donors on their perception of level of self-knowledge on blood donation (P = 0.868). About 84% of the youth agreed that blood donation is one of the duties toward the community. SQU students reported higher rates of respond to specific requests for blood donation (44.3% vs 29.7%, P < 0.001). SQU students reported greater influence of peers (84% vs 60.7%, P < 0.001), personal knowledge (82% vs 74.7%, P = 0.029) and personal experience (79.3% vs 69%, P = 0.005) when compared to non-SQU students. They also reported more feeling of commitment to the society (90.3% vs 78%, P < 0.001). SQU students reported lower influence of parents (53% vs 65%, P = 0.005), lower rates of fear from needles (18% vs 32%, P < 0.001) and lower rates of fear from blood (16% vs 29%, P < 0.001). There was no difference between male and female genders in any of the discouraging factors. Summary/Conclusions: These results highlighted the positive impact and important rule of the youth in the promoting blood donations among themselves through this yearly college competition; in recruiting blood donors and in the dissemination of the knowledge of blood donation. Distinct promotion strategies should be adopted to increased first time and repeated blood donation among the youth. We advocate for similar initiatives in encouraging blood donation and disseminate knowledge among individuals in the community.

Dubai Blood Donation Center, Dubai Health Authority, Dubai, United Arab Emirates Background: Dubai is multicultural city in United Arab Emirates. Only about 15% of the population consists of UAE nationals with the rest comprising expatriates from various countries all over the world. Approximately 85% of the expatriate population (and 71% of the emirate's total population) are Asian, chiefly Indian (51%) and Pakistani (16%). Dubai Blood Donation centre is the only centre providing blood donation services in Dubai. Arabic is the national and official language and English is used as a second language. In order to have good quality screening, it is important that blood donors understand the educational material and questionnaire properly. Aims: Dubai Blood Donation Centre receives donors (Nationals, Residents and GCC card holders) from various countries. The aim of this study is to analyze the multinational profile of donors and to find out the need to add any third language to meet the customer needs and expectations. Methods: A cross-sectional study of blood donors was conducted in Dubai Blood Donation Centre in 2019. The donors were asked about their country of origin, languages which they can read & understand and about the preferred mode of communication.

Results: A total of 1080 donors were surveyed and asked about the languages which they can read and understand and 1860 responses were obtained. The most common languages which can be read and understood by blood donors in DBDC are English (N = 760; 41%), Arabic (N = 272; 14.6%), Hindi (N = 268; 14.4%) and Malayalam (N = 233; 12.3%). The donors come from different countries, most common 591 (54.7%) donors are Indian and 73 (6.8%) are from UAE. It was found that 45% donors can read and understand only one language. Majority 884 (81.9%) donors can read and understand either of the official languages Arabic or English. However, 196 (18.1%) donors can't read and understand these two official languages, the other common languages being Hindi and Malayalam. The donors were asked about the preferred mode of communication, 1290 responses were obtained. The most common mode of communication were SMS and Telephone (85% together). Summary/Conclusions: Based on the above findings, it can be concluded that the blood donor profile in our centre is multinational which is a unique and almost similar to the population profile of Dubai. As 18.1% donors can't read and understand Arabic and English, so it has been decided that the educational material and questionnaire need to be prepared in one more language. Hindi has been decided as the third language in the centre and donor questionnaire and educational materials in Hindi will also be made available to the donors. Further,the donors will be communicated through SMS for routine messaging and disease notification while telephonic calls will be done only when the blood is urgently required. Background: Metabolic disorders (MetDs), including hypertension, dyslipidemia, hyperglycemia, and central obesity, are tightly associated with cardiovascular diseases and type 2 diabetes mellitus. Due to the sedentary lifestyle and increased consumption of high-calorie diet in modern society, MetDs have become serious health problems worldwide. To have a better understanding and possible improvement on blood donors' health condition, we conducted a survey of the prevalence of MetDs among blood donors in a blood donation station located in the Hsinchu Science Park in Taiwan. Participants with MetDs will be provided with health education materials about metabolic risk reduction, in order to prevent the development of future complications. Aims: The aims of this study were to determine the prevalence of metabolic disorders among blood donors, and to calculate how much money would be paid to identify a case of hyperglycemia, hyperlipidemia, or undiagnosed diabetes. Methods: This study was approved by the institutional review board of Taiwan Blood Services Foundation (TBSF). The body weight, body height, waist circumference (WC) and blood pressure (BP) of participants were measured. Blood samples were obtained to determine the values of hemoglobin A1c (HbA1c) Background: The law on blood donation supports the development of the blood service and guarantees the protection of the donor's rights and the maintenance of health during blood donation in the Russian Federation. National criteria for donor selection for blood donation are used in the activities of blood service establishments and are aimed at ensuring the blood products safety. The study of the characteristics of blood donors allows to predict the development of blood service and to plan the volume of blood products for transfusion and plasma fractionation.

Aims: The aim of this work was to study the characteristics of whole blood and apheresis donors in the blood service in the Russian Federation.

Methods: Indicators of activity in the blood service establishments in the Russian Federation in sectoral statistical observations over the period 2015-2017 and the calculation of indices characterizing the whole blood and apheresis donors were analyzed. Data are presented according to the administrative division of Russian Federation into federal districts (FD).

Results: The proportion of whole blood donors was 83.7%, plasmapheresis donors -13.2%, blood cell apheresis, including plateletapheresis, donors -3.1%. For the period 2015-2017, the percentage of repeated and regular whole blood and apheresis donors increased from 66.2% to 72.2%. The percentage of first-time donors ranged from 27.8% to 33.8%. The largest proportion of plasmapheresis donors was observed in the Volga FD (22.0%). About 28.9% of the total plasma was collected by apheresis from donors. The percentage of plateletapheresis donors increased from 1.9% to 2.3%. The largest percentage of plateletapheresis donors was observed in the Central FD (2.9%), where a significant part of medical centers of cardiac surgery, hematology and bone marrow transplantation are located. The proportion of platelet concentrate collected by apheresis increased to 69.9% in 2017. Actions to recruit young donors for blood donation and its components were regularly carried out in all federal districts. Summary/Conclusions: In the Russian Federation, the structure of donation is characterized by an increase in the proportion of plateletapheresis donors, stabilization of the percentage of plasmapheresis donors and an increase in the proportion of repeated and regular whole blood and apheresis donors. There are significant regional variations of donor's characteristics in the federal districts. Background: Shortage of blood supply despite continuous blood donation campaigns especially during local festive seasons has been a major issue in our country. Thus, our faculty initiated blood donation drives in collaboration with National Blood Centre in order meet the demand for the blood requirements. However, the pre-donation deferral rate was relatively high among our young blood donors leading to loss of valuable blood units. Understanding the causes of donor deferral provides direction on strategies for young donor recruitment and retention of future blood donation. Aims: The aim of this study is to evaluate the young donor deferral pattern and to identify factors which could help in minimizing the preventable deferrals.

Methods: This is a retrospective study of voluntary young blood donors age between 20 to 23 years old recruited during mobile blood donation in Faculty of Medicine, Universiti Teknologi MARA, Malaysia. The study was conducted between January 2016 to December 2018. The data were retrieved from the official reports of each mobile blood donation.

Results: A total of 828 young blood donors had attended mobile blood donation during the study period. The overall pre-donation deferral rate is 25.6%. The main causes of deferral are low haemoglobin (Hb) level (20.8%) followed by low blood pressure (16.0%), upper respiratory tract infection (11.3%) and sleep less than 5 h (9.4%). Summary/Conclusions: Low haemoglobin and low blood pressure are the two common reasons for blood donation deferral among our young blood donors. In our study a significant proportion of deferrals are due to sleep less than 5 h whereby this could be prevented if the donors are aware of the donor selection criteria. Strategies to mitigate preventable deferrals and improve blood donor retention particularly young blood donors as source of motivation for future blood donation are urged to avoid additional stress on the blood supply. Background: In the modern world, donating blood has become a humane manner for saving of patients life. But there are barriers to blood donation which are designed to ensure both donor and blood recipients' safety. Anemia is one of the most common health problems in the world. Based on the WHO estimation, nearly a quarter of the world's population are suffering from anemia, its prevalence varies among the populations and age groups. The prevalence of anemia among men is 12.7% and in non-pregnant women is 30.2%. Aims: The aim of this study was to determine the status of hemoglobin in volunteer blood donors referring to Fars province Blood Transfusion service and to determine the demographic status of them during the last two years. Our study included blood donors for all blood donors during the last two years. Methods: The study is descriptive cross-sectional and our sampling was non-random and simple sampling method. All parameters related to the donors, including age, sex and type of donation were investigated and analyzed in SPSS software. Results: The total number of referrals for blood donation was 454913. Repeated blood donors was 44.8% of total population and had the highest number of referrals, followed by first and lapsed donors with 31.2% and 24% respectively. In terms of gender distribution, 6.2% were female and 93.8% were male. The highest rate of hemoglobin level less than 12.5 g/dl was found in first-time donors with 51.6% and the lowest prevalence was observed in lapsed donors, followed by repeated donors with 24.7%. 44.8% of the repeated blood donors have hemoglobin higher than 16.5. There was a significant difference between blood donation type and hemoglobin level. Summary/Conclusions: According to our findings, low hemoglobin levels are more common among first-time and female donors, and this requires a special training among these groups. Because the high share of first time donors in blood supply and the positive impact of female donors on the blood safety, corrective action for that groups is recommended.

FINNISH BLOOD DONOR BIOBANK J Partanen, T Wahlfors, M Arvas, J Clancy, K L€ ahteenm€ aki, E Palokangas and N Nikiforow

Background: The increasing need for large, well-characterized cohorts of healthy individuals for modern biomedical research, such as genomics or phenomics studies typically including tens or even hundreds of thousands of subjects, has posed the possibility of using blood services as an option for collecting samples and related data. The possibility to re-contact blood donors for repeated sampling or asking for additional data has further increased interest in collecting large biobanks from blood donors. There is also a need to study more thoroughly the effects of blood donation on donor health. Aims: The first-phase goal is to recruit 50,000 blood donors with broad biobank consent for the FinnGen (https://www.finngen.fi/) project, a large publicprivate effort aiming to collect genome and health-related registry data of 10% (500,000) of the Finnish population. (11.58%), dental examination 10(3.32%) and medication history 6(1.98%). Permanent deferral namely, risk factor involving transfusion transmitted infections and chronic disease were 5(1.65%) and 8(2.64%) respectively. The prime cause of permanent deferral was risk factor involving transfusion transmitted infections while the temporary deferral was bed side hypertension. Gender wise, the leading cause of donor deferral in male was bed side hypertension and anaemia was the major cause in female. Summary/Conclusions: The findings of the survey aid to evaluate the significant causes of blood donor deferral. This study suggests that the restrictive criteria can be used for blood donor selection. This will in turn increase the blood supply of tertiary care hospital. Background: Donor selection is the first step towards safe blood but retaining blood donors is also very important for the blood supply. Donor questionnaire and the medical interview should provide optimal doctor deferral. Aims: To evaluate deferral rate in blood donors in order to identify the main reasons and to target eventual corrective activities. Methods: We analysed the data concerning blood donors who were registered in the period of three years (2016-2018). We used data from the information system e-Delphyn. Background: Iron deficiency (ID) in blood donors is an underestimated issue in many countries and may cause symptoms to blood donors even without anemia. ID prevention is mainly based on the prevention of anemia in whole blood donors, which is done by deferring donors whose haemoglobin level is under defined threshold (120 g/L in women, 130 g/L in men in France). EFS (French blood establishment) studies has observed that the rate of deferral for anemia is significantly higher in women than in men, either in French West Indies (15.9% versus 3.4%) or in continental France (2.9% and 0.8%). Assessing the prevalence of ID is of great interest since strategies to counteract it must deal with donor health and self-supply. However, data on ID are missing in France. Aims: To estimate the prevalence of ID in French whole blood donors and to identify risk factors associated with ID.

Methods: This non-interventional, cross-sectional, multicenter study is performed in blood donors of EFS and CTSA (Blood Center of the French Military Health Service).

All whole blood donors who met selection criteria are potentially included. Donors coming for bloodletting and donors who refuse to participate to the study are excluded.

No additional sample is taken for the study, ferritin is tested after blood qualification on surplus amount. Samples are selected at random within all the geographical areas and all mobile blood drives and blood centers between March 11 and March 28, 2019.

Results: This study FERRIDON has been approved by ethical research committee. Nine thousand (9000) whole blood donors will be included in EFS centers in continental France. To have information on donors of Afro-Caribbean origin and Comoros origin, 150 donations should be included in the French West Indies and 120 in Reunion Island. Additionally, 1500 whole blood donors will be included in CTSA centers. In this study, ID is defined by ferritin lower than 26 ng/mL and iron overload is defined by ferritin higher than 300 ng/mL. All donors with iron deficiency or overload will received a letter advising to consult their general practitioner. Weights will be calibrated on age, sex and geographical area so the sample will be representative of the French whole blood donors. Estimation of ID prevalence will take into account the weights and logistic regression model will be used to analyze risk factors associated with ID. Data will be analyzed during April and May 2019 to get result at the end of May. Summary/Conclusions: FERRIDON will be the first study on ID in the French blood donors. Considering the French health care system and diet, it will be interesting to compare those results to results from other countries. Mostly this study will allow to consider various strategies dealing both with donor safety and self-supply. Background: In Portugal, with an aging population of around 10 million people, only 3.8% are blood donors. The country has a national center of blood supply and some central hospitals with a blood donation center. Despite the growing practice of the excellent concepts of patient blood management, it is imperious to attract new donors. This need has been our inspiration to use new approaches towards people, in a constant work of promotion. Aims: Reach the majority of our local population using radio and telecommunication as well as social networks in an attempt to raise the number of new blood donors in a central hospital of the north of Portugal.

Methods: Active communication with the population of our reference area, via the social networks Facebook TM and Instagram TM , through educational digital posters and messenger service to answer any kind of questions. Establish contact with radio and television stations as well as with the mayor of the city, journalists, schools, town hall deputies and celebrities, through email and telephone calls. Design posters, flyers and public advertising to distribute in the city.

Results: Through the social networks it has been possible to reach a population of dozens of thousands in our city, in a daily basis. The national and world donor days were celebrated with success, in our health facility, with city mayor and journalists, and also in three television stations with national broadcast, reaching millions of people. Celebrities (sport, television, music, stand-up comedy, journalists and a magician) have accepted our challenge through videos or donating blood, appealing to blood donation and sponsoring our cause. These projects and continuous availability to innovate have given our hospital a self-sufficiency of 95% in 2018, instead of 80% in 2016, which implied receiving less blood unities from the national center of blood supply. Our most recent project involves high schools, in an attempt to educate our next generation of donors, with meetings in the town hall with deputies and district school delegates. Summary/Conclusions: The aging population and the low percentage of blood donors are an important issue concerning public health. Nevertheless, the good will and continuous advertising and educative work towards the population, appealing to the ethical and civil responsibility since young ages have shown to improve our capacity of response as a central hospital, increasing the auto-sufficiency of blood unities and the interest of younger donors. It is of the utmost importance to understand that this is a continuous and a hard work of the professional team of our hospital, involving countless calls, emails and hours to obtain some positive response, in an endless job. [1] [2] [3] [4] [5] [6] [7] [8] [9] [10] [11] [12] . The mean interval between donations is shorter for former regular donors (4.9 months, P < 0.01) whereas donors with an interval of 9 to 12 months are more likely to be regular (aOR 16; 95% CI 1.6-164). Summary/Conclusions: At the Provincial Blood Transfusion Centre of Bukavu, the percentage of regular donors is low and there is a substantial loss of former regular donors. Some factors identified to be linked to fidelity are unique to our study: female gender and a longer interdonation interval. Other factors that are similar to those found elsewhere have a particular significance in our donor population which consists mainly of young people and people without income. Efforts must be undertaken to ensure a supply from voluntary donations; recruitment strategies and target groups must be refined. Future qualitative studies are needed to explain the various associated factors and better understand the motivations of regular and non-regular donors to improve donor retention. Results: In Kazakhstan, the proportion of donors is higher, especially primary. The number of blood and especially plasma donations is higher, which can be explained by the presence of several albumin and immunoglobulin production sites. Increased evidence of blood transfusion rules, the development of a patient's blood management in combination with an increase in the quality of blood components cause a reduction in clinical need for red blood cells and plasma for transfusion. At the same time, the need for platelets is growing. It is difficult to assess the correctness of comparing the amount of banked whole blood. It is equally difficult to compare the number of received and distributed donor red blood cells and plasma: in Russia they are measured in liters, and in Kazakhstan in doses.

With a certain degree of conditionality platelet extraction can be compared. In Russia, they are counted in equivalent doses isolated from a dose of whole blood (at least 60 9 10 9 cells per dose), and in Kazakhstanin therapeutic doses (at least 200 9 10 9 cells per dose). In 2017, the estimated consumption of platelets in Kazakhstan exceeded the Russian indicator by 28.0%. 86% of platelets in Kazakhstan and 69.9% in Russia are harvested by the apheresis method. Inactivation of pathogens is performed in 92% of platelets in Kazakhstan and in 15.4% in Russia. Pathogen inactivation with amotosalen allows us to abandon the examination of donors for cytomegalovirus and irradiation of platelet concentrate. The main modern trend in the use of cryoprecipitate is using it as a source of fibrinogen, a blood coagulation factor that is first depleted in coagulopathy associated with injury and massive bleeding. Its production is growing in both countries, endowment in Kazakhstan in 2017 exceeded the Russian indicator by 141.4%. A significant plasma percentage in both countries does not pass quarantine due to repeated non-appearance of the donor and is subject to destruction. Inactivation of pathogens is performed in 10% of plasma in Kazakhstan and in 3.6% in Russia.

Despite the instruction and selection of donors, laboratory screening of infection markers remains effective: Russia more often identifies HIV and viral hepatitis C from potential donors, and viral hepatitis B and syphilis are detected in Kazakhstan. 0.7% of donors in Kazakhstan are exempted due to the results of multiplex screening of nucleic acids of three hemotransmissive viruses. Summary/Conclusions: The blood services of Russia and Kazakhstan perform tasks to provide medical organizations with effective blood components. In conditions of decreasing demand for red blood cells and plasma, it is advisable to focus on the efficiency of resource use and improving the quality of blood components produced.

Blood collection including apheresis P-091

Finnish Red Cross Blood Service, Helsinki, Finland

Background: Skin disinfectant must effectively reduce microbes from the arm of the donor. As a result of poor disinfecting microbes may be transferred from skin via venepuncture to the collected blood and contaminate the blood components. Aims: To ensure the efficiency of the skin disinfectant used for donor arm disinfecting by validation. The validation has two criteria which the post-disinfection samples must achieve: 1. No bacteria growth near the puncture spot (result 0 CFU) in ≥ 90% of the samples.

2. Total amount of bacteria on average is at most 2 CFU/25 cm 2 . At most 10% of samples are allowed to have 2-10 CFU/25 cm 2 . Methods: Microbiological samples were taken with contact plates from 30 voluntary persons' elbow folds before and after skin disinfection. The disinfecting was performed according to normal procedure by five nurses altogether with ethanol based disinfectant used in blood donation. On the sample plates an X was marked and this was directed to the puncture spot pointed by nurse. Post-disinfection sample was taken at the moment the skin would be punctured with needle. Results: The amount of bacteria varied from 20 to above 500 CFU/25 cm 2 in the pre-disinfection samples. Disinfection reduced bacteria very well; the critical puncture spot was totally clean (0 CFU/25 cm 2 ) in 93.3% of the samples and 86.7% of the samples had 0 or only 1 CFU/25 cm 2 . The average number of bacteria after disinfection was 0,6 CFU/25 cm 2 and the maximum number was 4 CFU/25 cm 2 . Most of the remaining bacteria were single colonies at the edges of the plates. Summary/Conclusions: Both main criteria are fulfilled. The sub criteria of the second main criteria is also full filled if the not so critical colonies at the edges of the plates are not taken into account. The skin disinfectant in question is shown to be effective and can still be used in blood donation paying attention to thorough procedure performance according to the instructions and sufficient drying time of the disinfectant.

Background: Research questions involving blood donation and recipient data often require advanced statistical methodologies. While such methodologies may appear in other medical research areas, specific tailor-made statistical tools and approaches are required for the analysis of blood-related data. These toolkits, which often require collaboration, are not always readily available to blood services, especially so in resource-limited settings. An international network of statisticians, epidemiologists and clinical researchers has been established for this purpose, which started with an Invited Session at the 2018 meetings of the International Biometric Society. Aims: To exchange ideas, experience and knowledge to further improve the quality of blood sector research. Methods: Currently our network covers four major blood services and members from five different countries. The network has monthly conference calls about past and current research topics. We wish to extend this network further, and establish a subcommittee on statistical and epidemiological methodology with regular face-toface meetings at an international organization such as ISBT. Results: The monthly meetings have already demonstrated that the members share common problems and interests. For example, we are discussing techniques to analyze data with repeated measurements, e.g. eligibility haemoglobin tests, ways to assess the healthy donor effect, e.g. determining appropriate controls groups, and predictive models of blood supply and demand, e.g. stochastic processes and queuing models. The network also aims to organize training sessions in methodology either on site and/or by developing web lectures. Summary/Conclusions: An international network on statistical methodology for the analysis of blood donation and recipient data will improve the quality of research in the field of transfusion medicine research. Expanding the network to include countries and blood services in research limited settings needs to be actively pursued. Background: Blood donor hemoglobin concentration (Hb) is commonly measured from a skin-prick sample at the donation site, and low Hb is the most common reason for temporary donor deferral. While a proportion of the deferrals do reflect true low Hb, the skin-prick sample is prone to preanalytical error and variation resulting in false deferrals. Aims: We assessed the applicability of a venous blood sample for second-line Hb screening in blood donors failing the initial skin-prick test. Methods: Initial Hb was measured from a skin-prick sample with the HemoCue Hb201 + (HemoCue AB) point-of-care (POC) device. Donors with Hb < 125 g/l for females or < 135 g/l for males or with a decrease > 20 g/l from latest donation were included in the study. In the study group, a venous blood sample was collected for Hb measurement with the POC device at the donation site. Donation eligibility was based on this Hb result. Venous Hb was also determined with a hematology analyzer (Sysmex XN, Sysmex Co.). The Blood Service's current workflow served as the control group: two more skin-prick samples were collected and the donor's final Hb and donation eligibility assessed with an algorithm based on all three skin-prick Hb results. Results: In the study (n = 305) and control (n = 331) groups, the proportion of male donors (27% and 26%) and the mean initial skin-prick Hb (122 g/l and 123 g/l) were similar. Significantly less donors were deferred from donation in the study group (40%) than in the control group (51%; Chi-square test P = 0.004). The mean difference in venous Hb with the POC device versus the hematology analyzer was À3 g/l (range À12 to + 6 g/l). Two donors were incorrectly accepted based on venous sample POC result; however, in both, Hb measured with the hematology analyzer was only 1 g/l below the limit of donation eligibility (124 g/l for a female and 134 g/l for a male). Interestingly, a further 33 donors (27% of all deferred in the study group) would have been eligible for donation based on the hematology analyzer result. Summary/Conclusions: Utilizing a venous blood sample for second-line screening of donors failing the initial skin-prick Hb test significantly decreased low Hb deferrals without compromising donor health. Blood donors' and Blood Service nurses' reactions to the new workflow have been favorable. We conclude that valuable donations can be recovered and donor satisfaction increased by implementing a second-line Hb screening model utilizing venous sample analysis at the donation site. Background: There is a paucity of literature on haemoglobin (Hb) reference values for adults above 60 years of age. This age group has been reported to use up to 50% the blood supply. Some studies report a decline of mean Hb with age, but others have found no change with age. Conflicting findings of Hb levels in the healthy elderly population may be associated with challenges in accessing data from healthy older adults, small sample sizes, selection bias and recent health population data. To donate blood, each individual is assessed as 'healthy' and must meet the minimum Hb criteria. However, the Hb criteria across countries vary and many blood collection services have an upper age limit for donors. As many populations around world are aging, restricting the upper age limit for blood donation may potentially affect the size of the donor pool and consequently the nation's blood supply. Aims: To explore the Hb levels of healthy older adults, through a multi-centre retrospective observational study of blood donors aged 60 years or older. Methods: Over a one-year period, Hb values were collected from blood donors aged ≥ 60 years from blood centres of four countries. The estimated proportion of blood donors aged ≥ 60 years old for each country was 0.81% in South Korea (SK); 2.57% in Hong Kong (HK), <3.18% Indonesia (INDO) and 9% in Japan (JAP). The minimum Hb criteria varied between each country and ranged from 11.5-12.5 g/dL for women and 12.5-13.0 g/dL for men. Hb levels were determined using point of care testing (Hemocue, Compolab, Hemcontrol) or the XE-2100D Sysmex dependant on the country of origin. Statistical analysis of the mean, standard deviation and cumulative distribution of Hb were determined by gender and age. Background: Medication usage is assessed to determine donor eligibility from the perspective of both recipient and donor safety. Different time frames since last taken apply to different medications. Assessment of medication use varies by jurisdiction, but most European centres use multiple questions. These often include a general question about recent medication use whereas the USA does not. At Canadian Blood Services there are 6 medication questions on the Donor History Questionnaire (DHQ), including any medication use in the last 3 days, vaccination and specific medications over different time frames (high teratogenicity medications). The name of each medication taken and reason for use are documented by staff at each donation attempt. Assessment of the frequency with which this process occurs is the first step in improving efficiency of this aspect of donor screening. Aims: To determine the percentages donors answering yes to medication questions by demographic variables. Methods: All whole blood donors who completed the DHQ (full length or abbreviated) in 2017 were included in the analysis. Donors' answers to each of the 6 medication questions were extracted from the National Epidemiology Donor Database, as well as sex and age. The number and percentage of donation attempts in which a donor answered yes to each medication question were calculated. Donors who answered yes to any medication question were sorted by sex and by age group, the totals and percentages calculated. Results: There were 975,067 donation attempts with a completed DHQ. Overall, 34% of donors answered yes to medications in the last 3 days, 8% to vaccination, and less than 0.1% to others (38% any). Slightly more were female (42 vs 36%) of those who answered yes to any medication question, as well as by individual question. The percentage of donors answering yes to any medication question increased progressively in each age group from 24% of 17-19 year olds to 57% aged 60 + (P < 0.0001 for trend). Summary/Conclusions: More than one third of all donation attempts answer yes to a medication question and require further questioning and documentation. This is more common in older donors and follows a similar trend to general population medication use. Comparison of ways of assessing medication use in different countries may help identify effective but more efficient approaches. In addition, the contribution to donor and recipient safety of assessing all medications should be assessed.

BLOOD CENTER EXPERIENCE WITH TRIMA ACCEL 7 AND TOMES SOFTWARE J Schreier 1 , A Davison 1 , J Gambarte 2 , Y L opez 2 , C Calonge 2 and E Herranz 2 1 Terumo BCT, Lakewood, United States 2 Centro de Transfusi on de la Comunidad de Madrid, Madrid, Spain

Background: In the Madrid community, more than 4000 apheresis platelet collections were completed in 2018, of which almost 3000 were completed in the blood transfusion center and the remainder in several hospitals in the region. Trima Accel 7 was implemented to meet the productivity needs of the blood transfusion center while improving the donation experience. TOMEs (Terumo Operational Medical Equipment Software), which enables bidirectional communication with Trima Accel devices, was used to connect and centrally manage all Trima Accel 7 devices with automated data capture and reporting. Aims: The aim of this study was to evaluate operational improvements using Trima Accel 7 with TOMEs compared to Trima Accel Version 6. Methods: This was a retrospective study analyzing 1372 apheresis procedures on Trima Accel Version 6 during the control period from 2 January 2018 to 10 September 2018 compared to 541 apheresis procedures on Trima Accel 7 during the test period from 11 September 2018 to 28 December 2018. This was not a paired study. Operator interventions, and completed procedure rate comparisons, were analyzed using a 2-proportions test, whereas donor demographic data were analyzed using a 2-sample t-test. Results: Trima Accel was used to collect single and double platelet products stored in platelet additive solution. Operators selected either a single (target platelet yield = 3.0 or 3.5 9 10 11 ) or double (target platelet yield = 6.0 9 10 11 ) platelet donation based on desired procedure time not the maximum number of products that could have been collected per donor. No statistically significant differences were observed for donors in the test arm compared to donors in the control arm for total blood volume (control = 5148 mL, test = 5124 mL, P = 0.545), hematocrit (control = 43.7%, test = 43.6%, P = 0.233), or platelet pre-count (control = 249 9 10 3 / lL, test = 253 9 10 3 /lL, P = 0.091). Females represented 21% of donors in the Control arm compared to 23% of donors in the Test arm. Platelet split rate (platelet products per procedure) increased from 1.15 with Trima Accel Version 6 to 1.18 with Trima Accel 7; procedure time decreased from 55.7 min to 53.3 min for single collections and from 63.0 min to 60.9 min for double collections with Trima Accel 7 (these differences were not statistically significant). The percentage of procedures that completed with no operator interventions due to access alerts increased from 62.4% to 84.8% (P < 0.001) and the rate of completed apheresis procedures increased from 89.8% to 92.4% (P = 0.083) with Trima Accel 7. Manual transcription of data during the procedure was discontinued with the implementation of Trima Accel 7 with TOMEs. TOMEs captured procedural data and operator steps with barcode scanning and tracking of configured events. This information was transferred to TOMEs post procedure and printed as a final report. Summary/Conclusions: Trima Accel 7 significantly decreased operator interventions, and automated data capture with TOMEs eliminated manual transcription of data. Both outcomes freed operators to complete other tasks and focus on donor well-being. Background: The European Committee (Partial Agreement) on Blood Transfusion (CD-P-TS) of the Council of Europe (CoE) has appointed a working group (WG) to focus on issues with plasma supply management (PSM). The task of the WG is, among others, to collect and analyze data in order to fill knowledge gaps concerning donor safety in plasmapheresis. In doing so, the working group will gather evidence base data to support the upcoming revision of the 19 th edition of CoE's "Guide to the preparation, use and quality assurance of blood components", the Blood Guide. An international survey was conducted Sept-Dec 2017, distributed to blood establishments (BEs) by the CD-P-TS representatives to CoE's member and observer states. The questionnaire included sections covering collection practices (volume and frequency), management of red cell loss, donor panel demographics and data on donor adverse events. Aims: The aim of this study was to investigate whether collection practices following the recommendations published in the Blood Guide for maximal collection volumes and number of donations per year were indeed associated with higher levels of donor safety and improved donor base sustainability. Methods: From the total of 36 respondents, 24 BEs collected plasma for fractionation (PfF) by apheresis and the study had a dataset covering 2,888,390 plasma donations in the latest fiscal year (LFY). The parameter used as marker of donor safety was the rate of immediate vasovagal reactions with loss of consciousness (VVR with LOC) per 10,000 plasma collections. The parameter used as marker of donor base sustainability was the retention rate of donors, ie % donors active in the previous year returning to make a donation in the LFY. Results: In the Blood Guide, the collection volume per apheresis is limited to 16% of the estimated total blood volume but maximally 750 mL, including anticoagulant. Respondents had differing practices and scale of collection program 15 BE were aligned or lower, and 9 BE had higher collection volumes. Altogether 14 reported the immediate VVR with LOC rate, which mainly was lower than 10/10000 collections. There was a small trend towards reduced rate with larger collection volumes than allowed by the current Blood Guide. Saline compensation during or after collection did not affect the rate of VVR with LOC. No correlation was observed between the annual donor retention rate and the rate of VVR with LOC or saline compensation practices, as reported by 16 respondents. The retention rate banded in the range of 50%>80% (mean = 60%, min = 25%, interquartile range = 14%, max = 90%). The association between maximum allowed yearly plasma collection (25 L) appears to be reasonably constant and showed no clear association with the donor retention rate. Summary/Conclusions: Restricting the maximum collection limit according to the current Blood Guide was not associated with either lower VVR with LOC or with higher donor retention rate. This study supports reassessment of current Blood Guide 0 s limits for collection volume of maximum of 750 mL per donation and 25 L per year per donor. Methods: Serum ferritin concentrations were established from sera stored at À30°C from repetitive platelet donors between 2014 and 2016, using ARCHITECT â Ferritin assay Chemiluminescent Microparticle Immunoassay (CMIA). The hematimetric parameters were evaluated in a total blood sample using the Celldyn 1800 â . Sixteen samples were obtained from women (age: 35.3 AE 12.4 years, range: 18-61) and 35 samples from men (age: 36.2 AE 9.4 years, range 20-61), corresponding to 55.2% and 37.2% of the total female and male repetitive donors of platelets by apheresis using Trima Accel â Terumo-BCT and Amicus TM Fresenius-Kabi. The difference in the concentration of serum ferritin between the last and first donation was established, as well as the change in the predonation platelet count between the last and first event.

Results: In the study population, 43.8% of women and 40% of men performed repetitive donations of platelets by apheresis with an interval of less than three months. The change in ferritin concentration was evaluated according to the interval between donations. In women ferritin delta was À38.4 AE 52.2 ng/ml when the donations had an interval less than three months, vs 3.3 AE 13.0 ng/ml when the time between donations was higher (P = 0.046). In men the change in the ferritin levels was À38.5 AE 61.2 ng/ml with donation times less than three months vs © 2019 The Authors Vox Sanguinis © 2019 International Society of Blood Transfusion Vox Sanguinis (2019) 114 (Suppl. 1), 5-240 À3.3 AE 38.9 ng/ml with prolonged donation times (P = 0.042). In women, the change in platelet count was À2 AE 46.2 9 10 3 /ul, when the donations had an interval less than three months vs À22 AE 45.3 9 10 3 /ul when the time between donations was greater (P = 0.43). In men, the delta of the platelet count was À12 AE 37.0 9 10 3 /ul in donation times less than three months vs À13 AE 26.6 with higher donation times (P = 0.93). No correlation was found between the concentrations of serum ferritin and the platelet count (r = 0.05, q = 0.75 for males, and r = 0.34, q = 0.22 for females). Summary/Conclusions: The data obtained suggest that repetitive donation of platelets by apheresis with intervals between donations of less than three months, significantly reduce serum ferritin concentrations in women and men, although normal levels were maintained in both groups. There was no correlation with platelet count. Therefore, it is proposed to develop prospective studies to establish the minimum time interval safety for platelet apheresis donor procedures. Background: The demand for platelets concentrates is increasing continuously and becomes a challenge for the blood establishments. Apheresis platelet collections may be a solution for this challenge. Improving apheresis collection efficiency while maintaining blood donor safety is an important goal for the Service du Sang of the Belgian Red Cross. Aims: Our establishment evaluated the improvements of the Trima Accel Automated Blood Collection System Version 7 (TA7) by comparing its routine performance with that of the previous software version 6.06 (TA6). Methods: Prospective, multi-site, controlled, non-randomized trial. Apheresis collections were performed in three SFS sites: Liege, Mons and Namur using the two Trima software versions TA6 and TA7 sequentially. Data were collected from December 2017 to April 2018 on TA6 and from June to July 2018 on TA7. Simple and double doses of platelets (respectively 5.0 9 10 11 , 5.5 9 10 11 and 8.0 9 10 11 , 9.0 9 10 11 ) were collected in platelet additive solution (SSP+, MacoPharma) with concurrent plasma from the same cohort of donors in accordance to donor's eligibility and preferences. In order to maintain the same final platelets content in Platelets Concentrates, the Trima Accel's tool Yield Scaling Factor (YSF) was subsequently adjusted from 1.06 (TA6) to 1 (TA7). Platelet yield, duration of procedure, number of alarms requiring operators' interventions were recorded and evaluated. Donor's hypocalcemia was avoided by giving preventively oral or intravenous calcium which was documented by the operators. Results: Five hundred ninety (590) collections with TA6 and 607 with TA7 were recorded, with 92% and 95% complete procedures respectively. Mean duration of procedures was 70 min on TA6 against 72 min on TA7, P < 0.05. The mean alerts number per procedure on TA6 was 4.1 against 0.5 on TA7, P < 0.05 whereas the maximum alerts number per procedure was 57 and 12 respectively. On TA7, 76% procedures did not require operator's intervention against 40% on TA6,. With TA7 the inlet flowrate was automatically adjusted in 97.2% procedures. The inlet flowrate was increased in response to access pressure in 45.6% of procedures, for 3% of the procedures the inlet flowrate was decreased and for 48.6% of the procedures the inlet flowrate was increase and decreased on the same procedure by the TA7 autoflow system. Summary/Conclusions: TA7 with its Autoflow function improves apheresis donors experience while decreasing operator' interventions through a significant reduction of access draw alerts. As expected from the Trima Accel platform, post-donation safety remains high. A weak increase in procedure duration was observed for the same platelet yield which may be resolved with further adjustments. Background: Trima Accel system is an apheresis platform relying on continuous flow centrifugation to collect from a donor platelets, plasma or RBCs based on donor qualification. The latest software version -Trima Accel 7 (TA7) introduced the AutoFlow feature which allows for automated flow rate adjustments. Moreover, TA7 leverages the mobilization capacity of the spleen increasing potential platelet productivity while maintaining high post-donation safety standards characteristic of Trima Accel. Aims: The objective of this evaluation was to assess the impact of TA7 software by retrospective comparison of procedure data and potential for increased productivity with those of Trima Accel version 6 (TA6) in the same cohort of platelet donors. Methods: Eight hundred twenty one procedures, started on TA6 from 4th January 2016 to 10th October 2017 were compared to 995 procedures, started on TA7 from 18th October 2017 to 31 st December 2018. Procedural data from the Trima devices were captured using the Cadence System (Terumo BCT, Lakewood CO). Parameters investigated were the number of machine access pressure alerts per procedure, the potential for higher platelet yield collections and the actual collected yields within the same cohort of platelet donors. Results: Both donor populations (TA6 vs. TA7 respectively) were comparable and were characterized by: TBV -5207 vs. 5344 mL; platelet count pre-procedure -252 9 10³/lL vs. 252 9 10³/lL; hematocrit pre-procedure -44% vs. 44%. Gender distribution was 11% female with TA6 vs. 2% with TA7. Venous access pressure alerts were significantly improved by TA7 with an average of 0.2 alerts per procedure as compared to 2.0 with TA6, i.e. 92% decrease. This decrease went down to 91% if only male procedures were analyzed. The maximum number of pressure alerts went down by 84% from 90 alerts in one particular run in the TA6 cohort to 14 alerts in one TA7 procedure. Procedure time for single platelet products was reduced from 51 to 49 min and for double platelet products from 59 to 54 min (TA6 and TA7 respectively). Donor qualification possible was 52% of procedures yielding single products and 48% of procedures yielding double products with TA6. The percentage of procedures qualifying for doubles increased to 91% with TA7. In terms of split rates, i.e. how many platelet doses could be produced per apheresis collection, potential split rates increased from 1.48 to 1.91 from TA6 to TA7, respectively. In fact, the observed split rate rose modestly from 1.01 to 1.05, as shorter procedures were generally selected according to donors' preferences. Summary/Conclusions: In comparable donor populations, implementation of TA7 decreased the number of access pressure alerts significantly compared to previous Trima versions. The average procedure duration was also found to be slightly reduced. Implementation of TA7 has the potential to increase productivity significantly. The observed modest actual rise in split rate suggested that factors related to donor and inventory management will determine at which extent the potential of the new software will be used.

DONOR COMPARED EXPERIENCE ON TRIMA ACCEL 7 TO TRIMA ACCEL VERSION 6

August 11 2017 to October 17 2017 or Trima Accel 7 during the Test period from November 28 2017 to January 9 2018. This was not a paired study. Donors completed the survey while recovering from the apheresis procedure in the cantina. Results from the paper survey were transcribed into EXCEL for analysis. Results: 63 donors completed the survey during the Control period whereas 86 donors completed the survey during the Test period. The mean number of previous donations for the Control period was 3.0 (min 1 max 6) and for the Test period was 3.2 (min 0 max 7). There were no first time donors during the Control period and 20 first time donors during the Test period. 91% of donors rated their overall donation experience as good on Trima Accel 7 compared to 90% on Trima Accel Version 6. Zero (0) donor rated their experience on either Trima Accel device as poor. 100% of donors who responded to the question said they would donate on Trima Accel 7 again. Summary/Conclusions: No significant difference was observed in donor experience between Trima Accel Version 6 and Trima Accel 7 as both versions receive high marks. Background: The trend on growth of query for donor platelet concentrates is observed in Russia for past few years. As reported by EDQM in 2014, a higher number of the platelets was consumed compare to 2011 by 7.8%. Patients' with hematological malignancies treatment requires platelet concentrates transfusions during chemotherapy, immunotherapy and hematopoietic stem cells transplantation. According to the data collected in National Research Center for Hematology (NRCH) in 2018, 635 (8.6%) of the 7,371 patients, treated within facility, received platelet transfusions as transfusion therapy. The total number transfused units is 14,292, which is 668 higher (by 4.9%) comparing to 2017. Platelet concentrates production can be performed either by apheresis process or by pooling individual units recovered from the whole blood. Taking into account that the NRCH produces blood units for its own needs, the pooling is not suitable method for production because its implementation doesn't cover require for platelets and overproduces RBCs. That is why platelet concentrates in NRCH are obtained by apheresis only. In summary, the growth on requirement for platelet concentrates and their safeness explains the need for a comparative study for effectiveness of platelet production using various apheresis systems. Aims: The aim of the study is to compare effectiveness of platelet concentrate production using MCS + 9000 (Haemonetics), UPP and Trima Accel (Terumo BCT) version 6.0 protocols. Methods: The data for 4868 protocols of platelet donations performed in 2018 were analyzed: 2773 on Trima Accel and 2095 on MSC + 9000. All donors were voluntary and non-paid donors with previous experience of blood donations. The choice of the platelet collection device was random; analysis of the main characteristics of donors did not reveal any significant differences between the groups. The median age of the donor was 32 years old, height -175 cm, weight -76 kg, platelet count before donation -254 9 10 9 /L, hematocrit -42%. Detailed data are presented in Table 1 . Student's t-test for unrelated sets was used for statistical analysis of the data. A value P of less than 0.05 was considered as significant. Results: The data obtained showed significant difference (P < 0.01) between average number of platelets collected on Trima Accel (6.3 AE 1.06 9 10 11 /L) and on MCS + 9000 (5.09 AE 0.78 9 10 11 /L). While cost of consumables are comparable, Trima Accel demonstrated 23.7% higher efficiency. Procedure duration also was comparable and averaged within 94 min for both devices. Detailed data are presented in Table 2 . It is crucial to mention that proportion of Trima Accel's donations was significantly increased in NRCH during 2018 and reached 56, 7% in total (2017-19.4%). A flexible usage of Trima Accel's consumables for different procedures (regular platelet collection and collection in PAS) allowed to change the PAS/regular platelets collection ratio from 7.64% up to 43.7%. Summary/Conclusions: Obtained results proved the effectiveness of the Trima Accel's use for platelets concentrates production. It allowed to increase the average count of platelets obtained for one procedure by 23.7% compared to MCS + 9000 while the cost of consumables and procedure duration are comparable. The donor's comfort during procedure did not affect either. In long terms increasing of number of platelets collected is reducing the cost of platelet concentrates production.

Abstract withdrawn. Background: Apheresis collected platelet concentrate is preferable in terms of reducing the risks of adverse reactions in platelet transfusion when compared to random donor platelet concentrates. Aims: The aim of our study is to present our experience in collection donation of single donor platelets with apheresis. Methods: This is a retrospective study performed in the Institute for Transfusion Medicine from 2010 till 2019. All donors were fully informed on the donation procedure and signed an informed consent for donation. The optimal platelet count that we want to achieve was ≥ 3.0 9 10 11 equal to 12 random donor platelet doses. Minimum preapheresis platelet count in donors requested to start the apheresis collection was 150.000/ll. Platelet collection was performed using flow cell separators Haemonetics MCS+ and Trima Accel. Acid Citrate Dextrose formula A was used for anticoagulation. Median precollection platelet count of donors was 273.000/ll, with range from 182.000/ll to 397.000/ll. Male were 77% of the donors and females were 23%. The single procedure usually took 45-70 min. The median platelet count collected was 4.0 9 10 11 , range 2-6.5 9 10 11 . The median processed blood volume was 3215 ml and median used ACD-A was 352 ml. Mean total volume of collected product was 312 ml. The adverse effects included vein perforation and the numbness of the extremities as reaction of ACD-A (hypocalcemia), which occur rarely and was very mild. Summary/Conclusions: The collected platelet count was more than the wanted optimum platelet count. The number of apheresis donors is increasing and we are working on expanding our Voluntary Platelet Donors Registry and increasing the number of typed donors in the Registry. Background: To determine value of hemoglobin in blood donors, there are some tools or methods used, such as: Cyanmethemoglobin method that can detect of hemoglobin quantitative and methods Cupric Sulfate solutions (CuSO4) can detect of hemoglobin qualitative. According to WHO (World Health Organization) to determine the level of hemoglobin in blood donors enough used CuSO4 solutions with specific weight (y) 1.053 can to detect value of hemoglobin above or same with 12.5 gr/dL. But, CuSO4 solution specific weight 1.053 can not to detect and elimination value of hemoglobin above 17 gr/dL or polycythemia sick. Because it, Central Blood Transfusion Unit (UTDP) as the central of blood service in Indonesia to manufacture Cupric Sulfate solution (CuSO4) with a specific weight (y) 1062 to detect value of hemoglobin below 17gr/ dL and determine value of hemoglobin above 17 gr/dL. Because it, do the testing the accuracy of the solution Cupric Sulfate in detecting and eliminating donor with value of hemoglobin above 17gr/dL with the test of 35 samples. Aims: To determine accuracy and effectiveness by Blood Donors Unit in Indonesia Red Cross to use CuSO4 solution with specific weight 1.062 in to detect and elimination value of hemoglobin donors above 17 gr/dL. Methods: Used The method Cyanmethemoglobin and CuSO4 (y) 1.062 determination value of hemoglobin donor. Test results were analyzed with SPSS software version 23 using nonparametric analysis Wilcoxon test.

Results: This research testing the accuracy and effectiveness of using a CuSO4 solution with specific weight (y): 1.062 in detecting and eliminating hemoglobin value donors above 17gr/dL. From data processing using SPSS with the Wilcoxon test P value 0.02. Summary/Conclusions: It was found that the CuSO4 solution (y): 1062 can detect hemoglobins value above 17gr/dL and more effective in checking the hemoglobin in blood donors. It can be seen from the data processing with SPSS version 23 with the Wilcoxon test P value < 0.05. It is important to monitor the precise course by which repeated blood donation affects Hb and the probability of low Hb deferral. Zinc protoporphyrin (ZPP) is a functional indicator of body iron levels and is hypothesized to predict Hb levels among blood donors. Advanced statistical methods are necessary to properly analyze the longitudinal associations between ZPP and Hb in data with repeated donations per donor. Aims: To determine whether predictions of future Hb levels using current Hb levels can be improved by taking ZPP levels into account, and to illustrate the use of statistical models for repeated measurements of blood donors. Methods: We used data from the ZPP and Iron in the Netherlands Cohort (ZINC) study. We identified previous ZPP levels (log-transformed) as the main predictor and adjusted for previous Hb level, age, day and time of donation, donation history, BMI, blood volume and blood pressure. We used linear mixed models, which take into account missing data in the outcome and associations between repeated measurements, to investigate the longitudinal association between previous ZPP and current Hb levels. The longitudinal analysis with linear mixed models was contrasted with a simpler analysis based on the area under the receiver-operating-characteristic (ROC) curve for the probability of low Hb deferral. Results: In total, 8194 whole blood donors (20,864 whole-blood donations) were included in the ZINC study, 63% being female donors. Previous ZPP showed a statistically significant association (P < 0.001) with Hb levels in females, but the size of the association was quite small (regression coefficient, B = À0.17, 95% confidence interval À0.22 to À0.11). The same was true for males, but the size of the association was even smaller. Blood volume and age for women were significant secondary predictor variables; blood volume, age and donation interval for men. By comparison, the ROC analyses showed relatively larger, but less statistically significant predictive effects of ZPP on Hb. Summary/Conclusions: ZPP is a statistically significant predictor of Hb levels, but the size of the effect after adjustment for previous Hb and other variables is small. The results cast doubt on whether ZPP is an effective predictive marker for Hb level and low Hb deferral, and suggest that ZPP should not be included in prediction models for Hb levels. By properly adjusting for associations between repeated measurements and by using all available data, longitudinal models provide less biased and more precise estimates than simpler cross-sectional analyses. Background: Finnish Red Cross Blood Service (FRCBS) is a national blood service and is responsible for all blood collection and component production in Finland. The highest age for blood donors was 66 years until the end of year 2013 and since beginning of 2014 donors between 66 and 70 years have been able to donate blood. Blood donation after the age 66 is possible if the donor has donated within the last 24 months. The upper age limit was raised up based on adverse event data from FRCBS donors up to 66 years and on published data from other Blood Establishments. Aims: The aim of this study is to find out if the new policy from 2013 with upper age limit of 71 years is safe. Therefore donor adverse event data was analyzed in order to evaluate if the blood donors older than 66 years have more adverse events compared to other donors. The most common donor adverse event for donors over 66 years, haematoma, was registered 211 times (0.05%). In the other age groups haematoma was registered 4408 times (0.56%) and the difference between the oldest age group compared to all other donors was statistically not significant (Chi2, P = 0.012). VVRs with LOC were registered 21 times (0.05%), VVRs without LOC 25 times (0.06), and the total number of all DAEs was 293 (0.65%) in the age group 66 years or older. The respective numbers in the other age group were: 1152, 0.15%; 11055, 1.41%; 17550 (2.23%). The number of VVRs with and without LOC, and total number of all DAEs in the age group 66 years and older was smaller than in the other groups and the difference between these groups was statistical significant (Chi2, P < 0.0001). Summary/Conclusions: Donors over the age of 66 years have less donor adverse events than other age groups. Decision to raise the age limit from 66 to 71 seems proven to be right as the older age group has even less donor adverse events than other donors. Background: Deep Vein Thrombosis (DVT) of the donor's phlebotomy arm is a rare, but serious complication of blood donation that needs to be recognised and managed appropriately in a timely manner. Post donation DVT will be classed as a 'Serious adverse events of donation' (SAEDs)these are events that either result in donor death, hospitalisation, intervention or significant symptoms persisting for more than one-year post donation. Aims: To review cases of DVT post donation reported in UK in 2016-2018 years and identify any common themes for improving practice Methods: All data relating to SAEDs from the four UK Blood Services reported to SHOT in the last 3 years (2016-2018 inclusive) were reviewed to look for reports of DVT post donation Results: A total of 135 SAEDs were reported in UK from approximately 5.8 million donations (whole blood and apheresis) collected during this period. Three cases of upper limb DVT were reported during this time accounting for 2% of the SAEDs reported and rate of DVT of 1 in 1.9 million donations collected.

-Case 1: A regular male whole blood donor in his early 30s reported worsening arm pain 12 days following blood donation, had a painful venepuncture and a small bruise at site of donation. He was diagnosed to have an upper limb DVT extending to the subclavian and brachiocephalic vein and started on oral anticoagulants. No other contributory factor was obvious -Case 2: A female donor in her mid-40s gave her sixth whole blood donation without event. 11 days after donation, she developed worsening arm pain in the donation arm and was diagnosed with an upper limb DVT and commenced oral anticoagulation. There was no other identifiable risk factor for the thrombosis -Case 3: A female donor in her 20s developed pain, swelling, redness and itchiness in her donation arm and chest wall two days after donation. She also described prominent veins on the affected side compared to her other arm. She contacted the transfusion service one week after donation; by this time she was also breathless on minimal exertion. She was admitted to hospital and commenced on anticoagulant therapy. A diagnosis of DVT and associated pulmonary embolus was confirmed. The donor's only risk factor for thrombosis was use of the oral contraceptive pill. Summary/Conclusions: Rare complications of blood donation, like DVT, can occur. Superficial venous thrombosis may occasionally progress into the deeper veins of the donor's arm but DVT can also occur without signs and symptoms of superficial thrombosis. None of our patients had any overt evidence of superficial thrombosis. One patient in our series reported using oral contraceptive pill. No other risk factors for thrombosis was forthcoming. Transfusion services should encourage donors to make early contact with the Blood service if they experience arm complications so that they can be investigated and managed in a timely manner. Staff dealing with such donors must recognise the possibility of this rare complication, explore other additional contributory factors and initiate prompt and appropriate management. Background: Voluntary blood donation is widely considered to be safe with very minimum chance of adverse reaction, which may occur during or after the end of phlebotomy procedure. Aims: To find the adverse blood donor reaction among voluntary blood donors in tertiary care hospital in Kathmandu Methods: This is a prospective study done among voluntary blood donors at Grande International Hospital, Kathmandu, Nepal from February 2013 to March 2015. The outlines of reported and communicated adverse donor reaction were also collected after the blood donation from voluntary blood donors in different locations including outdoor and in-house blood donation drive Results: In the present study 6,955 whole blood donors were included, during the period of 2 years, 105 (1.50%) adverse donor reactions were reported. Majority 89 (84.76%) of adverse donor reactions were mild in nature such as, sweating; 27 (25.72%), Light headedness; 19(18.09%), nausea and vomiting; 15(14.28), allergy and bruises; 11(10.47%), sore arm; 9(8.58%) and hematoma; 8(7.62%) while 16 (15.24%) were severe adverse reactions similarly, anaphylaxis; 11(10.49%), loss of consciousness; 3(2.85%) and convulsive syncope; 2(1.90%). Markers of the adverse donor reaction were age, sex, pulse, weight, blood pressure and donation status. Age and first time status were related with significantly higher risk of adverse reaction with 18-23 years old at higher risk compared to 24-55 years old. First time donors were at higher risk compared to repeated volunteer donors. Summary/Conclusions: The results of the study are helpful to identify and understand the complication of adverse donor reactions though the incidence of reactions in the blood donors is lower than in other studies. Donor age and donation status were strong possibilities of complications. Background: Blood donors with pollen-induced allergy and asthma must often refrain from donation in pollen season despite medication, because of symptom severity or similarity to airways infection. Extracts of the medicinal mushroom Agaricus blazei Murill (AbM) given orally have been found to reduce IgE anti-ovalbumin levels and ameliorate the skewed Th1/Th2 cytokine balance in mice sensitized to ovalbumin (Takimoto, Immunopharm Immunotox, 2008; Ellertsen & Hetland, Clin Mol Allergy, 2009). Aims: The objective was now to examine whether supplementation with the AbMbased extract that we used in the mouse model for allergy, could alleviate allergy and asthma in blood donors by reducing specific IgE levels and basophil sensitization. Methods: Sixty donors at Oslo Blood Bank with self-reported birch pollen allergy and/or asthma were recruited and randomized in a double-blinded, placebo-controlled study with oral supplementation for 7 weeks before the birch pollen season with the AbM-based extract Andosan TM (Immunopharma, Oslo, Norway). This is a water extract of the Bacidomycetes mushrooms AbM (82%), Hericeum erinaceus and Grifola frondosa. The participants filled in questionnaires for allergic conjunctivitis & rhinitis, asthma and medication. Serum IgE (ImmunoCAP â , ImmunoDiagnostics, Sweden) and

Bet v 1-induced basophil activation in whole blood determined by CD63 expression in a flow cytometer (Flow CAST â , B€ uhlmann Lab AG, Switzerland), were analyzed before and after the pollen season. (Trial record: NCT03198455, Clinical.Trials.gov). Results: There was significant reduction in allover allergy-related ailments and types of allergy medication used in the AbM extract compared with placebo group during the pollen season and no side effects. Also, AbM treated asthmatics had fewer symptoms and used less medication than controls. In the AbM group, serum levels of specific IgE anti-Bet v 1 and anti-t3, were significantly reduced during the pollen season as compared with levels in the placebo group. Whereas the maximal allergen concentrations needed for eliciting basophil activation before the season changed significantly to lower concentrations (i.e. enhanced sensitization) after the season in the placebo group, these concentrations remained similar in the group given the mushroom extract. Summary/Conclusions: Oral pre-seasonal supplementation with an AbM-based extract for 2 months reduced general allergy ailments, asthma symptoms and medication in blood donors with birch pollen-induced allergy and asthma during the pollen season. This was due to reduced specific IgE levels and basophils rendered less sensitive to allergen activation. The study suggests that supplementation with AbM mushroom extract can have prophylactic effect on aeroallergen-induced allergy and asthma in blood donors. It may therefore reduce such ailments in affected blood donors and impact blood donations in the pollen season. Results: DHV started in 20/9/2014. The data presented in this abstract is till 28/2/ 2019. Data is collected from total of 114475 blood donors (86.67% male donors and 13.33% female donors). Repeat donors accounted for 59.34% against 40.66% of first time donors. Of the total number of donor adverse events recorded, 2.73% (2633) reported for male donors and 6.97% (1063) for female donors When the donor adverse events stratified age-wise, the highest incidence reported in age group 18-24 years (male 5.45% and female 13%). Among age group 25-40 years, (male 2.4% and female 4.02%), whereas in age group 41-65 years, (male 1.52% and female 2.11%) Data analysis of total 6226 reported and registered donor adverse events, are categorized as Hyperventilation (864), Sweating (1458), Dizziness (pre-syncopal 3160), Loss of consciousness (416), Vomiting (108), Convulsions (220), Hematomas with Re-bleed (255), Nerve irritation (8) and Off-site reactions (333). Many donors showed multiple forms of reactions. Summary/Conclusions: Evaluation of donor side effects helps to improve donation process and donor compliance. Most frequently recorded reaction remains dizziness (pre-syncopal). Our donor vigilance data show reactions occurred more frequently in younger age, female and first time donors. Repeat donation and age are predictors for low rates of adverse events. Participation in DHV implies an effort to improve donor care and safety infrastructure and a desire for national and international comparisons to determine best practices and also to look into effectiveness of risk reduction strategies and follow-up trends. Pre-donation hydration was implemented as an interventional tool to test the effects of hydration on pre-syncopal reactions to blood donation, specifically targeting those at highest risk such as female, first-time, high school donors. The results are awaited. Background: Descriptions of deferral categories and a knowledge in the percentage of deferrals in each category are of value in formulating recruitment and retention strategies. This can also help in planning more efficient recruitment strategies and thereby assist in reducing the shortage in blood supply. Aims: The aim of the study is to categorize all donors who were deferred during medical checkup and find out the donor deferral rate in Dubai Blood Donation Center from January 1 st 2016 to December 31 st 2018 and also to find out whether there is any yearly or seasonal trend in any of the categories of deferral criteria's which can aid in forecasting and managing donor pool. Methods: A retrospective study of donors deferred during last three years from January 1 st 2016 to December 31 st 2018 was done in Dubai Blood Donation Centre. The donors deferred during pre-donation medical check-up were categorized into 8 categories including low Hemoglobin, High and low BP, intake of antibiotic, fever and flu, taking other medications, travel history etc. The deferrals were analyzed monthly and yearly and then were compiled to find any yearly trend or seasonal trend in the donor deferral rate in any of the categories. The data were analyzed using the SPSS software and a P value of < 0.05 was considered significant. The assessment of donor suitability is in accordance with AABB standards and is consistently applied in every blood donation setting on each occasion of donation to all blood donors. Results: During this study, 193,228 donors were registered from January 1 st 2016 to December 31 st 2018 and 41,037 (21.24%) donors were deferred. The common reasons of deferral were low Hb, High BP, Travel history, intake of antibiotics and cough/flu symptoms. There was a significant decrease in deferral rate from 24.07% (15302/63563) in 2016 to 20.79% (13180/63394)in 2017 and further to 18.74% (12419/66271) in 2018 (P < 0.05). The specific deferral rate due to low Hb also significantly (P decreased during these three years (86/1000 in 2016, 68/1000 in 2017, 58/1000 in 2018), though no change was seen in the deferral due to other reasons. The reduction in the rate of deferral due to low hemoglobin may-be linked to the change in the staff performing the hemoglobin testing in DBDC (nurses instead of phlebotomist were assigned to perform Hb estimation of donors). There was a seasonal variation in the deferral rate in all the three years-lowest in June (6/1000) and then increasing with a peak in October (19/1000) and plateauing till January. This pattern of deferral corroborated with the rate of deferral due to flu/fever and cough and antibiotics with an average of 4/1000 in June and increasing to 10/1000 in October (P < 0.05). Summary/Conclusions: Staff competency is pertinent in accurately deferring donors. There is also a significant seasonal pattern in flu/fever and intake of antibiotics deferral rate that is reflected in the total donor deferral pattern. Seasonal variation of specific category of donor deferral should be taken into account for donor recruitment and retention efforts. Background: West Nile Virus (WNV) is a mosquito transmissible flavivirus. It has been shown (Vogels 2017 Thesis) that the common mosquito in the Netherlands can transmit WNV in laboratory circumstances but presently does not lead to effective transmission. However, the number of outbreaks of WNV is increasing and moving from the Eastern and Southern European borders towards the traditionally more colder Western and Northern parts of Europe. In order to prevent WNV transmission to blood transfusion recipients, Dutch donors that travelled to regions with WNV risk are deferred for a period of 28 days for whole blood, platelet donations and quarantine plasma in order to exclude potentially infected asymptomatic donors. Aims: To assess numbers of Dutch donors who are deferred for travelling to WNV risk areas within Europe, and the return after onsite and offsite deferrals of donors. Methods: Data from 2015 to 2018 on donation attempts and deferral were retrieved from eProgesa, the blood bank information system. Onsite deferral is defined as a donation that was attempted in the deferral period or in the 7 days prior to deferral, all other deferrals are considered as offsite. A Generalized Estimating Equation model was used to assess the association between onsite versus offsite WNV risk deferrals in 2015-2016 and subsequent return rates within two years (after which a donor is inactive according to DOMAINE). Results: In 2015-2018, 16,400 donation attempts led to onsite deferral for WNV risk; 87% at whole blood donation attempts, 13% at new donor examinations. In total 19,624 offsite deferrals could not be traced directly to a donation, but based on the next donation more than 90% were probably whole blood donors. The number of deferrals peaks each year during August, the major holiday period in the Netherlands, and increased from 920 in August 2015 to 1711 in August 2018. This increase is probably caused by the expansion of WNV risk regions. The return rate of WNV deferred whole blood donors is slightly lower than for donors who are not deferred (92% versus 95%); for WNV deferred new donors the return rate is 75% (versus 87% for no deferral). Thus WNV deferral resulted in approximately 400-500 extra lapsing donors during these 2 years. However WNV deferred donors, that are older (odds ratio (OR) 1.03; 95% Confidence Interval (95% CI) 1.02-1.03), of male sex (OR 1.16; 95% CI 1.03-1.31) and whole blood donors as opposed to new donors (OR 2.01; 95% CI 1.70-2.38) were more likely to return to donate. There was no difference in return rate by offsite and onsite deferral. Summary/Conclusions: Travel-related WNV deferrals are increasing with expanding risk regions, especially in the holiday season where the availability of donors is already low. Although the numbers of donors who are permanently lost after WNV deferral are limited, the increasing numbers of lost donations make it important to consider alternatives to donor deferral such as WNV NAT testing. Background: Low haemoglobin due to iron deficiency is increasingly recognized as a serious problem in many blood centers. Donor education, iron supplementation, ferritin monitoring, and lengthening of inter-donation interval are currently the main mitigation measures. However, a number of factors in particular donor knowledge could impact their success. Locally, iron supplementation programme was implemented since 2012 with target group of donors who have given blood within the last six months. Aims: Here we look at an online donor survey to gain insight on their view of the programme and knowledge. Methods: Donors with successful blood donation in the past six months would be given 14 days of one tablet of iron supplementation (100 mg elemental iron) since 2012. An electronic questionnaire was sent to blood donors in 2017 to assess their view on the programme and knowledge which focused on iron store and absorption, compliance and any side effects occurred. Results: 3212 donors (male to female was 1:1.9) replied to the questionnaire. Of them, 594 received iron supplementation (male to female was 1:1.6). Most of the respondents (94%) had one or more donations in the preceding 12 months. Of the 594 donors received iron tablets, only 246 (41%) took all; 69 (12%) took more than 50% but not all; 130 (22%) took some but less than 50% and 149 (25%) did not take any. Gastrointestinal upset was reported in 113 (25%) donors and constipation seen in 193 (43%) among those who took at least some of the iron supplementation. Most respondents answered correctly to the questions on the knowledge on iron store and absorption. When comparing those with better compliance (took more than 50%) to those who did not (took less than 50%), significantly more donors in the former knew vitamin C could enhance iron absorption (P < 0.05). On the other hand, no difference was seen when they were asked if 1) Iron can only be absorbed from meat; 2) Tea and coffee consumed during meal can enhance iron absorption; 3) Everyone can take iron supplementation on their own; and 4) Iron store in male is always more than female. Summary/Conclusions: The results suggested that there is definitely more room to enhance the blood donors' knowledge on iron store and absorption in order to improve the effectiveness of iron supplementation programme. Besides, the side effects reported by the donors could be an important limiting factor that better alternatives should be explored and considered. Background: Vasovagal reactions (VVR) are a well-established deterrent to donor return. However, the correspondence between VVR experience and donor lapse is not perfect. In Australia, for example, VVRs only reduce two-year return rates by 27% for whole blood donors and 22% for plasma donors. The elements of a VVR and the donor's interpretation of this event that protect against or encourage lapse have not yet been identified. Aims: In this study we explored the views of donors on donating following a VVR, with a particular interest in their emotional reaction to the VVR, their understanding of what caused the reaction, and their intentions to return. Methods: Semi-structured telephone interviews were conducted with 36 whole blood and plasma donors who had a recent VVR experience. Data were analysed using the Framework approach. Results: Donors are generally motivated to give blood to help others and to positively impact on those in their communities. They anticipate feeling good after their donation but in contrast, for many, a VVR leaves them feeling anxious, embarrassed, and disappointed. For donors, the experience of a VVR negatively influences their perceived ability to donate successfully, and many fear it will happen again. However, this effect appears minimised among donors who at least partially attributed their reaction to their own behaviour, such as poor hydration. For donors already juggling multiple demands, a VVR may tip the balance with donating becoming too much of an effort and perceived risk. However, donors appeared more confident to return if they felt supported by staff or if they could donate with family or friends. Summary/Conclusions: This study provides valuable insight into the VVR experience, which will aid in the improvement of donor safety and retention. The findings highlight the need to improve communication at the time of and following a VVR, to educate donors on how to reduce their VVR risk, and to intervene to help donors maintain their perceived ability to give blood in order to maximise retention following a VVR. Background: Frequent blood donation depletes the iron stores of blood donors. Iron depletion might have negative effects on the health of the general population, but its effect on the blood donor population is not well known. Aims: To investigate the iron status of Finnish blood donor population and how it relates to donor health, the Finnish Red Cross Blood Service set up the FinDonor 10,000 study in 2015. We investigated whether there were changes in donors' selfrated health and if these possible changes could be associated with differences in iron biomarkers (Ferritin and soluble transferrin receptor -sTfR) or hemoglobin levels during the first study visit. Methods: Participants were recruited in three donation sites in the capital region of Finland between May 2015 and December 2017. Participants filled out an electronic questionnaire about their health and lifestyle at the donation site during their enrollment visit. Participants were asked by letter to fill out the same questionnaire electronically during the summer 2018. We included the 1435 participants (596 men and 480 premenopausal and 359 postmenopausal women) who completed both health questionnaires. To evaluate self-rated health we used the well-validated single question: "How would you rate your health in general?". Participants were able to evaluate their health status on a five-point scale: excellent, very good, good, moderate, and poor. Iron biomarkers and venous hemoglobin were measured from blood samples collected at the first study visit. We first computed the odds-ratios of reporting poorer health depending on demographic group. We then compared iron biomarker and hemoglobin levels between donors who reported improved, similar or poorer health rating. Results: Donors who rated their health in the first questionnaire as Moderate (N = 31), Good (N = 483), Very Good (N = 684) or Excellent (N = 237) health tended to report improved (58%), similar (63%), similar (55%) or poorer (55%) health ratings respectively in the second questionnaire. Pre-menopausal women reported their health poorer in the second questionnaire compared to the first questionnaire more often than post-menopausal women (pre-menopausal 51%, post-menopausal women 38%), OR = 1.37 95% CI 1.02-1.85). There were no differences between other groups. There were no significant differences in iron biomarkers levels (ferritin and sTfR) or hemoglobin levels between donors whose health ratings were improved, similar or poorer. Summary/Conclusions: In this cohort, pre-menopausal women rated their health poorer at the end than at the beginning of the study more often than post-menopausal women. No association was found between changes in self-rated health and iron levels (ferritin, sTfR) or hemoglobin levels. Further studies about the factors relating to blood donors' self-rated health need to be carried out. Background: In recent years, the blood donation business has made great achievements, but it still cannot avoid the occurrence of adverse reactions to blood donation which not only brings certain obstacles to the blood donation work, but also affects the enthusiasm of blood donors. Aims: To understood the causes and other relevant factors of adverse reaction among blood donors, the information of blood donors at Dai Autonomous Prefecture of Xishuangbanna were analyzed in 2018. Methods: The data of volunteers from January to December 2018 were analyzed. The causes of adverse reactions were classified, and the incidence of adverse reactions was compared in terms of gender, frequency, age and blood type of blood donors. Results: There were 9081 blood donors in 2018, 69 (0.76%) of whom had adverse reactions and 9 causes were induced, among which mental stress was the most common factor that accounted for 78.26% (54 cases). There was no significant difference in the incidence of adverse reactions between men and female (P > 0.05). From the frequency of blood donation, the incidence in the first donor was significantly higher than that in the second donor (P < 0.01). When it comes to age, the incidence was different and the 18-25 age group was the highest (1.61%). Among different blood group donations, there was no significant difference (P > 0.05). Summary/Conclusions: Adverse reactions of blood donation is closely related to the psychological state and age of the blood donors. The staff of the blood center should further optimize the service, strengthen the communication and publicize the knowledge of blood donation. The ultimate goal is to increase the blood donation rate on the basis of reducing adverse reactions. Background: Blood loss due to repeated blood donation can lead to iron deficiency or anemia, but currently there is no management plan for the prevention of iron deficiency in Korean blood donors. Female and male donors are required to wait at least 8 weeks between blood donations in Korea, which is the shortest period among all northeast Asian countries. Female and male donors are allowed to donate whole blood up to five times per year and platelets up to 24 times per year (if spaced more than 14 days apart for the latter) due to the chronic blood supply shortage. These facts induce concern about the impact of blood donations on the donors' iron status. Aims: This study aimed to evaluate the effect of oral iron supplementation in repeat donors based solely on donation history. Methods: The high-risk group included male donors with ≥4 whole blood donations or 16 plasmapheresis or plateletpheresis donations, and female donors with ≥3 whole blood donations or 12 component donations, both within the previous year. The control group consisted of first-time or reactivated (FT-RA) donors who had no history of blood donation in the past 2 years. The hemoglobin (Hb) level, ferritin level, total iron binding capacity (TIBC), transferrin saturation, and soluble transferrin receptor (sTfR) of repeat donors at high risk for iron deficiency were compared to those of FT-RA donors. Iron deficient erythropoiesis (IDE) is defined as present if the log of the ratio of soluble transferrin receptor to ferritin was ≥ 2.07. The repeat donors took iron supplements for 4 weeks and the same tests were repeated after 2 and 4 weeks to evaluate their effects and the side effect and compliance was assessed.

Results: A total of 53 male and 57 female repeat donors were recruited, and 30 each male and female FT-RA donors were recruited to the control group. After 4week iron supplementation, among male donors, the prevalence of: low Hb level (<13.0 g/dL) decreased from 24.5% to 1.9%; low ferritin level (<15.0 ng/mL) decreased from 58.5% to 3.8%; high TIBC level (>380 lg/dL) decreased from 66.0% to 37.5%; low transferrin saturation (<20.0%) decreased from 58.5% to 35.4%; and IDE (sTfR/ferritin ≥ 2.07) decreased from 28.3% to 2.3%. Among female donors, the percentage of: low Hb level (<12.0 g/dL) decreased from 43.9% to 9.8%; low ferritin level (<15.0 ng/mL) decreased from 78.9% to 11.8%; high TIBC level (>380 lg/dL) decreased from 68.4% to 24.5%; low transferrin saturation level (<20.0%) decreased from 70.2% to 22.4%; and IDE (sTfR/ferritin ≥ 2.07) decreased from 94.7% to 44.4%. In total, 15 male (28.3%) and 29 female (56.9%) blood donors reported undesirable side effects related to iron supplementation. A total of 38 male (71.7%) and 36 female (70.8%) blood donors were administered iron supplementations for 28 days. 89 participants (85.6%) answered that they were willing to take a complimentary iron supplementation. Summary/Conclusions: Ferritin level, considered a reliable indicator of iron status, increased and IDE decreased significantly after iron supplementation in female donor group, but not in male donor group, compared to the ferritin levels and IDE of control donors. Iron supplementation in repeat donors at a high risk of iron deficiency was shown to reduce their risk of iron deficiency or anemia irrespective of gender; however, 4-week oral iron supplement was not enough to restore iron storage level in the male donor group. Background: C-reactive protein (CRP) is an acute-phase protein and a non-specific maker of inflammation and tissue damage produced by the liver. Several prospective epidemiologic studies have demonstrated that high-sensitivity C-reactive protein (hs-CRP) is a predictor of future coronary events among apparently healthy men and women, hs-CRP level greater than 3 mg/L has been independently associated with a 60% excess risk in incident of coronary heart disease (CHD) as compared with levels less than 1 mg/L. Frequent blood donation has been associated with a lower incidence of Coronary artery disease (CAD); however, there is a dearth of information on serum levels of CRP in the Nigerian donor population. Aims: To investigate whether regular blood donation is associated with lower serum hs-CRP level in Nigerian blood donors. Methods: A descriptive cross-sectional study carried out to measure serum levels of high sensitive C-reactive protein (hs-CRP) and ferritin among blood donors attending the donors' clinic in Lagos University Teaching Hospital (LUTH). Subjects who did not meet criteria for blood donation were excluded. Additional data on sociodemographic characteristics was collected using interviewer-administered questionnaire. Serum ferritin was analysed using chemiluminescent microparticle immunoassay performed on the Abbott Architect ci4100 (Abbott Laboratories, Abbott Park, IL, USA). Serum concentration of hsCRP was estimated by immunoturbidimetry method using analytical kits from Erba Diagnostics Mannheim GmbH in semi-autoanalyzer (XL 180, Erba Mannheim). Data was analysed using Stata version 15 (Stata Corp) statistical software. Results: In total of 313 blood donors, 278(90.8%) were males and 28(9.2%) were females, the mean age was 32.3 AE 9.3 years. Two hundred and thirty four (74.8%) were first time donors and 79(25.2%) were regular donors, serum levels of hs-CRP was slightly higher in regular donors compared to first time donors (0.95 AE 3.7 vs 0.35 AE 1.7 mg/L, P = 0.06) though the difference was not significant. Serum levels of ferritin was significantly higher in first time donors compared to regular donors (87.56 AE 23.9 vs 46.44 AE 31.4 ng/mL, P = 0.02). Interestingly, levels of serum hs-CRP were significantly higher in male than female population (0.52 AE 2.4 vs 0.17 AE 0.2 mg/L, P < 0.03) and smokers than non-smokers (1.4 AE 4.6 mg/L vs 0.4 AE 1.9 mg/L, P = 0.02). Correlation analysis showed no correlation between serum hsCRP and serum ferritin levels in both categories of donors while there was a weak positive correlation between hs-CRP levels and White Blood Cells among the first time donors. Summary/Conclusions: This present study did not reveal any decrease in baseline levels of serum hs-CRP with regular blood donation; smoking status and gender were however associated with an increase in baseline hsCRP. This finding suggests that hs-CRP level might not be a useful marker of future coronary events in healthy blood donors in Nigeria.

Background: Because the blood donation removes 250 mg of iron from the donor, iron deficiency, frequently occurs in regular blood donors leading at a long term to the anemia. Aims: To determine the effect of blood donations on ferritin levels in regular blood donors. Methods: All prospective donors have been submitted to a physical examination and a health history assessment intended to ensure that the prospective donor is in a good general health and eligible to donate blood. The acceptance criteria are:

• Hemoglobin > or = 13.5 g/dl for male and > or = 12.5 g/dl for female • Inter donation interval = 56 days • 5 donations/year for male and 3/year for female All eligible donors and deferred donors for all reasons except for low hemoglobin who accepted to enroll in this study and signed a consent. In addition to the medical exam, two samples have been collected one for CBC and another for Ferritin. Donation history, sex, age and weight have been documented. Results: 1056 first time and regular donors accepted to enroll in this study. Only 38 female donors (3.6%) participated to this study. 11.3% of the participants were first time donor. 21% of male and 26% of female frequent donors are iron deficient 173 out of 1018 male blood donors were iron deficient (17%) with serum ferritin < 30 ng/ml. 98.8% were repeat donors. 7 out of 38 female donors were iron deficient (18.4%) with serum ferritin < 13 ng/ ml, all were repeat donors. 19.2% of repeat donors were iron deficient 3/180 of the deplete donors were first time donors Summary/Conclusions: Frequent blood donors have higher prevalence of iron deficiency than first time donors. Female donors have a slightly higher prevalence of iron deficiency than male donors. Prevalence of iron deficiency in Abu Dhabi donor population is lower than the published data. Changes need to be done on: Increase inter donation interval OR restrict the total number of allowable donations in a 12-month period for whole blood and red cells Modifying donor Hemoglobin requirements Testing for serum ferritin Iron supplementation Donor education

Abstract withdrawn. Background: Haemovigilance procedures aim to guarantee not only the safety of the recipients of blood and its components but the safety of the donors as well. Every adverse reaction that occurs during the donation of blood or its components can potentially be a threat to the health of the donor which can subsequently lead to the decision of the donor to resign from donating blood. Aims: The aim is to analyse the type and the frequency of occurrence of adverse reactions among the donors donating blood or its components independently of the method of the donation. Methods: We have analysed the number of collected donations and the number of adverse reactions in the years 2014-2018 in the group donors of aged 18-24. We have specified following adverse reactions: vasovagal response without fainting, vasovagal response with fainting, vascular reactions (bruises) and other (e.g. allergic reaction to the anticoagulant, loss of blood pressure due to hypovolemia). The analysis was made using data obtained from computer system Blood Bank which is in operation in Blood Center in Pozna n, Poland.

Results: In years 2014-2018 the total number of 1904 adverse reactions among the donors was recorded which is 0.39% of the total number of collected donations. 50% of the adverse reactions occurred in the group of donors aged 18-24. Vasovagal response without fainting was the most common adverse reaction in the total number of reactions and totalled 50.2% of all adverse reactions. In the group of donors ages 18-24 it totalled 27% of all adverse reactions. The second most common type of adverse reactions was vasovagal syncope that totalled 29.8%, in the analysed group of donors 15.96%. Vascular reactions (bruises) totalled 10.2% of all adverse reaction, in the analysed group 5.6%. The remaining adverse reactions totalled 9.8%. Summary/Conclusions: 1. Vasovagal reactions (with and without fainting) were proved to be 2 most common adverse reactions in the group of donors aged 18-24 i.e. in the groups of donors just starting to donate blood. It seems reasonable to continue with further research into the reasons for the occurrence of this psychosomatic reactions. 2. It seems beneficial to provide constant educational activities of young donors regarding the preparation for the process of donation of blood and its components (proper nourishment, hydration as well as planning the time for scheduled donation long enough for a safe and pleasant procedure. 3. It seems beneficial to provide constant training for the medical staff involved in the process of donation regarding active observation of donors, proper conduct in the situation when the adverse reactions occur during the blood donation, ways to minimize the fear of donors, effective communication with the donors (explaining the process of blood donation, proper behaviour after the donation e.g. avoiding physical exercise or straining the arm).

Blood products -Blood processing, storage and release Background: The accumulation of microvesicles (MVs) in RBC concentrates during storage may be responsible for clinical symptoms such as inflammation, coagulation, and immunization. Aims: Our aims was to determine whether any of CD molecules responsible for important functions are present on the microvesicles, and if their expression level is dependent on the storage period of RBC units. Additionally, by using cytometric analysis and phagocytosis visualization in a confocal microscope, we examined the interactions of donor monocytes with erythrocyte microvesicles, depending on their time of storage. Methods: Erythrocyte microvesicles were isolated from "fresh" (2 nd day) and "old" (42 nd day) stored RBC units. Qualitative and quantitative cytometric analysis of these membrane structures was performed using the annexin V-FITC, anti-CD235a-PE antibody, and calibrated beads. The microvesicles were also visualized under a confocal microscope. The expression of the molecules CD235a, CD44, CD47, CD55, CD59, and of phosphatidylserine was analysed using flow cytometry. Measurements of microvesicle phagocytosis by human monocytes were carried out using a flow cytometer and a confocal microscope.

Results: The analysis of the microvesicles with calibration beads allowed us to identify these structures with a diameter of about 0.5 lm in the "fresh" and "old" blood samples. We observed a statistically significant increase in the number of microvesicles in the "old" units (201 AE 139 MVs per 1 ll), as compared to the microvesicles in the "fresh" (67 AE 53 MVs per 1 ll). At day 2, the microvesicles had elevated expression levels of CD47 and reduced expression levels of phosphatidylserine. Significant changes were also observed in the case of CD55 and CD59 molecules. The expression of these molecules of vesicles isolated from "fresh" RBCs was lower than in the case of 42-day vesicles. The phagocytosis index was significantly higher (28.44%) for the microvesicles isolated from 42-day stored RBCs than for microvesicles from the 2- Background: Platelet concentrates (PCs) are conventionally stored at room temperature with a limited shelf-life of 5-7 days. Alternative storage methods, such as cold storage and cryopreservation are attractive options due to the potential for extended storage, reduced bacterial growth and improved hemostatic function. Cryopreservation of human PCs has been associated with formation of more microparticles and elevated procoagulant activity compared to liquid-stored (room temperature-and cold-stored) PCs. Microparticles are submicron plasma membrane particles that have been postulated as potential mediators of adverse transfusion outcomes. Similarities in the size and storage-related changes up to 7 days suggest that sheep may be a suitable model in which to investigate the effects of PC transfusion. Previous research has established that room temperature stored sheep PCs contain fewer microparticles than human PCs. However, nothing is known of the effect of other storage conditions. Aims: This study aimed to determine whether cold storage and cryopreservation contribute to variation in concentration and size of sheep platelet derived microparticles compared to conventionally stored sheep PCs. Methods: Sheep buffy coat derived PCs in 30% plasma/70% SSP+ were prepared with minor modifications to standard procedures for preparation of human PCs. Sheep PCs were split into 3 units (n = 6 of each) on day 2 and stored either at room temperature (RT; 20-24°C with agitation) for 5 days, cold stored for 21 days (2-6°C no agitation) or cryopreserved (À80°C with the addition of 5-6% dimethyl sulfoxide) for 33-109 days and sampled post-thaw. Platelet supernatant, prepared by double centrifugation, was stored at À80°C. The mean size and concentration of microparticles were measured using Nanosight NS300 nanoparticle tracking analysis system (Malvern Instrument). Results are mean AE standard deviation. Storage associated changes overtime were determined using a one-way analysis of variance with Bonferroni's post-test. Paired t-tests were applied to determine the effect of cryopreservation. A P-value of < 0.05 was considered significant. Results: At day 2, sheep PCs had a microparticle concentration of 3.77 9 10 10 AE0.84 9 10 10 microparticles/mL with a mean size of 156.6 AE16.7 nm. Storage duration at RT sheep PCs was not associated with significant changes to microparticle concentration or size. Cryopreservation of sheep PCs significantly increased the concentration (4.39 9 10 10 AE0.81 9 10 10 microparticles/ mL; P = 0.0087) and the mean size (170.9AE 20.5 nm; P = 0.0008) of microparticles post-thaw. The mean size and concentration of microparticles in the cold-stored PCs at day 21 was comparable to room temperature PCs stored for 5 days (165.4 AE17.5 nm vs. 163.6 AE20.9 nm; P = 0.4081 and 4.11 9 10 10 AE 0.54 9 10 10 microparticles/mL vs. 3.82 9 10 10 AE0.71 9 10 10 microparticles/mL; P = 0.16 respectively). Summary/Conclusions: Cold storage of sheep PCs did not impact formation of microparticles over the 21 days storage period; however, cryopreservation increased microparticle concentration and the size post-thaw. Further investigation is required to determine whether these findings are influence hemostatic function. A pre-clinical sheep model of cold-stored and cryopreserved PC transfusions can facilitate mechanistic studies and complement clinical trials. Background: During storage, the properties of RBC in storage solution change ("storage lesion"). For instance, pH, ATP and 2,3-DPG concentrations decrease upon prolonged storage. These changes can affect oxygen delivery by the cells. The capacity to deliver oxygen is defined as p50: the oxygen tension (pO2) at which 50% of the hemoglobin is saturated with O2. An oxygen dissociation curve (ODC) represents the non-linear relationship between saturated hemoglobin and pO2. This relationship is dependent on temperature, pH, pCO2 and 2,3-DPG. Due to changes in these factors, the curve will shift along the x-axis. In whole blood, p50 is at a pO2 of about 26 mm Hg. Not much is known about p50 of RBCs in storage solution, and the changes during storage. Aims: To determine the oxygen dissociation of RBCs stored in standard red cell additive solution SAGM and in PAGGGM (an experimental red cell additive solution, Transfusion. 2010;50:2386-92). Methods: RBCs were prepared in SAGM (n = 3) or PAGGGM (n = 3). PAGGGM is designed to better maintain both ATP and 2,3-DPG during storage. RBCs were stored at 2-6°C and sampled on day 1, 35 and 56 for (internal) pH, ATP, 2,3-DPG and p50. p50 was determined by Hemox analyzer (TCS Scientific Corp.). The principle of the Hemox is based on the measurement of spectrophotometric properties of hemoglobin at different oxygen pressure. RBC samples were brought from oxygen-rich environment to oxygen-poor environment (2%) using N2 gas. p50 was determined from the obtained ODC. Results: The whole storage period, pH i of PAGGGM-RBCs was higher compared to SAGM-RBCs. 2,3-DPG content of SAGM-RBCs decreased during storage and was below the detection limit after day 14. 2,3-DPG content of the PAGGGM-RBCs increased the first days of storage and slowly decreased from Day 7 on. At day 56, PAGGGM-RBCs still contained 2.3-DPG (2.2 lmol/g Hb). p50 values decreased during storage from 26 mmHg at day 1 to 20 mmHg at day 56 for SAGM-RBC and from 31 mmHg to 26 mmHg for PAGGGM-RBC. p50 values of PAGGGM-RBCs were higher during the entire storage period. Summary/Conclusions: During storage, the p50 decreased in all RBCs. The p50 was higher for the PAGGGM-RBCs during the whole storage period. The higher p50 in PAGGGM-RBCS seems to correlate with the higher 2,3-DPG content in these cells. Background: In Belgium 100% of the platelets are pathogen inactivated (PI) and legislation requires a minimum platelet content of 3.0 9 10 11 per Platelet Concentrates (PC). Therefore routine pools are produced with 6 buffy-coats (BC). Facing increased demand of PC and stable to slightly declining Red Blood Cells (RBC) demand, production of whole blood (WB) derived platelets must be adapted to switch flexibly from 6 to 5 BC per pool. This dual pooling strategy should allow alignment between WB collection forecast, PC inventory, PC demand and PC production. Aims: First develop a pooling procedure with 5 BC and 250 ml Platelets Additive Solution (PAS) instead of 280 ml for 6 BC, without changing the settings of our WB separators and platelets separators. Maintain a content of ≥ 3.0 9 10 11 platelets with a ratio plasma/PAS between 32 to 47% required for PI. After validation, deploy a dual pooling strategy (5 or 6 BC/pool). Methods: WB is collected with Top and Bottom Kit (COMPOSELECT; FRESENIUS KABI) and separated (MACOPRESS; MACOPHARMA) to produce 44 ml BC with 40% haematocrit (Htc) and > 90% platelets recovery with average platelets content of 1 9 10 11 . 5 random BC are pooled with 250 ml or 6 BC are pooled with 280 ml of PAS-E, platelets are then extracted on TACSI PL (TERUMO BCT) and PC are treated for PI (INTERCEPT BLOOD SYSTEM; CERUS). Each PC is sampled and platelet content is determined (ABX PENTRA XL 80; HORIBA). Results: During the study 45594 BC were processed into 8225 pools (3756 (45.7%) with 5 BC and 4469 (54.3%) with 6 BC). Before TACSI separation, BC mixture with PAS-E had volumes of 421 AE 9 ml (5 BC) and 491 AE 8 ml (6 BC) with respectively Htc of 19 AE 1% and 20 AE 2%. The plasma/ PAS ratio was 37 AE 1% in both cases. TACSI separation was performed with one same program for both types of pools. After PI, platelets content of the pools was 3.8 9 10 11 AE 0.5 with 5 BC and 4.7 9 10 11 AE 0.5 with 6 BC (Average AE Standard Deviation). Pools below the limit of < 3.0 9 10 11 were 139/3756 (3.7%) with 5 BC and 1/4469 (0.02%) with 6 BC. The platelets concentrations (10 3 /lL) were 1395 AE 167 (5 BC) and 1491 AE 155 (6 BC). Platelets recovery was 85% AE5 for 5 BC and 86% AE 6 for 6 BC. Summary/Conclusions: 45594 BC could theoretically produce 7599 pools of 6 BC or 9118 pools of 5 BC. This means a maximum potential gain of + 20% PC. In practice during shortage periods we switched from 6 to 5 BC when dictated by the actual inventory levels and hospital needs. The advantage of this dual pooling strategy was a gain in production capacity to cover these shortage periods (626 PC, +8%). The disadvantage of pooling randomly 5 BC is that 139 pools contained less than 3.0 9 10 11 platelets per pool potentially limiting their usage to low weight or paediatric patients. A preselection of the BC based on platelet count could optimize the 5 BC pooling procedure. Background: Apheresis-derived platelet concentrates (APCs) is a standard medical therapy indispensable to contrast bleeding or hemorrhage. However, bacterial infection caused by storage at room temperature (RT) still remains the major drawback. Recently, we showed that cold-stored APCs are associated with better PLT functionality but with accelerated clearance (Haematologica 2018, PMID: 30115655). Cold-induced apoptosis was identified as a potential mechanism of the shorter PLT survival Aims: To investigate the protective effect of apoptotic inhibitors during cold storage of APCs Methods: APCs were collected and stored at RT and 4°C in the presence or in the absence of caspase-3 inhibitor. The phosphatidylserine exposure and the mitochondrial membrane potential (MMP) (tetramethylrhodamine ethyl ester perchlorate [TMRE ] staining) were measured using flow cytometry. The protein expression was quantified by western blot Results: A higher expression of the apoptotic marker phosphatidylserine was detected in cold-stored APC compared to RT (% apoptotic events meanAESEM: 13 AE 1% vs. 5 AE 1% P = 0.018). To verify if the apoptotic signal, observed with phosphatidylserine, specifically involved the intrinsic pathway, the MMP was analyzed as a marker of alive cells. Interestingly, after cold storage a decrease of the MMP was observed compared to RT indicating the activation of the intrinsic pathway (Mean fluorescence intensity TMRE MeanAESEM: 6.13 AE 1.89 vs. 18.53 AE 3.64, P = 0.038). Accordingly, a decrease of the procaspase-3 level after cold storage was detected by western blot analysis. However, when PLTs were stored in the presence of caspase-3 inhibitor a significant rescue of the cold-stored cells viability was observed (TMRE staining: % alive cells meanAESEM: 74 AE 3% vs. 22 AE 3%, caspase 3 inhibitor vs. ionomycin, P = 0.005). This indicates that the activation of the apoptotic pathway, induced during cold storage, can be prevented using caspase inhibitor Summary/Conclusions: Our results show that the reduction of cold-stored PLT viability can be prevented by a specific caspase inhibitor. Consequently, cold storage, associated with a better PLT functionality, may become an efficient strategy for APC storage in combination with apoptotic inhibitors Background: Gamma-irradiation is used to treat red blood cell (RBC) concentrates (RCCs) for patients who are immunosuppressed. This treatment is known to damage RBCs and to increase storage lesions. One of the causes of the storage lesions is the presence of oxygen. Several studies have shown, based on different strategies to reduce O 2 , a reduction of storage lesions related to metabolism, protein modifications and cell morphology. Aims: The present research work investigated the effect of gamma-irradiation on RCCs stored under normal condition and hypoxia/hypocapnia. Methods: Saturation of O 2 (sO 2 )-and ABO-matched RCCs from whole blood donations, leukoreduced and prepared in PAGGSM (Macopharma, France) were pooled and split in two identical RCCs within 24 h post-donation. One bag (treated) was submitted to oxygen and carbon dioxide adsorption (oxygen reduction bag, Hemanext, USA) for 3 h on an orbital shaker (50 rpm) at 22°CAE2 and then transferred to a storage bag impermeable to gas. The other one (control) was left as it is. The two bags were then stored at 4°C. A g-irradiation treatment (25 Gy, Gammacell 3000 Elan, Theratronics) was applied at day 2 or 14 and the RCCs (expiry dates at day 16 or day 28, respectively) were stored until day 43. Hematological parameters, glycolytic metabolites, extracellular potassium level, antioxidant power, morphology and deformability were measured. Results: Starting sO 2 values were of 63.7%AE18.4 (n = 12) in control and of 20.8%AE9.8 (n = 12) in treated bags, and reached 90.8%AE9.1 and 6.6%AE5.9 at day 43, respectively. As expected, an increase in glycolysis rate was observed during deoxygenation without any influence from the irradiation. Potassium levels were identical in treated and control, and reached around 70 mM at expiry with an irradiation-dependent kinetic release. Antioxidant power and deformability were identical in both conditions. No difference in hemolysis was observed after irradiation on day 2 and the values stayed equivalent through end of storage (at day 16, hemolysis (control) = 0.37%AE0.24, hemolysis (treated) = 0.34%AE 0.15, P-value > 0.9999). When irradiated at day 14, hemolysis was lower (P-value = 0.033) in treated RCCs at the end of storage (day 28, 0.67%AE0.16) compared to control (1.06%AE0.33). Seven days post-irradiation, two-third of the control RCCs were above the limit of 0.8% whereas all the treated RCCs remain below the limit. Quantification of microvesicles and morphological analysis confirmed these data. Summary/Conclusions: The storage under hypoxia has a beneficial effect on RBC storage thanks to a decrease in O 2 content and to an improvement of metabolism. This benefit provided equivalent storage when RCCs were irradiated at day 2 and was an advantage when irradiated at day 14. Importantly, the results show that combining irradiation with hypoxia/hypocapnia retained the improved hemolysis profile of O 2 depleted RBC. In summary, the reduction of O 2 level in RCCs enables a better storage of RCC when a late irradiation is applied. Background: In vitro blood circuit machines require a constant monitoring of blood flow rate which have to be maintained at a constant value. Also, measuring the hematocrit of flowing blood in such machines is essential for performing real-time diagnostics. Recently, acoustophoresis has emerged has a promising blood separation technology capable of replacing centrifugation for the preparation of platelet concentrate. To avoid damaging blood cells, the technique is used without infusing pumps thus increasing the need of flow monitoring. However, acoustophoresis chips performs at low flow rates, outside the range of available commercial flow meters. In addition, hematocrit measurement is of a particular interest for acoustophoresis since it is a direct indicator of the separation efficiency. Aims: In this study, we present a straightforward Doppler ultrasound system designed for measuring blood flow rate and hematocrit in an acoustophoresis chip [Bohec et al, Platelets, 2017] . We show that the stability of the in vitro environment can be used to obtain high level of accuracy of the Doppler method using a basic and low-cost experimental set-up. This improvement allows a precise measurement of flow rates as low as 0.5 ml/min in sub-millimeter tubing. Furthermore we evaluate the capability of the system to measure hematocrit of human blood samples coming from different donors. Methods: The experimental set-up was constituted of an ultrasonic Continuous Wave Doppler probe mounted on a 3D printed support. The accuracy of flow rate measurements between 0.5 ml/min and 1.5 ml/min was evaluated as well as the optimal measurement time. For 4 different blood bags, the relationship linking the total energy of Doppler signals and hematocrit was derived. Hematocrit in a range under 8% was estimated from Doppler signals for each blood bag. Results: The system is able to acquire exploitable Doppler signals for the whole flow rate and hematocrit range. Flow rate estimation from the signals shows a high accuracy with a mean measurement error under 3% for a measurement time of 2s. The mean error is still under 5% for a measurement time of 0.5s. Hematocrit estimation from Doppler signals shows a good linear correlation with reference measurements for bags 2, 3 and 4. Hematocrit estimation for bag 1 diverges from reference for values above 6%.

Summary/Conclusions: The proposed Doppler ultrasound system is capable of measuring low blood flow rate in narrow medical tubing with a high accuracy. It is particularly suited for an acoustophoresis device but the versatility of the system makes it easily applicable to any in vitro blood circuit. We furthermore demonstrated that the system can be used for measuring hematocrit under 8% without additional developments. This finds interesting applications in blood sorting technologies but also demonstrates that Doppler ultrasound is a potential simple and low cost method for measuring hematocrit of flowing blood in vitro. Background: Hereditary hemochromatosis (HH) is the most common genetic disorder in populations of Northern European descent manifesting with high levels of storage iron (ferritin) in blood and tissues. The standard treatment is serial therapeutic phlebotomy to decrease iron overload. The collected blood is frequently discarded but some blood banks allow "healthy" HH patients to donate blood for patient use. Red cell concentrates from HH donors have been reported safe for transfusion, but little or no data is available on platelet concentrates from HH donors, including the potential contribution of surplus iron to the "platelet storage lesion". Aims: The aim of this study was to compare platelet quality, activation and aggregation over seven-day storage in platelet-rich plasma from patients with newly diagnosed HH and from healthy controls. Methods: Whole blood (450 mL) was drawn into CompoFlow blood bags containing CPD and SAG-M from 10 healthy controls and 10 newly diagnosed HH patients. Platelet-rich plasma (PRP) was prepared from whole blood and split into four Compo-Flex bags each containing 20 mL PRP (range 270-320 9 10 9 platelets/L). Platelet quality tests were performed on days 0, 1, 3, 5 and 7 of storage. Platelet aggregation was tested using a Chrono-Log aggregometer and four agonists (ADP, arachidonic acid, collagen, and epinephrine). Platelet expression of CD41, CD42b, and CD62P was measured with flow cytometry while pH and metabolites were measured with a blood gas analyzer. sCD40L and sCD62p in the supernatant were quantified using enzyme-linked immunosorbent assays. Results: Both HH and control groups included 7 males and 3 females. The mean age was significantly lower in the control group, 35 years (22-55 years), than in the HH group, 55.7 years (29-77 years) (P = 0.004) while ferritin levels were significantly higher in HH patients (median 847.5, range 498-1889) than in controls (median 45.8 ng/mL, range 9.28-97 ng/mL) (P < 0.001). In the HH group, 5 each had the C282Y/C282Y and C282Y/H63D genotypes. Results of PRP quality control tests were comparable between the two study groups over seven days of storage (P < 0.05) with the exception of glucose (higher in HH patients on all time points, P < 0.05). Platelet aggregation and the expression of activation markers (CD62p and CD42b) on platelets and in the supernatant (sCD62P and CD40L) were comparable between HH and control PRP units over all seven days of storage. The analysis revealed comparable and expected alterations in metabolic and platelet activation markers over seven-day storage in both groups. pH increased, glucose decreased, and lactate increased over time while CD42b expression decreased and CD62p increased. Platelet aggregation responses decreased during storage but to a varying degree depending on the agonist, however, the decrease was comparable in cases and controls. Summary/Conclusions: These results suggest that high iron stores in HH do not adversely affect the quality of platelet units produced from HH patients. Furthermore, the data also suggest that blood from HH patients, including platelets, can be donated for patient use. Background: Platelets are often shipped over long distances from collection centres to blood processing centres and subsequently to hospitals. Platelet agitation facilitates oxygen transfer, thus promoting aerobic metabolism, and maintaining platelet pH. During shipment, platelets cannot be agitated continuously, which may promote anaerobic metabolism. Previous studies have examined the effects of prolonged periods without agitation on apheresis platelets collected in plasma, but not platelets in platelet additive solution (PAS). It is therefore important to determine whether platelet quality and function are maintained during prolonged transport or hold time in a shipper.

Aims: The aim of this study was to evaluate the effects of prolonged storage without agitation on the in vitro quality of apheresis platelets in PAS.

Methods: Triple dose apheresis platelets (n = 16) were collected using a TRIMA Accel platform in 40% plasma/60% PAS (SSP+). After resting for 1 h, platelets were split equally into three components, packed into a shipper and transported immediately to the blood centre. Upon arrival, one of the platelet components was removed (<6 h; T0), and the others remained within the shipper, without agitation. The second component was removed at 6 h post-collection (T6), and the third was removed at 23.5 h post-collection (rounded up to 24 h; T24). Platelets were tested on day 1, 5 and 7 post-collection and in vitro quality and function were monitored. Data were analysed using a two-way repeated measures ANOVA, where a P-value of < 0.01 was considered significant.

Results: Platelets held without agitation for 24 h consumed significantly more glucose than those removed at 6 h or immediately upon arrival (P < 0.0001), even on day 1 post-collection. This was accompanied by increased lactate production (P < 0.0001), indicating increased anaerobic glycolysis. Consequently, the pH was significantly lower in T24 platelets (P < 0.0001), and on average it was 0.4 pH units lower than in platelets held in the shipper for 6 h or less. However, the pH remained above 6.9 in all components. Mean platelet volume was also reduced in T24 platelets (P < 0.0001), suggesting acceleration of the platelet storage lesion. Phosphatidylserine exposure, surface expression of CD62P and microparticle generation were significantly higher in the T24 platelets throughout the storage period (all P < 0.0001), suggesting platelet activation. Release of sCD62P was also increased in T24 platelets (P = 0.0006), whereas extended storage in a shipper did not affect release of RANTES (P = 0.4488). ADP-induced activation of glycoprotein IIb/IIIa, measured by PAC-1 binding, was decreased in T24 platelets (P < 0.0001), indicating reduced platelet responsiveness to agonist stimulation. Additionally aggregation in response to collagen (P = 0.0001) and ADP (P = 0.003) were significantly lower in T24 platelets, suggesting a decrement in platelet function after prolonged storage without agitation. Summary/Conclusions: Significant in vitro changes were observed in platelets held without agitation for 24 h. These results suggest that the length of time that platelets are held in a shipper should be minimised where possible. 

Background: The shelf-life for platelet products has been restricted to 5 days. This very limited window of time is intended to sustain the quality of platelet and to reduce the risk of bacterial growth. We have recently demonstrated that in suitable platelet bags, the platelet product quality remains high after 5 days of storage. This was proved by examining in vitro, the quality parameters of platelets such as platelet concentration, glucose, LDH, and pH (Alexopoulos K. et al., Haema, 9, 2018) . Our new target is to extend this research in 2 extra days of storage. We also want to determine if there is any bacterial development in this period. Aims: The goal is to investigate the capability of storage period for platelet units, from 5 to 7 days. Methods: In this study, platelets were collected from 11 normal blood donors in the Blood Bank Department of General Hospital of Patras "Agios Andreas". A total of 450 AE 10 mL of whole blood was drawn into triple CPD/SAG-M top-top bags blood container systems, Lmb Technologie (GmbH). The platelet concentrates were prepared by platelet rich plasma (PRP) method and then they were placed in a platelet incubator with agitator (Helmer PC 1200). Samples were drawn aseptically with a needless access coupler (CAIR-LGL) on days 1, 5, and 7. Platelet count was done by CEELDYN Ruby (ABBOTT All data shown are reported as mean AE standard deviation (SD). The swirling effect remained positive (+) during the seven days storage period. The bacterial screening was found negative. Summary/Conclusions: Platelet concentration in the bag remained constant between day 5 and day 7, maintaining platelet yield. The decrease in glucose and increase in lactate, along with the decreased pH, show that the platelets remain metabolically active between days 5 and 7 of storage. The pH remained well within the acceptable range. No bacterial contamination was reported. Thus, we conclude that platelet concentrates in these specific bags may be used with an extended shelf life of 7 days. Further studies are needed with other platelet bags to confirm our hypothesis.

Abstract withdrawn. Aims: We introduce RT-DC as a fast, robust and unbiased quality control tool for PC, RCC and HPSC. Utilizing the interdependency between cell deformation and the molecular state of the cytoskeleton, we demonstrate that RT-DC is capable to assess the quality of blood products. Methods: By RT-DC we assessed: i) platelets after storage at 4°C or room temperature (RT) over 10 days for 4 apheresis PCs in addition to standard in vitro platelet function assays; ii). red blood cells before and after gamma irradiation in addition to hemolysis; and iii) HPSC after cryopreservation with 5% or 10% DMSO in addition to cell count, and in vitro viability. In addition we compared the regeneration time of patients' platelets and leukocytes after transplantation of HPSC products containing either 5% or 10% DMSO. Results: For PCs standard quality assurance tests did not show a major difference between 4°C and room temperature storage while RT-DC showed a highly significant difference between both start conditions (day 1-7, P < 0.001 and day 10, P < 0.02).

For red cells, we found by RT-DC no impact of gamma irradiation with 30 Gy over the entire storage period of 42 days assessing 3 different RCC. For HPSC, RT-DC showed that cryopreservation in liquid nitrogen resulted in a significant increase in deformation (0.052 for 5% DMSO versus 0.034 for the control without DMSO; P < 0.00004). However, this did not differ to high extent whether 5% or 10% DMSO were used for cryopreservation (0.035 and 0.041, respectively; P < 0.02). HPSC viability was lower after cryopreservation using 10% DMSO in comparison to using 5% DMSO. Overall, blood cell regeneration is comparable between 5% and 10% DMSO. Summary/Conclusions: Studying platelet and red blood cell concentrates as well as hematopoietic stem cells under different, clinically relevant, storage conditions our results demonstrate that intrinsic material properties reveal insights into cell function and allow to predict cellular state in a robust way and using small sample volumes. In order to offer more flexibility to the production process, the storage of BCs overnight (16 h) has been validated in our blood center. Aims: The aim of the study was to assess the platelet quality in Platelet Concentrates derived from overnight stored Buffy Coats. Methods: Whole blood collected at day 0 was separated into plasma, BC and Red Cell Concentrates either at day 0 or at day 1. BCs were then stored until the pooling step at 20°C without agitation and PCs were prepared at day 1 by pooling 5 isogroup BCs. Seven "16 h-PCs" were prepared from BCs stored for 16 h (whole blood separation at day 0) and six "90 min-PCs" from BCs stored for 90 min (whole blood separation at day 1). Standard quality control measurements were performed during the process and the storage. In addition, the quality of the platelets into the prepared PCs was assessed throughout the period of storage by measuring the hypotonic shock response (HSR) and by measuring by flow cytometry the proportions of platelets in apoptosis (marked with Annexin V), of functional platelets (marked with CD42) and of activated platelets (marked with CD62 The changes observed during the 8-h storage period appear to be limited and compatible with a further PR process using a photochemical treatment (amotosalen and UVA) with INTERCEPT. Summary/Conclusions: Leukocyte-depleted "double dose" buffy coat platelets with a high platelet content and ready for pathogen reduction can be obtained with the IPP pooling and leukodepletion set developed by Kansuk. A storage period of 8 h before applying the photochemical treatment is feasible without significantly altering the biological quality of platelets. Methods: 32 DD-BC-PC were prepared with 8 BC and 280 ml of PAS (InterSol, Fresenius Kabi (Germany) are sterile docked to the Octopus harness and combined into a 600 ml pooling bag. The pool is centrifuged and the PC supernatant expressed through a Bioflex CS leukodepletion filter into a temporary platelet storage container. The obtained DD-BC-PC were tested within 1 h of preparation and after storage for 8 h in the platelet storage container for volume, platelet content, residual leukocytes (WBC), plasma ratio and biological parameters, pH, pO 2 , pCO 2 , glucose, lactate, MPV, LDH, p-selectin and swirling. Results: The platelet content of DD-BC-PC (n = 32) was on average 6.9 AE 0.3.10 11 in a volume of 393 AE 6 ml. The mean of plasma ratio was 42% [min: 39.3max: 43.9]. All PC contain <1.10 6 WBC [min: <LQ; max: 0.38]. pO 2 decreased from 166 AE 12 mmHg after separation (1 h) to 44 AE 18 mmHg after 8 h, pH (+22°C) and pCO 2 was stable during the same time period. Glucose decreased from 9.0 AE 0.3 mmol/l (1 h) to 8.7 AE 0.3 mmol/l (8 h) while Lactate increased from 6.07 AE 0.46 mmol/l (1 h) to 6.57 AE 0.54 mmol/l (8 h). The VPM was stable with 7.6 AE 0.2 at 1 h and 8 h. LDH increased from 120.4 AE 8.6 U/l at 1 h and 125.8 AE 10.3 U/l at 8 h as p-selectin 45.7 AE 7.6 ng/mL at 1 h and 57.7 AE 7.0 ng/ mL. All units have maintained swirling. The changes observed during the 8-h storage period appear to be limited and compatible with a further PR process using a photochemical treatment with INTERCEPT. Summary/Conclusions: Leukocyte-depleted "double dose" buffy coat platelets with a high platelet content and ready for pathogen reduction can be obtained with the platelet pooling and leukodepletion set developed by Fresenius. A storage period of 8 h before applying the photochemical treatment is feasible without significantly altering the biological quality of platelets. Background: The Irish Blood Transfusion Service (IBTS) is the statutory body with the responsibility for Ireland's national blood supply. In 2018 the IBTS collected 130,183 whole blood units and performed 9,654 platelet apheresis procedures. Blood is collected in three fixed and six mobile sites and is returned overnight in temperature controlled vans to a single processing site. In September 2017, the IBTS implemented the TACSI automated system for the preparation of buffy-coat derived platelets as an alternative to the OrbiSac system. Aims: The aim of this study is to compare operational aspects and quality data of buffy-coat derived platelets prepared by the TACSI (T-PCs) and OrbiSac (O-PCs) automated systems. Methods: QC data of T-PCs and O-PCs from years 2016 to 2018 were analyzed. In 2016, the IBTS prepared 5,609 OrbiSac platelet pools of which 5,477 were QC tested. In 2017 5,031 OrbiSac and 1,625 TACSI platelet pools were prepared and tested. In 2018 6,783 TACSI platelet pools were prepared of which 4671 were QC tested. QC data comprised PC volume, platelet content (10 9 /unit), residual leucocyte content (10 6 /unit) and pH at expiry. Feedback from the processing laboratory operators was collected comparing operational aspects of preparation of T-PCs and O-PCs. Results: From the 10,508 O-PCs tested in 2016 and 2017, mean PC volume was 292 AE 9 ml. Initially the T-PCs mean volume was 273 AE 13 ml but more recently the volumes were increased by addition of a larger volume of additive solution to 303 AE 13 ml. Platelet content (10 9 /unit) was significantly improved in T-PCs (384 AE 47) compared to O-PCs (356 AE 50) [P < 0.01] as well as residual leucocyte content (10 6 /unit) which was lower in T-PCs (0.05 AE 0.04) compared to O-PCs (0.1 AE 0.2) [P < 0.01]. pH at expiry was lower in T-PCs (7.32 AE 0.07) compared to 0-PCs (7.38 AE 0.06) but remained within the quality requirements. From an operational perspective with two TACSI devices, five operators produce approximately 48 T-PCs per hour compared to a lower throughput of 20 O-PCs per hour with five OrbiSac devices. The TACSI system is more compatible with batch processing which aligns with our staffing arrangements in routine production and has resulted in greater productivity since its introduction. With TACSI implementation, we reverted to manual pooling of buffy coats and new staff had to undergo training to achieve optimal platelet recovery. Once staff were trained during validation, we observed a 10% increase in platelet recovery. Processing laboratory staff indicated that TACSI devices were easier and simpler to maintain in comparison to OrbiSac, but highlighted that some improvements to TACSI system boxes could be made to make the system more robust. Summary/Conclusions: PCs prepared with TACSI and OrbiSac automated systems both met national and European quality requirements, however we observed a significant improvement in quality markers of PCs prepared with TACSI. Processing staff reported easier maintenance and processing with TACSI compared to OrbiSac. Throughput is higher with TACSI and there is greater additional capacity to increase production in the future if required.

A Perez Aliaga 1 , F Puente 1 , A Aranda 1 , J Domingo 1 , L Call en 1 and A Bah 2 1 Banco de Sangre y Tejidos de Arag on, Aragon, Spain 2 Terumo BCT Europe N.V., Zaventem, Belgium

Background: The Blood Bank and Tissues of Arag on (BSTA) is responsible for the collection, processing and distribution of blood in the region of Aragon in Spain. With five fixed and five mobile sites, the BSTA collects and processes 44,000 whole blood units per year. To improve quality of processed units and working conditions of personnel, the BSTA decided to implement the Reveos automated system. Validation studies were carried out in November 2012 and routine use started in July 2013. In parallel, the BSTA initiated pathogen inactivation of platelet concentrates (PC) in November 2012 to improve transfusion safety. In November 2015, the Mirasol PRT system was implemented due to simplicity of this platform. Aims: The aim of this abstract is to (i) describe the results of the validation studies carried out during Reveos implementation (ii) present routine use data of products processed with Reveos and (iii) provide information on Mirasol implementation. Methods: In 2012, 369 whole blood units were processed using Reveos. Quality parameters for red cell concentrates (RCC), such as: hemoglobin (Hb), hematocrit (Hct) and volume; plasma: volume and residual platelet content; and PCs: volume and yield, were analyzed. A control group consisting of units processed with a semiautomated platform was used as comparison. A survey was sent to the collection and processing staff for feedback on operational aspects of the use of Reveos. From 2013 to 2018, QC data of RCCs (n = 3025), plasma (n = 660) and PCs (n = 660) processed with Reveos were collected. Number of Mirasol treated PCs and hemovigilance data from 2015 to 2018 were collected. Results: Volume, Hb and Hct of RCCs processed with Reveos were significantly higher compared to control RCCs (Volume: 296 AE 21 ml vs 251 AE 19 ml; Hb: 59.9 AE 6.2 g/ unit vs 49.2 AE 7.8 g/unit; Hct: 59.5 AE 2.7% vs 56.1 AE 6.3%). Control plasma units had higher volume (280 AE 17 ml) and lower residual platelet content (9 AE 7 10 9 /l) compared to Reveos plasma units (volume: 249 AE 23 ml; residual platelet content 19 AE 13 10 9 /l). For PCs, volume was higher for units processed with Reveos compared to control (350 AE 20 ml vs 310 AE 10), but no statistical difference was observed in platelet content (Reveos: 361 AE 60 9 10 9 /unit; Control: 386 AE 80.10 9 /unit). We observed either an increase or stabilization in QC parameters of RCCs, plasma and PCs during the 5 years routine use of Reveos. For example, percentage of RCCs units hemolyzed dropped from 4% to 0% between 2013 and 2018 and platelet content in PCs increased from 370 9 10 9 /unit (first six months in routine) to 390 9 10 9 /unit. Plasma volume increased from 249 ml during validation to 267 ml in 2018. Survey results from staff highlighted the user friendliness of the Reveos device. Number of Mirasol treated PCs increased from 10% in 2015 to 59.7% in 2018 with no pathogen transmission nor serious adverse events reported following transfusion of these products. Summary/Conclusions: With implementation of two user-friendly systems, the Reveos whole blood automation system and Mirasol PRT system, we observed an increased standardization of our processes enabling us to provide higher quality and safer blood products to hospitals and the patients they serve. Background: White blood cells (WBC) may be regarded as contaminants in blood components and potentially reduce transfusion safety. There is currently enough evidence showing that WBC reduction through pre-storage filtration reduces the incidence of three major complications of allogeneic blood transfusions: febrile nonhemolytic transfusion reactions (FNHTR), refractoriness to random-donor platelet transfusions and transmission of CMV. Leukodepletion is now mandatory in Canada and several European countries. Aims: The aim of this study was to evaluate leukoreduction performance and the quality of the resulting red blood cell concentrate (RBC) produced with new quadruple system Top & Bottom IMUFLEX CRC with an integrated Red Blood Cells filter which was used in whole blood fractionation under routine conditions of San Paolo Asl blood bank Methods: Twenty-seven whole blood donations (450 ml) were collected with using quadruple blood bags Top & Bottom system with an integrated RBC filter (IMUFLEX CRC, Terumo BCT). Centrifugation and processing (using T-ACE II + -Terumo BCT) of whole blood units followed the blood bank SOP to obtain RBCs, Plasma and Buffy Coat. RBCs were diluted with SAGM (100 ml) and then filtered by gravity in average 2-3 h after blood collection to obtain leukoreduced RBC. Average temperature during filtration was 26°C. Samples were collected before and after leukoreduction for calculation of hemoglobin loss through the filtration process. Filtration time was recorded. Final Hb, hematocrit (Hct), residual platelets and white blood cells were determined after filtration using standard laboratory methods (blood cell counter) Results: WB donations (n = 27) were performed. RBC characteristics post-filtration and separation were as follows: volume (266.8 AE 17.1 ml), hematocrit (57.8 AE 2.1%) hemoglobin (19.8 AE 1.1 g/dL) and hemoglobin per unit (53.0 AE 5.4 g); residual platelets (11.7 AE 2.2 x10³/lL); residual WBCs (0 À 0.004 9 10³/lL). The mean filtration time was 19 AE 3 min and no filter blocks were observed Summary/Conclusions: The usability and performance of the new quadruple system Top & Bottom IMUFLEX â CRC with integrated RBC filter was evaluated. All quality parameters complied with Italian and European guidelines and requirements. In conclusion, the set was found to be a reliable and efficient collection and separation system that performs consistently Background: Novel devices for automated whole blood processing (Reveos TM Terumo BCT) have been installed in Regional Center for Blood Donation and Blood Treatment in Katowice to modernize and automate production of blood components. This system allows to separation of four whole blood units into four buffy coat depleted red blood cell concentrates (RBC), four units of plasma and four interim platelet concentrate (IPU) units in one automatic cycle. An IPU is the starting blood component for the production of pooled, leucoreduced platelet concentrates (LPC). Residual leukocytes (WBC) are obtained as a byproduct and discarded. The use of this system shortens production time because it combines otherwise two separate steps: centrifugation and blood separation in press. Aims: To evaluate the quality of the blood components obtained with the newly developed Reveos NLR kits, which are a whole blood collection kits containing no leucocyte reduction filter for the RBCs.

Methods: Blood [WB] was collected into NLR Reveos set (Terumo BCT), and processed between 2 and 8 h from collection using the 3C protocol. Quality control was performed on RBC, plasma and IPU. RBC were tested for hemoglobin (Hb) content, hematocrit (Ht), residual white blood cells (WBC), volume and hemolysis level on the last day (42 nd day) of storage. The content of WBC and platelet count (PLT), protein, factor VIII on the day of production and after one month of storage were determined in plasma. For IPU, platelet and leucocyte counts, volume and average platelet yield index (PYI) were displayed at the device after processing was recorded. Furthermore, a comparison between fully automated and semi-automated whole blood processing was done, by comparing the amount of time necessary to fractionate 4 whole blood units using the two different processes. Background: Direct, single step automatic blood separation devices (Reveos TM Terumo BCT) was installed in Regional Center in Katowice in 2018. The system allows for full automation of whole blood fractionation. One of produced blood components is an interim platelet unit (IPU), containing most of the platelets and limited of white blood cells (WBCs). It is then pooled through a filter to form a therapeutic unit of leucoreduced platelet concentrate (LPC). A rough estimate of the platelet yield in the IPU, the so-called platelet yield index (PYI) is calculated and displayed by the device after the end of the separation phase. It is a useful tool to optimize selection of IPU for pools to produce LPC. Aims:

To determine the quality of polled LPC obtained on the basis of IPU from whole blood processed up to 8 h after collection and the usefulness of this method in daily practice. Methods: IPUs used for production of LPC were obtained using fully automated whole blood processing single step system -Reveos TM (Terumo BCT). From the beginning of the application of the method, 1005 therapeutic units of LPCs were produced after overnight hold: 38 pools of 4 IPUs and 966 of 5 IPUs were made using Platelet Pooling Set (Terumo BCT), using 250 ml SSP+ solution (MacoPharma).

Results: 42 therapeutic units of LPC were analyzed. The mean volume of LPC was 387 AE 13 ml, platelet content was 3.67 AE 0.46 x10 11 , and white blood cells (WBC) count was 0.15 AE 0.13 x10 6 , 100% all LPCs had WBC below 1 9 10 6 . pH measurements were made on the fifth day of storage, the pH was determined in 15 units of LPC and was 7.2 AE 0.04. Summary/Conclusions: The use of interim platelet units in daily practice increases the possibility of producing high quality blood components for patients and is a great alternative to the laborintensive manual methods of LPC's production. Background: The development of cold-stored platelets has been hampered by the rapid removal of blood after transfusion by apoptosis and desialylation due to platelet storage lesions caused by refrigeration. Previous studies have shown that antioxidants inhibited the activation and desialylation of cold-stored platelets for 5 days and also inhibited rapid elimination after transfusion in animal models. Aims: It was tried whether in long-term (10 days or longer) storage conditions, antioxidants showed similar effects inhibiting the activation and desialylation of cold-stored platelets. Methods: Platelet-rich plasma (about 250 mL) were obtained from a healthy blood donors of type O blood group and divided into a 30 mL platelet storage bag manufactured by the manufacturer, and the conditions including room temperature and refrigerated condition and various kinds of antioxidants were prepared, (PH, glucose, lactic acid) and activation index (CD62P, GPIba (CD42b), Annexin V), degree of reactive oxygen species and sialidase activity on the 7th, 10th and 12th day, and phagocytosis using the HEPG2 cell line And platelet recovery after in vivo transfusion using SCID mice were compared and compared. Results: Cold-stored platelets showed autoaggregation on the 2nd day of storage, and apparent aggregation on the fifth day of visual observation but not in the antioxidanttreated group. As expected, the pH, glucose and lactate levels of the cold platelets were maintained and the platelets at room temperature changed significantly. NAC (N-acetylcysteine) -treated platelets were less active on day 12 and sialidase activity was maintained lower than that of control group on day 12. The degree of phagocytosis by the HEPG2 cell line remained at the same level during the storage period, and the in vivo recovery rate in the animal model was superior to that of the antioxidanttreated cold platelets for 2 h and 24 h after transfusion. Summary/Conclusions: Cold platelets could be developed as clinically effective agents for up to two weeks if appropriate preservatives were added, and antioxidants, especially N-acetylcysteine, were effective. Background: The Reveos 3C procedure produces the following three blood components for transfusion: plasma, RBCs, and a single interim platelet unit (IPU). Whole blood is collected into the Reveos Blood Bag Set and held at room temperature a minimum of 2 h before processing on the device. After processing on the Reveos device, the plasma product is ready to freeze. The RBC product is ready to combine with SAG-M additive solution and leukoreduce using the integrated leukoreduction filter. The IPUs are rested and agitated for the recommended time. For example, when whole blood is processed within 8 h of collection, the IPU is agitated overnight before pooling. Because the IPU is made from one unit of whole blood, approximately 4 to 6 IPUs are pooled together and leukoreduced by filtration prior to storage in a platelet storage bag. This leukoreduced platelet pool (4 units) can be supplied to the demand of hospitals like a Platelet apheresis product. Aims: To assess the usability of the Reveos Automated Blood Processing System to collect units of whole blood and to process the units on the Reveos device, producing blood components that meet product quality specifications. Methods: This study will evaluate approximately 19 units of whole blood using the Reveos system and approximately 4 units of pooled platelet products. A total of 19 units of whole blood (WB) have been collected into the Reveos blood bag set and then held at room temperature without the use of an active cooling system (or temperature control system), such as cooling plates, or in this case, ice packs. Of the 19 units, 10 units have been processed on the Reveos device using the fresh procedure (within 8 h of collection). Nine units have been processed using the overnight WBhold procedure. All units have processed successfully without alarms, resulting in three components (RBCs, Plasma, Platelets). We also evaluated four platelet pools created from eighteen interim platelet units (IPUs). One IPU has been discarded due to a 22-min whole blood collection time. The leukocyte count on all component using the automatic Sysmex-XN 2000 cell blood counter. Results: The Red Blood Cells meet the criteria for hematocrit, hemoglobin and residual WBC counts are less than 1 million per unit. The Plasma units meet the criteria for displayed volume accuracy compared to measured volume and also for Factor VIII levels. The average residual platelets in plasma levels meet the criteria. The platelet pools meet the acceptance criteria for platelet yield and volume. Limited data (n = 4) suggests that this criteria will be easily met, provided that WB hold conditions are suitable for platelets. Summary/Conclusions: Final results indicate that products produced from the Reveos system meet or exceed product quality expectations. Staff report that the Reveos system is very easy to use.

Abstract withdrawn. Background: Thorough manual mixing of overnight-held whole blood (WB) units prior to centrifugation to separate red cell (RC) from platelet-rich-plasma (PRP) is currently practised at the Hong Kong Red Cross Blood Transfusion Service (HKRCBTS). The mixing step is crucial to maximise platelet yield but laborious, and may cause elbow and wrist injuries in operators. A laboratory shaker, Reax 20 (Heidolph Instruments, Schwabach, Germany), originally designed for mixing solvents, was modified to allow mixing source WB units by the supplier. To enhance the well-being of the operators in the context of occupation health and safety (OH&S) management, feasibility of the application of such blood mixer to replace the manual mixing steps in blood component preparation was explored. Aims: To evaluate the in vitro quality control (QC) parameters of the blood components prepared with the use of the modified mixer. Methods: Fifty-eight WB collections, including 40 units in 450 mL quadruple bags (450Q) with/without integrated leucofilter and 18 units in 350 mL quadruple bags (350Q), were processed in accordance with HKRCBTS' prevailing component processing protocols except using the motor-driven mixer in lieu of manual mixing. WB collections were divided into 2 groups, mixed at 2 revolutions per minute (rpm) for 2 min (n = 30) and 30 min (n = 28), then processed into RC, PRP platelet and plasma components. In vitro QC assessments including haematocrit (Hct), haemoglobulin (Hb) and haemolysis at expiry for RC; absolute platelet count and pH for platelet concentrates (PLT); volume and residual platelet count for plasma units were evaluated and compared.

Results: All components derived from both 450Q and 350Q processed with the blood mixer fulfilled the QC requirements stipulated by AABB Standards and Council of Europe (CoE) Guidelines. There were no significant differences for all the QC parameters in RC and plasma components produced when mixed for 2 or 30 min. Summary/Conclusions: The overall performance of blood components processed with the motor-driven mixer met the acceptance criteria at the HKRCBTS in accordance with the AABB and CoE standards. Higher platelet yield was observed with prolonged mixing for 30 min. However, prolonged mixing will much delay routine component processing. Further evaluation on intermediate mixing time such as 3, 5 or 10 min may help determine an optimal mixing duration to maximise platelet yield without compromising processing workflow. To conclude, using the modified blood mixer to replace laborious manual mixing in components preparation is promising to improve the OH&S for blood component preparation operators. Background: Leukocyte reduction is widely used to reduce the risk of non-hemolytic febrile transfusion reactions and alloimmunization by multiple blood transfusions. Around and after year 2000, universal leukocyte reduction was adopted in many developed countries. There are mainly two types of filter, one to filter whole blood and the other to filter red cell concentrate (RCC) used during pre-storage blood processing. Aims: In this study, we conducted the filtration tests with Sepacell TM RS2 for RCC in comparison with Sepacell TM R-S11 and Sepacell TM Pure RC widely used in the world. Background: The Cardarelli Hospital Blood Bank processes over 40,000 whole blood units yearly. In order to constantly cope with the huge demand for platelets from Oncohematology and Intensive Care departments, a progressive review of the processing protocols for platelet concentrates (PC) from buffy-coat (BC) pools has recently been implemented to reduce the number of units assembled, from 5 (routine in Italy) to 4. The 4-BC PC units have slightly lower volume and plasma content, factors that further limit the transfusion risk. In addition, the 4-BC assembly allows to facilitate the production of the PC units obtained from the same blood type, in order to minimize both the adverse reactions related to the ABO/Rh incompatibility and the amount of BCs not used. Finally, the described innovation also impacts on the workload, with reduction of assembly, centrifugation and separation time.

Aims: The aim of this work is to define an optimized protocol for the preparation of PC units from 4-BC pools, so that the platelet yield is always higher than the minimum value required by current regulatory (2.0 9 10 11 cells/unit). Background: Blood is a basic component for human life and hence blood transfusion is an integral intervention in the treatment of patients. The need of blood transfusion is increasing with decreasing blood supply due to limited blood donations. Conversely wastage of blood products is also a topic for discussion. To ensure the availability of blood products when they are needed, wastage of blood products should be controlled and minimized. Aims: The study was designed to investigate the quantity and reasons of wastage of blood products at our hospital.

Methods: This was an observational study based on the statistical data available from blood bank department of NIBD and BMT, PECHS campus, Karachi, Pakistan. The study period was from February 2018 to February 2019. Study was approved from institutional review board. For all the blood products wastage and reasons of wastage were evaluated. Frequencies were calculated by using SPSS version 23.0 Results: A total of 2880 blood products were available at our institute including 960 each of platelets, pack red cells and fresh frozen plasma(FFP). The overall wastage rate was 3.5%. Pack red cells and platelets were fully consumed yet shortage of supply was observed. However, highest wastage was observed in FFP in our blood bank i.e. 102(10%). Results of investigating the common causes of blood product wastage at the hospital revealed that it was highly associated with 02 common causes, including the expiry of unused products 60(59%) followed by broken bags 30(29%). Summary/Conclusions: This study showed over all diminutive wastage rate. FFP wastage was highest among all the blood products. Wastage of blood products is a genuine issue in a hospital setup, strategies and plan of action should be discussed and implemented including enhanced collaboration with other centres to outsource the blood products or even donate at times, education and training of staff for better clinical use of blood products and ensure the availability when and where they are needed most. Background: In the early 2000s, the blood service of the Republic of Kazakhstan functioned along the lines of the Soviet period: donation of blood was approached to the place of its use (carried out at hospitals), screening of donor blood was carried out at one stage (enzyme immunoassay) on analyzers of semi-automatic type, there was no mechanism calculating the cost of blood components, the activity of blood centers was funded at the rate of 1 liter of whole blood. Donation was not popular in society, household fears of infection were common when donated. Aims: Research objective is to study the main stages of reforming of blood services of the Republic of Kazakhstan (RoK).

The research methods are based on the system analysis of the condition of the RoK's blood services based on the indicators of production activity for the period of 2010-2017.

Results: In order to effectively reform the blood services, the following steps were taken. The blood supply was centralized and optimized. Blood collection at hospitals was terminated, more than 200 blood collection subjects were closed. The result was a more efficient use of technical, human and financial resources, as well as ensuring the high quality of the blood components produced. Today, there are 18 blood centers in the republicone for each of the 18 administrative territorial units of the republic. The screening of donor blood for transfusion infection markers has been transferred into a two-step principleimmunological analysis and NAT testing. A fully automated analytical equipment of a closed type is used for screening, unified for all blood centers of the republic. Unification of the equipment choice allowed to provide centralized service maintenance of complex equipment and its uninterrupted operation.

Since 2012, the national reference laboratory has been operating in the blood service, which conducts an external assessment of the quality of laboratory research in blood centers, as well as research in controversial and complex cases. Introduced pathogen inactivation of platelet concentrates in 100% of cases of platelets. Erythrocytes are used only in the weighing solution and only after leukoreduction. The use of resource-saving blood harvesting technologies, as well as methods to further enhance the infectious and immunological safety of components, are expanding annually. The foundations for the development of applied scientific research in the field of transfusion medicine were laid, and an own school of transfusiologists was created. As a result of reforming the blood services, the mechanisms of reimbursement of blood services costs from the budget of the republic have been changed, uniform tariffs have been defined by type of blood components for all blood components suppliers in the country. Summary/Conclusions: The transformations made it possible to create a blood service in Kazakhstan that corresponds to the best international practice and ensures the quality, efficacy and safety of transfusion therapy. Further development of the blood service is aimed at deepening reforms, studying and developing cellular technologies, new properties of plasma blood components, and improving the clinical practice of using donor blood components. Background: Reconstituted platelet concentrate (RPC) is a component that contains platelets (thrombocytes) resuspended in plasma that is blood group compatible with the recipient. It is used when transfusion of platelet concentrate is necessary but the fresh platelet concentrates of the specific blood group are not available. Group 0 Rh-(negative) platelets resuspended in the AB group plasma are of universal use as such components can be used for all recipients independently of their blood group. In the area of activity of Regional Blood Center in Poznan RPC is used most often for patients after stem cell transplant incompatible with their blood group. Aims: The aim of the analysis is to evaluate the loss in the number of platelets in the reconstituted platelet concentrates in order to determine their quality and usage. Methods: We used for the analysis 30 units of pooled platelet concentrate derived from buffy coats and 30 units of pooled platelet concentrate derived from the apheresis. For the reconstitution group AB plasma was used.

We investigated the number of platelets prior to and after the reconstitution. Following measures were calculated: number of platelets in pooled platelet concentrates derived from buffy coats, number of platelets in pooled platelet concentrates derived from apheresis; average values and the standard deviation as well as the loss in number of platelets due to the reconstitution. The number of platelets was calculated with impedance method using Horiba Pentra XL 80 analyser.

1. Pooled platelet concentrates derived from buffy coats the number of platelets before the reconstitution: 4.12 9 10 11 /unit AE 0.50 the number of platelets after the reconstitution: 3.40 9 10 11 /unit AE 0.50 the loss in the number of platelets: 17.5% 2. Platelet concentrates derived from apheresis the number of platelets before the reconstitution: 3.68 9 10 11 /unit AE 0.55 the number of platelets after the reconstitution: 2.91 9 10 11 /unit AE 0.49 the loss in the number of platelets: 20.7% Summary/Conclusions: 1. Reconstitution results in the loss of 17.5% of platelets in comparison to the initial value of pooled platelet concentrate derived from buffy coats. 2. The average number of platelets after the reconstitution is 3.4 9 10 11 /unit, which fulfils the quality requirements. 3. Reconstitution results in the loss of 20.7% of platelets in comparison to the initial value of pooled platelet concentrate derived from apheresis. 4. The average number of platelets after the reconstitution is 2.9 9 10 11 /unit, which slightly deviates from the quality requirements. 5. The results that we obtained show that the process of reconstitution always results in the loss of number of platelets and that the quality of platelet concentrates that have not been reprocessed is always higher. Because of that we recommend that the reconstitution should only be performed in special cases such as for patients after stem cell transplant incompatible with their blood group and that hospitals should be supplied with platelet concentrates derived from buffy coats and apheresis.

Methods: PF4 was extracted from human PCs by using immunoaffinity chromatography and specific anti-PF4 antibody on the column. Hereafter, PF4 was purified with concentration tubes having 5 kDa molecular weight cut-off and dialyzed via dialysis tubing with 3.5 kDa cut-off. PF4 concentration was measured by Bradford method. Specific enzyme-linked immunosorbent assay (ELISA) and dot blot analysis were used to determine the PF4 specificity. Molecular weight of obtained PF4 was determined by polyacrylamide gel electrophoresis (PAGE). Results: Our data confirmed clearly that separated PF4 had 30 kDa molecular weight which is corresponding with a tetramer PF4. In addition, ELISA showed that the PF4 qualified true antigenicity. Dot blot analysis helped us to assure the specificity of PF4. Summary/Conclusions: We used and optimized a homemade protocol to isolate and purify the PF4. Nevertheless, there was no any scientific report among the databases that utilized the similar purification method. Recombinant PF4 is more feasible and ready-to-use, but its price may discourage the researchers to study the biology of PF4. Unused human PCs and specific anti-PF4 antibody can considered as an alternative to separate the PF4 particularly in labs with the shortage of resources. Background: Whole blood is increasingly used in civilian hospitals as an alternative to blood components in trauma resuscitation with massive bleeding. However, the hemostatic effect of whole blood depends on the initial platelet content and decreases rapidly within the first 2 weeks of storage at 4°C. Consequently the problem arises of how to provide WB to trauma centers without losing valuable low titer group O units if the units are not used within the expiry date of use. Aims: To assess the in-vitro quality of Red Cell Concentrates (RCC) produced from 7 days cold stored leucodepleted whole blood units filtered with a platelet-sparing whole blood filtration filter in order to save the RCC once the WB units has reached the expiry date.

Methods: 34 units of whole blood were leucodepleted within 24 h using a platelet sparing filter (Imuflex WB-SP/Terumo BCT) and stored for 7 days at 4 AE 2°C. On the 8 th day of storage, units are centrifuged and the RCC is supplemented with SAG-M additive solution for an additional storage of 35 days at 4 AE 2°C. In vitro parameters such as hemoglobin, hematocrit, residual leucocytes, platelet content, hemolysis, glucose, lactate, ATP, 2.3 DPG were tested during storage. Results: The Imuflex WB-SP provided satisfying leucodepletion of the WB units (0.23 AE 0.2.10e6/U)) while maintaining 80% of the initial platelet content (85 AE 20.10e9/U). Mean volume (464 AE 24 mL), hemoglobin content (54 AE 6 g/U) and hematocrit (36 AE 3%) was within conformance range. After 7 days of storage, 50% of the initial platelet content at collection is maintained and mean hemolysis is 0.27 AE 0.15%. RCC processing at day 8 was uneventful, without loss of hemoglobin or noticeable hemolysis. Mean volume (266 AE 20 mL), hematocrit (56 AE 3%), hemolysis (0.18 AE 0.19%) were in conformance with mandatory standards at day 8. After 7 days of storage (i.e. day 14 after collection), RCC quality parameters were maintained with however an increase in hemolysis (0.34 AE 0.36%) which was above usual values routinely observed with RCC produced from day 1 processed units. 3 RCC out of 34 were above the maximum limit of 0.8% at day 14 after collection Such increased hemolysis was more pronounced at day 28 after collection (0.70 AE 0.45%) with a proportion of RCC with a non-conforming hemolysis ratio above the accepted threshold (20% of the tested units). Summary/Conclusions: RCC units can be readily obtained from leucodepleted WB units with spared platelet contents after 7 days of cold storage. In vitro quality attributes of such RCC are within conforming ranges for hemoglobin, hematocrit, volume and hemolysis. Hemolysis increases more rapidly than in standard RCC, thus limiting the possibility of use within 21 days after collection. Additional studies are being initiated to reduce hemolysis during storage.

G Hetland 1,2 , F Mahmood 3 , L Nissen-Meyer 1 and I Nentwich 1 1 Immunology and Transfusion Medicine, Oslo University Hospital 2 Immunology, University of Oslo, Oslo 3 Immunology and Transfusion Medicine, Akershus University Hospital, Lørenskog, Norway

Background: Allergen-specific IgE in donors' plasma can be transferred from blood donors to recipients via plasma-containing products and consequently sensitize recipient's effector cells bearing receptors for IgE (mast cells, basophils, thrombocytes etc.). These cells can then degranulate after exposure to allergen. This can cause allergy symptoms of various degrees (Johansson, Allergy, 2005) . Food allergen-specific IgE antibodies, although causing mild or no symptoms in blood donors, can be of clinical importance to plasma recipients due to varying sensitization and activation grade of recipients' effector cells.

Aims: The aims of the study were 1) to assess sensitization profiles against an array of 55 allergens in 100 randomly selected blood donors and 2) to identify donors with high concentrations of food-specific IgE antibodies that could bear risk of clinically important sensitization of plasma product recipients. Methods: We tested serum samples from 100 blood donors randomly selected on one donation day outside the pollen season. We used 300 ll serum per sample in a multiplex IgE line-blot enzymoimmunoassay for 55 analytes (Euroline Atopy Screen, Euroimmun, Germany), which comprised 28 food allergen extracts and single allergens, 24 inhalant allergen extracts, 2 insect venom extracts and one carbohydrate allergen CCD. This high-throughput method enables scanning of 44 serum samples for IgE against 55 allergens in less than 3 h. Results are expressed as EAST (enzymoimmunoassay) classes: class 0 (no sensitization), 1-2 (weak sensitization), 3 (moderate sensitization), 4-5 (strong and very strong sensitization). Results: EAST class, allergen, number of samples. Food allergens: class 5none detected. Class 4, sesame seed: 1. Class 3, apple 1; hazelnut 2. Class 2, apple 1; almond 2; hazelnut 1; sesame seed 1; soybean 1; cow milk alpha-lactalbumin 3. Class 1: 26 donors weakly sensitized to one or more allergens as kiwi, apple, almond, hazelnut, sesame, soybean, wheat, mutton, beef, cow milk beta-lactoglobulin and alpha-lactalbumin. We did not find any donors sensitized to apricot, peanut, rice, rye, yeast, cow milk casein and carbohydrate allergen CCD. Insect venoms: Class 5, 4 and 3 none, class 2, wasp venom 7; honey bee 2. Lower classes (0-1) not reported in this abstract. Summary/Conclusions: We found considerable sensitization to inhalant allergens but such sensitization probably represents low risk of clinical allergies due to passive transfer of antibodies. Sensitization to insect venoms was negligible. We disclosed only one blood donor (1%) with high IgE to sesame seed with a potential to transfer clinically relevant IgE antibodies via plasma products. The need for a broad screening of donors for IgE sensitization remains still questionable. Background: The platelet storage lesion (PSL) is one of the key factors that limit the platelet shelf-life to 5 days. The mechanisms mediating the PSL are not well understood, but it is becoming increasingly evident that platelets from some donors do not store as well as others. Similarly, assessment of many in vitro quality parameters has been used to predict transfusion outcomes, with varying degrees of success. Donor attributes such as age, and body mass index (BMI) may contribute to these differences. Aims: To characterise the variability in the quality and function of apheresis platelet donations and to examine associations between donor attributes and platelet characteristics.

Methods: Apheresis platelets (n = 53) were collected, stored at 22°C with agitation, and tested at day 1, day 5 and 7 post-collection. VWF and fibrinogen binding (indicators of platelet adhesion; AE ristocetin stimulation), phosphatidylserine (PS) exposure (annexin V binding) and microparticles (CD61 + /annexin-V + ) were measured by flow cytometry. Platelet aggregation was initiated with collagen, thrombin or arachidonic acid. Thromboxane A 2 (TxA 2 ) was measured by ELISA. The proportion of procoagulant platelets (% COATED platelets) was assessed by fibrinogen binding following collagen/thrombin stimulation. Platelet-attached glycans were measured using flow cytometry and lectins Ricinus Communis Agglutinin-1 (RCA-1; detecting galactose-residues) and Wheat Germ Agglutinin (WGA; detecting sialic acid and Nacetyl-D-glucosamine, GlcNAc-residues) AE stimulation with ristocetin. Donation time, donor age, blood pressure (BP) and BMI were recorded. Linear regression was performed using GraphPad Prism software.

Results: For many of the parameters measured, there was high inter-donor variability. Platelets from subsets of donors showed up to 4-fold higher VWF and fibrinogen binding, formation of COATED platelets and microparticle numbers. Binding of lectins was also highly variable between the donors, indicating variability in sugar cleavage. Following ristocetin stimulation, binding of all lectins increased, and again there was high variability in the responses, with up to 4-fold higher binding in platelets from a subset of donors. Of particular interest, aggregation in response to arachidonic acid was observed in only 27% of platelet donations tested; although platelets from non-responders aggregated in response to the collagen and thrombin. TxA 2 was also higher in the arachidonic acid responders (P = 0.027). There were few associations between platelet parameters and donor attributes, and these associations were typically weak. pH at day 5 was weakly associated with donor age (P = 0.009, R 2 =0.2613) but not BMI (P = 0.9143, R 2 <0.001), with a trend towards lower pH in younger donors. Summary/Conclusions: These data indicate that apheresis platelet products are highly variable. Whilst donor characteristics may have some influence on the quality of the donated platelet product, there is a high level of inherent inter-donor biological variability. A much larger sample size is required to confirm these findings, and determine whether they have clinical implications. Background: The frequency of beta thalassemia mutations, and thus, of beta thalassemia heterozygotes (b-thal-het) is particularly high in certain geographical regions. It has been reported that a significant proportion of donors (occasionally more than 10%) are b-thal-het that meet the criteria for blood donation (Hb > 13.5 g/ dL). Red blood cells (RBCs) of b-thal-het donors are characterized, in vivo, by particular geometry and redox status. Despite sporadic indications that the RBC storage lesion may be milder in b-thal-het, targeted research on this donor group is still missing. Aims: The aim of this study was to investigate whether b-thal-het RBCs storage at blood banks leads to a distinctive hemolytic, physiological and redox profile, thus, making b-thal-het a unique blood donor group.

Methods: Blood samples from 10 healthy non-smoker donors (5 b-thal-het carriers and 5 controls) were analyzed before and after preparation and storage of leukoreduced packed RBC units in CPD/SAGM at various time intervals. Susceptibility in hemolysis (in the presence/absence of oxidative, mechanic and osmotic stimuli), redox status (lipid peroxidation, reactive oxygen species (ROS) accumulation, antioxidant capacity), intracellular Ca 2+ and proteasomal activities were determined. For statistical analysis, significance was accepted at P < 0.05. samples from the red cell units were collected aseptically, processed (dual centrifugation at 3,000 g for 15 min) and stored at À80°C. Processed samples were thawed, and then analysed using the Nanosight NS300 nanoparticle tracking analysis system (Malvern Instruments). Samples from all time-points from each unit were analysed on the same day. Data were analysed by one-way ANOVA with Bonferroni's multiple comparisons test. Results: At d2, red cell units contained an average of 8.1 9 10 9 AE 4.0 9 10 9 MVs/ mL. The mean size of these MVs was 112.8 AE 10.5 nm and the mode size was 79.9 AE 10.3 nm. The concentration of MVs increased gradually throughout storage (P = 0.0276), reaching a maximum at d42 of 32.4 9 10 9 AE 1.8 9 10 9 MVs/mL. Both the mean (P < 0.0001) and mode (P < 0.0001) size of the MVs increased during storage; however, this size increase primarily occurred in the first week of storage (d2 vs. d7: P < 0.0001 for both mean and mode). By d42, mean and mode size of MVs was 176.1 AE 4.8 nm and 171.8 AE 5.6 nm Summary/Conclusions: Nanoparticle tracking analysis demonstrated the presence of MVs smaller than 400 nm in red cell units. Both the concentration and size of MVs present in red cell units increased during the 42 days of routine storage. The concentration of these MVs was approximately 100-fold higher than we had previously detected using flow cytometry (Aung, Pathology, 2017) indicating the advantages of more sensitive techniques in characterisation of MVs.

Background: The lack of availability of sterile saline in a format suitable for use in blood centers for manual washing has led to an urgent need for blood services to consider alternative methods. For operational flexibility it would be desirable to be able to produce a washed RBC unit that had a shelf life longer than 24 h. Aims: The aim of this study was to validate the manual method for washing RBCs using SAGM solution both as wash and storage solution and to ascertain whether an extended storage period for washed RBCs may be feasible. Methods: Six 14 day old leukocyte depleted red blood cells (LD-RBC) and six 4 day old LD-RBCs were manually washed and stored in SAGM, and half of the units were pre-stored irradiated (25 Gy). A volume of 350 mL wash solution (SAGM) was added to the LD-RBSs by sterile connection. After mixing the units were centrifuged for 6.5 min at 2888 9 g at 4°C (Hettich Roto Silenta 630 RS) before removing the supernatant using CompoMat G5 extractor. Wash procedure was repeated twice using 450 mL SAGM solution, and after removal of the last supernatant, 100 mL of SAGM solution was added. All units were immediately measured for volume, haematocrit, albumin, IgA, potassium, haemolysis, haemoglobin, pH, glucose and lactate and tested again after 24 h, 7 days and 14 days storage at 4 AE 2°C.

Results: All washed LD-RBCs met European specification for haematocrit (0.50-0.70) and all but one for Hb content (≥ 40 g/unit). Hemolysis increased during storage. The rate of hemolysis in irradiated LD-RBCS was greater over time than in nonirradiated units. All units, both irradiated and nonirradiated, met European specification for hemolysis (less than 0.8%) 14 days after washing. After wash, potassium levels were low and then increased during storage; increase was greater in irradiated than nonirradiated units. Potassium concentration 14 days after washing and irradiation did not exceed those levels found at the end of shelf life (day 35) of standard LD-RBCs. pH decreased during storage due to the metabolic activity of red blood cells converting glucose to lactate. The pH level of the supernatant depends on the age of the unit and not on the irradiation. The glucose concentration of the supernatant after washing is high due to SAGM solution. The concentration of glucose decreased and lactate increased due to the metabolic activity of red blood cells. There is currently no specification in Europe or Finland for IgA in washed RBCs. AABB and American Red Cross Rare Donor Program stipulate that level of IgA should be less than 0.05 mg/dL (0.5 mg/L). Our IgA method 0 s lower limit for detection is 0.05 mg/L and all results were below this level. Total albumin were well below Finnish specification (<250 mg/unit). Background: Room temperature has been the standard storage condition for platelets since the 1970s, when it was shown that this improved in vivo survival compared to when stored at 4°C. However, storage at room temperature has several disadvantages, including risk for bacterial contamination and short outdating. Recently, the interest in cold-stored platelets increased, especially for patients with a hemostatic need. Using extensive analysis techniques, we evaluated the in vitro quality of cold stored platelets in additive solution.

Aims: Investigation of the in vitro quality of platelets stored at 4-9°C in PAS-E. Methods: Three experiments were performed, in which two platelet concentrates, prepared from 5 buffy coats and 300 mL of PAS-E (PCs) were pooled and split in equal PCs. PCs were stored for 23 days at 4-9°C, one of each pair with agitation on a flatbed shaker and the other without agitation. Various parameters were analyzed to study the in vitro quality during storage and compared to routine room temperature storage.

Results: During cold storage, the swirling phenomenon disappeared within one day. Due to the lower temperature, metabolism of the platelets was lower as compared to room temperature storage. The metabolic conditions were acceptable with pH d1-d16: 7.05-6.77 with platelet count 400 9 10 9 /U and glucose still at 2 mM at least until 16 days of storage. Platelet activation maintained acceptable levels with CD62P expression < 30%, while PS exposure increased rapidly; >20% after 6 days of storage. Aggregation tests showed functional platelets until 13 days of storage. Agitation during storage had no effect on any of the tested parameters. Summary/Conclusions: During storage of platelets at 4-9°C, the hematological parameters and pH met routine requirements, while swirling phenomenon disappeared already at the first day. The functionality of the platelets did not decrease during cold storage, indicating that the swirling phenomenon is not a good surrogate marker under these conditions. The strong increase of PS exposure might be involved in the observed short survival of cold-stored platelets. Platelet concentrates stored at 4-9°C are potentially suitable as a hemostatic agent for patients with a bleeding in need of platelets, but more studies are needed. Aims: The goal of the study is the reinforcement of platelet reserves for case of emergency events and increasing their availability for treatment, preferentially in patients with massive bleeding. Methods: We performed a comparative study with CPP and FP in vitro. Buffy coatderived pooled leukoreduced platelets 0 RhD negative were frozen in 5-6% DMSO and stored at À80°C for 6 months. CPP were thawed at 37°C, then reconstituted in platelet additive solution SSP+ and compared to FP. We measured these parameters: platelet content, platelet concentration, platelet loss during preparation process, coagulation properties, volume, pH, DMSO concentration, titres of anti-A and anti-B antibodies.

Results: The average platelet loss after the process of freezing and reconstitution was 24%. The amount of platelets and platelet concentration in unit was lower in CPP compared to FP, but high enough (amount 194 9 10 9 /unit, concentration 0.73 9 10 9 /unit). Both types of PLTs (either PCC or FP) maintained an acceptable pH during storage. Swirl was on value 3 in FP and on value 1 in CPP. The average plasma content in FP was 31% compare to 3.22% in CPP after reconstitution. Measured titres of IgM anti-A and anti-B antibodies were very low (0-1:2). CPP had faster clot initiation (ROTEM clotting time (CT) in CPP 69.2 s, FP 81.8 s). CPP contributes to a sufficient clot (ROTEM maximum clot firmness (MCF) in CPP 39.8 mm, FP 53.2 mm). Summary/Conclusions: Our results shows, that CPP have higher procoagulation activity and simultaneously lower clot firmness. Thawing and reconstitution of platelets are easy and fast processes if platelet additive solution is used. This method helps to increase the availability of platelets in emergency medicine. Low plasma content in CPP enables their use as washed platelet product in specific groups of patients.

Methods: After donation, the whole blood was stored in room temperature overnight before separating next morning by Reveos â system. Seven ABO compatible IPUs, each with a target volume of 24 mL, were selected and then they were connected to the pooling set provided by Terumo BCT. Prior to the pooling of IPUs, 250 mL of additive solution (T-PAS+ provided by Terumo BCT) was added and distributed evenly between the IPU bags. The pooling set was then kept 1 h on bench in room temperature followed by 1 h on agitator at 22 AE 2°C. After filtration, the pool might be manually adjusted if its volume exceeded the maximum of 420 mL to meet the requirements by the INTERCEPT TM Blood System. The final products were two pathogen-reduced platelet units with a shelf life of 7 days. Results: During validation of the method, 12 pathogen-reduced platelet units were controlled, in addition to the platelet count, for pH, glucose, pO2, pCO2 and lactate on day 2, 5 and 7 of storage. The platelet count was 2.27 AE 15 9 10 11 per unit on day 2. The pH value was 6.9 on day 2, 7.1 on day 5, and 6.9 on day 7. The glucose concentration decreased from 5.8 to 3.5 and 1.6 mmol/L on day 2, 5 and 7, respectively. The mean pO2 level was 25.3, 25.0 and 28.7 kPa while the mean pCO2 was 3.8, 1.7 and 1.8 kPa and the lactate concentration was 5.9, 9.6 and 12.9 mmol/L on day 2, 5 and 7, respectively. Since routine implementation of the method in April 2017, regular quality controls showed an average of platelet count of 2.63 AE 34 9 10 11 (n = 161) with a volume of 204 AE 7 mL per unit. Summary/Conclusions: The validation of the method and the following two years of experience in routine shows that the pooling of 7 IPUs processed in Reveos â system meet the requirements needed for INTERCEPT TM DS processing set for pathogen reduction of platelets. The results from the quality controls of the final platelet units were in accordance with the local and EU guidelines. Methods: Data was analyzed from 11 published and unpublished clinical studies that performed both primary and secondary testing of platelets using the BTA System. The studies included apheresis and whole blood derived buffy coat platelets and tested 4-10 mL sample volume per culture bottle. The 11 studies classified results based on AABB Bulletin 04-07 definitions with some modifications. The following assumptions were made including:

• Data was summarized as total number of positive tests, observed by the total number of tests performed on each day post collection;

• It was assumed that one test was performed per platelet unit; • All units eligible for secondary testing were negative by the primary test

The data needed to demonstrate a benefit for the use of the BTA 3D Systems for detecting contamination that was not revealed by previous bacterial testing as well as clinical specificity.

Results: A total of 217,932 platelet units from the studies where secondary testing of platelets was performed were analyzed. Platelets were tested on day 3, 4, or ≥ 6, and represented 8.9%, 44%, and 47% of the units tested, respectively. True positives were detected in 174 platelet units representing 0.08% of the total platelets tested. The majority were reported from platelets tested on day ≥ 6 with a total of 128. Data showed the BTA 3D System used for secondary testing detects the most prevalent contaminates reported, Staphylococcus spp., in ≤27 h with the majority detected in ≤24 h after incubation, allowing for interdiction of the units prior to transfusion. Instrument specificity was reported in 5 of the 11 studies for platelets tested at 3 days and ≥ 6 days with a total false positive rate of 0.27% (range of 0-1.1%). Instrument sensitivity when used for secondary testing could not be determined since subculture of negative bottles is not performed during routine use. During previous validation testing of LRAP and LRWBPC, 1,136 culture bottles were confirmed true negatives by subculture. Summary/Conclusions: Data from the studies that tested platelets at 3 to 8 days post collection provided evidence that the BTA 3D with BPA & BPN detects contaminants missed in previously tested platelet units. The data supports that the BACT/ALERT 3D System is an effective safety measure for secondary testing of platelet products to extend platelet dating beyond day 3 and up to day 7 when testing is performed using the test parameters described in the BPA and BPN bottle IFUs and according to the FDA Draft Guidance. Background: Magnetic nanoparticles have recently shown great potential in nonradioactive labeling of platelets. Platelet labeling efficiency is enhanced when particles are conjugated with proteins like human serum albumin (HSA). However, the optimal HSA density coated on particles and the uptake mechanism of single particles in platelets remain unclear. Aims: We characterize the interaction between single particles and platelets and determine the optimal HSA amount required to coat particles. Methods: Ferucarbotran iron oxide nanoparticles were coated with HSA in different amounts (0.5-2 mg/mL) and we confirmed successful HSA coating by addition of a crosslinking HSA antibody (dynamic light scattering). We labeled platelets from pooled platelet concentrates with 2 mM ferucarbotran coated nanoparticles and analyzed labeled platelets for iron content (atomic absorption spectroscopy) and particle localization (transmission electron microscopy). Single-molecule force spectroscopy was used to determine binding forces of nanoparticles to platelet compartments. We applied HSA-particles via linkers of different length (i.e. short~2 nm, medium 30 nm and long~100 nm) on the cantilever tip and let them interact with a platelet provided on a collagen surface. After interaction we determined the rupture force required for platelet retrieval. Results: The iron content per platelet reached a maximum at 0.5-1.0 mg/mL HSA coated particles with 0.57 AE 0.36 and 0.54 AE 0.39 pg/platelet, respectively. However, the 1.0 mg/mL HSA coating resulted in~100-fold higher binding affinity to platelets than particles coated with 0.5 mg/mL HSA. Depending on PEG length between tip and particle, particles interacted differently with platelets as shown by one, two or three force distributions of 80, 220, and 360 pN, which correspond up to three different binding pathways, respectively. The results indicate that a particle can interact with three targets including platelet membrane, open canalicular system, and platelet granules. Summary/Conclusions: Our results reveal mechanism of platelet-particle interaction on a single particle level and provide an optimal HSA concentration coated on particles to gain maximal platelet labeling efficiency. Labelling of platelets by magnetic nanoparticles may substitute radioactive labeling. Results: The activation/lesions on total platelets and small and medium-sized platelets platelet population was detected on storage day 3, by the increased expression of CD36. The percentage of CD36-positive cells among the population of large platelets did not change during storage. On the day 3, increased expression of CD42b and CD62p was detected, but only on large platelets. Small and medium-sized platelets had increased CD62p expression only on day 5. The expression of CD42a on total platelets increased significantly on day 3, and stayed unchanged until day 5. The same pattern of CD42a expression was detected for small and medium-sized platelets, whereas on large platelets the expression continued to increase until the end of storage. A decreased percentage of CD41-positive cells was detected among the total platelets and populations of medium-sized and large platelets. The storage induced externalization of phosphatidylserine on total platelets or on any of the platelet populations was not detected. The levels of TGF-b and P-selectin in the PC-BC supernatants were unchanged during the 5-day storage period. Increased annexin and PF4 concentrations were detected on day 5. The concentration of b-TG increased on day 3 of storage, and continued to rise until the end of storage. Summary/Conclusions: The evaluation of expression of activation markers on different platelet populations could be used as an additional analysis in quality control of platelet concentrates, and in the assessment of novel approaches to platelet concentrate manipulation i.e. for testing new additive solutions, cryoconservation protocols, and cryoprotectants.

Background: The primary goal of autologous blood transfusion is to reduce the risks related to allogeneic blood transfusion, including transfusion-associated graft-versus-host disease (TA-GVHD). Although downward trends in rates of autologous blood transfusion have been reported in Europe and the Americas, it still plays a role in eliminating risks related to allogeneic blood transfusion in Japan, especially TA-GVHD. Since February 2009, the transfusion service in our hospital has managed 3 autologous blood conservation techniques and helped to prevent mistransfusion by employing a bar code-based electronic identification system. Aims: The objective of this study was to determine the use of 3 types of autologous blood components in a single institution over an approximately 9-year period. Methods: Between February 2009 and December 2017, we retrospectively analyzed autologous blood transfusion, including perioperative autologous cell salvage (PACS), pre-operative autologous blood donation (PAD), and acute normovolemic hemodilution (ANH). We investigated the use of autologous blood components and the rate of complying with electronic pre-transfusion check at the bedside in the operating rooms. We also determined the adverse reactions to autologous blood transfusion, which were categorized according to the definitions proposed by the International Society of Blood Transfusion (ISBT) Working Party on Haemovigilance.

Results: A total of 9,193 patients (9% of whom received operations) received blood transfusion, of which 5,080 (55%) received autologous blood transfusion alone, 2,101 (23%) both autologous and allogeneic blood transfusions, and 2,012 (22%) allogeneic blood transfusion alone. The rate of autologous blood transfusion among patients who received blood transfusion was 78%. PACS units were transfused to 5,830 patients (60%), PAD units to 2,845 patients (30%), and ANH units to 982 patients (10%), and multiple blood conservation techniques were used for one patient. The overall compliance rate with electronic pre-transfusion check at the bedside in autologous blood components was 98.6%. Adverse reactions were observed only with PAD transfusion and not PACS nor ANH. The number and rate of adverse reactions to PAD transfusion were 12 and 0.1%, respectively, of which the most common was febrile non-hemolytic transfusion reaction at 9 (75%), followed by allergic reactions at 2 (17%), and hypotensive transfusion reaction at 1 (8%). The severity of adverse reactions to PAD transfusion was Grade 1 (non-severe) in all cases, and no serious adverse reactions were observed. Among PAD units, the rate of adverse reactions to whole blood PAD units was 0.55%, that to frozen PAD units was 0.05%, and that to autologous FFP units was 0.10%. Summary/Conclusions: Our observations indicate that the rate of autologous blood transfusion among patients who received blood transfusion was 78%, when all types of autologous blood conservation techniques were included. To accurately determine the rate of autologous blood transfusion in a hospital, it may be better for the transfusion service to manage all types of autologous blood conservation techniques. they are now clinically available as a blood product. The residual plasma level of this product, which is prepared using the automated cell processor ACP215 (Haemonetics Corp.), is approximately 1%. Recently, a retrospective multicenter study was reported that this product was effective and safety for prevention of recurrent or severe transfusion reactions. PLT products are generally stored with continuous agitation to maintain their quality. The interrupted agitation of PLT suspended in additive solution (plasma carryover: 3-40%) for up to 24 h was previously found to have only a slight impact on in vitro PLT properties. However, in some small hospitals with no agitator, if the initiation of transfusion is delayed by an emergent change in a patient's condition, the interruption of agitation may be prolonged. Aims: The aim of this study was to evaluate the effects the interruption of agitation for 48 h (shelf life of WPC in Japan) on the in vitro qualities of PLT. Methods: Leukoreduced apheresis platelet concentrates in 100% plasma were washed on day one after blood collection using the automated closed-system cell processor ACP215 (N = 6). WPC, which were rested 1 h after preparing, were divided equally into control and test units using polyolefin containers on day one. Control units were agitated from days one to seven. Test units were stored without agitation from days one to three, and agitation was subsequently performed until day seven. Both units were stored at 20-24°C. In vitro PLT quality was examined on days one, three, four and seven. Results: The PLT concentration of prepared WPC was 110.9 AE 1.9 (910 10 /L) and the volumes of the control and test units after the division were 120 AE 11 and 123 AE 12 (mL). The pH values of the test units on day three were lower than those of the control units; however, the pH of both units were maintained at higher than 6.85 during the seven-day storage period. Swirling was well maintained and no clumping was visible in both units during storage period. No significant differences were observed in PLTs concentrates, MPV, HSR, Aggregation response. The pCO 2 , pO 2 , bicarbonate, glucose and lactate mean values of test units were slightly lower or higher than those of the control units on days three or four. The levels of CD62P expression were significantly higher in the test units than in the control units on days three (52.6% AE 6.0 vs 40.9 AE 5.7, P < 0.01); however, this difference decreased in a time-dependent manner after agitation resumed. The levels of CD42b expression of test units were relatively lower than those of the control units until day seven, but no significant difference between the two units. Background: Monitoring residual white blood cells (rWBCs) is a requirement for quality monitoring (QM) the production of leucocyte depleted blood components. Although flow cytometry is widely used for monitoring rWBC, there are no widely accepted methods to accurately and consistently measure rRBCs in blood components. Sysmex have developed a novel algorithm, termed the Blood Bank (BB) mode for their XN-series of haematology analysers which is specifically designed to quantitate the levels of rWBCs and rRBCs in blood components. Aims: We have previously assessed the linearity, accuracy and reproducibility of the BB mode on spiked samples in an R+D lab. We sought to further assess the performance of the BB software in a routine, high throughput blood component manufacturing department.

Methods: Units of plasma, platelets (PCs) and red cell concentrates (RCCs) were produced according to standard UK specifications within NHS Blood and Transplant (NHSBT). QM of residual cells was tested using the BB mode whilst rWBC was additionally analysed by flow cytometry using BD LeucoCOUNT kit.

Results: During a 2-month field trial over 10,000 data points were collected representing all types of manufactured component. For some PCs, BB mode results from some sample tubes that did not contain EDTA gave very high rWBC values, indicating a potential large number of LD failures. The results were significantly different from those obtained from PCs using EDTA samples (P < 0.0001) which did not show the same high values. For RCCs or plasma, the range of results from plain and EDTA tubes were not significantly different (P ≥ 0.3246). The analyses of LD platelet and plasma concentrates by either BB mode or flow cytometry both show more than > 90% of LD components have less than 1 9 10 6 rWBC/Unit. For LD failures (n = 14) there was a good correlation (R 2 =0.9848) between flow cytometry and BB mode measurements. Spiking studies suggested that the limits of detection and quantitation of rRBC were around 6 and 8 rRBC/lL respectively. Residual red cell counts from manufactured components showed a wide variation in their numbers between units. As expected platelet production methods also showed a significant difference (P < 0.0001) in rRBC contamination, with lower levels in apheresis platelets (median = 15 RBC/lL, n = 1820) compared to those produced from buffy coats (median = 783 RBC/lL, n = 77) In our hands, although the time taken to analyse samples is similar for flow cytometry and BB mode, considerable time can be saved on manual handling and the processing of samples for flow cytometry (approximately 2-3 h for 60-90 samples). Summary/Conclusions: We have been able to embed the Sysmex BB mode into a routine production environment and confirm that its performance in spiked samples is mirrored in routine use. For platelets, sample collection in EDTA is essential. The BB mode offers an opportunity to reduce operator time compared to flow cytometry whilst gaining additional information on rRBC.

Abstract withdrawn. Results: In our experiment, the typical size of a spectrin matrix section (L) was 60 to 220 nm (without oxidation). The heights (h) of dips were 4 to 10 nm. Due to oxidation, the junctional complexes between spectrin and membrane proteins can rupture. Only 10% to 15% of the spectrin surface has the same structure as in the control group. The values of L and h vary significantly depending on the intensity and time of exposure. We observed significant changes in the spectrin matrix after exposure to UV radiation in a model experiment. The local topological defects in the membrane arise from the action of oxidizing agents on the red blood cells. The mechanism of their appearance is connected mainly with the distortion of the spectrin matrix. As a result of oxidation processes, the spectrin molecules can be damaged. There is a transformation of tetramers to dimers. Additionally, it can be easily seen with the AFM, that spectrin network structure was essentially destroyed. Most parts of the spectrin matrix have damaged structures with mesh breaks and dips after UV irradiation. Also the results of network distortions in response to temperature changes were obtained. There are presented preliminary results of spectrin matrix change during long-term storage of pRBC. Summary/Conclusions: Atomic force microscopy in direct biophysics experiment allows to observe and to quantitatively measure the disturbances in the spectrin matrix nanostructure in response to oxidation processes in RBCs. These studies are important for the fundamental research of interactions of RBCs on the molecular level during redox processes and the consequences to their structure and function on the cellular level. This is important for the advancement of transfusion medicine, intensive care medicine, and molecular and radiation biology. Methods: Blood samples were taken from 8 donors during a prophylactic examination and collected with EDTA-filled microvettes (Sarstedt AG and Co., Germany). All experiments were carried out in accordance with the Institute guidelines and regulations. The polylysine-coated glass was used to perform the sedimentation method for formation of native RBC smears. It is important that any fixatives weren't used. The stiffness of RBC membranes was studied in native RBCs (control) and native cells after the application of modifiers: glutaraldehyde, hemin, Zn 2+ (heavy metal ions). Local stiffness was studied by atomic force spectroscopy (AFS) (NTEGRA Prima, (NT-MDT, Russian Federation). Results: Experimental kinetic curves I(z) were measured. Nonlinear fitting method was used to determine the Young's modulus. The experimental dependences of membrane bending were approximated by the Hertz model to a depth up to 600 nm. The Young's modulus E = 10 AE 5 kPa for control RBC. It was shown that some natural oxidants (hemin), membrane fixatives (glutaraldehyde) modifiers, heavy metal ions (Zn 2+ ) significantly increased the absolute value of the Young's modulus of RBC membranes up 2-3 times. The biophysical parameter Hertz depth (h Hz ) was determined for each curve. Under the influence of modifiers the Hertz depth h Hz was changed from 200 nm to 600 nm. There are presented preliminary results during long-term storage of blood. Summary/Conclusions: The blood rheology is determined by RBC deformability, associated with membrane stiffness. The Young's modulus can be used as a quantitative criterion to estimate the membrane state of a native cell. The results of the work can be used in clinical practice, in assessment of the quality of donor blood during storage before transfusion, in biophysical studies of RBC state.

Abstract withdrawn.

Immunohemotherapy, Centro Hospitalar Universit ario São João, EPE, Porto, Portugal

Background: Transfusion of blood and blood components is an essential resource in modern medicine. A proper use of human blood, being an irreplaceable resource, is necessary in order to achieve minimal wastage. Blood wastage may occur for a number of reasons, like expiry date, haemolysis, seroreactivity or low volume. Monitoring wastage of blood product during collection, testing and processing of blood is used as a quality indicator. Aims: To determine the annual rate of discarded blood components due to expiry date in a Portuguese University Hospital Blood Bank (BB) from January 2016 to December 2018, in order to implement appropriate measures to minimize the number of discarded blood to a reasonable rate. Methods: We retrospectively analysed the rates of blood components discarded after meeting their expiry date of a Portuguese University Hospital Blood Bank from January 1st 2016 to December 31st 2018.

Results: A total of 54,599 whole blood units and 3,166 apheresis platelets were collected during the study period. Of the 66,289 blood components (packed red cells, whole blood pooled platelets and apheresis platelets) prepared during the study period, a total of 2,891 (4.4%) blood components were discarded, of those 75.4% due to expiry date. The rate of discarded packed red cells, according to this component production, decreased considerably over the years, in 2016 was 5.6%, in 2017 was 3.8% and 0.2% in 2018. Similar tendency was shown in the pooled platelets for 2 consecutive years with 4.8% (2016) and 3.8% (2017), but with an increase in 2018 (7.7%). The rate of apheresis platelets had a more variable behaviour from 2016 to 2018 with rates of 1.3%, 0.6%, and 0.9% respectively. Summary/Conclusions: Blood transfusion is an essential part of patient care. For this reason, the implementation of a quality system and continuous evaluation of all activities of the BB can help to achieve maximum quantity and quality of safe blood. We identified that date expiry was the main reason of discarded blood components, although there was a significant decrease in the rate of discarded packed red cells over these three years. Properly implemented blood transfusion policies, donor screening and training staff as well as implementation of automation also helps to improve the process, reducing the discarding rates of blood and blood component. Background: Storage performance of platelets (PLT) is associated with age of the donor. The risk for PLT with poor storage performance, characterized by high lactate production and rapid acidification of a PLT concentrate (PC), shows a positive correlation with age. We wished to explore whether high lactate production was associated with donor health issues. Aims: To investigate high lactate production by stored platelets in relationship to donor health. Methods: Single-donor PC were collected by apheresis or prepared from 1 buffy coat and donors were evaluated who could be marked as 'rapid acidifiers'. In total, 31 apheresis PCs and 66 PCs from whole blood were included in four studies. Information about donor health was obtained either from the blood bank information system or using questionnaires. In some donors, the lipid profile was measured from plasma, and the diabetes marker HbA1c from red cells. Triglyceride levels > 2.5 mmol/L and HbA1c levels > 42 mmol/mol were defined as high.

Results: Twenty two percent (21/97) of the donors were marked as 'rapid acidifiers' and 71% (15/21) of these donors had health issues. 'Rapid acidifiers' were of age 57, 31-69 (median, range) years. Three groups of donors can be distinguished: a) Donors affected by metabolic syndrome, prediabetes and Type 2 diabetes, indicated by high cholesterol and/or triglycerides, high HbA1c and/or the use of medication to treat diabetes. b) Donors affected by vascular diseases who reported or used medication to treat high blood pressure. c) "Other" donors who used other medication to treat various other conditions. The remaining 'rapid acidifiers' (29%) did not have high triglyceride or HbA1c levels and did not report health issues. Summary/Conclusions: PCs with rapid acidification by high lactate production are mainly collected from older donors with health issues. We postulate that high lactate production by stored PLTs is associated with health issues, and we will combine detailed donor information (health and behavior) with in vitro quality for a significant number of donations. Background: The development of applied biotechnologies requires a search and creation of new methods of cells' functional completeness analysis. The instrumental assessment of platelets quality for the selection of the most effective donors, quality assessment of platelet concentrates for short and long-term storage and for the selection of platelets for cryopreservation is in demand in blood service. Assessment of platelets morphofunctional status is possible using morphological studies of various platelet granules fractions (Makarov, Med. Alfavit, 2012). Among the biologically complete platelets there is a special population of cells, the so-called granule-rich platelets (GRP). These cells contain the largest number of cytoplasmic granules (more than 10 visually distinct granules). It is established that GRP have increased viability and functional activity. Earlier we found a correlation between the GRP level in blood plasma and shift of the redox potential value in blood plasma after cryodestruction of platelets (Tsivadze et al., Doklady Physical Chemistry, 2016). It was suggested that the shift of the redox potential may be partly due to the release of the low molecular weight antioxidants contained in functionally complete platelets outside the cell. In turn, the concentration of low molecular weight antioxidants can be estimated using the cyclic voltammetry. Aims: The aim of the study was to estimate of cyclic voltammetry method possibilities for quality assessment of platelets. Methods: The functionality of platelets was examined in platelet concentrate (PC) obtained by apheresis (1246.8 AE 90.1/lL). Voltammetric analysis in PC before and after the platelets cryodestruction was carried out on platinum electrode in the potential range from À600 mV to +1100 mV using a potentiostat IPC Pro L and saturated Ag/AgCl electrode as reference. For the morphofunctional analysis platelets were vitally stained with fluorochrome stains trypaflavin and acridine orange. Microscopic examination of platelets was carried out using confocal microscope Nikon Eclipse 80i. The following parameters were evaluated: concentration and percentage of platelets with granules and concentration and percentage of GRP. Results: Voltammetric studies in PC show that there are two oxidation peaks of low molecular weight antioxidants on voltammogram at potentials + 500 mV and + 800 mV. Analysis of PC before and after the cells cryodestruction showed that changes in the height of oxidation peaks occur, indicating an increase of antioxidant content in blood plasma. At the same time a correlation between the changes in the height of oxidation peaks and the GRP content in the sample was found. In samples with reduced initial GRP content (less than 10%) after the cells cryodestruction significant changes in the height of oxidation peaks were not observed, regardless of the total number of cells in the PC. Summary/Conclusions: In conclusion, voltammetric analysis allows to indirectly estimate the population of functionally active platelets that in combination with other methods of analysis can serve to assess the quality of platelet products. Background: Determination of hemoglobin derivatives in blood is one of the most important studies in clinical laboratory diagnostics, especially during the storage of donor blood and its transfusion. Concentration of hemoglobin derivatives can be changed during redox process. Aims: to show the possibility of using non-linear Fitting method to calculate concentrations of hemoglobin derivatives during reduction-oxidation processes. Methods: For this we performed model biophysical experiment, in vitro. Blood samples were collected into EDTA microvettes from 4 healthy donors (Sarstedt AG and Co., Germany) during prophylactic examinations. All the donors gave their consent to participate in the study. A suspension of erythrocytes was prepared in PBS buffer with pH 7.4. We used ultraviolet (UV) irradiation of blood or NaNO 2 as oxidizing agent. The drug cytoflavin (STPF "POLISAN", Russian Federation) was used as an antioxidant. In our study we used digital spectrophotometer (Unico 2800, USA) to measure the absorption and scattering of light (0.5 nm step). The method of Nonlinear Fitting was used to find the concentrations of hemoglobin derivatives. The empirical spectrum D l (k) exp was approximated by the theoretical curve D l (k l ) theor , which fits the experimental curve in the best way. Under approximation the light absorption by different hemoglobin derivatives was considered in model. Simultaneously effects of Rayleigh light scattering on structures with size D<< k (coefficient S) and light scattering on particles with size D≥ k (coefficient K) were taken into account: D l (k l ) theor = e HbO2,l C HbO2 L+ e Hb,l C Hb L+ e MetHb,l C MetHb L+ e HbNO,l C HbNO L+ e MetHbNO2 -,l C MetHbNO2 -L+ e MetHbNO,l C MetHbNO L+K+S/k 4 l (1), where e h,l is the molar absorption coefficient for each Hb h derivative at given wavelengths k l , C h is the concentration of the derivatives Hb h , L is the thickness of the solution layer, D l (k l ) is the optical density of the substance, K and S are the parameters of the model. Results: We determined the concentrations of hemoglobin derivatives without any additional chemicals in blood. There were measured experimental spectra for different agents action on blood. It was shown that concentration of MetHb increased after UV irradiation and NaNO 2 action (up to 90%). There were calculated C h for each Hb h derivative. It was established that theoretical curves coincide with experimental data with good accuracy (R 2 = 0.98). Incubation of RBCs with cytoflavin leads to reduction of MetHb to HbO 2 . Summary/Conclusions: The determination of hemoglobin derivative concentrations by the method of Nonlinear Fitting (without adding special chemical agents to blood) can be used for measurement of carboxyhemoglobin in blood during toxic state of organism. Also it is important for assessment of RBCs quality before blood transfusion. Background: The use of in line leukoreduction filters have been highly expanded in Iranian Blood Transfusion Centers within the last decade in order to provide sufficient leukoreduced blood fractions from healthy safe frequent blood donations to be supplied to the leukocyte sensitive patients. Leukoflex LCR5, the dominant brand of such filters procured by Iranian Blood Transfusion Organization, is the most updated generation of the filters used around the world. Aims: In this study, it is tried to recover the trapped leukocytes from this novel filter by different buffering systems and having optimized the elution mode, the cell differential of the viable recovered white blood cells were determined by flow cytometry. Methods: Having passed the routine virological tests, eight Leukoflex LCR5 leukoreduction filters freshly used in Tehran Blood Transfusion Center were daily collected and each were back flushed by a self-designed mechanical system (a peristaltic pump, a triple junction with regulator part and an air pump) using various conditions and additives for PBS buffer at different pHs in order to find the highest recovery yield for Leukocytes. The optimized elute was characterized by flow cytometry for subcellular profile to be determined. Results: It was illustrated that a system consisting of PBS (without CaCl2 and MgCl2) in pH 7.2 containing 2 mM EDTA and 4%(w/w) Dextran 40 without additive amounts of Triton X100 was the most optimized buffering system for LCR5 filter back flushing. Total cell content was also determined as 6.28*10 8 Granulocytes, 4.27*10 8 Lymphocytes and 0.8*10 8 Monocytes using auto hemoanalysis and flow cytometric methods. Summary/Conclusions: In addition to partly compensating of the overhead expenses inflicted by application of leukoreduction filters on healthcare system, the results will assist blood organization system to be more classified in rational profile design, future cell therapy strategies and exceptional blood management. Also, the recovered cells could be of significance in stem cell science, cellular interaction studies as well as novel molecular developments in drug discovery.

Vox Sanguinis (2019) Results: Three lines of strategy are in place to pursue self-sufficiency of the largest number of PDMPs. First strategy line: maximizing the yield of driving proteins, represented by Immunoglobulins (Ig) and albumin; this was assured by CSL Behring with a yield of 5.2 g Ig (70% intravenous -Privigenand 30% subcutaneous -Hizentra) and 26 g albumin (Alburex) per Kg plasma fractionated, corresponding to 998.000 g Ig and 4.992.000 g albumin; based on present demand, this represents 97% and 100% self-sufficiency, respectively, for NAIP regions. Second strategy line: ensuring other products from plasma fractionation; the fractionator granted 6.000 g fibrinogen (Riastap) and 6.000.000 IU vWF/FVIII (Haemate P) per year, which corresponds to the present demand of NAIP Regions for both products, but it is under the full potential of plasma, thus providing a high margin of safety in case of increased demand (now the case of fibrinogen). Third strategy line: exchanging cryoprecipitate, Fibrinogen and vWF with Italian Regions whose plasma is fractionated by other companies to obtain Prothrombin Complex Concentrates (PCC -Kedcom) and Antithrombin (ATKED) as to satisfy NAIP regions demand; this strategy allowed a supply of 5.000.000 IU AT and 3.000.000 IU PCC, capable of ensuring self-sufficiency for NAIP Regions until 2020. Summary/Conclusions: In Italy, differentiation of plasma contract manufacturing among companies with different portfolios allowed NAIP Regions to obtain a significant contribution to self-sufficiency from VNRD plasma for a variety of PDMPs by different and complementary strategies consisting in maximizing the yield and the portfolio of proteins from the fractionator and exchanging products among Regions for other PDMPs at high demand but not included in the portfolio of a single fractionator.

PLASMA CHECK SYSTEM: A VALUABLE TOOL FOR PLASMA FREEZING VALIDATION AND MONITORING.

Background: The validation of plasma freezing processes may result problematic in the monitoring/control of critical process parameters (CPP). In 2017 in Italy 923,944 litres of plasma were produced and frozen. Aims: In order to assist plasma freezing validation and CPP monitoring, 151 of the 176 Italian BEs performing plasma freezing utilize the Plasma Check System (PCS), a system able to record, store and certify the temperature (T) detected at the core of "surrogate" bags during the entire freezing session, consistently with GMP requirements. PCS is patented and commercialized by Expertmed Srl, Verona, Italy (http://www.expertmed.it). Methods: PCS consists of 3 parts: a) "surrogate" bags (Check-bags) of 250 and 700 mL corresponding to the average standard volumes of the real products, containing a fluid validated to simulate the thermal behaviour of plasma; b) a mobile probe (Cryo-Med) positionable at the core of the Check-bags; c) a dedicated software (Memo-Track). Plasma freezing session data are tracked via barcode/RFID and can be consulted by the PCS that associates blast freezer code, operator code, Cryo-Med and Check-bag. Data on plasma freezing are stored in a shared folder and transferred to the BE information system. The PCS can also be used to check and monitor the out-of-storage variations of core T of frozen plasma unit, i.e. during labelling and packaging procedures, thus allowing to establish optimal timeframes and operations and suitably validate these procedures. In the period 2016-2018, at the Pievesestina BE of Emilia Romagna region 210,871 plasma units were frozen so as to allow complete freezing within 60 0 to a temperature below À30°C, in 8,349 freezing sessions, using the PCS both for process validation, change control and for the systematic monitoring of core T at each freezing session. Furthermore, at the Bologna BE 108 tests on the out-of-storage conditions of plasma units were carried out to revalidate the procedures of labelling and packaging.

Results: Out of 8,349 freezing sessions carried out at the Pievesestina BE, 27 (0.3%) were detected to fail to reach À30°C at the core of the Check-bags within 60 0 . Of the latter, in most cases (70%) a technical error in the activation of the Cryo-Med was identified. In addition, the PCS was systematically utilized for periodical revalidation of the freezing procedures. The tests performed at the Bologna BE to validate the out-of-storage procedures of frozen plasma labelling and packaging allowed to modify the operating procedures in place so as to establish optimal timeframes and operations. This prompted corrective actions regarding: i) number of units to be taken out of storage sites at each labelling session (<24 units), ii) labelling time (<8 0 ), iii) optimal storage T (À40°C vs. À30°C), iv) optimal time between two openings of storage sites (>30 0 ). Summary/Conclusions: The PCS is a valuable system for plasma freezing validation and monitoring, as well as to perform monitoring and control of the whole pathway of frozen plasma in the BE. It is a technologically advanced, easy-to-use and costeffective tool that can efficiently replace other traditional methods commonly used for the above-mentioned purposes.

ASSESSMENT OF BLOOD GROUP MATCHING QUALITY USING SIX SIGMA METRICS Background: Six-sigma metrics provides a general methodology to evaluate a process performance on a sigma scale. Implementation of Six-sigma for quality assurance can benefit the health care sectors. One of the most important health care sectors is blood transfusion service. For that reason, maintaining a high quality in blood transfusion service is required. Pathogen in activated plasma is one of the main products that are provided by the blood transfusion service. The process of producing pathogen inactivated plasma involves blood group matching step. The quality of this blood group matching is extremely significant for the delivery of plasma that satisfies the recipient need. Aims: The aim of this study is to assess the quality of blood group matching of pooled plasma units using Six Sigma metrics, and to clarify the potential implementation of six sigma metrics as a quality management tool.

Methods: This retrospective study was conducted in the component preparation lab of Kuwait Central Blood Bank. The twelve months (January 2018 -December 2018) data of pooled fresh frozen plasma units were recruited and examined. The data was separated to data without double check (6 months) and data with double check (6 months). Data statistics and analysis were conducted by the use of six sigma metrics.

Results: In a sample size of 6818 from the first six months a 38 mismatch was found which equals 5573 DPMO and 4.1 Sigma metric. And in a sample size of 5854 from the second six months a 25 mismatch was found which equals 4277 DPMO and 4.2 Sigma metric. Out of the whole 12672 pooled units 63 were found to be mismatched. Some of which were found to be discarded as ABO discrepancy, broken, or expired. Other was still available in the system, while the rest of the mismatched units were issued.

Summary/Conclusions: Using the Six Sigma principle the study presents a successful assessment of blood group matching quality. As a 4.1 sigma metrics obtained from the first 6 months, were shifted to a sigma metrics of 4.2 in the second 6 months, after the addition of a double-checking step to the blood group matching of pooled plasma process. The implementation of these metrics in our laboratory quality management has been shown to be very beneficial. In which Six-sigma metrics were able to clarify the reduction in blood group matching errors. Although Six-sigma benefits in major quality improvements and helps to reach an error free laboratory services, yet it presents a new challenge to laboratory practitioners. Currently, the hemophilia A patients treated with Factor VIII concentrated as the first line of therapy but it is more expensive and the supply is not sufficient so for now they have not used Factor VIII concentrate as prophylaxis therapy. For some cases, Hemophilia patients in Indonesia depend on subsidy from the World Federation of Hemophilia. The first handicapped concentrated case is just for therapy not for prophylaxis. Big Blood Centers in Indonesia produce routinely Fresh Frozen Plasma (FFP) and cryoprecipitate-Anti Hemophilic Factor (AHF) as replacement therapy for Hemophilia A, but its content and safety of Factor VIII from 150 mL FFP need to be improved. Nowadays, there is an available kit for producing minipool cryoprecipitate (MC) that has better safety and quality but it is available as liquid products, stored in very strict and specific temperature (À20°C). Prophylaxis therapy for Hemophilia patients needs a stable product, easy to use and convenient treatment for patients. Aims: To analyze the content and safety of F VIII with minipool cryoprecipitate (MC) and Lyophilized MC for home therapy. Methods: We produced 7 MC; 1 MC as the control, 3 MC were lyophilized with excipient and 3 MC without excipient. We analyzed the number of Factor VIII, the Safety, and stability. We count the erythrocyte, leukocyte and platelet residual in MC using flow cytometry. We also measure the pH, Osmolality, Solubility to learn its stability after storage at 30 days at room temperature (30-32°C) and blood bank refrigerator temperature (2-8°C) at Central Blood Transfusion Services (CBTS). Results: We found the content F VIII with excipient is higher (9.8 IU/mL) than without excipient (4.5 IU/mL) and the storage at blood bank refrigerator (2-8°C) is better than at room temperature (30-32°C) . In both group, there were no residual cells and bacterial found in MC. No significant difference in The pH, osmolality and solubility in both groups. Summary/Conclusions: The Lyophilized MC with excipient stored at blood bank temperature (2-8°C) is better than room temperature. This experiment will be continued to know its stability in extended storage time. Background: Peptic ulcer disease (PUD) is a multifactorial and complex disease, and it affects a wide range of people in the world. However, a perfect therapy for PUD has not yet been available at present. Therefore, we provided a novel therapeutic approach for PUD patients and observed its effect in this study.

Aims: We provided a novel therapeutic approach for PUD patients and observed its effect in this study. Methods: In this randomized controlled trial, PUD patients residing in Chongqing were enrolled from 2016 to 2017. They were randomly assigned to two groups: (a) a control group used only rabeprazole, and (b) a platelet-rich plasma (PRP) group that received a combined therapy of autologous platelet-rich plasma (aPRP) and rabeprazole. The aggregation rate of aPRP was measured via aggregation remote analyzer module. The therapeutic effect was assessed via the ulcer size and the symptom score. All data were recorded and analyzed statistically using SPSS. Results: A total of 27 patients were included (12 patients as control group) and (15 patients as PRP group) in the analysis. We found that the aggregation rate of aPRP is not affected in pH 2.5 after treatment with pepsin. Our results showed that there were no significant differences between the PRP group and control group before the treatment, and there was also no significant difference in healing time between the two groups in different variables. However, regression analysis revealed that the healing time was 6.99 d less in the PRP group than in the control group, and the patients with higher symptom scores in the initial examination need more time to heal in treatment. Summary/Conclusions: This study showed an encouraging preliminary result that aPRP has a positive result in the peptic ulcer patients, and it seems to be a better choice for refractory PUD patients. Despite the further follow-up studies are needed to determine the duration of efficacy of aPRP, the approach will be helpful for improving the PUD treatment in clinical. Background: The Croatian Institute of Transfusion Medicine (CITM) collects, produces and distributes blood components in an area of 4.2 million habitants. Annually, it collects about 100,000 whole blood and 3,500 apheresis donations. Platelet concentrates (PCs) are more inclined to bacterial contamination due to storage conditions that favor bacterial replication. The CITM decided to evaluate the Mirasol Pathogen Reduction Technology (PRT) system as it offers the possibility to work with a non-toxic, non-mutagenic compound that upon UV illumination induce nucleic acid damage, reducing the risk of septic transfusion. Aims: The study objective was to evaluate quality of PCs treated with the Mirasol PRT system for platelets and stored in TPAS+ for 7 days at 22°C on a platelet shaker. Methods: PCs were produced according to the CITM's S.O.P., either through pooling of 4 BC with TPAS+, "WBD", or through apheresis collection using two devices: the Fresenius Amicus, "AD" and Haemonetics MCS+ System, "MCD". PCs were stored in 33% plasma and 65% PAS and MCD were subsequently evaluated also in 38% of plasma and 62% PAS. Identical PCs were produced with a pool-split protocol to be PRT-treated or serve as untreated control. PCs were treated with the Mirasol system according to manufacturer's instructions. QC parameters, such as yield, pH and swirl were measured at days 1, 5 and 7. Bacteria sterility test was performed at day 7 for a sample of all treated platelets. Protein content of PCs produced routinely at the CITM was determined to assess accuracy of plasma carry-over calculations for all processed PCs. Results: Mirasol-treated WBD (n = 10) and AD PCs (n = 8) stored in 33% plasma showed at day 7 an average pH ≥ 6.9; swirl ≥ 2.5 and yield = 3.3 9 10 11 . Their untreated counterparts showed average values for pH ≥ 7:0, swirl ≥ 2.9 and yield 3.3-3.4 9 10 11 . MCD stored in 33% plasma (n = 6) that underwent PRT showed at day 7 average values for pH = 6.7, swirl = 1.2 and yield = 3.05. Control MCD showed average values for pH = 7.0, swirl = 2.8 and yield = 3.1 9 10 11 . MCD stored in 38% plasma (n = 8) that underwent PRT showed average values for pH = 6.6., swirl = 1 and yield = 3.1. Their untreated counterparts had average pH = 7.1, swirl = 2.9 and yield = 3.2. Total protein content in PCs derived from WBD (n = 12), AD (n = 15) and MCD (n = 27) was 22 g/L, 20 g/L and 20 g/L, respectively. While the coefficient of variation of WBD and AD ranged from 3% to 4%, Plasma products 129 respectively, the one of MCD reached 14%. All PRT-PCs were negative for bacterial growth at day 7. Summary/Conclusions: Mirasol treated WBD and AD produced according to CITM current S.O.P. were quite similar to untreated controls at expiry, on day 7 and passed the requirements of the EU guidelines (19 th edition). Quality of MCD units met EU criteria at day 5; swirl decreased significantly at day 7 which might be explained by the variability in plasma content of MCS+ -derived platelets, challenging the accurate calculation of illumination index for the Mirasol treatment. All Mirasol treated PCs showed minimal platelet loss at the end of storage. As the implementation of PR had to be cost-neutral it could only be implemented for~25% of the annual produced buffy coat platelet concentrates (BCP) (~40.000 BCP/year) and required a change in the BCP production method. The primary aim of the implementation was to offer increased blood safety to our most vulnerable patients. The secondary aim was to ensure that we built-up enough routine experience with PR to enable us to quickly ramp-up the production of PR-BCP to 100% if there were an outbreak of an emergent pathogen in the Madrid region. Aims: To verify if we could produce~25% PR-BCP without increasing the overall production cost (OPC) for BCP. Also evaluate the impact of PR on overall scrap rates of BCP, outdate rates and usage of other safety measures. Methods: We compared OPC for BCP between the pre-PR period (2017) . This cost was offset by substituting a semi-automated production method for BCP, which was used in 2017 to produce 28.7% of BCP-units. A manual double dose buffy coat production method (DD-BCP) in combination with PR enabled us to reduce the BCP-disposables cost by 89.2%. Despite the moves from a semi-automated to a manual production method the overall scrap rates during production decreased in 2018 by 0.19%. The extension of max. storage time from 5 to 7 days for 24% of the BCP-units that were PR resulted in decreasing our overall outdating rates by 29% (versus 2017). This reduction in outdating rates reduced our OPC in 2018 by 2.2%. In 2018 we gamma-irradiated 25.9% fewer BCP-units, but this had only a minimal impact on the OPC. Summary/Conclusions: Results of this study confirmed that we reached our initial objectives of producing~25% PR-BCP without increasing the overall production cost (OPC) of BCP. It enabled us to offer increased blood safety to the most vulnerable patients. We built-up enough routine experience with PR so we could quickly rampup the production of PR-BCP to 100% if there were an outbreak of an emergent pathogen in the Madrid region. Background: Irradiation of red cell units is undertaken to prevent Transfusion-Associated-Graft-Versus-Host-Disease (TA-GVHD) in immuno-compromised patients. While irradiators using radioactive c-ray sources are primarily found in blood establishments, they require regular recalibration and supplementary safety measures. Xirradiation has been shown to have similar biological effectiveness to c-irradiation and does not require a radioactive source. There is international interest in moving away from gamma sources to reduce vulnerability to terrorism. Although damaging, impacts of irradiation on red cells are well recognised. Only a limited number of studies have compared red cell component quality following cand X-irradiation for both standard volume red cell concentrates (RCC) and neonatal red cell splits (RCS). Aims: To compare the in vitro quality of RCC and RCS when subjected to cor Xirradiation on day 14 of storage then stored for a further 14 days. RCS were also irradiated on day 5 of storage as that is most common practice in NHS Blood and Transplant (NHSBT). Methods: Four RCC were pooled and split into 4 arms on day 1 of storage, with 10 units in each arm. All units received an irradiation dose of 25.9-48.3 Gy. Two arms remained as standard volume RCC and were either cor X-irradiated on day 14 of storage. The other two arms were both split into 6 RCS on day 4 of storage before being irradiated on day 5 (early arm) or day 14 (late arm) of storage. For each replicate in these arms, 3 splits were c-irradiated and 3 splits X-irradiated. All arms were tested a day prior to irradiation and 1, 7 and 14 days post-irradiation for red cell quality parameters: haemolysis, intracellular ATP and 2,3 DPG, supernatant potassium, glucose and lactate, pH and red cell microvesicle release. The RCC arms were sampled over storage; while for the RCS arms, 1 split was tested on each testing day post-irradiation. A 2-way ANOVA was used to detect statistical differences over storage between cand X-irradiation for the same components. Results: All components produced were within NHSBT specification for volume, haemoglobin and haematocrit. There were no significant differences in red cell in vitro quality parameters studied over storage between cand X-irradiated units, for standard volume arms or neonatal arms and whether RCS were irradiated early or late in storage. Moreover, all arms were within haemolysis specification for the end of storage (>75% of units with < 0.8% haemolysis) and 100% of units had ATP levels above the recommended minimum for acceptable post-transfusion survival (2.3 lmol/gHb). Both haemolysis and potassium levels at the end of storage for the standard c-irradiated RCC were comparable to our laboratory's historic data for the same component. Summary/Conclusions: In summary, the storage quality of RCC and RCS post-Xirradiation did not differ from c-irradiation in this study, providing reassurance that either method could be used in routine manufacturing.

A Pajares Herraiz 1 , C Coello de Portugal 2 , M Morales 3 , F Solano 4 , C Perez Parrillas 5 , A Rodriguez Hidalgo 5 , T Diaz Rueda 5 and M Flores 5 1 Direccion, Regional Transfusion Center Toledo-Guadalajara 2 Transfusion Service, Toledo Hospital Complex, Toledo 3 Transfusion Service, General University Hospital of Guadalajara, Guadalajara 4 Transfusion Service, Hospital Nuestra Señora del Prado de Talavera de la Reina, Talavera 5 Regional Transfusion Center, Regional Transfusion Center Toledo-Guadalajara, Toledo, Spain

Background: The Regional Transfusion Center of Toledo-Guadalajara (RTC) manages the collection, processing and distribution of blood components for the hemotherapy area of Castilla La Mancha (Spain) that serves 3 general hospitals (Hospital Complex of Toledo (HCT), University General Hospital of Guadalajara (UGHG) and Hospital Nuestra Señora del Prado de Talavera (NSPT)) and the needs of 943,000 inhabitants. By also managing the HCT Transfusion Service, it facilitates the handling of stocks. Since 2008, RTC has initiated pathogen inactivation (PI) for a part of its platelet components(PC) with the INTERCEPT Blood system (Cerus) using a photochemical treatment with amotosalen and ultraviolet-A. This system allows the inactivation of a broad panel of pathogens and leukocytes, extending the shelf-life of the CP from 5 to 7 days. This affects the expiry and discards of this blood component, allows a better management of the inventory and has an influence on production costs. Aims: The objective was to evaluate the influence of PI in the production of CP at RTC and the expiry in the hemotherapy area during the last 8 years divided into four periods ( Results: PC were predominantly obtained from whole blood collections with 85% of BC platelets/15% of apheresis platelets. 77% of the available BC were used in production for period A and 88% for periods B, C and D. After wastes of approximately 1.9%, the distribution of PC was stable for the 4 periods studied. 7075 PC were distributed for period A, 7047 PC for B, 7467 PC for C and 7083 PC for D. The % of PI platelets with 7-day shelf life available in the 3 hospitals was limited to 13% during period A. It was then increased to 14.1%, 20.9% and 26% for periods B, C and D respectively. The percentage of wastes was stable at 0.2-0.3% but the discards due to expiry went down from 24.24% (period A) to stabilize at 10.9% in periods B and C and 10.3% in period D. In the 3 general hospitals the expiry went down from 20% to 5.89%(HCT), 29.4% to 14.5% (UGHG) and 33.36% to 17.68%(NSPT) respectively. Summary/Conclusions: Greater control of PC stocks through historical analysis and consumption projection, together with IT tools and the use of PI PC with 7-day shelf life allowed reducing discards for expiry from 24.24% to 10.3% in the last period analyzed at RTC and the 3 major hospitals of the hemotherapy area. This has a great value in cost-reduction and improves inventory management and the efficiency of the processes. Background: Blood centers are faced with many challenges including availability of concentrate platelets as well as ensuring highest quality of the product. Overcoming the shortage of platelet apheresis by using pooled platelet derived from whole blood units separated using automated standardized system, which can assist blood banks to meet the increase demand in platelets. The Pathogen inactivation (PI) technology can improve the quality of the product by mitigating the risk of transfusion-transmitted diseases (TTD) and residual white cells, resulting in minimizing non -hemolytic transfusion reactions. However, the pathogen inactivation treatment must not impact the platelet quality and functionality significantly, as well as the patient safety.

Aims: Evaluate the quality of pooled platelets derived from whole blood (five interim platelet units), separated using Reveos Automated Blood Processing system (Terumo BCT), pooled in 100% donor plasma and pathogen inactivated by amotosalen/UVA technology. Methods: Five interim platelet units (IPUs) produced with Reveos device (Terumo BCT) from single whole blood donations, were pooled with a Platelet Pooling Set (Terumo BCT) and leucodepleted with a LRF-XL filter (Haemonetics). Thirty pools have been included in this study, the units were treated using a Large Volume Cerus INTERCEPT Processing Set for Platelets according to the manufacturer's instructions and stored until day 5. The swirling was determined by visual inspection. The volume and yield content were assessed preinactivation and after treatment by pathogen inactivation with a cell counter (DXH-800, Beckman Coulter), RBC contamination was also measured preinactivation with a cell counter (Beckman Coulter), bacterial contamination was assessed by automated blood culture with a BacT/ ALERT system (Biomerieux). The pH of the platelet units was assessed with a pHmeter (Jenway), and residual Amotosalen levels were assessed by an HPLC assay.

Results: The impact of Amotosalen/UVA pathogen-inactivated pool platelet products quality were assessed. The pre and post-inactivation of the units showed a swirling score of 2-3. The average volume per unit of the pre-inactivation was 288 ml (278-302 ml) and post inactivation was 269 ml (254-284 ml), with average volume loss during inactivation was 36 mL (24-43 mL), corresponding to 13% (8-15%). The average platelet yield per unit pre-inactivation was 3.7 9 10 11 (3.0-4.4 9 10 11 ) and post inactivation 3.2 9 10 11 (2.8-3.9 9 10 11 ) with an average platelet loss of 13% (3-20%) . The average RBC contamination per unit (0.01-0.02 9 10 9 RBC/ml). The culture tests were negative, the average pH at day 1 was 7.4 (7.1-7.6), average pH at day 4/5 was 7.3 (7. 2-7.4 ). The average residual Amotosalen concentration post treatment was 0.30 lM (0.23-0.35 lM). Summary/Conclusions: The quality of pathogen-inactivated pool platelets tested, met the criteria set by AABB guidelines. The volume and platelet loss were in acceptable range, in alignment with previously published data. A residual amotosalen concentration below 2 lM is considered safe and acceptable by French and German authorities. The evaluated data support the reasonable assurance of quality and effectiveness of the device when used in accordance with indication for use. Background: The implementation of a pathogen inactivation process (PI) allows the redesign of processes to obtaining safe blood components by reducing the need for additional testing for pathogens detection, minimizing the residual risks (such as the infectious window period for those pathogens that are detected as usual), eliminates the need for selective tests (eg Cytomegalovirus serology test) and complements gamma irradiation given its ability to inactivate white blood cells. In addition, the routine implementation of PI reduces the incidence of bacterial infection in recipients of blood components and allows blood services to proactively protect the blood supply against future emerging infections. Aims: To verify the functional integrity and viability of platelet concentrates after being inactivated of any pathogenic agent, to be used as safe and functional components for transfusions. Methods: A total of 106 independent platelet concentrates were studied. Platelets are donated through a process called plateletpheresis according to the established norms, after the process, platelet concentrates were submitted to PI on the Intercept Blood System TM platform with UV-A Illuminator; an immediate sampling of each donation of platelet concentrates was carried out taking a sample of 2 mL pre-inactivation and another sample post-inactivation (16 h after PI). The platelet viability of each sample was evaluated by demonstrating the CD62P expression marker by flow cytometry. Once processed, platelet concentrates were released as safe components for donation. Compiled the experimental data of the platelet count with platelet activation marker with respect to the total platelet, a comparative, nonparametric test of Wilcoxon was carried out between two measurements (pre vs post) and the platelet viability after PI was determined. Results: A total of 106 independent platelet concentrates were studied, where the average percentage of pre-inactivated platelets with expression of the CD62P marker, was 18%, while the percentage of functional platelets post inactivation was 19%, this result only shows that the functionality of the platelets is not being altered after the inactivation process. The Wilcoxon test confirms that there is no significant difference between platelet activity pre-and post-inactivation, with a 95% confidence level. Summary/Conclusions: The process of photochemical treatment with amotosalen hydrochloride and long-wavelength ultraviolet light (UVA) applied to platelet concentrates provides functional products without alterations in platelet function to be transfused. Background: Treatment of platelet concentrates (PCs) with pathogen reduction technologies is widely implemented in blood establishments to reduce the risk of bacterial contamination and to face the presence of new emerging agents in blood components. Aims: The reduction of antioxidant power (AOP) could be a quality control test to prove the complete viro-inactivation treatment. This evaluation has the goal to study the feasibility of the method from "Abonnenc et al., Transfusion, 2016" in another blood service, assessing the AOP of platelet units treated by INTERCEPT technology. Methods: The AOP is expressed in EDEL value, one EDEL being equivalent to 1 lmol/L ascorbic acid. Repeatability, intermediate precision and accuracy were determined. Linearity was evaluated using the linear regression and the calculation of Pearson's coefficient (R²). Limit of quantification (LOQ) was determined by measuring AOP using NaCl samples to define the background. ROC curves were used to determine a threshold to discriminate PCs before and after treatment. A distinction was realized between men and women and between apheresis (A) PC and buffy coats (BC) PCs. A one-year evaluation was assessed on PCs before and after treatment on the routine production. Results: The coefficient of variation for the repeatability was less than 10%. For the intermediate precision, the coefficient of variation was less than 15%, but for the PCs after treatment, this result rose up to 21%. The R² value for the linearity was 97.7%. The detection limit corresponded to a result of 6 EDEL and the LOQ (equal to 10xSD) is 19 EDEL. Concerning ROC curves, the men APCs threshold was 58.5 EDEL compared to women APCs with 62.5 EDEL. The threshold for BCPC was 54 EDEL. All of these results had 100% of specificity. Below this threshold, INTERCEPT treatment was considered to be executed. About the one-year experience on routine PCs production, 404 APCs (182 women and 222 men) and 263 BCPCs were tested. All of the BCPCs and women APCs were under the threshold after treatment. Concerning men APCs, 14.0% of the PCs after treatment were not under the threshold. Summary/Conclusions: The device validation was satisfied. For the one-year evaluation and concerning men group APCs, the threshold found by Abonnenc et al. was 89 EDEL. Our study showed a threshold with 100% specificity and 90% sensitivity at 58.5 EDEL which is much lower. Specificity was favored compared to sensitivity but the analysis should be revised to adapt the threshold to get higher sensitivity. This can lead to reduce the non-conformity and allows measuring the AOP only after treatment. For women, our threshold was found at 62.5 EDEL compared to 66.5 EDEL for Abonnenc et al. Concerning sex in APCs, results were statistically lower in women group than men group before and after treatment. And for BCPCs, the two populations (before and after treatment) were very distinguishable and our threshold (54 EDEL) was lower than Abonnenc threshold which was at 59.8 EDEL. In conclusion, EDEL threshold enables the segregation and depends on the preparation process adapted in each blood service. Aims: This study has the goal of measuring antioxidant power (AOP) level in plasma units treated by MB technology. The aim is to use such a test as a quality control assay for documenting the execution of pathogen inactivation treatments during the preparation of plasma units. Methods: AOP measurements were performed using a potentiostat electrochemical analyzer. A 3-ll volume of sample is deposited over the electrodes on a single-use microship. The AOP is expressed in EDEL value, one EDEL being equivalent to 1 lmol/L ascorbic acid and reflects the redox status of the plasma units. Different protocols were established to understand the role of MB, the illumination and the filtration on the AOP variation measure: 1) complete treatment, 2) plasmas with MB without illumination, 3) plasmas without MB with illumination and 4) plasmas without MB without illumination. Ten dosages on men donor samples, except for protocol 1 where n = 20, were realized during the viro-inactivation process, T1 corresponds to a dosage of plasmas before treatment, T2 the plasma after the MB dry tablet passage, T3 is the time after illumination and T4 corresponds to the final product (after filtration). Results: In each protocol with MB, an increase was observed after addition of MB before illumination. After illumination, the EDEL values decreased for about less than 50%, which was expected because of the degradation of MB in its photoproducts during the illumination. In the series 1 and 3, the illumination seemed to have an effect by itself, with or without MB because the AOP increased. The final filtration has the goal to eliminate the residual MB and its photoproducts. After this step, the AOP values fell down. The series 2 was a confirmation of the efficacy of the filter to remove the MB as shown by the decreased AOP in T4 (238 AE 16 EDEL at T3 and 209 AE 17 EDEL at T4). However, in the absence of MB (series 3 and 4), the results at T1 and T4 were not statistically different. Summary/Conclusions: The filtration decreases the AOP rate, except when there was no MB. The results of non-complete viro-inactivation treatment allow concluding that the measure of AOP rate may not indicate that the treatment was completed or not since significant differences before and after treatments were found in the non-complete treatment series.

Vox Sanguinis (2019) Background: The INTERCEPT Blood System (IBS), a photochemical treatment with Amotosalen and UVA, is used to inactivate pathogens and leukocytes in plasma. The INTERCEPT TM plasma processing set (Cerus BV, Netherlands) was modified to incorporate plastic containers in non-PVC materials sourced from alternate suppliers and connecting parts and accessories in non-DEHP PVC formulations, making the system DEHP-free. The final storage container was modified with a higher contact surface with plasma to limit the thawing time. proportion of units with a fibrinogen concentration ≥ 2.00 g/L was 94% (>70% required). Mean recovery FVIII fibrinogen after IBS treatment and frozen storage were 75% and 90%, respectively. Residual platelets were < 25 9 10 9 /L, leucocytes < 1 9 10 4 /L and red blood cells < 4 9 10 9 /L. All units had a protein content > 50 g/L. Residual Amotosalen was below 2 lM in all post-CAD samples. The concentration of TAT complexes was slightly reduced after treatment and frozen storage. Concentrations of C3a and C5a were significantly reduced with the CAD treatment. The plasma thawing time in a water bath at 37°C was consistently short (6-7 min). Summary/Conclusions: Pathogen inactivated plasma units (FFP-A-IBS and FFP-WB-IBS) prepared with DEHP free INTERCEPT processing sets retained in vitro characteristics which meet the quality standards for therapeutic plasma. The process did not activate coagulation or complement. Reducing FFP thawing time from routine 8-10 to 6-7 min is an important benefit for emergency use. Background: Plasma coagulation factor concentrations usually differ for individual donors, therefore pooling of whole-blood derived plasma units moderates high or low coagulation factor concentrations and ensures transfusion of more standardized blood components. Moreover, pooling contributes to dilution of reactive antibodies and may reduce the risk of non-hemolytic transfusion reactions and TRALI. Additionally pathogen inactivation reduces the risk of transfusion-transmitted infections, and non-hemolytic transfusion reactions as well as GvHD through inactivation of residual lymphocytes. Aims: Assessment of the impact of plasma pooling and pathogen inactivation on the standardization of blood components and plasma quality. Methods: The study included 5 experiments. For each experiment 5 male-donor, ABO-compatible whole-blood derived plasma units (≥ 270 ml) were collected from different donors and pooled using the Donopack Optipool plasma pooling set (Cerus Europe B.V.). Each of the 5-unit pools were split into 2 equal minipools which were subsequently treated with the in Intercept Blood System (Cerus Europe B.V.). Then, each minipool was split into 3 (≥200 ml) therapeutic units. Samples were collected before and after pooling as well as after inactivation to assess the coagulation factor content (FVIII, FIX, Fibrinogen, vWF antigen using ELISA) and coagulation time (APTT, PT).

The study-analysis included samples from five pools from 5 single plasma units respectively ( Background: Biotin (Bio) is an alternative to radioactive red blood cell (RBC) tracers which allows one to concurrently track in vivo multiple cell populations labeled at different Bio densities. In American clinical trials, multi-labeled BioRBC have been transfused in man to assess their survival (Mock et al, Transfusion, 2018) . In these studies, the different BioRBC populations were monitored by ex vivo flow cytometry analysis using Streptavidin. So far, the biotinylation reagents BioSulfoNHS was not complying with good manufacturing practices (GMP). Moreover BioRBC, with Bio ≥ 18 lg/mL, have induced immunization of the recipient, in rare cases (Schmidt et al, Transfusion, 2017) . This represents an obstacle regarding the regulatory European authorities. Aims: The aim of this study is to describe a procedure of biotinylation of RBC intended for clinical trials while refining the levels of Bio ≤ 18 lg/mL. Methods: Sterile status is met throughout the process. RBC are taken from standard RBC concentrates and treated with BioSulfoNHS of GMP-grade (0 to 70 lg/mL) recently commercialized. Washing buffer is of injectable-grade. Biotinylation efficacy is controlled by flow cytometry with streptavidin conjugated to 2 different fluorochromes: phycoerythrin (PE) or brilliant violet (BV421). Results: Labeling with BioSulfoNHS of GMP-grade or non GMP-grade is comparable and 4 populations of RBC could be easily distinguished between themselves and from unlabeled blood cells. BioSulfoNHS (lg/mL): 0 (MFI 0.4), 4 (GMP MFI 12; non GMP MFI 9.5), 18 (GMP MFI 44; non GMP MFI 42), 70 (GMP MFI 174; non GMP MFI 180). Streptavidin-BV421 brighter than Streptavidin-PE is a promising tool because it amplifies by 1.7 the signal of fluorescence and allows a good differentiation of the 4 populations of RBC treated with only 0, 1, 4 and 18 lg/mL BioSulfoNHS. Summary/Conclusions: This preliminary study explores the feasibility of multilabeled BioRBC production for clinical trials. The benefits of this approach are to overcome the need for non-radioactive tracers, to follow simultaneously various populations of RBC and consequently to limit the number of volunteers, and to reduce the risk of immunization using Bio ≤ 18 lg/mL. Background: Rejuvenation is aiming to revert ageing-related disease development. Heterochronic parabiosis studies revealed eotaxin in young and old murine blood as a regulator of brain aging and neurogenesis. Umbilical cord blood (UCB)-borne factors including tissue inhibitor of metalloproteinases 2 (TIMP2) and neonatal immune cells also contributed to rejuvenation in animal models. Human platelet lysate (HPL) is commonly used by us and others for highly efficient cell propagation in vitro (Burnouf et al., Biomaterials, 2016) . Published data indicate only limited differences between adult and UCB-derived HPL, partly questioning enigmatic rejuvenation effects. Aims: To verify candidate regenerative factors in neonatal blood products we compared protein contents of neonatal and adult plasma and platelets, respectively.

Methods: Heparinized UCB samples (n = 9) were centrifuged within 3 h to collect neonatal platelet rich plasma. Aliquots from apheresis platelet concentrates (n = 9) were used as adult counterpart. Platelet concentration was adjusted to 7-10 9 10 11 / L. Plasma supernatants and platelets were obtained by centrifugation and platelet pellets were re-suspended in saline. After two freeze/thaw cycles at À30°C/37°C for platelet lysis (nPL; aPL) the platelet fragments were removed by centrifugation. The protein content was analyzed with a Proteome Profiler TM Array. Nine samples of each group were pooled to avoid individual donor variations. A threshold of 50,000 AU spot density was defined as cut-off. Data were analyzed by GraphPad Prism 8 using two-way ANOVA. Results: Semi-quantitative evaluation of 105 analytes per array revealed significant differences. In plasma samples and platelets 63 and 48 analytes were detected above cut-off, respectively. In neonatal plasma we found more highly prevalent proteins (>200,000 AU spot density) compared to adult plasma (6/63 vs. 3/63). Thirteen proteins were significantly elevated in neonatal plasma including growth/differentiation factor 15 (GDF 15), platelet derived growth factor AA (PDGF-AA) and serpin E1 (P < 0.0001). More highly prevalent proteins were detected in nPL (10/48) compared to aPL (1/48), and 20 proteins were significantly elevated including vascular cell adhesion molecule-1 (VCAM-1), platelet factor 4 (PF4/CXCL4), epidermal growth factor and lipocalin-2 (P < 0.0001). In adult samples only 10 proteins were significantly higher in plasma and three proteins in aPL compared to the neonatal groups (P < 0.05 to P < 0.0001). Summary/Conclusions: We detected significant differences in regenerative growth factor and cytokine contents of neonatal and adult plasma and platelet samples, respectively. Additional experiments are underway to further characterize their impact in distinct functional readouts. Background: The production and storage conditions of platelet (PL) products intended for transfusion are constantly evolving and need sometimes in vivo evaluations in clinical trials to ascertain whether the platelets have retained their ability to survive in the circulation. This requires that the transfused platelets can be distinguished from the recipient's circulating platelets. Labeling of platelets with biotin (Bio) affords to track in vivo and concurrently, multiple cell populations covered with various biotin densities as already described for red blood cells (Mock, Transfusion, 2018) . Surprisingly, there is only one study describing the transfusion of human BioPL (Stohlawetz, Transfusion, 1999) . So far, the biotinylation reagent Bio-SulfoNHS was not complying with good manufacturing practices (GMP), which represents an obstacle regarding the regulatory authorities. Aims: The aims of this study are 1) to describe a procedure to label injectable human platelets with 2 densities of biotin, 2) to evaluate the impact of biotinylation on platelet functions, 3) to track human BioPL in the circulation of the mouse. Methods: Platelets are taken from standard platelets concentrates and treated with 1.2 and 10 lg/mL BioSulfoNHS of GMP-grade, recently commercialized. Main platelet functions are assessed in vitro. Human BioPL survival is evaluated in immunodeficient NSG-mice treated with liposome-clodronate to eliminate macrophages and to prevent rejection. Circulating human BioPL are detected ex vivo by flow cytometry with streptavidin phycoerythrin. Results: Using TRAP (60 lM), P-selectin externalization reveals a normal capacity of secretion for all BioPL. GPIba and GPIIbIIIa expression is not affected by the biotinylation process. BioPL have the ability to aggregate: using arachidonic acid (1 mM), amplitude of aggregation is 81.7 AE 2.5% (Bio 0); 82.6 AE 2.3% (Bio 1.2 lg/ mL); 79.2 AE 1.6% (Bio 10 lg/mL). Using collagen (2.5 lg/mL), amplitude of aggregation is 65.6 AE 4.2% (Bio 0); 61.4 AE 4.0% (Bio 1.2 lg/mL) 40.8 AE 6.6% (Bio 10 lg/mL). The 2 BioPL populations could be easily distinguished between themselves and from unlabeled blood cells in the mouse circulation during more than 48 h. After 4 h, the mean fluorescence intensities are 0.13 AE 0.02 for unlabeled circulating mouse platelets, 1.01 AE 0.03 and 8.2 AE 0.15 for circulating human BioPL covered respectively with 1.2 and 10 lg/mL biotin. Summary/Conclusions: This labeling approach should be helpful to evaluate new platelet products in vivo and represents an alternative to radioactive tracers. It allows to follow simultaneously different platelet populations and consequently limits the number of volunteers in clinical trials. Background: Severe ocular surface diseases, Dry eye syndrome, persistent and recurrent corneal epithelial defects and diabetic or neurotrophic keratopathy are mainly successfully cured by standard treatment protocols. However, not rarely does refractory to these usual treatments appear, especially with serious forms of disease. In Military Medical Academy, Autologous serum eye drops -Auto SEDs and Autologous platelet lysate -APL eye drops have been being applied in the treatment of ophthalmological patients in these categories, who were previously resistant to standard therapy. Aims: To show the achieved results of therapeutic use of autologous blood products (Auto SEDs and APL) in the treatment of ophthalmological patients who previously had not responded to conventional therapysingle center experience. Methods: Auto SEDs are prepared by taking autologous blood into tubes (BD Vacutainer, CAT, 10 ml) and APL in tubes with anticoagulants (Greiner Bio-One, ACD-A, 9 ml). Control on TTI of every patient and sterility of every series has been conducted. Before and after the treatment, subjective ocular discomfort (Ocular Surface Disease Index -OSDI), objective parameters of the tear film (Schirmer's test, Rose Bengal, Tear breakup time -TBUT) and measuring of epithelialization zone were analyzed. APL, obtained from platelet-rich plasma which had been frozen, unfrozen and diluted with NaCl solution, up to 30%. Auto SEDs were administered in the form of 20% eye drops. Results: Auto SEDs have been applied to 17 ophthalmological patients (10 men and 7 women), previously resistant to standard therapy. In total 44 treatments were performed (each lasted 20 days). For successful curing, one or two treatments per patient, in average, were applied. APL has been used multiple times to one patient with Sj€ ogren syndrome and severe multiple tropical corneal changes. All ophthalmological patients had subjective improvements (the average Pre and Post treatment OSDI scores were 71.3 and 19.6 respectively). Also, objective progress was present in 83% of all patients (P < 0.001). Summary/Conclusions: The use of Auto SEDs and APL in the treatment of ophthalmological patients, previously resistant to standard therapy, is in constant increase, because of its simplicity and low expenses. APL has turned out to be better than Auto SEDs for patients with severe trophic changes, because APL contains larger amounts of the Nerve Growth Factor, TGF-B, VEGF and Platelet Derived Growth Factor. However, a larger number of clinical cases is needed for future conclusions. Background: Whole blood (WB) has recently regained favor in treatment of massively bleeding patients in military and civilian settings. 1 Platelets (PLTs) are a vital component in clot formation. As a component of WB, it is critical that they maintain functionality throughout storage. Red blood cells (RBCs) stored in hypoxic/ hypocapnic conditions preserve high level of 2,3-DPG while reducing storage lesions stemming from oxidative stress. 2, 3 On the other hand, effects of steady hypoxia (pCO2~10-20 mmHg) on PLTs contained in leukoreduced WB is poorly characterized. Aims: Examine the effects of hypoxic conditions on PLT function and microvesicle (MV) formation in WB stored hypoxically (H) and conventionally (C) for 3-week storage at 1-6°C. Methods: 11 units of WB were collected at Mayo Clinic Rochester Blood Donor Center from normal healthy volunteers into 70 mL CP2D. WB was leukoreduced using PLT-sparing filter (Terumo WB-S) then split into Control (C) and Hypoxic (H). H-WB was processed by the oxygen-reduction bag (Hemanext, Lexington MA) and unit was stored in O2-free bag. 5 mL of WB were collected from each unit at day 1, weeks 1, 2, 3. PLT counts, agonists (thrombin receptor agonist peptide (TRAP), adenosine diphosphate (ADP) and collagen stimulated platelets aggregation, nonactivated and agonists activated PLT surface expression of phosphatidylserine (PS, annexin-V binding), P-selectin, fibrinogen receptor (PAC-1 binding), and microvesicles (MV) were measured by Coulter counter and digital flow cytometer. Paired Student t-tests were used to analyzed differences in degradation rates; significance: P < 0.05. Results: H-PLT counts declined to~60% by the O2-reduction process, while similar decline was observed after 1 week in C, and thereafter remained steady. PLT activation (PS) increased over time (H >> C after processing; C increasing more rapidly during storage). P-selectin increased over time (H < C), while PAC-1 showed large increase after 1 week, then remained steady (H << C). PLT activation by TRAP or ADP declined modestly over 3 weeks (~15%) while H-PLT showed additional~10% reduction for all time points. Collagen activation for C-PLT increased after 1 week (74%) and gradually increased to 100% after 3 weeks (~20% reduction with H compared to C). PLT-derived MV (CD61 and CD61/Annexin V) increased~4-fold over storage time; Day 0 MV levers were significantly higher for H, but subsequent increase rates were similar or lower. Total number of PLT-derived MV (CD42a) in WB supernatant increased 17-fold after 3 weeks for C, while H suppressed increase to 7-fold. (Majority of the trends described above showed significant differences between H and C.) Summary/Conclusions: PLTs were activated over 3-week period when stored at 1-6°C in leukoreduced WB, accompanied by a modest loss of agonist-induced activation. Oxygen reduction treatment initially activated H-PLTs, while subsequent increase in activation rates were suppressed compared to C-PLTs. WB PLTs retained activatability, and hypoxic condition showed only modest further reduction on the activatability. Hypoxic WB may provide higher quality WB for trauma patients if the levels of initial PLT activation can improved during oxygen reduction procedure. Methods: After informed consent, eligible patients were randomized to either first receive autologous followed by allogeneic SEDs or first receive allogeneic followed by autologous SEDs. Each SED treatment phase was one month, separated by one month of patient's standard treatment (wash out period) between SED treatment phases. The patients each donated 500 mL whole blood from which the autologous SEDs were prepared. Allogeneic SEDs were prepared from blood from never-transfused male donors with blood group AB. All serum was diluted 1:1 by adding saline, and aliquoted in an eye drop dispensing system (Meise, Schalksm€ uhle, Germany). At each visit, the OSDI was determined using a validated questionnaire, with higher scores reflecting poorer outcomes. The results were analyzed intention-to-treat, and a random effects linear mixed model for cross-over design was used.

Results: In total, 19 patients were enrolled, 4 of whom were excluded because they failed the autologous blood donation. Background:

The following blood components for non-transfusional use (BCNTU) are produced in our Transfusional Center (TC): 1) allogeneic platelet gel (PG), derived from Buffy-Coats (BC) and human cord blood platelet gel (CBPG); 2) Autologous Serum Eye Drops (SED). The creation of both types of platelet gel started in 2014 but only in 2017 we confirmed the process for daily production: these blood components are used to treat pediatric patients with Epidermolysis Bullosa. The SED, produced from 2018, is dedicated to treat patients with Dry Eye Syndrome. Aims: Production and storage BCNTU. Methods: The whole process production of BCNTU is traced on the Transfusional informatic system (Emonet-Insielmercato), under the same conditions of another blood transfusional components. The process takes place in closed circuit using the laminar flow hood. 1) PG production starts from the BC resuspended in plasma that are not used for daily platelet concentrates, instead the CBPG is produced using cord blood units that are not used for hematopoietic transplant. Both have a platelet concentration between 800-1200 10 3 /lL and negative blood cultures, required by the Italian law; the units are frozen at À80°C and last 5-year. PG and CBPG must be activated with calcium gluconate or batroxobin to be used.

2) The ophthalmologist's patients, with Dry Eye Syndrome, donate 120 mL of autologous blood; the serum is separated and after the dilution with a balanced saline solution (30%) are divided in 2 boxes containing 30 single-dose vials each: they are stored at À80°C and they last one year. Negative blood culture was evaluated.

Results : Background: Candida albicans is the most common pathogen detected in fungal infections. Aims: In this study, we aimed to evaluate the in vitro antifungal activity of volunteerderived platelet rich plasma (PRP) against C. albicans ATCC 10231 strain and the possible effects of certain chemokines, kinocidins that might play a role in this activity. Methods: PRP from nine volunteers were derived by using Magellan PRP â kit. 10% calcium gluconate was used to obtain autologous thrombin. C. albicans isolates with a final yeast concentration of 1 9 10 3 cfu/ml and 1 9 10 4 cfu/ml were inoculated on Sabouraud Dextrose Agar at the 1 st , 2 nd , 4 th , 8 th and 16 th hours of incubation to reveal the antifungal activity of autologous thrombin-activated PRP. The colonies were counted after 18-24 h of incubation at 30°C. Chemokines and kinocidins (Platelet Factor-4, Interleukin-8 and Thymosin-b4) were also measured simultaneously by ELISA method. Results: Compared with the PBS-control group, the PRP-10 3 group showed that the antifungal activity was still going on at the 8 th hour. The difference in colony production between the two groups at 8 th hour was statistically significant (P < 0.05). It was observed that the antifungal activity continued at the 4 th hour, decreased at the 8 th hour in the group PRP-10 4 group. Although the same amount of PRP was used and the same amount of chemokine and kinocidins were released in both groups, the concentration of C. albicans was considered to be important in the detection of more effective PRP-10 3 group. Although there was an increase in IL-8 levels by hours in the two PRP groups by ELISA method, no antifungal effect was detected against C. albicans. It was observed that decrease in TMSB4 values results from the antifungal activity on the advancing hours in the PRP groups. Whereas PF-4 did not act an antifungal activity on PRP-10 3 and PRP-10 4 . Summary/Conclusions: Even in our study group where the highest platelet counts were obtained at the lowest concentration, C. albicans reproduction could not completely eliminated as mentioned in the literature. Repeated doses of PRP applications, such as drugs used in patients, may have longer duration of action and even complete repression of reproductive outcomes. Background: Generally, blood is available in developed countries for transfusion. Sometimes, transfused or previously pregnant patients form alloantibodies to red cell antigens and rarely, to antigens of high prevalence. This case focuses on a twoyear-old girl, of Pakistani descent, diagnosed with neuroblastoma stage IV with anti-In b and -E. Although the publications indicate that 4% of the Pakistani, Indian or Iranian populations are In(b-), it was discovered that this blood type is exceedingly rare. An international search was required to ensure blood product availability for chemotherapy and autologous hematopoietic progenitor cell transplants Aims: Illustrate the response of the public to a powerful story of a child needing rare blood for treatment and international collaboration for provision of very rare units. Methods Case Report: A two-year-old patient's sample was referred for antibody identification. The patient had received four transfusions (883 mL of red cells) in the preceding 10-day period. Hgb level fluctuations were consistent with decreased transfused red cell survival. Following the last transfusion of 225 mL, the hemoglobin decreased from 8.6 to 5.8. Anti-In b , and a ficin-only reactive anti-E was identified in the serum and anti-In b in the eluate. The Monocyte Monolayer Assay predicted the anti-In b to be clinically significant (68% reactivity). Transfusion of antigen neg units once obtained, resulted in a stable transfusion response. Although it was expected that In(b-) blood would be more easily sourced, only two donors in the USA were In (b-) E-. As 7-10 units of blood were requested for the post-transplant period, a national and international search was initiated, as was a robust media appeal to donors resulting in many donors for an intense domestic screening effort in the USA. The search of the WHO International Rare Donor Panel by the International Blood Group Reference Laboratory revealed three known In(b-) E-donors; two British and one Australian. They were contacted, recruited, collected and shipped to the USA with the work of the American Rare Donor Program (ARDP) staff and the ISBT Working Party on Rare Donors (ISBT WPRD) members in each of the countries. Results: The intense media coverage of OneBlood (the Florida blood center collaborating on treatment with the hospital) included online news outlets (YouTube, Facebook) resulted in over 27,000 responses from national and international potential donors to be tested for In b . ISBT WPRD members were sent the web information of potential donors identified in their countries by the ARDP. Over 3,500 samples from 75 blood centers and associated laboratories tested with anti-In b by OneBlood. Two new In(b-) donors were discovered (0.06%); but both typed E+, thus were not a match for the child. Summary/Conclusions: This intense media coverage and the overwhelming donor response was unprecedented in our experience. The coordination and cooperation among the numerous blood centers reflect the deep dedication of the Blood Banking community to the well-being of special patients in need. This case illustrates the response potential that a powerful story and a medical appeal for exquisitely rare blood utilizing social media and other online news outlets can generate. Background: Blood platelet units are generally stored in blood banks for 3-5 days, afterwards they are discarded. Prepared infusible platelet membrane (IPM) from fresh or outdated human platelets correct the prolonged bleeding times in thrombocytopenic animals such as rabbits. Infusible platelet membrane (IPM) as a platelet substitute may be the most feasible approach to reach the target market. Our previous experiments have shown that IPM has a hemostatic efficacy to shorten bleeding time without any adverse effects in rabbits. Aims: Abnormal Toxicity is the European Pharmacopoeia standard for assessment of biological products which the test material is administered to the mice. In this study, abnormal toxicity of IPM was evaluated in experimental animal model such as mice to assure the safety of IPM without any evidence of serious toxicity.

Methods: In this experimental study, infusible platelet membrane (IPM) was prepared from outdated platelet concentrates. Platelet concentrates were pooled, disrupted by freeze-thaw procedure, pasteurized for 20 h to inactivate the possible viral or bacterial contaminants with a sodium caprylate stabilizer, formulated by sucrose and human serum albumin and finally lyophilized. At first, the test for sterility is carried out under aseptic conditions for IPM vials and then we injected 0.5 ml of IPM (2 mg/kg) intravenously between 15 to 30 seconds into each 5 health mice, weighing 17-22 grams. These tests were performed according to EU pharmacopeia monographs.

Results: In the sterility test no evidence of microbial growth in our product is found. The abnormal toxicity test will be passed if none of animals die during 24 h after injection. If more than one animal dies, the preparation fails the test. If one of the animals just dies, the test is repeated. In our experiment all five mice were alive after 24 h of IPM injection. Summary/Conclusions: In this research the results showed that IPM as a platelet substitute is free of abnormal toxicity with adequate safety and it may be used in human clinical trial studies as a feasible approach to develop a platelet substitute in the future. However, further studies are required to confirm the different aspects of its safety as well. The success of such investigations may affect patients' care in transfusion medicine in the future. A substantial number of infants, especially premature infants, are unable to receive adequate amounts of their mothers' milk for a variety of reasons. The World Health Organization recommends that infants, especially preterm and ill infants are fed with quality-controlled donor milk if they cannot be fed with their own mother 0 s milk. Due to the possible transmission of the Human Immunodeficiency Virus many human milk banks closed in the 1980s, therefore the availability of donor milk has decreased. Aims: We analyzed the processing of donor milk and the required laboratory tests to establish a human milk bank within our blood donation service in cooperation with the department of neonatology at the Frankfurt University Hospital.

Methods: Based on the Recommendations for promoting human milk banks in Germany, Austria, and Switzerland (EFCNI) we evaluated the manufacturing steps and the quality controls require to establish a human milk bank. Background: For patients suffering from severe ocular surface disorders treatment with blood derived serum eye drops (SED) is a highly effective therapy. Autologous SED, prepared from the patient's own blood, is used preferably. For this approach we have more than 6 years of experience. If Auto-SED cannot be manufactured due to medical reasons allogeneic SED present an alternative. Since 2 years, the allogeneic approach is well established in our center. Aims: Retrospectively evaluation of our experience with Allo-SED. Methods: In Germany manufacturing of Allo-SED is only possible as an "individual healing attempt". For each patient experienced regular AB0-identical male donors without blood borne disease, who never received blood products and not taking any kind of medication are selected. Additionally, donors must pass a questionnaire excluding any form of dry eye syndrome. Allo-SED are manufactured directed for each individual patient according to the process for Auto-SED in a closed system. Patient files of our serum eye drops donors were screened for patients receiving an allogeneic treatment. Data concerning indication for Allo-SED, contraindication for phlebotomy, problems with donor selection and manufacturing, as well as serological and microbiological testing results were obtained. Clinical results were evaluated © 2019 The Authors Vox Sanguinis © 2019 International Society of Blood Transfusion Vox Sanguinis (2019) 114 (Suppl. 1), 5-240 by ocular surface disease index (OSDI) and patient's questionnaire, asking for subjective benefit, symptom reduction, possible side effects, consumption and comparison with artificial eye drops or, if applicable, with Auto-SED. Furthermore patients are undergoing regular ophthalmologic examination within a special consultation for dry eye syndrome at our hospital. Results: 31 patients were identified receiving allogeneic SED, 15 patients had been treated autologous previously. In total, allogeneic SED have been produced 54 times since June 2017. Indications were ocular GvHD (n = 15.48%), neurotrophic keratopathy (n = 9.29%), mucous membrane pemphigoid (n = 2.7%), Sj€ ogren Syndrome (n = 1.3%) and secondary keratoconjunctivitis sicca by virtue of chemotherapy, Meige syndrome, rosacea, Morbus Bruton (n = 4.13%). Contraindications for autologous donation were underlying disease (n = 19.61%), poor venous access (n = 12.38%), low haemoglobin (n = 8.25%), low body weight (n = 8.25%), very young age (n = 7.22%), circulatory disturbances (n = 3.10%) and lack of response to Auto-SED (n = 2.7%). Some patients presented more than one contraindication. Manufacturing problems were: lipemic donor plasma (n = 2.4%), high donor haemoglobin (n = 2.4%) and unspecific positive serological findings (Anti-HBs n = 2.4%). Microbiological testing was sterile every time. As side effects one case of allergic reaction, suspected as serum protein allergy, appeared. Clinical outcome can be considered equivalent to ASED. Subjectively, all patients benefited from the therapy and reported an alleviation of their symptoms. For some indications (highly active GvHD) Allo-SED might even be the better option. Summary/Conclusions: Considering our previous experience, Allo-SED seem to be a safe and equally effective alternative to Auto-SED for patients unable to donate blood. In case of urgent indication, timely supply can sometimes be difficult. To overcome this disadvantage licensing Allo-SED as a new blood product with the possibility of production and storage in advance would be a desirable goal. In addition supply would become even safer by preparing Allo-SED according to a quarantine principle like FFP.

Abstract withdrawn. Background: Vernal keratoconjunctivitis is a chronic, recurrent bilateral inflammation of the outer ocular layer. Mostly affected are children and young people and the condition is more common in boys. The disease presents with eye pruritus (itching eye), photophobia (sensitivity to bright light), excessive tearing and foreign eye syndrome. Severe cases manifest with diffusion of overgrown papillae usually of the upper eyelid, bursting of the connective tissue barriers and appearance of giant papillae that press on the cornea. Corneal ulceration is a severe complication of vernal keratoconjunctivitis that may induce scarring, corneal neovascularization and occasionally perforation. Treatment of keratoconjunctivitis mainly relies on steroids, mast cell stabilizers, antihistamines, immunosuppressive drugs (cyclosporine), artificial tears, contact lensdressing, cryotherapy and surgical papillae removal. We present the case of a 8 year-old girl with corneal ulceration who was applied artificial tears after traditional methods of treatment proved unsuccessful. Aims: The aim was to share our experience on artificial tears therapy applied in ophthalmic disorders.

Methods: Autologous blood (20 ml) was collected into disposable, sterile transfer bags used for routine blood component preparation (no anticoagulant) and incubated for 1 h at 37°C. The clot was then removed by centrifugation and the serum containing erythrocytes was press extracted. Centrifugation was applied again to obtain serum free of cellular components. The serum was then divided into 0.3 ml segments (capsules)and the artificial tears applied to the left eye 8 9 daily. Results: Ulcer healing was reported after 4 weeks of therapy with artificial tears. The dosage was reduced to 4 9 daily. No recurrence of corneal ulceration was observed after subsequent 8 weeks. Summary/Conclusions: Artificial tears are a safe and effective therapy for ophthalmic disorders in children. Background: ARV non-disclosure among HIV-positive donors who tested HIV antibody (Ab) positive but RNA negative (Ab+/RNA-), so-called False Elite Controllers, was previously described by our group in South Africa, with > 80% of Ab+/RNAdonations since 2016 testing ARV positive. The extent of undisclosed ARV use at time of donation represents a significant risk to blood safety in a country with a growing treated HIV population. Aims: To establish the prevalence of ARV non-disclosure among four subgroups of HIV-positive donors in South Africa along with demographic correlates of non-disclosure.

Methods: South African blood donors are screened by a self-administered questionnaire, which includes questions on current HIV status and ARV use, followed by a semi-structured personal interview. Specimens for HIV, Hepatitis B and C testing are collected at time of donation. Based on ID-NAT (Procleix, Grifols) and antibody (Prism, Abbott; Western blot) testing, HIV-positive blood donations were classified as acute (Ab-/RNA+), recent (Ab+/RNA+, Limiting Antigen Avidity [LAg] ODn ≤ 1.5), longstanding (Ab+/RNA+, LAg ODn > 1.5) and potential Elite Controller (Ab+/RNA-) cases. Stored plasma from these donations were tested for four ARV drugs using qualitative liquid chromatography-tandem mass spectrometry (detection limit 0.02 lg/mL). Chi-square tests were used to assess associations of HIV case type, gender, ethnicity, age, donor type, and donor clinic (fixed, mobile) type with ARV non-disclosure. Results: During 2017, 1671 donors tested HIV-positive of whom 1315 had samples available that were tested for ARVs. The overall prevalence of undisclosed ARV use was 9.3% (n = 122) with Efavirenz most frequently detected (115), followed by Lopinavir (5) and Nevirapine (2) . Potential Elite Controller cases had the highest proportion of detectable ARV (68/80; 85%) (P < 0.0001) followed by longstanding (37/741; 4.9%) and recent (17/366; 4.6%) infections. None of 82 acute HIV cases tested positive for ARVs. There were no associations between ARV use and gender or ethnicity. However, older (35 to 64 years) HIV-positive donors (49/305; 16.1%) were significantly more likely to test positive for ARV than younger (15 to 34 years) donors (73/1010; 7.2%) (P < 0.0001). ARV use was more frequent among first time (101/ 716; 14.1%) than in lapsed (13/277; 4.7%) or repeat (8/322; 2.5%) donors (P < 0.0001). Donors at mobile clinics had significantly higher ARV non-disclosure than donors at fixed sites (10.4% vs 5.0%; P = 0.0051). Summary/Conclusions: The 9.3% prevalence of undisclosed infection and ARV use among HIV-positive South African blood donors is alarming. Higher rates of nondisclosure among first-time donors was expected, but non-disclosure among repeat and lapsed donors suggests failure in donor education and assessment. The 4.7% prevalence among concordant Ab+/RNA+ cases may suggest sub-optimal viral suppression. Lack of detection of ARVs in acute cases should be qualified because the samples were not tested for Tenofovir, the most common drug used in pre-exposure prophylaxis. Donor motivation for non-disclosure of known HIV infection and ARV use needs further investigation, since early ARV initiation or infection while on PrEP could lead to low Ab and RNA levels, failure to detect HIV-infected donations and transfusion-transmission of HIV.

Blood Bank, Rotary Blood Bank, New Delhi, India

Background: Voluntary blood donation ensures safe blood transfusion. Careful blood donor selection is of importance to provide safe blood to patients, although new methodologies have also been adopted by blood centers for blood safety and to minimize risk of transmitting infections through blood transfusion. The quality and the availability of blood components depend on the willingness to donate and reliability of the information given by the donors about their own health, including risk behaviour. Blood donor history questionnaire is designed to evaluate donor's history in accordance with the guidelines laid down by the FDA. Donors, once deferred by the blood bank, will be less motivated to return for donation if he is not counseled effectively. It is important to reduce the number of deferrals by good donor comprehension and the centre should have a mechanism to recall temporarily deferred donors Aims: The aim of the study is to analyse donor history and test results of those who donated blood with past history of jaundice. Based on their history which suggested the type of viral infection they had, these donors were accepted or deferred. Data was collected from voluntary blood donors who were screened for blood donation in the year 2018. Methods: In this study, donor history was analysed with reference to history of jaundice. Jaundice in donors after the age of 11 yrs, history of surgery, blood transfusion, body tattoos and acupuncture treatment within past one year of donation, history of multiple sex partners and related history and intravenous drug abuse history was taken into consideration. Donors who revealed past history of jaundice were asked in detail about their illness and recovery. Blood was donated by donors from whom the history of jaundice was elicited and it was understood that the type of virus which caused jaundice was not Hepatitis B or C. Those who could not give the correct history or were not sure of the cause of hepatitis, those individuals were deferred. Aims: To assess the performance of this follow-up program in terms of donor participations, successful confirmed positivity rates, and potential reentry rates.

Methods: Eligible donors were tested for HBsAg, HCVAb, HIVAb/Ag, and TPAb with two EIAs for each marker. Samples reactive with at least one assay were tested further with electro-chemiluminescence assay (ECA) and reactive samples were considered repeated reactive (RR). TPAb reactive donations were re-tested with particle agglutination assay (TPPA). Samples ECA or TPPA non-reactive were considered non-repeatable reactive (NRR Background: The Blood Donation Service in Suhl processes more than 160.000 samples annually from whole blood and apheresis donations, testing on average around 600 samples per day. For the last 5 years, serology screening was performed on the ARCHITECT instruments (Abbott) (ARC), but will be changed to the ALINITY s SYSTEM (ALY) by middle of 2019. Although the design of the ALY assays is based on those of the ARC assays, we undertook a thorough evaluation of the four mandatory screening assays detecting HBsAg, HIV Ag/Ab, Anti-HCV and Anti-HBc. Aims: To validate the 4 mandatory screening assays on the new ALY system in our lab in terms of sensitivity and specificity, also including samples with known falsereactive results. Determine the rate of false reactive results for HBsAG, Anti-HCV and Anti-HIV that may lead to deferrals of donations and donors.

Methods: For sensitivity, we used known positive samples confirmed by immunoblot or NAT. Known unspecific positive samples for ARC not confirmed by immunoblot or NAT were testes for ALY also. Close to 2.000 unselected samples (EDTA plasma) from routine blood and apheresis donors were tested in parallel on both systems, ARC and ALY to determine the rate of initial and repeat reactive results.

Results: All known confirmed positive samples were identical detected by ALY. Samples with known unspecific reactive results were retested by ALY with the following results: 19/33 Anti-HCV, 19/21 HIV Ag/Ab and 04/22 HBsAg were found reactive by ALY to. One donation from an acute HIV infection in the early seroconversion period was detected by both methods in routine testing. There are no reactive results for ALY not already known for ARC. The specificity for the screening assays on ALY versus ARC assays were as follows: 1) HBsAg ALY 100. 00% (1994 00% ( / 1994 00% ( ) vs ARC 99.95% (1993 00% ( /1994 ; 2) HIV ALY and ARC 99.95% (1992/1993); 3) Anti-HCV ALY 99. 90% (1994 90% ( /1996 90% ( ) vs ARC 99.75% (1991 90% ( /1996 . The number of anti-HBc reactive samples did not differ between ALY and ARC. Summary/Conclusions: While the switch to the new system is mainly driven by operational efficiency, obviously, the high specificity of the Alinity s assay will reduce unnecessary deferrals of donations and donors.

Abstract withdrawn. Background: Blood donor selection is the cornerstone for blood transfusion safety, designed to safeguard the health of both donors and recipients. Donor safety is targeted by reducing the risk of complications associated with blood donation and transfusion safety by reducing the risk of transfusion-transmitted infections (TTI) and other preventable transfusion reactions. There is always a compromise on blood donor safety as well as blood safety during outdoor mega blood donation drives due to various reasons, mainly due to more number of donations within a stipulated time. Aims: To compare the blood donor selection patterns between in house blood donations and donations at mega blood donation drives and its influence on donor safety and blood safety in a tertiary care hospital in India.

Methods: A retro prospective study was done to audit and compare blood donor safety and blood safety over a period of 2 years from January 2016 to December 2017. Blood donor safety was analyzed by two indicators: Donor Health Questionnaire (DHQ) monitoring and blood donor reaction rates and blood safety through TTI positivity rates. (78) during mega blood donation drive. Summary/Conclusions: A good donor selection is a lengthy process which involves pre-donation information and advice: this is usually provided in a leaflet, especially about transfusion-transmitted infections (and the associated risk factors) and the potential risks of donation, filling of DHQs by the donor himself, donor interview: conducted by a qualified medical specialist trained in donor selection process and health assessment at the end of the interview to declare if the donor is eligible to give blood or deferred temporarily or permanently. It was observed that seroprevalence rates, number of donor reactions and incompletely filled DHQs were more among blood donations at mega blood donation drives when compared to blood donations during in house collections. This is mainly due huge number of blood donations with in a stipulated time where there is limited time spent on proper donor selection. Stringent implementation of WHO strategy: "safe donor safe blood" is the only way for blood donor and transfusion safety. Background: Safety of blood transfusion is a great concern especially in crisis countries and during humanitarian emergencies. Transfusion transmitted infections (TTIs) are one of the major health problem in Yemen that are associated with blood transfusion complications. Aims: The aim of this study is to determine the prevalence of TTIs among blood donors at National Blood Transfusion and Researcher Center (NBTRC This contributed to an additional reactivity of 0.09%, thereby total reactivity being 2.39%. 55% (22/40) of these were HCV reactive & 45% (18/40) for HBV. The NAT yield was 1 in 1086 and the viral loads of NAT reactives ranged from 1-9 x10 4 IU/ml for HCV & all the HBV yields had an extremely viral load of < 06 IU/ml. 12/40 NAT reactive showed sero-conversion after 4-8 months with follow-up ECLIA screening, and 7 of these were HCV reactive and 4 HBV reactives. Summary/Conclusions: Incidence rate indicate that the current risk of transfusion transmitted viral infections attributable to blood donation is relatively high in our country. Parallel use of both serology and NAT screening of donated blood in countries that have high seroprevalence can improve the blood safety. At our centre, by using best in class serology and NAT technologies, we were would add an extra layer of safety to blood supply by interdicting samples from donor with recent infections.

Abstract withdrawn.

Abstract withdrawn. (1/190,298) . The both HIV-RNA and HCV-RNA detected donors by NAT were identified in the window period. Summary/Conclusions: In this study, we found that NAT could detect 283 infected cases with HBV-DNA, HIV-RNA and HCV-RNA which were forgotten by serological methods Therefore, NAT is a sensitive screening method to detect low viral load and shorten the window period of the virus infection to ensure the safety of blood transfusions.

Service Du Sang, Croix Rouge De Belgique, Namur, Belgium

Background: Due to enhancement of kits specificity and machines throughput, Roche Elecsys â technology is a potential partner for blood donations screening laboratories.

Aims: The aim of the study was to assess the performance of the Elecsys serology assays on a cobas e801 equipment for clinical specificity, analytical sensitivity and reproducibility. Background: Deceased donors are the primary source of organs and tissues for transplantation but the risk of infectious complications in the recipient is high and is the main cause of morbidity and mortality after transplantation.

To minimize the risk of infections by organ or tissue transplantation, donors should be tested for Anti-HIV-1/2, HBsAg, Anti-HBc, Anti-HCV, and Syphilis. Further laboratory tests may be required depending on the history of the donor and on the tissue properties. Certain grafts can be donated after circulatory death of the donor; however, the absence of the heartbeat may change dramatically the blood composition by e.g., haemolysis and proteolysis. This may have an impact on test performance and lead to false results. Therefore, an assay validation is needed for testing of cadaveric samples. Aims: A validation study was performed to demonstrate the suitability of Elecsys HBsAg II, Anti-HBc II, Anti-HCV II, HIV combi PT, HIV Duo, Syphilis, HTLV-I/II, and Chagas for the use in cadaveric samples from non-heart beating donors. Methods: As the basis for validation, we followed the recommendations of the Paul-Ehrlich-Institut (PEI) "Proposal for the validation of anti-HIV-1/2 or HIV Ag/ Ab combination assays, anti-HCV assays, HBsAg and anti-HBc assays for use with cadaveric samples". Comparison of spiked samples from living donors and cadaveric donors was used to demonstrate accuracy. To determine precision, two cadaveric specimens were tested in several replicates. Acceptance criteria were implemented according to the PEI recommendations.

Results: Results were found to be within specifications requested by the PEI recommendations for all tested assays Summary/Conclusions: The evaluated results support the extension of the use of these assays with cadaveric specimens. Background: In developed countries, blood donors are routinely screened for a range of blood borne viruses (HIV, HBV, HCV and HTLV) using highly sensitive screening tests. This has dramatically improved the safety of blood supply. However, transmission by transfusion of unknown or unsuspected viruses remains a continuing threat. This is particularly relevant considering that a significant proportion of transfused patients are immunocompromised and more frequently subjected to fatal outcomes. In developed countries, blood donors are routinely screened for a range of blood borne viruses (HIV, HBV, HCV and HTLV) using highly sensitive screening tests. This has dramatically improved the safety of blood supply. However, transmission by transfusion of unknown or unsuspected viruses remains a continuing threat. This is particularly relevant considering that a significant proportion of transfused patients are immunocompromised and more frequently subjected to fatal outcomes. Aims: In this context, metagenomic analyses of viral content in blood donations collected in geographical zones recognized as "hotspot" for viral emergence represents a suitable approach without any a priori for the identification of a potential emerging viral risk that may compromise blood safety. Methods: In the framework of a viral discovery program founded by the French National Agency for Medicine Security (ANSM in French), more than 900 plasma samples collected in 7 sub-Saharan Africa countries (2011) (2012) and the Amazon region of Brazil (2016) have already been analysed by metagenomics. Results: Although no viral sequence could be described as novel (i.e. new species or even a new genus), we unexpectedly identified a Feline Bocavirus in two donors from Mauritania. A large diversity of known viruses that are not part of the regularly monitored agents were also observed, among which Anelloviruses, HPgV-1 (formerly known as GBV-C), Papillomaviruses, Herpes viruses, Parvovirus B19, Chikungunya virus, Enterovirus, and various small circular viruses (circo-, cycloand gemycircularviruses). While no significative differences was observed in the higher classification of detected virus (above families/genera) between Africa and Brazil, we observed variations at the sequence level allowing better resolution of the genetic diversity for several viruses (for example characterization of HPgV-1 genotypes). Summary/Conclusions: Overall, the absence of novel viruses in blood samples collected across countries of two distant continents is reassuring regarding threats emergence. However, continuous monitoring of prospective blood banks should be continued. Summary/Conclusions: After the high peak observed in 2014 during the first period, this study shows that the decrease in the seroprevalence of viral markers is continuous over the next five years. The second period is marked by an irregular evolution of seroprevalence but with lower levels than the first period. The recruitment of new donors allows a quantitative increase in donations. However, improving the quality of blood products essential condition of transfusion safety is achieved through retention of recruited blood donors. Background: In blood screening laboratories, samples may be transferred between automated serological and molecular instruments, and the potential for sample contamination is a serious risk to the integrity of nucleic acid testing (NAT) results. The sensitive limit of detection (LOD) for HIV and HCV NAT assays combined with the high viral titers encountered in specimens from patients with acute infections presents a challenge for maintaining the sample integrity of negative specimens. At additional cost per test, this risk can be reduced with single-use filter pipette tips. Aims: We evaluate the efficacy of applying induction heated washes to a non-disposable pipettor on serology instruments-Alinity s, Alinity i, and ARCHITECT i2000SR (Abbott Diagnostics)-to preserve the integrity of samples transferred to a downstream molecular instrument, the m2000 RealTime (Abbott Molecular Diagnostics), which amplifies viral nucleic acid targets exponentially. Methods: In this application of induction heating, the metallic pipettor warms under its own resistance to coil-induced electrical currents. By sweeping the pipettor through an induction coil, temperatures on the pipettor are elevated throughout its length. Single donor high viral titer HIV genotypes A (5.78 log IU/ml), B (5.90 log IU/ml), C (5.62 log IU/ml), CRF01 (5.61 log IU/ml), CRF02 (6.19 log IU/ml), and URF (6.33 log IU/ml), as well as single donor high viral titer HCV genotypes 1a (6.84 log IU/ml), 1b (6.73 log IU/ml), 3a (6.64 log IU/ml), 2 (6.10 log IU/ml), 2q (6.65 log IU/ ml), and 4t (6.07 log IU/ml) were used as potential sources of contamination; these genotypes account for the majority of HIV and HCV infections worldwide. On serology instruments, one high viral titer HIV or HCV specimen and three consecutive susceptible negative samples (HIV/HCV RNA negative human plasma, Abbott Molecular Diagnostics) were tested on an HIV Ag/Ab Combo or anti-HCV immunoassay (Abbott Diagnostics), and this schema was repeated four times per positive specimen. Induction heated washes occurred between all samples processed on the serology instruments. The first susceptible negative from each testing block, with approximately 1 ml of residual sample volume, was then tested using the 0.6 ml Abbott RealTime HIV assay (LOD 40 copies/ml) or 0.5 ml Abbott RealTime HCV assay (LOD 12 IU/ml) and an HCV Ag immunoassay (LOD 1.24 fmol/l; Abbott Diagnostics). Study acceptance criteria required that any susceptible negative sample had no detectable level of HIV or HCV RNA. Results: All first susceptible negative samples (n = 24 per platform per virus schema) run on Alinity s, Alinity i, and ARCHITECT i2000SR using induction heated washes after a high viral titer HIV specimen or HCV specimen were HIV Ag/Ab Combo nonreactive (< 0.20 S/CO) and reported no detectable level of the HIV RNA target, or were anti-HCV nonreactive (< 0.20 S/CO) and reported no detectable level of the HCV RNA or core antigen targets. Summary/Conclusions: While precautions should continue to be taken for samples run on molecular instruments, the integrity of samples originally tested on the Alinity s, Alinity i, and ARCHITECT i2000SR was preserved for downstream molecular testing through the use of induction heated washes. Aims: Increasing the safety of blood and blood products -Motivating the blood donors to be regular donors Methods: National reporting system showed the high prevalence of TTIs among first blood donors in compares with the regular donors. In 2015 per 2.083.914 donations, 54% % of confirmed positive HIV, 87% of HCV, and 93% of HBV cases has been reported among first blood donors. In the end of 2015 a national program named "Pre-Donation Screening Tests "has been developed and has been implemented in high prevalence provinces in whole country. Based on this program, all first blood donors who accept in donation sites, if after donor selection process are eligible to donate blood, they refer to give just a blood sample for screening TTIs tests. After 3 months, the invitation letters and SMSs send to the donors who have negative results for all screening TTIs tests, and they can be eligible to donate blood after another donor selection process.

In 2015, about 0.156% of all donations have been rejected because of at least one of HIV, HCV, or HBV confirmed positive results, while this reject rate in 2017 was 0.082%, which shows a significant decreasing the TTIs prevalence among blood donation from 2015 to 2017. The prevalence of HIV, HCV, and HBV among donations has been decreased significantly in 2017 compared with the 2015. Prevalence of HIV among donations reduce from 0.0032% in 2015 to 0.0024% in 2017, for HCV and HBV the same results have been experienced, respectively from 0.040% and 0.113% in 2015 reduce to 0.026% and 0.053% in 2017. It seems this applied study could effectively scale up the safety of national blood supplies. In addition this intervention could support Iranian blood transfusion service to increase the proportion of Regular blood donors from 80.19% in 2015 to 86.97% in 2017. It means that with increasing the Regular Blood donor population sizes, the safety of Iranian blood and blood products will be more and more scaled up. Summary/Conclusions: Evidence based reports show there is a high rate of prevalence of Transfusion Transmitted Infections (TTIs) among first blood donors. So an effective intervention which can reduce the risk of unsafe first blood donation can effectively increase the safety of blood and blood products. Pre Donation Screening Tests program in IRAN can support the national program to decrease the rate of TTIs among blood donations from 0.0156% in 2015 to .082% in 20117.

Abstract withdrawn.

Abstract withdrawn. Background: Despite the universal application of viral inactivation and elimination technologies during the preparation of plasma-derived products, the exclusion of infectious donations before any other procedure remains the first essential step as well as the major determinant for the safety of untreated labile blood products. Current selection and screening techniques have reduced the risk of viral transmission to very low levels, but there is still a very low but quantifiable risk of transmission through donations beyond routine detection, particularly during the " seroconversion window". "of an infection in a blood donor that is to say during the period when the recently infected donor has not yet developed a serological response. The level of residual risk, which must be as low as possible, is mainly conditioned by the rates of the infections concerned (HIV and hepatitis B virus (HBV) and C (HCV)) to blood donors. Summary/Conclusions: The evolution of serologic markers is generally satisfactory with continued regression, which has improved particularly for HIV. On the other hand, hepatitis B is still a concern because of its still high rate among new donors. It is desirable to initiate a regular donor vaccination program to protect against hepatitis B. Background: Blood centres require high throughput assays with a high level of reproducibility to assure consistent results and minimize unnecessary retesting of samples and deferral of donors. In addition, continued economic pressures on laboratory operations demand that assays perform on platforms capable of increased walk away time and enhanced automation in areas of reagent management, retest options, and commodity/waste management. Aims: Evaluate the reproducibility of HCVab, HAVab IgM and HAVab IgG essays using Abbott Alinity S when compared to Architect i2000SR. Determine repeatability of these tests in Alinity S essays. Methods: During 2 months a study was conducted where several samples (minimum 10 samples per test) were randomly sorted and tested using Alinity S and Architect i2000SR, results were compared using IBM SPSS Statistics â . In order to evaluate repeatability, at least 3 samples with different reactive degrees (high, intermediate and low) per test were repeated, using Alinity S, an average of 10 times per sample and it was determined the percentage of coefficient of variation (%CV).

Results: A total of 61 samples were tested (19 for HCVab, 24 for HAVab IgM and 18 for HAVab IgG) using Alinity S and Architect i2000SR, and it was ensured that there were no statistically significant differences between results (P > .05). Using 3 samples and a total of 31 essays we found the %CV HCVab ranged from 0 to 4.474%. 5 samples were tested for HAVab IgM in a total of 55 essays and the %CV ranged from 0 to 11.475%. HAVab IgG was tested in 3 samples during 33 essays and the %CV ranged from 0 to 4.861%. Summary/Conclusions: The new automated equipment Alinity S system demonstrated no statistically difference when compared with Architect i2000SR and repeatability was ensured. This demonstrates the precision of results generated by this fully automated blood screening analyzer, which helps assure consistent results for the testing and retesting of blood specimens for HCVab, HAVab IgM and HAVab IgG. Background: Blood centres require high throughput assays with a high level of reproducibility to assure consistent results and minimize unnecessary retesting of samples and deferral of donors. In addition, continued economic pressures on laboratory operations demand that assays perform on platforms capable of increased walk away time and enhanced automation in areas of reagent management, retest options, and commodity/waste management. Aims: Evaluate the reproducibility of Hbsag, Hbsab, Hbcab, Hbeag and Hbeab essays using Abbott Alinity S when compared to Architect i2000SR. Determine repeatability of these tests in Alinity S essays. Methods: During 2 months a study was conducted where several samples (minimum 10 samples per test) were randomly sorted and tested using Alinity S and Architect i2000SR, results were compared using IBM SPSS Statistics â . In order to evaluate repeatability, at least 3 samples with different reactive degrees (high, intermediate and low) per test were repeated, using Alinity S, an average of 10 times per sample and it was determined the percentage of coefficient of variation (%CV).

Results: A total of 85 samples were tested (10 for Hbsag, 20 for Hbsab, 18 for Hbcab, 14 for Hbeag and 23 for Hbeab) using Alinity S and Architect i2000SR, and it was ensured that there were no statistically significant differences between results (P > .05). Using 3 samples and a total of 30 essays we found the %CV Hbsag ranged from 0-4.375%. 3 samples were tested for Hbsab in a total of 33 essays and the % CV ranged from 0-5.196%. Hbcab was tested in 3 samples during 32 essays and the %CV ranged from 0-2.811%. Using 3 samples and a total of 28 essays we found the %CV Hbeag ranged from 4.176-5.147%. 4 samples were tested for Hbeab in a total of 29 essays and the %CV ranged from 0-4.444%. Summary/Conclusions: The new automated equipment Alinity S system demonstrated no statistically difference when compared with Architect i2000SR and repeatability was ensured. This demonstrates the precision of results generated by this fully automated blood screening analyzer, which helps assure consistent results for the testing and retesting of blood specimens for Hbsag, Hbsab, Hbcab, Hbeag and Hbeab. Background: Blood centres require high throughput assays with a high level of reproducibility to assure consistent results and minimize unnecessary retesting of samples and deferral of donors. In addition, continued economic pressures on laboratory operations demand that assays perform on platforms capable of increased walk away time and enhanced automation in areas of reagent management, retest options, and commodity/waste management. Aims: Evaluate the reproducibility of HIVag/ab, Syphilis and HTLV I/II essays using Abbott Alinity S when compared to Architect i2000SR. Determine repeatability of these tests in Alinity S essays. Methods: During 2 months a study was conducted where several samples (minimum 10 samples per test) were randomly sorted and tested using Alinity S and Architect i2000SR, results were compared using IBM SPSS Statistics â . In order to evaluate repeatability, at least 3 samples with different reactive degrees (high, intermediate and low) per test were repeated, using Alinity S, an average of 10 times per sample and it was determined the percentage of coefficient of variation (%CV).

Results: A total of 38 samples were tested (12 for HIVag/ab, 14 for Syphilis and 12 for HTLV I/II) using Alinity S and Architect i2000SR, and it was ensured that there were no statistically significant differences between results (P > .05). Using 3 samples and a total of 31 essays we found the %CV HIVag/ab ranged from 0 to 3.05%. 2 samples were tested for Syphilis in a total of 22 essays and the %CV ranged from 0 to 1.481%. HTLV I/II was tested in 3 samples during 28 essays and the %CV ranged from 3.342 to 7.5%. Summary/Conclusions: The new automated equipment Alinity S system demonstrated no statistically difference when compared with Architect i2000SR and repeatability was ensured. This demonstrates the precision of results generated by this fully automated blood screening analyzer, which helps assure consistent results for the testing and retesting of blood specimens for HIVag/ab, Syphilis and HTLV I/II. , Human Immunodeficiency (HIV) and Hepatitis C (HCV) viruses' infection in blood donors were 1.27%, 0.20% and 0.50% respectively. Consecutive positive results for HBV were 9.20% (63/685), for HCV were 6.0% (16/266) and nil for HIV. There was no sample carry over in this. Out of 79 consecutive reactive donors 69 were donated for same patients and 32 were related with infected patient which were statistically significant (P < 0.0001). Summary/Conclusions: Among all TTI reactive donors 7.4% (79/1061) were consecutive reactive. The reason for the same may be process related like sample carry over or reagent carry over or donor related. Donor related reasons may be, one of the close relative is reactive for virus and that is transmitted to other family members. In our study 32 reactive donors either had close contacts with persons with history of infective disease or were their first degree family relatives. These findings were found statistically significant (P < 0.0001). This study recommends that in analysis of consecutive positive results in ELISA along with looking for procedure/sample error, there is also a need to take retrospective history of donors for close contact with infected patient. Background: Screening for transfusion-transmitted infections (TTIs) is critical in ensuring safety of blood products. Transmission of infections through transfusion remains a major source of viral hepatitis especially HBV and HCV. The effectiveness of rapid immunochromatographic test (ICT) devices for screening of blood is a concern and needs validation through advanced methods like Chemiluminescence Immunoassay (CLIA) and Polymerase Chain Reaction (PCR). Aims: The current study was conducted to evaluate the performance and screening effectiveness of commercially available rapid screening kits in comparison with CLIA and PCR.

Methods: This single centre, cross sectional study was conducted at the Department of Blood Transfusion Services, Shaheed Zulfiqar Ali Bhutto Medical University, Islamabad, from January -June 2018. A total of ten commercially available ICT devices and one CLIA kit (LIAISONR XL) were tested for their sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV) and accuracy using 100 positive and 100 negative samples each for HBV and HCV respectively, in comparison with the values determined by PCR. The ICT kits included Hightop, RightSign, Wondfo, Accu-Chek, Fastep, Abon, ImmuMed, Insta-Answer, BioCheck and CTK. Results: The sensitivities and specificities of ICT kits for HBsAg were 65% and 70% (Hightop), 67% and 85% (RightSign), 62% and 73% (Wondfo), 70% and 80% (Accu-Chek), 68% and 77% (Fastep), 73% and 85% (Abon), 77% and 83% (ImmuMed), 80% and 90% (Insta-Answer), 67% and 81% (BioCheck) and 72% and 83% (CTK) respectively. Similarly the sensitivities and specificities of different ICT kits for HCV were 69% and 80% (Hightop), 76% and 83% (RightSign), 69% and 81% (Wondfo), 78% and 79% (Accu Check), 68% and 68% (Fastep), 63% and 73% (Abon), 71% and 70% (Immu-Med), 79% and 68% (Insta Answer), 62% and 66% (BioChek) and 69% and 78% (CTK) respectively. The sensitivity and specificity of Diasorin Liaison Murex assay for both HBV and HCV were found to be 100%, when compared with PCR. The PPV, NPV and Accuracy were determined accordingly. Summary/Conclusions: Rapid testing ICT devices for both HBV and HCV available in Pakistan were found to have a variable degree of sensitivity and specificity, when compared with PCR. Comparatively expensive but quality methods are more reliable as compared to rapid devices. The data generated will help policy makers to prepare future plan of action and introduce the concept of quality control in blood centres. The analysis has shown that the population of blood donors also included people infected with syphilis. In reference to the number of the tested samples this number is quite significant. The analysis proved the increase in the number of syphilis infections among the blood donors which is consistent with the general trend in the population. Summary/Conclusions: We have proved that testing blood donors for the Treponema pallidum infection increases the safety of recipients of blood and its components and that obligatory testing of donors is fully justified. , 1940 and 1945 , the use of third or fourth generation serological assays is mandatory for screening of blood donor units for HBV and HCV infection before transfusion. Routinely, blood banks in India screen the units by the ELISA testing. NAT is not very common due to cost constraints. Aims: The aim of this study is to determine the frequency and load of HBV DNA and HCV RNA in HBS and HCV reactive blood donors respectively, and hence it was intended to contribute to determining whether routine HBS and HCV screening of blood donors, using ELISA method alone, provides any concrete benefits with regard to HBV and HCV risk reduction or whether the implementation of NAT will be of great benefit to low-resource countries like India, which has high prevalence of HBV and HCV. 

Abstract withdrawn. ,906 donors were routinely tested for HBV DNA by using CobasTaqscreen MPX-1 and MPX-2 (Roche) or ProCleix Ultrio and Ultrio Plus ID (Grifols) assays. OBI was confirmed by repeat DNA testing and by performing additional serological and molecular investigations on index and follow-up samples. Anti-HBs concentrations were determined and anti-HBc antibodies were tested with three distinct commercial CLIA assays (Anti-HBc Elecsys Roche, Architect Anti-HBc II Abbott, and HISCL Anti-HBc assay Sysmex). HBV pre-S/S, precore/core and BCP regions were PCRamplified after viral particle concentration and viral amplicons were sequenced. Results: 348 HBsAg-/DNA+ donors (1:1,462) including 294 confirmed OBI were identified (1:1,731 prevalence). Among OBI donors, 160 (54.5%) tested anti-HBc+/anti-HBs-, 108 (36.7%) were anti-HBc+/anti-HBs+, 25 (8.5%) were anti-HBc-/anti-HBs+, and 1 anti-HBc-/anti-HBs-primary OBI (0.3%). Anti-HBc-/anti-HBs+ OBI donors were significantly younger (mean: 21 years [range: 18-57 years]) than those with anti-HBc+/anti-HBs+ (mean: 44 years [range: 19-60 years]) and anti-HBc+/anti-HBs-(median: 45 years [range: 21-55 years]) profiles (P < 0.0001). HBV vaccination was documented for 18 (72%) of these donors and was reported in one donor but without definitive evidence. Extremely low HBV DNA loads (range: <10-155 IU/mL) were transiently detected in seven donors during follow up. Genotypes identified were genotype B (n = 1/20) and genotype C (n = 19/20). Preliminary analysis of core protein (n = 16) and BCP (n = 10) sequences showed no particular genetic feature that could be associated with altered antigenicity or core gene expression. Follow-up was available for 15/ 25 anti-HBc-/anti-HBs+ donors (2-6 samples/donor; range: 2-56 months). Anti-HBc remained undetectable with all CLIA assays in these donors except one. Low transiently detectable levels of HBV DNA were observed overtime with anti-HBs levels fluctuating between 12 and 1,000 IU/L. no significant difference in HLA-A, -B (except HLA-B*46 more frequently detected in anti-HBc negative OBI), and -DRB1*. Summary/Conclusions: Overall, the 8.5% prevalence of anti-HBs-only in HBV DNA positive OBI carriers (1:20,355 of total donors) in Dalian blood donors confirmed previous reports from South East Asia. This phenomenon was not related to Core antigenic variations but was significantly associated with younger age of carriers. A particular route and natural history of the infection may be considered. The hypothesis of acute-phase vaccine breakthrough was ruled out in 15/25 donors by the over 50 months stability of this serological profile. Breakthrough in immunized donors may still be suspected. Further studies are needed to evaluate the potential infectivity of anti-HBs-only/HBV DNA+ OBI carriers, and to characterize the potential viral and immunological mechanisms responsible for this unusual HBV infection profile.

Confirmatory Laboratory, Hungarian National Blood Transfusion Service (HNBTS), Budapest, Hungary

Background: Vaccination against Hepatitis B virus (HBV) is an effective tool to avoid the infection. In Hungary, population born after 1986 is considered to be immunized, because inoculation has been mandatory for children as campaign vaccination since 2000. HBV vaccine is strongly recommended for healthcare workers, moreover trips to endemic countries and awareness of individuals could also be reasons of vaccination in immunologically na€ ıve age-groups. Since the HBV vaccine contains surface antigen, a recent inoculation can cause reactivity of HBsAg screening assays and positivity of confirmatory tests for several days resulting in deferral of donors from blood donation. The former regulation of HNBTS, which was valid until December 31, 2018, allowed the re-entry of donors whose immunization records and negative HBV confirmation of the second blood samples proved that the previous vaccination had resulted in the HBsAg confirmed positivity. Aims: The aim of this study was to strengthen that vaccination against HBV before blood donation had resulted in the reactivity of HBsAg screening and confirmatory assays between 2012 and 2018. Background: In Brazil, the introduction of nucleic acid tests (NAT) for HBV-DNA detection in the routine screening at public blood banks is relatively recent. At Fundac ßão Pr o-Sangue/Hemocentro de São Paulo (FPS-SP), about 130,000 blood donors are submitted to serological screening tests (HBV, HCV, HIV-1/2, Chagas disease, Syphilis and HTLV-1/2) and NAT for HIV, HCV and HBV per year. Approximately 2% of the blood donations are discarded due to some reactive result; of these, the HBV discard rate was 0.65% in 2016. Aims: Our study aims to determine the potential infectious cases among samples that had one or more HBV-reactive screening results (anti-HBc, HBsAg and MP-NAT-HBV) and verify the different categories of HBV infection (acute, chronic, Occult hepatitis B Infection (OBI) and immunological window). Furthermore, to characterize the distribution of HBV genotypes, drug resistance and escape mutations and analyze the risk factors. Methods: We carried out a cross-sectional study of roughly 74,000 donations from May 2016 to December 2016. HBV antibodies and antigen screening were performed using CMIA kits Architect â -Abbott/HBsAg and Architect â -Abbott/anti-HBc. NAT screening was performed in minipools (MP) of six samples using Kit NAT HIV/HCV/ HBV -Bio-Manguinhos (sensitivity 95% LOD 300 IU/mL for HBV). Reagent samples (n = 407) that presented one or more HBV-reactive screening results (anti-HBc, HBsAg and/or MP-NAT-HBV), were submitted to individual nucleic acid extraction and "in house" quantitative real-time PCR-HBV (ID-PCR-HBV) targeting the HBsAg region (sensitivity 10-20 UI/mL). The HBV genotypes and mutation analyses were determined by direct sequencing of the HBV pol-gene/surface-gene and use of the online analysis tool Geno2pheno [hbv] 2.0. Socio-demographic and epidemiological data were also analyzed. Financial support: FAPESP 2017/16658-6. Results: Among the 407 HBV reactive samples, 377 were reactive for anti-HBc only (92.6%), 10 for HBsAg only (2.5%) and 20 were reactive for both markers and HBV DNA (4.9%). Routine testing and ID-PCR-HBV identified 20 (0.027%) samples of active infections that had all HBV reactive/positive tests results. No HBV DNAyield samples or HBsAgyield or OBI were observed. Viral loads for active infections samples ranged from 1.08E+01 to 2.45E+09 cop/mL (median, 2.12E+08cop/mL). HBV sub-genotypes A1, A2, C1, D3 and F1 were found in 70%, 5%, 5%, 15%, and 5% of the donors, respectively. No reverse transcriptase inhibitor-resistant variants were detected. Escape mutations in small HBsAg protein SHB region were detected in 30% (6/20), with the following main substitutions 100C (3x), 120R, 123N and 144G. The mean age of donors with active HBV infection was 40 years, mostly donors were males (80%), mixed (40%) or white (40%) and had concluded high school (45%). Summary/Conclusions: Discard rate due to isolated anti-HBc is high but no OBI was found in the blood donor population studied. In addition, no case of immunological window for HBV or HBsAgyield was detected. There was a predominance of subgenotype A1 and mutations associated with escape were found in 30% of HBV-DNApositive samples. Continuous research and surveillance about HBV prevalence among blood donors are needed to maintain and evenly increase blood safety in Brazil. Background: Screening for anti-HBcore antibodies in blood donors is considered to contribute significantly to blood safety, since it reveals donors with occult or probable occult hepatitis B, with variable results in molecular screening, due to very low viral load. However, universal anti-HBcore testing in blood donors, might exclude a considerable number of blood donors in countries with high HBV prevalence and even in countries with low to moderate prevalence, like Greece. Aims: The aim was to investigate the percentage of blood donors with natural HBV infection (confirmed positive anti-HBcore) or HBV immunization due to vaccination (anti-HBs+ only, due to vaccination) and predict the impact of generalized anti-HBcore testing. Methods: During the period 15-30 November 2018, all blood donors were asked to give their consensus for additional screening for hepatitis B anti-HBcore and anti-HBs antibodies, besides the obligatory serological and molecular screening, The samples of few donors who disagreed, were not examined. All samples with repeated positive anti-HBcore results, were further examined for anti-HBcore IgM and anti-HBe antibodies. Furthermore, a new donor sample was requested, to confirm reactivity. The serology results were recorded in an excel spreadsheet. Additional data, including age, sex, nationality, number of previous blood donations, ABO blood group, family history of HBV infection, HBV vaccination, were also recorded and statistically evaluated. Donors were informed of the positive results.

Results: A total of 620 EDTA samples were tested using the Architect anti-HBcore, anti-HBs, nti-HBcore-M and anti-HBe assays (chemiluminescent microparticle immunoassay (CMIA). Repeated anti-HBcore(+) occurred in 24 (3.87%) samples, among which 7 (19%) were also anti-HBe(+), while anti-HBs was found > 200 m IU/ml in 15 (62.5%), between 100 and 200 mIU/ml in 3 (12.5%), and < 100 mIU/ml in 6 (25%). Among anti-HBcore positive donors, 4/24 were foreigners (16.6%) and 20 were Greeks, while foreigners consisted 6,29% (39/620) of donors examined. So, anti-HBcore was found positive in 10,25% of foreigners (4/39, all from countries with high prevalence for hepatitis B infection) and in 3,44% of Greeks (20/581). In total, 285 (45.96%) samples had anti-HBs > 10 mIU/ml (considered seroprotective for the donor). Summary/Conclusions: Almost half of our blood donors (45.96%) were immunized, 261 by vaccination and 24 (3.87%) by natural infection. The incidence of natural infection was significantly higher in foreigners (10.25% versus 3,44%).

If not all anti-HBcore+ donors, 25% with anti-HBs < 100 IU/ml, might be potentially infectious, especially for immunocompromised patients.

If we choose to screen all blood donors for anti-HBcore and reject those with positive results, regardless of the anti-HBs levels, we would probably lose a significant number of donors and jeopardize blood sufficiency.

Alternatively, we could reject only those with anti-HBs < 100 or < 200, or choose to selectively screen pre-donation blood donors from countries with high prevalence of HBV infection. Following this pilot study, the prevalence of immunization against HBV in large numbers of blood donors from various parts of Greece, must be investigated, in order to decide whether to introduce such screening. Aims: The aim of this study was to perform phylogenetic analysis of the donor samples with HCV found in the neighbouring villages to determine the nature of transmission.

Methods: Altogether, approximately 2 million blood donor samples were screened with anti-HCV immunoassay (Architect anti-HCV, Abbott GmbH, Wiesbaden, Germany) and reactive results were confirmed with anti-HCV line-immunoassays (INNO-LIA HCV Score, Fujirebio Europe, Gent, Belgium). Based on LIA positivity, in 20 samples an association of HCV infection was supposed, because the residence places of donors were in three neighbouring villages situated less than 20 km to each other. PCR was positive in 15 samples. From these samples, HCV sequencing and phylogenetic analysis were performed. Fourteen HCV infected samples of general population and 11 of IVD users were also included into the study.

Results: Phylogenetic analysis detected genetic relationship among the HCV virus sequences in donor samples. The most abundant was the 1a subtype, and it formed two different groups on the phylogenetic tree. According to their genetic distance, a more distant mutual ancestor could be supposed. Two samples with 1b subtype originated from the same village, and their difference was only 2 nucleotides. Three HCV from the IVD user control group showed close genetic relationship with the viruses detected in the donor samples. Summary/Conclusions: Based on our phylogenetic analysis, HCV transmission in blood donors could be the consequence of the IVD use and the origin might be related to 2 or 3 primary human sources. During 2011 and 2014, a significant increase in the HCV seroprevalence among the IVD users was observed, which was approximately threefold in the rural areas of Hungary. Our recent findings highlight the importance of the proper donor selection, which can identify the typical signs of the IVD use. Moreover, enhancing awareness of blood donors with education is a further significant issue in order to reduce the risk of transfusion transmitted infections.

Abstract withdrawn. Background: In China, the residual risk of transfusion-transmitted HCV has been declining since screening of blood donors for anti-HCV and/or HCV NAT from 1993. However, many high sensitivity reagent, using to test blood donors' samples, lead to false-positive results and donors loss.

Aims: This study intended to establish a donor reentry procedure for HCV screening reactive donors in China.

Methods: From March 2014 to December 2017, there were 2083 blood donor samples which were screened reactive or belonged to "grey zone" by ELISA and/or reactive by nucleic acid test(NAT) at the local blood centers were collected from 15 Chinese blood centers. All these samples were sent to Institute of Blood Transfusion (IBT) national reference laboratory where anti-HCV and HCV individual nucleic acid test (ID-NAT) were conducted. If the results were reactive for anti-HCV, then the samples were tested with a Recombinant ImmunoBlot Assay (RIBA).

Results: Based on this study, 1178 of 2083 donors in the study who could be classified into two categories for HCV status: 201(17.1%) true positive and 974 (82.9%) false positive. A total of 905 of 2083 donors lost to follow-up, their HCV status cannot be determined with certainty. Based on these data, a reentry procedure for HCV screening reactive donors was proposed. Summary/Conclusions: Based on our proposed donor reentry procedure for HCV screening reactive donors, a majority of screening false-positive donors (82.9%) can re-entry safely.

Abstract withdrawn. Background: Providing safe blood for transfusion in Sub-Saharan Africa (SSA) is a particular challenge due to a combination of factors; limited resources and infrastructure, suboptimal diagnostics and a high prevalence of the major transfusion-transmissible infections (TTIs). Average seroprevalence data estimates from the Ugandan and Kenyan Blood Transfusion Services (BTS) for hepatitis C (HCV) currently stand at 6.6% and 0.9% respectively. Between January and December 2016, in Mbale (Eastern Uganda) the HCV prevalence amongst blood donors was an alarming 8.1%. With no provision or funds for confirmatory testing, the BTS are unable to confirm or refute a diagnosis of active HCV. This results in large quantities of blood wastage, unnecessary anxiety in potential donors and high donor deferral rates limiting the donor pool. Aims: We aim to determine the true prevalence of active HCV infection amongst seropositive donors in BTS in Uganda and Kenya. In addition, we aim to compare the performance of locally used serodiagnostics and best available alternative tests and to examine the feasibility of cost-effective additional or alternative tests to help provide accurate results on the infectious status of blood. Methods: 235 HCV seropositive blood samples from 3 BTS study sites (Kampala, Mbale, Mombasa) will be re-tested using the local serology screening test (Abbott Architect anti-HCV), an alternative WHO pre-qualified rapid antibody test (SD Bioline) and a confirmatory test (HCV core antigen test). Where there is discrepancy in the results or need for clarification, samples will be tested on the Cepheid Xpert platform by reverse-transcriptase PCR to obtain a quantitative RNA result. S/CO (specimen to cut-off) values for false positive samples (by screening serology) will be analysed and presented. Pre-analytical factors (centrifugation speed, haemolysis check, time delay between collection and testing) will be controlled for and documented.

Results: Pilot data from re-testing quarantined HCV seropositive donor blood (Mbale BTS) in Uganda demonstrated that 45/50 seropositive blood (90%) was RNA PCR negative. In December 2018, 156/249 (63%) of seropositive samples (by screening anti-HCV serology) in Kampala BTS had S/CO values between 1.00-1.99 (1.00 is the cut-off indicating a positive sample). Data from the re-testing of 235 seropositive samples as true representation of active HCV will be demonstrated and S/CO values for the study period concomitantly with a retrospective analysis of January to December 2018. Preanalytical factors, cost analysis comparisons of the diagnostic platforms coupled with costs of the donor deferral process in false positive cases will be presented. Summary/Conclusions: For the BTS in SSA there are significant resource and financial implications, as repeat testing and donor deferral counselling is required. Evaluating and introducing new and appropriate diagnostics and algorithms in the screening of HCV is crucial in improving the supply of safe blood transfusion services in East Africa. Background: In November 2017, the Blood Services of England, Scotland and Wales reduced donor deferral to three-months for commercial sex workers and individuals with higher risk sexual partners, including sex between men. The change was recommended after a detailed review by an external expert committee (SaBTO) which recommended that a shortened deferral of 3 months would allow detection of recently acquired infection and maintain residual risk (RR) at a tolerable level. Recommendations were accepted by government but with a government commitment to explore a more individualised approach.

Aims: To assess the impact of a 3-month deferral on blood safety in terms of epidemiology of infections in blood donors and compliance with donor selection criteria, and to explore evidence required to develop a more individualised approach to donor selection policy Methods: Routine UK blood donation surveillance data for 2010-2018 (2018: preliminary) were reviewed. Annual prevalence and incidence of HBV and HIV infection were estimated, with a Poisson regression models to test for trends. Incidence was calculated from donors seroconverting within 12-months, and/or microbiological and clinical evidence of recent infection. For donors positive in 2018, compliance with the 3-month deferral was determined. UK hemovigilance data were scrutinised for evidence of transfusion transmitted infections (TTI) associated with newly eligible donors. Results: From 2010 to 2018 among new donors, annual HIV prevalence decreased significantly by an average of 11.3% each year (P = 0.02) to 1.49/100,000 donations in 2018; no significant trend was observed for HBV. Annual HIV incidence among repeat donors also decreased significantly by an average of 17.3% each year (P = 0.03) to 0.23/100,000-person years (pyrs) in 2018 (based on 2 seroconverters).

There was no significant trend in HBV incidence over the study period, however between 2017 and 2018 incidence increased from 0.35/100,000 pyrs to 0.84/ 100,000/pyrs (based on 3 and 7 seroconverters respectively). With the information available to date, none of the 2018 seroconverting donors were non-compliant, and there was no reported confirmed TTIs associated with the policy change. Summary/Conclusions: HIV prevalence and incidence has continued to decline. HBV incidence in repeat donors increased in 2018 although initial analysis suggests this is not associated with the policy change. Monitoring continues, and residual risks will be re-estimated as data post-change accumulate. These data are reassuring, and therefore it is appropriate to scope the evidence for, and feasibility of, a more individualised approach to selection policy. A multidisciplinary steering group has been convened including representation from patient and stakeholder groups. Gaps in knowledge are being defined, and a package of work is in development under the project of FAIR (For the Assessment of Individualised Risk), using the ABO RDF for guidance. Background: Permanent deferral of men who have sex with men (MSM), established in the 1980s, primarily to minimise the risk of HIV transfusion-transmitted infections is increasingly challenged. Accordingly, blood services in many countries have changed to time-based deferral. In Canada, a 5-year deferral was implemented in 2013, reduced to 12-months in 2016; a 3-month deferral is now being considered. Aims: To estimate the risk of undetected HIV among screened blood donations under a 3-month deferral since last sex between men.

Methods: The applied model combines features of previously published English and Canadian models to estimate HIV risk under a 12-month deferral. Three scenarios varying HIV incidence, prevalence and non-compliance under a 3-month deferral were modelled. Assumed constants were the HIV nucleic acid window period, testing procedure error rate and assay sensitivity. Model inputs were incidence under the current 12-month deferral, calculated as HIV positive donors with a previous negative within 12 months divided by number of person years, numbers of HIV positive donations, HIV positive MSM, HIV MSM incident cases and newly eligible MSM donors (from donor surveillance and compliance surveys). The risk with a 3-month deferral was estimated for three scenarios, one determined "most likely", where MSM donor non-compliance, HIV incidence and HIV positive donations do not change and MSM newly eligible to donate are estimated from compliance surveys. This scenario is based on data from two sequential policy changes in Canada. An "optimistic" scenario where non-compliance halves and a "pessimistic" scenario where MSM HIV incidence, HIV positive donations, non-compliance and new MSM donors double were also used. The median HIV residual risk was used as the final estimate.

The uncertainty in this estimate was assessed with the 2.5th and 97.5th percentiles over the simulation (95% CI). Results: Incidence, per 100,000 donations, was estimated to be 0.15, 0.13 and 0.27 for the "most likely" "optimistic" and "pessimistic" scenarios, respectively. For the 3month deferral "most likely" scenario, HIV residual risk was predicted to be 1 in 32.6 million donations (95% CI: 1 in 217,692 million to 1 in 8.3 million). For the "optimistic" scenario, HIV residual risk was estimated to be 1 in 34.3 million donations (95% CI: 1 in 257,692 million to 1 in 9.1 million). Finally, for the "pessimistic" scenario, HIV residual risk was estimated to be 1 in 16.0 million donations (95% CI: 1 in 34,091 million to 1 in 5.7 million). With these residual risk estimates, based on the number of donations in Canada, one HIV infectious donation would be in inventory every 30 years for the "most likely" scenario, every 32 years for the "optimistic" scenario and every 15 years for the "pessimistic" scenario. Summary/Conclusions: The risks of HIV entering the blood supply in Canada for a 3-month MSM deferral are predicted to be very low for all modelled scenarios, including a "pessimistic" doubling of HIV incidence post change. Background: Safety of blood and blood products is a major concern in Pakistan. The prevalence of transfusion transmitted infections among multi-transfused thalassaemia patients is high (above 25%). The HIV epidemic in Pakistan is following the Asian epidemic model where after establishment among the high risk groups, its transmission to general public is rapid. Fear, stigma and ignorance have contributed heavily to HIV transmission in Pakistan. The HIV detection among blood donors is on the rise and reports occur in media repeatedly. Aims: To investigate the possible transmission of HIV through blood transfusion in Punjab, Pakistan and to highlight the steps being taken to reduce further transmission of infections Methods: In September 2018, a report of HIV transmission through blood transfusion was reported in the media where a mother and her newborn acquired HIV after blood transfusion from a HIV positive donor (confirmed later). The case was referred to and investigated by the Punjab Blood Transfusion Authority (PBTA). The PBTA team took blood samples of both recipients (mother and her newborn) and the blood donor who was a family relative. The samples were tested by highly sensitive chemiluminescence immunoassay (CLIA).

The CLIA results confirmed the presence of HIV in both recipients and the blood donor. Due to maternal HIV antibodies transfer through the placenta, the infection status of the newborn was not re-confirmed as he died within two weeks. The donor informed that he had donated 22 times in the past few years. The PBTA was able to trace only one earlier donation three months ago. The recipient (a female) was found, tested by CLIA and was found to be HIV positive. All these cases occurred in unlicensed private blood banks that were screening for HIV on rapid manual devices. The blood banks were sealed by the Authority and infected cases were registered by the provincial AIDS Control Programme and are being treated. Summary/Conclusions: The main reasons for HIV spread through blood transfusion is the use of sub-standard rapid screening devices which are not evaluated and validated at a national level. In addition, the existing system relies on the family/replacement donors. The national Safe Blood Transfusion Programme, is implementing blood safety system reforms as recommended by WHO. Under the reform agenda, the blood transfusion authorities have been made functional and grant licenses to only those blood banks with proper systems to ensure quality and safety of blood products. The Programme is developing a national system for the evaluation, selection and validation of all assays used for screening of blood in close coordination with the Drug Regulatory Authority of Pakistan.

To promote the culture of voluntary blood donations, the Programme has taken concrete steps initiating with the formulation of a national blood donor policy, interaction with celebrities, celebration of world blood donor day and more recently the launch of blood donation feature through 'Facebook'. The promotion of voluntary blood donation concept along with regulation of blood sector will reduce the risk of HIV transmission through blood transfusions in Pakistan. Mianyang Blood Center, Mianyang 9 Urumqi Blood Center, Urumqi, China 10 RTI International, Rockville 11 National Heart, Lung, and Blood Institute, Bethesda 12 Stanford University, Stanford, United States

Background: The incidence of HIV infections has increased substantially over the past decade in China, especially among young people, who represent nearly half of the Chinese blood donor population. This upward trend in HIV infections underscores the importance of monitoring HIV prevalence and incidence in Chinese blood donors. Aims: To estimate HIV prevalence and incidence rate (IR) among Chinese blood donors using blood donation data from five geographically-disperse blood centers in 2013-2016 participating in the Recipient Epidemiology and Donor Evaluation Study-III (REDS-III) China program. Methods: Western blot confirmatory testing was done on samples of blood donations reactive for HIV-1/2 on one or both rounds of routine ELISA tests or positive by Nucleic Acid Amplification Testing (NAT). Multiple imputation was used for samples with missing confirmatory test results. HIV prevalence was calculated among first-time donors. To estimate HIV IR in first-time donors, single-well LAg-Avidity EIA testing was conducted with first-time HIV recent (incident) infections defined as being infected within approximately 129 days based on avidity of HIV antibodies. A novel model was derived to estimate HIV IR among infrequent repeat donors who had provided only one donation in the 2013-2016 estimation interval. To derive an overall HIV IR for repeat donors, this estimate was combined with the classical-model IR estimated for repeat donors who had given at least 2 donations in the estimation interval. Multivariable logistic regression model was used to examine factors associated with HIV infection. Results: A total of 1,276,544 whole blood and apheresis platelet donations with postdonation screening results were collected at the five blood centers between 2013 and 2016, including 648,607 donations from first-time donors and 627, 937 donations from repeat donors. HIV prevalence among first-time donors was 68.04 per 100,000 donors (95% CI, 61.68-74.40). HIV IR was estimated to be 37.93 per 100,000 person-years (95% CI, 30.62-46.97) among first-time donors and 20.55 per 100,000 person-years (95% CI, 16.95-24.91) among repeat donors. HIV prevalence and IR varied across regions with an increasing trend observed at some blood centers. Among first-time donors, being male, older than 25 years, minority ethnicity, less than college education, and certain occupations (commercial services, factory workers, retired, unemployed, or self-employed) were associated with positive HIV confirmatory testing results. Summary/Conclusions: Although HIV prevalence and incidence remain low among Chinese blood donors, it is important to monitor HIV epidemiology in blood donors on a continuous basis, especially among populations and regions of higher risk. Further donor screening and education strategies need to be developed and evaluated to reduce these risks. The IR methods used in this study for first time donors as well as repeat donors who donate very infrequently is readily applicable to other countries who have similar donation patterns. Background: In Thailand, the National Blood Centre is responsible for blood donation service which includes follow-up and blood donor counseling in order to indicate the infection status, especially HIV-positive blood donors. Currently, although the epidemic of HIV infection in Thailand is in decline, the HIV-positive cases still have been found in blood donors screening. Thus, monitoring of HIV infection status in blood donors and post-blood donor counseling are important for providing the HIV-positive infected donors lead to access the HIV treatment immediately. Aims: To study the HIV follow-up cases on serological testing over 10 years for assessment of the HIV infection in Thai blood donors.

The retrospective analysis of HIV follow-up cases on serological testing (CMIA, ICS and Western blot) was conducted during 2009 to 2018 at Thai National Blood Centre. Results: A total of 6,408,024 voluntary blood donations over 10 years, the repeated reactive results on HIV serological screening were 5,978 (0.093%) cases and only half of these HIV reactive donors returned to follow-up testing for ascertaining their HIV status. For HIV follow-up process, the HIV reactive screening donors must be followed for 6 months and tested by using the different three principles of HIV serological testing. A total of 5,978 HIV reactive results were separated to three patterns including HIV positive results, inconclusive results and negative results which the number of each group was 1,130 (35.7%) cases, 742 (23.5%) cases and 1,292 (40.8%) cases respectively. Out of 1,130 HIV positive results, we found that 1,105 (97.8%) cases were positive with all HIV serological testing for the first-time follow-up and 25 (2.2%) cases were tested and become to positive results after follow-up more than one time. In 742 cases of inconclusive results, 539 (72.6%) cases were reactive only 1 or 2 testing(s) which these donors did not return to confirm again leading to temporarily deferred donors in blood donor system. In addition, 203 (27.4%) cases of inconclusive results could not conclude the HIV result although they were repeated several times. For the last pattern, 1,292 negative results cases showed 762 (59.0%) cases were negative results after follow-up over 6 months while 530 (41.0%) cases were inconclusive results before changing to negative results which almost cases of this group were reentry as blood donor after deferral period is over. Summary/Conclusions: The number of repeated reactive results on HIV screening was constant over 10 years of which returned to follow-up only half of HIV reactive donors leading to accumulation of temporarily deferred donors in blood donation system. HIV follow-up positive cases were informed and counseled immediately then referring to anonymous clinic for treatment. The problem and challenges of HIV follow-up were inconclusive results that were unclear and some of these did not return to retest lead to loss of re-entry donor who might be changed to negative result afterward. Hence, the effective counseling and follow-up system need to be taken urgently to encourage the temporarily deferral donors returned to retest for reducing stigma of deferred donors in HIV follow-up cases. . We only analyzed the information that had non-reactive results for infectious markers reported by blood banks to SIHEVI-INS©, because they represent a risk for blood recipients. Results: When loading the information of SIVIGILA in SIHEVI-INS©, 241 donors were found (80% men); of these people 256 donations were obtained (97% whole blood). 166 donors (69%) had a reactive result for HIV being subsequently reported in SIVIGILA. In addition, five of them were reactive simultaneously for HBV in blood banks and took on average 174 AE 83 days to be reported in SIVIGILA. 25 donors (10.4%) had an HIV reactive result notified by SIVIGILA and subsequently they were reactive in blood banks. This behavior may suggest an attempt to spread the disease. 20 donors (60% men) despite being initially reported in the SIVIGILA database, presented a non-reactive result in a blood bank for HIV; one of them was reactive for syphilis and HBV and only one for HBV. This pattern may suggest false positive or negative results in one of the two databases analyzed. Fourteen donors had negative test in blood banks for HIV and in a range of up to 6 months they were reactive by SIVIGILA (93% of them donate whole blood). This conduct may suggest that accepted donations were in a window period and therefore warrant further investigation. Considering that two blood components could be obtained on average from each donor, a potential risk is estimated for 28 recipients. Summary/Conclusions: The donors reported first in the blood banks through SIHEVI-INS© and later in SIVIGILA allow to estimate an adequate orientation to the health services. The information from general epidemiological surveillance programs could improve the selection of donors and transfusion safety. Background: It is assumed that bacterial contamination of blood products most often takes place during the donation process. The number of bacteria at this time point is estimated to be around 10-100 CFU per bag. Little is known about the growth behavior of different bacteria species in whole blood (WB) units during storage and the distribution of bacteria to the different blood products. Aims: Aim of the current study was to determine the growth of different bacteria species in contaminated WB units and to study the distribution of the bacteria to the different blood components. Methods: Whole blood (n = 4-12 per species) was inoculated with approximately 10 CFU of different bacteria species (Escherichia coli, Klebsiella pneumoniae, Pseudomonas fluorescens, Staphylococcus aureus, Staphylococcus epidermidis, Streptococcus dysgalactiae, Streptococcus pyogenes) and stored for 22 to 24 h at room temperature before centrifugation and separation into red blood cells (RBC), buffy coat (BC) and plasma. BCs from spiked WB were each pooled with 3 random BCs to prepare plasmareduced platelet concentrates (PC). Samples were taken from WB after storage and from the blood products (RBC, BC, plasma and PC) right after preparation, and the bacterial titer was determined. Sterility of PCs was tested by BacT/Alert after seven days of storage. Results: Bacterial growth in WB varied remarkably between donations and bacteria species. The highest titers in WB were detected for the Streptococcus species, whereas Staphylococcus aureus, Staphylococcus epidermidis, Escherichia coli and Pseudomonas fluorescens did not multiply. Bacteria preferably accumulated in the BCs during separation, reaching titers of up to 3.5 9 10 3 CFU/mL in BCs and up to 0.9 9 10 3 CFU/mL in the corresponding PCs right after preparation. In total, 33 out of 48 PCs tested positive for bacteria at the end of storage. The results were dependent on the species used: e.g., 6/6 PCs tested positive after spiking with Streptococcus pyogenes, while only 1/8 PCs tested positive after spiking with Escherichia coli. Bacterial contamination of RBC and plasma units was much less frequent and associated with higher bacterial titers in the parental WB units. Summary/Conclusions: The growth and distribution of bacteria during processing of WB into the different blood products is species-dependent and remarkably varies between donations.

Results: Both patients were male (69 yo and 65 yo) with a history of acute myelogenous leukemia status-post haploidentical stem cell transplant. The patients were thrombocytopenic and underwent simultaneous transfusion of irradiated, non-PR, day 4 platelets stored in platelet additive solution, from a single apheresis collection. The blood supplier's primary pre-release bacterial cultures were negative, and the on-site point of release secondary safety measure pan genera detection (PGD) testing was negative for both Gram positive (GP) and Gram negative (GN) organisms. Both apheresis units also passed visual inspection prior to release from the blood bank. During transfusion, both patients displayed signs of septic transfusion reaction including rigors, fever, hypoxemia, tachypnea, tachycardia, and hypotension. Transfusion reaction evaluations were initiated, and both patients were admitted to the medical intensive care unit and started on broad-spectrum antibiotics. Gram stain of one platelet unit demonstrated Gram negative rods (GNR) and Gram positive cocci (GPC) in clusters, and the second platelet unit demonstrated GNR only. Repeat secondary safety measure PGD testing of both units was negative for both GP and GN organisms. Direct bacterial cultures of both platelet units grew both GNR and GPC identified as A. baumanii and S. saprophyticus after 18 h of incubation. Colonies on the initial bacterial plates were too numerous to count (TNTC), and subsequent re-plating of the platelet units showed: Unit 1: A. baumanii TNTC and S. saprophyticus with 8.5 9 10 4 CFU/mL Unit 2: A. baumanii 6.6 9 10 7 CFU/mL and S. saprophyticus 2.2 9 10 6 CFU/mL Blood cultures collected from both patients became positive within 8 h with GNR on Gram stain, and both blood cultures ultimately grew both A. baumanii and S. saprophyticus. The primary pre-release cultures at the blood supplier remained negative. After days on antibiotics and pressors, both patients stabilized and were discharged home. The blood donor was interviewed, and he was well. No cultures were collected. Summary/Conclusions: This case documents failure of both primary pre-release bacterial testing and secondary on-site point of release PGD testing to identify two pathogenic organisms. A. baumanii and S. saprophyticus are unusual causes of septic transfusion reactions, and it is possible that these organisms have different limits of detection in the PGD assay compared to other organisms. Rapid attention to clinical signs during transfusion and prompt initiation of antibiotics is critical for the management of septic transfusion reactions. We are currently evaluating ways to further reduce septic transfusion reactions, including increasing the utilization of pathogen reduced platelets. Background: Transfusion-associated infections due to the transmission of bacteria still represents a major risk in developed countries nowadays. Despite the refrigerated storage of red blood cells (RBC), fatal reactions of patients receiving contaminated RBC units are repeatedly reported. In order to further increase the safety of blood transfusions, new strategies and measures have to be developed. In this context, Transfusion-Relevant Bacteria Reference Strains can serve as a valuable tool for the validation, comparison and interpretation of these new developments. Aims: Conducting a collaborative study to establish the first repository for red blood cell Transfusion-Relevant Bacteria Reference Strains. Methods: Six bacterial strains (Serratia liquefaciens, Serratia marcescens, Pseudomonas fluorescens, Listeria monocytogenes, Yersinia enterocolitica A-105 and Yersinia enterocolitica A-176) were distributed from the Paul-Ehrlich-Institut to 17 laboratories in 10 countries for enumeration, identification and growth measurement in a 7-day interval for a total of 42 days after low-count spiking of RBC bags (10-25 colony-forming units (CFU)/RBC bag). Results: Except for S. marcescens, all other strains showed good-to-excellent growth in RBC. S. liquefaciens, P. fluorescens, Y. enterocolitica A-105 and Y. enterocolitica A-176 achieved >10 6 CFU/ml at day 14 and 10 9 CFU/ml at day 21. Growth of L. monocytogenes was lower reaching a maximum concentration of >10 6 CFU/ml at day 35. In 9 out of 17 laboratories, S. marcescens showed no growth at all. Summary/Conclusions: Five of the six tested strains showed robust growth in RBC independent of donor variability and are promising candidates to be adopted as official RBC Transfusion-Relevant Reference Strains by the World Health Organization. 

Background: The SampLok Sampling Kit (SSK), ITL BioMedical, is used by NHS Blood and Transplant (NHSBT) for sampling of platelet components (PC) for bacterial screening using the BacT/ALERT 3D system. Inoculation of BacT/ALERT bottles is performed immediately after sampling. Validation of delayed inoculation, with retention of the sample within the SSK devices, would allow a contingency for transport to other screening sites in the event of an incident that prevented testing at the sampling site. SSK maintain a closed system for sampling of PC and are compatible with standard blood collection bags. A graduated chamber (10 or 16 ml) ensures that only the required sample volume is collected and an integrated needle allows inoculation into BacT/ALERT bottles. Aims: The National Bacteriology Laboratory, NHSBT, evaluated the impact of prolonged storage of PC samples in SSK devices with regard to bacterial viability and detection. Methods: Four reference species were assessed: Staphylococcus aureus (ATCC 29523), Streptococcus agalactiae (ATCC 13813), Escherichia coli (ATCC 25922), Clostridium perfringens (ATCC 13124). A pool and split method was used with apheresis PC suspended in plasma. Units were screened using BacT/ALERT 3D prior to spiking to prove the absence of contamination. PC were spiked with a single species (range 4 9 100-2.8 9 103 CFU/ml) and tested on BacT/ALERT with a 1 ml inoculation into anaerobic and aerobic bottles (positive control). Enumeration was performed to confirm the bacterial concentration. Each unit was sampled using two 10 ml SSK, which were held for a period of 6 h at 20-25°C. The process was repeated with a 24-h period. Once elapsed, 8 ml of each SSK was inoculated into an aerobic and anaerobic BacT/ALERT bottle, one SSK per atmosphere per species and the remaining sample was enumerated. All bottles were incubated on the BacT/ ALERT system for a maximum of 7 days (36AE0.5°C) and subcultured if positive. Results: Positive controls had detectable growth by BacT/ALERT, excluding aerobic bottles with C. perfringens. This was expected as it is an anaerobic organism. After the storage periods, all bottles had detectable growth by BacT/ALERT. S. aureus showed an increase of 0.6-Log10 after 6 h (2.0 9 102 to 8.9 9 102 CFU/ml) and 2.0-Log10 after 24 h (3.1 9 101 CFU/ml to 3.4 9 103 CFU/ml). S. agalactiae increased by 0.7-Log10 after 6 h (2.1 9 102 CFU/ml to 1.1 9 103 CFU/ml) and 0.09-Log10 after 24 h (1.0 9 102 CFU/ml to 1.2 9 102 CFU/ml). C perfringens increased by 0.6-Log10 after 6 h (1.3 9 102 CFU/ml to 5.0 9 102 CFU/ml) and 2.7-Log10 after 24 h (4.0 9 100 CFU/ml and 2.2 9 103 CFU/ml). For E. coli, the concentration after 6 h was reduced by 0.28-Log10 (2.8 9 103 CFU/ml and 1.5 9 103 CFU/ml), however this was possibly a result of inherent counting errors. At 24 h, an increase in growth by 2.7-Log10 (1.5 9 102 to 7.9 9 104 CFU/ml) was obtained. Summary/Conclusions: Storage of PC samples in SSK devices for up to 24 h does not have a negative effect on bacterial viability and detection using the BacT/ALERT 3D system. Background: The INTERCEPT TM Blood System for Platelets efficiently inactivates pathogens and leukocytes in platelet concentrates (PC). The system utilizes amotosalen and UVA light and is available for the treatment of apheresis and whole blood (WB) derived platelets (mostly buffy coat pools) in Europe in plasma or platelet additive solution (PAS), and the treatment of apheresis platelets in the US (TRIMA TM in 100% plasma or AMICUS TM for 65% InterSol PAS/35% plasma). Acinetobacter baumanii and Staphylococcus saprophyticus strains were isolated from a saline flush taken 7 h after successful and complete transfusion of an apheresis INTERCEPT-treated PC in 65% PAS/35% plasma, from a patient with a suspected septic reaction that occurred 2 h post transfusion. Bacterial isolates, and a sample of a Gram stain-negative and culture-negative sister split PC were submitted for evaluation. We report here the in vitro inactivation of the fast growing, gram negative bacterium A. baumanii and slower growing Gram positive S. saprophyticus. The sister unit was assessed for amotosalen break down products as an indication of successful INTER-CEPT treatment. Aims: The objective of the study was to evaluate bacterial inactivation of A. baumanii and S. saprophyticus in apheresis platelets, assessed immediately after treatment and with re-culture at the end of a 7 day shelf-life. Methods: A double apheresis PC collected in 65% PAS/35% plasma was split into three equal components, yielding approximately 250 mL of platelets/PC. A. baumanii and S. saprophyticus were grown in LB broth and each PC unit was inoculated with either bacterial strain or the combination of both strains, each at~6 log colony forming units/mL (cfu/mL). After inoculation, the contaminated units were treated in small volume (SV) INTERCEPT kits. Samples were taken: pre and post-inactivation treatment, and at 3, 5 and 7 days of storage. The samples were analyzed by plating on LB plates (100 lL-10 mL). Residual amotosalen levels were assessed by HPLC. Results: Initial bacterial titers were 5.9-6.0 cfu/mL. Following the inactivation treatment, no viable bacteria were detected by plate culture. No bacteria were detected after 3, 5 and 7 Days of storage, corresponding to > 5.9 log 10 inactivation of both bacterial strains. Performance of the INTERCEPT treatment process was confirmed in the sister PC unit as evidenced by levels of amotosalen and its byproducts characteristic of INTERCEPT treatment, as well as by review of the process documentation. Summary/Conclusions: Amotosalen/UVA effectively inactivated A. baumanii and S. saprophyticus individually and together below the limit of detection after 7 days storage. No bacteria in the sister PC by Gram stain and culture, and the presence of amotosalen byproducts suggested that the PC collection involved in the septic reaction was sterile at the time of INTERCEPT treatment and was successfully illuminated. The possibility of only one-of-two split PC being contaminated due to biofilm formation is minimized in the INTERCEPT System which decants platelets into virgin storage bags at the end of treatment. Contamination of the source PC container likely occurred after INTERCEPT treatment, possibly at the time of spiking for transfusion. Background: Studies in sub-Saharan Africa have documented bacterial contamination of blood products for transfusion varying between 0,3%>17,5%, up to 5000 times higher than in the North. Published data from Central Africa are lacking. Aims: The aim of this study was to determine the proportion of blood products contaminated with bacteria in three hospitals in the Democratic Republic of the Congo (DRC). To assure aseptic sampling, we used a closed system of sampling bags. In addition to the presence of contamination, we assessed semi-quantitative colony counts. Methods: From July to December 2018, a total of 2411 blood products were sampled, of which 979 in Hôpital Provincial G en eral de R ef erence, Kinshasa (HPGRK), 662 in Hôpital P ediatrique Kalembe Lembe, Kinshasa (HPKLL) and 770 in Hôpital Saint-Luc, Kisantu (HSLK). After compatibilization of blood products, 16 ml of blood was transferred from the primary blood bag to an attached sampling bag. Sampling bags were sealed off, stored in the fridge and transported once daily to the bacteriology laboratory. Using the adapter connected to the sampling bag, 4 ml of blood was inoculated in a blood culture (BacTAlertPF, bioM erieux) and incubated at 35°C for 7 days. Cultures were checked daily for signs of growth. In addition, 2 ml of blood was equally distributed on the CLED and MacConkey agar-coated sides of a dipslide (MEUS s.r.l.). Dipslides were incubated 48 h for semi-quantitative culture, expressed as colony-formingunits (CFU) per ml. In case of blood culture growth, bacteria were identified and a second blood culture was inoculated to exclude contamination during processing. Bacteria grown on semi-quantitative culture were also identified.

Results: A total of 1.6% (39/2411) of whole blood and red cell concentrates were contaminated with bacteria. In HPGRK, 2.7% (26/979) of blood products were contaminated, in HPKLL 1.5% (10/662) and in HSLK 0.4% (3/770) . The proportion of contaminated blood products was significantly higher in HPGRK compared to HSLK (P = 0.00047). There was no significant difference between the other sites (P = 0.051 and P = 0.12). Majority of isolated bacterial species were coagulase-negative Staphylococcus spp./Micrococcus spp. (46.7%) and Bacillus spp. (33.3%). The remaining 20% of bacterial isolates were identified as non-fermentative Gram-negative rods, Klebsiella pneumoniae, Staphylococcus aureus, mould, Listeria spp., Corynebacterium spp./Coryneform bacteria. The concentration of all isolated bacteria was lower than 10³ CFU/ml, except for one coagulase-negative Staphylococcus spp. found in HPGRK at 10³ CFU/ml. Summary/Conclusions: To our knowledge, we were the first to reach a sample size of more than 2000 blood products for bacterial culture and the first to use a closed system of sampling bags in sub-Saharan Africa, which guarantees aseptic sampling of blood cultures. This might explain the low bacterial contamination rate (1.6%) of blood products in three hospitals in DRC compared to previous studies in other sub-Saharan African countries. Moreover, bacterial concentrations in the contaminated blood products were low (<10³ CFU/ml). The different proportions of contamination between study sites suggest that different environments and practices play a role in the risk for bacterial contamination. Background: Although the screening of the Treponema pallidum (Tp) is mandatory in blood donations, its necessity is controversial, because there have been no transmissions by blood products documented in the developed countries in the last few decades. Aims: Based on laboratory markers, active and early Tp infected donors (AEID) were determined. The demographics of AEID and the frequency measures of cases were compared with that of early infected syphilis cases (SYC) notified from the 18 to 65-year-old general population registered at the NPHC. Methods: Altogether, 474,017 18 to 65-year-old donors were screened with anti-Tp immunoassay (Architect Syphilis Tp, Abbott, Wiesbaden, Germany) between 2015 and 2017. Reactive results were confirmed with immunoblots (Viramed Biotech AG, Planegg, Germany), which discriminated both specific anti-Tp (IgG, IgM) and non-specific VDRL antibodies in five dilutions. Meeting the criteria of anti-Tp IgG positivity with a VDRL titer of ≥ 1:8 and anti-Tp IgM positivity, donors were considered as AEID. They were stratified by age, gender and residence regions. The proportion of AEID (PAEID) and SYC (PSYC) were calculated in first time (FT), and repeat tested (RT) donors and in the 18 to 65-year-old general population, respectively, in each year studied. The period prevalence (PP) of AEID and SYC was estimated in the populations at risk 1,2 across 2015-2017. Statistics: weighted proportions and one-way ANOVA with Tukey Post-Hoc test and z score test were applied. Statistical significance was defined as P < 0.05. Results: Anti-Tp reactivity was confirmed in 167 blood donors. AEID was proved in 85 cases with 36 FT and 49 RT donors. In that period, 1696 SYC were notified. Both in AEID and SYC, the age group of 25-34 years with approximately 35% and 36% of individuals was the dominant. The proportion of men was 74% and 77% (P = 0.5) in the AEID and SYC, respectively. PAEID estimated in FT donors was significantly higher (0.020%; 0.023%; 0.032%, P < 0.0001) than that of RT donors (0.007%; 0.009%; 0.009%) and the proportion of SYC (0.008%; 0.009%; 0.010%) in the general population. PP of AEID showed a roughly homogenous distribution in the 7 regions (0.011%-0.025%), however, PP of SYC had a significant (0.058%; P < 0.0001) Central Hungary dominance in relation to the other regions (0.008%-0.016%). Comparing the PP of AEID to SYC, Central Hungary indicated a significant difference (0.025% vs. 0.058%, P < 0.0001), however, other regions showed no substantial differences. Summary/Conclusions: Donors with anti-Tp confirmed positivity are referred to the healthcare system. Based on the laboratory markers tested, AEID could be separated and their demographical characteristics are pretty similar to that of SYC notified from the general Hungarian population. The proportion of early and active infection in FT donors is significantly higher than that of RT donors and the proportion of SYC in the general population. Given the considerable number of Tp infection in Background: Quality assurance and safety of hematopoietic stem cells (HSC) with emphasis on prevention of bacterial and fungal contamination are the prerequisites for any transplantation procedure. Bacterial contamination is of particular significance as it occurs relatively more frequently and bacteria are gradually gaining more antimicrobial resistance. Aims: The aim was to determine the incidence rate of bacterial and fungal contamination during processing of transplantation material at the Institute of Hematology and Transfusion Medicine (IHTM) taking into account the HSC sourceperipheral blood (PBSC), bone marrow (BM) or cord blood (CB). Methods: Analysis involved both autologous and allogenic components collected at IHTM and other hospitals and dedicated for IHTM patients. In all, the analysis comprised 4135 donations, including 112 BM (2.70%), 3787 PBSC (91.60%) and 236 CB (5.70%) donations processed in our laboratory in the years 1996-2016. BM was collected in operating theatre-conditions, PBSC with cell separators -CS-3000 (Baxter), Cobe Spectra (Gambro) and Trima Accel (Terumo BCT) and CB was acquired from umbilical vein at obstetrics and gynaecology wards. Aerobic and anaerobic bacteria contamination was determined at various incubation temperatures (room temperature and 35°C) using a variety of culture media. PBSC and BM were tested using 2 samples with Trypcase-soy broth (TSB-T) and 1 with Schaedler + Vit K3 (BioMerieux). CB was tested using Bactec Peds Plus/F and Bactec Lytic/10/Anaerobic/F (Becton-Dickinson).

Results: In the 1996-2016 period 42 contaminated products were found: 25 PBSC (0.66% of all tested PBSC units) and 17 CB (7.20% of all tested CB units). No infected BM products were determined. The overall percentage of contaminated products was estimated at 0,1%. In 2010, three (3) products were found contaminated with Staphylococcus epidermidis; all came from one patient with central venous catheter and were collected on consecutive days. Other products were contaminated mostly with Staphylococcus epidermidis (61.36%). Detailed results to be presented on the poster. Summary/Conclusions: According to IHTM policy no contaminated product is admitted to clinical use. The outcome of our study identifies processing experience of the staff as the main indicator of product quality. Important is also proper assessment of donor health and condition of the injection site as products are usually collected from central venous catheter. The closed system is an additional safeguard against contamination during processing. The sample collecting procedure should help to avoid false positive results. Background: Syphilis is considered a global public health problem. The World Health Organization (WHO) estimates that there are annually around 12 million new cases of syphilis in the world, more than 90% occurring in developing countries. Despite significant decrease in syphilis transfusion transmission. The recent increase in worldwide incidence associated with the risk of transmission through platelet concentrates (CP), which are stored at room temperature, have called attention to the potential residual risk of syphilis transmission by transfusion. Between 2015 and 2017 we observed in our institution a significant increase of 24% in positivity of syphilis among blood donors from 0.62% in 2015 to 0.73% in 2016 and 0.77% in 2017 (P < 0.0000001). Aims: To determine the prevalence of active syphilis in blood donors and characterize the serological profile of syphilis positive donors. Methods: Each positive sample in a treponemic chemiluminescence assay (CMIA, Abbott Architect) performed during blood donor screening in 2017 was submitted to a treponemic Elisa Anti-Treponema pallidum IgM (Euroimmun) and a non-treponemic test (ANTIGEN-Omega Diagnostics). Samples with positive results for one or two of these tests (indicating recent Syphilis) were submitted to a Real-time PCR for syphilis. The INNO-LIA Syphilis-Fujirebio Immunoblot test was also performed for samples that presented a positive result for Elisa-IgM alone. Financial support: FAPESP 2017/23028-9. Results: Among 123,851 samples screened in 2017, 958 (0.77%) presented a positive result for CMIA -Syphilis. Of these, 626 (65.4%) were included in the study. A total of 106 samples (17%) showed VDRL+/IgM+; 96 (15%) VDRL+/IgMand 28 (4.5%) VDRL -/Elisa IgM+. The INNO-LIA Syphilis test was performed as a confirmatory test in 28 (4.5%) samples that presented positive results for Elisa IgM and VDRL negative with 21 (3.35%) positive results, 1 (0.15%) undetermined and 6 (0.95%) negative. None of the 626 samples showed the presence of Treponema DNA by real-time PCR. The prevalence was 0.77%, the incidence was 0.1% in the year 2017, and the incidence in relation to the total positivity was 20.4%. Both, prevalence and incidence were higher in men, white, not married, aging 18-29 years and high school educational level. We observed a 6% a-HBc seroprevalence in the Elisa IgM-Syphilis positive samples and a prevalence of 1.5% HTLV coinfection. Summary/Conclusions: We observed a significant increase in prevalence of syphilis in 2017 (0.77%) with an incidence of 20.4% of the total of cases initially positive in the CMIA test. According to our data, we could identify a risk of syphilis transfusion transmission in blood banks that exclusively use the VDRL for donor screening, once we found 22 (3.5%) cases with negative VDRL and Elisa IgM and INNO-LIA positive. Continuous monitoring of the profile of donors infected with syphilis at this time of reemergence of the disease is useful and important not just for blood banks, as it reflects the epidemiological situation of disease in community, and can contribute to the definition of health policies. Background: Transfusion related sepsis is a serious concern limiting platelet storage time to 5 days at room temperature. While most units are screened for bacterial contamination when collected, bacterial monitoring methods can take up to 7 days to detect contamination. Thus, cold storage of platelets represents an attractive alternative for improving platelet safety. In this study, we assessed bacterial growth in platelets stored either at room-temperature (RT; 22°C) or refrigerated (CS; 4°C). Aims: The aims of this study were to 1) assess the effect of storage temperature on platelet function and bacterial growth in "contaminated" platelet units, and 2) identify factors contributing to bacterial growth during RT storage. Methods: Apheresis platelets in plasma (PLT) were obtained from healthy donors using the Terumo Trima Accel Automated Blood Collection System (Terumo BCT). Fresh plasma (FP) was collected similarly. Aliquots of PLT or FP were transferred to pH SAFE minibags (Blood Cell Storage, Inc) and "contaminated" with Acinetobacter baumannii, Escherichia coli, Pseudomonas aeruginosa, Staphylococcus aureus, Staphylococcus epidermidis, or PBS (uninfected control). Minibags stored at RT were agitated using an orbital shaker set to 60 rpm while CS aliquots were stored under static conditions. Bacterial growth was monitored daily through dilution plating. Lactate levels were assessed by iSTAT (Abbott) CG4 + test cartridges. Plasma glucose levels were assessed using blood glucose testing strips (Germaine Laboratories). Platelet activation and aggregation were assessed on days 0, 1, 3, and 5 by flow cytometry and Multiplate platelet aggregometry, respectively. Results: Bacterial growth progressed rapidly over the first 3-4 days post-collection in all PLT aliquots stored at RT except those challenged with S. epidermidis. Significant growth of S. epidermidis was not detected until day 4. Bacterial numbers remained unchanged in refrigerated aliquots through day 5. RT storage resulted in significantly (P < 0.05) decreased platelet aggregation over time which was exacerbated by bacterial challenge. PLT function was largely preserved with refrigeration regardless of challenge. Bacterial growth was significantly reduced, or at least delayed, in FP. FP challenged with Gram-negative pathogens exhibited a significant (P < 0.05) delay in bacterial growth at day 1. While growth of E. coli and P. aeruginosa recovered by day 2, growth of A. baumannii was significantly (P < 0.05) inhibited throughout. FP challenged with Gram-positive pathogens exhibited significant (P < 0.05) reduction in bacterial growth relative to PLT aliquots. Bacterial growth correlated with PLT lactate production. Lactate levels in PLTs challenged with E. coli showed diminished significantly after day 3, indicative of lactate utilization. With exception of FP challenged with S. aureus, bacterial growth was restored in FP supplemented with lactic acid in all challenge groups. Summary/Conclusions: Refrigeration preserved platelet function while both inhibiting bacterial growth and lactate production. Conversely, the opposite was observed with RT storage. These data demonstrate that bacterial growth can be controlled through refrigeration without loss of function and RT storage may potentiate growth of certain bacterial strains through accelerated PLT metabolism. Background: Bacterial contamination of peripheral blood progenitor cell (PBPC) for transfusion has been the cause of serious sepsis and life-threatening infections. However, a standard procedure or choice of test sample(s) has not been established to screen PBPC products for microbial contamination, because these products are not large enough to facilitate inoculation of the recommended volume for the automated blood culture systems. Samples taken from by-product plasma and low volume PBPC product were cultured in routine sterility test. Aims: To evaluate the residual risk of microbial contamination in PBPC products for transplantation, we cultured sufficient post-thaw inoculation volumes from PBPC products which were discarded for various reasons in our blood center. Methods: In routine sterility test, a 20-mL sample of by-product plasma collected with PBPC product was inoculated into BacT/ALERT BPA and BPN culture bottle (10 mL each) within 48 h after collection. The bottles were then placed in the BacT/ ALERT system and incubated for at least 7 days or when a positive reaction was indicated by the automated liquid-media culture system. Moreover, a 2-mL postthaw sample would be cultured before transplantation performed. In the residual risk investigation, discarded PBPC products were thawed, and then a 2-mL and a 20-mL aliquot were taken and cultured with the same method. All positive bottles were subcultured for bacterial isolation and identification. Results: In September 2008 and March 2018, after maintaining in liquid nitrogen for 1 to 17 years, 205 PBPC products collected from 45 patients, which was preserved in a volume between 35 and 60 mL, were discarded. All of these products had been cultured negative in routine sterility tests with plasma samples. These 205 final products were thawed and cultured with both the 20-mL and the 2-mL aliquot. One of these PBPC products had the positive culture result with the 20-mL retested samples. Nevertheless, the same PBPC product had the negative result with the 2-mL post-thaw PBPC sample and the 20-mL by-product plasma sample. Propionibacterium acnes was isolated from the BPN positive bottle. Summary/Conclusions: The residual risk of microbial contamination in PBPC postthaw products still exist after routine sterility test with the plasma sample and the 2-mL volume of PBPC sample. The bacterium isolated from PBPC product was normal skin flora bacterium. An optimal screening method of PBPC products merits further study to increase the safety of the blood supply. Background: Hospital hygiene tools that serve as a proxy for assessment of microbial contamination are increasingly used. They include adenosine triphosphate (ATP) bioluminescence and air particle counting. However, their use for microbial monitoring of blood banks remains underexplored. They could be of particular interest in a sub-Saharan African setting (temperatures, dust) to circumvent bacterial culture and provide direct results usable for monitoring over time.

Aims: The aim of this study was (i) to quantify environmental bacteria in the air and on surfaces that are regularly in contact with blood products, and (ii) to evaluate ATP bioluminescence techniques and particle counts as a predictor for bacterial contamination, in three blood banks in the Democratic Republic of the Congo (DRC). Methods: Samples were taken in three blood banks in the Democratic Republic of the Congo: Hôpital P ediatrique de KalembeLembe (HPKLL) (10 surfaces, 1 air), Hôpital Provincial G en eral de R ef erence (HPGRK) (24 surfaces, 2 air) and the National Blood Transfusion Centre (CNTS) (20 surfaces, 2 air). Surfaces that are regularly in contact with blood products were selected (sealer, fridge, donor chair,. . ..). Regular surfaces were sampled using RODAC contact plates (23.7 cm²) containing CLED and MacConkey agar, irregular surfaces using swabs (NRSII, MedicalWire). ATP was measured on the same surface (PD30, Kikkoman), expressed as Relative Light Units (RLU) per 100 cm². Air was sampled by active sampling (500 liter; SpinAir, IUL) on CLED and MacConkey medium. In parallel, particles > 0.5 lm and > 5 lm were counted using a particle counter (14,15 liter; MetOne 227A). Culture media were incubated for 48 h at 35°C before counting colony forming units (CFU). Results: For regular surfaces, the median (range) viable bacterial count was 27 (6-60) CFU/RODAC, 69 (6-103) CFU/RODAC, 82 (3-132) CFU/RODAC for HPKLL, CNTS and HPGRK, respectively. At HPKLL, highest viable counts were found in the sink (plain growth) and cool boxes (43 and 60 CFU/RODAC). In CNTS the blood processing bench, the donor chair arm support and washing basin showed the highest counts (plain growth). Whereas in HPGRK, most bacteria were found in a fridge (plain growth), blood bag trolley (plain growth) and manual separator (132 CFU/ RODAC). Gram-negative bacilli were isolated from water basins and sink in CNTS and HPKLL, but also surfaces close to donor chairs at HPGRK. The median (range) of ATP per 100 cm² was 2.906 (778-26.497) RLU at HPKLL, ) RLU at CNTS and 35.235 (1.754-348 .052) at HPGRK. ATP results and total viable count were not correlated (n = 49, P = 0.52). Median (range) bacterial count in the air was 258 (210-375) CFU/500L for all sites together. There was no correlation found between total bacterial count and particles > 0.5 lm or > 5 lm (r = 0.7 and r = 0.6 respectively; P < 0.05; n = 5) Summary/Conclusions: Total viable bacterial count of surfaces varies over blood bank sites. According to our results, ATP and particle counts did not correlate with bacterial counts on surfaces and in the air, respectively. Bacterial isolates from blood bank environments in DRC need to be identified and seasonal variations need to be evaluated. Background: The risk of transfusion-transmitted hepatitis E virus (TT-HEV) infections in line with the question of the necessity of HEV-NAT screening of blood products is currently subject to an ongoing debate on the importance of timely introduction of HEV screening of blood donors and the impact of blood safety. Different countries have chosen different regulatory approaches. Just recently, the German federal authorities have introduced mandatory testing of all therapeutic blood products beginning from January 1st 2020. However, we already decided to voluntarily test all our blood products since January 2015. Aims: In this study, we present our results of a 100% screening of therapeutic blood products for HEV RNA including four years of active surveillance of hepatitis E infection among blood donors in Germany. Methods: From January 2015 to December 2018, a total of 386,307 allogenic blood donations from 69,956 individual German blood donors were screened in a minipool format of 96 samples of for the presence of HEV RNA (RealStar HEV RT-PCR Kit, Altona Diagnostic Technologies (ADT), Hamburg, Germany). Nucleic acids were extracted from 4.8 ml plasma using the Chemagen MSM-I extractor (Viral 5k, Perkin Elmer Chemagen GmbH). The 95% LOD of the assay was determined to 4.66 IU/ml (447 IU/ml per single donation). The presence of HEV-specific IgM and IgG antibodies was determined using the anti-HEV IgM/IgG ELISA (Euroimmun, Luebeck). HEV RNA concentrations were quantified using the first WHO international Standard for hepatitis E Virus RNA for NAT-based assays. All HEV RNA positive donors were deferred from donation for 3 months. Follow-up samples were tested for the presence of HEV RNA and HEV-specific antibodies. Genotyping was performed by sequencing of the hypervariable region (HVR) and ORF1. Results: In total, 274 HEV RNA positive donors were identified. Of these, 274 HEV RNA-positive donors, 216 were NAT-only positive donations (78.83%, negative for anti-HEV IgM and anti-HEV IgG), three donors had a positive IgM titer (1.09%), 30 donors showed reactive IgM and IgG titers (10.95%), 25 donors already had isolated IgG titers (9.12%). Median values of viral loads were approximately twice as high in index donations that were antibody negative. Merely 62 donors showed elevated ALT levels (22.63%), mostly within a double increase within the reference range (16.06%), only 6.57% of donors had even further elevated ALT levels. Significantly higher ALT values were found in donors with a viral load > 1,000 IU/ml compared to the group with viral loads between 100 and 1000 IU/mL. Available follow-up samples confirmed IgG seroconversion for all donors, however we also observed long-term IgM positivity in some donors. Genotyping revealed genotype 3 in all cases. The month-dependent incidence ranges from 1:719 to 1:3,781 blood donations with a peak in June and July. Summary/Conclusions: The high number of identified HEV RNA positive donors emphasizes the need for HEV-NAT screening to increase the safety of blood products. This study further confirmed that HEV infection is common in German blood donors. Background: Zika virus (ZIKV) is a mosquito-borne virus that has caused outbreaks in Central and South America in February 2016, and has threatened the safety of blood transfusion globally. There is a high risk of ZIKV transmission by Whole Blood and blood components transfusion. It was reported that, ZIKV RNA in infected patients plasma can only be detected within 1 to 2 weeks. However, in whole blood, ZIKV RNA might present positive up to day 101 after the symptoms appear in some patients, even if the clinical symptoms disappeared with ZIKV RNA negative in plasma. This phenomenon suggested that the presence of ZIKA is associated with red blood cells (RBCs). Moreover, another report showed that viral load in whole blood of type A West Nile virus (WNV) patients was higher than type O, implying that the binding of virus to RBCs may be related to blood group glycoprotein. Both of ZIKV and WNV are member of the Flavivirus genus. The study is intended to explore whether ZIKV have the same adherence mechanism to RBCs as WNV. Aims: To investigate the distribution of ZIKV in blood components and adherence of ZIKV to different blood types of RBCs in whole blood. Methods: Five units for each blood type of A, B, O and AB whole blood were randomly selected. Each unit of 200 mL whole blood was divided into two half-unit. ZIKV was added to one half-unit in a certain proportion, and incubated at 37°C for 3 days. Each component of whole blood was collected for viral load detection. In the other half-unit,RBCs were suspended in the same type pools of plasma with equal volume after the plasma removed from the whole blood after centrifugation. ZIKV was added with the same certain proportion, and then incubated at 37°C for 3 days. The whole blood samples and the upper plasma by centrifugation were collected detected for ZIKV RNA. Meanwhile, RBCs were washed and resuspended with normal saline followed by viral load detection. Results: ZIKA RNA of these samples which extracted from whole blood, RBCs, and plasma were determined in a quantitative reverse transcription PCR, and viral RNA of each component was all up to 10 9 copies/mL. Although, ZIKV RNA loads did not show significant difference in distribution between RBCs and their corresponding plasma components, ZIKV RNA quantification were significantly higher than those in plasma (P < 0.05) in type O RBCs and lower than those in plasma (P < 0.05) in type AB RBCs. Summary/Conclusions: In our study, we detected high viral RNA loads in RBCs. It was demonstrated that ZIKV adheres to erythrocyte in whole blood, and the blood type may have influence on the adherence.

Background: Hong Kong is not endemic for dengue virus (DENV) with most of the documented cases being imported. The presence of sufficient number of mosquito vectors, Aedes albopictus, in the territory has led to two self-limiting indigenous outbreaks affecting 20 residents from 2000 to 2014. During 14 August to 4 September 2018, another outbreak of 29 confirmed cases of autochthonous dengue fever were reported to the Department of Health, linked to two epidemiological clusters, one in Lion Rock Park near Wong Tai Sin (WTS) District (19 cases) and the other in Cheung Chau, an outlying island (10 cases). Aims: We assessed the risk of dengue transmission from blood donors during the 2018 outbreak using a simplified version of the probabilistic model developed by Biggerstaff and Petersen (B-P) and the European Up-Front Risk Assessment Tool (EUFRAT) model (Oei, Transfusion, 2013) . Methods: Patient demographic and general population data were obtained from the Centre for Health Protection and the Department of Census and Statistics of the Hong Kong Government for the number of 15-to 64-year-old patients in the 2018 outbreak and residents of the same age range in Hong Kong and WTS District as at mid-2018 respectively (16-65 years old being the eligible age range for first time donation). To apply the B-P model, we estimated DENV incidence among donors in Hong Kong territory and in WTS with confirmed DENV infection during 12 August to 8 September 2018 after correction for clinical:subclinical infections ratio, the mean length of asymptomatic viraemia and the probability of collecting blood from asymptomatic donors as described previously (Seed, Transfusion, 2009 ). To estimate the risk using EUFRAT model, outbreak and blood donation variables were entered into EUFRAT's web-based interface (https://eufrattool.ecdc.europa.eu/), which provided automatic calculation of risk-related output parameters. Results: While using the B-P model, the estimated risk of collecting a DENV viraemic donation was one in 778,000 (266,000-1,822,000) territory-wide for the 28-day study period but increased to one in 147,000 (50,000-345,000) in WTS. Similarly while applying the EUFRAT model, the risk of encountering a viraemic donor was 1 in 279,000 (118,000-752,000) territory-wide and 1 in 52,000 (21,000-188,000) in WTS during the same period. The EUFRAT also predicted a territory-wide issue of 0.08 unit of DENV-contaminated labile blood component during the outbreak period. Summary/Conclusions: Like many mosquito-borne infections such as DENV, the risk is characteristically localised and varies geographically and seasonally during outbreaks. The average predicted risk of collecting a DENV-viraemic donation territory-wide is low at 1 in 778,000 during the 2018 outbreak based on the B-P model, which was generally considered as tolerable. However, the risk increased by 4 folds when blood donations were collected from WTS residents, who had higher chances of paying visits to Lion Rock Park in close proximity. It was then justifiable to institute risk mitigation policies such as geographically-based deferral and/or fresh component restriction, enhanced post-donation reporting, etc. to protect against blood safety. Background: HEV is a developing threat to blood safety following the reporting of several cases of transfusion transmission HEV (TT-HEV). Transfusion-related HEV infection has been reported in several countries but its true frequency is probably underestimated because it is often asymptomatic and testing of blood donors is infrequent. Pakistan is classified as a highly endemic region; with sporadic cases of HEV occurring throughout the year, mainly affecting the adult population. To the best of our knowledge, no studies have been reported from Pakistan on the epidemiology of HEV in blood donors. Aims: To assess the epidemiology of the HEV specific antibodies and serum ALT levels in Blood Donors of Capital twin cities of Pakistan. Methods: This cross sectional study was conducted from July 2017 to December 2017 at three blood banks in the capital twin cities (Rawalpindi and Islamabad) of Pakistan. The blood donors were equally distributed across the three blood banks. Only donors who tested negative for HIV, HBV and HCV were included in the study. Serum ALT levels were analyzed by using automated clinical chemistry analyzer (SELCTRA Pro M) using MERCK kits. All samples were tested for HEV-specific antibodies (IgM and IgG) by using Enzyme linked immunosorbent assay (ELISA) kits (Adaltis, Italy). Statistical analyses were performed using SPSS software version 21.0 (IBM). Results: In our study population there were 445 (98.9%) males and 5 (1.1%) females. The mean age of recruited blood donors was 28.38 (SD AE 7.34), with a range of 18-55. Younger donors were more common with a frequency of 18-27 year olds of 249 (55.3%). We found an overall HEV IgG prevalence of 17.5% and an HEV IgM prevalence of 9.1%. There were 10 (2.2%) blood donors who were positive for both IgG and IgM antibodies. Our results revealed that the HEV specific antibodies (IgG, IgM) prevalence increased with age. The mean value of serum ALT was 33.8 (SD AE 41.0) with a range of 4-554 IU/L. The serum ALT levels were elevated (>45 IU/L) in 73 (16.3%) blood donors. There was significant correlation (P=<0.001) between serum ALT level and HEV specific antibodies for IgG and IgM. Summary/Conclusions: This study shows that a significant proportion of blood donors at our blood centers have been infected with HEV and may be able to cause TT-HEV. As we have not yet measured HEV RNA, we have used IgM antibodies as a proxy for donors who have active infection. HEV is generally asymptomatic, so it is debatable whether mandatory HEV screening in blood donors should be required. Results of this pilot study show that there is a need to conduct a larger study at National level with highly sensitive assays before making screening for HEV mandatory in Pakistan. Background: Hepatitis E virus (HEV) is a zoonotic virus. WHO estimates that there are 20 million HEV infections, 3 million acute HEV cases and 56 thousands HEVrelated deaths worldwide each year. In recent years, the prevalence of HEV in European and American countries has increased significantly. The survey results show that the positive rate of HEV IgG in blood donors is respectively 4.0% in New Zealand, 13.5% in Britain, 20.6% in Denmark, 16% in the United States and 27.0% in the Netherlands. HEV has become a global public health concern. In addition to the food route of infection, several cases have been reported that HEV can be transmitted via blood products. Aims: To investigate the prevalence of hepatitis E virus (HEV) infection among voluntary blood donors and potential impact on blood safety in Guangzhou China. Methods: Blood samples from 5552 blood donors were collected from April 2017 to April 2008 at the Guangzhou Blood Center and were tested for anti-HEV IgG antibody (HEV IgG), anti-HEV IgM antibody (HEV IgM) and HEV antigen (HEV Ag)by enzyme linked immunosorbent assay (ELISA). HEV RNA detection was performed on HEV antigen positive samples by RT-PCR. The association of age, gender, ethnicity, occupation and ALT with HEV IgG and IgM were analyzed by Chi-square test. Multivariate logistic regression analysis was applied to identify the independent risk factors of HEV infection. Results: The positive rates of HEV IgG, IgM and HEV Ag were 20.05% (1113/5552), 0.76% (42/5552) and 0.04% (2/5552), respectively. No positive HEV RNA was detected. Age and ethnicity were independent risk factors for HEV IgG and HEV IgM. The rate of HEV antibody increased significantly with age (IgG OR = 1.089, P < 0.001; IgM OR = 1.055, P < 0.001). Donors who were Zhuang minority (32.69%, 7.69%) showed higher anti-HEV than those who were Han ethnicity (19.89%, 0.70%), and the difference was statistically significant (IgG OR = 2.052, P = 0.023; IgM OR = 12.029, P < 0.001). In addition, we found that occupation was an independent risk factor for HEV infection, where students showed the lowest anti-HEV rate. Summary/Conclusions: The results indicate that the positive rate of HEV antibody among blood donors in Guangzhou is high, and the infection status differs in different populations. Our study provides basic data for the estimation of risk of transfusion-transmitted HEV. Background: Human cytomegalovirus (HCMV) belongs to the viral family of Herpesviridae. It is an enveloped double-stranded DNA virus, widely distributed in the human population (60-100% seropositive subjects worldwide) and cause of severe disease in immunocompromised patients and upon infection of the foetus. In normally healthy subjects, HCMV persists lifelong without clinical manifestation undergoing alternating phases of active viral replication and latency. Since HCMV can be readily detected in blood, as free virus as well as associated to neutrophils and monocytes, HCMV transmission is a complication of blood transfusion. Even though leukoreduction of blood products has been shown to significantly reduce the risk of HCMV transmission, higher inactivation standards may be required for high-risk, immunocompromised groups of patients. Aims: In this study, murine macrophages infected with murine cytomegalovirus (MCMV) were used as a model to study the inactivation cell-associated CMV in human plasma using the THERAFLEX MB-Plasma system (Macopharma). Methods: MCMV expressing the green fluorescent protein was used to infect murine macrophages. Infected macrophages were harvested 20 h after infection, washed and used for spiking of plasma. Plasma units (n = 2, 290 mL) were spiked with infected cell suspension (10% v/v) and treated with the THERAFLEX MB-Plasma system according to the manufacturer's protocol using the Macotronic-B2 illumination device (Macopharma). Samples were taken after spiking (load and hold sample), after illumination with different light doses (0 after addition of MB, 30, 60, 90 and 120 [standard] J/cm 2 ) and after Blueflex filtration. MCMV titers were determined by endpoint titration and large volume plating on murine fibroblasts. Infectious virus, which expressed GFP in infected cells, was detected using a fluorescence microscope. Results: The results of infectivity assay showed that the treatment of human plasma by the THERAFLEX MB-Plasma system inactivated cell-associated MCMV in a dosedependent manner. After spiking with MCMV infected macrophages a MCMV titer of 4.2 (bag no. 1) and 4.5 (bag no. 2) log 10 TCID 50 /mL was achieved in the plasma units. In hold samples, a MCMV titer of 3.8 (bag no. 1 and bag no. 2) log 10 TCID 50 /mL was determined. The illumination step of the THERAFLEX MB-Plasma treatment procedure efficiently inactivated MCMV. Already three-fourths of the standard light dose decreased infectivity of cell associated and remaining cell-free MCMV to infectivity levels below the limit of detection (≥ 2.9 log). Further investigations would be needed to evaluate the log reduction capacity of the Blueflex filtration step for cell-associated MCMV. Summary/Conclusions: The results with the murine model virus suggest that the THERAFLEX MB-Plasma system is an effective technology to inactivate cell-associated CMV in human plasma units.

Background: The use of pathogen inactivation (PI) technologies for platelet concentrates and plasma is slowly but steadily increasing. Methods for treatment of red blood cells (RBCs), the most commonly used blood component, are still under development. Aims: A novel approach for PI in RBC units employing UVC light was developed. Methods: PI treatment was applied to full-scale RBC units after leukodepletion. The PI capacity of the UVC-based method was evaluated by bacteria and virus infectivity assays. A panel of in vitro assays to measure quality, metabolism, functional, morphologic, and blood group serology variables was applied to a pool-and-split approach in which pathogen-reduced RBCs were investigated in comparison to untreated RBCs. Results: UVC treatment caused dose-dependent inactivation of bacteria and enveloped and non-enveloped viruses in RBC units. At a full dose, the mean log 10 reduction factors ranged from 4.2 (Bacillus cereus) to 6.1 (Serratia liquefaciens) for the tested bacteria, and from 3.1 (EMCV) to ≥ 4.9 (VSV) for the tested viruses. UVC treatment did not alter RBC blood group antigen expression. Quality of UVC-treated RBCs was maintained during storage, e.g. hemolysis in UVC-treated and untreated RBCs were well below 0.8% until day 35 of storage. Summary/Conclusions: The data obtained until now show that UVC irradiation is a potential new method for PI in RBCs and justify further development of this process. Background: Histo-Blood ABH antigens are the mayor allogeneic antigens in human and they are widely distributed in almost all tissues. The expression of a-1,2-fucosyltransferase (FucT2), encoded by FUT2 gene, determines the secretor status of an individual. About 80% of Caucasian population have a functional copy of FUT2 (secretor gene) expressing ABH blood group soluble antigens in organic fluids such as saliva and seminal plasma. This individuals are known as "secretors". Soluble ABH blood group antigens have been associated with several metabolic and infectious diseases as well as reproductive failures. The incidence of infertility related of both male and female factors continues to rise despite many advances in reproductive technologies. It is well known that ABO antigens are expressed on sperm membrane and in seminal fluid of secretors as well as ABO antibodies are present in cervical mucus. In previous studies we observed significant loss in progressive motility of spermatozoa of non-secretors compared to secretor ones caused by specific cervical mucus antibodies in ABO-incompatible couples. In addition, sperm cells are haploid cells, so that a heterozygous individual has two sperm subpopulations, each expressing the corresponding allele. The specific antibody of cervical mucus will attack only its complementary sperm. Aims: To evaluate the prevalence of secretor character in men belonging to fertile and infertile couples in order to investigate a possible association with reproductive success. Methods: 126 samples of semen, 68 from infertile men and 58 from fertile controls were studied. Comprehensive infertility evaluation was performed in all patients according to WHO 2010 criteria. Secretor phenotype was evaluated in seminal plasma by inhibition of hemagglutination assay using saline erythrocyte suspensions, monoclonal antibodies anti-A, anti-B and lectin from Ulex europaeus (Anti-H). To distinguish between ABO genes, genomic DNA was extracted by an enzymatic digestion method. PCR was designed with two sets of oligonucleotides that allow to amplificate two different regions of the transferases without use of restriction enzymes. By comparison of bands of the PCR products, the individual genotype was determine. Cervical mucus antibodies of their female partners were titrated with the corresponding red blood cells. Results: Results were analysed in both groups. In infertile couples with ABO incompatibility, the frequency of non-secretor phenotype of male partners (76.9%) were significantly higher than those from fertile couples (21.6%) (P < 0.03) The results obtained by PCR in sperm cells correlated 100% with red cells phenotypes. Summary/Conclusions: Incidence of infertility continues to increase. Several factors have a negative impact on men's reproductive health. Immunological implications are now being studied and considered as a cause of failure in sperm-egg interaction, even among normal gametes. Secretor phenotype in male partners could help reproductive success by blocking cervical ABO antibodies. Furthermore, if the male is heterozygous, cervical mucus antibodies will only affect the corresponding sperm. We propose to evaluate ABH antigen expression on sperm membrane and seminal plasma as well as ABO antibodies in cervical mucus to contribute to the diagnosis and treatment of human infertility. Background: The H blood group contains one antigen, the H antigen, which is present on virtually all red blood cells (RBC) and is the acceptor substrate of both A and B gene-specified glycosyltransferases. In blood group O the H antigen remains unmodified and therefore its RBCs show the highest and the RBCs of blood type AB the least amounts of H antigen. Individuals with the so called Bombay phenotype carry homozygous H null alleles (h | h) and do not produce any H antigen. The para-Bombay phenotype retains some H antigen on RBCs either induced by a weakly active (H+ w | H+ w ) or completely silenced FUT1 gene (h | h), mandatory linked with an active FUT2 gene. Aims: In this study, we aimed to develop an adapted flow cytometric method to quantify the relative amount of H substance present on RBCs in order to distinguish different ABO phenotypes in routine diagnostics as well as to capture rare H-deficient phenotypes. Methods: Analyses were performed on a flow cytometer (FACS Canto II, BD Biosciences, CH) and measured with identical instrument settings. List mode data were evaluated and visualised using BD FACSDiva software. RBCs were incubated with increasing concentrations of monoclonal anti-H antibodies (BRIC231-PE and a 1:1 mixture of BRIC231-PE/BRIC231, IBGRL, UK). After rinsing the cells with PBS, micro-aggregates were mechanically dissolved. RBCs from 29 blood donors with different ABO phenotypes (O (5), A 1 (5), A 2 (5), B (5), A 1 B (5), A 2 B (4)) and 2 patients with genetically confirmed Bombay and Para-Bombay phenotype were assessed. Results: Saturation of H antigen binding sites on type O RBCs was achieved only upon use of a 1:1 antibody mixture (BRIC231-PE/BRIC231) covering approx. half of the H-binding sites by unconjugated BRIC231. In contrast, Non-O type RBCs reached saturation of H-binding sites using pure BRIC231-PE. RBCs coated with BRIC231-PE at saturation revealed a distinct pattern of MFI (mean fluorescence intensity) depending on the ABO phenotype. In addition, MFIs of RBCs upon staining with BRIC231-PE did discriminate Bombay-and Para-Bombay type RBCs, respectively. Summary/Conclusions: Adapted flow cytometry is able to distinguish variant expressions of RBCs H antigen. Thus, our flow cytometric method may complement traditional serological and genetic analyses in routine ABO phenotype cases or, more intriguing, when the Bombay or para-Bombay phenotype is suspected. It will be of interest to further prove this method by investigating additional rare H-deficient phenotype cases.

S Chen 1,2 , X Xu 1,2 , X Hong 1,2 , K Ma 1,2 , J He 1,2 , J Chen 1,2 and F Zhu 1,2 1 Blood centre of Zhejiang province 2 Zhejiang provincial Key Laboratory of Blood Safety Research, Hangzhou, China Background: Weakened A and B antigen expression results in ABO typing discrepancies. H gene controls the development of H substance from which A and B antigens develop. Depressed A and B antigen expression and strengthened H antigen expression are always simultaneously observed in ABO subgroups. There are other possibilities for weak antigen expression of ABO system such as leukemic change and pregnancy. It is undiscovered whether abnormal expressions of A, B and H antigen stand for ABO subgroups in hemopathic patients. Aims: The aim of this study is to explore the role of enhanced reactions with anti-H in direction to ABO subgroups of hemopathic patients. Methods: 109 samples from blood donors and hemopathic patients with nonconcordant ABO typing by serological tests were collected after consent information. The agglutination strength of these RBCs with anti-H reagent was recorded. Enhanced reactions were determined by comparison with the results from normal ABO groups. The genomic DNAs of 109 samples were extracted and genotyped for ABO system. This work was sponsored by the Medical Science Research Foundation of Zhejiang Province (2018RC029). Results: 69 samples in 80 blood donors showed increased expression of H antigen, of which 47 were identified as ABO subgroups. There were 22 enhanced reactions in 29 hemopathic patients. However, 19 were finally confirmed as normal ABO genotypes. No statistical significance (86.3% vs 75.9%, P > 0.05) in the frequency of strengthened H antigen expressions was observed between donors and hemopathic patients. The total number of subgroups is 50 and 3 respectively in blood donors and hemopathic patients. Extremely significant statistical differences (68.1% vs 13.6%, P < 0.005) existed in the frequency of subgroups with enhanced H antigen, which meant the possibility of subgroups in hemopathic patients samples was less. Summary/Conclusions: The expression of H antigen is comparably enhanced in subgroups and hemopathies. But most of hemopathic patients with strengthened H antigen expression present normal ABO genotypes. As a result, the enhanced reaction with anti-H is necessary but not sufficient for serological identification of ABO subgroups in hemopathic patients. Background: Although the use of automated blood bank analyzer with the advantages of speed and efficiency has recently increased, the ABO discrepancies in automated blood bank analyzer have caused the reporting delays of the results and increase of the task. Aims: We analyzed the causes of ABO discrepancies in automated blood bank analyzer and suggested a solution strategy based on the causes. Methods: From November 2018 to January 2019, 55 cases (0.6%) of ABO discrepancies among 9,550 ABO blood type tests performed using the 15-min reaction mode of IH-500 in Chonbuk National University Hospital blood bank were identified. We compared the test results of 15-min mode with results of immediate mode using different red cell reagents, and analyzed the causes of discrepancies by performing additional tests such as microscopy, auto-control, antibody screening and identification, anti-A1 and ABO genotyping.

Results: In the immediate reaction using different red cell reagents, 45 cases (81.8%) of discrepancies disappeared and 10 cases (18.2%) remained discrepancies. All ABO discrepancies observed in the 15-min reaction were due to serum side causes, and one case (1.8%) was due to both of serum and red cells side cause. Nonspecific response (28 cases, 50.9%), cold antibody (20 cases, 36.4%), rouleaux formation (3 cases, 5.5%), cis-AB (3 cases, 5.5%), and ABO subtype (1 case, 1.8%) were analyzed as causes of discrepancies. One discrepancy due to cis-AB was disappeared in the immediate reaction using different red cell reagents, ABO subtype was changed to totally different blood group, A. On the other hand, in cases of the discrepancy corrected by the immediate reaction using different red cell reagents, the intensity of the positive results still observed in immediate reaction was not different from the 15-min reaction. Summary/Conclusions: IH-500, an automated blood bank analyzer, was considered useful for automation of ABO blood typing, and some observable ABO discrepancies are expected to be mostly addressed by reexamining with immediate reaction mode using different red cell reagents.

Abstract withdrawn.

Background: ABO blood group antigens mainly expressed on red blood cells, but along with that they also present on many organs and tissues like epithelia, platelets, vascular endothelia and neurons etc. The importance of ABO antigens extends beyond transfusion medicine by association with various systemic diseases like cardiovascular diseases, gastric diseases, cancers, infectious diseases etc has been proven previously. Previous researchers also tried to find out the involvement of ABO antigens in neurological diseases like Alzheimer's disease, Parkinson diseases etc. but association with neurological tumours is less explored. Aims: This study aimed to analyse the association of ABO blood group antigens with neurological tumours. Methods: A retrospective study in a tertiary care institute in India analysed the 2 years data from Jan 2017 to Dec 2018. The carcinoma patient's admitted in neurosurgical department during study period were included in our study. Their diagnosis and ABO blood groups were collected from hospital information system. Data were analysed into Microsoft excel 2016 and SPSS (version 22). Results: During study period a total of 1970 patients with neurological tumours were admitted in our hospital. The blood group frequency of these patients were 20.91%, 37.51%, 32.74%, 8.83% for A, B, O and AB respectively. The common neurological tumours found in our study were glioma (33.55%) followed by pituitary adenoma (20.05%), meningioma (18.58%), schwannoma (8.98%), Cavernoma (2.54%), neuroma (2.23%) and space occupying lesions (14.06%). The prevalence of ABO antigens was almost similar in all neurological tumours except in neuroma. Neuroma was found in 47.73% O group patients as compared to other blood groups which was found statistically significant (P < 0.05). Summary/Conclusions: In this study we tried to analyse the association of neurological tumours with ABO blood groups antigens. We found there is no association of neurological tumours with ABO blood groups because the prevalence on ABO group in general population is almost similar in patient with neurological tumours except neuroma. Neuroma group of tumours like neurofibroma, neuroblastoma, nerve tumours etc. were more common in O group of patients while in our population frequency of B blood group antigen (38.2%) is more common as compared to O blood group(33.4%). Background: RHD and RHCE represent homologous genes in head-to-head position on chromosome 1 (chr1, p36.11). They encode for the proteins RhD resp. RhCE which compose together with Rhesus associated glycoprotein (RhAG), Band 3 and ankyrin the ankyrin complex (AC) linking the red blood cell (RBC) membrane to aspectrin of RBC cytoskeleton (S.E. Lux, BLOOD, 2016). Cooperatively, the proteins of AC are important for maturation and physiologic properties of RBCs. Many proteins of the RBC membrane express blood group antigens on their extracellular surface and are therefore of concern in transfusion medicine. Cepellini et al. described weakened hemagglutination reactions of RHD+ RBCs in the presence of an RhC+ antigen (Cepellini et al, PNAS, 1955) . We attempted to further elucidate the expression of RhD/RhAG proteins in various RhCE/RHCE pheno-/genotypes using a sophisticated flow cytometry approach. Aims: In this study, we investigated a flow cytometric method for measurement of the antigen-density of various RHCE-phenotypes. Methods: Analysis was performed on a flow cytometer (FACSCanto II, Becton Dickinson (BD)) using BD FACSDiva software and identical instrument settings for all samples. Optimized number of RBCs was incubated with saturating concentration of PE-conjugated anti-RhD antibodies BRAD-3/BRAD-5/FOG-1 (IBGRL, Bristol, UK). Debris was excluded by RBC gating in FSC/SSC plot. QuantiBRITE-PE beats (BD) were applied according to manufacturer's instruction to quantify the relative expression of RhD epitopes. In addition a representative number of samples from common phenotypes were assessed for expression of RhAG using BRIC-69PE (IBGRL). Results: A total of 146 samples from healthy blood donors with serologically defined RhCDE phenotypes were included into this study (rr(21), R1r(20), R1R1(23), R2r(18), R0r(15), R1R2(27), R2R2 (22)). Variant expression of RhD by different RhCE phenotypes using BRAD-3-PE was shown. RhD was weakly expressed in presence of RhC antigen (Cepellini effect). Effect of RHD gene dose on RhD protein expression is mitigated by RHC/c genotypes. When only samples with molecularly confirmed phenotypes were assessed, the RHDCE genotype predicts consistently the strength of RhD protein expression. Outlier samples (3) were retrospectively genotyped and revealed RHDCE genotypes as expected from the strength of RhD expression falsifying serological RhCDE phenotypes. In contrast, RHE/e polymorphic site does not correlate with RhD expression. In addition, RhAG protein is equally present across all RhCDE phenotypes. Similar results were obtained by using alternative anti-D antibodies such as BRAD-5-PE and FOG-1-PE, although different antibody's avidity precludes quantitative comparison of antigen expression on RBCs. Summary/Conclusions: Sophisticated FACS methods reveal different expression of RhD on RBCs according to RhCE/RHCE phenotype/genotype. RHC/c polymorphic sites (c.48G>C, c.201A>G, c.203A>G of exon 1, exon 2 resp. and intron 2) are in linkage with RhD expression, confirming the observation by Cepellini et al. In contrast, RHE/e (c.676C>G, exon 5) is not in linkage with RhD expression. Based on epigenomic signature it is conceivable that altered transcription factor binding sites (TBS) of RHD mirrored by homologous RHC/c may cause variant RhD expression. RHE/e SNP mirroring the homologous sequence of RHD in exon 5 is not recognised as TBS. In addition, although AC comprises all three Rh proteins (RhD, RhCE, RhAG), their transcriptional regulations seem to be distinct.

Red Cell Reference Laboratory, Australian Red Cross Blood Service, Perth, Australia Background: The Rh26 antigen was first described when an antisera thought to contain a potent anti-c did not react with all c+ cells. These non-reacting c+ cells were classified as c+, Rh:-26, and the antibody specificity anti-Rh26. Most polyclonal anti-c contain anti-c and anti-Rh26. Previous studies have shown 2 of 10 monoclonal anti-c reagents are actually anti-Rh26. These reagents will not detect the c antigen where the red cells are Rh:-26. Aims: The Australian Red Cross Blood Service investigated a phenotype discrepancy in a Blood donor. The donor's historic phenotype c+ (R 1 r) was inconsistent with the current donation phenotype c-(R 1 R 1 ). We aimed to investigate the cause of the discrepancy so the donor could be assigned the correct phenotype, identify the root cause of the discrepancy and implement any corrective actions. Methods: The donor's red cells were phenotyped with all available anti-c reagents as per the Manufacturers product insert across both manual and automated testing platforms. Following variable results and weaker reactions with some reagents, DNA was extracted from the EDTA sample and was genotyped using Immucor BioArray TM HEA Precise and RHCE BeadChip TM . Targeted DNA sequencing of RHD and RHCE was also performed using the Trusight TM One sequencing panel. A review of the historical phenotype results, including the testing platform and reagents used at the time was also performed.

Results: On the current sample the donor's red cells gave a 2 + reaction by tube with Bio-Rad Seraclone â (2) [clone MS35] and Immulab Epiclone TM [clone anti-c reagents. The sample tested negative on the Beckman Coulter PK7300 using Beckman Coulter anti-c [clone 951] blood grouping reagent and tested positive (4) reaction on the Immucor NEO using ImmuClone â (1) anti-c [clone . Immucor BioArray TM HEA Precise BeadChip TM predicted a c+ phenotype and no variants were detected with the BioArray TM RHCE BeadChip TM . The Trusight TM One sequencing panel genotyped the donor as RHD*01/*01N.01 and RHCE*01.15/*02 with a predicted phenotype of C+, c+ w , D+, E-, e+, RH:55 (LOCR+), RH:-26. A review of the donor's historical records indicated the donor tested as c+ on the PK7200, which at the time was being used with an in-house Bromelain preparation (Sigma-Aldrich) and Diagast Olymp Pheno anti-c reagent [clone MS33]. Summary/Conclusions: Results indicated the phenotype discrepancy was caused by the c+ Rh:-26 variant associated with the RHCE*01.15 allele. Reagents containing clones MS-33 and MS35 correctly phenotyped the donor as c+, with the manual tube reagents showing a weaker reaction which may alert the operator to a possible variant which is important in the patient setting. The Beckman Coulter PK7300 and associated anti-c [clone 951] failed to detect the c antigen. This reagent appears not to detect the c antigen where it is associated with the Rh:-26 phenotype, which is in contrast to the previous report by Faas et al, Transfusion, 1997 where it was demonstrated that clone 951 reacted with c+ Rh:-26 bromelain treated red cells.

Abstract withdrawn. Background: Although serological RhD typing has always been challenging due to variation of techniques and variable sensitivity of anti-D reagents, most individuals are unequivocally typed as either RhD positive or RhD negative. However, variants of D (weak D and partial D phenotypes) may present typing difficulties. Individuals with partial D (missing epitopes of the D antigen) must be typed as RhD negative as blood receivers, but as RhD positive, as blood donors. Aims: The aim of our study was to evaluate the algorithm used since 2017 at AHEPA University Blood Center, to resolve RhD typing problems among first time donors. Methods: Since automatic analyzers may type variants of RhD as RhD+, our practice is to routinely perform two different typing methods in first time donors: an automated microplate method on the Neo analyzer (Immucor) and the slide test, using a potent reagent (anti-D Blend-Immunodiagnostika). In case of negative, weak, slow or mixed-field reaction, further testing with an automated microplate Weak D method [Immucor-modified indirect antiglobulin (anti-IgG) test] follows. The next step of the protocol consists of testing with the commercial ID-Partial RhD Typing kit (Bio-Rad) comprising a panel of 6 monoclonal anti-D reagents, in an indirect Coombs gel test assay. The patterns obtained with this kit can distinguish between D weak and partial D and can also differentiate between categories II, IV, V, VI, VII DFR, DBT and DHAR. The last step of our algorithm consists of molecular testing (Immucor BioArray RHCE and RHD BeadChip assays) at the Hellenic National Blood Transfusion Center, in case of remaining uncertainty. Results: We applied the above algorithm in 32 samples: A) By using the partial D kit, 23 samples were typed: Four samples were characterized as "partial D" (3 DFR, 1DIII) and 19 as "weak D".

Four of the weak D samples (all from women of reproductive age) were confirmed by molecular typing ("Weak D type 1" three samples, "Weak D type 4.0 or 4.3" one sample). B) The nine (9) remaining samples that showed atypical serological pattern, were sent for molecular testing, which characterized 2 samples as "Weak D type 1", one sample as "Weak D type 3" and another as "Weak D type 11". Results are pending for 5 samples. Summary/Conclusions: In our experience some partial RHDs may be mistyped as RHD+ if the technologist does not inspect the pattern of the reactions and only takes into account the assignment by the automatic analyzer as D+ or D-. By use of our algorithm, serological characterization was sufficient to distinguish between weak D and partial D in 68,75% of cases. Molecular typing was necessary in the rest. The integration of molecular techniques improves the quality and accuracy of D typing of blood donors. If applied to patients, it also allows administration of D positive blood without compromising safety to those carrying prevalent weak D types that have not been reported to produce anti-D. Furthermore, it permits withholding RhIG in case of pregnant women carrying such weak D types. Background: RhD antigen is one of the most clinically significant blood group antigens. Except D positive and D negative phenotypes, there are over 200 RhD variants, which represent as serologic weak D phenotypes (swD). Patients with certain swD can make anti-D alloantibodies. By serology testing it is not possible to clearly distinguish among different swD. In Croatian Institute of Transfusion Medicine (CITM) patients and pregnant females with swD are mostly reported as RhD negative and generally did not refer for confirmation, because molecular testing was not part of the algorithm. That remains the risk of shortages of RhD negative blood and overuse of anti-D immunoprophylaxis for pregnant females. According to UK Guidelines patients with swD who are likely to require chronic transfusion support and females ≤ 50 years are treated as D negative and refer for confirmation of D type. People who are RHD genotyped as weak D type 1, 2 or 3 are not susceptible for RhD alloimmunisation. One study showed that in Croatian population the most frequent variants are weak D type 1, 2 and 3. Aims: The aim of this study is to estimate the prevalence of swD in patients and pregnant females and to find out serologic and molecular characteristics of swD referred for confirmation. Methods: From 2013/01/01 to 2018/10/01 we analysed 119.845 samples of patients and pregnant females. RhD typing was performed by anti-D IgM monoclonal reagents in direct agglutination micromethod on TANGO (BS232, BS226) (BioRad, Dreieich, Germany), Swing Maestro [LMH 59/20 (LDM3) + 175-2 and TH-28 + RUM-1 + LDM1] and IH-1000 [LMH 59/20 (LDM3) + 175-2] (ID-Card, BioRad, Cressier, Switzerland). Cut-off value for TANGO was determined as ++ and for gel microtyping as +++. The samples with results below the cut-off were reported and treated as RhD negative, all except those which gave discrepant results at current testing or with historical data. These were sent to RHD genotyping for confirmation. DNA extraction was done by QIAamp Blood Mini kit (Qiagen, Hilden, Germany) and RHD genotyping by PCR-SSP kits Ready GeneWeak D and Ready GeneCDE (Inno-Train, Kronberg im Taunus, Germany). Results: From 119.845 samples 300 (0,25%) were swD. 71/300 (24%) were referred to RHD genotyping. 55/71 (77%) samples were weak D type 1, 2 or 3, while 16/71 (23%) were weak D type 14 and partial D variants VII and Va. Serologic reactions with monoclonal IgM anti-D reagents showed different pattern for weak D types 1, 2 and 3. Clearly negative serologic reactions were given in 27/29 samples with BS 226 and BS 232, in 30/33 samples with LMH 59/20 (LDM3) + 175-2 and in 18/39 samples with TH-28 + RUM-1 + LDM1. Summary/Conclusions: The prevalence of swD in this study is rather low (0,25%). After RHD genotyping 77% of referred samples were finally reported as D positive. Serologic determination of D variants is inconsistent and only RHD genotyping can resolve RhD status in swD. To define the permanent RhD status of swD female of childbearing potential and patients who are likely to be chronically transfused we will introduce RHD genotyping in the new algorithm. Background: Among all blood group systems, the antigens of the ABO system are by far the most clinically significant. Comes second in importance is the antigens of the Rh system, which comprise D, C, E, c, and e antigens. Another clinically relevant antigen is the K of the Kell blood group system, which is known to be involved in both HTR and HDFN. The distribution of the major blood group antigens, such as Rh, and Kell, is well-studied among populations of developing countries. In contrary, a relatively few studies have addressed their frequencies in Saudi Arabian population This is also the case in Jazan province, where only two published studies have analysed the prevalence of ABO and D antigens, while the frequency of other clinically important antigens, such as Rh and Kell antigens, is yet to be explored. Aims: To determine the frequency of the following clinically relevant blood group antigens; Rh(D, C, E, c, e) and K among Saudi blood donors in King Fahd Central Hospital in Jazan province.

Methods: A retrospective, cross-sectional study was carried out in the blood bank of King Fahd Central Hospital in Jazan province. The red cell phenotyping records for blood donation of 3243 randomly selected Saudi donors, who donated blood between January and June 2018, were reviewed to identify the prevalence for the following antigens: D, C, E, c, e and K. The hospital blood bank routinely performs Rh/K1 phenotyping for all blood donation using either Bio-Rad or Ortho diagnostic Column Agglutination Technology (CAT) platforms. Phenotype frequencies were expressed as percentages.

Results: This study included a total of 3243 Saudi voluntary as well as family replacement blood donors. The D antigen was found to be positive in 93.7%, while K antigen was positive in 11.1%. Among other studied Rh antigens, e was the most common (98.1%) followed by c (78.2%), C (70.3%) and E(26.9%). DCe/dce (34.2%) and dce/dce (5.3%) were the most common phenotypes amongst D-positive and Dnegative donors, respectively. Surprisingly, Dce/dce phenotype was significantly prevalent (11.9%) with almost 5 times higher frequency compared that reported in Caucasians (2.0%). The rare phenotype dCe/dCE was found in 3 donors (0.09%), while DCE/DCE and dcE/dCe phenotypes were found in only one donor each. Summary/Conclusions: This study is the first to determine the frequency of Rh and K antigens in Saudi blood donors in Jazan province. Determination of the frequency of these clinically significant antigens in our geographical area will facilitate the selection of antigen-matched red cell units for transfusion in recipients with multiple alloantibodies. It will also help in the management of blood donation processes and planning the estimated need of blood stock of different blood group phenotypes to meet the patient's needs.

Abstract withdrawn. Background: The Gerbich (GE) blood group system includes several high-frequency antigens located on glycophorin C and D. With only few reports published on the clinical significance of antibodies directed against these antigens, it is unclear whether blood transfusions have to be antigen negative in the presence of an anti-Ge antibody. The monocyte monolayer assay (MMA) is an in-vitro method used to estimate the clinical significance of alloantibodies. Aims: To illustrate the role of the monocyte monolayer assay (MMA) in the transfusion management of a patient with an anti-Ge alloantibody. Methods: The clinical and transfusion history was retrospectively retrieved from the patient's medical records. Serological investigations were performed by indirect antihuman globulin test. Papain and trypsin treated cells were also used. The clinical significance of the antibody was assessed by MMA. Genomic DNA was isolated from whole blood and the samples were further characterized by PCR.

Results: A 58-year-old male patient with lung cancer without previous transfusions was admitted (06/2009) for surgery. His hemoglobin was 13.2 g/L. An anti-Ge antibody was detected and it was decided to transfuse Ge-positive packed red blood cells (pRBCs). However, no blood transfusion was needed. In July 2017, the patient was admitted for colon cancer surgery with a hemoglobin of 11,0 g/dl. The Anti-Ge alloantibody was still detectable and a SSP-PCR revealed the genotype GE*01.-03. An MMA performed on the pre-transfusion sample revealed a monocyte index (MI) of 0.35% and the antibody was considered not to be clinically relevant. The MI was interpreted as following: 0-3% not significant; 3-5% inconclusive; >5% clinical significant. However, due to the clinical background of the patient it was decided to transfuse Ge-negative pRBCs, which were obtained from Etablissement Francais du Sang (EFS), Paris, France. Two days after surgery, the patient received 2 units of GE:-2,-3 pRBCs without any transfusion reaction. One and a half year later (11/2018), peritoneal carcinomatosis, as a complication of colon cancer, was diagnosed. The patient's hemoglobin was 87 g/L and he had a passage disorder, symptoms of deterioration and an adynamia. Based on the MMA results from July 2017 indicating no clinical significance of the antibody, it was decided to transfuse Ge-positive pRBCs. In the following 16 days the patient received a total of 5 units of Gepositive pRBCs No immediate or delayed transfusion reaction were observed following these transfusions. Two further MMA's, performed on samples drawn on December 12 th and 16 th (12 days after transfusion of a total of three and two days after two further pRBCs respectively), showed a MI of 0.8% und 1% respectively and the anti-Ge antibody was considered still not to be clinically significant. Summary/Conclusions: We report the case of a patient with an anti-Ge antibody transfused with Ge-positive pRBC. As Ge-negative pRBC are not available in Switzerland and not easy to obtain internationally the MMA can help in the decision on how to transfuse. In this case, the clinical course confirmed the MMA-based prediction. Transfusions of Ge-positive pRBCs were tolerated without signs or symptoms of immediate or delayed transfusion reactions. Background: ABO grouping discrepancies occur when the results of forward grouping are not corroborative to those of the reverse grouping. These may be due to weak subgroups of A and B, missing or weak ABO antibodies or red cell alloantibodies. Determination of correct ABO blood group of a donor is essential for preventing ABO incompatible transfusions and to avoid hemolytic transfusion reactions in the recipient. Aims: To determine the frequency of ABO discrepancies and their resolution to correctly identify the blood group of the donors. We also determined the frequency of 'Weak D' positivity in RhD negative donors.

Methods: This was a retrospective study on donor samples collected from 1 st April, 2013 to 30 th September, 2015 (two and a half years). For discrepant samples, the ABO and RhD grouping was repeated using tube technique using commercial antisera {anti-A, anti-B, anti-AB and anti-D (IgM), anti-D blend (IgM+IgG), anti-H and anti-A1 lectins}. Adsorption-elution testing was done for detecting weak subgroups of A and B. Antibody screen (3-cell) and identification (11-cell) was done by gel technique (Bio-Rad, Switzerland). 'Weak D' testing in RhD negative donors was also performed by gel technique. Antibody titration was done using tube technique. The donor details including name, age and the registration/unit number of the donation were also checked for all the discrepancies to avoid repetition while data analysis. Results: We detected 104 (0.072%) ABO discrepancies out of the total 144279 donor samples tested during the study period. Out of these, 135043 (93.6%) were RhD positive. The most common cause of ABO discrepancies was weak anti-B antibody (33/104; 31.73%), followed by weak anti-A antibody and weak subgroups of A (24/104 each; 23.07% each) and weak subgroups of B (5/104; 4.8%). The remaining 17.3% (18/104) discrepancies were due to agglutination with O cells in reverse grouping. The overall frequency of weak subgroups of A and B collectively was 0.02% ( Background: Detection of unexpected red blood cell (RBC) antibodies before transfusion is critical for prevention of hemolytic transfusion reaction. Ideally, unexpected RBC antibody detection is carried out within 3 days after receiving a patient's sample. However, in some cases, retests could be performed after more than 3 days for evaluation of any transfusion reaction, quality control or research. Therefore, it is necessary to determine the stability of antibodies after refrigeration or freezing for a certain period of time.

Aims: We carried out antibody identification test with fresh, refrigerated and frozen samples using automated analyzer IH-500 and manual tube methods to evaluate the stability of antibodies after storage and compare the results between the two methods Methods: Antibody identification tests were performed using IH-500 (Bio-rad, 1785 Cressier FR, Switzerland) and manual tube methods. Fifty samples showing positive results in antibody screening test by both methods were divided into three and tested immediately, 1 week after storage at 4°C and 1 month after storage at À20°C. The specificities and reactivities of antibodies at each storage state were recorded and compared between the two methods.

Results: Specificities of antibodies identified were concordant between IH-500 and manual tube methods irrespective of the storage state. The results were as follows:

anti-E/E+c, 15; anti-Le a , 4; anti-Di a , 4; anti-C+e, 3; anti-M, 3; anti-D, 2; anti-C, 1; anti-K, 1; anti-Jk a , 1: anti-Xg a , 1; unidentified antibody, 13; autoantibody, 2 cases. With regard to the changes in reactivity owing to storage, 26 (52%) samples (anti-E+c, 12; anti-M, 3; anti-Di a , 3; anti-D, 2; anti-C+e, 2; anti-Le a , 1; anti-C, 1: autoantibody, 1; unidentified antibody, 1) showed identical reactivities after 1 week and 1 month storage by both IH-500 and tube methods. However, 19 (38%) samples, comprising 12 unidentified antibodies, 3 anti-Le a , 1 anti-C+e, 1 anti-E, 1 anti-E+c, and 1 autoantibody, showed decreased reactivities after storage in both methods. Three samples, comprising anti-Di a , anti-E+c and anti-K antibodies, showed increased reactivities after storage. One sample with anti-Jk a showed increased reactivity only after 1 month storage, while one sample with anti-Xg a showed decreased reactivity only after 1 month storage. Higher reactivities were observed in all samples detected using the IH-500 analyzer than manual tube methods (P < 0.005, Wilcoxon rank sum test). Summary/Conclusions: The specificities of unexpected antibodies detected by IH-500 and tube methods were the same in all storage states; however, reactivities were higher in IH-500 than in the tube method. Twenty-six (52%) of 50 samples showed identical reactivities after 1 week refrigeration and 1 month freezing. Nineteen (38%) samples showed decreased reactivities after storage; however, 12 (12/19, 63%) of them were nonspecific antibodies, unable to identify using commercial ID panels. Therefore, it is suggested that retests for evaluation of transfusion reaction, quality control or research could be reliably performed after more than 3 days, if stored appropriately in refrigerated or frozen states.

Abstract withdrawn.

T Gleich-Nagel 1 , D Huber-Marcantonio 1 , N Rufer 1 , G Canellini 1 and C Niederhauser 2 1 Unit of transfusion medicine, Interregional Blood Transfusion SRC, Lausanne 2 Laboratory Diagnostics, Interregional Blood Transfusion SRC, Bern, Switzerland

Background: A positive direct antiglobulin test (DAT) is mainly found in patients with warm/cold autoantibodies or alloantibodies directed against transfused erythrocytes. The identification of antibodies fixed on red cells is important for the clinician, allowing the further evaluation of a patient's clinical situation including their current medication. In immunohematology the elution of a positive DAT remains a tedious and expensive procedure. The Blood Transfusion Service SRC (BTS SRC) has derived a flow chart that indicates in which situation an elution of DAT positive samples should be performed. In order to follow the BTS SRC guidelines, it is mandatory to obtain additional data related to the patient's condition, such as haemolytic parameters and recent transfusion history. Currently, our laboratory is not always able to apply the recommended flowchart, since information is often unavailable.

Aims: Here, we performed a comparative study between the algorithm provided by BTS SRC and our in-house strategy, which is based on the qualitative changes of a positive DAT, without the need for additional patient and biological information.

Methods: Details of DAT positivity and the patient's transfusion history was taken from the software eProgesa (MAK-system) and analysed in Excel. We analysed a total of 3'753 DATs and evaluated them for their positivity, whether an elution was performed or whether antibodies were detectable in the eluate. Furthermore, we performed an additional analysis on those samples, that were derived from recently transfused patients (<14 days).

Results: A positive DAT was found for IgG and C3d in 421 out of 3'753 (11.2%) samples, a level similar to previous reports of positive DATs for hospitalized patients. Among these positive samples, 244 (57%) were eluted because of a qualitative change in their positivity according to our in-house algorithm. Identification of warm autoantibodies or alloantibodies occurred in only 10.7% (26/244) of the cases. From the 161 patients transfused within the last 14 days and having a positive DAT, 60 (14%) were eluted according to our in-house algorithm. The same samples would have been analysed if the Swiss Transfusion guidelines had been applied. However, this comparative study reveals a significant discrepancy in regards to overall sample numbers that should have been eluted according to the two algorithms (244 versus 60 samples). This is mainly due to the fact that the Swiss Transfusion based algorithm does not recommend an elution of positive DATs from patients who did not receive a transfusion within the last 14-days, except if there is a significant clinical suspicion (e.g. haemolysis). Summary/Conclusions: This comparative study indicates that our elution-based algorithm was performed on all clinically relevant samples as recommended by the BTS SRC guidelines. Qualitative changes in the DAT positivity represent our main parameter for selecting those samples to eluate. Besides ensuring that no clinically relevant samples were missed, this strategy also led to a large number of unnecessary elution analyses. In conclusion, a significant reduction in the laboratory workload and economical savings arises if the relevant clinical information and patients history is known prior to laboratory analysis. Background: Novel anti-CD38 monoclonal antibodies, such as daratumumab (DARA) and Isatuximab, used in treatment of multiple myeloma, interfere with routine blood bank serologic tests. As part of the strategies to manage these patients, it is recommended to perform extended phenotyping to provide matched units (AABB Association Bulletin #16-02). Many investigations have focused on the interference with IAT for the screening and identification of underlying alloantibodies and how to overcome them, but less has been published on the potential interference with extended phenotyping techniques. Aims: The purpose of this study is to compare different technologies to type the most important antigens in myeloma patients before and during the treatment with therapeutic anti-CD38 antibodies.

Vox Sanguinis (2019) 114 (Suppl. 1), 5-240

Methods: EDTA-anticoagulated whole blood samples coming from 30 patients in different stages of treatment with Daratumumab and 5 with Isatuximab have been typed in parallel with DG Gel microcolumn (Grifols) and MDmulticard technology (Grifols). The results are also compared with genotyping results obtained with ID CORE XT (Grifols). Direct Coombs, Autocontrol and antibody screening has also been performed as complementary tests.

Results: The study provides that four patients had positive DAT and/or AC before therapeutic CD38 antibodies treatment. In these cases, 6 of 7 negative antigens (Fy / Jk and/or S) turn to positive in gel technology but MDmulticard showed 100% agreement with genotype ID CORE XT results. Focusing in the data obtained during the treatment, 8 negative antigens were type as positive in gel technology (12% of the tests). MDmulticard agreed with genotype in 100% of the analyzed antigens. As complementary data, 13 of 66 patient-treated samples had DAT or AC positive and 59 showed panagglutination. Summary/Conclusions: The results demonstrated that MDmulticard is an effective method to type CD38-directed cytolytic antibodies treated samples in addition to DAT and or Autocontrol positive samples.

Background: Antibody titration is a semi-quantitative method to estimate the strength and concentration of antibodies present in plasma or serum sample. Titration methodology should be validated together with clinical data to evaluate the relevance of the titer value in each application. The titer of an antibody depends on different parameters: the antibody concentration in the sample, the density of the corresponding antigen expressed on the red blood cells used, the affinity constant of the antibody-antigen and other parameters regarding the technique used (e.g. gel cards or tube test). Gel cards technology reduces the intra and inter-laboratory variation in titration studies comparing with the tube technique. Aims: To evaluate the suitability of DG Gel Coombs, DG Gel Anti-IgG and DG Gel Neutral (Grifols) for titrations using two sample volumes 25 lL and 50 lL. Methods: Twenty frozen plasma samples containing unexpected antibodies from different specificities (anti-Jk a , -Fy a , -K, -D, -E and -c) were titrated in DG Gel Coombs and DG Gel Anti-IgG cards and 20 donor fresh plasmas with natural occurring antibodies (anti-A and -B) were titrated in DG Gel Coombs and DG Gel Neutral (saline technique). The titer of the antibodies was determined by testing two-fold dilutions of the plasma with selected red blood cells depending on the antibody tested. Plasma samples were diluted in DG Gel Sol. Selected red blood cells Serascan Diana, Serigrup Diana or donor blood were added into the card (50 lL at 0.8%). Further, sample dilutions were dispensed into the card (25 lL or 50 lL). Subsequently, cards were incubated 15 min, 37°C (Coombs technique) and 15 min, 18-25°C (saline technique), centrifuged in DG Spin and the results read. Agglutination intensity was graded visually according to the instructions for use of DG Gel cards. The reciprocal of the highest plasma dilution that gives macroscopic agglutination was interpreted as the titer.

Results: Titers obtained with DG Gel Coombs and Anti-IgG (n = 80 titrations, titer ranged 0-256) were compared for each sample with unexpected antibodies. No differences were found between gel cards types (differences were ≤ 0.5 titer in the 98% of the cases). Differences between DG Gel Coombs and Neutral (saline technique) (n = 80 titrations, titer ranged 2-512) were observed when anti-A and -B antibodies were titrated using the same sample. The titer was similar or higher in Coombs in comparison to the saline technique. Coombs titers may be a mix of IgM antibodies reacting at 37°C and IgG antibodies. Differences were > 1 titer in 35% of the comparisons and ≤ 1 titer in the rest of the cases (65%). Comparing sample volumes of 25 lL and 50 lL in all cards (n = 160 titrations), higher titers were observed using 50 lL, as expected. Differences were 1 titer in the 51% of the comparisons, <1 titer in 44% and > 1 titer in the 5% of the cases. Background: Autoimmune haemolytic anemias (AIHA) are characterized by production of antibodies directed against red blood cells and destruction by the mononuclear phagocytic system or complement system. AIHA observed in paediatrics is usually self-limiting and often precipitated by viral infections. In some, the condition is secondary to autoimmune diseases, drugs, infections or underlying primary immune deficiencies. Appropriate immuno hematological evaluation to characterise the underlying autoantibody can help identify the type of AIHA to aid in diagnosis & treatment of these cases. Aims: Retrospective analysis of immune-hematological evaluation, treatment and outcome of AIHA in paediatrics.

Methods: Patients aged 0-18 years, diagnosed with AIHA, between April 2017-December 2018 (21 months) were included in this analysis. AIHA was defined as positive direct Coombs' test (DCT) with anemia associated with corroborative evidence of haemolysis in the form of raised indirect hyperbilirubinemia, raised LDH, raised reticulocyte counts or red cell agglutination on peripheral smear. Further monospecific DCT and evaluation for the specificity of autoantibody was done for all patients using BioRad gel cards and panel cells. Steroids were given as first line in all; second line agents included cyclosporine and rituximab. Red cell transfusion was given in those with severe anemia with cardiac decompensation.

Results: 10 patients were diagnosed during the study period with autoimmune haemolytic anemia. Haemoglobin at presentation ranged from 2.5 to 9 grams/dl. The initial presentation was severe anemia in 7 children and mild-moderate anemia with thrombocytopenia (Evan's syndrome) in 3. The trigger for haemolysis was infection in 4 children. Rheumatological evaluation was performed for 5 children out of whom 2 were diagnosed as evolving lupus. Primary immune deficiency evaluation was advised for 4 and one child was diagnosed as suffering from combined immunodeficiency. DAT was positive in 9 out of 10 AIHA patients as one of the infant had DAT negative IgA mediated AIHA secondary to viral infection. Two out of 9 DAT positive cases had IgG & C3d positivity on monoclonal DAT testing whereas rest 7 had only IgG coating the red cells. DAT titration was more than 1:300 in 4 patients; where only 1 of these 4 patients had both IgG1 and IgG3 coating and rest 3 had only IgG1. Alloantibody screen was negative in all. Specificity of autoantibody was found only in one case, which was against Rh blood group antigen (anti E). All patients received prednisolone as the primary treatment. Three children attained remission following a 4-6 weeks of steroids. In those who were steroid dependent, cyclosporine was used as the second line agent in 2 and Rituximab was used in 3. Out of these children 5 children are in sustained remission and off any medication, whereas the rest are on low dose steroids with cyclosporine. Summary/Conclusions: AIHA is not an uncommon problem in children and can vary in its clinical severity. The proper diagnosis and management involves efficient immuno-hematological evaluation, as detailed characterization of the autoantibody coating the red cell is very important in guiding the clinician for management and prognosis.

Abstract withdrawn. Background: Drug-induced immune hemolytic anemia (DIIHA) is rare and has only been described once with dexchlorpheniramine (Polaramine TM), an antihistaminic agent widely used in the treatment of a variety of allergic reactions. We report a case of DIIHA complicated with acute renal failure associated with antibodies to dexchlorpheniramine. A 64-year-old woman with no history of transfusion, was treated semimonthly with a combination of chemotherapy and targeted therapy for metastatic colorectal adenocarcinoma. Her chemotherapy regimen consisted of oxaliplatin and 5-FU with leucovorin rescue (FOLFOX). Panitumumab (monoclonal antibody anti-EGFR) was used as targeted therapy. Premedication with dexchlorpheniramine IV was systematically given at the beginning of each cycle of treatment to reduce the risk of perfusion reactions mainly associated with Panitumumab. The patient developed chills and febrile agranulocytosis during the first and second infusion respectively. The third infusion was not performed due to pyrexia, chills, general discomfort experienced by the patient at the beginning of chemotherapy. Probabilistic antibiotherapy was administered and the patient recovered rapidly. During the next infusion (day 1), following premedication with dexchlorpheniramine, a more "impressive" reaction including all the above mentioned symptoms occured along with back pain and dark colored urine. The infusion was halted and no chemotherapy was delivered. Bacterial infection at the implantable port was first thought to be the cause of this adverse event but was not confirmed. Additional laboratory findings revealed biological signs of inflammation associated with IHA and acute renal failure. The patient was treated with hemodialysis (day 5), two units of RBCs (day 6) and was discharged one week later in stable condition. Dexchlorpheniramine was then suspected and samples collected on day 24 were sent for a DIIHA laboratory workup. Aims: The aim of this study was to support a clinical diagnosis of DIIHA. Methods: Laboratory workup included direct and indirect antiglobulin tests (DAT and IAT). Drug antibodies investigation was performed by incubating patient's serum and eluate from patient's RBCs in the presence of drug against normal donor RBCs that had not been previously treated with the drug (i.e., by the so-called "immune complex" method). Control tests were performed in parallel. Drug was diluted in PBS and tested at 1 and 5 mg/ml. Results: DAT was positive (anti-IgG 2 + , anti-C3d 2 + ) and no unexpected RBCs antibodies were detected by IAT in patient's serum and eluate without the in vitro addition of the drug. An antibody directed against untreated (titer 2) and enzymetreated (titer 8) normal donor RBCs was demonstrated only in patient's serum in the presence of the drug tested at 5 mg/ml by the gel method. The pool of normal sera did not react in the presence of the drug. Summary/Conclusions: The multi-drug treated patient described in this study was demonstrated to have dexchlorpheniramine dependent antibody detected by the "immune complex" method. The key to the diagnosis was the observation of positive DAT with negative eluate tests which prompted a reexamination of the medications administered in temporal relationship with the hemolytic event. Although rare, this case report should alert physicians to the need to investigate the possibility of dexchlorpheniramine induced hemolytic anemia in any patient who develop unexpected anemia after hematologic or oncologic procedures P-331

Singapore, Singapore, Singapore

Background: Daratumumab is a monoclonal antibody against CD38 used in the treatment of multiple myeloma and has been known to bind to CD38 on RBC's and interfere with indirect antiglobulin based serologic tests such as red cell antibody screens and crossmatch compatibility testing. In order to negate the interference of Daratumumab, our reference laboratory follows the Daratumumab protocol recommended by the AABB which uses Dithiothreitol (DTT) treated reagent red cells in red cell antibody screening and identification test in patients known to have received Daratumumab. Aims: The objective of this study is to determine the impact of Daratumumab in the turnaround time (TAT) for red cell antibody screening and identification. Methods: A retrospective review of the TAT for red cell antibody screening and identification samples of patients known to be treated with daratumumab from October 2016 to December 2018 was performed. Turnaround time is defined as the time the sample is received up the time the results were reported. The TAT for routine red cell antibody screen and identifications were also reviewed during the same period and was compared with the TAT of samples from patients treated with daratumumab.

Results: A total of 55 patients on daratumumab had samples sent to our reference laboratory for red cell antibody screen and identification during the study period. Information on daratumumab treatment was not provided to the reference lab prior to the start of testing in 23 of the 55 patients while the use daratumumab was mentioned in the serology request form of the other 32 patients. The median TAT for red cell antibody screen and identification is 212 min (range: 47-877) if information on daratumumab was provided prior to start of testing and 301 min (range: 133-1417) if information was not provided prior to testing. The median TAT for routine testing is 198 min (range: 15-2245). Using Wilcoxon rank-sum test, turn-around time for antibody screening and identification for daratumumab treated patients was observed as statistically not significant when compared to routine samples (P value 0.72634). However, TAT for serologic tests requests with appropriate medical history compared to the testing requests without relevant information was also observed to be significantly difference (P value 0.00694). Summary/Conclusions: There is no significant impact in the TAT of red cell antibody screen and identification in patients known to receive daratumumab as compared to routine testing. However, there is a significant difference in the TAT if information on daratumumab treatment is not provided prior to testing. This highlights the importance of providing the relevant medication information in the request form in order to prevent delays in testing and provision of blood to patients on daratumumab, which can result in improved organizational efficiency and have positive impact on cost and resource savings. Background: Daratumumab, an anti-CD38 monoclonal antibody, has been shown to be highly efficacious in the treatment of Multiple Myeloma (MM). CD38 is a glycoprotein highly expressed on plasma cells and, to a less extend, on the surface of red blood cells (RBC). When bound to CD38 on RBC, daratumumab interferes with the pretransfusion tests, with positive antibody screening and crossmatch. Anti-CD38 interference is an important challenge as many MM patients will require blood transfusions during their treatment. Dithiothreitol is a reducing reagent with multiple applications in blood bank testing. Treatment of RBC with dithiothreitol irreversibly removes cell surface CD38 tertiary structure, avoiding the binding and testing interference by the anti-CD38 daratumumab. Aims: To demonstrate the efficacy, safety and celerity of the protocol between the Blood Bank (BB) and Haemato-Oncology of our institutions, using just the crossmatch. Methods: A retrospective research was used for the evaluation of the results obtained from the implemented protocol. This comprehends a previous contact by Haemato-Oncology that leads to a study of the patient before the beginning of Daratumumab treatment, and consists in: ABO/RhD grouping; Rh and Kell phenotyping, and other clinically significant antigens; antibody screening; and direct antiglobulin test. Genotyping may be required for some patients who received previous blood transfusions. Before the beginning of the therapy, a blood sample of the patient is sent to the BB to perform laboratory tests and frozen after. This frozen sample is used for crossmatching in patients that already started therapy, did not have a blood transfusion in between, and have a positive antibody screening and/or crossmatch. In further transfusions, in case of positive tests, the dithiothreitol-treated donor RBC is applied. The donor RBC antigens are always selected accordingly to patients negative clinically significant antigens, when transfusional support is needed. The laboratory tests are executed in gel column agglutination technique.

Results: Since 2016, 32 patients were studied, from which 16 were transfused with 108 blood units, according to the protocol. There were no immunizations or adverse reactions to transfusion registered within the transfused patients, neither delay on the availability of blood units. Patient blood sample collected and frozen prior to the beginning of the treatment, has shown to be a good strategy by reducing significantly the waiting time for the blood unit in the first transfusion. Summary/Conclusions: This protocol, which defines the communication among the involved professionals, has shown to be a secure and effective way of reducing interferences caused by Daratumumab. It ensures the previous study of the patients and their transfusion with RBC respecting the patients negative clinically significant antigens. If not adopted, the mitigation measures described in this protocol, delays in the availability of the RBC requested and alloimmunizations, may and will possibly occur. A good communication between the BB and the Haemato-Oncology is crucial for a good time management when a transfusion is requested for these patients. Three methods were used to resolve this DARA interference. Reagent RBC's were treated with DTT, which know to denature CD38 and then tested with patient plasma. Allo-adsorption study was performed using a certain ratio of red cells to plasma. In addition, a selection of phenotyped cord cells were used as an antibody screening panel.

Results: DTT treatment of reagent red cells was successful at eliminating DARA interference and allowing for the presence of underlying antibodies to be identified. In this case, underlying antibodies were not detected by using reagent DTT treated red cells or phenotyped cord cells. Adsorption technique was ineffective at elimination the reactivity. Summary/Conclusions: DARA is the first commercial FDA-approved therapeutic monoclonal antibody used in treating Multiple Myeloma patients.

• Since CD38 is weakly expressed on normal red blood cells, DARA attachment to red blood cells can interfere with pre-transfusion IAT testing.

• DTT treatment of reagent red blood cells and cord cells can abolish the interference of DARA to test for the presence of underlying alloantibodies.

• To prevent delays in issuing red blood cell units to patients, hospitals should send patient samples to be tested before receiving DARA treatment to ensure that clinically significant alloantibodies are not being masked. Background: Antibody screening (AS)is considered superior to antihuman globulin (AHG) cross match during pretransfusion compatibility testing. In spite of knowing the utility and superiority of AS, it has not been adopted uniformly in India. Therefore, scarce data is available from this subcontinent in terms of optimisation of red cell antibody detection during pretransfusion testing in form of "Type and screen" Aims: The main objective was to study the benefits of performing simultaneous antibody screening along with the blood grouping during the first hospital visit to the hospital. Other objectives were to study the prevalence of clinically significant antibody among the Indian population and to follow up the patients who were transfused antibody screen negative but cross match incompatible blood. We also studied some other relevant quality indicators related to efficiency of blood transfusion services Methods: This prospective study was carried out at a tertiary healthcare centre in India between July 2014 and Dec 2018 (54 months). The study protocol was submitted to institutional review board and permission was granted. Blood grouping and AS were done during patients' first hospital visit, which we called "type and screen". When the patient got admitted to the hospital and required blood transfusion, a blood request form was generated by the user and sent to blood bank. Depending upon the results of antibody detection, further course of action was chosen. If patient was found to have no antibody, immediate spin test (IST) cross match compatible blood was issued and transfused. In such cases the procedure of AHG crossmatch testing was continued even after issue of blood. Cases where AHG cross match test was found negative no further follow-up of the patient was done whereas when AHG cross match was found positive, patients were followed after the transfusion Results: A total of 22888 patients were "type and screened". Majority were from hemato-oncology, BMT, liver transplant, paediatric cardiac surgery, and medical ICU units. Clinically significant allo-antibody was detected in 145 patients and autoantibody was detected in 53 patients. Alloantibody was detected mainly against Rh and Kell blood group systems. In diagnosed AIHA cases, majority were in the form of Warm AIHA (58%) and 20% of AIHA cases were having hidden single or multiple alloantibody. Significantly higher proportion of patients in AS positive group required blood transfusion than AS negative group (45% VS 34%, P < 0.05). in both the groups, in planned cases, most of the time blood was issued immediately within the defined turnaround time except in 21 where either transfusion was delayed or surgery was postponed. It happened only in trauma or surgical bleed cases. Expiry of blood was decreased significantly due to no usage of blood (1.2% vs. 5%, P < 0.05). During the period of study we obtained 10 cases where the IST cross match was compatible but the AHG cross match was incompatible. During follow up none of the cases demonstrated any sign of hemolysis Summary/Conclusions: In developing countries like us, optimization of AS during pretransfusion testing increases operational efficiency and significantly decreases the expiry of blood. Results: During the period when AbSc was performed on PK7300, 250,599 donation samples were tested and 4,895 (1.95%) were found AbSc positive. Antibodies to red cells were identified in 250 donations out of 4,895 (5.11%) AbSc positive samples and in the rest, no irregular antibodies were detected. The prevalence rate for atypical antibody was 0.10%. The top 5 most frequent antibody specificities were: nonspecific cold antibodies (28.8%), anti-E (26.8%), anti-Mi a (19.6%), anti-M (16.8%) and anti-Le a (4.0%). A total of 225,124 donations were screened for atypical antibodies by IH-1000 and 2,275 (1.01%) were screened positive. Among these, anti-red cell antibodies were identified in 1,239 samples (54.46%), which was significantly higher than those identified in PK7300 screened positive samples (P < 0.00001). The prevalence rate for atypical antibody as screened positive by IH-1000 and with confirmed red cell specificities was 0.55%, which was also significantly higher (P < 0.00001). The top 5 most frequent antibody specificities were: anti-Mi a (55.3%), anti-M (21.1%), anti-Le a (10.2%), anti-E (6.5%) and non-specific cold antibodies (3.6%). Anti-Fy b was detected in 7 cases, which would be missed detection by enzyme treated reagent cells on PK7300 system. Summary/Conclusions: The performance of the IH-1000 system using a 3-cell screening panel including one cell with Mi(a+) expression and column agglutination technology with IAT phase was superior in comparison with that of PK7300 in the context of higher sensitivity in detecting more true positive results and higher specificity in detecting more true negative and less false positive results. This has translated into the advantages of reduction in workload of Reference Laboratory in performing less antibody identifications in those false positive samples as well as enhanced transfusion safety by removing more irregular red cell antibody positive plasma-containing components from the issuable inventory, which may potentially lead to haemolytic transfusion reactions. The prevalence of irregular red cell antibodies of 0.55% in healthy blood donors in Hong Kong reflects more the true statistical figure. Background: Chronic Red Blood Cell (RBC) transfusion is the upfront therapy for thalassaemia patients, however this therapy is featured by several adverse events including RBC alloimmunization. Phenotype matched products transfusion policy can prevent alloantibody formation, but it makes routine transfusion more difficult for both the donor center and the transfusion service. A recent systematic review (Franchini et al, Blood Transfus 2019) reported a RBCalloimmunization prevalence of 11.4%, with a higher incidence against Rh and Kell systems in thalassemia intermedia patients. Aims: The aim of our retrospective study is to evaluate the RBC alloimmunization prevalence in thalassemia patients transfused in a single center over a 18 years period with limited phenotype matched RBC (Rh and Kell system antigens) units. Methods: From 1990 to 2018 thalassaemia patients, with a minimum follow up of 1 year and transfused with more than > 10 RBC units, were included in our study. Patients were studied for: blood group and Rh / K phenotype determination, direct antiglobulin test (DAT), irregular antibodies research (AbIrr). Cross-match and detection of alloantibodies were performed using the indirect antiglobulin test by the column agglutination method. Six-monthly DAT and antibody screening were performed using the indirect antiglobulin test and enzymatic papain-treated RBC test.

Results: Overall 57 patients (38 females, 19 males) were included in our retrospective analysis: 54 patients were affected by Thalassaemia Major and 3 by Thalassaemia Intermedia. RBC alloimmunization prevalence was 12.3% (7 patients): 3 patients were found to be positive for RBC alloantibodies, four with alloantibodies and autoantibodies. Eleven alloantibodies were detected (1 anti-H, 1 anti-Cw, 4 anti-E, 1 Kpa, 1 anti-Jka, 1 anti-Jkb, 1 anti-M and 1 anti-Lua). In 2 out of 3 alloimmunized patients we found an anti-E antibody reactive in enzymatic papain-treated RBC test only, in the third alloimmunized patient anti-Kpa and anti-Lua antibodies were detected, while in the remaining 4 patients, in which auto and alloantibodies were detected, a severe autoimmune hemolytic anaemia (AEA) requiring therapy was diagnosed. In these cases the appearance of alloantibodies is concomitant with the presence of autoantibodies. Among the 7 patients positive for alloantibodies, 6 were affected by major thalassemia and one by intermedia thalassaemia Summary/Conclusions: In our experience a limited phenotype matched RBC transfusion policy showed a RBC alloimmunization prevalence similar to literature data: 12.3% vs 11.4%; we didn't find higher alloimmunization prevalence in thalassemia intermedia patients may be due to the low patients number.

We believe that introduction, in our department, of an extended-phenotype matched transfusion, including antigens of the main group systems (Fy, Jk, MNS) and the main rare antigens (Cw, Kp, Lu), could reduce the risk of red blood cell alloimmunization in thalassemia patients.

Abstract withdrawn. Background: Undoubtedly, preventing alloimmunization has an advantage over overcoming its consequences. However, the high cost of technical and organizational aspects of preventive measures requires their scientific substantiation confirmed by clinical and laboratory data. Selection of donors of the Rhesus (D, c) and Kell (K) antigens for the red blood cell transfusions to hematological patients has been regulated in the Russian Federation since 1998. Recipients with the phenotype C+c-transfuse red blood cell only with the same antigenic combination. For transfusions red blood cell obtained from K-negative donors are used. The compatibility of the donor and recipient with the antigens C, E, e, C W (Rhesus system) and k (Kell system) is additionally taken into account from April 2013. That is, transfuse red blood cell that do not contain antigens in the phenotype that are not in the recipient's phenotype. Aims: To evaluate the efficiency of red blood cell donor selection using antigens of Rhesus (C, c, E, e, C W ) and Kell (K, k) systems for the prevention of the recipient alloimmunization.

Methods: Immunohaematological studies using equipment and reagents of BioRad (USA) were performed in 3642 patients of the hematology clinic. Non-Hodgkin lymphoma was diagnosed in 759 patients, acute leukemia in 600, multiple myeloma in 390, chronic lymphatic leukemia in 319, chronic myeloid leukemia in 218, aplastic anemia in 147, hemophilia in 105, myelodysplastic syndrome in 73, and other hematological diseases in 1031. The frequency of detection of antibodies to antigen C (0.25% vs 0.06%) and to antigen E (0.46% vs 0.12%) decreased four times. The frequency of detection of antibodies to the C W antigen has not changed significantly (0.10% vs 0.06%, respectively). Selection of antigens c (Rhesus) and K (Kell) has been carried out in the clinic since 1998, therefore the immunization index for these antigens remained unchanged and amounted to 0.10% vs 0.12% for anti-c antibodies; 0.36% vs 0.36%for anti-K antibodies. Alloantibodies to the antigens e (Rhesus) and k (Kell) were not detected for the entire observation period. Summary/Conclusions: Research verified the effectiveness of alloimmunization prevention of recipients by selecting red blood cell for antigens C, c, E of the Rhesus system and K (Kell). The study concluded that selection of red blood cells for the antigens C W , e (Rhesus) and k (Kell) does not affect the level of alloimmunization of patients and is not clinically justified. Background: In the Russian Federation, there is an order according to which patients requiring multiple transfusions, who are at high risk of immunological complications are to typed for red blood cell antigens: ABO, D, C, c, E, e, Cw, K, k. Selection of erythrocyte-containing blood components is carried out taking into account the donorrecipient compatibility according to all the listed antigens. Aims: Analysis of results of immunological evaluation of patients of hematological clinic. Methods: The study included 466 first time patients of hematology clinic in 2017-2018. Typing of antigens of ABO, Rhesus, Kell systems, screening and identification of antibodies were carried out using equipment and reagents from Bio Rad (USA). Results: Interpretation of results of immunohematological screening was complicated in 84 (18.0%) patients. The total number of complex cases was 96. The double population of red blood cell was most often determined in antigens of the Rhesus system (10.9% of the total number of patients) as a result of previous transfusion therapy. Of those, chimera for the antigen E was detected in 31 cases (60.8% of patients with the chimera for Rhesus and Kell antigens), Cin 23 (45.1%), sin 15 (29.4%), e -5 (9.8%), Cw -8 (15.7%), K -5 (9.8%). In such cases, donor red blood cells were chosen not carrying chimeric antigen for transfusions, in the presence of chimeras in both paired antigensred blood cell transfusion with the CC phenotype and / ee. Chimera for ABO antigens was detected in 0.6% of the examined individuals. The discrepancy between the direct and reverse blood grouping of the ABO system in patients (1.1%) was due to a decrease in the production of antibodies -4 cases and the appearance of extra agglutinins -1 case. Autoantibodies were detected in 3.9% of all patients, including 0.6% of patients, when they caused panagglutination phenomenon. Upon detection of autoantibodies that complicate the individual selection of donors, transfused red blood cells that are compatible with antigens of ABO, Rhesus, Kell, Duffy, Kidd, MNS systems. Alloantibodies were detected in 2.8% of patients, including specific anti-Din 4 (0.86%), anti-DCin 2 (0.43%), anti-Kin 1 (0.21%); antibodies of unidentified specificityin 2 (0.43%), polyspecificin 4 (0.86%). Summary/Conclusions: The complexity of interpreting immuno-hematological tests in hematological patients is due to intensive transfusion therapy, changes in red blood cell antigens and appearance of nonspecific antibodies due to underlying disease. Red blood cell for transfusion in these patients should be selected taking into account the expanded red blood cell antigen profile.

Abstract withdrawn. Background: Blood transfusion is an essential part of therapy for many patients. Although life-saving for many patients, blood transfusion is not without risk. The main goal of blood transfusion services is that transfused blood should be compatible with the patient. The clinical and serologic evaluation, which allows for the transfusion of the most compatible (or "least incompatible") blood, requires a joint effort between the clinician and the transfusion medicine physician. Aims: Root cause analysis of incompatible cross matches in patients. Methods: In this prospective study, total of 3,49,497 crossmatches were performed over period of last four & half years, out of which 867 units were found incompatible by column agglutination method-CAT in polyspecific (Anti-IgG+ C3d) gel media. A root cause analysis protocol was formulated to resolve incompatibility to ensure safe transfusion.

Results: On the evaluation of 3,49,497 crossmatches, only 867 units were found to be incompatible (0.14%). The major cause for incompatibility found in patients was AIHA-(32.87%). Other causes of incompatibility were infections (27.44%), multiple transfusions (17.41%), trauma (11.23%), Evan's syndrome (4.15%), Rh Negative mother (3.57%), SCA (2.99%) & incompatibility due to DAT positive Packed Red Cells (0.34%).The most common antibody found were anti-'c', anti-'s' & anti-'M'. Summary/Conclusions: The RCA protocol involves a thorough evaluation of the patient's clinical condition and underlying pathology to identify the cause. A logical stepwise approach will enable provision of safe transfusion to the patient. Background: Antibodies to high-frequency antigens (HFAs) are a transfusion hazard, as compatible blood is often very difficult to obtain. Other clinically significant alloantibodies represent an additional transfusion risk. In patients treated with allogeneic bone marrow transplantation (BMT) recipient red cell alloantibodies may cause acute or delayed haemolysis of donor red blood cells (RBC) and contribute to morbidity and mortality. Aims: The aim is to present the case of a patient with Myelodysplastic Syndrome (MDS), multiple "common" alloantibodies and an additional alloantibody to a highfrequency antigen, treated with allogeneic BMT. Methods: A forty-one-year-old Caucasian patient with MDS (RAEB-1) was admitted to our hospital in January 2017 for unrelated allogeneic BMT. She previously received myeloablative conditioning therapy according to the Flu / Bu4 / ATG protocol (5 days of 250 mg iv. Fludarabine, 4 days of Busulfan 792 mg iv, 2 days of 300 mg iv. Antithymocyte Globulin). The indirect antiglobulin test (IAT), done in August and December of 2016, was negative. According to anamnestic data, the patient had two pregnancies. She received red cell transfusions during childbirth and platelets in December 2016. Results: The patient's blood group was O RhD positive, IAT positive. The donor blood group was A RhD positive, IAT negative. Phenotype of the recipient's RBCs, as well as the donor RBCs, was also determined. Anti-E and -C w were found in the patient's plasma, but an additional alloantibody was suspected. The autocontrol was negative. Column agglutination technology (CAT) and tube technology were used to identify RBC antibodies. Plasma was tested with pheno-matched RBCs, papain-and 0.2 M dithiothreitol-treated RBCs, as well as cord and autologous RBCs. Adsorption and elution tests were done, excluding other "usual" clinically significant alloantibodies, and the patient received three incompatible (XM in IAT, CAT) Yt(a+), E-, C w -, K-red cell units. The sample was urgently sent for an antibody investigation at the International Blood Group Reference Laboratory (Bristol, UK). In the reference laboratory, anti-E, -C w and an alloantibody to a high-frequency antigen were confirmed, whose specificity was determined to be anti-Yt a . Anti-Jk b was also suspected and later confirmed. Before the patient was discharged from the hospital, she received eight more red cell units (Yt(a+), E-, C w -, Jk(b-)), during which she was serologically closely monitored. Summary/Conclusions: The results of the antibody investigation in this case study indicate the presence of multiple alloantibodies in a patient who has previously received immunosuppressive myeloablative conditioning therapy. In addition to the "common" alloantibodies (anti-E, -C w , -Jk b ), an alloantibody to a high-frequency antigen (anti-Yt a ) was detected in the patient. This patient was transfused with incompatible red cell units (Yt(a+)) in an emergency, with no ill effects. Although anti-Yt a is rarely a clinically significant antibody, according to literature, it can cause immediate haemolytic transfusion reaction. Additional risk were "common" clinically significant alloantibodies, especially anti-Jk b , which was in this case extremely difficult to detect and had further complicated the selection of blood. Background: The identification of an antibody against a high-incidence antigen always introduces a challenge due to the difficulty in finding compatible units of Red Blood Cells (RBCs). In patients needing surgery it is important to minimize their transfusional needs by implementing patient blood management programs (PBM). Tests that predict the clinical significance of antibodies, such as monocyte monolayer assay (MMA) are also useful in guiding clinical decisions. Kell Blood Group System contains highly immunogenic antigens. Antibodies against these antigens are Immunoglobulin G, and can cause severe hemolytic transfusion reactions and fetal anemia. Results: Case report We report the case of a 75-year-old female, with Non-Hodgkin lymphoma, chronic anemia and scoliosis with severe neurological compromise, proposed for lumbar spinal stabilization surgery. She had a total hip replacement surgery in 2004, with unknown transfusion history. Her obstetric history was G6P4A2. The patient had no history of thromboembolic or hemorrhagic events. During pre-transfusional tests, she was typed as a 0 rr and had a positive antibody screening test. The identification studies were suggestive of an antibody against a highincidence antigen, so the surgery was delayed until clarification of these results. She was also referred to a PBM appointment where her hemoglobin was improved from 9.0 g/dl to 12.0 g/dl by administration of ferric carboxymaltose IV and darbepoetin SC. The patient was phenotyped as Kp(a+b-) with anti-Kpb, an antibody against a highincidence antigen (>99% prevalence worldwide). It is a rare antibody with variable reactivity, causing from none to moderate/delayed transfusion reactions. To access the clinical significance of this antibody, a MMA was performed, resulting in a reactivity of 1.2%, suggesting no clinical relevance, however it could be altered after transfusion of kpb+ blood. In order to find compatible RBC's, several family members were phenotyped, however they were all positive to the Kpb antigen. In Portugal there were no 0 rr Kp(b-) blood donors, as it is extremely rare, so we searched in the International Rare Donor Panel (IRDP) and two donors were found in Spain. Two units of compatible RBC's were requested prior to the surgery, which was performed successfully four months later without transfusional support. Summary/Conclusions: Anti-Kpb is a rare antibody that in some cases can cause hemolysis of the transfused Kp(b+) red blood cells. The combination of Kp(b-) and O rr, an extremely rare phenotype, presented a challenge in finding compatible RBCs. This case illustrates not only the complex transfusional and logistic problems that an antibody against a high-incidence antigen can pose, but also the importance of an efficient PBM programme to mitigate the transfusional needs in these patients. Background: Blood transfusion is an integral part of the supportive care for patients with sickle cell disease (SCD). Allo-immunization is a recognized complication to red blood cells transfusion (RBC) in those patients. This may result in difficulties in providing compatible blood, and may be associated with the risk of acute of delayed hemolytic transfusion reactions. Aims: To describe transfusion management in a patient with SCD who has multiple alloantibodies with difficulty in obtaining compatible blood, in order to highlight the importance and clinical consequences of this complication and suggest a possible management approach Methods: An 18-years-old female patient with SCD presented to our hospital with hemoglobin level of 4 g/dl secondary to acute splenic sequestration. She had a history of multiple previous admissions and many previous RBC transfusions.

Blood grouping and pre-transfusion compatibility testing were performed in addition to phenotyping of the patient's red cells. Screening was done using column agglutination technique by automated machine (Ortho; USA) and antibody identification was performed manually using commercial 11 cells identification panel. Phenotyping for the patient was done using haemagglutination technique with mono-specific anti sera (Bio-Rad; Switzerland). Results: The patient was of group O RhD (positive). Antibody screening was positive and antibody identification revealed probable anti-E and anti-Fya with possible development of anti-K allo-antibodies, in addition to recent development of autoantibodies; giving pan-positive reactivity with the identification panels. Phenotyping of the patient's RBCs was found to be R1r and K-negative. Other masked allo-antibodies of undefined specificities were suspected and no compatible blood was found. The clinical condition warranted a blood transfusion, so least incompatible phenotypically matched RBC unit was released. The patient developed acute hemolytic transfusion reaction with drop of the Hb level to 2.8 g/dl. Despite screening hundreds of RBC units, no compatible units were identified, and no transfusion was given. The patient was managed conservatively using hydration, analgesics, hydroxyurea, erythropoietin, Intravenous Immune Globulin (IVIG), steroids, and rituximab. Hb level increased to 8 g/dl in 2 weeks, and the patient was discharged from the hospital. The sample of the patient was sent to a reference lab (Institut fur Klinische Chemie und Laboratoriumsmedizin-Regensburg -Germany) for further investigations, clarifications and advice for compatible transfusion in case of need. The report of the reference lab revealed the development of additional anti-M and anti-S with confirmation of the presence of anti-Fya, anti-K and warm auto-antibodies. Phenotyping of RBCs was confirmed by molecular diagnostic testing done in the reference lab; as R1r, K-neg. Summary/Conclusions: Finding compatible blood may be extremely difficult in patients with SCD who develop multiple alloantibodies. It is therefore essential to perform an initial extended red cell phenotyping for the patients at diagnosis and to have on shelf ready phenotyped blood units for issuing to the patients, to minimize allo-immunization. Transfusion may occasionally be avoided in allo-immunized patients, utilizing alternative options of treatment and reducing the risk of serious complications such as hemolytic transfusion reactions. Background: Red blood cell (RBC) antigens that are present on less than 1% of most populations are known as low incidence antigens and those present on more than 90% are known has high incidence antigens. The MNS blood group system consists of 49 antigens carried on glycophorin A (GPA), glycophorin B (GPB) or on hybrids of these glycophorins. There are 35 low incidence and 10 high incidence antigens in the MNS blood group system. An individual that is homozygous for GP.Mur will be negative for the high incidence JENU (MNS49) antigen. Anti-JENU was first described in a Thai patient with thalassemia where only 2 compatible units were found following screening of 3600 units. The JENU negative phenotype is a rare phenotype with an estimated frequency of 0.06%. A male patient with a history of previous transfusion presented with an anti-E and a weak auto antibody with no apparent specificity. A donor unit selected for cross match (group O RhD positive, C+E-c-e+, K-) was incompatible with a reaction grade of 4 + by column agglutination technology. The patient's sample and donor unit were referred to the Red Cell Reference Laboratory for investigation for a possible antibody to a low incidence antigen. Aims: We aim to characterize the phenotype of the incompatible donor unit. Methods: Standard serological procedures were used to identify the antibody specificities in the patient's sample. Blood group phenotyping of the patient and donor was performed by standard serological procedures. Genotyping and zygosity testing was performed using polymerase chain reaction (PCR) high-resolution melting (HRM) assay. GP.Mur is a GP(B-A-B) hybrid glycophorin resulting from a gene conversion event between GYPA and GYPB . This disruption to GPB impacts s expression. The donor was negative with anti-S MoAb (Albaclone), positive with anti-s polyclonal (Immulab) and negative with anti-s monoclonal antibody (Immulab). This S and s phenotype was consistent with the previously reported examples of GP.Mur homozygote JENU negative individuals. Molecular testing was consistent with serology supporting GP.Mur homozygosity and JENU negative phenotype. Summary/Conclusions: This donor has been added to our rare donor panel and their red cell donations are cryopreserved for future use in our rare donor frozen inventory. There is limited anti-JENU antiserum available to confirm the JENU negative phenotype. We currently rely on the serological profile of red cells presenting with the GP.Mur phenotype, S negative and the discrepant s phenotyping to identify JENU negative donors. This case has highlighted the importance of following up unexplained serological incompatibilities. The development of a monoclonal antibody directed against JENU antigen would provide an opportunity to screen for suitable donors for this rare phenotype. Background: Molecules expressed on tumor cells are a target of interest for drug development by the use of monoclonal antibodies or blocking proteins. However these drugs have the potential to interfere in pretransfusion testing when the target molecule such as CD47 is also expressed on red blood cells (RBCs). Recently, many drugs targeting CD47 have been developed but appropriate mitigation strategies and approach to selecting RBCs for safe transfusion is still an obstacle. Aims: We describe a case of delayed hemolytic transfusion reaction (DHTR) by anti-Jk a in a patient treated previously with CD47 targeted high affinity SIRPa fusion protein ALX148. Methods: A 35-year-old woman diagnosed with nasal cavity squamous cell carcinoma was enrolled in an ALX148 clinical trial. Her blood type was group AB, RhD positive, and the antibody screening test was negative for the past 8 months. She had no previous transfusion history during the past two years. After two infusions of ALX148, two units of apheresis platelets were requested for transfusion. The blood bank noticed that the antibody screening was positive and further investigation was proceeded. Results: Antibody screening showed trace positivity in both panel cells (I & II) at room temperature (RT) and 37°C albumin phase, and 2 + at anti-human globulin (AHG) phase by tube method. The auto control was negative at RT and 37°C albumin phase, but 2 + at AHG phase. Antibody screening (2 cells) and identification (11 cells) all showed 3 + at AHG phase using gel cards. Direct antiglobulin test was 4 + for anti-IgG and 3 + for anti-C3d using gel cards. Two units of RBCs were requested for transfusion after hemoglobin decrease to 7.8 g/dL. RBC genotyping was unavailable at the moment. As her previous antibody screening was negative (anti-Jk a not detectable), E-, c-, Fy b -RBCs were given as a second best option, considering the phenotype distribution of major blood groups in the Korean population. The hemoglobin level was well sustained between 11.1-12.0 g/dL but it decreased again to 9.2 g/dL twenty days after RBC transfusion. Further laboratory investigation was consistent with a DHTR. The patient was no longer being given ALX148, and antibody screening and DAT decreased to 0-1+ reactivity. We presumed that antigen typing results would be reliable after chloroquine dissociation and cell washing using antisera that did not require AHG for testing. Serologic phenotyping showed that the patient's cells were C+, E+, c+, e+, Jk a -, Jk b +, Fy a +, Fy b -, S-, s+, M+, N + . Antibody identification using papainized panel cells revealed anti-Jk a antibody. We concluded that the DHTR was due to anti-Jk a , and Jk a -, Fy b -, S-RBCs were issued for further transfusion requests. The patient's hemoglobin level recovered to 13.6 g/ dL. The patient's genotype was later identified to be the same as serologic typing. Summary/Conclusions: Communication with the physician and blood bank to perform adequate pretransfusion testing before administration of drugs targeted to CD47 is important to achieve safe transfusion for patients. Serologic phenotyping using antisera which do not require AHG for testing can be used as a second option when genotyping is unavailable in a timely manner. Background: Transfusion is still a key treatment for sickle cell disease (SCD) patients. As a result, these patients are much more exposed to transfusions' risks, the most feared one being a delayed hemolytic transfusion reaction (DHTR). We investigated a female SCD pediatric patient with no known antibody, who was referred to us for a suspicion of two DHTRs. Three transfusion episodes were reported (a total of four units collected from four donors). For the last transfusion, a premedication with rituximab was done. The patient was planned to undergo a bone marrow transplant with her brother as her donor. Aims: To describe the molecular and serological workups needed to investigate a DHTR in a SCD patient. Methods: Antibody identification and crossmatches were performed by IAT gel testing with Red Blood Cells/panels, which were used raw, papain-treated and trypsintreated. RBCs' phenotypes were determined by conventional techniques. Semi-quantitative phenotypes were conducted by serial dilutions with a monoclonal anti-Jk a (MS15/Seraclone â ). DNA was extracted using the MagNA Pure Compact Instrument (Roche). Sequencing of JK exons 4-11 was carried out by in-house techniques. Results: The antibody identification showed a very weak anti-Jk a , which was only reactive on papain-treated RBCs. Autologous control was also only positive in this technique. DAT and the eluate were negative. As the patient had recently been transfused (less than four months earlier), on this first sample we were neither able to perform autologous adsorptions, nor verify her Jk a /Jk b phenotypes. In order to rule out the imputability of an anti-LFA in the DHTR outcome, crossmatches with her donors' RBCs were undertaken. Three out of the four donors were tested. Apart from the anti-Jk a reactivity, none of them was reactive. Because the patient had previously been phenotyped as Jk(a+b+), her JK gene was sequenced. Her genotype was determined as JK*01(28A,226A,303A,588G)/JK*02. To confirm this Jk a variant allele, a family study was conducted. All her siblings were found to harbor the same genotype. Her mother's and father's genotypes were JK*01(28A,226A,303A,588G)/ JK*01 and JK*02/JK*02, respectively. Subsequently, autologous adsorptions were performed, which proved the anti-Jk a to be an autoantibody. Considering the weakness of this antibody, internal controls were used, in order to evaluate a possible dilution effect of this technique. Finally, serial dilutions with the anti-Jk a reagent showed a weakened Jk a expression encoded by the JK*01(28A,226A,303A,588G) variant allele. This finding is consistent with the fact that the crossmatches between the proband's serum and her brother's RBCs were weaker than those performed with (Jka+b+) RBCs. Summary/Conclusions: About a third of DHTRs are reported to happen in patients with no previous history of immunization. Performing sensitive serological techniques in order to identify antibodies is necessary to select the most appropriate units. Molecular work and extra serological testing can be useful to determine whether an antibody is an allo or autoantibody. Even though in this case the anti-Jk a was the only antibody identified, because it was proven to be an autoantibody, it is difficult to conclude if it was the cause of the DHTR. Nevertheless, Jk(a-b+) blood was issued, and no adverse events have been reported. Luckily, the patient's bone marrow donor harbors the same variant allele.

Background: According to the AABB, a pre-transfusion sample must be obtained within 3 days of transfusion if a patient has been transfused or pregnant in the preceding 3 months. Despite this safeguard, high risk patients (i.e. those recently transfused with a history of pregnancy or transfusion) may develop antibody during this 3 day window. To avoid issuing incompatible red blood cells (RBCs) to these patients, a new antibody screen (ABS) sample should be drawn and tested shortly before anticipated transfusion. Aims: We report a case of a 60 y/o man who presented to the ED (hospital day 0, HD0) with a post-fall intracranial hemorrhage and multiple fractures. Anti-E and anti-Jka were identified after admission on a new specimen prior to current specimen expiration (<3 days). Methods: Specimen #1 (S1) was sent on HD0 for Type & ABS (T&S) and crossmatch (XM) of 2 RBCs. ABS and immediate spin XM were negative; there was no patient history. By HD9, he had 4 negative T&S specimens (HD0: S1; HD2: S2&3; HD6: S4) and had been transfused 4 RBCs (HD2: 2; HD5: 2) via electronic XM (EXM). At 1730 hr on HD9, 2 RBCs were requested and could have been issued via EXM since S4 was not expiring until midnight. However, given recent transfusions, BB staff first called the patient's nurse to review history. Patient was uncommunicative, but had scars suggesting past trauma or surgery. S5 was requested and received at 1801 hr. Results: S5 showed anti-E and anti-Jk a in plasma and eluate. His hemoglobin/hematocrit (H/H) decreased from 10.2 (14.0-17.5 g/dL)/30.1 (41.5-50.4%) on HD6 to 6.9/ 20.6 on HD9. During this period, he underwent several surgeries without unexpected bleeding, documented jaundice or dark urine. Two E-Jk(a-) RBCs were transfused on HD9, which he tolerated well with an increase of hemoglobin from 6.9 g/dL to 8.6 g/ dL. He did well post transfusion with stable H/H between 8.1/24.2.0 to 8.5/25.3. He was discharged on HD19. Repeat ABS on S4 was negative. Of the 4 RBCs transfused before S5, one was E+ and four Jk(a+). The family reported that he was injured 20 years prior and had been admitted to 3 hospitals, but was unaware of transfusion. Hospital #1 (H1) reported admissions 20 years ago (2 RBCs transfused) and 4 years ago; all ABS were negative. H2 admission was 5 years ago with positive ABS and inconclusive workup. H3 admission 4 years ago showed negative ABS. Summary/Conclusions: The patient developed a significant antibody response in less than 3 days from the specimen collection, likely a secondary immune response to sensitization from a transfusion 20 years earlier. A new specimen was requested prior to transfusion even though the existing sample (which was ABS Negative) had not expired. This approach identified new antibodies, preventing transfusion of incompatible RBCs, and a potentially serious hemolytic transfusion reaction. This case suggests that for high-risk patients, ABS more frequently than every 3 days may be beneficial. It is important to increase clinicians' and laboratorians' awareness of this issue. Background: Red cells with partial D antigen have historically been classified as such, based on the fact that the red cells type as D positive, but individuals make anti-D antibody when exposed to conventional D antigen. A definitive confirmation of the variant of D antigen is obtained after the Rh D genotyping. Aims: To present a case study of the patient's alloimmunisation with the present D partial antigen type DNB, most likely on previously received transfusions. Methods: The patient's pretransfusion testing included the determination of the ABO blood group and RhD type (Id card DiaClon ABO/D DV+, DV-, reverse grouping, monoclonal antibodies, gel method), antiglobulin crossmatch, additional phenotyping (gel and tube methods), antibody screening, identification of the specificity of irregular anti-erythrocyte antibodies by commercially available red cell panels (Id Dia-Panel Bio Rad gel method, Panocell Immucor, tube method) through an indirect antiglobulin test (IAT) and enzymes. After routine RhD typing we continued further characterisation of the RhD antigen by serologic assay (Bio-Rad ID-Partial RhD typing),and finally by RhD antigen molecular genotyping (FluoGene method on Fluo Vista machine). Results: Our patient is a 75 year old woman with a diagnosis of Tu mammae who was preparing for total mastectomy surgery. She had a history of blood transfusions twenty years ago, and she also had two births. The blood group typing was: O, CcDee, K-, Fy (a-b +), Jk (a+b +), Ss, MN, Le (a+b -). The agglutination reactions that we tested with anti D serums were strong (4+). The compatibility test with RhD positive donated blood units was positive. The presence of anti-D and anti-Fya antibodies in the serum of the patient was determined. We prepared one compatible blood unit, RhD negative and Fya negative, for a surgery. Interpretation of the ID-Partial Rh D typing set indicated that this is a DIII category of D partial antigen. A sample of blood of our patient was sent to the Blood Transfusion Institute of Serbia, where molecular typing of D antigen was performed and the presence of partial form of antigen D, DNB type, was found. Summary/Conclusions: RhD positive patients or donors with anti-D antibody presents in their serum should be tested for D genotyping. The recommendation for further transfusions of our patient with DNB D partial and her alloimmunisation is to prepare D negative, Fya negative erythrocytic blood components, and as a possible blood donor it would be labeled as Rh D positive. Background: The JR blood group system consists of Jr a (JR1), a high frequency antigen expressed by the ABCG2 gene. The individuals with Jr(a-) phenotype are mainly found in the Japanese population and may develop anti-Jr a when stimulated by blood transfusion or pregnancy. Anti-Jr a is a dangerous antibody for pregnancy, but also could cause mild or moderate neonatal jaundice. Aims: To conduct the antibody specificity identification of the high frequency antibody in a pregnant woman with history of pregnancy but no transfusion. Methods: ABO, RhD and some special blood group antigens were identified by tube method in saline. Antibody screening and blood group specific antibody identification were performed by indirect antiglobulin test (IAT) in gel column. The reagent cells treated with trypsin, chymotrypsin and papain, were used to test the antiserum to obtain the characteristic of antibody reaction. The antibody titer in the patient's serum was detected. DNA sample was extracted and 16 exons and adjacent intronic sequence of the ABCG2 gene were sequenced. The sample of one family member was collected for testing. Results: The blood groups of the patient were B, RhD(+), LU b (+) and Kp b (+). The negative reaction of the serum reacted with all reagent cells were tested in saline, but positive (2+) in IAT test, while the self-control was negative. The antiserums reacted strongly (4+ in IAT test in Gel card) with the papain-treated cells, but kept the same reaction strength (2+) with trypsin-and chymotrypsin-treated cells, which indicated the possible existence of anti-Jr a . The titer of IgG antibody in serum was 2. In Cross matching test, the red blood cell of the patient's brother with the same ABO and RhD blood group with the patient was successfully matched with the serum of the patient. The sequencing analysis of the ABCG2 gene in the patient and her brother revealed one homozygous nonsense mutation in exon 4 (c.376C>T, p.Gln126X). After the delivery of the pregnant women, no pathological jaundice was seen in the newborn. Summary/Conclusions: In the condition of the anti-Jr a reagent was unavailable for the identification of Jr a antigen in the patient, having an indication with anti-Jr a by serological test, the alternative genotyping method was used. The most common silencing JR allele reported in Asian population, especially in Japanese population, was identified to indicate Jr(a-) phenotype.

Immunohemotherapy, Centro Hospitalar Vila Nova de Gaia/Espinho, Vila Nova de Gaia, Portugal

Background: If the investigation of irregular/unexpected antibodies reveals a pattern in which all or most screen and panel cells are positive, with reactions in the same phase and with the same strength, along with a negative autocontrol, an irregular antibody to a high-prevalence antigen may be suspected. High-prevalence antigens are those that are present in almost all individuals (98% or more). Fortunately, because these antigens do occur so frequently, it is not common to find a patient with an antibody to one of them. However, when it happens, it may become a troubling situation. Aims: Clinical case report of panagglutination in assessment of irregular antibodies. Methods: Collection of clinical data in SCl ınico â and Sibas â applications. Results: Woman, 76 years old, O RhD+, previously transfused with 4 red blood cells concentrates in 2006, was proposed to a correction surgery of a periprosthetic hip fracture. Pretransfusion serologic tests were requested and irregular antibodies were detected (2+ in all the 3 screening cells). In order to identify the specificity of the antibody, a panel of 11 cells was tested; the result was considered inconclusive, due to positive reactions (2+) with all test cells in LISS/Coombs and atypical positivity with dragging in all cells in enzymatic environment. Autocontrol and direct antiglobulin test were negative. It was decided to send two blood samples to the reference laboratory for a more complete immunohematological study. Compatibilization of red blood cells to this patient was also requested. During the waiting period, haematopoiesis was optimized. Although the patient did not present anaemia at admission, the analytical study revealed iron deficiency; therefore, supplementation with intravenous iron was performed. The reference laboratory also obtained a panreactive panel (2+ with all cells) in LISS/Coombs and weak positivity in papain. After allo-adsorption, the search for irregular antibodies was negative. An anti-Yt a , apparently without clinical significance (negative IgG1 and IgG3) was then identified. Transfusion was not needed either during or after the surgery, with a good recovery of the haemoglobin value in the postoperative period. Summary/Conclusions: Yt a , which belongs to Cartwright system, is a high-prevalence antigen in all populations. Anti-Yt a , an IgG antibody stimulated by pregnancy or transfusion, is not as uncommon as we may think, which suggests that it is reasonably immunogenic. These antibodies are not generally considered clinically significant, but there are reported cases of acute and delayed haemolytic transfusion reactions in which anti-Yt a has been implicated. Therefore, although the described pattern of panagglutination in assessment of irregular antibodies may suggest the presence of an alloantibody directed against a highfrequency antigen, it is very important to confirm that hypothesis, recurring to a reference laboratory if necessary, to identify the antibody and to determine its clinical relevance. Even if the identified antibody is associated with rare haemolytic transfusion reactions, it is crucial to optimize haematopoiesis when it is not an emergent procedure, in order to minimize transfusion and its associated risks. Both for emergent and elective procedures, the creation of a national database of patients with already identified irregular antibodies would facilitate the administration of red cells concentrates without the implicated antigen. Aims: To investigate the frequency and explore the genomic characterization of Jk (a-b-) phenotype in blood donors in Harbin, China. Methods: All samples were screened for Jk(a-b-) phenotype using a direct urea lysis test. And the results were confirmed with by IAT using anti-Jka and anti-Jkb with a standard tube test. Additionally, polymerase chain reaction amplification and sequence analysis of the JK gene were performed. Results: From 80865 blood samples, four donors with Jk (a-b-) were selected, at a frequency of 0.0049%. Among these four samples available for sequencing JK gene, a total of two genotypes were discovered: heterozygote of IVS5-1G>A combining with heterozygote of 359G>A (Gly120Glu) and heterozygote of 896G>A (Gly299Glu) combining with heterozygote of 956C>T(Thr319Met). Summary/Conclusions: The frequency of Jk(a-b-) phenotype in blood donors in Harbin area was lower than the reported data from the populations in other areas of China and in Finland, but higher than that in Japan. IVS5-1G>A, 896G>A and 956C>T were common mutations in the before reports, while 359G>A was reported first time. In addition, it is an effective measure which establish the Jk(a-b-) phenotype donors in this region, to solve the blood transfusion problem in patients with anti-JK3. Background: Blood types, indicating the type of blood group antigen expressed in the red blood cells, is determined by the type of allele at the blood group gene locus. Therefore, when allele frequency of each blood group gene is determined, it is possible to predict the frequency of a specific blood type donor with a homozygous allele. It is also possible to estimate the proportion of donors within a particular blood type through combination of specific alleles. And because the ratio of blood group allele differs between ethnicity and race, this can be used as basic data for population genetics and anthropology. Therefore, we present a study that examined the allele frequencies of 10 blood group systems in the Korean population through blood group genotyping. Aims: The purpose of this study is to determine the frequencies of blood group alleles in the Korean population, to predict the proportion of homozygous donors, and to obtain the basic data of population genetics. Methods: 5,213 blood donors from age 19 to 54 were recruited at Korean Red Cross blood centers located nationwide. Acquired samples were examined by blood group genotyping methods using the RBC genotyping system ID CORE XT (Progenika Biopharma). For each donor, genotypes of 10 blood group systems, excluding ABO and RhD, were identified. Calculation of the frequencies of blood group alleles in the Korean population was done. Results: We conducted molecular genotyping of the RhCE, Kell, Kidd, Duffy, MNSs, Diego, Dombrock, Colton, Cartwright, and Lutheran blood group systems. The allele frequencies of these blood group systems in the Korean population were estimated as follows.

-RHCE*CE 0.3%, RHCE*Ce 65.0%, RHCE*cE 28.8%, RHCE*ce 5.9% -KEL*k_KPB_JSB allele 100% -JK*A allele 49.1%, JK*B allele 50.8%, JK*B_null allele 0.1% -FY*A allele 92.8%, FY*B allele 7.2% -GYPA*M allele 51.1%, GYPA*N allele 48.9% -GYPB*S allele 5.1%, GYPB*s allele 94.8%, GYPB*Mur allele 0.1% -DI*A allele 4.7%, DI*B allele 95.3% -DO*A allele 10.1%, DO*B allele 89.9% -CO*A allele 100% -YT*A allele 100% -LU*B allele 100% Summary/Conclusions: The significance of this study is accumulation of data on the allele frequencies of blood group genes through highly accurate genotyping method in the East Asia region. This enables the prediction of the proportion of donors with a combination of specific blood group alleles in the Korean population, which accounts for a decent percentage of the population in this region. Background: In donors from Arabian countries only little is known about blood groups other than ABO and Rhesus. During the last years increased migration to Central Europe has put a focus on the question how to guarantee blood supply for patients from these countries, particularly because hemoglobinopathies with the need of regular blood support are more frequent in patients from that region. Aims: Blood group allele frequencies should be determined in individuals from Syria, other Arabian countries, and Iran by molecular typing. Methods: As most blood groups are defined by single nucleotide polymorphisms (SNPs) we introduced a MALDI-TOF MS assay to detect alleles encoding 16 blood groups including Kk, Fy (a/b), Fy null , C w , Jk(a/b), Jo(a+/a-), Lu(a/b), Lu (8/14), Ss, Do (a/b), Co(a/b), In(a/b), Js(a/b), Kp(a/b), RHCE*c.697C>G, and RHCE*c.733C>G. Additional blood groups and polymorphisms like Yt(a/b), S-s-U-, Vel null , Co null and RHCE*c.667G>T were tested by PCR-SSP. A total of 1111 probands including 800 individuals from Syria, 147 from Iran, 123 from the Arabian Peninsula and 41 from Northern African countries were included. Results: 2% of the donors were homozygous for the Fy null (FY*-67t>c, FY*02N.01) mutation, 16.2% carried the heterozygous mutation. 0.4% of the Syrian probands were heterozygous for the DO*350C>T mutation (both, DO*JO1 and DO*JO2; Jo(a+/ a-)) that is virtually unknown in Caucasian donors. 0.8% of the Syrian donors heterozygously carried the KEL*02.06 allele coding for Js(a) (phenotype Js(a+/ b+)) that is very rare in Caucasians. However, no homozygous KEL*02.06 carriers were identified. 1.8% of the Syrian and 1.5% of all donors were negative for YT*A, which is definitely more frequent than in Europeans. One donor from Northern Africa homozygously carried the GYPB*c.251C>G, intron 5 + 5 g mutation, inducing the S-U+ w phenotype. 3.6% of all and 29.3% of Northern African donors were heterozygous for the RHCE*c.733C>G substitution, 0.3% of the Syrian donors carried RHCE*c.697C>G (heterozygously) and 0.004% of all donors were heterozygous for RHCE*667G>T. Heterozygosity for Vel deficiency (VEL*-01) was detected in 21 individuals (2%; 16 of them from Syria) whereas only one Syrian donor carried the homozygous mutation. None of the donors carried the AQP1*c.601delG (CO*01N.06) mutation that induces the Co null phenotype. Summary/Conclusions: The study provides a first overview on a number of different blood group alleles in blood donors from Arabian countries. Some blood group alleles that largely are lacking in Europeans but had been described in African individuals are present in Arabian populations at a somewhat lower frequency. In single cases it could be challenging to provide immunized Arabian patients with compatible blood. Methods: Three unrelated individuals (2 blood donors and one pregnant woman) of Polish origin who were typed as AB group with a very weak A antigen and normal B antigen expression were subjected to extended ABO typing. In one case family studies were performed (blood samples from donor's mother, father and sister). Sequencing analysis of this donor DNA was performed three times (from two blood samples and buccal swab). Serologic investigations were performed with standard methods: 1/gel cards DiaClon ID ABO/D (anti-A: clone A5, anti-B: clone G1/2, anti-A,B: clone ES131, ES15+ BIRMA 1+ ES4; Bio-Rad) and DiaClon ID ABD-Confirmation for Donors (anti-A: clone M297/628 = LA-2; Bio-Rad); 2/tube techniques with: anti-A (BIRMA 1; A-11H5, A1 s.PA1M095, c.9113D10), anti-B (LB-2, B-6F9, c.9621A8). Genotyping was determined by RBC FluoGene ABO Basic Kit (Inno-train, Germany) and by sequencing of +7.21-kb site of ABO gene to cover sequences ranging from the end of Intron 1 to 3 0 UTR of the ABO gene. Additionally sequence of Exon 1 of the ABO gene was analyzed. Results: ABO typing showed normal B and a very weak A antigens on RBCs of all three individuals (2 blood donors and one pregnant woman). The A antigen was detected by tube technique only using anti-A clones: BIRMA 1 (1+ to 2+), A-11H5 (1+ to 2+) and c.9113D10 (weak+ to 1+); negative reaction of A antigen typing by gel cards was observed. The sera of all individuals contained anti-A1 antibodies. Commercial PCR-SSP kit revealed three heterozygous A/B genotypes (absence of 1061delC typical for ABO*A2 alleles). In all these individuals ABO sequencing of 7.21-kb fragment confirmed the heterozygous genotype with 7 polymorphisms characteristic for ABO*B.01 allele (297A>G; 526C>G; 657C>T; 703G>A; 796C>A; 803G>C; 930G>A) and detected a novel ABO*A allele sequence with duplication-based insertion of 21 bp after 564 position (ABO*A c.dup543_563; GCAGGACGTGTCCATGCGCCG). As a consequence, the online protein translation predicts an in-frame duplication of seven amino acids after codon 188 (p.dup_182_188QDVSMRR), with synonymous change of the repeated codon 182 (CGC>CGG) and 188 (CGG>CGC) but both coding arginine (R). Inheritance of ABO*A c.dup543_563 allele was confirmed by family studies of one donor: his father and sister had A/B genotype associated with normal A and B antigens expression; his mother had normal A antigen expression. She carried ABO*A1.01 allele and the same ABO*A c.dup543_563 allele as a son. Summary/Conclusions: A novel A weak allele at the ABO gene detected in three unrelated Polish individuals is an in-frame insertion of seven amino acids to the wild-type glycosyltransferase A. The stability of the encoded protein may be affected causing the weak A phenotype. The inheritance of this mutation was confirmed in the family studies. Background: Since the cloning in 1990 of cDNA corresponding to mRNA transcribed at the blood group ABO locus, polymorphisms and phenotype-genotype correlations have been reported by many investigators. Although many subgroups have been explained at the genetic level, unresolved samples are still encountered in clinical practice. We report here the result of an ABO investigation of a sample from a Swedish blood donor that showed a very weak agglutination of RBCs with anti-A in routine forward typing. Aims: To elucidate the genetic basis of the apparent weak A subgroup. Methods: Routine ABO genotyping by PCR-ASP and PCR-RFLP including PCRbased analysis of the upstream CBF/NF-Y-binding enhancer region was carried out. Further genetic analysis was performed by DNA sequencing of ABO exons 1-7 (including 50 base pairs of the adjacent introns) and the proximal promoter. Flow cytometric testing of RBCs was performed with monoclonal anti-A, anti-B and anti-H. Results: The weak agglutination of erythrocytes with anti-A was accompanied by the expected lack of anti-A and anti-A1 in plasma. ABO genotyping gave the genotype ABO*A1.01/O2.01 usually consistent with normal expression of A antigen. Enhancer analysis resulted in an amplification product corresponding to the expected single CBF/NF-Y binding motif. Flow cytometric testing of the sample showed A antigen expression with an almost chimeric pattern where the majority of the cells (approximately 85%) expressed the A antigen at a very low level, marginally distinguishable from the group O control. The remaining approximately 15% of the cells displayed an A antigen level ranging from normal to very weak. Genomic ABO sequencing showed an ABO*A1.01-like allele except for a novel mutation located in intron 5, c.239+4G. The O 2 allele had an additional SNP, c.689G>A, consistent with the ABO*O2.03 allele variant Summary/Conclusions: A previously unreported variant, c.239+4A>G, likely effecting the 5 0 -donor splice site of intron 5 was found in an A weak sample. This type of mutations is expected to decrease mRNA stability and/or cause skipping of the preceding exon in the mRNA. However, small amounts of full-length enzyme might still be made, being able to give rise to the weak A antigen expression seen in this individual. Interestingly, this mutation is very similar to the genetic variant underlying the weak A subgroup A finn . In this case, however, the c. 374+4A>G mutation is located in the 5 0 -end of intron 6 and is predicted to cause partial skipping of exon 6. Strikingly, the A finn phenotype also results in a pseudochimeric pattern by flow cytometry but with only approximately 2% positively staining erythrocytes. Due to the well documented lack of A-allele-derived mRNA in peripheral blood, further transcript studies could not be undertaken. Further studies are needed to investigate the exact mechanisms underlying the pseudochimeric pattern observed by flow cytometry in these two interesting genotypes/phenotypes

Abstract withdrawn. Background: ABO is the clinically most relevant blood group system in transfusion and transplantation medicine. ABO genotyping is potentially useful in clarifying serologic blood grouping discrepancies. This scenario includes inherited subgroups alleles, temporary acquired variant ABO phenotypes in disease or pregnancy, and chimerism due to exchange of progenitor cells early in fetal life or after blood progenitor cell transplantation. Aims: To investigate the molecular basis for ABO discrepancies detected in clinical samples, including donors and patients, sent to our reference laboratory during the past 3 years. Methods: If routine ABO grouping showed weak agglutination or forward vs reverse typing discrepancy, further ABO typing studies were performed manually. Adsorption-elution tests were also performed in some cases with polyclonal anti-A and anti-B to confirm whether A or B antigens were weakly expressed on the RBCs membrane. A PCR approach using sequence specific primers for A2, B, O1 and O2 alleles was used for initial genotype determination. The full ABO coding region was analysed as previously described in selected samples for which ABO discrepancy was still unexplained. Allele specific fragments spanning exon 6, intron 6 and exon 7 were amplified using a forward primer targeting the 261G nucleotide (to exclude O1 alleles amplification) in combination with either B, A2 or a generic reverse primer. Analysis was carried out by Sanger sequencing. Results: A total of 16 samples with suspected inherited ABO subgroup alleles were selected for further molecular studies by sequence analysis. A subgroup alleles: in 8 out of 12 samples with suspected A subgroup alleles, the c.804insG insertion was detected corresponding to the ABO*Ael.01 allele. The ABO*Aw31.02-05 variant, a hybrid A1-O1v allele, was found in 2 cases. In 1 case we found the c.722G>C change, previously reported associated with weak A antigen expression. Finally, a novel c.961C>G change was detected in an A2 allele. B(A) or cis-AB suspected alleles: The ABO*B(A)04 variant carrying the c.640A>G change was found in 1 of 3 samples with BO1 genotype but A weak antigen expression. In the remaining 2 cases, a consensus B allele was detected, thus pointing to a potential chimerism as the cause of the results observed in ABO grouping. Finally, we have identified an ABO*B01.02 allele carrying the nucleotidic change c.926A>G in the context of an ABO phenotype vs genotype discrepancy. Summary/Conclusions: The Sanger sequencing approach applied in this study have proved to be informative and helpful to determine the molecular basis of ABO grouping discrepancies with suspected inherited subgroups. We found mutations, within exon 7 of the ABO gene, in 14 out of 16 samples, including 2 novel alleles. Chimerism was suspected in 2 cases of A antigen expression in samples with B1O1 genetic background carrying an apparent normal B allele. We are evaluating at the moment a deep sequencing approach by Next Generation Sequencing to determine the presence of a small amount of a minor allele in the presence of a large surplus of the other two alleles. Background: Recently, the multiple pregnancy rate has been increasing due to advances in artificial fertilization including in vitro fertilization-embryo transfer. Most dizygotic twins have dichorionic placenta, but 8% of them share the placenta. Monochorionic dizygotic twins can have blood chimerism, leading to double RBC populations in routine ABO serologic typing. Recently, more sensitive and objective column agglutination tests with automated systems are being widely used. Therefore, blood chimerisms in dizygotic twins can be detected more easily by routine ABO blood typing. Aims: We report congenital blood chimerism in monochorionic dizygotic twins of triplets, found incidentally during ABO serological testing and confirmed by ABO genotyping and STR marker analysis. Methods: A 20-year-old male (one of triplets) was admitted to the hospital for medical checkup. He did not have any history of transfusion or bone marrow transplantation. Routine ABO blood grouping test was performed using automated blood bank system IH-500; however, it showed ABO discrepancy. The red blood cells showed double cell populations in a gel column with anti-A and anti-B. We carried out ABO genotyping both from the blood and from a buccal swab. For the further evaluation, we performed ABO serologic testing, ABO genotyping, and STR marker analysis in his family members. Results: Among the triplets, blood chimerism was demonstrated in the patient and his brother. They both showed A 3 B 3 phenotypes in the serologic test and tri-allelic ABO genotypes in the blood, A102/B101/O01. However, in buccal swabs, the patient showed A102/O01 and his brother showed B101/O01. Other members of the family (father, mother, and dizygotic sister) had regular ABO blood types in the serologic test. We performed STR analysis in the triplets and parents. Eleven loci (D8S1179, D21S11, D7S820, CSF1PO, TH01, D13S317, D16S539, D19S433, D18S51, D5S818, and FGA) revealed more than one additional allele in the blood sample, apart from those in the buccal swabs. STR marker analysis showed that his brother too had blood chimerism. Summary/Conclusions: We found blood chimerism in monochorionic dizygotic twins of triplets during routine ABO blood typing, and this was confirmed by STR analysis. As the application of assisted reproductive technology increases, the incidence of blood chimerism will also increase. Blood chimerism can often create confusion during ABO serologic typing and microchimerism can be overlooked in routine methods. Therefore, it is helpful to use an automated blood bank system to improve sensitivity and blood chimerism should be considered if ABO blood grouping reveals double populations. Background: Expression of ABO transferase genes can be affected by genetic variants located within the coding sequence, at splice junctions, in the proximal promoter and in the intron 1 enhancer. Here we describe five new alleles with singlenucleotide substitutions found in samples with discrepant or unusual ABO serology. Aims: To resolve serological discrepancies or unusual serological findings in the ABO blood group system by molecular methods, in particular by Sanger sequencing. Methods: Forward and reverse ABO phenotyping was performed by the gel or tube methods. Genomic DNA extracted from whole blood was PCR amplified to cover the entire ABO coding sequence, splice junctions, proximal promoter and intron 1 enhancer. Amplification products were Sanger sequenced directly or after cloning in a bacterial host. Results: Case #1 is a patient with an unclear ABO phenotype: Forward type B, reverse type AB. Sequencing of genomic DNA and cloned ABO exon 7 detected variant c.29-5T>G in heterozygosity on an otherwise common A1 allele, and in trans an ABO*B.01 allele. Case #2 is a caucasian donor with an ABO discrepancy: Forward type Aweak/O, reverse type A. Sequencing also detected variant c.29-5T>G in heterozygosity on an A background, and in trans an ABO*O.01.01 allele. Given that this variant is located near the intron 1 splice acceptor site, ABO*29-5G transcripts are postulated to undergo altered splicing, leading to an Aweak phenotype. Case #3 is a prenatal sickle-cell disease patient with an ABO discrepancy: Forward type Aweak, reverse type A. DNA sequencing detected variants c.467C>T (Pro156Leu) and c.709T>A (Tyr237Asn), both in heterozygosity on an otherwise common A1 allele, with an ABO*O.01.01 allele in trans. Thus, the data establish an association of allele ABO*467T,709A with an Aweak-like phenotype. Case #4 is a donor with an ABO typing discrepancy: Forward type O, reverse type A. Sequencing detected variant c.479C>G (Pro160Arg) in heterozygosity on an A2 background, and in trans an ABO*O.01 allele. An interpretation of the data is that variant c.479C>G weakens the activity of the A2 transferase, with allele ABO*A2(479G) encoding the Aweak-like phenotype detected by serology. Case #5 is a 9 year-old patient with an ABO discrepancy: Forward type O, reverse type AB. Sequencing of genomic DNA and cloned ABO exon 7 detected variant c.803G>C (Gly268Ala) in heterozygosity on an A2 background, and in trans an ABO*O.01.02 allele. The serology and molecular results suggest that allele ABO*A2(803C) encodes a cisAB weak phenotype. Case #6 is a caucasian donor with an ABO typing discrepancy: Forward type O with a weak agglutination with anti-AB, reverse type O. DNA sequencing detected variants c.739G>A (Glu247Lys) and c.871G>A (Asp291Asn), both in heterozygosity, in trans, and on A1 backgrounds. Variant c.871G>A by itself constitutes allele ABO*A3.01. The phenotype encoded by ABO*739A is uncertain. Summary/Conclusions: Molecular characterization of ABO alleles can help in their future identification and discrepancy resolution. Background: Expression of ABO transferase genes can be affected by genetic variants located within the coding sequence, at splice junctions, in the proximal promoter and in the intron 1 enhancer. Here we describe five new alleles with singlenucleotide substitutions found in samples with discrepant or unusual ABO serology. Aims: To resolve serological discrepancies or unusual serological findings in the ABO blood group system by molecular methods, in particular by Sanger sequencing. Methods: Forward and reverse ABO phenotyping was performed by the gel or tube methods. Genomic DNA extracted from whole blood was PCR amplified to cover the entire ABO coding sequence, splice junctions, proximal promoter and intron 1 enhancer. Amplification products were Sanger sequenced directly or after cloning in a bacterial plasmid vector. Results: Case #1 is a 35 year-old pregnant female with an ABO typing discrepancy: Forward type O, reverse type A. PCR-RFLP predicted ABO*A1/ABO*O1. Sequencing detected variant c.107insG (Val36Gly>fs56Ter) in heterozygosity on an otherwise common A1 allele, and in trans an ABO*O.01.01 allele. It is unclear how the early truncation of the A1 transferase encoded by allele ABO*107insG still allows for some residual enzyme activity, as suggested by the reverse A type. Case #2 is a recently-transfused 72 year-old black patient with an unresolved ABO type. Sequencing detected variant c.297A>G (silent) in homozygosity and variant c.1049C>T (Ala350Val) in heterozygosity, both on an O1 background, with an ABO*B.01 allele in trans. Although variants c.297A>G and c.1049C>T are likely of no consequence to the ABO phenotype of this patient, they are reported here as components of a new ABO*O1(297G,1049T) allele. Case #3 is a 40 year-old prenatal female with a RhD typing discrepancy. Failure to yield an ABO genotype on Blood-Chip (Progenika), a genotyping microarray that interrogates polymorphic positions in RHD and ABO, prompted DNA sequencing. Sequencing of genomic DNA and cloned ABO exon 7 detected variant c.436C>T (Arg146Cys) in heterozygosity on an ABO*B allele background, and in trans an ABO*O.01.01 allele. The phenotype encoded by allele ABO*B(436T) is predicted to be B, as evidenced by forward typing on Immucor NEO and reverse manual typing. Case #4 is a prenatal black patient with an ABO typing discrepancy: Forward type O in gel, A 2+ mixed field (mf) in tube. Reverse type on A1 cells 1+ in gel, 0/1+ in tube. Sequencing of genomic DNA and cloned PCR products covering exons 6-7 detected variant c.784G>C (Asp262His) in heterozygosity, and in trans an ABO*O.01.09 allele. Case #5 is the newborn baby of case #4, with a forward type A 1+ mf in gel, A 3+ mf in tube. Sequencing of the baby's DNA detected variant c.784G>C (Asp262His) in heterozygosity, and in trans an ABO*B.01 allele. From these results it is inferred that the phenotype encoded by allele ABO*784C is A3-like. Case #6 is an 18 year-old hispanic donor with an ABO typing discrepancy: Forward type A, reverse type O. Sequencing of genomic DNA and ABO exons 5-6 and 6-7 detected variant c.979C>T (Gln327Ter) in heterozygosity, and in trans an ABO*O.01.02 allele. The truncation of the A1 transferase at such a relatively late position is consistent with the retention of some enzyme activity, explaining the forward A type encoded by allele ABO*979T. Summary/Conclusions: Molecular characterization of ABO alleles can help in their future identification and discrepancy resolution. Background: Expression of ABO transferase genes can be affected by genetic variants located within the coding sequence, at splice junctions, in the proximal promoter and in the intron 1 enhancer. Variants reported to date in the intron 1 enhancer include large deletions, small deletions and single-nucleotide substitutions.

Here we describe four new alleles with single-nucleotide substitutions found in samples with discrepant or unusual ABO serology. Aims: To resolve serological discrepancies or unusual serological findings in the ABO blood group system by molecular methods, in particular by Sanger sequencing. Methods: Forward and reverse ABO phenotyping was performed by the gel or tube methods. Adsorption-elution by the heat elution method and testing for H and A substances in saliva were performed by following the procedures in the AABB technical manual. Genomic DNA extracted from whole blood was PCR amplified to cover the entire ABO coding sequence, splice junctions, proximal promoter and intron 1 enhancer. Amplification products were Sanger sequenced directly or after cloning in a bacterial plasmid vector. Background: Inactive alleles of the FUT1 could be decreased or aborted the activity of the fucosyltransferase, which results in to form the Bombay or para-Bombay phenotype with weak or no H antigen expression on erythrocytes. Now many para-Bombay individuals have been found in the Chinese population. According to names for H blood group alleles v5.1 170221 of Red Cell Immunogenetics and Blood Group Terminology working group of the ISBT, 55 FUT1 alleles were identified for Bombay or para-Bombay phenotype around the world. Aims: The study was explored the distribution of FUT1 alleles for the 19 Chinese individuals with Para-Bombay phenotype. Methods: The samples were come from the blood donors or the patients. The A, B, H antigens were determined using conventional serological method according to the manufacture's instruction. The sequences of the full coding region for FUT1 was amplified, then amplicon was purified with enzymes digestion and used as template for sequencing bidirectionally. All nucleotide sequences obtained were analyzed and compared with standard FUT1 sequence. Results: Nineteen Chinese individuals with Para-Bombay phenotype were identified. Ten of them were the donors and nine individuals were come from the hospital. The RBCs had a very weak agglutination reaction with anti-H in the most of the individuals. FUT1 homozygous mutations were found in the 12 individuals and FUT1 heterozygous changes were existed in 7 individuals after bidirectionally sequencing. .05%, 7.89%, 5.26%, 5.26%, 5.26%, 2.63%, 2.63%, 2.63% respectively in the 19 individuals with Para-Bombay phenotype. According to our previously reports, the fucosyltransferase activity of FUT1*01N.06(c.551_552delAG), FUT1*01W.09 (c.658C>T) and FUT1*01W.01 (c.293C>T) were abolished in vitro assay, while FUT1 mRNA levels of them had no effect compared with wild type. Summary/Conclusions: The FUT1 mutations in the Para-Bombay individuals were various. The most common FUT1 allele in the Chinese individuals with Para-Bombay phenotype was FUT1*01N.06(c.551_552delAG). Background: The regulatory mechanism of the ABO gene is complicated and has been investigated extensively.Variation in A antigen expression was recognized very early in the twentieth century and the A blood group was divided into A1 and A2. Later the A blood group was subdivided further based on characteristic reactivity with human polyclonal antisera, i.e., strength of reactivity and presence of mixed field agglutination; presence of anti-A1, and whether A or H blood group substance was present in the saliva of secretor subjects. Mutations critical for ABO blood group phenotypes have predominantly been found in exons 6 and 7 of the ABO gene, both of which encode the catalytic domain of ABO glycosyltransferase. In our case report we show how mutation ranging from single nucleotide in the intron 1 enhancer element can alter the efficacy of enzyme and alter antigen expression. Aims: This study aims to investigate the molecular basis of discrepant results of ABO forward/reverse typing in blood donor. Methods: The ABO typing was performed using tube technique and column agglutination tests (Bio-Rad, Grifols). Standard tests were completed with adsorption-elution study using O plasma as a source of anti-A, and with saliva testing for presence of A and H substances. We performed quality control for these methods. ABO group genotyping was performed using PCR with sequence-specific primer by commercial kit (ABO-variant; BAG Healthcare, Lich, Germany). PCR-amplified exons and intron 1 enhancer were subject to bi-directional DNA sequence analysis using standard Sanger dideoxy chemistry. Seqscape software (ABI) was used to analyze sequence data by comparing the obtained sequence to a reference sequence from NCBI. Results: Standard serological forward tests identified blood group O, however, only anti-B iso-agglutinins were present. Anti-A in adsorption-elution study was successfully adsorbed and eluted from the investigated cells. A and H substances were detected in saliva. ABO genotyping using PCR-SSP indicated genotype O1v/A 1 . DNA sequence analysis showed result ABO*A01 (28+5859A), ABO*O.01.02. The specimen was revealed as an A subgroup, probably A m with an unusual genetic variant in the intron region of the ABO gene, the enhancer of the gene expression. Summary/Conclusions: We report the first case of ABO*A01(28+5859A), the mutation located in the enhancer region of gene expression in allele A, that causes discrepant results not only in ABO forward/reverse typing but also in molecular blood grouping tests. Based on our serological findings, this subgroup is considered as A m . Background: A chimera is a single organism composed of cells with distinct phenotypes and/or genotypes. Several different types of chimeras are described: artificial, twin and dispermic. The artificial chimerism can be seen following hematopoietic stem cell transplantation, or more transiently following blood transfusion. The second type may also be inherited most commonly through blood exchange in utero between twins. Dispermic chimerism is induced by the fertilization of two maternal eggs with two spermatozoa and their fusion into one body. This one is also called tetra-gametic chimerism. In transfusion medicine, chimeras are often detected when mixed field reactivity is observed in ABO/D typing or, less commonly, when phenotyping for other blood group antigens. Aims: This investigation was prompted by finding a double population of erythrocytes in a surgery patient with no transfusion history. Our aim was to investigate the chimera and determine the underlying ABO genotype of this patient. Methods: Routine blood grouping was performed by column agglutination. Separation of the double cell populations was performed by differential agglutination with IgM anti-D (immuClone, anti-D fast IgM, clone: D175-2, Immucor). Initial ABO genotyping was performed by PCR-SSP (FluoGene; Inno-train Diagnostik GmbH); further resolution was performed using in-house PCR-ASP and PCR-RFLP methods. Next generation sequencing (Monotype ABO; Omixon using Illumina sequencing platform) and Sanger sequencing analysis were also performed. Identification of reference alleles was investigated by fragment analysis of Short Tandem Repeats (STR) polymorphisms. Results: Double population was found in column agglutination in tests with anti-A and anti-AB, and subsequently when typing for D and C antigens, with approximately 85% of O D+C+ cells. The patient's genotype was identified as ABO*O.01/*A by CE-certified PCR-SSP kit (FluoGene). Routine PCR-ASP and PCR-RFLP could not resolve the patient's genotype Possible ABO*A1/*O1 genotype was detected by PCR-RFLP, but the PCR-ASP analysis gave an apparent ABO*A1 homozygote result. Sanger sequencing of ABO exons 6 and 7 also gave anomalous reactions: no ABO*A allele was detected. Homozygosity for c.261delG was observed as well as heterozygosity for c768C/A. This result therefore suggests the patient's genotype is ABO*O.01/*O.01.26. Next generation sequencing (Omixon) revealed the same result. However, when PCR amplification of the CBF/NF-Y enhancer VNTR 3 0 -region was performed, possible heterozygosity was observed, i.e. a weak band representing a single copy, and one representing 4 copies of the enhancer region were present. Presence of a single copy of the 43-bp CBF/NF-Y enhancer VNTR region is unique Background: DEL is a very weak form of D antigen with low density expression of D antigen on the surface of red blood cell, which is generally typed as D-blood group as couldn't form agglutination in routine RhD blood group testing and could only be detected by the non-routine adsorption-elution test. In the East Asian and Southeast Asian population, 9-30% of the individuals with serologically apparent D-phenotype are not these with truly D-phenotype, but DEL phenotype, which is very rare in Caucasian and Black ethic groups. And the RHD*01EL.01 (RHD*1227A) is most prevalent (>99%) in DEL people in these regions, so the DEL carried this allele was commonly known as "Asia type" DEL. In previous studies, no alloanti-D was observed in a large cohort of Chinese "Asia type" DEL pregnant women with D+ fetus to indicate no occurrence of alloanti-D immunization against D+ red cell in "Asia type" DEL individuals. Aims: To conduct genotyping analysis in the Chinese patients having serologically apparent D-phenotype simultaneous with alloanti-D to confirm the existence of the "Asia type" individuals to produce alloanti-D or not. Methods: From 2017 to 2018, the blood sample of the patients or pregnant women identified with alloanti-D in our reference lab were collected. D antigen was confirmed again using the blend anti-D reagent (Clone TH-28/MS-26, IgM/IgG) by tube method in saline and indirect antiglobulin test (IAT) in gel card. The zygosity of RHD gene was detected by hybrid rhesus box PCR with PstI digestion. For the samples with D or DD genotypes obtained by RHD zygosity analysis, multiplex ligation-dependent probe amplification (MLPA) genotyping was conducted for RHD genotyping analysis.

Results: A total of 129 serologically apparent D-Chinese patients (female, n = 128; male, n = 1) with alloanti-D were identified. Different titers of alloanti-D from 1:2 to 1:4096 (≤1:16, n = 60; >1:16, n = 69) were detected including few cases with mixed antibodies (anti-D mixed with anti-C, n = 11; anti-D mixed anti-E, n = 5). Serological RhD typing confirmed the serologically apparent D-phenotype. RHD*01N.01/01N.01 (homozygous RHD gene deletion) genotype was identified in majority of them (123/129, 95.3%) by RHD zygosity analysis, while RHD*01N.03/ 01N.01 genotype (n = 5) and RHD*01N.05/01N.01 genotype (n = 1) carried the RHD non-functional hybrid alleles were detected by MLPA. Summary/Conclusions: Compared with the distribution of average 25% frequency of "Asia type" DEL in serologically apparent Dpopulation in Guangzhou of China, no one case of "Asia type" DEL was identified in the cohort of serologically apparent D-patients with alloanti-D in this study. This also provides evidence to confirm no occurrence of alloanti-D immunization in "Asia type" DEL individuals. Aims: A serologically RhD-negative donor was found to be RHD-positive in the routine RHD screen. To solve the discrepancy between serology and molecular screen, the sample was sequenced on DNA and RNA level. Methods: Phenotyping on ID/IAT-cards (Bio-Rad) was done using commercial anti-D antibodies. The adsorption-elution analysis was performed using an in-house pool of polyclonal anti-D antibodies. Furthermore an antibody D-screen was performed (DIAGAST). For RHD genotyping RH-TYPE and Partial D-Type assays (BAG Health Care) were carried out. The sample was further characterized by exon sequencing including flanking intronic regions. RNA was extracted from whole blood, reverse transcribed and the cDNA sequenced. For amplification and sequencing, both published (Gassner, Transfusion, 2005; Legler, Trans. Med., 2001; Richard, Transfusion, 2007) and in-house primers were used. Results: Repeated phenotyping of the sample with commercial as well as, in-house anti-D antibodies confirmed the RhD negativity. In addition, the adsorption-elution analysis showed a negative result. However, genotyping, using commercially available kits, yielded a RHD positive result and no variants were detected. To investigate this discrepancy, all 10 RHD exons were sequenced. The sequencing data revealed the mutation c.148+2delT in the splice donor site of exon 1. To confirm the effect of the splice site mutation on transcription, RNA from a fresh whole blood sample was analysed. As a positive control, GYPB was amplified and sequenced from the same cDNA. Wild-type GYPB (MNS4) was found. With RHD specific primers, no product could be amplified. Summary/Conclusions: We present a serologically RhD negative case, that was identified as RHD positive by standard commercial genotyping kits. Sequencing revealed the new splice site mutation c.148+2delT. RNA sequencing yielded no detectable product. The donor was classified as RhD negative. This case of a discrepant result between serology and genetics shows the importance of a profound and highly sophisticated genetic investigation of conflicting laboratory results.

J Stettler, S Lejon Crottet, H Hustinx, C von Arx, F Still, J Graber, C Niederhauser and C Henny

Interregional Blood Transfusion SRC Berne Ltd., Berne, Switzerland

Background: One of the most immunogenic and clinically significant blood group antigens in transfusion medicine is the RhD antigen. Variant RhD phenotypes with weakened or absent antigen expression pose a challenge for RhD status assignment in blood donors. To ensure patient safety, it is necessary to fully characterize these variants at the molecular level. Aims: Samples from two donors were investigated in our laboratory due to discrepancy in RhD typing.

Methods: Rh blood group phenotyping was done by standard serological column agglutination testing (ID-system, BioRad). Further RhD characterization was performed by an anti-D antibody panel containing 9 monoclonal antibodies (D-Screen, Diagast) and an adsorption-elution test using an in-house pool of polyclonal anti-D antibodies. Molecular investigation was initially performed by SSP-PCR detecting common RHD variants (RBC-Ready Gene CDE Inno-Train; RH-TYPE BAG Health Care). RHD sequencing was done on either DNA or RNA using published and inhouse primers for amplification and sequencing.

Results: By tube testing, the RBCs of Donor 1 were predicted to be RH:-1,-2,-3,4,5. However, all ten exons of the RHD gene could be detected by routine genotyping. Sequencing of RHD revealed a homozygous mutation C>G at position 1151 which is the second last nucleotide of exon 8 and thus might have an influence on exon splicing. By cDNA analysis a transcript with a correctly spliced exon 8 was identified. The mutation c.1151C>G leads to the amino acid substitution T384R located in the twelfth transmembrane domain of RhD using the model of Flegel (Transfus Apher Sci., 2011) as reference. Adsorption-elution testing using a pool of polyclonal anti-D showed a weak positive reaction, re-classifying the donor as RhD positive. This novel allele, RHD*1151G, could thus be categorized as a DEL allele. Serological results displayed an almost normal RhD antigen expression for Donor 2.

Further serological determination of the RhD antigen with 9 different antisera, however, showed a reaction pattern typically observed with a weak D variant. With commercial available kits no RHD variant could be detected. RHD sequencing revealed a novel homozygous mutation c.526G>C in exon 4. This mutation causes a p.A176P exchange in the sixth membrane-spanning domain of RhD. Based on serological data, the donor is RhD positive and in case of transfusion the patient would be treated as RhD negative. Summary/Conclusions: Here we report two novel RHD missense mutations c.1151C>G and c.526G>C harbouring an amino acid substitution within a transmembrane segment. The c.1151C>G variation displayed an unusual low RhD antigen reactivity and would have been mistyped as RhD negative without extensive genotypic testing. Molecular analysis of variant c.1151C>G suggests that the T384R exchange causes a DEL phenotype rather than a miss splicing event. This was also confirmed by adsorption-elution testing. Interestingly, variant c.526G>C could only be detected due to comprehensive serological and genetically investigation. Background: The Rh blood group system is highly polymorphic and one of the most clinically relevant systems in transfusion. Actually D antigen is of critical importance due to its involvement in hemolytic transfusion reaction and hemolytic disease of the fetus and newborn. RHD gene variants are common in Africans and mostly related to partial D phenotype. Aims: RHD gene sequence was investigated in two African Brazilian samples. We further attempted to take advantage of combining the molecular data and the available in silico tools for the functional interpretation of the variations, in order to get insights into the clinical phenotype that may be predicted a priori from genotyping.

Methods: Sample #ID1 is a D-negative donor self-declared as African descent. Sample #ID2 is a patient with sickle cell disease (SCD) typed as D-positive with anti-D in his serum. Serologic D typing was determined by manual gel test and by microplate in an automated instrument. Sample #ID1 was also submitted to adsorption/elution test. After genomic DNA extraction, all ten RHD exons and flanking intronic regions from sample #ID1 were PCR-amplified with RHD-specific primers and analyzed by Sanger sequencing. Sample #ID2 was investigated by next-generation sequencing on the MiniSeq platform (Illumina) by using a previously published, custom (selected blood group genes) AmpliSeq panel. A reported three-dimensional (3D) structural model of the RhD-RhD-RhAG heterotrimer was used to visualize the position of variations and predict their putative functional/clinical effect. Results: In sample #ID1, a single nucleotide missense change, i.e. c.1151C>G in exon 8, was identified. This transversion is thought to replace a threonine by an arginine residue at amino acid position 384 (p.Thr384Arg) of the RhD protein. Analysis in the 3D model clearly suggests a dramatic impact of the p.Thr384Arg substitution occurring in a functionally-critical, conserved motif in terms of interhelix interaction, which is supposed to be highly deleterious to the stability of the protein, and potentially impairs totally its expression at the red blood cell plasma membrane. This predicted functional effect is definitely in accordance with the D-negative phenotype reported in sample #ID1. In sample #ID2, the single c.325A>G transition was found in exon 2 leading to a threonine-to-alanine substitution at amino acid position 109 (p.Thr109Ala). Amino acid 109 is located in RhD protein extracellular loop 2, and is thus thought to alter D antigen structure, resulting in a partial D phenotype. This hypothesis is in accordance with anti-D found in the serum of sample #ID2. Summary/Conclusions: For the past years, due to the advent of next-generation sequencing and the subsequent identification of numerous rare variants, bioinformatics prediction and modelling tools have evolved and currently help physicians in diagnostics, clinical management and genetic counselling. We took advantage of some of those in silico methods to predict retrospectively the effect of two novel variant RHD alleles, including one D-negative and one partial D alleles. Although phenotype and clinical symptoms remain definitely the standard determinants to assess the effect of genetic variations, use of those approaches may soon become valuable for guiding subsequent investigations in immunohaematology.

Abstract withdrawn. alleles of the weak D type 4 and DIVa cluster. In Africans, the 16 most frequent were typically associated with alleles of the weak D type 4 (including DOL and RHDpsi), DIVa and DAU clusters with F223V occurring in > 10% of alleles; in addition the key mutations of weak D type 1 and DII and two inactivating mutations (c.1056_1057insT and c.1060delG) not reported in RHB were among the first 20 polymorphisms. In East Asians, RHD(1227G>A) at 0.8% was most frequent, followed by DFV, weak D type 33, DBO-3, key mutations of DIVa and weak D type 4 cluster as well as RHCE-like substitutions and the mutations of weak D type 25, type 15, type 66, RHD(A85V), DVL-1, weak D 119 and RHD(N135S). Weak D type 151 and RHD(T148R) were frequent in South Asia but not elsewhere. Summary/Conclusions: Data from TGP and gnomAD add relevantly to the knowledge on RHD alleles; TGD discloses linked intron polymorphisms, gnomAD frequency data not biased by the likelihood of serologic detection. Current typing strategies usually start with serology later complemented by molecular typing. In the future, molecular methods will gain importance and frequent alleles currently not distinguished from "standard RhD" may need a rational transfusion strategy. In this respect, the high frequency of weak D type 45 and type 33 in Europeans was surprising, might warrant confirmation by alternative methods and should trigger discussion on rational transfusion strategies for these alleles. consistent with an R 0 haplotype and 1 probable Dc-. Two siblings that were ABO compatible including the Dc-sibling were incompatible at IAT phase. Reactivity could be completely adsorbed from the serum using R 1 R 1 , R 2 R 2 , and rr RBCs indicating the antibody is probably a single specificity. The donor returned in 2015 and 2017 to continue autologous donations. The aim of this case study was to examine the genetic framework of the RHD and RHCE genes and to characterize the Rh epitope recognized by the antibody. Aims: The donor returned in 2015 and 2017 to continue autologous donations. The aim of this case study was to examine the genetic framework of the RHD and RHCE genes and to characterize the Rh epitope recognized by the antibody. Methods: Serologic testing was performed by manual tube testing using AHG in the indirect antiglobulin phase. RBC phenotyping was performed by standard tube hemagglutination testing from EDTA anticoagulated blood. RHD and RHCE exons were sequenced using genomic DNA and standard Sanger dideoxy method with the BigDye Terminator v3.1 Cycle Sequencing Kit. Sequence data was aligned to RHD_NG_007494.1. RHD zygosity was performed using PCR-RFLP with MspI. Background: According to recent findings in molecular immuno-hematology, RHD genotyping is strongly indicated in RhC+ and RhE+ donors classified in routine as D-negative. Among these, one could find a non-negligible share of entirely new genetic alterations or even DEL alleles, which are often not identifiable with routine serological methods due to the low number of antigenic sites. Aims: The present study reports the genotyping data of RHD on 201 RhC+ and RhE+ Caucasian donors classified serologically as D-negative, all enrolled by a single transfusion center in Italy Methods: RhD serological typing was carried out in microplate direct agglutination tests (IRIS, Immucor) by using 2 different anti-D IgM clones (Clone 1, DVI+: LDM1+ESD1M; Clone 2, DVI-: RUM-1, TH28) and 2 different anti-D IgG clones (Clone 1: MS26; Clone 2: D415 1E4). All donors with D-negative results (N = 201, divided into 153 subjects with RhC+, 45 with RhE+ and 3 with both RHC+ and RhE+) were addressed to genotype analysis with RHD BeadChip Molecular Test (Immucor), PCR-SSP (BAGene, Inno-Train) and/or RBC-FluoGene (Inno-Train). The discrepant results between serology (D-neg) and molecular biology (wild-type or full-length RHD gene) were further investigated by bi-directional sequencing of the RHD coding regions. Results: One-hundred donors have been analyzed retrospectively, as part of a pilot study. Following the data obtained in this first phase, the analysis methods described above have been implemented in routine, allowing to include further 101 donors, studied prospectively. In 92.5% of donors (N = 186), the molecular analyses showed the complete deletion of the RHD locus, while in 15 cases (7.5%) a genetic status was found with "non-deleted" RHD. Over all, bi-directional sequencing on these 15 donors revealed the presence of 9 negative and 4 Weak-D variants. The list of RHD alleles we have identified at the molecular level is as follows: RHD*01N.82 (2 cases), RHD*01N.83 (1), RHD*01N.80 (1), RHD*01N.61 (1) , RHD*01N.05 (3), RHD*01EL.08 (1), RHD*01EL.18 (1), RHD*01EL.17 (1), RHD*01W.54 (1) . Moreover we found a donor with a lack of signal encompassing exons 1-5 of the RHD sequence (BioArray RHD BeadChip), while 2 additional cases are currently under investigation.

Summary/Conclusions: Our study confirms that a non-negligible number of Caucasian subjects, classified serologically as D-negative, present RHD gene alterations that differ from the common total deletion. In line with the literature data, we also found a frequency of about 1 in 50 cases (4 subjects out of 201), in which a donor re-classification as D-positive (weak D type) was necessary. Hence, a wider use of molecular typing methods is desirable in order to achieve the correct genetic characterization and the appropriate phenotypic classification of "apparently" D-negative donors. Background: Without evidence of abnormal serological D antigen expression there will be no quest for weak D, partial D or D variant on the red blood cells. According to our blood donor registry we found that out of 43960 serologically typed donors, 85.5% were D+, 14.0% D-and 0.5% weak D. Aims: To compare different weak serological reactions of the D antigen to the RHD genotyping. Methods: Molecular RHD typing using isolated DNA and RBC-Ready Gene CDE and RBC-Ready Gene D weak kits was performed in 22 blood donors, who were serologically typed as weak D using monoclonal blended IgM/IgG and DVI-and DVI+ anti-D reagents by slide and microplate (MP) technique respectfully, as well as by the antiglobulin test (IAT) in gel and with the set of monoclonal partial D typing reagents (BioRad). In addition, RhCcEe phenotyping and genotyping was also performed. Results: All of the donors with serologically weak reactions were confirmed to be weak D variants by genotyping except one donor whose IAT was false positive due to RBC autoantibodies. The frequency of D variant genotypes was as follows: 62% weak D type 1, 28% weak D type 3, one donor was typed as weak D type 14 and another one as weak D type 11. These weak D types were associated with different degrees of serologically determined weakness ranging from negative to weak positive reactions concerning slide and MP. All of them gave positive reaction ranging from 2+ to 4+ with IAT, except for the weak D type 11 with the score of <1+ which gave negative reaction by slide and MP and inconclusive result with the set of monoclonal anti-D reagents for partial D typing. The percentage of donors, who, at serological typing were only found to be D positive in the IAT was 19%. One of the weak D type 1 donors was negative with DVI-and positive with DVI+ reagent in the MP. The additional Rh phenotype (genotype) was Ccee in all of the donors except in the one who was genotyped as weak D type 14, as well as in the D negative donor, being ccee. Summary/Conclusions: Further RHD genotyping is required to estimate the actual frequency of D variants in our blood donors. In practice, current serological methods are sufficient to detect almost all variant D phenotypes. There is a consensus that routine molecular D antigen screening in D negative donors in order to detect DEL variant when ddccee phenotyped red blood cell transfusion is practiced in all D negative patients does not seem to be cost-effective. Background: Rh null or Rh mod -the so-called Rh-deficiency phenotypes-are characterized by a null or severely reduced RH antigen expression (including D, C/c and E/ e), respectively. Molecular genetic studies showed that these phenotypes are transmitted in an autosomal recessive manner. Rh null phenotype originates from two different molecular events giving rise to the amorph type and the regulator type. The former is caused by homozygosity for silent genes at RHD and RHCE loci, caused by inactivating mutations in RHCE and deletion of RHD. On the other hand, the regulator Rh null type as well as the Rh mod phenotype are attributed to mutations in RHAG gene when in homozygous state or when in heterozygosity with another RHAG allele containing an inactivating mutation. A functional RhAG is essential both for the correct Rh complex assembly and Rh antigen expression in the erythrocyte membrane.

Aims: The aim of this study was to investigate the molecular genetic basis of an Argentinean proband with no detectable D, C, c, E and e antigens by standard serological techniques.

Methods: Blood samples were collected from the proband, her parents and sister. The proband was a 14 year-old young woman with parameters of hemolytic anemia: low hemoglobin level (10 g/dL), reticulocytosis (14%), hyperbilirubinemia, increased LDH and marked spherocytosis. The D, C, c, E and e status was determined by standard serologic hemagglutination techniques using specific monoclonal antibodies. Genomic DNA was isolated using a modified salting-out method. DNA samples were initially screened for the presence of intron 4 and the 3 0 untranslated region of the RHD gene using PCR strategies. RHC/c, and RHE/e alleles were studied by allele-specific PCRs to determine the RHCE genotype. RHD zygosity was analyzed by PCR-RFLP. RHD exon polymorphisms were studied by RHD exon scanning procedure based on PCR-SSP. RHAG gene was investigated by exon-specific PCR amplification and Sanger sequencing. Results: No D, C, c, E and e antigens were detected in the proband's erythrocytes.

The father and sister Rh phenotype was: D+, C+, c+, E+, e+ whereas the mother Rh phenotype was: D+, C+, c-, E-, e+. RH genotyping confirmed the Rh phenotypes for all family members except for the proposita who genotyped RHD+, RHC+ and RHe+.

All samples showed an homozygous status for the RHD gene and all RHD exons were detected by exon scanning. Sequencing analysis revealed an homozygous c.920C>T mutation in RHAG exon 6 in the proband whereas the rest of the family showed an heterozygous state in the same nucleotide position. The c.920C>T mutation is responsible for the p.Ser307Phe amino acid substitution predicted to be in the 10 th RhAG glycoprotein transmembrane segment. Summary/Conclusions: This study described the molecular background responsible for an Rh-deficiency phenotype in an Argentinean proband. We identified the novel missense mutation c.920C>T in the RHAG gene which results in the Ser to Phe single amino acid substitution that shows to be critical for Rh antigen complex assembly within the erythrocyte membrane. Further studies are being performed in order to determine whether the proband is Rh null or Rh mod . Background: Rh blood group system is the most immunogenetic blood group system and blood donor typing should account for all expressing antigens in order to prevent anti-D alloimmunization. Aims: The objective of this prospective study was to investigate RHD alleles among blood donors who typed D-by serologic methods and positive for C and/or E. For this reason we developed an easy-to-perform DNA-based screening method for the detection of RHD gene and positive samples were further characterized by two commercial PCR-SSP kits. Methods: Of 15692 individual blood donors within a 15 month period, 1688 (10.76%) typed as D-with standardized immunohematologic methods including the indirect antiglobulin test (IAT). Residual EDTA-anticoagulated blood samples were used to isolate genomic DNA using the QIAamp DNA Blood Kit (QIAGEN, Germany) from 112 out of 151 (8.95%) C/E+ and serologically D-donors. All DNA samples were tested individually for the presence of RHD-specific DNA sequences in the RHD promoter, intron 4, exon 7 and exon 10 by a multiplex PCR-SSP method. The reaction was conducted in a final volume of 20 lL with primers that were applied as described by F. Wagner et al. (BMC Genetics, 2001 ) except antisense primer for exon 10 and the two primers amplifying an HGH gene fragment as internal control, designed by our laboratory. PCR products were visualized by electrophoresis on a 4% agarose gel with ethidium bromide staining. In case of a positive reaction the sample was analyzed by PCR-SSP D weak and PCR-SSP CDE (Inno-train, Germany). Results: Out of 112 D-individuals analyzed, 101 were ddCcee, 8 ddccEe, 2 ddCcEe and one had a ddCCee phenotype. Molecular analysis showed that 104 (92.86%) were negative for all four RHD DNA regions. Among the other 8 samples, all of ddCcee phenotype, three were found to be positive for RHD promoter, intron 4, exon 7 and exon 10, three for RHD promoter and exon 10, and two for exon 10 alone. Further genotyping revealed five hybrid RHD-CE-D alleles [3 RHD-CE(2-9)-D and 2 RHD-CE(3-7)-D], one allele represented the DEL(M295I) genotype, while the remaining two samples did not show an allele that could be determined with the PCR-SSP kits. Summary/Conclusions: Serotyping is the standard method to assign transfusion strategies but it is not always capable to correctly define all samples that show weak reactions in D. A RHD genotyping strategy is needed to confirm D-blood donors and thus to avoid anti-D immunizations. For these reasons we suggest the implementation of an easy and possible cost-effective method. Background: More than 100 weak D types have been described to date. Transfusion recipients with weak D type 1, 2, or 3 are not at risk for forming allo anti-D when exposed to conventional Rh D-positive RBCs. Molecular analysis of weak D offers a more reliable basis than serotyping to determine the prevalence of weak D types and optimal D transfusion strategies. Background: The D antigen, which consists of a mosaic of epitopes, is determined in all the blood donors and patients. Most people are either RhD-positive or RhDnegative, but there is a certain number of people who have a variation of the D antigen, which are called weak D, partial D and DEL phenotypes. Aims: The objective is to use molecular methods to determine whether blood donors in Republika Srpska (with whom a serological weak D antigen has been detected) really have the weak D antigen. In addition, determine whether blood donors, who have been determined as persons who are RhD-negative, with the phenotypes C and/ or E, who have the RHD gene and D antigen on the erythrocyte membrane, so weak that it could not be determined by serological techniques.

Methods: Blood samples were used from regular blood donors, who have been determined as persons with a weaker D antigen, as RhD-negative or as C and/or E positive (based on the agglutination strength) using serological techniques, the test tube method, the microplate method and the gel method. GP.Mur was also modelled and shown to closely resemble the tertiary structure of glycophorin A. The predicted structure is 5 anti-parallel b sheets arranged in a "b barrel" also referred to as an OB-like-fold. The regions in which blood group antigens were identified in the predicted stable dimeric structure. Summary/Conclusions: OB-like-fold structures typically to bind oligonucleotides or oligosaccharides and are associated with cold shock proteins. Further modelling is in progress to predict the structure of GPA/GPB heterodimers as a basis for understanding the presentation of blood group antigens. Of interest, this finding is consistent with a previous report showing that this GPA binds to carbohydrates. This model serves as a foundation for future work regarding the properties of GPA, which includes identifying locations of specific interactions between GPA and other RBC surface proteins such as GPB and Band 3, as well as identifying structural features of antigenic regions on GPA. . Even though no significant differences were found among the groups studied, 4 haplotypes containing the McC b and SL2 polymorphisms were identified in D samples but were not found in TB and L groups. Summary/Conclusions: This preliminary data obtained suggests that CR1 polymorphisms and haplotypes, especially those containing McC b and Sl2 SNPs, could be involved in the disease pathogenesis of tuberculosis and leprosy. The entrance of mycobacteria into macrophages is mediated by complement receptors that facilitate their uptake by host cells so the combined haplotypes could be enhancing parasite phagocytosis and inflammation. Further studies are being carried out to establish whether CR1 polymorphisms are risk or protective factors and whether other genetic variations in this receptor are also involved.

Abstract withdrawn. Background: The Dombrock blood group system consists of two antithetical antigens, Do a and Do b , and three high-prevalence antigens, Gregory (Gy a ), Holley (Hy), and Joseph (Jo a ). The rare Do null or Gy(a-) phenotype lacks all Dombrock antigens, and the DO null alleles vary with both DO*01 and DO*02 backgrounds. Here we report the molecular basis of a novel DO null allele in a Gy(a-) Brazilian patient with anti-Gy a . Aims: Case presentation: An alloantibody to a high-prevalence antigen was detected in the serum of a 42 year old woman from the Northeast Brazil with a history of 4 pregnancies but no history of previous transfusion. She required transfusion because of a schedule for total thyroidectomy surgery due to a large compressive nodular goiter. The antibody did not react with the autologous RBCs but reacted by the indirect antiglobulin test in LISS with all panel RBCs and other RBC samples tested except with the Gy(a-) phenotype. The corresponding antigen was resistant to treatment with papain but sensitive to DTT and trypsin. These results suggested that the antibody recognized an antigen in the Dombrock blood group system. The purpose of this study was to identify the antibody specificity and to determine the molecular basis of the phenotype detected.

Methods: The red cells phenotype and the presence of the Dombrock related antibody in the serum were detected by standard hemagglutination techniques. RBCs and antibodies were from our in-house collection of rare samples. Genomic DNA was prepared from peripheral blood of the patient. Dombrock genotyping was performed by ID-Core XT platform (Grifols, Spain). The 3 exons of the DO gene were amplified by PCR and directly sequenced. Experimental Immunohematology and Diagnostic Immunohematology 2 Diagnostic Immunohematology 3 Experimental Immunohematology, Sanquin, Amsterdam, Netherlands

Background: Typing of blood group antigens is essential to prevent transfusion reactions or haemolytic disease of the foetus and newborn. To date, the ISBT recognises 360 blood group antigens. Most antigens (322) belong to one of the 36 blood group systems. Since the genetic basis of these systems is known, genotyping of these antigens is possible. The molecular background of 38 antigens is unknown and can only be determined serologically. One of these antigens is Sd a (Sid), first reported in 1967.~91% of the population carry Sd a on erythrocytes, but this frequency might be higher since identification is difficult due to variability in expression. In 96% of individuals Sd a is present in urine. Cells with a high expression of Sd a (Cad/Sda++) are used for detection of antibodies. Recently, a 3-cells antibody detection panel of Bio-Rad contained a Sda++ cell and many individuals with anti-Sd a were detected. The B4GALNT2 gene has been implicated in the synthesis of Sd a . We collected individuals with and without anti-Sd a to elucidate the genetic background of the antigen. Aims: Elucidation of the genetic basis responsible for loss of the Sd a antigen on red blood cells.

Methods: Routine diagnostics to identify antibodies in patients was performed using a Bio-Rad 3-cells panel, containing donor 626521 with high expression of Sd a . Additionally, 200 pregnant women were screened for anti-Sd a . DNA of eight samples with anti-Sd a and eight samples without anti-Sd a was isolated for further analysis. Sanger sequencing was performed on B4GALTNT2 exon 1-11. Results: Sequencing of B4GALTNT2 revealed two homozygous mutations which are present in all eight individuals with anti-Sd a , but not present in 6 controls. The remaining two controls are heterozygous for these mutations. The first mutation within exon 10, c.1396T>C (ENST00000300404.2, rs7224888) changes a cysteine to arginine at position 466 of the protein. The second mutation in exon 11 c.1590A>G (rs16946912) does not change an amino acid. Both SNPs have a MAF of 0.11 and therefore we expect that 2.1% of the population is homozygous for the minor allele. Genotyping of a large population of pregnant women and the serological detection of anti-Sd a in women with a homozygous mutation is in progress. Summary/Conclusions: The high frequency antigen Sd a has not been linked to a blood group system because the molecular basis for loss of the antigen has not been elucidated. The B4GALTNT2 gene has been associated with Sd a synthesis and therefore we analysed this gene for mutations in individuals with antibodies against Sd a . A single homozygous mutation within exon 10 causing an amino acid change was found in all individuals with anti-Sd a , and no individuals without antibodies were homozygous for this SNP. From population studies we expected~4% Sd a -negatives, but either this frequency is an overestimation because of difficulties to detect low expressed antigens or mutations in other genes are interfering with Sd a synthesis. A larger study of individuals with homozygous mutations in B4GALNT2 and linkage to Sd a -negativity and presence of antibodies will be performed before Sd a can be assigned to a new blood group system.

Abstract withdrawn.

Abstract withdrawn. Background: Erythrocyte Duffy blood group antigen can scavenge chemokines in whole blood. Duffy blood group gene consists of two major alleles: FY*A and FY*B. However, little is known regarding the association of Duffy blood group polymorphisms with the red blood cell (RBC) chemokine scavenging. Aims: The aim of this study was to determine the association of Duffy blood group polymorphism with the RBC chemokine scavenging. Methods: The Duffy blood group were genotyped by 5ˊ-nuclease assay in healthy Chinese Han individuals, while erythrocyte chemokine scavenging function and Duffy antigen expression from the same samples were measured using erythrocyte chemokine binding assays and quantitative flow cytometry respectively. Results: RBC chemokine scavenging of CXCL8 was significantly lower in the individuals with the FY*A/FY*A genotype compared to those with FY*A/FY*B genotype (P = 0.016). Similar result was also observed in RBC chemokine scavenging of CCL2 (P = 0.038). The expression of Duffy antigen on RBC surface in the individuals with the FY*A/FY*A genotype was significantly higher compared to those with FY*A/ FY*B genotype (P = 0.021). Summary/Conclusions: Duffy blood group polymorphism is associated with the differential RBC chemokine scavenging. It is probable that a change in Duffy antigen structure caused by Duffy blood group polymorphism is responsible for the differential RBC chemokine scavenging.

Background: Individuals with p-phenotype can develop a naturally occurring anti-PP1Pk and has clinical significance, causing hemolytic transfusion reactions or hemolytic disease of the fetus and newborn. Finding and procuring blood units of pphenotype is a challenge because of its rarity throughout the world. Therefore, acute normovolemic hemodilution (ANH) can be an on hand tool in the perioperative successful management of patient with rare blood group. However, this approach has not been commonly used Aims: N/A. Methods: N/A. Results: A 66-year-old Korean woman was referred to Samsung Medical Center for surgical management for gallbladder malignancy. Her blood type was group A, D-positive. The patient had no known history of transfusion. However, antibody screening and identification test using the column agglutination method (Bio-Rad, Cressier, Switzerland) showed panagglutination with negative reactions to autologous red blood cells, indicating the presence of alloantibodies to high frequency antigens. The specimen obtained from the patient was sent to the central laboratory of the Swiss Red Cross (Bern, Switzerland) and confirmed as anti-PP1Pk. At first, the transfusion team of our hospital recommended the surgical team to postpone the surgery. However, ANH was planned because postponing surgery was not preferred and the patient's preoperative hemoglobin was 12.9 g/dl. 800 mL of blood was withdrawn through a radial arterial catheter in two 400 mL blood bags containing citrate-phosphate-dextrose-A solution after anesthetic induction. Equal volume of 6% hydroxyethyl starch solution was infused during the procedure. The patient underwent radical cholecystectomy and liver wedge resection with lymph node dissection, and two units of autologous blood were returned to the patient during surgery. She was then discharged 48 h later with a hemoglobin level of 12.3 g/dL. Later, the family study was performed with the standard serologic method using the proband's plasma containing anti-PP1Pk and sequencing of the A4GALT gene, which were conducted according to the protocols by Koda et al.(Transfusion. 2002) . The proband and her brother were homozygous for c.1029dupC, indicating a rare p phenotype. Summary/Conclusions: We experienced that autologous blood transfusions via ANH is an alternative to allogenic RBC blood transfusion in patients who have no blood available because of high alloimmunization antibodies against rare blood groups. " and the third sample as "GYPB*S_GYP*[140A], GYPB*S_null(IVS5 + 5t)" with a predicted phenotype: S-s+ Mi a + and S+s-Mi a +, respectively. The GYPA specific primers used for discrepancy resolution detected the nucleotide substitution, GYP.c.140C>A, in GYPA-B-A hybrid associated to GP.Hut allele, thus confirming the ID CORE XT result. The expression of Mi a for one of these samples was confirmed using non-commercial anti-sera. Hence, these three samples were not GP.Mur but GP.Hut phenotype. Both alleles codify for the expression of Mi a antigen since it is expressed on several hybrids between the usual forms of glycophorin A and B. Two of these three GP.Hut samples are African-American donors. GP.Hut was reported in white people with a frequency about 0.06% and in Thais with 0.04%. These three GP.Hut cases found by ID CORE XT in this study point to a higher frequency of this glycophorin variant and also to the presence in African American population. Summary/Conclusions: ID CORE XT was able to detect two glycophorin phenotypes, GP.Mur and GP.Hut, which codify for the expression of Mi a antigen. Standard molecular methods should be implemented in pre-transfusion testing and obstetrical care routine to detect the most clinically relevant glycophorin variants in MNS system. Background: SERF(+) is a high prevalence antigen in the Cromer blood group system, which is encoded by a CROM*12 allele. The lack of the SERF antigen, SERF(À) on red cells is caused by a single nucleotide polymorphism, c.647C>T in exon 5 of the Decay-accelerating factor, DAF gene. Alloanti-SERF has been found in Thai pregnant woman with SERF(À) and a SERF(À) individual was found among Thai blood donors. Anti-SERF is not a marketed product; hence, a molecular technique has to be implemented to genotype for the CROM*12 allele among blood donors.

Aims: This study aimed to identify the CROM*12 allele among Thai blood donors leading to predicted SERF(+) and SERF(À) phenotypes. Methods: DNA samples obtained from 1,512 central Thai blood donors were genotyped for SERF allele detection using in-house PCR with sequence-specific primer (PCR-SSP) and confirmed by DNA sequencing. Results: The allele frequencies of CROM*12(+) and CROM*12(À) among 1,512 central Thais were 0.992 (3,001/3,024) and 0.008 (23/3,024), respectively. The homozygous of CROM*12(À/À) alleles was not found in this study. Additionally, the PCR-SSP technique was validated by DNA sequencing using randomly chosen 100 samples together with 23 heterozygous CROM*12(+/À) samples and the results were in agreement. Summary/Conclusions: Our results confirm a high frequency of the CROM*12(+) allele in the Thai population and their frequencies were similar to those formerly reported among Thai blood donors. This study would be beneficial to predict the SERF antigen from genotyping results due to unavailability of commercial antiserum. Background: There is increasing interest in the use of molecular methods for predicting ABO grouping. Though NextGen and Sanger sequencing have both been used to predict ABO type, predicting ABO type from buccal swab-derived DNA and from deceased donors benefits from a quick and reliable method. Besides a PCR-RFLP that has been used by many labs for more than 25 years, there is a commercially-available research use only (RUO) kit, and both interrogate nucleotides associated with O1, O2, A2 and B with A representing the ancestral allele. Aims: The aim of this report is to compare two low-resolution polymerase chain reaction (PCR)-based methods, for investigation of samples submitted to a reference molecular immunohematology laboratory for ABO typing discrepancies. Fifty-six peripheral blood samples were tested, 31 from patients and 25 from blood donors. Methods: Genomic DNA was isolated from peripheral blood mononuclear cells. Background: DEL is the weakest known D positive phenotype in the Rh blood group system and detectable only by adsorption and elution tests. The RHD1227G>A change is an important marker for DEL phenotype in East Asians. A rapid and efficient PCR method for RHD gene 1227 G>A genotyping is useful in East Asian countries.

Aims: The aim of this study was to develop a method for RHD 1227G>A genotyping by using single-tube PCR with melting temperature(T m )-shift primers. Methods: Two allele-specific primer for RHD 1227G>A and a common primer were designed and synthesized. Two GC-rich tails of different lengths were attached to 5 0 ends of the allele-specific PCR primers. Single-tube PCR with T m -shift primers was carried out with the three primers. After PCR, melting curve analysis was performed. RHD 1227G>A could be genotyped by differences of the T m s of the PCR products. All of genotyping results were compared with those obtained from conventional PCR-SSP. For the discordant results, RhD exon 9 sequencing was performed to determine RHD 1227G>A genotype.

Results: A total of 84 samples were genotyped for RHD 1227G>A by PCR with T mshift primers. 32 samples were typed as 1227A+/G-, 22 samples were typed as 1227A-/G+, 6 samples were typed as 1227A+/G+ and 24 samples were typed as 1227A-/G-. Two samples typed as 1227A+/G+ by PCR-SSP but 1227A+/G-by PCR with T m -shift primers were confirmed as 1227A+/G-by RHD exon 9 sequencing. Summary/Conclusions: The single-tube PCR with T m -shift primers for RHD 1227G>A genotyping is simple, rapid, accurate, and it is superior to conventional PCR-SSP.

Abstract withdrawn. Background: The Rh blood group system has numerous variant alleles, which may affect Rh antigen expression, including RHD-RHCE (D-CE) hybrid genes. These variant alleles are frequently found in people of African descent, and typically result in either D-negative (D-) phenotype, or partial D antigen expression, including silencing of high-frequency antigens and/or expression of low-frequency antigens.

Patients carrying those alleles are particularly at risk of alloimmunization, suggesting that their identification is important in diagnostics. Quantitative multiplex polymerase chain reaction (PCR) of short fluorescent fragments (QMPSF) has proven successful for genotyping those DNA samples carrying D-CE hybrid genes by assessing both qualitatively and quantitatively RHD and RHCE gene exons. Aims: The aim of this project was to genotype both RH genes in a cohort of Brazilian patients with sickle cell disease (SCD), which are known to be of African descent, by using the QMPSF approach and report hybrid gene variability in this population. Methods: One-hundred fifteen DNA samples were selected for the study and analyzed prospectively by the RHD-QMPSF and RHCE-QMPSF approaches to investigate the copy number of all exons in both RH genes. Genotypes were further confirmed or investigated by Sanger sequencing and conventional PCR-RFLP assays.

Results: In the 115 DNA samples, 75 (65.2%) exhibited a "wild-type" profile by QMPSF analysis. Hybrid genes involving exon 8, which is functionally not relevant as reported before, was found in 28 samples, including 11 and 17 samples carrying respectively RHD-CE(8)-D and RHCE-D(8)-CE (two homozygous each). Except two samples that require additional studies (1.7%), RHD zygosity was resolved successfully: 60 (n = 2 RHD gene copies; 52.2%), 49 (1; 42.6%) and 4 (0; 3.5%). Clinically relevant, i.e. partial D, genotypes were identified in four hemizygous samples (4/115, 3.5%) carrying RHD*DAU5, RHD*DV.2, a RHD*DIIIa-like allele, and a novel RHD*D-CE(7:G329H-Y330S-N331I)-D allele, as confirmed by sequencing. Other hybrid alleles, such as RHD*03N.01 and RHD*DIIIc, were also found in trans with a normal RHD*01 allele. In RHCE, C/c genotype could be resolved. The RHCE*ce16 (RHCE*ce (48C)-D(9)-ce) allele, which is commonly cis-associated with RHD*Ψ, was observed in four samples. However the clinically relevant polymorphisms in variant RHCE alleles, such as those involved in ceMO, ceAR, ceAG, and ceTI, were mostly identified by other standard methods. Summary/Conclusions: Although most of the Brazilian patients with SCD investigated in this study did not carry RHD-RHCE hybrid genes, QMPSF analysis has been shown to be an efficient tool in the whole genotyping process to investigate RH gene variation. As previously reported, it has been conclusive for characterization of RHD zygosity and identification of rare, as well as novel, variant alleles. Additionally, our results show a large diversity of hybrid genes among the Brazilian patients with SCD. Therefore, we suggest that QMPSF may be used as a complementary screening approach for assessing RH genotype in selected patients and donors. = 19) vs. non-bleeding (n = 15) patients. Platelet, PMP and CP phenotype and function were evaluated by flow cytometry: Activation and granule release were examined by antibodies against granulphysin (CD63), P-selectin (CD62P), activated GPIIb/IIIa (PAC-1) and phosphatidylserine (PS) (lactadherin) unstimulated and ADP, TRAP or collagen stimulated. Coated platelets were identified as a highly granulated independent cell population appearing following collagen stimulation, gated on side scatter and GPIba (CD42b). Normal healthy reference levels were available.

Results: The platelet count in bleeding (72 9 10 9 /l) and non-bleeding (68 9 10 9 /l) patients was comparable (P = 0,66). Bleeding patients had a higher BAT score compared to non-bleeding patients (10 vs. 2, P < 0,01). The proportion of CPs was normal in all patients. However, in non-bleeding patients the proportion of PS+CPs and per cell PS expression (MFI) (86,16% and 4,96MFI) were higher, compared to bleeding patients (64,08% and 2,44MFI, both P < 0,05), and the proportion of PS+CPs correlated negatively with BAT score (r 2 =0,26, P < 0,01). CD63 + CP was higher in non-bleeding (97,25% and 10,54MFI) compared to both bleeding patients (94,88% and 6,89MFI) and significantly higher than the reference level (88,44% and 5,36MFI, both P < 0,05). Finally, the proportion of PS+PMPs was normal in bleeding patients, but their PMPs expressed higher than reference PS per cell, both unstimulated and for all agonist (134,12 MFI unstimulated vs 32,38 MFI reference, P < 0,01). Summary/Conclusions: Patients with IT exhibited different bleeding tendency despite comparable thrombocytopenia. In non-bleeding patients the proportion and per cell level of PS+ were higher, indicating that generation of CPs with high PS expression is a critical factor determining bleeding phenotype. The finding of high PMP PS per cell level in bleeding patients could represent an inadequate compensation for lack of CP function, indicating that procoagulant PMPs may be less important than CPs for thrombocytopenic bleeding. Quantification and characterization of CPs may be a useful tool for future assessment of bleeding risk as well as a therapeutic target in IT and other conditions with bleeding diathesis and/or thrombocytopenia. More studies investigating this field are warranted. Background: Alloantibodies against human platelet antigens (HPAs) and human leukocyte antigen (HLA) are implicated in several immune-mediated platelet disorders. Detection of these antibodies is crucial in the diagnosis and management of these disorders. Aims: To establish a method detecting HPA-1, HPA-2, HPA-3, HPA-5 and HLA antibodies using Luminex bead technology. Methods: Monoclonal antibodies specific for platelet glycoproteins and HLA class I molecules were separately coupled to the Luminex microbeads. Positive anti-HPA-1a, anti-HPA-2b, anti-HPA-3a, anti-HPA-5a samples were used to validate the specificities of the Luminex assay. The anti-HPA-1a, anti-HPA-3a standard samples were used to evaluate the sensitivities of the Luminex assay by serial dilutions (from neat to 1/1024). Results: 44 samples collected from patients or ISBT platelet workshop were tested by the Luminex assay. The results showed that Luminex assay could detect antibodies against HPA-1a, HPA-2b, HPA-3a, or HPA-5a successfully from the known samples. The sensitivities of the Luminex assay detecting anti-HPA-1a, and anti-HPA-3a were 1:512 and 1:64, respectively, using the standard samples. No cross-reactivity was observed in the samples containing multi-platelet antibodies, or mixture antibodies against HPA and HLA. The results of 44 samples with platelet disorders were agreement with those of monoclonal antibody immobilization of platelet antigens (MAIPA) assay. Summary/Conclusions: Luminex beads coupled with monoclonal antibodies could be successfully used to detect HPA and HLA antibodies with high sensitivity. Background: Platelet transfusion is important in clinical treatment. The expression of ABO antigen on platelet surface is differential, so it is usually need to ensure the consistency of the ABO antigen in clinical transfusion. But in many cases, it is difficult to find the platelets that the ABO blood type matched between the recipient and donor, and ABO-incompatible platelet infusion is required in these cases. To data, the expression of ABO antigens on platelets in normal blood group individuals is rarely reported in Chinese population. Aims: To understand the differential expression of ABO antigen on platelet surface in population of Zhejiang province, China. Methods: Total of 358 individuals with normal ABO groups (101 group A, 100 group B and 101 group AB individuals, and 56 group O as negative control of ABO antigens on platelets) were analyzed. The expression of ABO antigens on platelets was determined by flow cytometry using monoclonal antibodies: Fluorescein isothiocyanate (FITC)-conjugated mouse antihuman blood group A and PE-conjugated murine IgG1 anti-B antibody (9431PE BGRL1). Flow cytometric parameters were statistically analyzed by the Mann-Whitney test or the Kruskal-Wallis test to observe the difference in two or more groups using GraphPad software v5.01. The correlation and regression analysis between A and B antigen in the platelets and RBCs were also performed by the software. Population studies were reported as the mean and standard deviation (SD), and P values less than 0.05 were considered statistically significant.

Results: According to MFI values of ABO antigens expression on platelets, the samples were divided into three groups: low expression (LE), high expression(HE) and moderate expression (ME) according to the background MFI observed in group O samples. It was found that about 66.22% of the individuals had a weak expression of ABO antigen on the platelet surface in Zhejiang province. there was a significant difference in the intensity of antigen expression between these three different groups of the same blood group. For each blood group, there was a positive correlation between the intensity of ABO antigen expressed on the platelet membrane and red blood cells of the individuals. Results: 40 cases were found with antibody positive. Among them, 6 cases (15%) were only anti-HLA-I positive, 4 cases (10%) were only anti-HPA positive, 30 cases (75%) were both anti-HLA-I and anti-HPA positive. 8 cases were found without anti-HLA-I or anti-HPA. Among the 34 cases with anti-HPA positive, the distributions of anti-GPIIb/IIIa, anti-GPIa/IIa, anti-GPIb/IX, anti-GPIV were 73.5%, 61.2%, 50%, 44.1%, respectively., HLA antibody positive rate in the female patients was higher than that in the male and HPA antibody positive rate in the female was lower than that in male, but there was no significance difference between them (P > 0.05). Summary/Conclusions: In PTR patients, the platelet antibody was mainly HLA-I antibody combined with HPA antibody. Background: Human neutrophil antigens (HNA) are polymorphic structures located on surface membrane of human neutrophils. Alloantibodies against HNA are implicated in a number of clinical conditions, including immune-mediated neutropenia and transfusion reactions. Genotyping for human neutrophil antigen (HNA) systems is an important in the diagnosis of disorders involving alloimmunization to HNA. Aims: The aim of this study was to investigate the HNA allele frequencies among blood donors and hematological patients undergoing blood transfusions and to estimate possible HNA incompatibilities and risk of HNA alloimmunization. Methods: A total of 303 blood donors and 302 hematological patients from the North-West region of the Russian Federation were recruited. DNA samples were obtained and typed for HNA-1, -3, -4 and -5 systems using polymerase chain reactions with sequence-specific primers (PCR-SSP). Specific primers for HNA were designed and the polymerase chain reaction amplification conditions were optimized. The v 2 test was used to test for the Hardy-Weinberg equilibrium for the HNA systems. The probabilities of the incompatibility and the potential risk for alloimmunization against different HNA systems after random transfusions were estimated based on the HNA allele and genotype frequencies.

Results: In blood donors, the frequencies for the FCGR3B*01 (HNA-1a), FCGR3B*02 (HNA-1bd), and FCGR3B*03 (HNA-1bc) alleles were 0.384, 0.584 and 0.032; for the SLC44A2*1 (HNA-3a) and SLC44A2*2 (HNA-3b) alleles, 0.804 and 0.196; for the ITGAM*1 (HNA-4a) and ITGAM*2(HNA-4b) alleles, 0.898 and 0.102; for the ITGAL*1 (HNA-5a) and ITGAL*2 (HNA-5b) alleles, 0.708 and 0.292, respectively. In hematological patients, the gene frequencies for HNA-1a/1bd/bc, -3a/3b, -4a/4b, and -5a/5b were 0.376/0.588/0.036, 0.795/0.205, 0.887/0.113, and 0.699/0.301, respectively. No statistic significant difference between genotypes in these groups was observed. Since the allele frequencies of HNA -1, -3-5 for hematological patients and donors did not have statistically significant differences, possible HNA incompatibilities and risk of HNA alloimmunization were estimated based on the obtained data on the allele and genotype frequencies of HNA in a group that combines donors and hematological patients (n = 605). The predicted risk of HNA-1, -3, -4, -5 incompatibilities in this cohort were 34.9%, 26.9%, 19%, and 32.9%, respectively. The possible risk of HNA-1a, -1bd, and -1bc alloimmunization were 0.233, 0.143, and 0.064, respectively; of HNA-3a and -3b alloimmunization, 0.037 and 0.231; of HNA-4a and -4b alloimmunization, 0.01 and 0.163; of HNA-5a and -5b alloimmunization, 0.080 and 0.250, respectively. Summary/Conclusions: The information about HNA gene frequencies can be used not only in blood services for detection and identification of HNA alloantibodies in donors and assessment of alloimmunization risk but also for anthropological studies. Background: Non-invasive fetal RHD genotyping is performed using circulating cell-free fetal DNA from maternal plasma sample and real-time polymerase chain reaction. This antenatal routine DNA test is used to target Rh-Ig administration to prevent hemolytic disease of the newborn. Aims: The aim of this study is to characterize maternal RHD variants responsible for indeterminate results during fetal RHD genotyping due to early amplification of at least one of the exons (5, 7 or 10) of the RHD gene.

Methods: 2004 samples were tested from 01/12/2017 to 01/12/2018 using Free DNA Fetal Kit â RhD. 44 samples (2,2%) yielded a premature signal for one or more exons of the RHD gene. After extraction of maternal cellular DNA, the maternal RHD was characterized using RHD BeadChip assay (Immucor/BioArray). RHDIIIa-CE(4-7)-D Summary/Conclusions: Greater diversity is observed in the Caucasian population rather than in the Afro-Caribbean. 65% of the identified variants are RHD negative alleles including alleles leading to partial RH2 antigen expression. Unexpected alleles are found such as weak D type 1, 2, 5 or 11. These data underline the benefits of maternal RHD genotyping when abnormal early signals are detected during noninvasive fetal RHD genotyping. Background: A considerable number of RHD alleles responsible for weak D phenotypes have been identified. Serologic determination of these phenotypes is often doubtful and makes genetic analysis of RHD gene highly desirable in transfusion recipients and pregnant women. DNA-based methods are useful for enhancing immunohematology typing in doubtful D phenotypes at pregnant women. Aims: Determination of the RHD gene in a cohort of pregnant women with doubtful D phenotypes. Methods: Determination of the RhD phenotyping was performed with microagglutination technique BioRad and Ortho Diagnostic simultaneously. RHD genotyping was performed on 20 cases with D typing serological discrepancies with Ready-to-use Inno-train RBC-Ready Gene CDE and RBC-Ready Gene D weak test kits based on polymerase chain reaction with sequence-specific priming (PCR-SSP) to unclear serologic findings. Results: Molecular analyses showed 16 of 20 (80%) pregnant women were RHD*weak D type 1 and not at risk for anti-D. RHD*weak D type 3 were typed in 3 cases (15%) and 1 case was RHD*weak partial 4.0 and potentially at risk for being alloimmunized producing anti-D allo-antibodies. Summary/Conclusions: Appropriate classification of RhD phenotypes is recommended for correct indication of RhIG in pregnant women. However, the serologic differences between RhD-negative and RhD-positive pregnant women is a real problem for unnecessary application of RhIG prophylaxis in pregnant women with D variants. Conclusion: Antenatal RhIG prophylaxis is useful in RhD negative pregnant women. With genotyping we found that 95% of serological doubtful RhD negative women was D variants that not produce anti D antibodies. In that cases those RhIG prophylaxis was unnecessary and harmful as a product of human origin. On other hand there is a save up of a stock of RhIG which is any way in deficit. Is it time to think about cost benefit of RhIG prophylaxis and genotyping in pregnant women. Background: In May 2018, UK NEQAS (BTLP) created an External Quality Assessment (EQA) sample designed to mimic a Feto-Maternal Haemorrhage (FMH) bleed of 3 mL. All material used passed pre-acceptance serological testing; samples were dispatched to 298 participants in 17 countries. Post-dispatch testing by flow cytometry (FC) using an anti-D marker showed a bleed volume of 1.1 mL so an investigation was initiated. Aims: To determine the cause of the unexpectedly low bleed volume and what lessons could be learnt. Methods: Production methodology and results of pre-acceptance testing were reviewed. FC testing was repeated, plots examined, and the FMH Scientific Advisory Group consulted for advice. Further FC testing was performed at WBS using alternative markers, and the material used was investigated at IBGRL. Participant results were examined to determine if the sample should be withdrawn from scoring. A questionnaire on how results were managed was sent to the 36 participants using FC with an anti-D marker. Results: A material production methodology review showed no obvious cause of the erroneous in-house result. Review of pre-acceptance testing images showed no issues, further D-typing of the cord showed 2 + reactions vs. two reagents by tube, cf. 4 + with two different reagents by column agglutination technology. Repeat FC testing using the anti-D marker gave similar results; however, closer examination of the plots showed a left shift in the positive peak, indicating reduced fluorochrome binding, possibly due to reduced D antigen density on the cord cells.

Further FC testing at WBS demonstrated a marked reduction in fluorescence intensity with an anti-D marker. Further investigation using an anti-HbF marker showed a bleed volume of 3.7 mL, indicating the correct proportion of cord material had been used during sample production. Additional serology at IBGRL on the cord material showed reactions which were weaker than the control with 4/17 anti-D reagents. Overall, the investigation supported the hypothesis that the cord material was D variant. A review of results submitted by participants mirrored the FC investigation and the sample was withdrawn from scoring, as the FC median result is used to calculate scores and the D variant cord was clearly affecting testing with an anti-D marker. The questionnaire showed that all 16 respondents examine FC plots and the gating used, but not all act on them before reporting results, and not all have a back-up plan for anti-D Ig dosing in a similar situation. Later sequencing of the D gene revealed the cord donor to be DVII which can have a lower than normal D antigen density. Summary/Conclusions: The use of a D variant cord in an EQA sample was not planned, but allowed UK NEQAS to highlight some important learning points: -Thorough examination of FC plots is essential to avoid underestimation of FMH; a controlled procedure should be in place if modification of gates is required -Access to cord/neonatal blood to allow serological investigation may be useful in a similar clinical situation -It is important to have a back-up plan for issuing anti-D Ig in the event of an uninterpretable FMH result Background: Allo-antibodies against fetal blood group and platelet antigens produced by antigen-negative pregnant women can cause hemolytic disease of fetus and newborn (HDFN) and fetal and neonatal alloimmune thrombocytopenia (FNAIT). Prediction of the fetus antigen status in immunized women is important for making decisions concerning further management of pregnancy. NIPT is widely used for determination of fetal blood groups but determination of proper specificity in the real-time amplification of a single nucleotide polymorphism (SNP), such as K or HPA-1a, requires modified protocols. Droplet digital PCR (ddPCR) permits detection of low-grade fetal chimerism in maternal plasma DNA with higher specificity using allelic discrimination PCR protocols. Aims: To establish ddPCR protocols for non-invasive prenatal diagnostics (NIPD) of clinically important blood group antigens. Methods: DNA was isolated from 133 plasma samples of pregnant women and donors with known genotypes (easyMag, Biomerieux). Allelic discrimination protocols for determination of K/k (n = 29), S/s (n = 13), HPA-1a (n = 49), HPA-3 (n = 8), HPA-5 (n = 14), HPA-15 (n = 20) genotypes were performed using ddPCR method with Droplet Digital TM (Biorad).

The results of allelic discrimination performed using ddPCR were concordant with the already known phenotype/genotype of donors and pregnant women. DdPCR enabled the detection of 100-16,000 reads for total DNA from plasma in tested samples. All fetal results were in agreement with antigen positive genotype of the neonates and the fetal chimerism was from 0,01% to 26,4% (one case was for advanced pregnancy -38 week of gestation). In 19/133 tested samples false positive results were detected at the level of 1 or 2 unspecific reads. Summary/Conclusions: The implementation of allelic discrimination protocols for ddPCR allowed detection of fetal-maternal incompatibility in K/k, S/s and HPA-1a, -3a/b, -5a/b, -15a/b antigens encoded by SNP. Background: In France, for pregnancies complicated by anti-D (RH1) and anti-c (RH4) allo-immunization, the tests currently used to quantitate maternal antibodies are tube method titration and continuous flow analysis determination of the antibodies concentration. Recently, an automated assay was developed using the column agglutination technology on the IH-500 system (Bio-Rad â). Aims: We wanted to evaluate the score, calculated from the agglutination profile of the antibodies on the IH-500 system, as a quantitative data to appreciate the level of maternal antibodies. Methods: Titers from 29 samples containing anti-D and 20 containing anti-c have been established using the semi-automated tube method performed since decades in our lab and the fully automated gel method on the IH-500 system. Scores were calculated manually in both cases. Antibodies concentrations were also determined for all samples by continuous flow analysis on our auto-analyzer device (Evolution III AMS Alliance). We looked for a possible correlation between anti-D and anti-c scores and the corresponding concentrations using the Spearman correlation test.

Results: Anti-D tube and gel scores were significantly correlated with the anti-D concentration values (p < 0.0001, r = 0.79 and p < 0.0001, r = 0.82 respectively). Anti-c scores were also significantly correlated with anti-c concentration values (p < 0.0001) but gel scores have a better correlation coefficient than tube scores (r = 0.78 versus 0.55). It was easier to extrapolate gel score thresholds than tube score thresholds from the autoanalyzer values, with the aim of triggering fetal monitoring by ultrasounds and measurements of the peak systolic velocity in the middle cerebral artery only for risk pregnancies. The determined gel score thresholds were 75 and 35, corresponding respectively to 5 UI/ml (250 UCHP/ml) of anti-D and 7.5 UI/ml (500 UCHP/ml) of anti-c.

Conclusions: Calculating the score from the hemagglutination profile displayed by the IH-500 system provides added values compared to the sole reading of the titer. For anti-c immunization, gel scores are more discriminant than tube ones and better correlated to the concentration values established by continuous flow analysis. The proposed score thresholds to trigger fetal antenatal monitoring need, however, to be confirmed on more samples and to be clinically documented. Background: HDNF is due to maternal IgG alloantibodies directed against fetal antigens that cross the placenta during pregnancy, causing hemolysis in the fetus, anemia that can lead to edema, ascites, hydrops and, in some cases, death. The diagnosis and management of HDNF is based on maternal screening, and Middle Cerebral Artery (MCA) Doppler monitoring. In severe HDNF intrauterine blood transfusions (IUTs) and or exchange transfusion (ET) after birth are necessary to correct anemia, to prevent and treat fetal hydrops. Aims: We report eight years of experience in our Immunohematology Reference Laboratory (IRL) to highlight the importance of red cell antibody detection as a fundamental parameter to identify pregnancies with high fetal risk and to drive a correct treatment.

Methods: We report laboratory data from 250 pregnant women with a positive indirect antiglobulin test (IAT) referred to our IRL from January 2008 to December 2016. We performed antibody screening and identification by indirect antiglobulin test (IAT) in microcolumn method with BioVue System (Ortho-Clinical Diagnostics, Raritan, USA), and the title of antibodies in IAT by tube method without additive.

Follow-up tests were also performed in the presence of significant red cell antibodies in order to check antibody title and begin clinical monitoring. Threshold values were ≥ 1:8 for anti Kell antibodies and ≥ 1:32 for other specificities.

Results: Out of 250 women, 143 (57.2%) displayed clinically significant antibodies, 92 (36.8%) clinically insignificant antibodies and 15 (6%) natural antibodies of different specificities. Among women with clinically significant antibodies the most frequent was anti-D (16.8%) also in combination with other Rh antibodies (8.8%), while anti-K accounted for 10%, anti-E for 10% and antibodies against high-incidence antigens for 2.4%. Anti-M and anti-Le a antibodies were also found (16.8% and 8% respectively) but they were not clinically significant. Among 143 women with clinically relevant antibodies, 37 showed a critic antibody title and they underwent gynecological and obstetric monitoring. 21 fetuses resulted affected by HDFN, displaying anti-D in 16 cases and anti-Kell in 5. 11 fetuses with severe HDFN (anti-D in 7 and anti-Kell in 4) required IUTs, 2 were treated with ET, 8 received red blood cells units at birth. Summary/Conclusions: The mother screening program led to important improvements in the outcomes of HDFN. The identification of women with clinically significant antibodies allowed an appropriate monitoring program and therapy. Background: The hemolytic disease of the fetus and newborn (HDFN) is a severe disease, resulting from maternal erythrocyte alloantibodies directed against fetal erythrocytes. Alloimmunization in pregnant women has been found to range from 0,4% to 2,7% worldwide.

There are over 400 erythrocyte surface antigens, of which more than 43 have been reported to be associated with HDFN. Although anti-Rhesus D was once the major etiology of HDFN, the universal introduction of antenatal and postpartum Rh immunoglobulin has resulted in a marked decrease in the prevalence of alloimmunization to the RhD antigen in pregnancy. Consequently, alloantibodies other than anti-D emerged as an important cause of severe HDNF, in particular anti-K and anti-c. However, there are other antigens that have also been found to be associated with HDFN. Aims: Retrospective identification of erythrocyte antibodies in pregnant women in Hospital de Braga in 2016 and 2017.

Methods: This study was planned to assess the prevalence of erythrocyte antibodies responsible for alloimmunization, excluding ABO-immunizations, in pregnant women attending the antenatal clinics of Hospital Braga during 2 years, from January 2016 to December 2017.

In this study, we retrospectively evaluated the erythrocyte antibody screening results of pregnant women. Women with positive erythrocyte antibody screening also underwent identification with gel card system following the manufacturer's instructions (DiaMed â ). The outcomes of infants, whose mother's indirect antiglobulin tests were found to be positive, were examined. Direct antiglobulin tests, jaundice and phototherapy history, transfusion and mortality of the newborns were recorded. Results: During the study period, 5982 pregnant women were attended in Hospital de Braga. The laboratory registered 100 positive erythrocyte antibody screening tests. The prevalence of positive erythrocyte antibody screening was 1,7%. Anti-D was the most common antibody found (58,5%). Anti-D prophylaxis given during pregnancy was responsible for 51 of 62 cases and maternal antibody titer levels did not exceed 8 among these cases. The prevalence of non-RhD immunization was 33%.

Anti-E (9,4%) was the most frequent alloantibody other than anti-D followed by anti-M (5,7%) and anti-C (4,7%). Multiple maternal antibodies were found in 5 pregnant women. Four women had 2 types of alloantibodies: anti-c and anti-E; anti-C and anti-D; anti-K and anti-Cw; anti-E and a non-identified antibody. One pregnant had 3 types of alloantibodies: anti-D, anti-C and anti-E. Of all cases of newborns whose mothers had a positive antibody screen tests, icterus occurred in 45% of them and phototherapy was given in 14%. Summary/Conclusions: The prevalence of positive erythrocyte antibody screening in Hospital de Braga was 1,7%. The erythrocyte antibody screening showed that anti-D was the most common antibody found (58,5%) in most of the cases because of anti-D prophylaxis. The prevalence of non-RhD immunization was 33%. The other most frequent alloantibodies were anti-E (9,4%), anti-M (5,7%) and anti-C (4,7%). An increasing prevalence of non-anti-D alloimmunization was found and there are currently no preventive strategies. In contrast to RhD alloimmunization, the main risk factor for non-anti-D alloimmunization is a previous transfusion therapy. Thus, it is important to minimize the exposure of women to incompatible erythrocyte antigens through unnecessary transfusions when possible. Background: The MNS blood group system is one of the most complex blood group systems. Although alloanti-M is a common antibody observed in pregnant women and could also be found in the serum of individuals who have not been exposed to M positive erythrocytes, it is rarely clinically significant and has been regarded as an unimportant antibody to cause hemolytic disease of the fetus and newborn (HDFN), especially in Caucasian and black ethnic groups, for a long time. However, an increasing number of cases of severe HDFN resulting in fetal hydrops and recurrent abortion caused by alloanti-M have been reported mainly in the Asian population, especially in the Japanese and Chinese populations. Aims: To summarize the characters of serological testing in preterm twins newborns suffered with severe HDFN.

Methods: The blood sample of two newborns with severe HDFN and the mother, who had the history with three hydrops fetus, were collected. ABO, RhD, RhCE, and MN blood group typing of the twins newborn and their mother were performed in saline with tube or gel card. Direct agglutination test (DAT), elution test, antibody specificity identification and antibody titer detection were conducted by IAT method in gel card. Results: O, RhD(+), and CcEe blood groups were identified both in the mother and the twins newborn. Background: In France, since May 2018, the legislation does not promote anymore the use of the reference tube method for titration of anti-red blood cells antibodies. This opened the way to the use of newly developed automated anti-red blood cells antibodies quantitation by column agglutination technology. Aims: We wanted to assess the performance of titration and scoring by the ID-gel test on the IH-500 system (Bio-Radâ) and to compare it with the performance established for the reference tube method, used in our lab since decades. Another objective of the study was to determine titer thresholds for the gel method, to trigger fetal monitoring by ultrasounds and measurements of the peak systolic velocity in the middle cerebral artery.

Methods: An home-made internal quality control (IQC) prepared and calibrated using the international anti-D Standard (01/572) was used to determine the intraassay and interassay imprecisions, regarding the score and the titer results. Patients samples for testing were chosen during the 2-months assay period, regarding the specificity of the antibodies and the tube titer in order to cover a wide range of 2 have lower values. The highest differences (more than 2 to 3 dilutions higher) were seen for antibodies directed against RH system antigens. Among the other specificities, Anti-K (KEL1) and anti-M (MNS1) antibodies show the most samples with equal or lower titers compared to the tube method.

Conclusions: Automated anti-red blood cell antibodies titration by column agglutination technology on IH-500 system shows better intra and interassay CVs compared to the tube method. It is explained by the fully automated process that includes the reading step. Titer results are almost always higher with the gel technology. Thus, it seems possible to safely extrapolate the titer thresholds defined for anti-red blood cells antibodies by the tube method to the gel method. However, based on future clinical studies and fetal/neonatal outcomes, it would probably be necessary to increase these thresholds, at least for anti-RH antibodies, in order to avoid heavy, expensive, stressful and useless monitoring of some pregnancies. Results: The first case was a 1-day-old female infant, yellowish skin developed the next day after birth. Her capillary bilirubin level was 13 mg/dL, the evidence favored neonatal hyperbilirubinemia and the clinical manifestation revealed hemolysis symptoms. Her laboratory findings showed elevated reticulocytes (15.2%), LDH (1162 IU/L) and G6PD (25.3 U/gHb); DAT (+/-), IAT (-), anemia (Hb 8.7 g/dl, Hct 28%), and blood smear showed anisocytosis, spherocytes, and polychromatic RBC.

Her mother blood typed O, D positive, while her blood type was B, D positive and Anti-B was found from her elution RBCs (3 + ). Due to rarely severe anemia with ABO incompatibility, maternal plasma was analysed for ABO IgG Antibodies and showed high antibody A and B titre with 1:1024 and 1:2048. The female infant received one unit washed-PRBCs for anemia and intensive phototherapy for hyperbilirubinemia. Her clinical condition improved significantly, Hb rose to 14.6, bilirubin level was within normal range, she was discharged. Another 5-days-old male infant was our second case. On the third day after birth, yellowish skin discoloration developed and bilirubin level was 15 mg/dL. Two days later, his Transcutaneous bilirubin (TcB) measurement data was high and laboratory findings also showed raised reticulocytes (5.2%), DAT (+/À), IAT (À), Hb 12. Background: Anti-Indian b is a rare alloantibody against the high frequency antigen In b . Individuals with the IN:1,-2 phenotype (In(a+b-)) are observed with a frequency of < 0.1% in the Indian population and have not been described in Caucasians. The majority of anti-In b antibodies have been reported in individuals without previous transfusions, indicating the possibility of a naturally occurring antibody. Anti-In b is considered clinically significant and haemolytic reactions after In b -incompatible transfusions have been reported. Haemolytic disease of the foetus and newborn (HDFN) due to anti-In b has not been described. However, a positive direct antihuman globulin test (DAT) may be observed. Aims: To describe the challenges of managing a pregnancy and childbirth of a woman with an anti-In b . Methods: Serological investigations were performed by IAT (tube and column agglutination). Papain and trypsin treated cells were also utilised. Soluble recombinant In blood group proteins (In-rBGP) (Inno-Train, Germany) were used in neutralization tests. The clinical significance of the anti-In b antibody was determined by monocyte monolayer assay (MMA). Genomic DNA was isolated from whole blood and the samples were further characterized by PCR amplification and Sanger sequencing of exon 2 of CD44. Results: In a 27-year-old pregnant (para 1) woman of Indian origin without previous transfusions, an alloantibody of the specificity anti-In b with a titer of 1:2 was detected by IAT (negative with papain-treated cells) at gestational week (GW) 32 and 36. The MMA, performed in duplicate on samples taken at these dates, showed a MI of 0.5%/4.8% and 7.7%/6.3% respectively. The MI was interpreted as follows: 0-3% not relevant; 3-5% inconclusive; >5% clinical significant. The patient's parents were typed heterozygous, IN:1,2 whereas her husband was homozygous, IN:-1,2. Due to the husbands phenotype, the fetus was predicted to be In b positive. Doppler flow measurement of the peak systolic velocity in the middle cerebral artery of the foetus was normal. Delivery took place at GW 41 without increased bleeding. The neonate presented no clinical manifestation of HDFN. Neither the mother nor the baby required blood transfusions. Summary/Conclusions: We report the case of a pregnant woman of Indian origin with an anti-In b alloantibody. The first MMA, performed in GW 32, was inconclusive whereas the second MMA, performed in GW 36, indicated that the antibody was clinically significant. If the MI-increase is only due to the pregnancy or has also a clinical significance, cannot be stated. In b negative blood components were not available and the patient's relatives were all In b positive. Therefore, measures to avoid transfusions, including optimised peripartal management of haemostasis, was of utmost importance. With only few cases published, the risk of HDFN could not be excluded with certainty. An intrauterine investigation by Doppler was performed to exclude relevant anaemia of the fetus. No transfusion was needed at delivery as there were no haemorrhagic complications. The neonate presented no clinical signs of HDFN. Background: Hemolytic disease of the fetus and newborn (HDFN) is a disease which if untreatedcan cause perinatal mortality and morbidity with a substantial risk for long-term sequela. In Albania we lack of studies in this field. Aims: The aim of this study is to determine the predictive value and the reliability of the "critical titre" during the evaluation of red cells alloantibodies ability to cause the Hemolytic Disease of Fetus and Newborn. Methods: We conducted a descriptive, cross-sectional study. The data were collected in the University Hospital for Obstetrics and Gynecology in Albania. In the study were included 20 immunized pregnant woman for anti-D antibodies and their newborns which were affected from the Hemolytic Disease of Fetus and Newborn. The data belong to the period 2013 and 2018. Results: The "Critical Titre" in our study was 8, meaning that this was the minimal value of the titre antibodies that could cause Hemolytic Disease of Fetus and Newborn. Our study concluded that only 2 newborns were born without the Hemolytic Disease of Fetus and Newborn and the titre values were less than 4. Moderate Hemolytic Disease of Fetus and Newborn were caused between the titre values 8-32. The Summary/Conclusions: The titre values of the mothers are a predictive option of the high risk of giving birth to a child with the Hemolytic Disease of Fetus and Newborn. It is recommended that in this cases the mother should be followed with Doppler Ultrasonography to measure the blood flow of the middle cerebral artery. Also the doctors should recommend in pregnant women with positive Coombs test not only the identification of the anti-D antibodies but also the identification of the other antibodies such as anti-E, anti-c, anti-K. Background: RhD-negative pregnant women with allo-anti-D are at risk of having a fetus affected by haemolytic disease of the fetus and newborn (HDFN) where the fetus is RhD-positive. The RHD allele is highly polymorphic and many RHD variants give rise to an array of partial D phenotypes. The clinical significance for many partial D phenotypes is not well-established. RHD genotyping by Non-invasive Prenatal Testing (NIPT) to assess the fetal RHD status determines whether the fetus is at risk for HDFN. NIPT tests also include strategies for detecting maternal RHD variants to provide for accurate reporting. However, the presence of a paternal RHD variant, while having the potential to confound NIPT interpretation, is often not recognised. We report a "trio" family study triggered by a request for NIPT for an RhD-negative pregnant mother, 16 weeks gestation, who presented with allo-anti-D and anti-Jk a antibody. Subsequent paternal and fetal RHD genotyping was conducted and revealed a novel variant RHD allele. Aims: We aim to characterise the paternal RHD allele and review clinical case features. Methods: Rh phenotyping was performed by standard serological procedures. NIPT tested for fetal RHD Exons 4, 5 and 10. RHD genotyping on whole blood/cord blood DNA was performed on the Immucor Bioarray RHD BeadChip kit which predicts a RhD phenotypic variant of best fit. DNA sequencing was performed using the Illumina TruSight One Sequencing panel. Copy number variation (CNV) analysis was used to assess the RHD exon structure and zygosity. Results: The paternal red cells typed as group O RhD+C-c+E-e+, (Ror). NIPT genotyping detected fetal RHD signals for all 3 exons, predicting RhD-positive. No maternal RHD sequences were detected consistent with homozygosity for the RHD deleted haplotype. For both paternal and cord genomic DNA (gDNA), BeadChip genotyping predicted a RhD variant "DIIIa/ceHAR". Furthermore, signal drop out was observed at 3 nucleotide positions (c.1154, c.1193, c.1227) located in RHD Exon 9 suggesting Exon 9 was either deleted or RHCE-replaced. Paternal and cord gDNA sequencing detected 4 out of 6 SNPs (c.186G>T, c.410C>T, c.455A>C, c.602C>G) associated with DIIIa phenotype plus 2 additional SNPs (c.604G>A, c.733G>C) on the RHD gene. Both were RHD hemizygote by CNV analysis. No RHCE variants were detected. Clinical case features: The maternal anti-D quantitation increased from 5.3 IU/ml (16 weeks gestation) to 166 IU/ml (33 weeks gestation). The fetus required 3 intrauterine transfusions during the pregnancy to manage the HDFN. Summary/Conclusions: Both father and fetus carry an RHD allele that does not align with alleles encoding DIII phenotypes. This putative novel RHD variant allele comprises SNPs associated with DIIIa and with a possible Exon 9 deletion/RHCEreplaced. A similar allele was reported in literature, although based on sequence analysis only, with no phenotype data. The variant allele here encodes RhD-positive phenotype and we predict that there may be a loss of D-epitopes. Notwithstanding, the clinical presentation shows that maternal anti-D against this RhD phenotype (presumed partial) is associated with a severe HDFN and that such RhD blood group phenotypes are of clinical significance for alloimmunised pregnancies.

Abstract withdrawn. Background: CD109 is a glycosylphosphatidylinositol (GPI)-anchored protein with apparent molecular mass of 170 kDa. In addition to being expressed on human PLTs, CD109 is expressed on activated T-cells, endothelial cells, CD34 + hematopoietic stem cells as well as on progenitor cells. In the Chinese population, the calculated allele frequencies of HPA-15a and -15b are 0.505 and 0.495, respectively. Based on these data, the risk of alloimmunization against HPA-15 alloantibodies due to incompatible PLT transfusion or pregnancy is expected to occur in relatively high frequency. However, until today there is no report of HPA-15 alloimmunization in the Chinese population. In this study, we analyzed sera from hydrop fetus cases by MAIPA technique and ICFA. Aims: To detect the anti-HPA 15b alloantibodies by MAIPA and ICFA. Methods: A 24-year-old mother, gravida 2/para 0. The mother in the first pregnancy was diagnosed hydrop fetus at pregnancy 33 weeks by ultrasound. In the second pregnancy, fetal hydrops was observed by ultrasound at pregnancy 24 weeks. The mother's irregular antibody test was negative. The Maternal platelet specific antibodies and HLA antibodies were negative. Blood routine and morphological examination of fetal umbilical cord blood showed that PLT count dropped to 4.7 9 10 10 /L, WBC count dropped to 2.96 9 10 10 /L, including Neutrophil 37%, lymphocyte 16%, mononuclear 43%, eosinophil 2%, basophil 2%, Red blood cells were normal, Hb was 111 g/L. Screening for HLA and PLT-specific antibodies was performed using a ELISA-based PLT antibody kit (PAKPLUS, GTI Diagnostics) as recommended by the manufacturer. PLT antibodies were detected by ICFA and MAIPA.HPA genotyping was detected by CPR-SSP. Results: The fetus's genotype was HPA-1a/a, -2a/a, -3a/a, -4a/a. -5a/a, 6a/a, 7a/a, 15a/b, Naka (+) and the maternal was HPA-1a/a, -2a/b, -3a/a, -4a/a. -5a/a, 6a/a, 7a/ a, 15a/a, Naka (+). The paternal genotype was HPA-1a/a, 2a/b, 3a/a, 4a/a, 5a/a, 6a/a, 7a/a, 15a/b, Naka (+), which was the only incompatible antigen compared with the maternal HPA. Samples were tested using the fresh PLT panels consisting of HPA-15aa and -15bb homozygous donors. The reactivity of the negative control and the mother's sera with the PLTs from HPA-15a/a (Donors 1), HPA-15a/b (Donors 2) and HPA-15b/b (Donors 3) donors by MAIPA. The mother's serum showed no reactivity against 15a/a PLTs, weak positive reactivity against 15a/b PLTs (OD values 0.28), but strong reactivity against 15b/b PLTs (OD values 0.38).This finding could be confirmed by one of the reference PLT laboratories (Japanese Red Cross Kanto-Koshinetsu Block Blood Center, Japan) using freshly isolated PLTs from HPA-15genotyped donors (Anti-HPA-15b average value 9.8). Summary/Conclusions: In this study, we found anti-HPA-15b in a case of FNAIT (patient HPA-15aa, blood group O) using the MAIPA technique. We were able to detect the presence of HPA-15b alloantibody in one case of NAIT. Background: Fetal and neonatal alloimmune thrombocytopenia (FNAIT) occurs in 1:10000 live births in Caucasians. Serological and molecular Human Platelet Antigens (HPA) genotyping tests are performed to investigate and conclude to FNAIT diagnosis. However, in few cases and particularly in case of suspicion of private platelet antigen, some specialized analyzes must be performed in the laboratory (lab). These analyzes can range from Sanger or NGS sequencing to platelet serology with transfected cells. Aims: The aim of our study was to explore where the frontier between research and care takes place in the field of Platelet Immunology through the prism of the FNAIT investigations carried out by the Platelet Immunology laboratories. Methods: A two-part electronic survey have been sent to foreign platelet immunology experts (PIE) from Platelet Immunobiology Working Party (PIWP) members and ESPGI board members (n = 40). The first part focused on the lab practices and regulatory environment regarding to accreditation, contact with patient, informed consent and patient results. The second part stressed on the investigations performed to discover new platelet antigen and more precisely on the perceived status of these analyzes ( Background: Haemolytic disease of the fetus and newborn (HDFN) can occur when maternal red cell antibodies, directed against red cell antigens present on the fetal red blood cells, cross the placenta and enter the fetal circulation. In a "traditionally" conceived pregnancy, when HDFN occurs, it is as a result of maternal antibodies directed against fetal red cell antigens in the heterozygous state, whereby the antigen is inherited from the father only. With the advent of donor oocyte (DO) in-vitro fertilisation (IVF), the addition of a third person into the reproductive equation allows for the possibility of a more severe form of HDFN when fetal red cell antigens are present in the homozygous state (one copy from father and one copy from donor) and maternal antibodies are directed against these. Antigens expressed in the homozygous state will have more antigens sites per red blood cell and therefore are at an increased risk of red cell destruction from the maternal derived cognate antibodies.

Aims: To raise awareness of increased severity risk of HDFN in donor oocyte conceived pregnancies. Methods: We describe two unusual cases of HDFN in our institution of two women whose pregnancy was induced using a donor oocyte and their offspring requiring transfusion support in the postnatal period to treat HDFN. Results: The first is a case previously reported (Doyle, Quigley, Fitzgerald et. al. Transfusion Medicine, 2014 ) of protracted HDFN due to anti-c, managed with phototherapy initially, then intervention with red cell top-up transfusion at 4 weeks post-delivery. The second is an unusual case of severe ABO HDFN requiring exchange transfusion therapy (pre-publication). Summary/Conclusions: Given the increased number of pregnancies conceived using DO we recommend that antenatal guidelines are reviewed to create awareness regarding the potential increased risk of HDFN in DO pregnancies complicated by allo-immunisation. Critically, antenatal testing guidelines should highlight that the predicted outcomes associated with quantitation/titres can only be used when DO has not been used to obtain the pregnancy. It is also essential that clinicians inform the blood transfusion laboratory when DO has been used.

Abstract withdrawn. 19%) are deceased due to organ rejection, and 8/36 patients (22%) are deceased due to disease not related to rejection. Summary/Conclusions: The use of therapeutic plasma exchange for the treatment of antibody mediated rejection in solid organ transplant is safe and effective when used along with other treatment modalities. Further studies will help determine whether it can be reproduced in larger cohorts and whether it is more effective in certain organs. Background: Extracorporeal Photopheresis (ECP) is an important cellular therapy for the treatment of several (auto-)immune diseases such as graft-versus-host disease. The international standard for the ex vivo treatment of the leukapheresis product is the application of 8-Methoxypsoralen (8-MOP) and irradiation with UV-A light. However, the addition of 8-MOP to the illumination bag is associated with a potential risk of contamination. Aims: The basic principle of the ECP is the induction of apoptosis in the leukocytes. Our aim was to find an alternative for the conventional apoptosis induction without the need of external substance application. The objective of the study was the investigation of the apoptosis levels and kinetics in leukocytes after treatment with 8-MOP+UV-A compared to UV-C treatment without additional 8-MOP. Methods: We used an in vitro 72 h cell culture approach with human mononuclear cells from healthy blood donors. Untreated control cells were compared with 0,2 lg/ ml 8-MOP plus 2 J/cm 2 UV-A treated cells and 2 J/cm 2 (effective dose) UV-C treated cells. Apoptosis in several leukocyte sub-populations was detected daily with Annexin V and 7-AAD flow cytometry standings. Results: The apoptosis analysis of CD3 CD4 T-helper cells, CD3 CD8 cytotoxic Tcells, CD19 B-cells, CD14 Monocytes, CD3 neg CD56 NK-cells and CD3 CD56 NKT cells revealed no statistical differences in almost all of these cell types after treatment with 8-MOP/UV-A or UV-C light. The apoptosis kinetic as well as the final apoptosis after 72 h were similar in both treatment groups. Summary/Conclusions: The addition of 8-MOP to the photopheresis irradiation bag is a risk for potential infections. The main effect of the 8-MOP/UV-A treatment is most probably the induction of apoptosis in the leukocytes. Here, we provide information that this induction of apoptosis can also be achieved with UV-C irradiation without the need of 8-MOP addition. The apoptosis patterns in most leukocyte subpopulations are very similar after treatment with UV-C compared with 8-MOP/UV-A treatment. Future in vivo studies are needed to prove the therapeutic effect of UV-C treated cells in the ECP setting.

Abstract withdrawn. Background: Therapeutic Plasma exchange (TPE) is performed to remove the implicating substances from the plasma causing the disease. A periodic appraisal of TPE data is important to get insight into the procedural related effects and toxicities and overall outcome in order to have a guided future approach. Aims: The purpose of this study is to observe the overall profile and outcome of the patients receiving the TPE in the Medicine Intensive Care Unit (MICU) of a tertiary care hospital in South India. Methods: A record based audit was conducted for the all the patients who were admitted to our tertiary care hospital of South India with 16 bedded MICU and received TPE therapy between 1 June, 2016 and 31 December 2018. All the TPE procedures were performed using Haemonetics Multicomponents System (MCS) + LN9000 apheresis system based on intermittent flow centrifugation. We audited our TPE for: number of treatments, clinical indications, treatments prescribed and administered, any procedural or patient complications, and adherence to current best practice recommendations. Results: Sixty nine patients had undergone 269 TPE procedures. Among them, thirty were female patients (43%). The median age 45 (13-75) years. Guillain-Barre Syndrome (GBS) was the most common indication (72%) followed by cases of Thrombotic thrombocytopenic purpura, diffuse alveolar hemorrhage, myasthenia gravis, autoimmune encephalitis and hypertriglyceridemia respectively. The TPE regimens received by patients in this ICU were not always prescribed in accordance with current best practice recommendations. There were 48 (18%) episodes of patient related complications during the TPE treatments. In 8 (3%) procedures, technical error in the machine was encountered. Summary/Conclusions: The findings of this audit have identified differences between the current prescription recommendations for TPE and those applied. The infrequency of the therapy and the different indications may present a challenge for Medicine Intensive Care clinicians to provide best care in all cases. Background: Microangiopathic hemolytic anaemia (MAHA) encompasses a spectrum of disorders characterised by widely disseminated thrombosis in small blood vessels resulting in formation of schistocytes and concomitant thrombocytopenia. Plasma exchange (PE) needs to be considered as empirical and urgent life saving therapy in these disorders irrespective of waiting for specific testing like ADAMTS 13 levels in Thrombotic thrombocytopenic purpura (TTP) or Complement levels or factor H antibodies in Atypical Hemolytic uremic syndrome (aHUS). Aims: To assess the efficacy and safety of plasma exchange in patients diagnosed as having microangiopathic hemolytic anaemias. Methods: A retrospective analysis of all PE procedures performed in patients diagnosed as having MAHA was done over a period of 9 years (2007) (2008) (2009) (2010) (2011) (2012) (2013) (2014) (2015) (2016) . Procedures were done on apheretic device (Cobe Spectra, Terumo BCT, Lakewood Co. USA). Patients' pre and post procedural hematological and renal parameters were analyzed by applying paired T test. Adverse event if any was recorded. Results: PE was performed in 46 patients with diagnosis of MAHA (27-aHUS, 16 -TTP, 1 each of post stem cell transplantation drug induced thrombotic microangiopathy (TMA), post thyroidectomy TMA and post-partum TMA). The mean age of patient was 19.94 AE 19.58 years with M:F as 1.5:1. Number of procedures per patient varied from 1 to 27. Post PE recovery was observed within 10-14 days with statistically significant increase in mean platelet count from 40.05 AE 5.9 to 82.11 AE 12.10 9 10 9 /L (P = 0.000) and significant decline in mean lactate dehydrogenase level from 48.91 AE 34.73 to 10.98 AE 6.49 lkat/L (P = 0.000). There was also significant decline in mean percentage of schistocytes in peripheral smear from 5.44 AE 3.96% to 0.56 AE 0.89% (P = 0.000). The mean serum urea changed from 48.88 AE 24.56 to 24.50 AE 17.78 mmol/L and creatinine from 266.11 AE 142.59 to 173.09 AE 127.34 lmol/L (P = 0.000 and 0.001 respectively) with significant increase in urine output from 0.71 AE 0.53 to 1.06 AE 0.33 ml/kg/h (P = 0.000). Adverse events were observed in 10 patients (21%), allergic reaction to replacement fluid (n = 6) being the commonest followed by hypotension (n = 2), rigors and chills (n = 2). Overall survival rate at 6 months was 89%. Summary/Conclusions: PE had proven its safety and usefulness as life-saving first line treatment modality in MAHA. Prompt and aggressive treatment helps in achieving early and complete remission in these patients. Background: Neuromyelitis optica (NMO) also known as Devic's disease or Devic's syndrome is a rare demyelinating disease of the central nervous system that most often results in selective involvement of the optic nerves (optic neuritis) and spinal cord (myelitis)and has female preponderance. Neuromyelitis optica (NMO) attacks are poorly controlled by steroids and evolve in stepwise neurological impairments. Assuming the strong humoral response underlying NMO attacks, Therapeutic Plasma Exchange is an appropriate technique in severe NMO attacks. Aims: To study the effect of TPE in Neuromyelitis Optica. Methods: A 17 year old Female in the Medicine department, Civil hospital, Ahmedabad admitted with chief complains of weakness and numbness in the arms and legs, blurred vision, reduced sensation, difficulty in controlling bladder and bowels, uncontrollable vomiting and hiccups since 2-3 days in the medicine department, Civil hospital, Ahmedabad. Attacks were treated with short courses of high doses of intravenous corticosteroid -Methylprednisolone Intravenous. But there was no clinical improvement. Results: Clinician advised for the trial of TPE in this patient. The procedure was performed by automated device with continuous flow centrifuge machine Fresenius Kabi-COM.TEC using double lumen femoral catheter. After obtaining informed consent from the relative of the patient, 6 cycles of TPE were performed on daily basis.

After 6 cycles, both subjective and objective clinical response to TPE was estimated by three different sources (the patient, a Transfusion Medicine Physician, and the treating Neurologist). [1] For Motor Performance, patient was assessed on a disability scale (0 = healthy; 1 = minor symptoms; 2 = able to walk 5 meters without support; 3 = able to walk 5 meters with support; 4 = confined to bed or wheelchair; 5 = requiring assisted ventilation; 6 = dead).Patient's motor performance was increased to Scale 1(Upper limb) and 2(Lower Limb) from Scale 5, deep tendon reflexes were normal. Visual function began to improve 1 week after the treatment. Visual acuity was 6/6 after 4 weeks. Summary/Conclusions: Assuming the strong humoral response underlying NMO attacks, Therapeutic Plasma Exchange is an appropriate technique in severe NMO attacks. This suggests that TPE is beneficial in NMO patients during acute attack if there is no response to corticosteroid treatment. Background: Babesiosis is a tick borne infectious disease caused by the protozoa Babesia. While most infections with Babesia are asymptomatic, some patients present with a symptomatic infections and rarely this can be a severe life threatening illness. Treatment is primarily with antibiotics but red cell exchange (RCE) has been used in the more severe cases which are characterized by high grade parasitemia, evidence of severe hemolysis and or multi-organ failure involving the kidney, lung or liver. A threshold parasite level of 10% has arbitrarily been applied as an indication for RCE, however, this threshold is not evidence based. Aims: To report on patients with babesiosis and high grade parasitemia who were treated with antibiotics only without RCE Methods: Data were collected from July 2014 to July 2018. A case was defined as a patient diagnosed with babesiosis for whom RCE was requested on the basis of a parasitemia of > 10% but on clinical evaluation it was considered that RCE could be withheld and the patient monitored awaiting response to antibiotics. Results: Three cases of severe babesiosis in which the use of RCE was requested on the basis of a parasite level of greater than 10%, but was not performed. The RCE was deferred on account of the good clinical state of the patient and the absence of renal failure. Levels of parasite at diagnosis were 10.6%, 11% and 31%. All patients were followed daily until discharge. Two of these patients had been splenectomized and each received a single unit of red blood cells during the hospitalization. The third patient had a long history of refractory lymphoma and was pancytopenic requiring multiple transfusions during the years before the diagnosis of babesiosis. She had transfusion transmitted babesiosis from a red blood cell transfused 46 days prior to the diagnosis. All three patients responded well to antibiotics and were discharged between 9-16 days with undetectable parasites. Summary/Conclusions: This small case series suggests that requests for RCE solely on the basis of an arbitrary level of parasitemia should be questioned and the clinical state and evidence of organ failure considered in the decision to perform RCE.

Abstract withdrawn. Chronic Transfusion Program (CTP) remains the gold standard therapy for stroke prevention and for patients with a severe disease who have inadequate response to hydroxyurea treatment. Aims: To evaluate the safety, efficacy and cost between SCD patients on CTP that underwent both AET and Partial Manual Exchange Transfusion (pMET) procedures. Methods: Retrospective observational cohort study of patients with SCD on CTP that have switched between pMET and AET. This study was carried out from 01/01/2017 to 31/12/2018 in a hospital in Portugal. Data on patient history, haematological values, duration of the procedure, intervals between them, adverse events as well as the cost of material and working hours were collected and compared between both procedures. Results: A total of 6 patients met the inclusion criteria described. However, 1 patient was excluded from our study because of the lack of attendance to the CTP. During the study, we recorded 88 exchange procedures (42 pMET and 46 AET), both on peripheral venous access. From all those procedures the major concern was the poor venous access, which was the reason why 2 patients had returned to pMET. No major complication or alloimmunization was observed. The indications for CTP were cerebral vasculopathy (N = 2), stroke (N = 1) and recurrent vaso-occlusive crisis with multiorgan failure (N = 2). For both procedures, target values were to obtain a pre-exchange HbS level ≤ 30% for stroke and cerebral vasculopathy and ≤ 50-60% for other indications. The median HbS level before pMET was 42,6% (31,3-59,1) and 38,4% (18, 9) before AET. We documented a higher HbS level prior to the next procedure in 11,4% of patients (N = 10). Despite that all patients remained stable without any major SCD related event. Both procedures were well tolerated and iron overload was well controlled (median ferritin level pMET: 1356,1 vs. AET: 1314,7 ng/mL). The duration of the exchange procedure was longer and the intervals between procedures were shorter with pMET (median pMET: 360 vs. AET: 60 min and pMET: 21 vs. AET: 24 weeks, respectively). Annual RBC requirements per procedure were superior (median 2 vs. 4 units) and the overall costs related with AET were 2,2 times higher -18.180,93€ and 8.174,79€ AET and pMET, respectively (estimated cost per session AET: 790,48€ and pMET: 389,28€). Summary/Conclusions: Our study shows, that the HbS level before both procedures, performed during the same interval, was similar. We verified that pMET has a comparable efficacy with AET in terms of preventing the development or progression of chronic complications and that the cost per procedure is significantly higher with AET. However, in a clinical situation where it is important to rapidly reduce the HbS level, and/or where the control of the target HbS is stricter so that the patients are clinically controlled without an increase in hospital visits, AET is preferred. We conclude that AET is more effective in the rapid reduction of HbS and ferritin levels, as well as being less time consuming. Despite this, for the reasons described above, it is more cost-effective to maintain both AET and pMET procedures. Background: Erythrocytapheresis/Red Blood Cell (RBC) exchange, involves removing of a large number of RBCs from the patient and returning the patient's plasma and platelets along with compatible allogenic donor RBCs. Typical indication for RBC exchange is Sickle Cell disease and its related complications. However, one of the miscellaneous indications of RBC exchange is for the patients of methemoglobinemia who are refractory to treatment by methylene blue. Acquired methemoglobinemia is more common than any genetic causes. Acquired methemoglobinemia is caused by toxins that oxidize heme iron, notably nitrate and nitrite-containing compounds.

For patients failing to respond to standard treatment with methylene blue or in whom its use is contraindicated; hyperbaric oxygen or RBC exchange is indicated Aims: Case reports on use of RBC exchange in methemoglobinemia are few and indications are based on anecdotal reports. Methods: Exchange was performed on the Cell Separator machine, Com Tec by Fresenius Kabi. Results: We report a case of acquired methemoglobinemia where patient was admitted with peripheral capillary oxygen saturation (SpO2) of 87% on air. The patient did not show improvement in SpO2 level with effective emergency treatment of methylene blue. Since, the patient was refractory to treatment with methylene blue, the decision was made by clinician to proceed with RBC exchange. The patient improved significantly after two cycles of one RBC volume automated RBC exchange, and was discharged with SpO2 of 97% on air. Summary/Conclusions: Automated RBC exchange can be used in patients of acquired methemoglobinemia successfully when methylene blue is ineffective, and may be superior to manual one. Background: Therapeutic plasma exchange (TPE) is known to disturb the pH and electrolyte status. Patients with compromised liver functions may be at a higher risk of electrolyte imbalance due to metabolic abnormalities. Aims: The aim of this study was to analyze the variation in pH, ionized calcium, sodium, potassium, and bicarbonate in liver disease patients undergoing TPE. Methods: Patients with liver disease undergoing TPE during the period from July 2016 to August 2017 were included in the study. Data on patient demographics, details of the TPE procedure, blood gas analysis report and adverse effects of TPE (if any) were collected and analyzed. Results: One hundred and seven procedures were done during the study period; of these 46 (43%) were done on the MCS plus (Haemonetics Corporation) and rest 61 (57%) were done on the Spectra Optia (Terumo BCT). The percentage change in ionized calcium, sodium, and potassium due to the procedure was found to be statistically significant (P = 0.000). The systolic (P = 0.010) and diastolic (0.001) blood pressure also changed significantly with the procedure. The predictors for the change in ionized calcium were found to be pre-procedure ionized calcium (P < 0.001), the age of the patient (P < 0.001) and the pre-procedure pH (P = 0.002). Procedurerelated complications occurred during 30 procedures of which 13 complications (12.15%) were categorized as features of hypocalcemia. No association was found between hypocalcemic manifestations and pre-procedure calcium, change in calcium, age or gender of the patient. Summary/Conclusions: The TPE procedure in liver disease patients causes remarkable changes in ionized calcium, sodium, potassium and bicarbonate ions. The decrease in ionized calcium during the procedure is predicted by pre-procedure ionized calcium levels, pH and age of the patient. Monitoring of these parameters and appropriate corrective measures are imperative to patient safety. Background: Therapeutic plasma exchange (TPE) in pediatric age group is technically demanding because of low blood volume, difficult venous access and poor cooperation of the patient during the procedure. We here present our experience of TPE in pediatric patients from our centre. Aims: To assess the challenges during TPE in pediatric patients and formulate appropriate strategies. Methods: We did retrospective analysis of all TPE procedures performed in pediatric patients over a period of 16 years (2001) (2002) (2003) (2004) (2005) (2006) (2007) (2008) (2009) (2010) (2011) (2012) (2013) (2014) (2015) (2016) . TPE procedures were done on two different apheretic devices (CS 3000 plus, Fenwal USA and Cobe spectra, Terumo BCT Lakewood, Colorado) daily or on alternate days depending on clinical condition of the patient. For all procedures, kit was primed with compatible packed red cells. Adverse events during the procedure were noted and analyzed.

Results: A total of 356 TPE (range 1-22/patient with mean of 6.2 procedures) were performed for 55 pediatric patients with different indications like atypical HUS (category I as per American Society for Apheresis (ASFA) in total 44 patients, Neuromyelitis optica (category II) in 4 patients, Rapid proliferative glomerulonephritis (category I), C3 glomerulopathy in 3 patients each and one patient of infective hemophagocytosis. The average age of patient population was 7.8 yrs (1.2-13 years) . The Male:Female ratio was 3:1 with an average weight of 25.5 Kgs. Adverse events were observed during 20 (5.61%) procedures. Most commonly observed adverse events were allergic reaction to replacement fluid (1.4%) followed by hypotension (1.1%), line occlusion (0.8%), vasovagal, endotracheal tube blockage and symptomatic hypocalcemia was observed in one procedure each (0.28%).There was no corelation observed between physical parameters of patient with adverse events. All adverse events were managed as per departmental standard operating procedures (SOPs) and procedures were completed successfully except in one where the procedure was abandoned. No mortality was observed during the procedures. Background: The hemoglobin (Hb) content of packed red blood cell (PRBC) units is heterogenous. The patient's blood volume is also variable which can be calculated based on the weight, height and body surface area (BSA) of the patient. The efficacy of a transfusion episode can be assessed if the Hb content of PRBC is known and the patient's post-transfusion Hb increment is determined.

Aims: This prospective study was performed to compare the efficacy of the transfusion of PRBCs based on Hb content versus the standard transfusion practice in thalassemia major patients. We also determined the correlation between Hb increment and the Hb content of PRBC units transfused.

Methods: A total of 160 registered thalassemia major patients of our institute were included in the study after excluding the patients who had allo-or auto-antibodies. The study was approved by the Institute Ethics Committee. The enrolled patients were randomly divided into two groups: Group I (n = 80)they received ABO/RhD identical PRBCs suspended in additive solution (saline, adenine, glucose, mannitol: SAGM-PRBCs) after determining its Hb content (units with Hb content ≥ 50 g); and Group II (n = 80)they received randomly selected ABO/RhD identical SAGM-PRBCs. The Hb estimation of the randomly selected units in group II was blinded. Following tests were done on pre-transfusion sample: Hb estimation using the hematology analyzer (Orion 60, Ocean Medical Technologies, India), blood grouping using tube technique, anti-human globulin (AHG) crossmatch and direct antiglobulin test (DAT) using gel technique (Biorad, Switzerland), antibody screening (ABS) using a fully automated immunohematology analyzer (Neo, Immucor, USA). On the posttransfusion sample collected 1 h after transfusion, Hb estimation and DAT were performed.

Results: There was no significant difference among the patient characteristics of the two groups. The mean Hb content of the SAGM-PRBC units was significantly higher (P = 0.000) in group I (Mean AE standard deviation: 67.86 AE 8.07 g; range: 50.80-92.13 g) than group II (60.92 AE 8.29 g; range: 40.86-86.76 g). The mean Hb increment in group I patients (3.26 AE 0.83 g/dl) was significantly higher (P = 0.04) than the group II patients (3.00 AE 0.76 g/dl). In both the groups I and II, there was a significant negative correlation between Hb increment and weight (P = 0.000 in groups I and II), age (P = 0.001 for group I; P = 0.032 for group II), body surface area (BSA) (P = 0.002 for group I; P = 0.000 for group II) and blood volume (P = 0.006 for group I; P = 0.000 in group II). In both the groups I and II, there was a significant positive correlation between Hb increment and Hb dose adjusted for BSA and the Hb dose adjusted for blood volume (P = 0.000 in both groups I and II for both the parameters). Summary/Conclusions: The efficacy of transfusion is more when patients are transfused with SAGM-PRBCs having Hb content of 50 g or more as compared to those who are transfused with randomly selected units. For optimal Hb increment in thalassemia major patients, the transfusion strategy should be based on the Hb content of the SAGM-PRBCs. Background: In male transfusion recipients under 50 years of age, receiving red blood cells (RBCs) from an ever-pregnant blood donor has been associated with increased mortality, compared to receiving a product from a male donor. Although it has been suggested that older units of RBCs could be associated with increased mortality, there are significant methodological challenges in these studies. Other studies indicated the freshest units of RBCs could be associated with increased mortality among transfusion recipients. We hypothesize both the association between ever-pregnant donors, and fresh units, with mortality could be caused by passenger leukocytes in the transfused RBC units, which decay during storage. Aims: To quantify modification of the effect of ever-pregnant donors on mortality in young male RBC transfusion recipients, by storage time.

Methods: Data on transfusion recipients receiving their first-ever RBC transfusion in one of six major Dutch hospitals between 20/03/2004 and 01/09/2015 was collected. For the current study, male transfusion recipients under 50 years receiving only transfusions from one donor sex exposure category were selected and followup was censored at three years after transfusion. Differences in storage time between groups were estimated by linear regression, adjusted for total number of transfusions, patient age, blood group, transfusion year and month. In a single-unit, single-transfusion cohort, cumulative mortality was estimated separately for patients receiving transfusions from ever-pregnant or male donors and for 'fresh' (<10 days storage) or 'old' (>24 up to 36 days storage) RBCs.

Results: For recipients of only blood from male donors, the storage time of the freshest unit was 0.47 day shorter when comparing the 221 patients who died, to 1,623 patients who survived (CI: À1.41 to 0.48). For recipients of only blood from ever-pregnant donors, the storage time of the freshest unit was 0.64 day longer when comparing the 27 patients who died, to 101 patients who survived (CI: À2.53 to 3.80).

In the single-transfusion cohort, 1,280 patients received a fresh RBC transfusion from a male donor, 52 of whom died; 138 patients received a fresh transfusion from an ever-pregnant female donor, 9 of whom died. 193 patients received an old transfusion from a male donor, 7 of whom died; 16 patients received an old transfusion from an ever-pregnant female, 2 of whom died. The 3-years cumulative incidence of death among young male recipients was 4.7% (confidence interval (CI): 3.6% to 6.2%) after a fresh transfusion from a male donor and 4.8% (CI: 2.2% to 10.4%) after a fresh transfusion from an ever-pregnant female donor. The 3-years cumulative incidence of death was 7.2% (CI: 3.8% to 13.6%) after an old transfusion from a male donor and 15.4% (CI: 4.1% to 48.8%) after an old transfusion from an everpregnant female donor. Summary/Conclusions: Prolonged storage of RBCs from ever-pregnant donors was not associated with decreased mortality at 3 years. Contrary to our expectations, our results indicate older units may potentiate the effect of ever-pregnant donors. However, due to limited sample size the observed differences were not statistically significant. Background: According to the literature review, there was limited impact of premedication (antipyretics, antihistamines and steroids) before transfusion on the prevention of adverse transfusion reactions (ATRs). However, the necessity of premedication remains controversial. The premedication before transfusion is still a common clinical practice in Pacific-Asian countries, along with the premedication rate ranging from 50 to 80%. In our previous investigation, we found that premedication rate was 92.5% in the outpatients in 2017, which was much higher than the reported rate in Asia. Aims: To investigate the incidence of ATRs and decrease premedication rate without increasing the rate of ATRs via education and evidence-based clinical practice.

Methods: The incidence of ATRs from April to December, 2017 was retrospectively surveyed. Evidence-based clinical practice was initiated since January, 2018. Clinical data of the outpatients receiving transfusion therapy were requested and analyzed from January to September, 2018. The incidences of ATRs and premedication rates in 2017 and 2018 were compared using chi-square test. A P value less than 0.05 was statistically significant. Besides, feedback of the incidence of ATRs and premedication rate was given quarterly to the clinicians during the investigation.

Results: From April, 2017 to September, 2018, a total of 5,018 blood units were transfused in the outpatients with 2,453 transfusion events. Of these, 25 cases of ATRs, including febrile nonhemolytic transfusion reactions (FNHTR) and minor allergic reactions were reported. The overall premedication rate in the outpatients was 92.5% in 2017, and was significantly decreased to 77.9% in 2018 (P < 0.001). It was reported that the incidences of ATRs in 2017 and 2018 were 0.48% and 0.52% per unit, respectively. There was no remarkable difference between the incidence of ATRs in 2017 and 2018 (P = 0.642). Summary/Conclusions: Via education and evidence-based clinical practice, we successfully reduced premedication rate without increasing the rate of ATRs in the outpatients. Furthermore, introduction of computerized provider order entry (CPOE) and clinical decision support system (CDSS) could be considered and be expected to prevent unnecessary premedication before transfusion, increasing the compliance with optimized transfusion strategies in the future. Methods: A retrospective analysis was done over a period of one year to evaluate clinical efficacy of 19 granulocyte transfusions in 15 hemato-oncology patients with febrile neutropenia. Mobilization of granulocyte donors was done as per standard protocol, which included subcutaneous injection of granulocyte colony stimulating factor (G-CSF) 5-10 lg/kg and tablet Dexamethasone 8 mg, 10-12 h prior to granulocyte harvest by apheresis. All granulocyte products were gamma irradiated before transfusion. Patient parameters like white blood count (WBC), absolute neutrophil count (ANC), hemoglobin and platelet count were recorded pre-and post-granulocyte transfusion. Infection related mortality (IRM) within 30 days of granulocyte transfusion was also recorded. Results: Minimum adequate granulocyte yield of 1 9 10 10 per unit was fulfilled in 90% of granulocyte harvests. Clinical indications for granulocyte transfusions were fever, an absolute neutrophil count (ANC) < 500/lL, evidence of bacterial and/or fungal infections (i.e. clinical signs of infection, positive cultures and radiological evidence) and unresponsiveness to appropriate antimicrobial therapy for at least 48 h. Effects of clinical, microbiological and granulocyte transfusion related variables on infection-related mortality were investigated. The post transfusion ANC (within 24 h) increased significantly (median value: 350/lL) as compared to baseline levels (median value: 40/lL) (P < 0.05). Infection related mortality was observed in only 20% (3 out of 15) of patients. Patients became afebrile within 2-4 days and culture negative within 3-6 days after granulocyte transfusion. For analysis purpose granulocyte transfusion episodes were grouped according to doses of granulocyte transfusions, based on European guidelines (standard dose: 1.5-3.0 9 10 8 cells/kg and high dose: >3.0 9 10 8 cells/kg Background: HSA's Blood Services Group (BSG) is Singapore's National Blood Service. In 2016, we conducted our pilot National PBM Audit to promote PBM practices. It was agreed that the audit would be performed annually with incorporation of a new indicator to continue promotion of PBM and sharing of good practices. Aims: To provide an update on the second National PBM Audit for 2017. Results are compared to the pilot audit and summarized below. Methods: We collected data on 3 performance indicators from 7 acute public care hospitals for 4 weeks each in March and August 2017 (the pilot audit covered 2 weeks in 2016). The performance indicators were: 1). Percentage compliance to documentation of red blood cell transfusion indications 2). Percentage of patients screened for pre-operative anaemia, 14 to 45 days before surgery 3). Peri-operative transfusion rates (3 days before to 3 days after surgery) for 6 commonly performed surgeries: coronary artery bypass graft surgery (CABG), total knee replacement (TKR), total hip replacement (THR), nephrectomy, colectomy and hysterectomy. The first two indicators assess PBM efforts and were measured in the pilot audit. Indicator 3) was added to the second audit to assess impact of PBM practices on transfusion in surgical patients. It was an appropriate time to incorporate this indicator as the hospitals would have been familiar with PBM since its introduction in 2012. Results and recommendations were shared with the Senior Management and Hospital Transfusion Committees of the participating hospitals. Results: For indicator 1), 2 hospitals had a compliance of 57-61%, the remaining 5 had a compliance of 90-100%. All 7 hospitals incorporated electronic blood ordering but the usage was not compulsory in some. Hospitals which mandated electronic ordering performed better as doctors could only order blood products after entering the transfusion indication. We saw compliance increase from 75% in 2016 to 100% in a hospital that had newly mandated electronic ordering. For indicator 2), results ranged from 30% to 92%. 2 hospitals made notable improvements when compared to 2016, achieving 83% and 88% respectively. They had implemented pre-operative workflows screening all elective surgical cases for anaemia at least 2 weeks before surgery. One hospital also started an outpatient intravenous iron service which reduced pre-operative anaemia rates. For indicator 3), mean number of transfused units for each surgery ranged from 1.5 to 2.8 units per patient, lowest being THR and highest being CABG. This suggests that some transfusions were potentially avoidable with more robust PBM practices. The rate of perioperative transfusions was highest for CABG at 46% and lowest for TKR at 7%. Summary/Conclusions: The annual National PBM Audit increases PBM awareness, allowing hospitals to share and learn good practices and implement measurable improvements. Based on this audit, a recommendation to mandate electronic ordering of blood products to improve adherence to red cell transfusion indications and implementing pre-operative workflows with consideration for Intravenous Iron support was made. This audit was more representative than the pilot, with a longer duration of data collection and incorporation of indicator 3) showing impact of PBM practices. Background: Autoimmune haemolytic anaemia (AIHA) is a decompensated acquired haemolysis caused by the host's immune system acting against its own red cell antigens. AIHA is a rare disorder and although British Society of Haematology (BSH) guidelines for diagnosis and treatment were published in February 2017, there is little evidence for clinical practice in the United Kingdom. Aims: To investigate the approach to the diagnosis, investigation and management of patients with autoimmune haemolytic anaemia (AIHA) in English NHS Trusts. Methods: We designed and distributed a survey to the clinical transfusion leads at all English NHS Trusts between November 2017 and March 2018. The survey requested information on detailed, simulated clinical scenarios. The first simulated scenario described a young patient with active AIHA 3 months after an allogeneic stem cell transplant, who has received multiple transfusions in the last 2 weeks and is hypotensive, tachycardic, with a falling haemoglobin (Hb), currently 48 g/l. The second scenario describes a young man with a new diagnosis of warm AIHA who has an initial Hb of 104 g/l and returns to clinic at a 2-week interval with symptoms of fatigue. He is actively haemolysing and commenced on 1 mg/kg prednisolone.

Results: There was a 42% (58/137) response rate by Trusts. Faced with a 4-6 h delay for allo-adsorption studies, 68% (38/56) of respondents would instead transfuse acutely with ABO, Rh and K matched red cells negative for any previously detected alloantibodies, 7% (4/56) would transfuse with O Rh D negative red cells and 25% (14/56) would wait for completion of allo-adsorption studies before transfusing. In this first scenario, a quarter of respondents appeared to delay a potentially lifesaving blood transfusion. 2017 British Society of Haematology guidelines recommend that when anaemia is life-threatening in the time required for full compatibility testing, ABO, Rh and K matched red cells should be transfused. In the 2017 Serious Hazards of Transfusion (SHOT) report, the most serious and fatal of 95 cases of preventable delayed transfusion was a patient with AIHA who died untransfused with an Hb of 38 g/l, while awaiting alloadsorption studies. A key SHOT message was that if clinical harm to patients from withholding blood outweighs safety concerns over a possible delayed haemolytic transfusion reaction, emergency blood is essential and should be offered. The second scenario also identified considerable variation in transfusion practice. It can take several weeks for patients with AIHA to respond to prednisolone so a transfusion threshold < 60 g/l after an Hb fall of at least 40 g/l in the previous 2 weeks is perhaps overly conservative. Summary/Conclusions: The overall findings support a need for studies to explore barriers to uptake of guidelines, and to identify areas for further audit and research to guide safe and appropriate transfusion practice in AIHA. Background: Balance between supply and demand of O D negative red cells remains a challenge for almost every blood service. With this re-audit, we wanted to collect objective and comprehensive information regarding usage of O D negative red cells supplied by NHS Blood and Transplant (NHSBT) to private and NHS hospitals in England. Aims: The aim was to understand hospital practices, actual needs and possible avoidable usage of O D negative red cells. Where possible, comparisons were made with two previous audits (2008) (2009) (2010) . Methods: Participating hospitals were asked to determine the fate of all group O D negative red cells they received between 14 th and 27 th May 2018 excluding substitutions and complete an organisational survey regarding activities, policies and stockholding practices with respect to O D negative blood. Participating hospitals were asked to provide (if available) the prevalence (as a percentage) of O D negative patients in their population. This information, in conjunctions with hospital activities, will be used to estimate appropriate O D negative stockholding levels. Background: O RhD-negative (neg) red blood cells (RBCs) are a precious resource, are often in short supply and transfusion of these units in emergency settings carries the potential risk of transfusion-related adverse outcomes such as haemolytic reaction due to minor blood group incompatibility. As such, their use should be closely monitored within health services. Most recent Australian guidelines (2008) for their use in emergency settings include pre-menopausal females of unknown blood group (mandatory indication) or while the blood group is being established; use should be limited to 2 or less units where possible before a switch to group-specific RBCs (acceptable indication).

Aims: Audit of use of emergency uncrossmatched O RhD-neg RBCs against national guidelines in our institution (an Australian tertiary metropolitan public hospital providing acute medical and surgical, emergency and critical care services). Methods: Use of emergency uncrossmatched O RhD-neg RBCs units over a six-year period was retrospectively reviewed. We collected information about RBCs transfused and discarded, adverse outcomes, patient characteristics, clinical indications and whether use met national guidelines or could have been avoided. Results: 105 episodes of emergency uncrossmatched O RhD-neg RBCs were identified, encompassing transfusion of 241 RBC units to 103 patients and the discard of 2 RBCs (due to incorrect transport). Of the 105 episodes, 78 episodes (74%) involved an eventual switch to group-specific RBCs (range of emergency units, 1-13 units). The main requester was the emergency department (53%). The most common clinical indication for transfusion was acute gastrointestinal bleeding (49%). Of the 105 episodes, 28 episodes (27%) did not meet the guidelines for emergency use because > 2 units of emergency uncrossmatched O RhD-neg RBCs were issued. 2 episodes (2%) were flagged as potentially inappropriate as the patients were clinically stable according to documentation in the medical records. 30 episodes (29%) were identified as potentially preventable due to delay in pre-transfusion sample collection (defined as > 1 h elapsed between patient arrival and group and screen sample collection) in the setting of acute bleeding (6%), receipt of an unsuitable pretransfusion sample requiring sample recollection (5%), delay in pre-transfusion sample processing (4%), no valid pre-transfusion sample being available at the time of the bleeding episode despite having a planned elective procedure or being an inpatient with recent clinical bleeding (10%). Only one patient was investigated for potential transfusion-related adverse outcome (1%) which was thought likely due to concurrent sepsis. Summary/Conclusions: Over six years, 105 episodes utilising emergency uncrossmatched O RhD-neg RBCs were identified with 241 RBCs issued and 2 RBCs discarded. A significant proportion of episodes (29%) were potentially avoidable if there had been a valid pre-transfusion sample available in the transfusion laboratory at the time of the episode. Efforts to minimise use of this precious resource are ongoing, and include feedback to clinical units regarding importance of valid pretransfusion samples prior to applicable invasive procedures and in bleeding patients, ongoing education to medical and nursing staff, and continuing audit of use of this blood component in the hospital haemovigilance programme.

Abstract withdrawn.

Abstract withdrawn. Background: Platelet transfusions are often given prophylactically to thrombocytopenic hematology patients. To which extent platelet function improves after transfusion, and how this improvement correlates with an increase in platelet count, is not well studied. Flow cytometry has been used to evaluate platelet function after transfusion in a few studies and can be performed even at low platelet counts. Rotational thromboelastometry (ROTEM) represents a more physiological measure of platelet function in whole blood that has not been extensively used in transfusion settings. We used these methods to investigate if platelet transfusion improves platelet function in hematology patients and if improvement correlates with increased platelet counts. Aims: The aim was to evaluate the relationship between response to platelet transfusion, measured as corrected count increments (CCI), and platelet function in thrombocytopenic patients with hematological disorders. Methods: Blood samples (sodium-citrate anticoagulated) were collected from unselected hematology patients receiving prophylactic platelet transfusions, after informed consent had been obtained. Samples were taken at three time-points: within 1 h before transfusion, 1 h after and 14-24 h after transfusion (via a central venous catheter or a subcutaneous venous port). For each time-point, platelet response to adenosine diphosphate (ADP) and thrombin receptor-activating peptide (TRAP-6) was assessed by flow cytometry by measuring P-selectin and PAC-1 expression on single platelets. ROTEM analysis was also performed on all samples, using INTEM and EXTEM reagents. Results: An interim analysis was performed after inclusion of 22 patients. The mean platelet count before transfusion was 8 9 10 9 /L (range 2-34 9 10 9 /L). 1 h CCI was 11 9 10 9 /L and 14-24 h CCI was 6 9 10 9 /L, but response was highly variable. Pselectin expression after stimulation with ADP and TRAP was significantly higher at 1 h after and 14-24 h after transfusion compared to before transfusion (P < 0.05). PAC-1 expression after stimulation with ADP was significantly higher at 14-24 h after transfusion (P < 0.001), but not at 1 h after transfusion. In ROTEM, clot amplitude at 10 and 20 min (A10 and A20) as well as maximum clot firmness (MCF) improved after transfusion (P < 0.05). A significant correlation between absolute platelet count and P-selectin expression after TRAP and ADP stimulation was found (r s =0.53 and 0.45 respectively, P < 0.001). Absolute platelet count was also significantly correlated with MCF (r s =0.61, P < 0.001), where 84% of patients with a platelet count of more than 20 9 10 9 /L reached MCF values within the reference interval. Summary/Conclusions: Platelet function generally improves after transfusion and was in our patient population correlated to the absolute platelet count, but was also seen at the single platelet level in flow cytometry. A post transfusion platelet count of more than 20 9 10 9 /L might be sufficient to significantly improve coagulation in heavily thrombocytopenic patients, but larger studies are needed to confirm this conclusion.

Abstract withdrawn.

Abstract withdrawn. Background: Sickle cell disease (SCD) is a genetic disorder that is frequently referred to as a hypercoagulable state. Hydroxyurea (HU) is known to decrease the frequency of vaso-occlusive complications and need for blood transfusions in severely affected individuals. Although cross-sectional studies show that treatment with HU is associated with decreased coagulation activation, there are no prospective studies evaluating the effect of HU on coagulation activation. Aims: To assess the effect of HU on markers of fibrinolysis (D-dimer) and endothelial activation (soluble vascular cell adhesion molecule-1 [soluble VCAM-1]) in patients with SCD in their non-crisis, "steady state." Methods: Patients, at least 10 years of age, with documented HbSS or HbSb-thalassemia, eligible for treatment with HU were studied in this prospective, observational study. Laboratory investigations were obtained at baseline, prior to commencement of therapy with HU, with repeat evaluations at three and six months of therapy. Non-parametric test was applied to observe the association between HU therapy and the biomarkers of interest. Results: Twenty-five patients with SCD (HbSS: 15, HbSb thalassemia: 10) were enrolled (females: 15 [60%]), with a median age of 23 years (IQR: 11). Following 6 months of HU, median values for WBC count (9.02 9 10 9 /L vs. 7.22 9 10 9 /L, P = 0.007) and D-dimer (1243.8 ng/mL vs. 830.2 ng/mL, P = 0.028) were significantly lower than baseline values, while the mean corpuscular volume (76.0 fL vs. 88.0 fL, P = 0.001) was significantly higher than the baseline value. No significant differences from baseline were observed in the median values for hemoglobin (9.1 g/ dL vs. 9.6 g/dL, P = 0.72), platelet count (250 10 9 /L vs. 196.5 10 9 /L, P = 0.71), lactate dehydrogenase (744 U/L vs. 567.5 U/L, P = 0.23) or soluble VCAM-1 (567.8 ng/ mL vs. 526.4 ng/mL, P = 0.33) following 6 months of HU therapy. Summary/Conclusions: This exploratory study confirms that treatment with HU is associated with decreased coagulation activation in patients with SCD, although no effect on endothelial activation was observed. By decreasing coagulation activation, HU may decrease the risk of thrombotic complications in SCD.

Abstract withdrawn.

Abstract withdrawn.

Transfusion Medicine, Apollo Gleneagles Hospitals, Kolkata, India Background: Reduction of immune responsiveness through blood transfusion has been documented by previous authors. Breast cancer is considered as one of the commonest cancer globally and the second main cause of death in females Transfusion of allogeneic blood in breast cancer surgery is variable and differences of transfusion incidence have been observed in the literature. Where the maximum surgical blood ordering schedule (MSBOS) dictates cross matching and reservation of blood before surgery, factors deciding their utilization are varied and numerous. Our hospital protocol guides that every patient planned for elective breast cancer surgery should routinely have a blood sample sent for reservation of one unit of compatible packed red blood cell (PRBC) in the blood bank. Aims: In this prospective study we aimed to audit the blood utilization in patients undergoing elective breast surgery and thereby optimize the blood ordering schedule, economic burden and loss of clinical resources. Methods: The study included 478 confirmed breast cancer patients planned for elective breast surgeries from January 2012 to December 2017. Patient and disease details like age, stage, TNM status, estrogen receptor (ER) and progesterone receptor (PR) status, human epidermal growth factor receptor 2 (HER -2) expression, triple negative breast cancer (TNBC) status, reproductive and treatment status were documented. Patients were divided into younger group [≤40 years] and older group (>40 years). Before surgery blood samples for compatibility testing were sent to blood bank for blood reservation. Details of test, blood issue and blood transfusion were documented in the blood bank. Approximate loss of time in minutes and wastage of resources in terms of money (INR) in the blood bank were noted. All results were calculated as mean AE SD and a 'P' value of < 0.05 was considered statistically significant. Results: Of the total 478 patients most underwent wide local excision of the breast and modified radical mastectomy. A total of 16 patients received 71 units of blood and blood components in all categories of surgeries. Only 103 were younger women (≤40 years) with mean age of 31 years. Non-transfused patients were significantly more than transfused ones (P < 0.05). Frequency of blood transfusion was more in young patients (4.9%). Seven (22.6%) of the total 31 stage IV patients received blood transfusions. Frequency of blood transfusion was more in patients undergoing surgery after chemotherapy (8.8%). A significant loss of time and loss of revenue was observed. Summary/Conclusions: We conclude that routine compatibility test is not justified for all patients undergoing breast surgery. A more targeted approach is needed to reduce blood demand and associated cost to patient and blood transfusion services. Background: Blood transfusion guidelines are not only essential for the optimal use of blood products, but also help reduce transfusion-related adverse reactions and improve patient outcomes. The Korean national transfusion guidelines were developed in 2009 and fully revised in 2016 by the Korean Centers for Disease Control and Prevention and the Korean Society of Blood Transfusion. In our hospital, which is a 700-bed university hospital, a transfusion-indication data-entry program based on the national transfusion guidelines was developed in 2016. It was applied to the electronic medical record system and all transfusion orders, except emergencies, have been performed through this program since then. Aims: We planned to record and analyze the reasons for transfusion in order to monitor blood product usage and provide feedback to clinicians. Furthermore, we intended to contribute to patient safety through the appropriate use of blood products. Methods: We classified transfusion-indications by the blood product requested and created a pop-up window listing these indications, which would appear at each regular transfusion order. Indications for transfusion with each blood product were as follows: Red blood cells (RBCs)acute blood loss, chronic disease (sub-classified as Hb ≤ 7 g/dL, cardiovascular disease, cerebrovascular disease, peripheral vascular disease, respiratory disease, age ≥ 65 years, age ≤ 6 months, chemotherapy), surgery/ procedure, transplantation and 'other'; Platelets (PLTs)present bleeding, bleeding prevention (sub-classified as hematologic disease, solid tumor, peripheral blood stem cell transplantation, disseminated intravascular coagulopathy, infant), surgery/procedure, massive transfusion and 'other'; Fresh frozen plasma (FFP)bleeding in coagulopathy, bleeding prevention in coagulopathy, massive transfusion, plasma exchange and 'other'. Transfusion indications entered into the data-entry program from Sep 2016 to Feb 2018 were analyzed. Results: The number of transfusion-indications analyzed was 16138 for RBCs, 11158 for PLTs and 6024 for FFPs. The most common indications for transfusion were chronic disease for RBCs (7977/16138, 49.4%), bleeding prevention for PLTs (5726/11158, 51.3%) and 'other' for FFP (2180/6024, 36.2%). 'Hb ≤ 7 g/dL' was the most frequent sub-indication of chronic disease (3570/7977, 44.8%), and hematologic disease was the most frequent sub-indication of bleeding prevention (3432/ 5726, 59.3%). Many clinicians entered transfusion indication as 'other': RBCs (2866/ 16138, 17.5%), PLTs (856/11158, 7.7%) and FFP (2180/6024, 36.2%). However, the free-text supplied by the clinician when 'other' was selected, often corresponded to an indication already categorized in the transfusion-indication data-entry program; 82.9% of RBCs and 54% of PLTs. Of the indications entered as 'other' in FFP, 80.3% were surgery/procedure-related. Summary/Conclusions: In our hospital, the release of blood products has been dependent on the data-entry of transfusion indications (except in emergencies) since Sep 2016. Transfusions of RBCs and PLTs were most common for chronic disease and bleeding prevention, respectively, but many cases entered as 'other' could have been categorized as existing indications in our data-entry program. Therefore, we conclude that additional training is needed for clinicians regarding the determination of transfusion-indications and correct use of the transfusion-indication dataentry program, in order to use blood products more appropriately. Methods: This was a prospective cohort designed study. Subjects were children aged 1-18 years with indication of platelet transfusions in Sardjito Hospital Yogyakarta Indonesia. The patient samples were collected before and 1 h post-transfusion, the expression of CD62P on platelet was determined by flow cytometry method. Results: There were 102 subjects who were divided into two groups. Fifty-one subjects received non-leukodepleted PCs and the other fifty-one transfused by pre-storage leukodepleted PCs. The mean of pre-transfusion platelet CD62P for nonleukodepleted and leukodepleted groups were 26.2% and 27.7%, and the mean increase of post-transfusion platelet CD62P for non-leukodepleted was 10.1% and the mean decrease of leukodepleted groups was 3.3%. It was shown the increase of post-transfusion platelet CD62P for non-leukodepleted group, and it was significantly (P < 0.05) higher than in the leukodepleted groups. Summary/Conclusions: There was an increase of post-transfusion platelet CD62P expression in patients received non-leukodepleted, but a decrease in leukodepleted PC transfusions. Background: Preoperative anaemia is a common finding in patients undergoing surgery and often neglected in our country. Aims: The objective of this study was to evaluate Hb(values and the identification of cardiac patients who entered operation with anaemia. And also to study the correlation between Hb values and the number of RBC (red blood cell) transfused unit Methods: This is a retrospective, descriptive and analytical study. The data for this study was collected from the files in the Statistic's Service at QSUT (University Hospital Center "Mother Teresa"). The object of our study were the files of 158 patients hospitalized in the period January -May 2018 in the Cardiac Surgery Ward, which were subjected to cardiac surgery. From the files were collected data on age, gender, primary diagnosis, accompanying diseases. We also collected Hb, RBC, Htc (hematocrit), MCV (mean corpuscular volume), MCH (mean corpuscular hemoglobin), MCHC (mean corpuscular hemoglobin concentration). From the Transfusion Service at QSUT and from the files were pulled out the transfused patients and the number of transfused units. Results: Based on the WHO definition for Anemia (females < 12 g/dl and males < 13 g/dl), from the 158 patients included in the study, 61 (39%) were anaemic. From 117 males in the study, 40 (34%) of them were anaemic based on Hb lab values, whereas from 41 women in the study anaemic were found to be 21 (51%) of them. From the 61 anaemic patients in the study, 35 (57.4%) of them with mild anaemia, 23 (37.7%) with moderate anaemia and 3 (4.9%) with severe anaemia. In the total of anaemic female 38.1% are under 65, while 61.9% are over/or 65 years old. In the total of anaemic males, 35% are under 65, while 65% are over/or 65 years old. It is noticed that most of them are with normochromic normocytic 67.2%, normocytic hypochromic anaemia 16.4%, hyperchromic microcytic anaemia 8.2%, macrocytic normochromic anaemia and macrocytic Hypochromic anaemia respectively 1.6% and microcytic normochromic anaemia 4.9%. The average value of preoperative Hb decreased from 12.8 g/dl before surgery to 10.3 g/dl after surgery, so there is a decrease of approximately 2.5 g/dl of Hb value. In our 158 patients, 48% (76) were transfused and the remaining 52% (82) were not transfused. From 76 transfused patients 41 (54%) patients were anaemic. The correlation between the values of Hb, RBC, Htc and the number of transfusions shows that with the decrease of these values the number of transfused units increases. Summary/Conclusions: The diagnose of anaemia is underestimated before surgical intervention in our country and investigation of Hb low values do not take the proper importance to find probable cause and correct it before surgical intervention. The lower the Hb values, the greater the chance to be transfused and the number of RBC transfused units. Failure to correct Hb values before surgery results in unnecessary transfusions for the patients or which could have been avoided, eliminating also the risk of transfusion complications. Background: Alloimmunization after red blood cell transfusion is affected by various factors. It is known that the incidence of alloimmunization increases in certain diseases. Extended red blood cell matching can be used to prevent the development of alloimmunization in diseases which the rate of alloimmunization is increased. In Asia, extended red blood cell matching is not actively implemented. Aims: We tried to investigate whether there is a difference in the disease categories between unexpected red blood cell antibody positive and negative groups. Methods: From January, 2003 to December, 2017, the diseases of the patients who had undergone unexpected red blood cell antibody identification test at Dong-A University Hospital was examined through medical records. From January 2008 to December 2009, the diagnosis was made on patients who had two or more unexpected antibody screening tests. We analyzed the frequency difference of disease category between two groups. Results: A total of 988 patients were performed with unexpected antibody identification tests. Of 1896 patients who underwent more than 2 screening tests, 25 (1.3%) were positive. 1871 were consistently unexpected antibody negative. The patients with solid tumors (N = 375, 56.3%) and those with hematologic diseases (N = 112, 16.8%) had a higher incidence in unexpected antibody positive group. The patients with myeloid malignancy had a significantly higher frequency than lymphoid malignancy (P = 0.0002). The frequency of patients with liver cirrhosis was significantly higher in the unexpected antibody positive group (65/988, 6.6%) than in the negative group (77/1871, 4.1%) (P = 0.006). The incidence of non-Hodgkin lymphoma was significantly higher in the unexpected antibody negative group (28/1871, 1.5%) than in the positive group (5/988, 0.5%) (P = 0.019). Summary/Conclusions: There was a difference in the distribution of diseases between unexpected antibody positive group and negative group. The patients with liver cirrhosis were more frequent in unexpected antibody positive group, suggesting that extended red blood cell matching would be considered. Background: In hematological patients with multiple platelet transfusions (PC) often develop immune response to human leukocyte associated antigens (HLA-I) and human platelet-specific associated antigens (HPA). Besides, platelet associated immunoglobulins (PAIg) and complement components (PAC) are found on platelet. This leads to increased platelet destruction and development of refractoriness to transfusions of donors' platelets. Transfusion therapy using an individual selection of platelets and plasmapheresis, contribute, in the majority of cases, to the realization of efficient transfusion by PC. But, in difficult cases, there is a need to use intravenous immunoglobulin, which may promote the efficient transfusion of PC. Aims: Evaluate the algorithms of using the complex therapy of refractoriness to transfusions of donors' platelets with additional application of intravenous immunoglobulin (IVIG). Methods: In 2018 there were three female patients in the clinics of the centre for observation, age between 29 and 51 years (Me = 39) with the ineffectiveness of complex therapy for overcoming refractoriness to transfusions of donors' platelets due to selection and plasmapheresis. The diagnoses were as follows: aplastic anaemia (AA)-2, acute myeloid leukemia (AML)-1. Individual selection of platelets was carried out by the adhesion method on the solid phase (Immucor "Galileo Neo"). PAIg and PAC3/4 were evaluated by the method of flow cytometry (BD FACSCanto II) by the method of double staining with CD41a. The density of fixed PAIg, PAC was © 2019 The Authors Vox Sanguinis © 2019 International Society of Blood Transfusion Vox Sanguinis (2019) 114 (Suppl. 1), 5-240 evaluated by the Median Fluorescence Intensity (MFI). The two patients with AA received IVIG-IgG therapy in the standard dose 0,4 g/kg per day, for 3 days. One patient with AML received IVIG-IgGAM therapy in the standard dose 5,0 ml/kg/day for 3.

Results: Under pressure of the complex therapy with the use of IVIG in the standard dose there was are decrease in MFI over time in the case of two patients: AA-1 MFI-PAIgG reduced from 926 to 65; while the patient with AML: PAIgA reduced from 5506 to 187, and PAIgM from 1971 to 302, PAC3 from 691 to 31, PAC4 from 404 to 103. The patient with AA-2 over time, regardless of the treatment, there was an increase of MFI, but the effect of PC transfusions was achieved under pressure of complex therapy. Under pressure of complex therapy all the 3 patients also reduced the frequency of reaction of alloantibodies when resorting to an individual selection and increasing the frequency of compatible couples "donor-recipient". Summary/Conclusions: Delivery of complex therapy and the additional application of IVIG enables an adequate transfusion therapy of PC, neutralize hemorrhagic syndrome and continue the treatment of the main disease. Detection and monitoring of PAIg/PAC during the development of refractoriness to transfusions of donors' platelets are additional markers for prescription of IVIG therapy. Anaesthesia, Tan Tong Seng Hospital, Singapore, Singapore

Background: Blood transfusion is quite prevalent in paediatric cardiac surgical procedures. We hypothesized that the routine use of rotational thromboelastography (ROTEM) to guide transfusion decisions would reduce the overall proportion of patients receiving transfusions in paediatric cardiac surgery Aims: The aim of the study was to find if the use of blood and blood products in pediatric cardiac surgical cases in a single centre is affected due to ROTEM. Methods: Sixty paediatric cardiac surgical patients undergoing CPB were included in this study. Thirty patients (study group) were prospectively included and compared with thirty procedure and age-matched control patients (control group). In the study group, ROTEM, performed during CPB guided intraoperative transfusions. Perioperative transfusions of blood and blood products, postoperative blood loss and hemoglobin levels were compared between the two groups.

Results: The patients in the control group received fewer transfusions of packed cells (60% vs 78%) and fresh frozen plasma (36% vs 84% P<o.oo1). More patients in the study group received platelets (72% vs 60%) and cryoprecipitate (50% vs 36%).

The postoperative blood loss was lower in study group compared to the control group. The postoperative hemoglobin did not differ between the two groups. Summary/Conclusions: The results suggest that the routine use of ROTEM in paediatric cardiac surgery to guide transfusions is associated with reduced proportions of patients receiving transfusions and is evidence based practice.

Abstract withdrawn.

Abstract withdrawn.

Abstract withdrawn. Background: Mycoplasma pneumonia (MP) infection has often been implicated in respiratory tract infections. Although this agent has also been associated with other non-respiratory diseases, hemolytic anemia is the most common hematologic complication of MP infection. Episodes of sudden onset of severe anemia are rarely seen in beta thalassemia. We report a 33-years-old female with beta thalassemia major who was diagnosed to have severe anemia secondary to autoimmune hemolytic anemia induced from MP infection Aims: To report a case of patient with beta thalassemia major who was diagnosed to have severe anemia secondary to autoimmune hemolytic anemia induced from MP infection and how it was managed with minimal transfusion.

Methods: A 33-year-old female case of beta thalassemia major who developed autoimmune hemolytic anemia following Mycoplasma infection. The patient is on monthly blood transfusion since the age of 3 years at Dubai Thalassemia Center. She was admitted to the hospital with 5 days history of dizziness, severe low back and joint pain and her travel history indicated a four-week visit to Pakistan. Initial investigations showed a hemoglobin level of 7.8 g/dL the direct and indirect coombs test were positive. Patient was transfused with two units leuko-depleted compatible PRBC (O, Rh +, negative for E and Kell antigens.) and discharged next day. Three weeks later, the patient was still with lower limbs pain and the hemoglobin was 8.5 g/dl with a positive DAT with both IgG+4 and C3+4, patient was not transfused as it was difficult to find matching blood; therefore she was given one week follow up. Four days later, patient reported to the center with fever, generalized body pain and fatigue. She had significant drop in hemoglobin 5.6 g/dl, MCV 85.0, Platelets count 216000, CRP 3.6, Retic count 2.18, Blood culture no growth, total bilirubin 1.5, Malaria parasite smear was negative, urine culture and microscopy were normal. Mycoplasma pneumonia antibody showed positive with IgG 57.1 and IgM 21.3, she was started on Azithromycin for 5 days and received 2 units PRBC least incompatible leuko-depleted (O, Rh +, negative for E and Kell antigens.). After which her hemoglobin increased to 9.3 g/dL. She did not show any improvement in her condition over the following 2 weeks and repeat Mycoplasma pneumonia antibody showed an increased titer, which denoted resistance to Azithromycin; hence, we started her with second line of treatment Levofloxacin for 10 days. Screening for collagen disease were all negative apart from high ESR of 130 mm/hr. Patient remained afebrile and transfused with least incompatible available blood, post transfusion Hb was 11.8 g/dl. Three weeks later, during her routine follow up, she was doing well with ESR dropping to 85 mm/hr and hemoglobin 10.2 g/dl, which indicated gradual settling of hemolysis, although the last DAT remained positive. Subsequent visits showed Hb drop of 1.2 g/dl/week which is acceptable for transfusion dependant thalassemia. Results: With conservative management patient condition improved. Summary/Conclusions: Hemolytic anemia associated with Mycoplasma pneumonia is usually self-limited and resolves spontaneously after mycoplasma infection elimination. Packed red cell transfusion in transfusion dependent patient may be troublesome and can aggravate the condition; therefore it should be utilized and limited to significant symptomatic anaemia Background: Early plasma transfusion in women with severe postpartum hemorrhage is often instituted to prevent and treat coagulopathy, but whether maternal outcomes improve with this treatment is unclear. Aims: To quantify the association of plasma transfusion within the first 60 min after diagnosing persistent postpartum hemorrhage and adverse maternal outcome. Methods: We performed a retrospective cohort study of women with persistent postpartum hemorrhage, defined as postpartum hemorrhage refractory to first-line measures to control bleeding. Women were enrolled from January 1, 2011 to January 1, 2013 in 61 Dutch hospitals. In a time-dependent propensity score-matched analysis, women with transfusion of fresh frozen plasma within 60 min following the diagnosis of persistent postpartum hemorrhage were matched to women without plasma transfusion or plasma transfusion at a later time point during hemorrhage. Plasma transfusion was not guided by coagulation tests. The main outcome measure was adverse maternal outcome, defined as a composite of mortality, hysterectomy and arterial embolization to control bleeding. We performed sensitivity analyses with initiation of plasma transfusion within 120 and within 180 min following diagnosis persistent postpartum hemorrhage, compared with other plasma transfusion strategies.

Results Results: The cohort consisted of 1216 women with persistent postpartum hemorrhage, with uterine atony as cause of hemorrhage in 780 women (64.1%). In this cohort, seven maternal deaths (0.6%), 62 hysterectomies (5.1%) and 159 arterial embolizations (13.1%) were observed. Plasma transfusion within 60 min in 114 women was matched on time-dependent propensity scores with 114 women with no or later plasma transfusion. Rate of adverse maternal outcome was similar between women with and without early plasma transfusion, 21.2% versus 19.9%, adjusted odds ratio 1.09 (95% confidence interval 0.57-2.08). Results of sensitivity analyses were comparable to the primary results. Summary/Conclusions: Among women with persistent postpartum hemorrhage, initiation of plasma transfusion within 60 min following this diagnosis was not associated with improved maternal outcomes, compared with no or later plasma transfusion. Whether other transfusion strategies or identification of women with high risk of coagulopathy will improve maternal outcomes remains to be studied. Background: Preoperative evaluation of increased risk for perioperative bleeding is essential for cardiac surgery patients. Platelet aggregation, as a laboratory test for assessment of platelet function, is very efficient for optimal antiplatelet treatment and also for assessment of the increased risk of postoperative bleeding and perioperative application of allogenic red blood cell transfusions.

Aims: The aim of this study was to establish whether preoperative platelet function testing for the presence of residual effect of acetylsalicylic acid (ASA) on platelet aggregation can be correlated with an increased risk for intraoperative bleeding during cardiac interventions.

Methods: A retrospective study included 60 patients who underwent surgical procedures (CABG II and CABG III) at the Department of Cardiovascular Surgery, Clinical Center in Ni s in period November 2017-July 2018. Patients were previously taken ASA at a dose of 100 mg per day, but therapy was discontinued 5 days before surgery. Platelet aggregation was measured on the day of surgery using impedance aggregometer Multiplate (Multiplate Platelet Function Analyzer, Roche), using TRAP and ASPI tests. Patients were divided into two groups: Control group (CG), which included patients with preserved function of platelets (ASPI 790-1410 AU*min), and Examined group (EG), which included patients with inhibited platelet aggregation in ASPI test (<790 AU* min Background: Hemophilia B is an X-chromosome-linked inherited bleeding disorder resulting from reduced levels or an absence of factor IX clinically represented by recurrent prolonged bleeding. Mutations can be inherited or acquired de novo. De novo mutations arise in about one-third of patients with haemophilia. The disease affects primarily males, but approximately 30% of carrier females have factor IX clotting activity lower than 40% and are at risk for bleeding. Aims: case report of a Hemophilia B carrier. Methods: the clinical history of the patient was thoroughly studied by analyzing medical records and analytical results using the software available in the health institution and paper records. Results: 45 year old woman, with no history of abnormal haemorrhage, healthy, up to 2004 when, after a dystocic delivery, presents with subcutaneous and ocular haemorrhage and dispersed bruises. A basic coagulation study is performed and a level of 20% FIX is found. Genetic analysis reveals a mutation in FIX gene and she is diagnosed as a carrier of Hemophilia B. Except for a son, no other direct family members carry the mutation. In 2008, after total hysterectomy with bilateral adnexectomy due to an invasive carcinoma in the uterine cervix, the patient suffers a haemorrhagic shock with multiple transfusion support and around six months later undergoes an ureteronephrectomy also with the need for post-surgery transfusion support. The patient is referred to the Immunohemotherapy Department where she has regular appointments as an outpatient since 2009.

In 2012, she requires surgery for the removal of a thyroglossal duct cyst, which is performed under prophylactic treatment with 2000 IU recombinant FIX (rFIX) daily, for four days, and up to 48 h after discharge maintaining basal levels of FIX of 60% and with no major complications reported. In 2013, the patient is admitted to the ER in haemodynamic shock and a history of black stools and syncope. At admittance, she receives a bolus of 4000 IU of rFIX and requires severe transfusion support due to active bleeding. She is diagnosed with colonic angiodysplasia and undergoes surgery. Daily doses of 3000 IU rFIX are administered from day 1 (D1) and up to D7 maintaining FIX levels around 60-80%. The patient is operated at D8 under the cover of 2000 IU of rFIX, twice per day, and up to D14 after surgery reaching FIX levels of around 80-110%. At D15 the dose was diminished to 2000 IU of rFIX daily and at D17 she is discharged with no rFIX replacement therapy necessary in ambulatory. Since then, no complications or new occurrences have been reported. The patient is under prophylactic administration of rFIX prior to minor invasive procedures (nodule biopsy, dental extractions and colonoscopies). Summary/Conclusions: Hemophilia B carriers usually do not require any major health care for their daily routine or invasive procedures. However, in the case reported, basal FIX levels conditioned any minor intervention to be performed. Thus, this carrier must be considered as a moderate Hemophilia B patient and mandatory prophylaxis with rFIX must be performed prior to any invasive procedure. Background: Blood transfusion is a life saving procedure but transfusion associated complications are equally important that need to be addressed. With limited resources of blood donations and screening, excessive transfusions must be avoided to prevent risk and economic burden on patients. On the other hand discussion on appropriate use of blood product is a matter of debate in medical literature. It is recommended to restrict the liberal use of transfusion. Aims: In this regard we aimed to observe the frequency of genuine and non genuine transfusion at our hospital and also to compare the outcomes of liberal and restrictive transfusions. Methods: It was a cross sectional study carried out at NIBD and BMT, PECHS campus, Karachi, Pakistan, from February 2018 to January 2019. The study was approved from institutional review board. Pack red cells (PRC) transfusion in case of < 7 g/dl hemoglobin (Hb) with cardiac history and < 7 g/dl Hb with symptomatic anemia was considered genuine. Platelets transfusion in case of sepsis and count < 50 9 10 9 /L, sepsis with bleeding and < 100 9 10 9 /L, patients on active chemotherapy without bleeding but platelet count < 10 9 10 9 /L and in patients presented with bleeding was considered genuine. Patients who were presented with bleeding, deranged coagulation profile and with sepsis + bleeding considered genuine for fresh frozen plasma (FFP) transfusion. SPSS version 23.0 was used for descriptive and inferential statistics.

Results: A total of 250 transfusions were evaluated for genuine and non genuine transfusion. Male predominance was high in our data 194(78%). Out of 250, 134 (54%), 100(40%) and 16(6%) PRCs, Platelets and FFP were transfused respectively. Out of 100 platelets, 10(10%) were platelet apheresis. 80/134 (60%) PRCs and 22/90 (24%) platelets were non genuinely transfused as per the criteria described in methods. However, FFP and platelet apheresis were genuinely transfused. In non genuine group of platelet transfusion, all patients received more than 1 unit platelet and the increment of platelet count post transfusion was found statistically non significant (P = 0.121). Thirty six (45%) of transfusions were done with more than 1 units of PRCs in non genuine group. The mean Hb level of patients received 1 unit and more than 1 units PRCs was statistically same (P = 0.868) and it was found out that there was same increment in Hb in both the groups post transfusion. (P = 0.867). Summary/Conclusions: We concluded that although blood transfusion is an integral procedure for saving life yet correct use of blood products is necessary in the era where blood donations are scarce and blood transfusion has its potential associated hazards. The approach towards the appropriate use of blood products will not only minimize the risk of transmission of infectious diseases but also will reduce the economic burden. Longitudinal studies on large sample size are needed to validate this study.

uncertain. An ovine model enables comparisons of; (a) invasive and non-invasive methods to measure oxygen delivery and utilisation at a tissue level, and of (b) the efficacy of various resuscitation fluids and transfusion protocols in treating haemorrhagic shock. Aims: To develop an ovine model of haemorrhagic shock. Methods: Sheep (n = 4) were anaesthetised, ventilated and instrumented. Instrumentation included blood flow, perfusion, and microdialysis probes placed in the brain, kidney, liver and skeletal muscle. Haemodynamic, tissue oxygenation, tissue flow and respiratory data were recorded continuously by data capture software. Non-invasive assessments, including brain and muscle oxygen saturation by NIRS, and visualisation of sub-lingual microvascular perfusion, as well as arterial blood gas measurements and plasma/serum/urine collections were made at specific timepoints. After a baseline period (1 h) sheep were bled~40% of their estimated blood volume (estimated at 65 mL/kg) to a mean arterial blood pressure (MAP) of 30-40 mmHg. Sheep were then resuscitated with either PlasmaLyte â (up to 20 mL/kg/ hr; n = 3) or transfused with sheep red cells (n = 1) to achieve a MAP > 65 mmHg. Sheep were euthanised 4 h after resuscitation. Data are presented as mean AE standard deviation. Results: Sheep were haemorrhaged an average of 931.7 AE 135.3 mL blood which combined with iatrogenic blood loss (~300 mL) corresponded to an average 40.2 AE 2.4% blood loss. Two out of the four sheep met clinical criteria for haemorrhagic shock (MAP = 30-40 mmHg, lactate > 4 mM, SvO 2 < 60%). Across all four sheep the nadir MAP averaged 40.5 AE 13.1 mmHg, lactate peaked at 3.9 AE 1 mmol/ L, and nadir SvO 2 was 41.3 AE 17.9%. All sheep survived to the end of the experimental protocol. Summary/Conclusions: These data demonstrate the successful induction of haemorrhagic shock in an ovine model. Further experiments are planned to improve the protocol and to achieve 100% incidence of haemorrhagic shock, and then to compare invasive and non-invasive measures of oxygen delivery and utilisation as well as the efficacy of different resuscitation fluids and red cell transfusion.

Adverse events, including TRALI P-515

Bilirubin were recorded within the 28-day period. The clinical parameters were compared against the reaction strength of the antibody reactions. The automated strength was measured by Solid phase. The manual testing consisted of a 15-min incubation using LISS and adding Monospecific IgG. The DAT was performed manually by adding Poly-specific IgG and then testing with Monospecific IgG and C3d. The Rh Group and non-Rh group had 11 and 10 cases performed manually, and results were 2+ or weaker further indicating the manual strength did not correlate with the clinical hemolysis. Likewise, in 31/44 (70%) the DAT was negative, and did not show any correlation with clinical hemolysis. However, when LDH and Bilirubin were measured, the two parameters increased as the automated strength of the antibodies increased. Summary/Conclusions: Most of the DSHTR investigation was not associated with overt accelerated red cell destruction. A strong correlation was observed only between the automated immunohematology testing results and other laboratory markers of hemolysis. In our experience, the direct antiglobulin test and manual strength showed no correlation. Background: Numerous transfused patients present severe, sometimes critical clinical conditions. The occurrence of adverse transfusion reactions (ATR) may induce deterioration in the clinical condition with a worsened clinical course and a lifethreatening or fatal outcome as is the case with nervous system impairment. In France, in 2017, out of 7,276 notified ATRs, 113 (1.5%) and 6 (0.1%) were life-threatening and death respectively. Aims: Our aim was to evaluate the notified ATRs with neurological signs that occurred in transfused patients over a period of six years and six months in hospitals in the Auvergne Rhône Alpes area.

The study included patients with reported ATRs in hospitals in this area from January 1 st 2010 to June 30 th 2018. Each ATR was registered in the national haemovigilance database system. Two signs observed at the time of the ATR were analyzed: unconsciousness and convulsions. Stroke was excluded. The type of ATR, its severity, the blood product involved and its imputability were studied. Results: During the period under study, 9,544 ATR were reported, of which 29 included unconsciousness and/or convulsions (0.3%). Of these 29 patients, 13 were females (44.8%) and 16 males (55.2%). Unconsciousness alone was frequently observed (21 reports, 72.4%). Convulsions were notified in 8 reports (27.6%) and were associated with unconsciousness in 2 of them. The diagnosis of seizure, with no other clinical signs, was established in 2 cases (6.9%). Unconsciousness and/or convulsions were present in 8 allergic reactions (27.6%), 4 cases of transfusion-associated circulating overload (13.8%), 3 cases of suspected transfusion-transmitted bacterial infections and 2 hypertensive reactions. In allergic ATRs, unconsciousness was notified in 7 cases and unconsciousness associated with convulsions in one. Twelve ATRs were severe (41.4%), 10 were life-threatening (34.5%) and in 4 cases, they resulted in the death of the recipient (13.8%). Of the 8 allergic ATRs, 4 were severe and 4 life-threatening. Red blood cell concentrate was involved in 15 ATRs (51.7%) and platelet concentrate in 9 (31.1%), including 5 cases with apheresis platelet concentrate and 4 cases with pooled platelet concentrate. Fresh frozen plasma was involved in 5 ATRs (17.2%). Nevertheless, the imputability of the blood product was excluded or unlikely in 11 ATRs (37.9%). In the 3 suspected transfusion-transmitted bacterial infections, the imputability of the transfusion was ultimately excluded after a negative result was obtained in the bacterial culture of the blood product. The imputability of the blood product was probable or possible in 7 and 9 ATRs respectively, but was certain in only 2 ATRs. Summary/Conclusions: Unconsciousness and/or convulsions were rarely observed in ATRs notified in transfused patients. Nevertheless, the presence of these signs highlights the seriousness of the ATR (26 ARs, 89.7%). Lastly, the imputability of the blood product was often excluded or unlikely.

In the multivariate Cox model for the effect of LPI on overall survival, adjusted for age and IPSS-R category, elevated LPI levels were associated with inferior overall survival (HR 3.0, 95% CI 1.5-5.7, P = 0.001). This effect was most pronounced in the TD-RS subgroup (HR 6.0, 95% CI 2.2-16.2, P < 0.001). Similarly, elevated LPI levels were associated with inferior PFS (HR 3.4, 95% CI 1.9-6.3, P < 0.001) for the whole study population and the TD-RS subgroup (HR 8.2, 95% CI 3.4-21.0, P < 0.001).

In total 16 patients received iron chelation during the sample collection period (11 patients deferasirox, 5 patients desferrioxamine). LPI levels were normal in 14 out of the 17 samples collected during deferasirox treatment and in 2 out of 5 samples collected during desferrioxamine treatment. Summary/Conclusions: Transfusion dependency is associated with the presence of toxic iron species and inferior overall and progression-free survival in lower-risk MDS patients. In TD-RS patients the effects were most pronounced indicating ineffective erythropoiesis leading to additional iron toxicity. Background: Post-transfusion immunomodulation has been reported to contribute to poor patient outcomes. Clinically relevant transfusion models are needed to improve our understanding of underlying mechanisms. Sheep transfusion models are of increasing importance in blood transfusion research as they provide several advantages over small animals, including their size, anatomy, physiology and similar blood volume compared to human. A current limitation of sheep transfusion models is the lack of characterisation of the sheep immune system. Understanding the sheep immunology is necessary to advance sheep transfusion models, identify mechanisms that contribute to post-transfusion immunomodulation and facilitate the translation of findings into clinical settings. Aims: To characterise the sheep leukocyte inflammatory responses to in vitro lipopolysaccharide (LPS) challenge in EDTA and heparinized whole blood. Methods: EDTA and heparinized sheep whole blood (n = 4 of each) was cultured with RPMI media (37°C, 5% CO 2 ) alone or with the addition of LPS (1-100 lg/mL; derived from Escherichia coli 055: B5). The inflammatory response was assessed after 2 h (h), 6 h, 12 h, 24 h, 36 h and 48 h. Supernatant was harvested at each time point and stored at À80°C. Inflammatory cytokine/chemokine production was determined using sheep specific in-house ELISA (IL-1b, IL-6, IL-8 and IL-10). Twoway analysis of variance with Bonferroni's post-test was used to measure the effect of incubation time and concentration compared to no LPS matched samples. Results: When EDTA was used as an anticoagulant, addition of LPS resulted in production of sheep IL-1b and IL-10 but not IL-6 or IL-8. IL-1b production was significantly increased following stimulation of 100 lg/mL LPS for 6 h (P = 0.043) and declined following 36 h incubation. Release of IL-10 was significant 12 h post-LPS stimulation with 100 lg/mL (P = 0.030) and reached a maximum at 24 h. The use of heparinized blood resulted in a different immune profile as all inflammatory markers tested were detected following stimulation with much lower concentrations of LPS (1 lg/mL), although the incubation times differed. IL-1b was significantly increased following 2 h incubation (P = 0.002), with increasing levels observed up to 24 h post-LPS stimulation. IL-8 production was evident from 6 h and reached significance at 24 h post-LPS stimulation (P = 0.009). IL-10 was significantly increased following stimulation of 5 lg/mL LPS for 6 hr (P = 0.043) with lower concentrations of LPS resulting in IL-10 production at 24 h (P = 0.008). Release of IL-6 was significant after 6 h of 50 lg/mL LPS stimulation (P = 0.046), with lower concentrations of LPS resulting in IL-6 production at 24 h (P = 0.015). In heparinized whole blood an LPS concentration-dependent effect was evident for all cytokines. Summary/Conclusions: Using a time-and concentration-approach our findings indicate that sheep are more tolerant and have a delayed response to LPS stimulation compared to previous research using similar human in vitro whole blood culture models. In addition, data suggest that sheep have greater immune responses using heparin as anticoagulant for the collection of blood samples. Improving our understanding of sheep immunology and development of relevant sheep transfusion models will provide a bridge between sheep models of transfusion and clinical settings. 1. RhDIg inappropriately administered (unnecessary exposure) (n = 17, 40%) Administered to: -RhD positive woman (n = 9) -RhD negative mother with RhD negative neonate (n = 5) -Woman with immune anti D (n = 1) -Administered in error (instead of other Ig) (n = 2) 2RhDIg delayed/omitted/wrong dose (risk of sensitisation to the D antigen) (n = 17, 40%) -Omitted (n = 14) -Delayed (n = 1) -Inadequate dose (n = 2) 3Administration without correct patient identification (n = 6, 14%) 4Storage & handling (n = 3, 7%) Failure to check the maternal and neonatal blood groups prior to administration was identified as a source of error. Misinterpretation of blood results also led to women receiving product inappropriately. e.g. reading a negative antibody screen as the mother being RhD negative. Patient identification was raised as an issue. RhDIg is often stored in satellite blood fridges for easy access. Collection from these areas did not always require confirmation against patient identifiers and there was no register of women who received product or link to the batch number to ensure traceability. Two incidents involved the administration of RhDIg when the prescription for other immunoglobulin products was not clear, leading to a child and a baby receiving RhDIg instead of the intended immunoglobulin. Summary/Conclusions: These incidents indicate problems with the processes of appropriate identification of women who need RhDIg, the use and interpretation of pathology tests and requirements for prescription and administration. These resulted in omitted and inappropriate doses of RhDIg. Blood Matters has made a number of recommendations regarding RhDIg administration: -All health professionals involved in RhDIg administration should be appropriately trained in the use of RhDIg -Confirmation of the maternal RhD status is essential prior to prescription or administration -Positive patient identification must be used prior to administration of RhDIg -Health services should consider regular auditing to identify areas for improvement relating to RhDIg Blood Matters continues to work with maternity care providers to improve practice. Centro Comunitario de Sangre y Tejidos de Asturias, Oviedo 2 Agencia Gallega de Sangre, Organos y Tejidos, Galicia 3 Banco de Sangre y Tejidos de Cantabria, Cantabria 4 Banco de Sangre de La Rioja, La Rioja 5 Banco de Sangre y Tejidos de Navarra, Navarra 6 Banco de Sangre y Tejidos de Arag on, Aragon 7 Fundaci on de Hemoterapia y Hemodonaci on de Castilla y Le on, Castilla y Leon 8 Fundaci on Banco de Sangre y Tejidos de las Islas Baleares, Islas Baleares, Spain 9 Terumo BCT Europe NV, Zaventem, Belgium Background: Hemovigilance, a long-term monitoring process made mandatory by national and supranational regulations, begins with a systematic whole blood or blood component collection and ends with an examining period after transfusion of blood components into the patients. In Spain, organized in 17 autonomous regions, the hemovigilance system is structured in three levels: (1) the local level comprised of transfusion centers and hospital based transfusion services that monitor and collect all transfusion related adverse events (AE) and level them up to (2) the regional hemovigilance coordinator, who communicates all the region's data to the (3) Spanish Ministry of health which issues an annual report and corresponds with European institutions. To ensure safer blood supply, pathogen reduction technology (PRT) was approved and implementation started in Spain in 2008. The Mirasol PRT system for platelets and plasma was introduced in 2010 and is currently being used in 10 of the 17 Spanish regions. Aims: To monitor the safety of the system, a passive hemovigilance study on Mirasol treated products was initiated in the region of Asturias and collaboration was extended to other regions (Baleares, Galicia, La Rioja, Cantabria, Navarra, Castilla y Leon and Aragon). Methods: Collected data included allergic and febrile reactions, TRALI and all other adverse event observed. Severity of the event and level on imputability of the transfusion were also assessed using the WHO grading scale. Hemovigilance data of Mirasol treated products (platelets or M-PC and plasma or M-P) are included from 2012 to 2017 as blood centers started to apply the technology in routine. Results: Increase adoption of the Mirasol system is observed between 2012, when 4,196 Mirasol treated blood products were issued to hospitals and 2017 with 56,229 Mirasol products issued. Due to low number of transfusions of Mirasol-treated blood components in 2012 and 2013, notification rates began to be analyzed in 2014, showing AE rates of 0.2%, similar to reports at the national level. Stable transfusion reaction rates were observed with M-PC (around 0.23). Rate of AE after transfusion of M-P is fluctuant between 0.06 and 0.17. This fluctuation could be due to the inconsistent numbers of M-P transfused from one year to the other. Most of transfusion reactions (around 80%) were of grade I severity and grade II level of imputability. Allergic reactions accounted for most of the adverse events, with G&I > 2 reactions in 2016 and 2017 of respectively 0.18 and 0.07 No bacterial nor viral transfusion transmission was recorded on Mirasol products during the study period (2012) (2013) (2014) (2015) (2016) (2017) . At the National level, nine cases of bacterial transfusion transmission (with G&I > 2) were reported. These transmissions were probably due to transfusion of non-pathogen reduced products. Summary/Conclusions: The observed notification rate of AE is similar to the national rate but allergic reactions with G&I > 2 is inferior with Mirasol treated products. Also, we found no reports of transfusion transmission infections nor cases of transfusion associated graft-vs-host disease, demonstrating safety of Mirasol treated products. were attributed to Human Error (75%) with the lowest frequency in Equipment Failure (10%), compared to 21% and 29%, respectively, in the following three years. Root cause analysis demonstrated failures in the Quality Management System including failures in administration, inadequate staffing for blood collection as well as in distribution and processing, and failures arising from institutional constraints and system failures in hospital management. High numbers of "Other" AEs (25%) in distribution and whole blood collection call for further investigation to indicate measures necessary for prevention and correction. Errors related to incorrect blood component transfused (IBCT) in 2007-2017 were 80 in 8,385,448 blood units (1/104,818) issued for transfusion. These resulted in 27 serious reactions (34%) (1 fatal, 11 life-threatening) . Another 21 (26%) were related with IBCT that did not cause a reaction. Near misses (component not transfused) were 24 (40%) Summary/Conclusions: Our data demonstrate increasing compliance with reporting requirements. Questions about the initial factors for deviations in certain activities specifying failures in equipment and materials due to system as well as human errors, highlight the need for further specifications beyond "other" and "human error". Background: The weakest link in the transfusion chain currently is the handling of blood components after their issue and the bedside blood administration practices. Aims: To evaluate compliance with standard procedures for bedside blood transfusion practices by analysis of the "Transfusion feedback forms" in a tertiary care multi-specialty hospital setting. Methods: During the study period of 24 months, the transfusion feedback forms received from various clinical areas of the hospital were studied with special reference to the transfusion times. The data was categorized based on the patient's location as well as the time of transfusion, whether done in routine or emergency hours. Results: 42,403 blood components were issued during the study period, while transfusion feedback forms for 37,816 components (89.1%) were received in the transfusion medicine department. Delay in starting the transfusion (more than 30 min after issue) was observed in 2965 transfusion events (6.9%). The component transfusion time exceeded the permissible limits for 930 component (2.1%).The overall total permissible time for completion of components exceeded permissible limit in 2217 (5.2%) of transfusion events. The pediatric ward (23.9%), ICU and OT complex (25.4%) were found to be the most non-compliant delay in transfusion, transfusion time and total transfusion time. Amongst the 2965 delayed transfusions after issue, 2120 (71.5%) were during the routine hours i.e. between 7 am to 7 pm and 845 (28.5%) were in the non routine hours i.e. between 7 pm to 7 am. Summary/Conclusions: The audit of bedside blood transfusion practices has given us a good insight into various areas of noncompliances as well as the predominant locations in the hospital where the practices need to strengthened further. Focused training program on safe blood administration practices for all staff involved in handling and transfusion of blood components is now planned to combat this issue. Background: The international surveillance of transfusion adverse reactions (ARs) and events (AEs) (ISTARE) of the International Haemovigilance Network (IHN) collects aggregate data from member national haemovigilance systems (HVS) in order to estimate the morbidity and mortality of blood transfusion in a holistic approach. The ultimate goal is to contribute to improving the safety of transfusion by close monitoring throughout the chain "from vein to vein". Aims: We analyse recent ISTARE data on suspected transfusion transmitted infections (sTTIs) for 2013-2016 in comparison to previous years of surveillance, [2006] [2007] [2008] [2009] [2010] [2011] [2012] Methods: Annual aggregate data from IHN member HVS on transfusion associated bacterial, viral and parasitic infections collected online in ISTARE are analyzed by incidence in blood components (BCs) issued for transfusion, by severity and imputability as well as by blood component. ARs with definite, probable or possible imputability were included in the analysis. Trend analysis is performed to allow comparisons and to collect information on established and newly emerging infectious threats of blood transfusion. Results: For 2013-2016 89 sets of annual aggregated data from 25 countries covering 85,521,393 BCs issued were analyzed. All ARs totalled 76,907 and infectious ARs amounted to 285 (0.4%). The overall incidence of the infectious ARs was 0.33/ 100,000 units of BCs issued. Bacterial infections were the most frequent (188, 66%), next viral (84, 29.5%) and then parasitic (13, 4.5%). Serious were 46% and there were 11 fatalities (3.9%, incidence 0.013/100,000). Nine deaths were attributed to sepsis and the other two were associated with non-malarial parasitic pathogens. One Geotrichum clavatum fungal infection associated with apheresis platelets was reported as a free text comment. This very rarely recognized fungal pathogen caused a very severe infection in a patient but the route of transmission is inconclusive. The 84 viral sTTIs included 17 HBV (20%), 10 HCV (12%) and 2 HIV (2.5%). The 55 recorded as "Other" (65.5%) including 24 cases of HEV, one case of Parvovirus B19, one CMV and one EBV. No case of TT-malaria was reported. Other sTT-PI were 15 (two fatal). The prevailing BCs were in general RBCs followed by platelets. Comparison with corresponding data for 2006-2012 shows a consistent overall incidence in total sTTIs (0.33 vs 0.4/100,000). However, considerable differences were seen in separate categories, such as bacterial infections (significantly increased rate in 2013-2016, P < 0.001) and an almost doubled rate of parasitic infections (P < 0.001). Compared to the earlier period, there were many fewer HBV infections (17 vs 160) and many more HEV. A similar reduction in the rate of HCV and HIV was observed in 2013-2016 in comparison with previous years. This may be explained by the fact that NAT testing for HCV/HIV/HBV has been implemented in many countries in the last decade. Summary/Conclusions: The infectious risk of transfusion overall remains very low. The rate of bacterial cases has increased and among other viral sTTIs the frequency of HEV is increasing. The mortality of transfusion due to sTTIs is lower than in the previous period of surveillance.

Abstract withdrawn. Background: One of the main aspects of haemovigilance system in hospitals is following of adverse events and reactions related to blood transfusions. Aims: It was intended to analyse the adverse reactions related to transfusion of blood components in pediatric patients. Methods: Over a four year period (January 2015-December 2018), the haemovigilance records of all patients receiving blood transfusions procedures were reviewed and transfusion reactions were analysed. Statistical analysis of data was performed by SPSS software (version 22.0, SPSS Inc., Chicago, IL, USA). Majority of blood components were provided by regional blood center organized by national Red Crescent Society. But granulocytes collected by apheresis after donor mobilization and reconstituted whole blood for exchange transfusions were prepared in the transfusion center of the hospital. Results: The median age of patients who developed transfusion reactions was 72 months (interquantile range-IQR 108). The median for the numbers of individual transfusions in children in a year was 12 (IQR 17). The median for the numbers of blood components individually transfused to patients was 18 (IQR 24). patients, anaphylactic transfusion reactions in 4 patients and transfusion-related lung injury (TRALI) in a patient. The overall incidence of transfusion reactions was estimated at a rate of 2.7 per 100000 units. Summary/Conclusions: It was reported that adverse effects related to blood transfusion, especially allergic reactions and FNHTRs are common in pediatric patients than adults. In a multinational study concerned about the transfusion reactions related with red cell concentrates, allergic transfusion reactions and FNHTRs were reported at a rate of 11 and in 100000 units and 26 in 100000 units, respectively. While the incidence of transfusion reactions in children was found 0.62% in a study from the U.S.A., the overall incidence of transfusion reactions in our study which was estimated at a rate of 2.7 per 100000 units represents a lower rate. Hospital Gran Canaria Dr. Negr ın, Gran Canaria 6 Hospital General Universitario, Ciudad Real, Spain 7 Hospital Nostra Senior de Meritxell, Andorra, Andorra 8 Banco Sangre y Tejidos, Santander 9 Banc de Sang i Teixits, Barcelona, Spain 10 Fundaci on Hematol ogica Colombia, Bogot a, Colombia 11 Centro Regional de Transfusi on de Almer ıa, Almeria 12 Complejo Hospitalario de Navarra, Pamplona 13 Fundaci on Banc de Sang i Teixits Illes Balears, Palma de Mallorca 14 Hospital de Cabueñes, Gij on, Spain

Background: Root analysis cause is defined as the cause of an error that, if it is treated, eliminates the repetition of the error Aims: Describe types of human and latent errors detected by a work group in the root analysis cause of transfusion incidents, analyze the concordance between the individual responses of the members and propose recommendations in order to improve transfusional safety. Methods: In 2018 fifteen participants (nurses and hematologists dedicated to transfusion and component preparation) studied some incidents of administration of nonirradiated components and tried to approach the root causes by applying the classification of errors in MERS-TM Transfusion Medicine. They transferred the answers to a questionnaire (simple or chain error, initial process affected, human and latent errors and measures derived from the analysis to correct the errors). The communication was made by mail and by the Spanish Transfusion Society web forum, which contained the consultation documents. Data and percentages are exposed for each type of error and the answers of the participants are tabulated. Results: Cases corresponded to 3 patients. Two patients of 55 years of age diagnosed of acute myeloblastic leukemia (case 1 and 2) and chronic lymphatic leukemia (case 3). In one case, the hematologist of the Transfusion Service canceled an irradiation prescription; in another, a patient with fever was transfused in the Emergency Room without the irradiation requirement and it was later discovered that he had received a transplant of hemopoietic progenitors 1 month earlier; In the last case, neither the requesting doctor nor the laboratory technician nor the following doctor (prescriber) detected the alerts located in their respective computer applications. In all 3 cases, the story was judged as sufficient for analysis. The majority of reviewers (93%) diagnosed a chain of errors. There was agreement of 95% with respect to the initial process affected. The initial error was communication (42%), monitoring (45%) and compliance (62%), in cases 1, 2, and 3. 2-3 human errors were detected per case (average: 2.2, 2.7 and 2.4 errors respectively) and 2-3 latent errors per case (average: 1.8, 2.7 and 2.1, respectively). The latent errors most punctuated were: failures in the quality of the protocols (24%), in the transfer of important knowledge (22%), in the available technology (21%) and in the information to the patient (10%). All the participants contributed feasible measures of improvement according to root causes: 1) improve the quality and drafting of work procedures and their compliance, including procedures of effective communication between professionals, 2) train staff in knowledge important for safety, 3) communicate with computer application providers to improve the effectiveness and visibility of the alerts and 4) involve the patient with essential information to ensure transfusion safety. The measures were processed later as recommendations. Summary/Conclusions: The root analysis shows agreement between participants and allows the elaboration of useful recommendations to increase patient safety. This strategy can contribute to the comprehensive prevention of errors. Background: In transfusion-associated circulatory overload (TACO), pulmonary oedema develops primarily due to volume excess. Data from the UK haemovigilance scheme, Serious Hazards of Transfusion (SHOT) suggest that either the incidence of TACO, or the recognition and reporting of TACO, has increased over time. From 2007 to 2017, reports of TACO increased from 6 to 92; deaths from 1 to 7, major morbidity from 3 to 20. Known risk factors include pre-existing cardiac and/or renal dysfunction, low body weight, extremes of age (eg, <3 years, >60 years), concomitant fluid administration, positive fluid balance, peripheral oedema and hypoalbuminemia. In a small subset of cases reported to SHOT, TACO developed following transfusion for severe anaemia in the absence of other risk factors. This may be an under-recognised independent risk-factor. Aims: To raise awareness of severe anaemia as an under-recognised risk factor for TACO and is potentially life-threatening transfusion. Methods: Cases of TACO submitted to SHOT over the last 3 years were reviewed to identify cases where transfusion for severe anaemia was a key identifiable patient risk factor. Results: The following are illustrative cases: -Case 1: A patient in their 50s weighing 67 kg was prescribed six units of red cells for iron deficiency anaemia after being admitted with Hb 37 g/L. The patient had no risk factors for TACO except for profound anaemia. During transfusion of the fifth unit the patient became dyspnoeic, hypoxic and hypertensive. The patient recovered after diuretic therapy and had a post-transfusion Hb level of 100 g/L. -Case 2: A patient in their 50s presented with a 4-week history of weakness and dizziness and had felt unwell for 6 months. The Hb was 34 g/L, ferritin 26 lg/L and ECG showed cardiac ischaemia. Two units of red cells were transfused. After the second unit oxygen saturations fell despite supplemental oxygen, post-transfusion Hb of 51 g/L. A third unit was transfused over 125 min and the hypoxia worsened with dyspnoea and crackles on chest auscultation. The chest x-ray showed an enlarged cardiac silhouette and pulmonary congestion. The patient improved with diuretics. -Case 3: A patient in their 90s with severe megaloblastic anaemia, Hb 41 g/L and peripheral oedema developed TACO after transfusion of 3 units and recovered with diuretic therapy. Summary/Conclusions: Chronic and acute anaemia are associated with compensatory cardiac changes irrespective of the aetiology of anaemia. This is further compounded by the underlying cause of anaemia particularly haematinic deficiencies (iron/B12 deficiency) that independently affect myocardial function. Hyperdynamic circulation related to anaemia increases the load on the heart, causing myocardial ischaemia and hypoxia and if the anaemia is not corrected, eventually leads to heart failure. Clinicians need to make an accurate diagnosis and avoid excessive transfusion in patients with severe anaemia with or without other additional risk factors. Patients with chronic iron/folate/B12 deficiency without haemodynamic instability should be given the appropriate haematinic replacement. Haematinic deficiency responds rapidly to appropriate vitamin/mineral. Blood transfusions are to be given only when clinically indicated and even then, only the minimum volume needed for symptomatic relief transfused with consideration for diuretic therapy. Methods: Legal forms for reporting transfusion reactions were used in the retrospective analysis, which were adjusted by the Department of Quality Assurance and Quality Control in the electronic form and distributed to clinics using blood components. Clinicians were trained to report transfusion reactions through the Hospital's Transfusion Board and through the "Service for Improvement of the Quality and Safety of Health Services" at the Clinical Center of Sarajevo. Analysis of the reported reactions in the Institute include immunohematological and microbiological examination based on which the guidelines for further treatment with blood components are being made. Users of registered services are obliged to report since 2015.

Results: Total of 121,076 different blood components were applied in the period between 2015-2018. Department for Quality Assurance and Control has received 4 serious adverse reactions, 1 serious adverse event, 157 reports of transfusion reactions, of which 11 (7%) were inadequately filled, in the same period. From the above, 54 (34.39%) were transfusion reactions to erythrocyte blood components which were applied, 86 (54.77%) to platelet components and 17 (10.82%) were transfusion reactions after the application of fresh frozen plasma. The analysis has shown that the most frequent were febrile non-haemolysis reactions (88 or 56.05%), followed by allergic reactions (50 or 31.84%). Two transfusion reactions (1.27%) were characterized as circulation overload. Summary/Conclusions: The frequency of serious adverse reactions and events was 0.004% (5 of 121,076) and 0.12% were reported transfusion reactions (157 of 121,076). With the establishment of the Hospital Transfusion Board and with the increase of collaboration with the Clinical Center, significant progress has been made. It is necessary to increase awareness among clinicians in regards to the safe transfusion practice. Reporting transfusion reactions should be a mandatory procedure, a path to the proper selection of blood components, monitoring adverse reactions, and for us, transfusiologist, guide to the safest, most efficient blood components.

J Garc ıa-Gala, E Martinez-Revuelta, A Caro-G omez, C Castañ on-Fern andez and I Fern andez-Rodriguez Hospital Universitario Central de Asturias, Oviedo, Spain

Background: Elderly patients are the main group of transfusion recipients in our country. Given their comorbidities are a risk group for the development complications related to transfusion. Aims: Analyze the incidence of adverse effects related to transfusion in the elderly population and to assess what factors may influence its appearance Methods: Transfusions were reviewed in patients > 70 years old. The variables analyzed were: sex, age, diagnosis/reason for transfusion, pre-transfusion hemoglobin (Hb), number of transfused units, infusion rate and transfusion side effects, as well as the measures used to prevent or treat the transfusions. effects of circulatory overload Results: A total of 93 patients were analyzed (48 women, 45 men), with a median age of 86 years (70-97). In total, 189 CH were transfused. 70 patients received 2 CH, 3 patients 3 CH, 10 patients received 1 CH. 10 patients were transfused at two different times. The median Hb prior to transfusion was 7.6 g/dL. In the patients who received 2 CH was 7.5 g/dL, those who received 3 CH: 6 g/dL and those who received 1 CH: 7.75 g/dL. The infusion time could be estimated in 84% of the patients. In those who received 2 CH was 223.62 min; 249.33 min in those who received 3 CH and 109.75 min in those who received 1 CH. 13 patients (14% of the total) suffered some type of adverse effect related to the transfusion. In 9 patients there was an increase in posterior TA, in 2 an increase in HR, in 1 an episode of hypotension and in another one episode of acute respiratory failure. 70% of those who had an adverse effect were older than 85 years. Patients with AHT after transfusion, 75% received 2 CH and the remainder 1 CH. Among their background, 66% had a history of ischemic heart disease. 33% also had a positive balance. The average previous BP was 137/65 mmHg and the subsequent one was 182/72 mmHg. 55% of patients did not receive diuretic treatment.

In the case of the patient with acute respiratory failure was in oligoanuria, with positive balances. 2 CH was transfused in total. She was treated with oxygen therapy and with intensification of the diuretic treatment, recovering later. Summary/Conclusions: -Patients > 85 years have a higher risk of suffering some type of adverse effect related to transfusion because they have pre-existing risk factors such as ischemic heart disease or heart failure. -We see that the risk of suffering some type of adverse effect in the elderly population is greater when we transfuse 2CH than 1CH. -We have appreciated that in those patients receiving 3CH, the infusion rate is higher. -The study highlights the lack of methods to prevent the development of circulatory overload. Background: Iron deficiency anemia is the commonest cause of anemia worldwide. Weakness, fatigue, reduced physical activity and difficulty in concentration are the symptoms which are associated with its deficiency. The forefront treatment available is oral iron replacement therapy which is convenient, cost effective and has substantial outcome. Another option is intravenous (I/V) iron when oral is not tolerable. Despite of potential transfusion associated hazards and limited availability of blood due to shortage of voluntary blood donations, it is insisted by the patients prior to iron therapy. Aims: The aim of conducting this study was to observe the impact of administration of oral iron, I/V iron and transfusion on hemoglobin levels in patients presented with iron deficiency anemia.

Methods: This was an observational study carried out at NIBD and BMT, PECHS campus, Karachi, Pakistan from February 2018 to December 2018. The study was approved by the institutional review board. Diagnosed IDA patients presented at our hospital were recruited for analysis who were given oral iron, I/V iron and transfusion for the correction of anemia. Informed consent was taken from the participants. Descriptive and inferential statistics was applied by using SPSS version 23.0.

Results: A total of 108 IDA patients were analyzed in which 74(69%) were females and 34(31%) were males. The most common symptom in females and males was fatigue followed by body aches in females 12(16%) and pallor in males 10(29%). Menorrhagia was present in 24(44%) of females of reproductive age. Surgical history was present in 12(16%) of females while there was no surgical history in males. Mean Hemoglobin, MCH and MCV of females at baseline was 8.0 AE 2.2, 60.5 AE 9.6, and 20 AE 8.3 while in males it was 7.8 AE 2.3, 63 AE 14.3 and 18.4 AE 6.1 respectively. Sixty two (84%) females were advised oral and I/V iron and 12 (16%) received transfusion. However, in males 8(24%) received transfusion and 26 (76%) were advised oral and I/V iron therapy. It was observed that the increment of hemoglobin after oral/IV iron at average of 3 months follow up in males and females was same as that the transfusion (P > 0.05). Summary/Conclusions: In our society where blood donations are scarce especially voluntary blood donations that are considered to be the safest type of blood donation. We would like to draw attention towards the alternatives to correct anemia such as oral and I/V iron replacement therapy as our results revealed that there was no difference in the increment of hemoglobin between the two groups. We need to educate our society especially the older age adults and young women who are more vulnerable of getting IDA to opt oral and I/V iron therapy. It will be cost effective, convenient and also has less risk than transfusion.

Cellular therapies -Stem cell and tissue banking, including cord blood Background: The differentiation of megakaryocytes plays an important role in the production of platelets. However, the underlying mechanisms regulating megakaryocytes differentiation have rarely been studied. Aims: To identify candidate genes involved in megakaryocytes differentiation and investigate the potential regulatory mechanisms of megakaryocytes differentiation from human cord blood hematopoietic stem cells in vitro. Methods: CB-derived CD34 + cells were isolated using density gradient centrifugation and magnetic activated cell sorting (MACS). Cultures were stimulated with only recombinant human TPO (100 ng/ml). After 12, 14 and 18 days, the MK fraction was selected by immunomagnetic sorting from the non-MK fraction using an anti-CD41a monoclonal antibody. RNA-Seq-derived gene expression data was performed on uncultured samples (day 0), cultured but unselected samples (day 7), and cultured, selected samples (day 12, 14 and 18) by using the next-generation sequencing (NGS) platform, and RQ-PCR technology was used to verify the expression of transcription factors.

Results: The comparison of the transcriptome profiles among the five stages showed that a massive gene expression change occurred in megakaryocytes differentiation. A total of 65140 genes were detected, of which 16612 showed up-regulation and 48528 down-regulation. Among these genes, 8 differentially expressed genes (DEGs) (fold change ≥ 10; false discovery rate < 0.05) were selected were further validated with RQ-PCR, including GABRE, CDHR1, WASF3, PKHD1L1, THBS1, PF4V1, LRRC32 and LGALS12. The RQ-PCR result indicated that the mRNA expression level increased with the prolongation of culture time. However, PF4V1 mRNA expression level was highest at day 14, LGALS12 was highest at day 18. Summary/Conclusions: Conclusion: Our study identified a series of genes that may participate in the regulation of megakaryocytes differentiation. These results should serve as an important resource revealing the molecular basis of megakaryocytes differentiation and thrombocytopoiesis.

PREOPERATIVE ANEMIA AND BLOOD TRANSFUSION REQUIREMENT DURING HIP AND KNEE SURGERY

Rambam Health Care Campus, Haifa, Israel

Background: Blood transfusion (BT) is independently associated with increased morbidity, mortality and hospitalization length across different patient populations. Due to BT-related risks, the concept of "Patient Blood Management" (PBM) has been introduced to clinical practice. The three PBM pillars are: optimizing red cell mass, minimizing blood loss and optimizing physiological reserve. BT indications during orthopedic surgery include excessive bleeding or hemodynamic instability and not the hemoglobin (Hb) level. In most clinical scenarios, a restrictive transfusion threshold (Hb level: 7-8 g/dL) appears to be non-inferior to the liberal transfusion strategy in terms of blood use, morbidity and mortality. Similar results are observed in highrisk patients after hip surgery. We hypothesize that preoperative anemia may lead to blood product overuse and its complications. Aims: Evaluating potential correlation between preoperative anemia and BT requirement during hip or knee surgery. Methods: We reviewed medical files of patients who underwent hip or knee replacement surgery at Rambam between 2011-2018. Patients with Hb level measurement within 90 days pre-surgery were included. Receiving > 1 blood unit was considered a surgery complication and such patients were excluded. Patient demographic and clinical data, including comorbidities, surgery type, length of hospital stay, were collected. We created a synthetic data cohort using MDClone Healthcare Data Sandbox, an environment enabling fast data extraction and producing synthetic data for analysis that does not require IRB approval. Results: During the evaluated period, 2591 patients underwent hip or knee surgery; 231 were excluded from the analysis due to receiving > 1 blood unit. Hb measurement within 90 days pre-surgery was available for 1202 patients. Hip or knee surgery was performed in 588 (49%) and 614 (51%) patients, respectively. Women comprised 60% (n = 356) of patients who underwent hip surgery. In the hip-surgery group, 14.5% of patients required BT, with this need being slightly higher among women (31.5% vs. 26.2%; P-value=NS). Only 50 (8%) patients were transfused during knee surgery and this cohort was not further analyzed. Patients receiving BT had a significantly lower mean Hb level than those who didn't require it (11.93 g/dL versus 12.8 g/dL for women and 12.3 g/dL vs. 13.8 g/dL for men; P-value < 0.001). Hospitalization was longer in transfused patients compared to non-transfused ones (mean 7.52 vs. 6.91 days, P-value = 0.018) and in patients with a low Hb level (female < 12, male < 13.5) than in those with a high Hb level, irrespective of receiving BT (P-values < 0.00045). Patients with at least one of the following diagnoses: diabetes, renal failure, ischemic heart disease, were significantly more likely to have a lower preoperative Hb level (P-value < 0.05). No other factors (e.g., patient's weight, RDW value or blood pressure) were predictive of transfusion need. The probability of a need for 1 blood unit was 0.43 in the Hb 11 g/dL group and 0.15 in Hb 13 g/ dL group (35%>reduction). Summary/Conclusions: Anemia presence before elective hip surgery is a risk factor for BT requirement and longer hospitalization. Diagnosis and management of anemia using timely pre-surgery consultations may minimize intraoperative BT, particularly in women and patients with comorbidities. Real-patient data and prospective trials are warranted.

Abstract withdrawn.

Abstract withdrawn. Background: CD36, known as platelet glycoprotein IV, belongs to type B scavenger receptor and is related to the pathogenesis of many diseases. Type I CD36 deficiency was CD36 not expressed on platelets and monocytes. Individuals with type I deficiency can produce homologous antibodies and cause related immune diseases. In recent years, it has been reported that CD36 deficient individuals cause fetal immune thrombocytopenia with fetal edema syndrome in Asia. CD36 is not expressed in mature RBC, but exists in hematopoietic stem (progenitor) cells. Anemia is an important cause of edema. In view of the phenomena of clinical and animal experiments, CD34 + hematopoietic stem (progenitor) cells were cultured in vitro to observe the effect of anti-CD36 monoclonal antibody on CD34 + hematopoietic stem (progenitor) cells. Aims: To investigate the effect of anti-CD36 monoclonal antibody on proliferation and differentiation of human CD34 + hematopoietic stem (progenitor) cells in vitro. Methods: Choose 3 healthy full-term maternal women without various obstetric complications, take cord blood 20 ml. After density gradient centrifugation of Ficoll cell separation solution, CD34 + hematopoietic stem (progenitor) cells were sorted by flow cytometry and cultured for 2-3 generations. MTT was used to examine the effect of anti-CD36 monoclonal antibody on the growth of hematopoietic stem (progenitor) cells. Flow Cytometry Analysis was used to detect the apoptosis and cell cycle of CD34 + hematopoietic stem (progenitor) cells. The effect of anti-CD36 monoclonal antibody on the formation of CFU-E/BFU-E in hematopoietic stem (progenitor) cells was analysis by CFU-E/BFU-E account after 10-14 days culture. Results: After umbilical cord blood was isolated by Ficoll to obtain mononuclear cells, the hematopoietic stem (progenitor) cells of CD34 + were sorted by flow cytometry, and about 0.44% of CD34 + hematopoietic stem (progenitor) cells were isolated. Different concentrations of anti-CD36 monoclonal antibody and hematopoietic stem (progenitor) cells were cultured in vitro. The OD value of value (0.9 AE 0.15) of anti-CD36 monoclonal antibody group (2 mg/ml) was decreased than normal group (1.05 AE 0.12) (P < 0.05), and the OD value (0.81 AE 0.11) was significantly decreased at the CD36 monoclonal antibody concentration of 32 mg/ml (P < 0.01). There was no significant difference between the hematopoietic stem (progenitor) cells culture group and the IgG control group (P > 0.05). In the Annexin V flow detection, the apoptotic rate of anti-CD36 monoclonal antibody group (2 mg/ml) was statistically increased than the normal group (P < 0.05). Anti-CD36 monoclonal antibody significantly induced hematopoietic stem (progenitor) cells to undergo S phase cell reduction, G1 phase cells increased, and G1/S phase cell arrest occurred. The number of CFU-E/BFU-E clones in the normal group was 169 AE 12, the number of CFU-E/BFU-E clones in the control group was 172 AE 12, and the number of CFU-E/BFU-E clones in the anti-CD36 monoclonal antibody culture group was 85 AE 6. the number of colonies formed by hematopoietic stem (progenitor) cells in the anti-CD36 monoclonal antibody culture group was significantly lower than that of the other groups (P < 0.05). Summary/Conclusions: Anti-CD36 monoclonal antibody can reduce the proliferation of human CD34 + hematopoietic stem (progenitor) cells and reduce the ability of erythroid differentiation. Background: Recently the new modern collection techniques were introduced in the apheresis procedures. Cobe Spectra system was replaced with Spectra Optia, and it was necessary to verify the efficiency of Spectra Optia in PBPC collections. Aims: The aim of the study was to evaluate and optimize the new CMNC protocol Spectra Optia v. 11 (Terumo) for PBPC collections in patients with haemato-oncological malignant diseases.

Methods: The results of 159 autologous PBPC collections were evaluated in: (a) well mobilized patients with precollection CD 34+ cells concentration in blood higher than 20/ll, (b) from only the first collections, which were performed either by the use CMNC Spectra Optia v. 11 or Cobe Spectra v. 6, v. 7, Terumo (c) Collections were performed in the Standard and Large volume Leukapheresis regimen, LVL. Engraftment data in 56 transplanted patients were assessed. Results: Standard collections were performed in 52 patients. The yield of CD 34+ cells was high, and no significant differences were found between the numbers of CD 34+ cells prepared from Spectra Optia 8,6 (1,3-41) 9 10 6 and Cobe Spectra 10,9 (1, 6 ) 9 10 6 /kg b. w. (a = 0,05; pval 0,619). The dependence of CD 34+ cell yield on the precollection concentration of CD 34+ cells in blood can be considered as linear with high correlation coefficients in CMNC Spectra Optia R = 0,95, and Cobe Spectra R = 0,93. LVL collections were performed in 107 of patients, and there were no significant differences between the numbers of CD 34+ cells prepared by CMNC Spectra Optia 10,9 (2-61,2)9 10 6 and Cobe Spectra 9,3 (2,4-86) 9 10 6 /kg b.w. (a = 0,05; pval 0,35). The relations between the precollection CD 34+ cells concentration in blood and the numbers of CD 34+ cells from collections can also be considered as linear with the correlation coefficients in CMNC Spectra Optia R = 0,93, and Cobe Spectra R = 0,78, respectively. In LVL, the median platelet loss was significantly lower in CMNC Spectra Optia (45%) than in Cobe Spectra (57%). A group of 12 patients was transplanted by means of PBPC prepared in the standard regimen. Median time in the neutrophil reconstitution was in CMNC Spectra Optia as well as Cobe Spectra 11 days, while in platelets from CMNC 14 days, and from Cobe Spectra 12 days, respectively. The number of 44 patients obtained PBPC from LVL. The median time in neutrophils and platelets reconstitution was in CMNC Spectra Optia as well as Cobe Spectra the same, and corresponded with 11 and 13 days, respectively. Summary/Conclusions: CMNC protocol Spectra Optia is a modern, efficient and the safe system, which can be used for both Standard and LVL procedures. In well mobilized patients the sufficient dose of CD 34+ cells for transplantation could be prepared from one Standard or one LVL procedure. No serious adverse reaction have been observed. Background: Peripheral hematopoietic stem cells are collected from patients/donors after mobilization with G-SCF. The aim of the collection is a fixed number of CD34 + cells/kg. This number depends on the pre-apheresis CD34 + number, the blood processed and the collection efficiency of the procedure. The aim should be to collect all the requested cells in 1 day, whenever possible. This is in order to reduce the dose of G-CSF given to donor/patient and the resources used in the collection centre. The only parameter that can be adjusted is the volume of blood processed, If this is increased, the likelihood of collecting the requested amount of cells is increased, but only if the pre-apheresis CD34 number is high enough. Therefore, you need to know, when it is feasible to increase the volume and thereby increasing the time of the procedure with the intention to collect all the requested cells in 1 day. It can also show if it is possible to reduce the volume of blood processed, thereby reducing the time of the procedure. Aims: To develop an easy tool to calculate the volume of blood processed in order to collect the requested cells in 1 day. Methods: The mean collection efficiency (CE) was calculated. CE is calculated as CD34 + cells collected/(pre-apheresis CD34 + number*processed volume)*100%. Based on the mean CE, an excel sheet was generated to calculate the volume of blood that should be processed in order to collect all the requested cells. The excel sheet is designed so the user enters the pre-apheresis CD34 + number, patient weight and the requested number of CD34 + cells. The CE is fixed according to the mean CE calculated. The result is the volume of blood processed in order to collect the requested yield. Based on that result, the apheresis machine will provide time for the procedure, thereby it is possible to evaluate if the collection can be finished in 1 day or not, e.g. by increasing the volume of blood processed. Spectra Optia â was used for all collections, CMNC for allogeneic donors and MNC for autologous patients.

Results: Mean CE = 64% (n = 348). A CE of 40% was chosen as the cut-off for the CD34 calculation tool. Using the CD34 calculation tool: Allogeneic donors (n = 61): mean CE = 61%, mean blood volume processed = 3.3 9 TBV, mean time: 253 min, 37 donors were finished in 1 day collection (61%) Autologous patients (n = 205): mean CE = 65%, mean blood volume processed = 2.4 9 TBV, mean time = 218 min, 173 patients were finished in 1 day (83%). The calculation failed in only 1 case (0.4%). In this case the volume of blood processed was reduced according to the calculation, but because of unexpected low CE, the requested number of cells was not achieved. Summary/Conclusions: The CD34 calculation tool based on an excel sheet has shown to be simple and easy to use in order to personalize the stem cell collection.

IMMUNOTHERAPY PRODUCTS: BLOOD PRODUCT, PHARMACEUTICAL, OR A NEW CATEGORY ALL TOGETHER?

from 2001 till 2019. All donors were HLA typed and matched; they were fully informed on the donation procedure and signed an informed consent for donation. Minimum dose required to ensure successful and sustained engraftment was 2 9 10 6 /kg CD34 + cells and 2 9 10 8 /kg mono-nucleated cells (MNC). PBSC harvesting was performed with continuous flow cell separator Baxter C53000, COBE Spectra and Spectra Optia using conventional-volume apheresis processing the 2-2.5 total blood volumes per apheresis. A femoral catheter was used for harvesting and Acid Citrate Dextrose formula A is used for anticoagulation. Recombinant human granulocyte colony-stimulating factor (G-CSF) is used to mobilize PBPC for collection. Harvesting of PBSC is usually performed after 4 to 5 days of G-CSF subcutaneous administration at a dose of 10 lg/kg body weight.

Results: All the donors were siblings of the patients treated at the University Hematology Hospital. There were 159 apheresis procedures performed in 106 healthy sibling donors. There were 75 males and 31 females, aged 20-55. One to two apheresis procedures were required to collect adequate graft. The single procedure usually took 3-4 h and the volume of collected stem cells was 50-220 ml. The needed number of MNC and CD34 + cells was successfully collected by 1.5 apheresis. There were 29 ABO incompatible donors. Procedures for mobilization and collection of PBPC from healthy donors are generally well tolerated. The only adverse effects of the apheresis procedure were bone pain as reaction of G-CSF and numbness of the extremities as reaction of ACD-A (hypocalcemia), which occur rarely and were very mild. The collected PBSC were used in allogeneic stem cell transplantation in patients with: acute myeloid leukemia -57 patients (53.7%), acute lymphoblastic leukemia -14 patients (13.2%), chronic myeloid leukemia -9 patients (8.5%), myeloproliferative disorders -8 patients (7.5%), myelofibrosis -5 patients (4.7%), severe aplastic anemia -5 patient (4.7%), non-Hodgkin lymphoma -3 patient (2.8%), multiple myeloma -3 patient (2.8%), chronic lymphoblastic leukemia -1 patients (0.9), Hodgkin disease -1 patient (0.9%). Summary/Conclusions: The apheresis collection of PBSC in healthy donors is an effective and safe procedure. We are developing our National Stem Cell Donors Registry as a part of Bone Marrow Donors Worldwide. In that way we hope we will help widen the world network of stem cell donors and enlarge the possibility for each patient to find the right match. Background: Leukocyte-removing filters for blood are being used widely as a universal leukocyte reduction policy is being adopted progressively throughout the world. Filtration is one of the most effective methods for preventing various adverse transfusion effects caused by leukocytes included in blood components, such as febrile reaction, alloimmunization, and transmission of leukotropic viruses. Aims: The goal was to evaluate whether the new domestic blood filter FINECELL, developed by KOLON INDUSTRIES, Gumi, Korea, is appropriately suited to the international standards. And to reveal its efficacy and safety in the settlement of leukocyte reduction system in Korea. Methods: Thirty-two units of packed red blood cells obtained from 400 mL whole blood collected from 32 healthy donors were used. This was done by analyzing the filtration time, residual leukocyte count, RBC recovery, and hemolysis rate during a storage period of 35 days after leukoreduction. Results: The standards commonly used for the evaluation of leukocyte-removing filters are set by the Food and Drug Administration of the USA and the Council of Europe. The results of our study satisfied these international standards. Summary/Conclusions: The newly developed domestic leukoreduction filter was, thus, found to be efficient and will contribute to the improvement of the quality of isolated blood components used in Korea. Faculty of Science, Humanities and Education, Technical University of Liberec, Liberec, Czech Republic Background: As polymeric fibrous scaffold fabrication techniques strive to create structures that more closely replicate tentative extracellular matrix form and function, the need for increased scaffold bioactivity becomes more pronounced. The fibrous structure made from biocompatible and nontoxic polymers ensures mechanical stability, however cell proliferation requires further stimulation. Platelet-rich plasma, which has been shown to contain over 300 bioactive molecules, has the potential to deliver a combination of growth factors (GFs) and cytokines capable of stimulating cellular activity. Aims: The presented work deals with the preparation of nanofibrous materials with platelet growth factors incorporated into the internal fiber structure. Polyvinyl alcohol (PVA) was used for the preparation a material providing a progressive release of native GFs without need of subsequent crosslinking. Methods: Materials were prepared from PVA (Mw 125,000, 98% of hydrolysis) using electrospinning technology (Nanospider TM 1WS500U). Platelet lysate (PL) was prepared from thrombocyte rich solution (obtained from regional hospital in Liberec, the concentration of 700-900 x10 6 PLT/ml, freeze-thaw method with subsequent centrifugation). Nanofibers were electrospun from 10% PVA solution using water: ethanol (8:2) solvent system. Materials with proteins were electrospun from solution containing 10% of PVA and 10% of PL. Morphological analysis was performed by scanning electron microscopy. Protein release was monitored using spectrophotometry (Bradford method) and chromatography. Results: The prepared fibrous materials consisted of random oriented end-less fiber with smooth surface with minimal defects in structure. The morphology of materials was not altered by the addition of proteins. The average fiber diameter was: 340 AE 120 nm for pristine PVA fibers and 350 AE 148 nm for PVA with incorporated proteins (PVA/PL). PVA/PL layers contain 5-10 mg of protein per gram of PVA. 60% of the proteins are released during the first day (burst release) followed by a gradual release of up to 2 weeks. Summary/Conclusions: Nanofibrous PVA-based nanofiber materials were prepared with native growth factors. The process used for the preparation of solutions and subsequent spinning does not affect the activity of the incorporated proteins, which are being gradually released. Therefore, we believe that the developed material has great potential for use in tissue engineering e.g. to promote healing of chronic wounds. Acknowledgements: Supported by the Czech Health Research Council, project No NV18-01-00332. Background: Human a-defensins are small cationic peptides with antimicrobial and anticancer activity. Up till now, six a-defensins have been described in humans. They include the human neutrophil peptides (HNP) 1, 2 and 3 which present in large amounts in neutrophil azurophilic granules and differed from each other only in the first amino acid. A fourth defensin, termed HNP-4, comprises less than 1% of the total defensins in neutrophils and has a distinct sequence from HNP1-3. The other two, human defensin 5 and 6, are synthesized mostly by intestinal Paneth cells. Neutrophil defensins (HNP 1-3) are 3.4 kDa peptides that are characterized by three disulfide bridges. The pattern of disulfide bonds in the mature forms is crucial for the functional properties. Due to this structural feature, synthesis of defensins using the chemical and recombinant approach presents quite a challenge. Moreover, purification from the natural source can be very difficult because the large number of neutrophils is needed to obtain a sufficient amount of protein. In blood banks, leukocyte reduction filters are used to remove leukocytes from blood components in order to prevent adverse transfusion reactions. Leukofilters contain high numbers of normal human cells and discard after use. Aims: The aim of this study was to purify a-defensins from neutrophils trapped in leukocyte reduction filters. Methods: Blood bags from healthy blood donors were collected after written consent. All donors were screened for infectious diseases (HBV, HCV and HIV) and negative samples were included in the study. Blood bags were filtered at 22°C by Leukoflex LST-1 filters. The cells were extracted from the filters by back-flushing with cold phosphate buffered saline (PBS), pH 7.4, without MgCl2 and CaCl2, containing 5 mM EDTA and 2.5% sucrose. The PBS was homogenized with the filter content and then collected in a sterile tube. Neutrophils were separated from mononuclear cells by Ficoll. Isolated neutrophils resuspended in PBS 1X at a concentration of 1 9 10 7 cells/ml. For degranulation, cells were stimulated with 100 nM of formylmethionyl-leucyl-phenylalanine (fMLP) for 5 min followed by stimulation with 10 lM of cytochalasin B for 5 min. Supernatant was collected by centrifugation at 200 9 g for 6 min. Supernatant was incubated with mouse monoclonal antibody to HNP 1-3 and purification of HNP 1-3 was performed by lMacs Protein G Microbeads system. The presence of protein was confirmed by Western Blot.

Results: The presence of the 3.4 kDa band was confirmed by Western Blot, which corresponded to the size of the a-defensins. Summary/Conclusions: The development of defensins as therapeutic products requires access to a steady supply of neutrophils. Our results indicated that LST-1 filters are economical source for purifying a-defensins.

Anatomical Sciences, Abadan School of Medical Sciences, Abadan, Iran

Background: Epigenetic reprogramming of terminally differentiated cell can modify somatic cells to a pluripotential state. There are several approaches that induce pluripotency in somatic cells. Exposure the cells with the embryonic stem cell extract is an easy way, and some investigations were done on fibroblast cell line. However, its efficiency was low Aims: The purpose of this study was to increase the number of reprogrammed granulosa cell as a full differentiated cell into pluripotential state Methods: The human granulosa cells were cultured in the medium containing 5-Aza-Deoxycytidine and trichostatin A. Then, the cells were exposed to mouse ESCs extract and co-cultured with mouse embryonic fibroblast in the presence of leukemia inhibitory factor (LIF). Alkaline phosphatase test and also immunohistochemistry staining for Oct4, Sox2 and Nanog were performed after 24 and 72 h and 1 week Results: The results indicated that after 24 h the granulosa cells were revealed a round and expanded morphology. The cells in all groups except in negative control, were showed alkaline phosphatase activity. The cells that were cultured in medium containing 5-Aza-Deoxycytidine and Trichostatin A and exposed to the extract had the most numbers of alkaline phosphatase positive cells. Immunocytochemistry showed the granulosa cells that were cultured in medium containing 5-Aza-Deoxycytidine and trichostatin A with extract expressed Oct4 with weak intensity after 24 h. No expression of Oct4, Sox2 and Nanog were observed in other groups at the same time. After 72 h, Oct4, Sox2 and Nanog were over expressed in the cells that were treated with 5-Aza-Deoxycytidine, Trichostatin A and extract. Furthermore, there was high expression of Oct4 in the granulosa cells that were cultured in medium containing DMSO and exposed to the extract. After one week, the expression of Oct4 and SOX2 in the granulosa cells that were cultured in medium containing DMSO and exposed to the extract was continued while its expression ceased in the other groups. The expression of Nanog were ceased in all groups after one week Summary/Conclusions: Present study revealed that the inhibitors of the methyl transferase (5-Aza-Deoxycytidine) and histone deacetylase (trichostatin A) could delete the epigenetic markers and improved cells reprogramming by administration of the extract

Abstract withdrawn.

Abstract withdrawn.

Abstract withdrawn. Background: Mesenchymal stem cells (MSCs) are adherent spindle shape cells expressing different surface markers. They show special criteria including, paracrine effects, differentiation to several tissue cells, migration, immunomodulatory and regenerative potentialities. MSCs are isolated from different sources and employed as therapeutic tools to treat several diseases and injuries. However, some of MSCs properties including secretion of growth factors and migration ability are controversial especially during remission or in presence of tumor. Interestingly, MSC-derived compartment could be used as practical tools in term of diagnosis, follow up, management and monitoring of disease instead of intact MSCs. Exosomes are kind of extracellular vesicles (EVs) characterized via their size and releasing mechanism. Usually they defined as less than 150 nm in diameter vesicles. They secreted from different cells and are also found in urine, blood, breast milk, cerebrospinal fluid and other body fluids. Exosomes contain genetic material including DNA, mRNAs, microRNAs (miRNAs) and other biomolecules. miRNAs are single stranded non-coding RNAs transcribed from DNA. Immature miRNAs are subjected to two known cleavages to modify to mature miRNA that involve to either mRNA degradation and gene expression process or cell-cell interaction and communication via secretion as the part of exosomes. Aims: This study was aimed to discuss some aspects of exosomal microRNAs derived from MSCs in progression, diagnosis and treatment of some diseases. Methods: Different scientific data bases including PubMed, Google scholar and Scopus were used to find and review related articles. Results: EVs play important role either in intercellular communication related to pathological and physiological situation or intracellular communication, angiogenesis, immune system modulation and metastasis progression. miRNAs could regulate expression of multiple mRNAs then they play important role in different biological processes and contribute cell-cell interaction as well as influence in the progression of different disease. Exosomal miRNA-derived MSCs are involved in cancer procession, tumor growth, angiogenesis and metastasis. They are used as diagnosis and therapeutic tools to treat different diseases such as renal failure, liver fibrosis, myocardial infarction. Summary/Conclusions: Due to controversial aspect of using of intact MSCs especially during remission or in presence of tumor, MSC-derived exosome could be used as practical tools in term of diagnosis, follow up, management and monitoring of disease instead of intact MSCs. 

Aims: The aim of study try to use SYBR Green I based real-time PCR to identify homozygous, heterozygous, gene deletion or wild type for RhD exon 1, 5, 10 and 1227A. Methods: For this study, we used real-time PCR with high resolution melting curve mode, and Matrix mix containing SYBR-Green I were used for sequence specific primers of 1227 G>A and RhD exon 1, 5, 10. Samples with RhD gene deletion homozygous/heterozygous, 1227 G>A heterozygous with RhD gene deletion and normal RhD, normal RhD homozygous/heterozygous and RhD1-RhCE(2-9)-RhD10 homozygous/heterozygous were enrolled in our study. All samples were screened using RhD exon genotyping, Sanger sequencing and Rhesus box analysis. Concentration and mass of DNA samples were

1 in alleles of normal RhD/RhD gene deletion. The Tm ratio of RhD exon 1 (87°C) to internal control (77°C) were 2.33 in alleles of normal RhD/RhD1-RhCE(2-9)-RhD10, 2.09-2.21 in alleles of RhD gene deletion/normal RhD, 2.53-2.66 in alleles of normal RhD and < 0.1 alleles of RhD gene deletion. The Tm ratio of RhD exon 10 (81°C) to internal control (77°C) were 3.35 in alleles of normal RhD/RhD1-RhCE(2-9)-RhD10, 4.29-4.39 in alleles of RhD gene deletion/normal RhD, 4.67-6.10 in alleles of normal RhD and < 0.1 alleles of RhD gene deletion. The Tm ratio of RhD exon 5 (81°C) to internal control (77°C) were 3.64 in alleles of normal RhD/RhD1-RhCE(2-9)-RhD10, 2.49 in alleles of RhD gene deletion/RhD1-RhCE(2-9)-RhD10 3.47-3.59 in alleles of RhD gene deletion/normal RhD, 3.97-4.77 in alleles of normal RhD and < 0.1 alleles of RhD gene deletion. Summary/Conclusions: Using the Tm Ratio of sequence specific primers to internal control is an effective way to detect the RhD gene deletion or RhD

Weak D Types 1, 2 and 3 not detected") were tested with a method based on Next Generation Sequencing (NGS) using the Illumina MiSeq platform to detect a possible RHD variant not interrogated by ID RHD XT. Results: In total 583 DNA samples were tested in 87 pools. Fifteen (15) pools (181 samples) gave RHD deletion genotype and seventy two (72) pools (402 samples) resulted to the presence of RHD gene. The 72 positive pools were also analyzed individually. The genotype results obtained were: RHD exon 1 no amplification (1), RHD exon 6 and

The genotype results obtained with ID RHD XT (in pools and individually) were concordant with the results provided by the centers. Hence, 100% accuracy was obtained using ID RHD XT with DNA pooled samples. The results of Rh NGS for the samples with inconclusive results by ID RHD XT showed RHD variants previously described: 1 sample RHD*93-94insT (DEL), 1 sample RHD*IVS3+1G (DEL), 9 samples RHD*weak D type 11 (Partial D), 1 sample RHD*weak D type 5 (Weak D), 1 sample RHD*weak D type 61 (Weak D) and not described: 1 sample RHD*del 1-5 (Unknown)

Summary/Conclusions: ID RHD XT is a high accurate tool for genotyping the most common RHD alleles associated to weak D and D negative phenotype in up to 20 pooled DNA samples. Use of RHD genotyping improve RHD typing in blood donations

Variant RhD alleles generate qualitative/quantitative alteration in serological expression of D antigen such as weak and partial RhD phenotypes which are clinically important in transfusion setting. Population studies have shown varied distribution of the variant D alleles in Caucasians, Africans, East Asians and Indians. Many countries have developed their own population-specific strategy for identifying D variants. Our previous study in Indian population showed absence of weak D type 1, 2, and 3 which are commonly found in Caucasians D variant individuals. Instead, a novel population-specific pattern i.e.~12-kilobase duplication event, including exon 3, was predominantly identified in 58.3% D variant samples. Functional analyses showed that this genetic variation results in the expression of several transcripts, including a wild-type product. Commercial genotyping assays available, mainly detect common D variants found in Caucasians and Africans, thus limiting its usefulness in India. Hence, based on our findings we have designed a multiplex PCR assay specific for Indian population that can be easily implemented at the laboratory level for genotyping variant RHD. Aims: To characterize RhD variants using "Indian-specific, RHD genotyping assay". Methods: Seventy samples referred to our laboratory for molecular characterization of RhD variants were included in this study. All RhD variant samples were serologically typed for

Results: Out of the 70 RhD variants included in this study, 49 samples (70%) showed presence of Indian specific allele i.e. exon 3 duplication. Seventeen RhD variants samples showed presence of both exon 5 and 10. QMPSF analysis of these samples excluded involvement of RHD-RHCE-RHD hybrids. Sixty of the seventy D variant individual had R 1 r genotype

This assay thus can be used routinely in Indian laboratories to identify and characterize RhD variants. -128 non-invasive fetal KEL1 genotypes from allo-immunized anti-KEL1 women were done (34 positive confirmed fetuses, 6 undetermined, 16 positive non-confirmed, 22 negative non-confirmed and 50 negative confirmed). -190 non-invasive fetal RHc genotypes from allo-immunized anti-RH4 women were done

non-invasive fetal RHE genotypes from allo-immunized anti-RH3 women were done (66 positive foetuses, 1 undetermined

For 21,5% of the allo-immunized women, the pregnancy was compatible and no specific antenatal monitoring was necessary

Summary/Conclusions: Non-invasive fetal red blood cell genotype is a powerful tool to diagnose a feto-maternal red blood cells incompatibility and allows to legitimize a costly and heavy specific antenatal monitoring

S Purchla-Szepioła 1 , M Krzemienowska 2 , M Pelc-Kłopotowska 2 , M Jurkowska 3 , M Debska 4 , M Uhrynowska 2 and E Brojer

The test developed by IHTM has been offered to clinicians and pregnant women since 2016 but it is not covered by the health care system. RHD NIPT is not informative for mothers with RHD variant. In such cases further analysis of the molecular background is offered to exclude from immunoprophylaxis the women with weak RhD type 1, 2 and 3. Aims: Summary of a 3-year period of routine RHD NIPT available at IHTM. Methods: cffDNA isolated using easyMag, Biomerieux from plasma of 366 pregnant women determined with standard serology as RhD-negative (in 8-38 week of gestation) was examined for the presence of exons 5 and 7 of RHD and CCR5 by realtime PCR using LC480II (Roche). Maternal DNA from whole blood was tested for identification of RHD variant using RBC FluoGene RBC-Dweak/variant (Inno-Train, Germany) or the home-made protocol. Results: In 123 cases the RHD gene was not detected in cffDNA and the administration of RhIg was not recommended. In seven cases Ct-values for RHD and CCR5 indicated a maternal D variant (D Ct CCR5-RHD >2); the genetic follow-up of six of them identified: RHD*01W.2 in 4 cases, RHD*01W.1 and RHD*15. In 235 cases the RHD NIPD results indicated that a fetus is RhD positive and RhIg administration was recommended

It was recommended in the remaining 67% of mothers. In 1.9% cases with maternal D variant RHD NIPT was not possible. However, in 5/6 such cases the test is unnecessary because follow up analysis revealed maternal RHD variant of the weak D type 1 and 2

In Switzerland extended antigen-matching for Duffy, Kidd and MNSbesides Rhesus and Kell -is recommended for sickle cell disease (SCD) patients. The ethnic diversity of red blood cell (RBC) antigen polymorphism engender that these patients are often transfused with RBCs from donors of African origin. This strategy, however, increases the likelihood of being exposed to certain low-prevalence antigens, such as Rh23 (D w ), as these are almost exclusive to African populations. Rh23 is encoded by several types of RHD*DV as well as by DAU-5. Anti-Rh23 is associated with delayed hemolytic transfusion reactions (HTR)

Aims: Here we report a specific low-prevalence antibody newly formed by the same patient, meanwhile gravida 4, para 1, causing positive crossmatches with the RBCs of two of the four selected donors. Subsequently, advanced serologic and genetic workup and close international collaboration enabled optimal patient care. Methods: Standard serological methods were used for antibody specification (BioRad, Cressier, CH and in-house). Crossmatches were carried out by indirect antiglobulin test at 37°C. Molecular typing of donors' and parental blood group antigens was performed by

Further serological analysis (Institute National de Transfusion Sanguine, Paris) revealed an anti-Rh23 in addition to anti-Fy 5 , anti-E and anti-Jk a . Genotyping of the two donors causing positive crossmatches presented heterozygosity for RHD*10.05 which encodes Rh23. The newborn's phenotype was A R0r K-, Fy(a-b+) and most likely Rh23-and Jk (a+b+), considering both maternal and paternal (A R0r, K-k+, Fy(a-b+), Jk(a+b-), Rh23-) predicted phenotypes. The neonatal serum contained maternal anti-A1, anti-Rh23 and anti-E. The direct antiglobulin test was positive but elution only showed nonspecific reactions with papain-treated cells. Latter might have been caused by anti-Fy 5

During her present pregnancy we were able to demonstrate that two positive crossmatches of two former compatible donors were caused by a new alloantibody against a low-prevalence antigen, namely anti-Rh23, derived from several Rh23 + RBC transfusions during the previous pregnancy. Despite this challenging blood supply we were able to support the patient with a total of ten antigen compatible and crossmatch negative RBC units from French and Swiss donors until delivery

With increasing age, the relative number of women in the study population raise from 22% in the patients younger than 60 years to 58% in the patients older than 80 years. Our study showed that cardiovascular diseases were the commonest indications for warfarin use in older patients with 59%. Only 48,5% achieved target therapeutic range

While the risk of thromboembolism and the subsequent need for proper anticoagulant therapy increases sharply with age, the bleeding risk rises as well. Older patients are more sensitive to any given dose of warfarin and need a significantly lower total weekly dose. A well-informed patient provides one of the best defenses against bleeding complications. Recent data demonstrate DOACs advantages over warfarin, especially for older population: more predictable dosing, fewer drug interactions and reduced risk of intracranial bleeding

Although vast majority of FH cases are caused by mutations in LDL-R gene 17%-33% patients do not harbor genetic cause in the known loci. Patients with homozygous/severe heterozygous FH are unresponsive (LDLc above 200 mg/dL with diet and drug therapy) and require additional extracorporeal therapy to reduce LDLc concentrations to prevent the development/progression of CAD. LDL apheresis techniques remove apolipoprotein B-containing lipoproteins from blood and include heparin-induced extracorporeal LDL precipitation(HELP), immunoadsorption, dextran-sulfate adsorption

Methods: A 28y Iraqi male visited Cardiac-OPD. CT coronary angiogram showed CAD-DVD. He had multiple tendinous xanthomas and xanthelasmas. Family history was significant for death of elder brother from coronary event at 30y, a sister with similar profile age 26y and one sister apparently normal. He was taking medical treatment for dyslipoproteinemia (Ecosprin 75 mg OD, Ticagrelor 90 mg BD, Rosuvastatin 40 mg OD). Despite dietary and medical treatment his dyslipoproteinemia was refractory. Therefore Cascade-filtration was planned with Evaflux5A plasma fractionator. One procedure of Cascade plasmapheresis was done on Com.Tec apheresis system (Fresenius Kabi, Germany) separating patient's plasma as the first step and passing it through a pore sized based filter column 5A20 (Evaflux, Kawasumi, Japan) as the second step. A total of 1.5x plasma volume(4470 ml) was processed. The patient was given continuous calcium infusion. The flow rate of 50 ml/min was maintained

Immunoglobulins) were not assessed. Summary/Conclusions: The procedure successfully met the requirement of reduction of cholesterol by 60%. The patient became responsive to the medical treatment. Follow up of the patient up to a year has been uneventful with no additional procedure requirement

Actions included development of major haemorrhage protocols with improved communication and required instances of delayed transfusion to be reported to the UK national haemovigilance scheme (Serious Hazards of Transfusion, SHOT)

Methods: Delayed transfusion data have been collected from 2010. Hospitals identify incidents and report them via an online database. MH may also result in avoidable or overtransfusion. Reports are analysed and collated data published in the SHOT annual reports in July each year. Results: The total number of reports of delayed transfusion has increased with time: 101, 95, 111 in the last 3 years. Delayed transfusion in relation to MH was reported for 54 cases 2016-2018 contributing to death in 6 patients

7%) miscommunication was noted between clinical different teams, between emergency departments, porters and the transfusion laboratory, failure of bleeps, failure to communicate the urgency, failure to confirm the patient location. Failures to follow MHP correctly occurred in 31/71 (43.7%): incorrect activation including failed alerts to porters, wrong contact telephone details and wrong components in the MHP packs

Most transfusions included red blood cells (median, 2 units); 14% of women were transfused with fresh frozen plasma (median, 2 units) and 2% with platelets. Mean pre-and post-transfusion hemoglobin levels were 6.7 g/dL and 9.0 g/dL, respectively, representing an increment of 1.0 g/dL per RBC unit transfused (1.09 g/dL in Soweto and 0.83 g/dL in Durban). Indications for transfusion included obstetric hemorrhage (31%), chronic anemia (29%), surgery or anesthesia (13%), other (9%) and not specified (17%). Transfusion for chronic anemia (vs. hemorrhage) was associated with gestation ≥ 26 weeks (odds ratio = 7.07, 95% confidence interval 3.52-14.24). Surgical blood loss was a common indication in trimester 1 (21%) that declined to 7% then 1% in trimesters 2 and 3. Summary/Conclusions: Hemorrhagic complications accompanying spontaneous abortions and ectopic pregnancies in the first and second trimesters were the most common reasons for antenatal transfusion

Surveillance and analysis of blood transfusion reactions represents inseparable part of hemovigilance. Aims: Summarization of data on reported cases of transfusion reactions. Methods: Analysis of serious undesirable reactions to blood products administration in the Czech Republic (CR) during period 2016-2018. Results: There were evaluated 1,281 688 of blood products administrations in 117,414 patients in the CR during defined three years period. Announced 1,456 (0,11%) transfusion reactions including 50 severe transfusion reactions (20 9 adjudged with grade 3). The most frequent types of severe transfusion reactions: Anaphylaxis 20, TRALI 7x, TACO 5x, HCV 4x, HBC 2x, bacterial infection 1x, delayed hemolysis 1x. Transfusion reactions incidence according to administered BP: Red blood cells products: 882,017 administrations, 883 transfusion reactions (FNHTR 386x, Allergy 227x, circulatory overload 66x, anaphylaxis 6x, TRALI 4x, HBV 2x, HCV 1x) Platelets: 88,438 thrombocyte administrations, including 178 transfusion reactions (Allergy 129x, FNHTR 30x, Anaphylaxis 5x, Circulatory overload 8x, Delayed immune hemolysis 3x, Acute circulatory overload 8x. Granulocytes: 203 administrations, 2 transfusion reactions Plasma: 293,801 administrations, 359 reactions reported (allergy 278, FNHR 25, circulatory overload 14, anaphylaxis 17x, TRALI 4x, HBV 3x, ARDS 1x. Summary/Conclusions: Conclusions: Comprehensive analysis and data processing help to appropriate prospective setting of blood products (BP) production and hemotherapy. Concrete outputs from processed data triggered undermentioned changes in many departments in the CR: 1. plasma for clinical uses from male blood donors, 2. prestorage of leucocyte reduced blood products, 3. production of platelets in additive solutions, 4. implementation of PCR testing method for blood donors screening. Background: SKAE's basic activities include epidemiological surveillance of all adverse events (AEs) associated with deviations in the collecting, testing, processing, storage and distribution of blood and blood components that may affect quality and safety

Near misses" and "uneventful transfusion errors" are collected to identify preventable causes. Incorrect Blood Component Transfused (IBCT) events are reported following IHN instructions. Results: A total of 5

They were mainly associated with deviation in Processing (22.4%) and attributed to Equipment failure and Materials (71%)

Whole Blood Collection, Materials and Distribution, as a result of Product Defect, Equipment Failure, Human Error and Other. Trend analysis showed a significantly increasing (P < .001) annual rate of total AEs by 28% (95% confidence interval 26-30)

) 10% fibrinogen-depleted pHPL or (3) 10% fibrinogen-depleted pHPL plus heparin. Internalization of fluoresceinamine-labeled heparin in STCs was investigated by flow cytometry and immunocytochemistry. All stromal cells were subjected to whole genome expression analysis (Affymetrix Human Gene 2.1 ST array) and data were analyzed using R/Bioconductor and Panther analysis tools. Confirmative qRT-PCR was performed and protein levels of selected pathways were analyzed by a bead-based western blot system (DigiWest â ). Immunophenotyping, in vitro differentiation, longterm proliferation and colony forming units (CFU) assays were done for all cell types. Results: In vitro exposure of heparin induced differential internalization and lysosomal accumulation in stromal cells, as well as regulation of distinct gene sets, both in a tissue-source dependent manner. Affected signaling cascades were mainly involved in proliferation, cell adhesion, apoptosis, inflammation and angiogenesis. The influence of heparin on protein expression and phosphorylation of four pathways (WNT, PDGF, NOTCH and TGFbeta) was further analyzed, revealing most alterations in BM-STCs. Independent of origin and medium composition, flow cytometry analysis revealed the characteristic fibroblastoid phenotype profile (CD73+/90+/105+ and CD14-/19-/34-/45-/HLA-DR-). In addition a comparable osteogenic and adipogenic differentiation capacity was found

Summary/Conclusions: Internalization of heparin in lysosomes by stromal cells, differential gene and protein expression and phosphorylation changes were observed in a tissue-source dependent manner. However, stromal cell characteristics as immunophenotype pattern, long-term proliferation, clonogenicity and in vitro differentiation were unaffected, putatively by post-translational protein modifications. In this respect, application of porcine heparin is compatible with efficient manufacturing of stromal cell based medicinal products

ABO incompatibility may have no effect on the clinical outcome after allogeneic hematopoietic stem cell transplantation. However, it carries additional risks of hemolytic reactions, delayed red blood cell (RBC) engraftment and incidence of graft-versus

Patients were categorized according to ABO compatible and mismatched groups; these were further sub-categorized into major, minor and bidirectional. Direct Coombs test (DCT) was performed when hemolysis was suspected in the post-transplantation period along with serum Lactate dehydrogenase (LDH)

5%) were male and 31(36.5%) female. Mean age of ABO matched and mismatched groups were (6.99 AE 4.6) years. Most common indications for transplant included beta thalassemia major 53(60.2%), aplastic anemia in 25(28.4) and pure red cell aplasia 2(2.35%). Source of stem cell was bone marrow in 45 and peripheral blood 40 patients

ABO matched while ABO mismatched group comprised of 28(32.9%) patients with further subdivision into major (n = 13), minor (n = 13) and bidirectional

In the post transplantation period, packed red blood cell and platelets were transfused in matched group (n = 401) and (n = 1837) comparably(n = 102) and (n = 480) in mismatched group. Primary and secondary graft failure in matched group was 8.77% and 12.28% patients while in mismatched group graft failure was observed in 4(14.28%) patients respectively. Positive DCT in ABO matched group in 1(1.75%) patient, whereas 2(7.14%) patients with major and minor ABO mismatch group with raised LDH levels and deranged LFTs were found. Episodes of acute and chronic GVHD in ABO compatible and incompatible groups were insignificant. Overall survival in ABO

Summary/Conclusions: These results indicate that ABO incompatibility does not seem to influence outcome of the patients undergoing allogeneic hematopoietic stem cell transplantation. Careful monitoring of patients can help detect problems early and treat them efficiently, thus, reducing the number of life threatening events

A Picascia 1 , C Sabia 1 , F Cavalca 1 , G Nicoletti 2 and C Napoli 1

In our routine work with One Lambda SAB class II reagents, we observed non-specific reactivity with some beads bearing DR4 and DR16 in patients without sensitizing events. This pattern was not confirmed by testing same sera with screening-and PRA-beads suggesting non-specific reactions. Aims: Here, we sought to determine if fetal bovine serum (FBS) treatment would be effective in reducing/eliminating non-specific reactivity. Methods: We tested 5 sera pre-treated with FBS from non-sensitized patients that showed the DR4/DR16 pattern. In particular, 5 ll of FBS was added to 95 ll of patient serum; incubated for 30 min at 37°C; centrifuged and subsequently tested in the SAB assay. As controls, we treated sera from 5 patients with documented DSA including DR4/DR16 and 5 patients without HLA antibodies. Results: DR4/DR16 non-specific reactivity was eliminated or significantly reduced after FBS treatment. We found that patients with DR4 and DR16 DSA had no change in MFI values and additional reactivity was not observed in negative FBS treated sera

Transfusion Medicine, National Blood Transfusion Centre 2 Transfusion Medicine, National Blood Transfusion Center 3 Transfusion Medicine, National Blood Transfusion Centre, Tirana, Albania Background: ABO blood group, has been associated with many diseases, although the explanation for ABO's blood group association and some illnesses is still unclear. Aims: To find the distribution of cases by blood groups in patients with malignant pathology compared to donors in order to assess the presence of the ABO blood group as an epidemiological indicator to identify populations exposed to different malignant pathologies Methods: We conducted a case-control study. ABO blood group and diagnosis of all patients have been studied. The control sample was collected from 17,992 healthy donors from which group A (36,8%), group O (41,7%), B (16,2%) and group AB (5,3%) resulted. The study was conducted in 3727 patients who have been transfused and submitted a request to determine the blood group at the Blood Bank at QSUT during the period 2011-2017 Results: Among the 3727 patients, when all malignant pathologies were taken together, the highest frequency was seen in blood group A (39.7%), followed by 0 (39.5%), B (15.2%) and AB (5.4%). Group A frequency was higher and O was lower compared to controls. A high incidence of blood group A is seen in: pancreatic cancer A (42%), in gastric cancer A (43%), colorectal cancer A (39, 6%), breast cancer A (41%), cervical cancer A (43%) and ovarian cancer A (42%) versus A (36.8%) in the control group. A high incidence of blood B is seen in multiple myeloma B (22%) and cervical cancer B (20%) versus B (16.2%) in the control group. Blood group AB has a high incidence in malignant lymphoma AB (10%) versus (5.3%) in the control group Summary/Conclusions: It appears that individuals with blood groups A, B and AB are more at risk of developing malignant pathologies and individuals with blood group O are more protected.

Background: The high homology and opposite orientation of RH genes promote many rearrangements between them and generate a large number of RHD and RHCE variants which can be inherited together. Several studies have shown that those Rh variants in patients with SCD represent an additional risk for alloimmunization and delayed hemolytic transfusion reactions (DHTRs), but little clinical or biological evidence related to alloimmunization and DHTR are presented for all the RH variant alleles. It is well established that transfusion recipients with the most common weak D types 1, 2 and 3, are not at risk for forming alloanti-D when exposed to conventional RhD-positive RBCs. Aims: We report here a case of a 12-year-old patient typed as weak D type 3, receiving D+ RBC units who presented anti-D in his plasma detected three weeks after the last transfusion. Methods: RHD BeadChip (Immucor, NJ, USA), was performed to identify the RHD variant allele associated with the weak expression of D. RHCE genotyping was performed by laboratory developed tests. Sequencing of RHD, RHCE and RHAG were performed to determine if there were other mutations that could explain the production of alloanti-D. Serologic testing was by standard hemagglutination methods. The clinical significance of the antibody was evaluated by monocyte monolayer assay (MMA). Results: Serological analysis showed a negative DAT and the presence of anti-D in plasma (2+ by gel). Anti-LW was ruled out. RHD genotyping revealed the patient was RHD*weak D type 3. RHCE genotyping predicted the D+C+c+E-e+ phenotype. Sequencing of RHD, RHCE and RHAG found no additional changes and confirmed the presence of RHD*weak D type 3. MMA showed the anti-D was clinically significant (>5%). Summary/Conclusions: We report the production of alloanti-D in a SCD patient with RHD*weak D type 3 allele. Weak D type 3 patients are not considered to be at risk for allo anti-D but our results show that there are exceptions and that these anti-D can be associated with clinically significant RBC destruction. Background: The MNS blood group system is located on Glycophorin A (GPA), Glycophorin B (GPB) and hybrid glycophorins on the surface of the red blood cell (RBC). These glycoproteins are involved in complex structures interacting with other RBC surface proteins including the Band 3/Diego protein. The glycophorins are heavily glycosylated and contains multiple clinically significant blood group antigens. It has proved difficult to model the GPA extracellular structure due to its heavy glycosylation, and lack of homology with existing modelled proteins. Aims: To develop an in silico model of GPA as a basis for improved predictions of structure function relationships Methods: Prediction of secondary structure and disorder: 1.1. PredictProtein (https://predictprotein.org); 1.2. Spider2 (http://sparks-lab.org/server/SPIDER2/); 1.3. DSC (Discrimination of Protein Secondary Structure Class): Using an in-house implementation; 1.4. Jpred4 (http://www.compbio.dundee.ac.uk/jpred4/); 1.5. RaptorX (http://raptorx.uchicago.edu). Prediction of secondary structure: 2.1. Robetta (http://robetta.bakerlab.org/submit. jsp); 2.2. FALCON (http://protein.ict.ac.cn/TreeThreader/); 2.3. iTasser (https://zha nglab.ccmb.med.umich.edu/I-TASSER/) Threading methods to evaluate the quality of protein structures: 3.1. Verify3D (http://servicesn.mbi.ucla.edu/Verify3D/); 3.2. Prosa (https://prosa.services.came.sb g.ac.at/prosa.php) Protein-Protein Docking: 4.1. GRAMM-X Protein-Protein Docking Web Server (http://vakser.compbio.ku.edu/resources/gramm/grammx/); 4.2. GRAMM (http://va kser.compbio.ku.edu/main/resources_gramm1.03.php) Results: Using in silico modelling we derived a stable tertiary glycosylated structure for GPA both as an individual protein and a homodimer. The hybrid glycophorin Background: Non-invasive prenatal testing of fetal antigen using cell-free fetal (cff) DNA from maternal plasma of immunized women is widely implemented into clinical routine but the sensitivity and specificity of the method, especially for genotyping antigens encoded by single nucleotide polymorphisms such as K antigen, is limited by low proportion of cffDNA in maternal plasma DNA. According to literature reports detection of circulating tumour (ct)DNA can be improved by selection of short ctDNA fragments using automated electrophoresis methods. Aims: The aim was to assess the feasibility for enrichment of cffDNA fraction in maternal plasma DNA by size selection using the Pippin Prep gel selection system. Methods: Plasma DNA isolated using easyMag (Biomerieux) from RhD negative and K-negative pregnant women (n = 10) carrying fetuses with known genotype was loaded into 3% agarose gel casette (3% DF Marker Q3, Sage Bioscience) and size selection of fraction was performed on a Blue Pippin TM (Sage Bioscience) with the elution from 45 min to 2 h 30 min of electrophoresis. Results for real-time PCR detection of fetal RHD, KEL*1 and CCR5 (as a marker of total plasma DNA) in DNA fraction after gel selection were compared to results obtained from non-processed plasma DNA. Results: The total DNA level (measured by CCR5) was significantly lower in DNA samples tested after gel selection (from 8.4 to 25.9geq/PCR) versus the level obtained from non-processed plasma DNA (from 130 to 133geq/PCR). The results for fetal fraction (measured by RHD) from DNA samples of RhD-negative pregnant women carrying RHD positive fetus tested after gel selection were from 1,5 to 6.6geq/PCR versus 10.8-11.2geq/PCR for non-processed plasma DNA. Results for KEL*1 detection in plasma DNA from K-negative pregnant women carrying K-negative fetus were KEL*1-negative in DNA samples tested after gel selection comparing to nonprocessed DNA samples were false KEL*1 positive amplification was observed. However, KEL*1 detection in plasma DNA from two K-negative pregnant women carrying K-positive fetus gave false KEL*1-negative results in DNA samples tested after gel selection comparing to non-processed DNA samples were KEL*1 positive genotype was obtained. The total DNA level in samples from K-negative women was from 18.3 to 18.7geq CCR5/PCR after gel selection versus from 52 to 746geq CCR5/ PCR in non-processed DNA samples. Summary/Conclusions: Using the Pippin Prep gel selection system increases the proportion of cffDNA fraction in total plasma DNA by retaining long maternal DNA fragments in the gel cassettes, but the protocol of gel separation dilutes the separated material decreasing the concentration of fetal DNA and leading to false negative results of NIPT.

ANTI-RH1 QUANTIFICATION ASSAY USING IH-500 (BIO-RAD â ): PROMISING RESULTS FOR MONITORING RH:-1 PREGNANT WOMEN J Beaud, H Delaby, C Toly-Ndour, A Mailloux and S Huguet-Jacquot Centre National de R ef erence en H emobiologie P erinatale (CNRHP), Hôpital Saint-Antoine, Paris, FranceBackground: The generalization of immunoprophylaxis by anti-RH1 immunoglobulins since 1970 complicates the interpretation of the anti-red blood cell antibodies screening during pregnancy. To distinguish an alloantibody from a passive one, many laboratories in France use anti-RH1 microtitration. It is a column agglutination technology using red blood cells RH: 1, -2, -3,4,5 (R0r) . It permits to quantify low levels of anti-RH1 in comparison to a range of an anti-RH1 standard. Performed since 1999 at the CNRHP and automated on Evo clinical Base Tecan in 2008 (dilutions and distribution), anti-RH1 microtitration is well adapted to Rh prophylaxis. Aims: The aim of this study was to evaluate this technique on the IH-500 system from Bio-Rad â . Methods: On IH-500, the reactivity of the Bio-Rad â reagents was compared with the CNRHP reagents (red blood cells R0r, anti-RH1 standard). The performances of the method were evaluated using three internal quality control (ICQ) (2 CNRHP home-made at 2 and 12 ng/ml and 1 Bio-Rad â at 12 ng/ml) on papainized R0r (PLC) and native R0r (NLC). A comparison of results from patient sera ranging from 1.5 to 48 ng/ml was done between IH-500 and Evo clinical Base Tecan. Results: The results of the 3 QCI are similar between the different reagents used. There is no significant difference between the 2 types of red blood cells except for the limit of detection: 1.5 ng/ml in PLC -6 ng/ml in NLC. For the 3 QCI, the intra and interassay imprecision based on the dilution degree show coefficients of variation between 0 and 15%, similar to those found with the Evo Clinical Base. The correlation with the CNRHP technique performed on 50 samples in PLC and 44 samples in NLC was satisfactory (Deming PLC: r2 = 0.80 Y = 0.89X + 0.78 -NLC: r2 = 0.86 Y = 1.08X-0.25). Summary/Conclusions: The anti-RH1 microtitration on the IH-500 offers similar performances to the method conducted at the CNRHP. The IH-500 allows automated reading of gel cards. However, it does not have a calculation or interpretation algorithm and does not directly give the concentration of anti-RH1. This final part remains manual and requires trained staff. Background: Haemolytic disease of the foetus and newborn (HDFN) due to maternal-foetal incompatibility has been perfectly framed for decades from the etiologic, pathogenetic and therapeutic point of view. The anti-D alloantibody is most frequently responsible for the most serious form of HDFN due to RhD incompatibility (RhDi HDFN). Although immunoprophylaxis (IP) has reduced the number of cases of RhDi HDFN, this disease continues to occur and red blood cell alloimmunization still remains the most common cause of foetal anaemia. HDFN due to ABO incompatibility (AB0i HDFN) is currently the most common neonatal haemolytic disease in the western world. However, only in about 1.5-2% of cases haemolytic disease demands transfusion support. Aims: Analysis HDFN from 2011 to 2018. Methods: The HDFN's transfusional support is: intrauterine transfusion (IUT) in the antenatal period; exchange transfusion (ET) for severe hyperbilirubinaemia and neonatal transfusion of small volumes red cells for the newborn's late anaemia in the postnatal period. Our policy for IUT, for ET and for the neonatal transfusion requires the use of a concentrated blood cells (EC) preferably group 0 Rh negative (cde/cde) or negative for any red cell antigens if the mother has antibodies, fresh (<5 days), preferably CMV safe. For IUT, the EC must be compatible with mother's plasma, must have hematocrit 70 + 5%, and irradiated. The unit for ET must be compatible with the newborn's plasma, whit hematocrit 40% -60% and irradiated. The EC used in post-natal transfusions is usually divided into rates of 70 mL, hematocrit 55 AE 5%. Results: In last 7 years, we calculated 59 neonates with HDFN (28 males and 31 females): 31 with RhDi HDFN, 19 with AB0i HDFN and 9 with HDFN due to incompatibility for other red blood cell antigens. We have produced 81 IUT: 48 for our hospitalized patients and 33 for patients located in other hospitals. 25 of these 48 patients, who received IUT, were immunized: 19 showed anti-D antibody and 6 antibodies different from anti-A and anti-B. 7, of the 31 infants with RhDi HDFN, were transfused in utero. 4 neonates on 59 (6.8%) have performed ET: 1 with AB0i HDFN and 3 with RhDi HDFN; the latter had also been transfused in utero. 27 neonates on 59 were transfused after birth: 18 with RhDi HDFN, 3 with AB0i HDFN and 6 with HDFN due to incompatibility for other antigens. Summary/Conclusions: Our case studies reflect the literature data. Neonates with RhDi HDFN are the most numerous (52.7% of the total) and are those who have requested the highest blood supply both in the antenatal period (39.6%) that postnatal (9.6% performs ET, 66.6% performs postnatal transfusions). Neonates with ABOi HDFN are 32.3%: nobody has received IUT, only one has been subjected to ET, and 11% has transfused after birth. Patients with HDFN due to other antigens are 15%, have undergone IUT 12.5% and were transfused after birth 22.2%. Background: According to British Guidelines on Neonatal Transfusion, since 2012 we shared with neonatologists a transfusion protocol for preterm babies. Patients are anemic premature newborns with a gestational age ≤ 30 weeks and/or a birthweight lower than 1500 g, until 4 months of age. Aims: Reduce the incidence of iatrogenic anemia. Methods: Pre-transfusion tests were based on AB0 direct test, Rh phenotype, direct and indirect antiglobulin test (DAT, IAT). A second blood sample was required for AB0/Rh confirmation. Blood transfusions were performed with 0 negative Kell negative (0 cde/cde/kk) CMV negative irradiated erythrocyte concentrates (EC) of less than 5 days. EC were subdivided in 70 mL aliquots with a hematocrit of 55 AE 5%. According to the definition of "small volume transfusions", our protocol established that further four transfusions had to be delivered free of testing. After the fifth EC transfusion the supplementary release of EC was provided of Type and Screen (T&S) test with 72 h of validity. Serological investigation and full compatibility testing were applied in the presence of a IAT and/or DAT positivity and in the case of mother alloimmunization.

Results: From October 2012 to the end of 2018, 694 premature newborns received 2328 EC transfusions within their first 4 months of life. In 51% of cases (n = 1186), transfusion requirement was comprised within the 'small volume transfusions'. Another 44% of cases (n = 1035), requiring further EC administration, was requested of a blood sample for T&S determination and 5% (n = 107) for a cross-match test. In 79.4% of newborns (n = 551), being transfused within the " small volume transfusions", blood requirement of 1401 EC was fulfilled by the initial blood test (1102 blood samples). 13.3% of newborns (n = 92) received more than 5 transfusions (6-21; median = 8) accounting for 820 EC released and for this group 381 blood samples were required. Summary/Conclusions: With the exception of babies requiring crossmatch test, 381 blood tests were performed to sustain 643 infants transfused with 2221 units. The alternative option of omitting crossmatch test (otherwise suggested by Italian Directives), allowed a reduction of 75% of blood drawn without any adverse effect or incident reported. Due to the relevance of anemia in premature babies, we suggest the application of this transfusion policy in all newborns in the first 4 months of life. Background: Glucose-6-phosphate dehydrogenase deficiency (G6PDd) is a sexlinked enzymopathy which is usually asymptomatic unless individuals are exposed to oxidative stress agents. The G6PD 202 genotype is the most common G6PD genotype in sub Saharan Africa (sSA). Some studies have linked blood from G6PDd donors to poor outcome of a transfusion. However, there are no genetic screening programmes for blood donors in the region hence the contribution of G6PDd to the donor pool in the sSA setting had not been described.Aims: This study aimed to describe the prevalence of G6PDd 202 genotype among donors in two regions in Uganda. It also described the effect of G6PDd and the coinheritance of haemoglobin S and a-thalassaemia on the haematological quality of blood. Methods: 3,255 blood samples from donor packs were utilized in a transfusion trial conducted in Uganda, were genotyped for G6PD 202, haemoglobin S and a-thalassaemia. Haemoglobin and haematocrit measurements for the donor units (packs) at the time of transfusion were used to describe the effect of G6PD 202 and co-inheritance with a-thalassaemia (N = 2,546) and haemoglobin S (N = 2,642) on the haematological quality of blood packs. A subset of 142 donor blood packs was utilized to determine the sensitivity and specificity of the CareStartTM rapid diagnostic kit (RDT) for G6PDd. Results: Based on G6PD 202 genotyping, 10.3% (N = 274) of the blood samples used in the trial were deficient for G6PD enzyme while 5.3% (N = 142) were heterozygous. Significant lower hemoglobin values were observed in red cell concentrates (P = 0.010) and whole blood (P = 0.009) donations of heterozygous G6PD 202 genotype. Co-inheritance of G6PDd and a-thalassaemia resulted in significantly lower haemoglobin levels. The CareStartTM RDT test was 83.3% sensitive and 0.8% specific for detecting donor blood packs with G6PDd. Summary/Conclusions: The prevalence of G6PDd among Ugandan blood donors was similar to that in the general population. The heterozygous genotype resulted in lower haemoglobin concentration of the blood units. The use of CareStartTM RDT for screening of stored blood units was not as efficient in this study hence further testing for the determination of G6PDd needs to be done on fresh samples from donors. 

Transfusion medicine, Jaypee Hospital, Noida, India Background: during last two decade there has been a continuous remarkable improvement in desensitization therapy in high risk HLA sensitized kidney recipients. In India there has been a tremendous increase in the number of kidney transplantations in patients having anti-HLA antibodies (HLA sensitized) with excellent success rate. Aims: In present study, we are describing successful role of desensitization in 39 HLA sensitized patients having preformed donor-specific HLA antibody (DSA). Methods: All patients were preconditioned with combined modality of a standard dose of rituximab, therapeutic plasma exchange (TPE) and low dose IVIG. TPE was started using COM. TEC (Fresenius Kabi, Germany) after 21 days of administration of Rituximab. Complement dependent cytotoxicity cross match (CDC-XM), Luminex cross match with donor lysates (LM-XM, Immucor INC., GA, USA) and flow cytometry cross match (FC-XM, BD FACS Canto II).) was done in all cases. If any of the three tests was positive, single antigen bead assay (SAB) was performed. Desensitization therapy was given in all cases where DSA was detected. Pretransplant TPE procedures were done until DSA (MFI < 1000) and CDC-XM became negative. CDCXM labeled positive at ≥ 10%. T-cell FCMX was considered positive above 42 MFI and B-cell FCMX was considered positive above 120 MFI. LMXM was considered positive above 500 MFI. SAB was performed using Lifecodes single antigen (LSA) class I and class II kits (Immucor, USA). If the specificity of anti-HLA antibodies was against donor HLA antigen(s) it was called as donor specific antibody (DSA). Results: Present study demonstrated the diagnostic and clinical superiority of adding FC-XM and LM-XM in pretransplant compatibility testing algorithm over CDC-XM. CDC-XM alone was not able to detect anti-HLA antibody in 8 patients (20.5%). Among the three pretransplant compatibility tests, FCXM demonstrated highest sensitivity. Among the 39 cases initially screened 35 showed DSA positivity in SAB. Desensitization was done in those 35 cases only. In our study, SAB was positive for class II alone in 13(37%) while in remaining 22 (63%) cases it was positive for both class 1 and class II. The number of pre transplant TPE procedures required was 6.7 (1) (2) (3) (4) (5) (6) (7) (8) (9) (10) (11) . The mean number of post-transplant TPE sessions required was 0.7 (Range, 1-6). During pretransplant and post transplant TPE procedures, five (14.3%) patients presented with allergic or hypotensive reactions which were managed conservatively. Most of the patients were discharged after seven days of hospital stay whereas patients who required post-transplant TPE were discharged after a relatively longer hospital stay (mean-8.5, median-7 days). After three months, protocol biopsy was done in those cases only where post transplant TPE was required. Protocol biopsy showed normal findings. In present study, the mean duration of follow up was approx 17 months with the longest duration of follow up of 36 months. Summary/Conclusions: In a country like India where there is a huge gap in the demand and supply of Kidney and a large no. of patients waiting for a suitable organ, transplant across HLA barrier could a good doable option. Thorough pretransplant compatibility and TPE are essential tools to make these transplants program successful Background: Most transfusion-dependent chronically anemic patients are managed by simple red cell transfusions. However, some patients are not able to tolerate the additional volume associated with simple transfusions and are at a high risk of developing transfusion associated circulatory overload, if transfused with multiple red cell units. Plasma-to red cell exchange (PRX) is a modified procedure wherein an apheresis machine is used to remove patient's plasma, while simultaneously replacing with donor RBCs. This procedure allows for a rapid euvolemic transfusion of RBCs to patients that are severely anemic and intolerant to excess fluid volume. Others as well as our group have previously described this procedure. We now summarize our institutions nearly seven years of experience performing this procedure on a routine basis. Aims: To document patient experience with PRX. Methods: We performed a retrospective chart review of all patients that underwent PRX at our institution in the last seven years. Our protocol for PRX has evolved during this period. Currently, we perform the procedures using Spectra Optia (Terumo BCT, Lakewood, CO) machine using the plasma-exchange program and tubing set. If the patient's pre-procedure hematocrit (Hct) is < 22%, we custom prime the tubing set with 5% albumin. The number of red cell units transfused to the patient depends on their pre-procedure hematocrit and is individualized to the patients. Results: We have treated four patients with PRX procedure. Patient #1 is a 56-year-old transfusion-dependent male with beta-thalassemia major. The patient had experienced multiple congestive heart failure exacerbations secondary to simple transfusions and we consequently performed PRX procedure, every 4 weeks, starting in 2012. The patient has completed 84 procedures with 3-4 units of washed red cells transfused to achieve a target HCT goal of 45 to 57%. He tolerated all procedures without any volume overload issues. He continues on this transfusion regimen. Patient #2 was a 25-year-old female who had symptomatic anemia secondary to sickle cell disease (Hb SS complicated by end-stage renal disease (ESRD). She had progressively become intolerant to simple transfusions, including an episode of severe dyspnea, which required intubation. She underwent 9 PRX procedures with 2-3 units of washed red cells. Patient tolerated the procedures without any significant complications. However, during a different surgical procedure, she experienced cardiac arrest and subsequently passed away. Patient #3 is a 33-year-old transfusion-dependent male with severe anemia secondary to sickle cell anemia (Hb SS). He was intolerant to excess fluid because of ESRD and congestive heart failure. He has undergone 38 PRX procedures with 3-5 red cell units transfused to achieve a HCT goal of 30%. He tolerated all procedures without any volume overload issues. He continues on this transfusion regimen. Patient #4 is a 48-year-old male with a sickle cell disorder (Hb SS) complicated by ESRD, heart failure and chronic hypoxemic respiratory failure. The patient has undergone two PRX procedures with 4-5 red cell units. Other than an episode of non-bloody emesis that was symptomatically treated, he tolerated both procedures. He continues to be managed on this regimen. However, the patient remains noncompliant with treatment. Summary/Conclusions: PRX is a safe and efficient method to transfuse multiple red cell units to volume-intolerant anemic patients. Background: Transplanted organ failure due to antibody mediated rejection in ABO-compatible organs is a serious complication with a bad prognosis. The goal treatment in these cases encompasses the following strategies: adjustment of the immunosuppressive medications, IVIG infusion, antibody removal by therapeutic plasma exchange, and/or the use of target-specific monoclonal antibody medications to lymphocytes, plasma cells, and/or complement. The 2016 American Society for Apheresis has assigned a category I to the use of therapeutic plasma exchange for the treatment of ABO-compatible antibody mediated rejection in kidney, but a category III to all other ABO compatible organs: Liver, Lung, and Heart. At our institution, a standardized approach for the use of therapeutic plasma exchange as a supportive intervention for ABO-compatible immune mediated rejection, regardless of the organ type, has been in place since 2011. Aims: A retrospective review was performed to evaluate our patient outcomes using therapeutic plasma exchange for the treatment of antibody mediated allograft rejection in ABO-compatible solid organ transplantation. Methods: Patients used for the retrospective review were selected from an existing therapeutic apheresis list. The therapeutic plasma exchange protocol consists of: adjustment of the immunosuppressive medications, IVIG infusion, antibody removal by therapeutic plasma exchange, and/or the use of target-specific monoclonal antibody medications to lymphocytes, plasma cells, and/or complement. It is performed as follows: One plasma volume exchange is performed on days 1, 2, 3, 5, 7, 9 along with one or more of the above strategies followed by an IVIG infusion. Cases with allograft rejection in which plasmapheresis was not used were excluded. and T Devos 7 Aims: This study aimed to explore the possible causes of the decreased transfusion rate for all adult cardiac surgery patients. Methods: Data were collected from adult cardiac surgery patients during the mentioned time frame and were extracted from electronic patient files and a database of the Department of Cardiac Surgery. A set of 63 variables was defined as possible confounders by a panel of experts. After discussion, 9 global variables (age, gender, duration of surgery, use of CPB (cardio-pulmonary bypass), American Society of Anesthesiologists (ASA) risk score, type of surgery, urgency, attending cardiac surgeon and attending anesthesiologist) and 7 CPB-related variables (administration of cardioplegia Yes/No (CPG), duration of CPB, circulatory arrest, hypothermia, duration of aortic cross-clamp, baseline hemoglobin and CPB-priming volume) were retained. Negative binomial models for counts were used for data analysis. All analyses were performed with SPSS. Results: 1018 patients were extracted from databases and further analyzed. The mean age of this group was 65,9 years (SD +/-14,1 years) and 67.3% of them were male. The mean duration of surgery was 256 min (SD +/-88,3 min). The decrease of perioperative RBC transfusion rate over four years was statistically significant (P < 0.001). In 2011, the mean use was 2,34 units per operation (SD +/-2,277), which changed to 1,38 units (SD +/-2,158) in 2014. Three variables (urgency, attending cardiac surgeon, attending anesthesiologist) changed significantly over 4 years and were used in a multivariable model as confounders together with RBC transfusions and year. Even after adjustment for these factors, the decrease in RBC transfusion rate was still statistically significant (P < 0.001). In the specific group of patients undergoing cardiac surgery with CPB (n = 640), the use of RBC was also significantly reduced (P < 0.001). In 2011, the mean use was 3,06 units per operation (SD +/-0,448) and this changed to 1,94 units (SD +/-0,167) in 2014. After correction for the 3 CPB variables that notably changed over the 4 years (CPG, priming volume and hypothermia) and the three previously defined confounders (urgency, attending cardiac surgeon and attending anesthesiologist) the reduction of RBC transfusions over 4 years still remained statistically significant (P < 0.001). Summary/Conclusions: Our study shows evidence for a decreased RBC transfusion rate in adult patients undergoing cardiac surgery between 2011 and 2014. This tendency was also seen in the subgroup of patients undergoing surgery with CPB. Possible explanations of the decrease are implementation of various established parts of patient blood management. However, a unique reason could not be identified in this study. Background: Growing worldwide demand for immunoglobulin products such as intravenous immunoglobulin (IVIg) and subcutaneous immunoglobulin (SCIg) is driving plasma collection. Patients with primary immunodeficiency (PID) or secondary immunodeficiency due to haematological malignancy or its treatment (SID) rely on these products to maintain therapeutic serum IgG levels to minimise recurrent infection. Efficacy of immunoglobulin replacement therapy (IRT) in PID is well established but information on SID is limited. The different aetiologies of hypogammaglobulinaemia between PID and SID raised the question of whether SID patients on IRT experience similar clinical and quality of life (QoL) benefits as reported in PID patients. Aims: To assess whether SID patients experience similar clinical and QoL benefits while on IRT as PID patients. Methods: Following ethics approval, data on dosage, serum IgG trough levels and infection (bacterial, viral and fungal requiring treatment such as antibiotics) was collected from 14 adult PID and 13 adult SID patients from medical records and pathology reports, for their last 12 months of IVIg and their first 12 months of SCIg. The starting and maintenance dose was 0.4 g/kg/month for IVIg, transitioning immediately to 0.1 g/kg/week for SCIg without a washout period. A study specific questionnaire was developed to gather data on patient perceived side effects, treatment satisfaction and impact of IRT on social/family life, work/study and their overall QoL. Paired t-test was used for parametric data and the Wilcoxon signed-rank test for non-parametric data. Results: SID patients were significantly older with a mean age of 62.9 years versus 43.4 years in PID patients (P = 0.007). A mean of three training session was required to reach competency in SCIg administration in both cohorts. There was a trend of reduced side effects on SCIg for PID and SID patients compared to IVIg, with a significant reduction of headaches in the PID cohort (P = 0.041). The majority of patients experienced infusion site reactions, which were predominantly perceived as manageable. 55% of infections were respiratory tract infections. PID patients had slightly higher mean serum IgG trough levels with SCIg (9.3 g/L) compared to IVIg (8.4 g/L), and fewer infections on SCIg than IVIg (mean annual infection rate of 1.64 vs 2.14 respectively). SID patients had higher mean serum IgG trough levels on SCIg (8.4 g/L) than IVIg (7.1 g/L) (P = 0.009) but experienced more infections while on SCIg versus IVIg (mean annual infection rate of 2.15 vs 1.62 respectively). The number of hospitalisation due to infection decreased in both cohorts with SCIg. PID patients perceived that switching from IVIg to SCIg improved their health and QoL. In contrast SID patients perceived no improvements in health and QoL. Summary/Conclusions: Data from this pilot study suggests that the clinical and QoL impact of IRT in SID patients is different to that of PID patients. To support evidence based IRT management and effective use of this limited and expensive blood product in SID, larger studies which account for different stages of malignancy and associated treatment regimes are required. Background: There is an increasing platelet transfusion for treatment and prophylaxis of bleeding in patients with hematologic disorders and malignancies. Because of limited resources, leukoreduced platelet concentrates is not yet implemented in most Indonesian hospitals. In vitro platelet activation may cause morphology, functional, and ultrastructure changes. Those changes will reduce the platelet viability, in vivo functions, and clinical efficacy. High platelet CD62P expression is the cause of faster platelet destruction in the reticuloendothelial systems. Post-transfusion in vivo hemostatic efficacy can be determined by the measurement of corrected count increment (CCI), recovery, and platelet CD62P expression. Aims: To analyze the increase of platelet CD62P expression in patients of non-leukodepleted compared to pre-storage leukodepleted PC transfusion.Background: Haemorrhage is a leading cause of preventable death not only in the military trauma care, but also for civilian population suffering accidents or bleeding injuries in regions with low population density where health services should reach people in remote areas. Resuscitation using blood products and limited infusion of normal saline improves survival for critically bleeding patients. Nowadays there are HEMS programs (Helicopter Emergency Medical System) carrying blood products around the world. The HEMS in Castilla-La Mancha, with physician and nurse, is the first out-of-Hospital Emergency Service in Spain that provides packed Red Blood Cells (pRBC) transfusion where the accidents happen without delaying the transport to the proper Hospital for definitive treatment. This program has been developed between the Blood Center of Ciudad Real and the HEMS team ('Gigante 2', Emergency Service Castilla-La Mancha). The goal of the designed protocol was to preserve the properties of the product to be transfused in out-of-hospital environment by HEMS teams. Aims: To describe the process for out-of-hospital pRBC transfusion in HEMS of Ciudad-Real. The protocol for out-of-hospital blood transfusion was developed according to criteria of medical indications and security, monitoring, and tracking of the product. Methods: Data for the observational retrospective study were collected from June 2014 to August 2018. The medical helicopter (EC 145T2) was provided with two pRBC O Rh(D) negative. The Shock Index was selected for the indication for transfusion according to the literature revised and as a simple rate to obtain out-of-hospital data. To achieve the feasibility and preservation of the pRBC a prospective monitoring of volume was established, haematocrit, haemoglobin, leucocytes, coulter, hemolysis and microbiological culture. Blood Center established two groups: the case group for the pRBC kept in the HEMS Base and Helicopter and the control group for the units remaining in the Blood Center with standardized blood conservation. For both groups, control and comparison of immediately obtained hematologic analyses, and 35 days after collection, were performed. The statistical analysis used SPSS 23.0 version (significance P < 0,05). Results: 138 pRBC samples were evaluated, 48,5% (67) from case group and 51,5% (71) from control group. Analyses were tested day 1 and day 35 after collection. Haemolysis was not observed. All cultures were negative. Although significant differences were found between the parameter in the value of before-after in the value of the hematocrit, leukocytes and coulter, there are no differences between the pRBC that flew and those conserved in the Transfusion-Service. All results comply with current legislation and blood transfusion standards. There have been administered 35 pRBC transfusion to 28 patients during out-of-hospital advanced medical assistance. No post-transfusion reactions have been registered. pRBC units have a 35-day rotation to allow the use of the units in the Hospital after achieving their optimal status. Summary/Conclusions: The out-of-hospital Transfusion protocol designed to transport blood (pRBC) in the helicopter for HEMS has demonstrated to keep the standard conditions and properties of the product to be considered useful in the treatment for critically bleeding patients in the out-of-hospital. Background: Early and adequate treatment of major bleeding is important for survival and a good outcome. Blood and plasma are given increasingly early including before hospital admission in trauma based on successes reported from combat experience. In 2010 the National Patient Safety Agency issued a rapid response report requiring National Health Service hospitals in England to take actions to improve provision of blood in an emergency including provision of major haemorrhage protocols (MHP) and drills. The National Reporting and Learning scheme had identified reports of 11 deaths and 83 instances of harm due to delay over a 4-year period. Aims: The aim of the study was to monitor the acid-base status of the patient by means of ABG and to administer the blood component therapy based on TEG results. Methods: This study was a prospective observational study of 18 adult patients over a period of 7 months. Serial monitoring of the ABG in the intra-operative period was done. TEG guided resuscitation was performed in all 18 cases. Results: The ABG analysis of all 18 patients showed decrease in the pH, increase in pCO 2 , decrease in serum bicarbonate level and elevation in negative base excess. These components of metabolic acidosis can be attributed to massive transfusion. Increased lactate, an independent parameter, which reflects poor tissue perfusion or shock and predicts need for massive transfusion was observed in all patients. All the 18 cases showed a decrease in ionized calcium levels which could be a result of citrate related toxicity. Increased glucose was observed in all patients which may be due to increase in the catecholamine release as a response to haemorrhagic shock. Electrolyte correction was given depending on results of the ABG analysis wherever appropriate. Two out of 18 cases showed an increase in R time indicating deficient coagulation factors, which was corrected with Fresh Frozen Plasma (FFP). Three cases showed elevation in K time indicating deficient fibrinogen levels, which was corrected by FFP. Fresh frozen plasma was also given in 4 cases, which showed decrease in the alpha angle, indicating deficient fibrinogen, and cryoprecipitate was given in 2 cases. Platelets were transfused in 5 patients showing a decrease in the Maximum Amplitude (MA), which indicates deficient platelets. Summary/Conclusions: TEG as POC testing is an important tool in appropriate blood component therapy in massive transfusions. Serial monitoring of ABG helps in monitoring acid-base status of the patient and therefore is a guide in the correcting electrolyte level in patients undergoing massive transfusion. Background: Massive blood loss is encountered in various situations like trauma, major surgeries, gastrointestinal bleeds and obstetric haemorrhages. Haemorrhage is an important cause of mortality and morbidity in massively bleeding patients. Early recognition of haemorrhage and intervention is essential for survival. Massive transfusion (MT) of blood is required to replenish blood losses and is a lifesaving treatment in these patients. A variety of haemostasis and pathophysiological changes occur during massive haemorrhage and massive transfusion. All of these changes contribute to the vicious cycle of progressive coagulopathy due to the 'lethal triad' of refractory coagulopathy, progressive hypothermia and persistent metabolic acidosis. Aims: The aims of the study included understanding management of cases of massive blood transfusion in surgical patients, impact of MT of blood components on patient outcome, evaluating post-operative complications of massive transfusion and the development of institutional Massive Transfusion Protocol (MTP).Methods: This prospective observational study commenced after Institutional Ethics Committee (IEC) approval. It comprised of 40 adult surgical oncology patients who received massive transfusions and was conducted for a period of 7 months. Every case of a massive transfusion was studied under the following headings (1) Patient's details (2) Patients base-line laboratory tests (3) Resuscitation with transfusion (4) Intra-operative laboratory tests (5) Thromboelastography (TEG) (6) Post-operative complications (7) Duration of stay in the hospital (8) 30 day mortality rate. Results: Complete blood count, serum electrolytes, arterial blood gases, coagulation profile and TEG were used to monitor transfusion therapy in the intraoperative period. Intraoperative laboratory parameters of patients showed dilutional coagulopathy, metabolic acidosis, hypocalcaemia, hypomagnesaemia, hyperkalaemia and hypokalaemia, increased lactates and glucose. Electrolyte correction was done based on the derangement. The derangements were on a decreasing trend in the postoperative period and returned to baseline level by 2 nd or 3 rd post-operative day with no requirement of correction in the post-operative period. The post-operative outcomes were evaluated in terms of the Surgical Site Infection (SSI) as per the Centers for Disease Control (CDC) criteria, surgical complications as per modified Clavien-Dindo classification and respiratory complications. A total of 13 (32.5%) patients had SSI, 14 (35%) had surgical complications and 22 (55%) patients had respiratory complications. The length of the stay in the hospital was longer for patients who had postoperative complications. Despite complications, owing to excellent peri-operative care, 38 (95%) patients were discharged alive. Summary/Conclusions: Surgeries associated with massive transfusion are at an increased risk of SSI as well as morbidity and mortality. Complications associated with rapid transfusions of blood, acute haemorrhage and associated risk of the surgery lead to a prolonged ICU stay and increased length of stay in the hospital. A well-developed Massive Transfusion Protocol optimizing the ratio and dose of the blood component therapy results in excellent patient outcome with minimal postoperative morbidity and mortality. Background: Despite the introduction of new oral anticoagulants (dabigatran, rivaroxaban, apixaban), vitamin K antagonists (VKA), such as warfarin and acenocoumarol are still the most widely used oral anticoagulants for the treatment of non-valvular atrial fibrillation (NVAF). The use of VKA must be regularly and often laboratory controlled in order to ensure the adequacy of therapy and to avoid subdosing or drug overdose. The most commonly used test for the control of oral anticoagulant therapy is the prothrombin time (PT), expressed in INR system, which provides an internationally standardized monitoring of the treatment. Time in therapeutic range (TTR) represents a measure of the quality of the anticoagulant effect of VKA and estimates a percentage of time a patient's INR is within the desired therapeutic. Aims: The aim of this study was to evaluate of the effectiveness of VKA therapy in patients with NVAF and to identify factors affecting the anticoagulation efficacy. Methods: A retrospective study was conducted on a population of 725 outpatients with NVAF, treated with VKA and followed in Blood Transfusion Institute of Ni s from January to December 2017. Laboratory control of INR was done from capillary blood of patients on Thrombotrack Solo (Axis Shield, Norway) and Thrombostat (Behnk Elektronik, Germany). Targeted 15 AE 17.52%, but 49.72% of patients had a TTR less than 60%. Patients were at high risk of thrombosis in 6.15% of time (INR < 1.5) and high risk of bleeding in 2.2% of time (INR > 4.5). The most significant independent factors affecting the quality of VKA therapy are gender, arterial hypertension, diabetes mellitus and the use of amiodarone and antiplatelet drugs (aspirin, clopidogrel). Summary/Conclusions: The TTR is undoubtedly useful indicator of the effectiveness of VKA treatment. The most important predictors of poorer efficacy of VKA therapy are arterial hypertension, diabetes mellitus, patients' gender and the use of amiodarone and antiplatelet (aspirin, clopidogrel) drugs. To improve the quality of VKA therapy, education of patient and better collaboration with them, as well as a successful teamwork with clinicians are also imperative. Background: An estimated 1.9 million deaths per year result from haemorrhagic blood loss. At a cellular level, haemorrhagic shock develops when oxygen delivery is insufficient to meet oxygen requirements to maintain aerobic metabolism. Successful resuscitation prevents further oxygen debt and repays the prior oxygen debt. This includes the administration of fluids and blood components (e.g. plasma, red cells and platelets). Measurement of oxygen delivery and utilisation at a tissue level requires invasive monitoring not possible clinically, meaning that surrogate markers such as lactate and venous oxygen saturation (SvO 2 ) are used instead. New technologies such as incident dark field imaging and near-infrared spectroscopy may offer a non-invasive alternative; however their utility in haemorrhagic shock remains Background: Transfusion-induced red cell alloimmunization is still a major challenge in transfusion practice. Besides logistic problems for the transfusion laboratory, it may compromise available blood supply, and when undetected and unanticipated, it may risk haemolytic transfusion reactions. Knowledge about risk factors can help to optimize preventive matching strategies. Severe renal failure and subsequent renal replacement therapy influence the immune system and could therefore modulate the risk of alloantibody formation against foreign red cell antigens subsequent to transfusion. Aims: This study aims to quantify the association between renal failure, according to its degree and its treatment with renal replacement modalities, and transfusioninduced red cell alloantibody formation. Methods: We performed a multicenter case-control study within a source population of patients receiving their first and subsequent red cell transfusion between 2005 and 2015 in the Netherlands (Risk Factors for Alloimmunization after red Cell Transfusion, R-FACT study). Using a conditional multivariate logistic regression, we compared first-time transfusion-induced red cell alloantibody formers (N = 505) with two similarly exposed non-alloimmunized control recipients (N = 1010) during a five-week alloimmunization risk period. Degree of renal function was categorized as: 'no renal failure' i.e. glomerular filtration rate (GFR) > 30 ml/min/1.73 m 2 , 'moderate renal failure' i.e. GFR ≥ 10-30 ml/min/1.73 m 2 during a continuous period of minimally seven days, 'severe renal failure' i.e. GFR < 10 ml/min/1.73 m 2 and/or use of any type of renal replacement therapy during at least one day of the alloimmunization risk period. Odds ratios were interpreted and presented as relative risks (RR). Adjusted RRs were conditioned on the matching variables and identified confounders. Results: No renal failure was observed among 441 (87.3%) cases versus 838 (83.0%) controls; moderate renal failure among 24 (4.8%) cases versus 54 (5.3%) controls; and severe renal failure among 40 (7.9%) cases versus 108 (11.7%) controls. Among the latter, 30 cases and 97 controls underwent renal replacement therapy. Moderate renal failure and severe renal failure without renal replacement therapy were not significantly associated with red cell alloimmunization (adjusted RR 0.82, 95% CI 0.67-1.01 and adjusted RR 0.81, 95% CI 0.58-1.11, respectively). However, patients undergoing renal replacement therapy had a two-fold lower alloimmunization risk (adjusted RR 0.48, 95% CI 0.39-0.59) as compared to transfusion recipients without renal failure, unrelated to type and duration of renal replacement therapy. Summary/Conclusions: These findings suggest that patients undergoing renal replacement therapy have strongly diminished red cell alloimmunization risks. Further research should confirm these results and elucidate the underlying pathophysiological protective mechanism. Background: The ability of allogeneic hematopoietic stem cell transplantation(allo-HSCT) to prevent relapse depends partly on donor natural killer (NK) cell alloreactivity. NK effector function depends on specific killer-cell immunoglobulin-like receptors (KIR) and HLA interactions. Thus, it is important to identify optimal combinations of KIR-HLA genotypes in donors and recipients that could improve hematopoietic transplantation outcome. Aims: To obtain the optimal combinations of inhibitory KIR and its ligand between donor and recipient which is helpful for the guidance of selecting donors and recipients in HSCT. Methods: The PCR-SBT method was used for KIR2DL1, KIR2DL2/KIR2DL3, KIR3DL1, KIR3DL2 and HLA-A, -B, -C, -DRB1, -DQB1 genotyping. 58 pairs of HLA 10/10 identical donor/recipients matching samples were retrospectively analyzed. Three different models of KIR were established. There were KIR-KIR gene model, KIRligand model and haploid model. In KIR-ligand model, patients were divided into three groups: C1/C1 homozygote group (48 cases), C1/C2 heterozygote group (8 cases) and C2/C2 homozygote group (2 cases). According to the expression of 3DL1, 53 cases were 3DL1 positive and 5 cases were 3DL1 negative. There were 5 cases of Bw4/Bw4, 24 cases of Bw4/Bw6 and 24 cases of Bw6/Bw6 in the 3DL1 positive samples. According to the expression of A3/A11, they were divided into three groups: A3/A11 negative group (28 cases), A3/A11 heterozygous group (28 cases) and A11/ A11 homozygote (2 cases). According to KIR genotyping, KIR haploidentical group (38 cases) and KIR haploid mismatched group (20 cases) were divided. The clinical data on neutrophil and platelet remodeling time, GVHD and OS of 58 cases were statistically analyzed by the Mann-Whitney test or the Kruskal-Wallis test using Graph-Pad software v5.01. Results: There was no significant difference in the time of neutrophil and platelet remodeling, the incidence of aGVHD and the survival time after transplantation in the KIR genotype model. In haplotype model, there was no significant difference in neutrophil and platelet remodeling time and survival time after transplantation. The incidence of aGVHD was low when the KIR haploid mismatched and KIR3DL1 was positive. It was conducive to neutrophil and platelet remodeling when Bw4/Bw6 and A3/A11 was heterozygosity. Summary/Conclusions: It is important to establish the three different models of KIR genotypes, haplotypes and receptor-ligand mismatches for analyzing the effect on the prognosis of allo-HSCT. KIR-ligand model plays an important role in HLA unre-Background: Transfusion of platelet concentrates (PCs) has been associated with adverse outcomes including transfusion-related acute lung injury (TRALI). The underlying mechanism of TRALI has been related to the accumulation of immunomodulatory mediators (e.g. lipids, cytokines/chemokines) present in PCs. Current room temperature storage limits the shelf-life of conventional PCs to 5-7 days. Alternative storage conditions, including cryopreservation, offers extended storage and a solution for blood banking logistics. Cryopreservation of human PCs has been associated with higher concentrations of immunomodulatory mediators compared to room temperature stored PCs and it has been suggested that cryopreserved PCs may be immunomodulatory. To investigate the effects of cryopreserved PCs, a transfusion sheep model would be a beneficial approach. Aims: To characterize immunomodulatory mediators in supernatants of sheep conventional and cryopreserved PC and to investigate whether storage duration and cryopreservation impacts the accumulation of these mediators. Methods: Buffy coat pooled sheep PCs (n = 3), prepared in 30% plasma/70% SSP+ with minor modifications to standard human procedures, were stored room temperature (RT) for 7 days (D) and sampled on D2, D5 and D7. Cryopreserved sheep PCs (n = 3), prepared by the addition of 5-6% dimethyl sulfoxide, were stored at À80°C and sampled pre-freeze and post-thaw. Supernatant was prepared at each time point with double centrifugation and stored at À80°C. Concentrations of pro-inflammatory cytokines (interleukin (IL)-6, IL-1b, IL-17A), anti-inflammatory cytokine IL-10 and chemokines (IL-8, monokine induced by gamma interferon (MIG) and interferongamma induced protein (IP)-10) were measured using sheep specific in-house and commercial enzyme linked immunoassays (ELISA). Levels of non-polar lipid mediators, such as arachidonic acid (AA), 12-HETE and 15-HETE were assessed in the stored sheep PC-and cryo-PC supernatant using commercial ELISA. Results shown as mean AE standard deviation. The effect of storage was determined at P < 0.05 using paired t-test. Results: In RT stored sheep PC supernatant IL-6, IL-1b, IL-17A, IL-10, IL-8, MIG, IP-10, 12-HETE and 15-HETE were detected at D2, D5 and D7. Storage duration significantly increased accumulation of IP-10 at D5 (253.4 AE 266.7 pg/mL compared to 569.7 AE 272.7 pg/mL, P = 0.008) and further increased at D7, and IL-8 at D7 (3477 AE 937.4 pg/mL compared to 5092 AE 521.1 pg/mL, P = 0.0460). Cryopreserved sheep PC supernatant pre-freeze and post-thaw contained equivalent or higher concentrations of IL-6, IL-1b, IL-17A, IL-10, IL-8, MIG, IP-10, 12-HETE and 15-HETE than RT stored D5 PCs. However, cryopreservation did not impact levels of any of the platelet derived mediators. Summary/Conclusions: Several platelet-derived cytokines/chemokines, including high concentration of IL-8 with neutrophil priming activity, and non-polar lipids were found in stored sheep PC supernatant. These immunomodulatory mediators may contribute to adverse outcomes associated with PC transfusion. Storage at RT, but not cryopreservation was associated with increased accumulation of immunomodulatory mediators in sheep PCs. Most importantly, similar to human PCs, sheep cryopreserved PCs contained at least if not higher concentrations of majority of cytokines as PCs stored at RT, therefore making sheep a suitable model in which to investigate immunomodulatory effects of cryopreserved PC transfusion. Background: Transfusion, despite being a lifesaving therapy, has been associated with adverse transfusion outcomes. Transfusion related acute lung injury (TRALI) remains one of the leading causes of transfusion-related mortality. Accumulation of immunomodulatory mediators (e.g. lipids, cytokines/chemokines) present in blood products, including packed red blood cells (PRBCs), have been implicated with the development of non-antibody mediated TRALI. However, how specific mediators contribute to the underlying mechanism is yet to be defined. During routine storage of human PRBCs fewer than 10 cytokines/chemokines and several biologically active lipids have been identified. A sheep model of TRALI has successfully been developed using human PRBC supernatant, however transfusing sheep PRBC has not been investigated. To support the use of sheep PRBC in the TRALI model and to better understand the precise mechanism, characterization of the potential mediators in sheep PRBC is required. Aims: To characterize immunomodulatory mediators in sheep PRBC supernatants and to investigate whether storage duration impacts the accumulation of these mediators. Methods: Sheep PRBCs (n = 5), prepared according to standard human procedures with minor modifications, were stored (2-6°C, 42 days (D) ) and sampled at D2 and D42. Supernatant was prepared by double centrifugation and stored at À80°C. Concentrations of pro-inflammatory cytokines (interleukin (IL)-6, IL-1b, IL-17A), antiinflammatory cytokine IL-10 and chemokines (IL-8, monokine induced by gamma interferon (MIG) and interferon-gamma induced protein (IP)-10) were measured using sheep specific in-house and commercial enzyme linked immunoassays (ELISA). Levels of potential non-polar lipid mediators (arachidonic acid (AA), 12-hydroxyeicosatetraenoic acid (HETE) and 15-HETE) were assessed in the sheep PRBC supernatant using commercial ELISA. Paired t-test was used to compare fresh and stored PRBC supernatant (P < 0.05). Results are mean AE standard deviation. Results: At day 2, AA (75,142 AE 47,205 pg/mL), 12-HETE (849.1 AE 235.6 pg/mL), 15-HETE (87.6 AE 32.7 pg/mL) and IL-1b (144.7 AE 198.9 pg/mL) were detectable in sheep PRBCs supernatant. At day 42, storage duration significantly increased concentrations of AA (136,254 AE 60,433 pg/mL, P = 0.0425) and 15-HETE (380.9 AE 116.3 pg/mL, P = 0.0022) in sheep PRBCs supernatant. Summary/Conclusions: Similar to reported findings of human PRBCs, the predominant type of immunomodulatory mediators present in sheep PRBCs were non-polar lipids. The concentration of these non-polar lipids increased during storage. These immunomodulatory mediators may contribute greatly to adverse outcomes associated with PRBC transfusions. Further investigation is required to determine whether stored sheep PRBCs supernatant induce immunomodulation in sheep in vitro and in vivo transfusion models. Background: DSHTR incidence is reported as 1 in 2,500 transfusions, presenting days to months after the transfusion. The published data addressing the correlation between the strength of the antibodies detected after a DSHTR has taken place and the corresponding clinical symptoms as measured by laboratory parameters that assess the presence of hemolysis is limited. Aims: The aim of this study is to evaluate the correlation between the results of the DAT, automated and manual antibody reactivity strength with the corresponding clinical parameters of Hemoglobin, Lactate Dehydrogenase (LDH), Bilirubin, and Haptoglobin. Methods: A DSHTR is defined as discovering a new antibody within 28 days of a transfusion. For all positive antibody screens, a work-up is initiated consisting of identification panels, DATs, antigen typing of the red cells transfused, and eluates at the discretion of the Transfusion Medicine Physician. Additional laboratory testing for hemolysis is requested when indicated. A retrospective review was conducted of patients who were identified as having a DSHTR. Levels of Hemoglobin, LDH, and transfusion safety Background: RhD immunoglobulin (RhDIg) has been available for 50 years in Australia. Since its introduction for routine antenatal and postpartum prophylaxis, alloimmunisation has decreased from 16% to 0.2%, reducing the number of Australian deaths from haemolytic disease of the newborn over a hundred-fold, to approximately 0.01 deaths per 1000. Blood Matters Serious Transfusion Incident Reporting (STIR) system has been collecting transfusion incidents and adverse events across four Australian jurisdictions since 2007. Since January 2015, RhDIg administration errors have been reported. Aims: To understand incidents relating to the administration of RhDIg and increase safety and awareness of risks. Methods: Health services registered with STIR (n = 93) were notified of the inclusion of reporting RhDIg incidents. When an incident is identified, the reporter sends an online notification to STIR, prompting the appropriate investigation form to be sent for completion. The completed incident data are reviewed and validated by an expert group. Data is de-identified and collated for reporting. Results: During the period January 2015-December 2018, 45 reports were received; 43 reports were validated, with 2 reports excluded (reactions rather than administration errors). Reports were categorised as below: Background: Following the NICE Transfusion Guidelines, recommending offering iron before and after surgery to patients with iron-deficiency anaemia (IDA), we worked collaboratively with the anaesthetic and pre-operative team to implement a clear and robust anaemia pathway for pre-operative haemoglobin (Hb) optimisation. Oral iron was started, where appropriate, and our anaemia pro-forma was sent for review in a virtual clinic to assess eligibility for intravenous iron. We performed a retrospective evaluation of the patients who received IV iron during the anaemia pathway. Aims: The aim of this retrospective evaluation was to look at the cohort of patients who had received IV iron in 2017 and assess the effect of IV iron on haemoglobin levels for different defined groups. Methods: We classified patients, as described in Munting and Klein, 2019, depending on their iron parameters as having either: -IDAserum ferritin < 30 mg/L -Chronic inflammation with IDAserum ferritin 30-100 mg/L with transferrin % of < 20%/CRP > 5 mg/L -Anaemia of chronic inflammationserum ferritin > 100 with transferrin % of < 20%/CRP > 5 mg/L Patients were considered eligible for IV iron if the following criteria were met:1. An inadequate response to oral iron, OR were unable to tolerate oral iron OR the interval between diagnosis and surgery was short 2. The anaemia pro-forma was completed 3. Hb was ≤ 120 g/L 4. They were classified as either having IDA OR Chronic Inflammation with IDA OR Anaemia of chronic inflammation Hb was measured prior and on average, 20 days following the IV iron infusion. We excluded patients who had their post IV iron follow up blood tests done after surgery. Results: This retrospective evaluation included 80 patients. 48 patients were classified as having IDA and 32 patients classified as having chronic inflammation with IDA. Those classified with IDA had a mean Hb of 96 g/L (55-120), a mean MCV of 77.4 fL and a mean serum ferritin of 16 lg/L. Those with chronic inflammation with IDA had a mean Hb of 106 g/L (77-120), a mean MCV of 87.9 and a mean serum ferritin of 57 lg/L. Follow-up Hb was measured on average twenty days post IV iron infusion in both groups. The average Hb post IV iron infusion in the IDA group was 119 g/L (100-149) with an average increment of 23 g/L and in the group with chronic inflammation with IDA the average post IV iron Hb was 117 g/L (85-129) with an average increment of 11 g/L. Summary/Conclusions: In conclusion the group with IDA had, on average, a lower starting Hb that the group with chronic inflammation with IDA and the average increment in Hb 20 days post IV iron infusion was greater in the group with IDA. However, the group with chronic inflammation with IDA cases also responded to IV iron and therefore we strongly consider the use of IV iron in both groups. Further studies to evaluate the ongoing effect of IV iron would help assess whether the same level of increment seen with IDA can also been seen for the group with chronic inflammation with IDA over a longer period and how long the increment was sustained.

Background: The expansion of personalized genomic medicine has led to the development of targeted therapeutic approaches for patients. One example is sipuleucel-T, an autologous cellular immunotherapy product used to treat prostate cancer manufactured from the patient's white blood cells. This study describes our experience with incorporating autologous cellular immunotherapy products into the workflow of the blood bank. The policies supporting the workflow are outlined and compliance with them is assessed. Aims: This study aims to evaluate the process and method used to dispense and track the infusion of sipuleucel-T. Methods: This is a retrospective analysis of the dispensation and administration of sipuleucel-T from January 2012-August 2018, which was handled exclusively by the blood bank. Standard operating procedures and hospital policies were reviewed and compliance with these policies evaluated. Included were patients who had the sipuleucel-T product dispensed and administered. Information collected included the total number of products dispensed, patient age, adverse reactions/incidents, premedication, and patient outcome. Descriptive statistics were used for data analysis. Results: There were 154 products dispensed to 53 patients. The recipients were male patients diagnosed with prostate cancer with a mean age of 74 years. There were 3 doses (a complete course) administered to 50/53 (94%) recipients and a partial course (1-2 doses) administered to 3/50 (6%) recipients, for a total of 154 products. The blood bank workflow treated sipuleucel-T as a derivative in the computer system, listing the manufacturer (Dendreon Corporation) as the supplier. Health care providers were instructed to follow the nursing policy for the administration of blood products and derivatives for the infusion of sipuleucel-T. This policy required documentation of the infusion in a transfusion nursing note and reporting adverse events to the blood bank as transfusion reactions. There were no adverse events reported to the blood bank, yet there were 5 adverse events described in provider notes; 2 of them necessitating transfer to the Emergency Department, and 1 requiring hospital admission. Of the 154 infusions, 6 infusions were documented in a chemotherapy note rather than a transfusion note (4%), and 59 (38%) were documented as both a transfusion and a chemotherapy administration. There were 6 additional deviations from the blood product administration policy: 2 cases where the consent check was not performed, 1 case where the product was infused with Ringer's Lactate rather than normal saline, and 3 cases where the 2-person 3-way check erroneously indicated the product was irradiated. Summary/Conclusions: This study describes one approach to managing cellular therapy products as an extension to existing blood products dispensed by a blood bank. The findings demonstrate noncompliance with hospital policy with this new product as evidenced by failure to report adverse events and failure to follow hospital practices regarding administration. Although sipuleucel-T is a product manufactured from an autologous blood product donation, the administration and perceptions of this product may be more similar to a pharmaceutical. As the field of immunotherapies derived from blood product donations continues to expand, these products may necessitate an entirely new approach to ensure proper management.

Abstract withdrawn. (REF 10310) . While the MNC procedure is fully automated, CMNC requires frequent interface checks to ensure the collection of the correct cell layer. At the Rambam Health Care Campus, a tertiary care center, solely the MNC procedure had been employed till 2017, at which point, the CMNC has been introduced for the use in patients with a white blood cell (WBC) count of ≥ 20,000/lL on the collection day. Aims: The current study aimed to compare various parameters of peripheral blood stem cell (PBSC) collection, using the CMNC protocol in allogeneic donors and patients undergoing autologous stem cell (AutoSC) transplantation. Additionally, data on AutoSC collection using MNC (n = 31) and CMNC (n = 88) procedures were compared. Methods: Data were retrospectively obtained from PBSC collection reports in 134 consecutive CMNC procedures, including 88 autologous and 46 allogeneic donors. The following comparisons were made: CMNC results of allogeneic versus autologous donors, a sub-analysis of CMNC results for autologous donors with a PB CD34 + count ≥20/lL versus allogeneic donors as well as MNC versus CMNC results in autologous donors. The collection efficiency-2 (CE-2) was defined as the total CD34 + amount in the collection bag divided by the amount of CD34 + cells in the PB processed by the collection apparatus. Results: In the CMNC, the following parameters significantly differed between autologous and allogeneic donors: mean collection time (333 AE 59 and 289 AE 73 min, respectively; P = 0.001), the total blood volume processed (3.4 AE 0.8 and 2.4 AE 0.8, respectively; P = 0.001) and the final volume in the collection bag (337 AE 77 and 291 AE 84 mL; P = 0.001). The mean CE-2 in autologous versus allogeneic donors was 49 AE 24 and 66 AE 22, respectively (P = 0.003). Using CMNC, the collection was effective in 94% of allogeneic and 63% of autologous donors. In autologous donors, a significantly lower collection bag volume (341 AE 84 and 396 AE 132, respectively; P < 0.01) and increased total WBC in the collection bag (263 AE 119 versus 149 AE 36, respectively; P < 0.000) were obtained using CMNC compared to MNC protocol. Thirteen patients were treated with plerixafor due to a low PB CD34 + count following G-CSF therapy; 7 of them achieved a CD34 count ≥20 and their collection was considered effective. Summary/Conclusions: The CMNC protocol is highly effective in terms of the cell yield in both allogeneic and autologous donors with a PB CD34 + count ≥ 20/lL. Significantly superior collection results are obtained in allogeneic donors versus autologous ones. CMNC provides a significantly higher WBC and a lower final collection volume than MNC. Similar total CD34 + cell counts are obtained with both methods. . TBV processed ranged from 1-4.8 TBV with mean of 2.6, average was 2.65 TBV for females and 2.74 TBV for males Mean pre-apheresis CD34 + count was 92.89 cells/ll (Range 33.14-152.64). Mean postapheresis CD34 + count was 1402.3 cells/ll (559.02-2245.5). Mean CD34 + cells x10 6 / kg recipients body weight was 7.5 (Range: 2.77-12.33). Our target yield was ≥3 9 10 6 CD34 + cells/kg body weight of the recipient and in only 2/34 (6%) cases, the yield was <3. 18/34 (52.9%) procedures were LVL and 16/34 (47.1%) were SVL. Summary/Conclusions: Most of our PBSC were done for haematological indications (85.3%) and the target dose was 3 9 10 6 cells/ll in single leukapheresis. In 32 cases (94%), target yield was achieved, only 2 cases had <3 but >2 yield. In our study donors <5 years have shown to mobilize better than the older children. Hematocrit (Hct) and weight showed correlation with CD34 + cell yield but they cannot be taken absolute predictors. WBC count cannot be taken as a predictor for CD34 yield as high WBC count did not convert into high CD34 yield or vice versa. High prepheresis CD34 + count gave higher postpheresis CD34 + count. Large volume leukapheresis (LVL), >3 TBV gave higher yield as compared to Standard volume leukapheresis (SVL). Blood volume processed related to prepheresis CD34 + count and/or the weight difference between the donor and recipient. Other parameters like hematocrit, WBC count, age etc did not show correlation to the volume processed. In our study, younger age and prepheresis CD34 + count were found as the most relevant predictors for stem cell yield. Background: Allogeneic hematopoietic stem cell transplantation is an established therapy for many hematologic disorders. Since the discoveries of the potential of Peripheral Blood Stem Cells (PBSC) in the hematopoietic reconstitution mid 1980s and early 1990s PBSC gradually replaced bone marrow as the preferred source of stem cells. The introduction of hematopoietic cytokines that can mobilize large number of progenitors into circulation accelerated PBSC usage. Aims: The aim of our study is to present our 18 year experience with apheresis collecting of PBSC in donors. Methods: This is a retrospective study performed in the Institute for Transfusion Medicine of Republic of Macedonia and University Hematology Hospital for period Background: Obtaining unambiguous results of HLA typing plays an important role in the transplantation of hematopoietic stem cells. Appropriate selection of alleles in the level of HLA between recipients and unrelated bone marrow donors reduces the risk of transplant rejection and graft-versus-host disease. New generation technology ensures the highest possible resolution and obtaining unambiguous genotyping results due to the high complexity of the HLA system. Currently, this is the selection method for obtaining HLA test results at the high resolution level. Aims: The aim of this study was to determine 11 HLA loci (HLA-A, -B, -C, DRB1/3/ 4/5, DQB1, DPB1, DPA1, DQA1) in potential bone marrow donors from Poland. The research included 18,500 potential bone marrow donors registered between 2017 and 2018. A novelty of this paper was that the amplification of all 11 HLA loci was performed by using multiplex PCR primers in a single tube. That solution completely eliminated the need to pool amplicons. Methods: The typing of the 11 HLA loci (HLA-A, -B, -C, DRB1/3/4/5, DQB1, DPB1, DPA1, DQA1) of potential bone marrow donors was made by using the AllType TM NGS 11-loci Amplification Kit (One Lambda). Genomic DNA was isolated from peripheral blood of 18,500 donors. HLA genotypes were determined according to the manufacturer's protocol on the MiSeq Illumina platform. The obtained sequencing data was evaluated by using the TypeStream TM Visual NGS Analysis Software. Results: The NGS method allowed to obtaining unambiguous results of genotyping of potential bone marrow donors, and also provided the identification of rare alleles, such as: C*12: 143, C*12: 30, C*05: 37, C*07: 151, DRB1*11: 28, C*14: 04, B*51: 22, C*15: 13, DQB1*03: 12, DRB1*14: 87, DRB1*11:69. Summary/Conclusions: 1. New generation sequencing technology (NGS), which is based on PCR, ensures the highest possible resolution. 2. The NGS method allows to obtain more accurate sequencing results compared to the conventional methods. 3. The research has confirmed the superiority of the NGS method over conventional methods in obtaining unambiguous HLA genotyping results at the high resolution level. Background: The accurate results of HLA typing are significant for ensuring the success rate of hematopoietic stem cell transplantation. Currently, HLA typing is mainly based on Sanger sequencing, which has a high proportion of ambiguous combination results indicating potential errors for HLA typing. It is necessary for finding a more accurate typing method to reduce the risk. Next-generation sequencing (NGS) method could provide clonal sequencing of single molecules, which has been used for HLA genotyping and improved the scope and precision of HLA study. Aims: To establish a full-length precision sequencing platform for HLA-I gene (HLA-A, -B, -C) based on NGS technology and be evaluated by classical Sangersequencing method, which can effectively improve the accuracy of HLA typing for donor and recipient in hematopoietic stem cell transplantation. Methods: HLA-I (HLA-A, -B, -C) gene-specific primers were screened, and the amplification parameters were optimized to obtain full-length sequences of HLA-I gene under the same condition. The sample library for the amplicon was prepared with TransNGS Tn5 DNA library Prep Kit and the sequencing step was carried out with Illumina MiSeq platform according to the manufacturer' protocol. All the sequencing data in FASTQ format were analyzed by TypeStream Visual Software version 1.2.0(One Lambda Inc.)with the default setting. 94 cord blood samples were collected for HLA typing with the Mentioned above next-generation sequencing method in our study. In parallel, all the sample were also tested with the Sanger sequencing method according to the previous study in our laboratory. Results: 94 samples were successfully tested with two methods and the coincidence rate between two sequencing methods was 100%. With the next-generation sequencing method, the probability of ambiguous results among 94 samples in our study is 1.06%(1/94) for HLA-A, 5.31% (5/94) for HLA-B and 0% (0/94)for HLA-C. However, the probability of ambiguous results with the Sanger sequencing method is 96.8% for HLA-A, 95.7% for HLA-B, 100% for HLA-C. Summary/Conclusions: The full-length precision sequencing platform for HLA-I gene (HLA-A, -B, -C) based on NGS technology was established, which could greatly reduce the probability of ambiguous results and effectively improve the accuracy of existing HLA typing techniques.