key: cord-276565-vkbu581j authors: he, qing; zhang, guo; gu, ye; wang, jitao; tang, qiyuan; jiang, zicheng; shao, chuxiao; zhang, hongguang; chen, zhenhuai; ma, baoyi; liu, dengxiang; xie, guanghang; xu, dan; huang, yifei; zhang, haijun; liang, mingkai; huang, huihong; wang, yan; liu, hongyan; yang, jie; pan, hongqiu; zou, shengqiang; li, fujian; wang, fang; liu, chuan; wang, wenjuan; xiong, bin; li, xun; liu, lei; yang, jianrong; qi, xiaolong title: clinical characteristics of covid-19 patients with pre-existing hepatitis b virus infection: a multicenter report date: 2020-09-11 journal: am j gastroenterol doi: 10.14309/ajg.0000000000000924 sha: doc_id: 276565 cord_uid: vkbu581j nan coronavirus disease 2019 (covid-19) has become a global challenge since december 2019 (1) . of the 99 patients with covid-19 in wuhan, 43 (43.4%) had differing degrees of liver function abnormality (1) . therefore, liver disease in covid-19 attracted widespread concern (2). there are no data yet focusing on the impact of severe acute respiratory syndrome coronavirus 2 (sars-cov-2) infection in patients with underlying liver disease, such as hepatitis b virus (hbv) infection. to date, 257 million people are living with hbv infection worldwide (3) . thus, it is indispensable to study the clinical characteristics of covid-19 patients with preexisting hbv infection. data were obtained from a cohort (coronavirus disease 2019-hepatitis b virus-chinese portal hypertension diagnosis and monitoring study group, covid-hbv-chess) to consecutively monitor covid-19 patients in 10 designed hospitals of 8 provincial administrative regions in china ( figure 1a ). patients were hospitalized from january 10, 2020, to february 20, 2020, with a final follow-up on april 2, 2020. this study was approved by all ethics commissions, with a waiver of written informed consent. as of april 2, we have collected and analyzed 571 cases diagnosed with laboratoryconfirmed sars-cov-2 infection by real-time fluorescence polymerase chain reaction. fifteen (2.63%) of 571 patients had a history of hbv infection that seems to be lower than the incidence of hbv infection in the overall chinese population (5.7%) (3). there were no cases with cirrhosis diagnosed by either clinical findings and/or liver biopsy in the cohort. of them, 3 (20.00%) of 15 patients had a history of antiviral treatment (entecavir), and all had suppression of the hbv. the mean age of covid-19 positive patients with pre-existing hbv infection was 45.80 years (sd, 11.06), and 10 (66.67%) were men. the common symptoms at onset of illness were fever (9 [60.00%]), dry cough (7 [46.67%]), and diarrhea (2 [ figure 1b) . in the covid-hbv-chess study, we analyzed the clinical characteristics of covid-19 patients with pre-existing hbv infection for the first time, to our best knowledge; only by multicenter analysis can we follow-up covid-19 with underlying liver disease, such as hbv infection. we found that patients with pre-existing hbv infection might have a lower incidence of intensive care unit admission or death, and similar findings were reported in severe acute respiratory syndrome (sars) coronavirus with hbv coinfection during the outbreak of sars in 2003 (4). our hypothesis of the mechanism of this protective effect might be mediated by host immune responses (5) on the indirect interplay between hbv and sars-cov-2. however, the study was limited with a epidemiological and clinical characteristics of 99 cases of 2019 novel coronavirus pneumonia in wuhan, china: a descriptive study liver injury in covid-19: management and challenges accelerating the elimination of viral hepatitis: a lancet gastroenterology & hepatology commission clinical significance of hepatic derangement in severe acute respiratory syndrome dominance of hepatitis c virus (hcv) is associated with lower quantitative hepatitis b surface antigen and higher serum interferong-induced protein 10 levels in hbv/hcvcoinfected patients national clinical research center for infectious diseases, the third people's hospital of shenzhen, the second affiliated hospital of department of infectious diseases and critical care medicine, the affiliated third hospital of jiangsu university, zhenjiang, china; 8 department of respiratory medicine, the people's hospital of baoding, baoding, china; 9 department of respiratory medicine, the people's hospital of linxia hui prefecture correspondence: xiaolong qi, md. e-mail: qixiaolong@vip.163.com key: cord-007562-4hcs0z65 authors: bijlenga, g. title: proposal for vaccination against sars coronavirus using avian infectious bronchitis virus strain h from the netherlands date: 2005-07-19 journal: j infect doi: 10.1016/j.jinf.2005.04.010 sha: doc_id: 7562 cord_uid: 4hcs0z65 nan occult hepatitis b virus infection among anti-hbc positive blood donors: necessitates substitution of screening by hbv nat safe blood transfusion still remains a major concern and so far all the efforts in this direction have failed to achieve zero residual risk of transfusion transmitted hepatitis b virus (hbv) infection. in this direction the recently published work by silva et al. in journal of infection has revealed remarkable observations. 1 this report shows 3.3% hbv dna positivity of the blood donor's samples that were anti-hbc positive, more enlightening finding is the hbv dna positivity among the high level anti-hbs positive donors. at this tertiary care centre of saudi arabia out of 26 606 blood units collected during 2000-2003, isolated anti-hbc positivity was 3.2% and hbsag positivity 1.9%, where as 10.1% of the blood units were anti-hbc and anti-hbs positive. as per policy of health ministry, the anti-hbc and anti-hbs positive blood units were utilized and the isolated anti-hbc blood units were rejected. 2 the blood units which are anti-hbc and anti-hbs positive do not appear to transmit hbv infection and there is inverse correlation between anti-hbs level and infectivity, only 10% of the blood units with low level (!0.1 iu/ml) anti-hbs are infectious. 3 the observation by silva et al. that hbv dna positivity among anti-hbc and high level anti-hbs positive blood donors is a pointer towards the transfusion transmitted risk involved by transfusion of anti-hbc and anti-hbs positive blood units. though the viral load in these samples was low (!1000 copies/ml) but this can be highly infectious if transfused to an immunocomprised patient. considering the volume of infectious blood transfused any amount of hbv dna will be infectious as the minimum infecting dose of hbv in chimpanzees is only 100 virus particles. 4 in many of the developed countries and most of the developing countries the blood units collected are still being screened for hbsag, anti-hbc and anti-hbs by enzyme immuno assay. on many occasions the results are indeterminate and has to be repeated leading to higher per unit cost of blood screening and lot of rejection of the invaluable units of collected blood or exclusion of the generous donor because of isolated anti-hbc positivity and still the safety of transfusion transmitted hbv is compromised. this high rate of rejection of collected blood units and the exclusion of the anti-hbc positive blood donors leads to the unceasing blood shortage in the blood banks. the hbv screening policy for the collected units of blood needs reassessment in light of the present report 1 and hbv dna testing should be preferred instead of three enzyme immuno assay tests. hbv dna testing by nat of all the collected units of blood should be adopted by all the blood banks, in order to possibly achieve zero risk of transfusion transmitted hbv infection and also to reduce the rejection rate of the precious units of collected blood by testing for anti hbc. the outbreak of severe acute respiratory syndrome (sars) in 2003 has resulted in a number of infections and deaths among healthcare workers (hcws) and those in contact with sars-infected persons. the virus, now classified provisionally as a coronavirus in group 4, is highly contagious and treatment of infected persons has so far been disappointing. the first evidence of successful treatment in monkeys (cynomolgus macaques) was reported recently using alpha-interferon (ifn-alpha) 4 administered from 1 to 3 days after experimental exposure. this gave only some success, whereas the drug given at 3 days before experimental infection significantly reduced viral replication and excretion from their throats. lung damage was also reduced by 80% as compared with non-treated monkeys. in a review article on avian infectious bronchitis (ib) vaccine strain h, 1 various characteristics of this vaccine were outlined. here i shall mention the most valuable properties of this ib vaccine so far known to underline the hypothesis that it may be beneficial in people at risk from sars coronavirus. (1) it has been observed that the ib vaccine h is able to protect against a broad spectrum of different heterologous serotypes of ib challenge viruses. 12 these serotypes differ in their surface proteins (spikes-s1) which are responsible for the induction of neutralizing antibody. differences in s1 of only 2-3% can change the serotype of an ib virus. 3 therefore, it can be concluded that the protection provided by the vaccine strain h is not only dependant on the production of neutralizing antibody, but is also due to the induction of other immunological reactions. (2) the role of the nucleocapsid protein (n) is still not well understood but it may play an important role in protection, inducing specific cytotoxic t lymphocytes. 2,7-10 thus, the vaccine strain h may be responsible for the induction of protection through its nucleocapsid protein. 13 in order to evaluate the importance of cellular mediated immunity (cmi) in protecting against ibv infections more studies would be necessary to explain all the mechanisms of cross-protection of the vaccine strain h, for instance the induction of interleukine 2 (il 2). (3) the observation that interferon (if) is poorly induced by ibv and may not be induced by the vaccine strain at passage level 52, could be an indication that if plays a limited role in heterologous protection. 5 (4) in a study by marra et al. 6 it was concluded that the sars coronavirus is a novel coronavirus. stavrinides and guttman 11 concluded recently that the sars coronavirus is mammalian-like through the replicase protein, and avian-like through the m and n proteins. they also observed a mammalian-avian mosaic in the s protein. these observations are of extreme importance to the consideration of an avian coronavirus as a possible candidate for a vaccine against sars coronavirus. in adequately equipped laboratory facilities (p4): (a) it is proposed to use passage 52 of the h strain of vaccine in preliminary experimental studies in monkeys. this passage level has been chosen for its retention of cross-protective characteristics. the vaccine strain h at passage 120 induces only a low level of interferon 5 but has lost its heterologous protection characteristics due to the attenuation of the virus. (b) in order to produce a valuable immunological reaction in monkeys with the ib h52 vaccine it will be necessary to inoculate a high dose of live virus vaccine, for example 10 8 median embryo infectious doses (100.000.000 eid 50 ) intranasally, intramuscularly and/or subcutaneously. it is not expected that the virus will be infectious for macaques, therefore, a high dose will be required in order to achieve an adequate response of the immune system. for more than 50 years avian ib infections have occurred worldwide and there are no reports of infection among human beings, including in poultry farmers or other people who have had direct contact with highly contagious ib viruses of chickens. (c) in the study using alpha if in macaques the amount of sars coronavirus virus (scv) used for challenge was 1!10 6 median tissue culture infectious dose (tcid 50 ) in 5 ml of pbs administered intratracheally. 4 however, it was not mentioned in that publication whether or not a prechallenge titration of this virus was performed. it is very important to establish the amount of challenge virus, which will provoke disease and eventually death. therefore, before starting the experiment titration of the challenge virus in these monkeys should be performed in order to determine the amount of virus, which will produce clinical symptoms in not more than 90% of the infected animals. if an overdose is applied no real effect of the treatment will be demonstrable and if insufficient challenge virus is used no results will become available. (d) it is of extreme importance that the h52 vaccine virus should be free of all microorganisms other than ib live vaccine virus, therefore, its production and passage in specific pathogen free (spf) embryonated eggs is a prerequisite. (e) it is proposed to challenge the vaccinated monkeys at 2 and 14 days after vaccination with a challenge scv which has been titrated in macaques (see point c). this proposal is based on the likely immediate effect of the vaccine at 2 days through immunostimulation mechanisms and at 2 weeks, if protection is observed, through the heterologous cross-protective activity of the vaccine virus. it is without question that careful consideration by the relevant official health authorities must be given before an animal live virus vaccine is applied to human beings. the application of the ib vaccine strain h in humans should be restricted and only hcws and other persons at risk but not yet showing any signs of the disease will be considered as candidates for vaccination. if clinical symptoms are observed other methods of treatment, such as administration of alpha if are recommended. low rate of occult hepatitis b virus infection among anti-hbc positive blood donors living in a low prevalence region in brazil epidemiology of antibody to hepatitis b core antigen screening among blood donors in eastern saudi arabia: need to replace the test by hbv dna testing occult hepatitis b virus infection: implications in transfusion b-propiolactone irradiation: a review of its effectiveness for inactivation of viruses in blood derivatives development and use of the h strain of avian infectious bronchitis virus from the netherlands as a vaccine: a review induction of anti-viral immune responses by immunization with recombinant-dna encoded avian coronavirus nucleocapsid protein review article. severe acute respiratory syndrome vaccine development: experiences of vaccination against avian infectious bronchitis coronavirus pegylated interferon-alpha protects type 1 pneumocytes against sars coronavirus infection in macaques induction of chicken interferon by avian infectious bronchitis virus the genome sequence of the sarsassociated coronavirus specific cytotoxic t lymphocytes are involved in in vitro clearance of infectious bronchitis virus the carboxyl-terminal 120-residue polypeptide of infectious bronchitis virus nucleocapsid induces cytotoxic t lymphocytes and protect chickens from acute infection cytotoxic t lymphocytes responses to infectious bronchitis virus infection adoptive transfer of infectious bronchitis virus primed alphabeta t cells bearing cd8 antigen protects chicks from acute infection mosaic evolution of the severe acute respiratory syndrome coronavirus potential for polyvalent infectious bronchitis vaccines study of protection by recombinant fowlpox expressing c-terminal nucleocapsid protein of infectious bronchitis virus against challenge 74250 la tour-en-faucigny, france q 2005 the british infection society key: cord-004605-gsi4yxzj authors: nan title: prüfung und deklaration der wirksamkeit von desinfektionsmitteln gegen viren: stellungnahme des arbeitskreises viruzidie* beim robert koch-institut (rki) sowie des fachausschusses „virusdesinfektion“ der deutschen gesellschaft zur bekämpfung der viruskrankheiten (dvv) und der desinfektionsmittelkommission der deutschen gesellschaft für hygiene und mikrobiologie (dghm) date: 2004 journal: bundesgesundheitsblatt gesundheitsforschung gesundheitsschutz doi: 10.1007/s00103-003-0754-7 sha: doc_id: 4605 cord_uid: gsi4yxzj nan der nachweis der wirksamkeit von desinfektionsmitteln ist die grundlegende voraussetzung für ihre erfolgreiche und sinnvolle anwendung. diesbezügliche anforderungen an das desinfektionsmittel leiten sich dabei aus den eigenschaften der zu inaktivierenden erreger und den bestimmungsgemäßen anwendungsbedingungen ab. gegenwärtig verwendete deklarationen wie "virusinaktivierend", "viruzid" oder "wirksam gegen" bestimmte viren wurden bisher nicht einheitlich angewendet und interpretiert. die vorliegende stellungnahme gibt das ergebnis der diskussion des arbeitskreises viruzidie am rki sowie des fachausschusses "virusdesinfektion" der dvv und der desinfektionsmittelkommission der dghm wieder. ziel dieses arbeitskreises war es, wissenschaftlich begründete anforderungen an die prüfung der wirksamkeit von desinfektionsmitteln gegen viren und die entsprechenden prüfmethoden als voraussetzung für eine sachgerechte deklaration zusammenzustellen. das spektrum humanmedizinisch relevanter viren ist im anhang dargestellt. hinsichtlich der widerstandsfähigkeit gegen desinfektionsmittel lassen sich aufgrund der struktur 2 gruppen -die behüllten und die unbehüllten virenunterscheiden [1] . entsprechend werden die begriffe ◗ "begrenzt viruzid" als wirksam gegen behüllte viren und ◗ "viruzid" als zusätzlich wirksam gegen unbehüllte viren verwendet. diese unterscheidung ist zweckmäßig, da die "viruzide" wirksamkeit schwieriger zu erzielen, jedoch auch nicht in allen fällen erforderlich ist. in abhängigkeit vom anwendungsbereich muss deshalb zunächst entschieden werden, welches wirkungsspektrum die desinfektionsmaßnahmen umfassen sollen. durch dieses abgestufte vorgehen soll eine sachgerechte und angemessene desinfektion unter berücksichtigung von umweltbelastung und verträglichkeit erzielt werden. unter diesem gesichtspunkt kann zukünftig auch die deklaration einer wirksamkeit gegen ausgewählte unbehüllte viren, die häufig umfangreiche ausbrüche verursachen, wie z. b. rotaviren [2, 3, 4, 5, 6] , insbesondere bei händedesinfektionsmitteln sinnvoll sein. die deklaration "begrenzt viruzid" würde in diesem fall mit einem entsprechenden zusatz versehen werden. ähn-liche überlegungen könnten auch für noroviren (norwalk-like-viren) [7, 8] sinnvoll erscheinen. nicht zuletzt wegen der geringen infektionsdosis dieser unbehüllten viren sollten hier jedoch bis auf weiteres nur "viruzide" desinfektionsmittel eingesetzt werden. unter praktischen gesichtspunkten lassen sich 3 anwendungsbereiche unterscheiden: ◗ für die abschließende instrumentendesinfektion 1 gibt die anlage "anforderungen an die hygiene bei der aufbereitung von medizinprodukten" der richtlinie für krankenhaus-hygiene und infektionsprävention [9] vor, dass hierfür nur desinfektionsmittel mit "viruzider" wirksamkeit anzuwenden sind. die bisher vorliegenden prüfmethoden (s. 5) verwenden bestimmte testviren stellvertretend für das bekannte spektrum der viralen krankheitserreger. im unterschied zur künftigen europäischen norm verlangt die gemeinsame prüfrichtlinie von dvv und bga (jetzt rki) [11, 12, 13] zusätzlich zur testung von polio-und adenoviren auch die prüfung von papova-und vakziniaviren. da sich papovaviren in einigen untersuchungen resistenter als poliound adenoviren erwiesen haben [1] , kann insbesondere im hinblick auf papillomaviren auf die testung dieser viren nicht verzichtet werden, wenn eine "viruzide" wirksamkeit deklariert werden soll. die von der who ergriffenen maßnahmen zur eradikation der poliomyelitis machen es erforderlich, dass für die desinfektionsmittelprüfung nur der polio-impfstamm typ i, stamm lsc-2ab verwendet werden darf [14, 15] . er erfüllt die kriterien der who für die bisherige polio-lebendimpfstoffherstellung [16] . diese setzen auch voraus, dass nicht mehr als 10 passagen kultiviert werden und eine exakte dokumentation dazu vorliegt. der bislang in prüflaboratorien verwendete stamm gleichen namens erfüllt diese kriterien in der regel nicht. in folge der eradikationsmaßnahmen wird es weltweit zu einer einstufung von polioviren in eine höhere risikogruppe (schutzstufe 3 oder 4 gemäß biostoffverordnung) kommen, was eine weitere verwendung als prüfvirus weitestgehend ausschließen wird und somit die festlegung eines anderen geeigneten virus notwendig macht. das hepatitis-a-virus (hav) als ebenfalls unbehülltes virus hat sich in vergleichenden untersuchungen mit poliovirus zum teil als resistenter erwiesen [17] . besonderes interesse gilt hier den klinisch relevanten durch blut, gewebe und körperflüssigkeiten übertragbaren behüllten viren, wie z. b. dem human-immunodeficiency-virus (hiv), hepatitis-c-virus (hcv) und hepatitis-b-virus (hbv). die deklaration "begrenzt viruzid" erfolgt künftig, wie im folgenden begründet, auf der basis von prüfungen unter verwendung relevanter testviren, die den rückschluss auf die wirksamkeit auch gegen hiv, hcv und hbv zulassen. für die deklaration "begrenzt viruzid" stehen gegenwärtig vakziniavirus und bvdv (bovine viral diarrhea virus) als testviren zur verfügung. das vakziniavirus [18] wurde bereits in der bga/dvv-richtlinie [11, 12] als vertreter für die behüllten viren aufgeführt. hcv lässt sich nicht in vitro kultivieren. für das in vielen eigenschaften vergleichbare bvdv liegen jedoch aus der validierung von inaktivierungsverfahren bei der herstellung von blut und blutprodukten umfangreiche erfahrungen vor, die seine verwendung als testvirus auch für die desinfektionsmittelprüfung nahe legen [19] . eine ausdrückliche deklaration der wirkung gegen hcv allein auf dieser basis ist jedoch nicht gerechtfertigt. auch die auslobung der wirksamkeit gegen hiv setzt eine prüfung unter verwendung von hiv in zellkulturen voraus, welche jedoch aufgrund der gefährlichkeit des virus (schutzstufe 3) nicht erstrebenswert ist. eine spezielle problematik stellen aussagen zur hbv-wirksamkeit dar [20] . hbv ist für die virusdesinfektion von besonderer bedeutung, da bereits geringste blutmengen bei hoher viruslast zu infektionen führen können und der erreger weit verbreitet ist (weltweit sind schätzungsweise 350 millionen menschen, d. h. 5-7% der gesamtbevölkerung chronisch infiziert [21] ). die bewertung der wirksamkeit von desinfektionsmitteln gegenüber hbv war in der vergangenen zeit auch unter experten anlass für kontroverse diskussionen bezüglich der aussagekraft der durchgeführten prüfverfahren. unstrittig ist, dass derzeit kein zellkultursystem zum empfindlichen nachweis von hbv und daher keine geeignete, va-lidierbare prüfmethode für die bestimmung der infektiosität von hbv zur verfügung steht. somit ist die bezeichnung "wirksam gegen hbv" auf der basis der gegenwärtig verfügbaren tests nicht in jedem falle valide, da der verlust der infektiosität nur in begrenztem umfang in einem biologischen system nachgewiesen wurde. bisher wurden 2 surrogatteste, der madt (morphologic alteration and desintegration test) [22] und die reduktion von hbsag (hepatitis surface antigen) [23] zur bestimmung der wirkung von desinfektionsmitteln gegenüber hbv durchgeführt. der madt bestimmt die morphologische veränderung von hbv-partikeln im elektronenmikroskop nach desinfektionsmittelbehandlung, während der hbsag-reduktions-test die antigenität von hbsag nach desinfektionsmittelbehandlung im kommerziellen festphasen-radio-immuntest bestimmt. der madt erfordert eine visuelle beurteilung der viruspartikel, die nur sehr erfahrenen betrachtern möglich und schwierig zu standardisieren ist. der hbsag-reduktionstest mit käuflichen testkits arbeitet mit antikörpern, deren epitope von den herstellern nicht bekannt gegeben werden und deren spezifität nicht in einem klaren zusammenhang zu neutralisierenden epitopen steht. der besseren standardisierbarkeit dient die weiterentwicklung der o. a. surrogatmethoden hinsichtlich molekularbiologischer alteration der hbv-dna und desintegration von hbv-epitopen [24, 25] . die neutralisierende wirkung einiger weniger monoklonaler antikörper (z. b. ma18/7) gegen bestimmte sequenzen von hbv ist in zellkulturversuchen nachgewiesen worden [25] . werden die zugehörigen epitope dieser antikörper durch ein desinfektionsmittel zerstört, ist es plausibel anzunehmen, dass auch die infektiosität zerstört ist. in suspensionsversuchen mit peressigsäurehaltigen desinfektionsmitteln erwies sich das präs1-epitop des antikörpers ma18/7 als das resistenteste. diese befunde lassen einen hochempfindlichen hbsag-nachweis mittels des antikörpers ma18/7 als validierungsmethode geeignet erscheinen. es ist jedoch wahrscheinlich, dass eine reihe wirksamer desinfektionsmittel aufgrund ihrer wirkungsmechanismen dieses epitop nicht zerstört. ähnlich verhält es sich mit der hbv-dna als zielstruktur für die validierung von desinfektions-bzw. virusinaktivierungsverfahren. hbv-dna kann mittels quantitativer pcr (bevorzugt realtime-pcr) hochempfindlich nachgewiesen werden. die zerstörung der primärstruktur der dna bedeutet zerstörung der infektiosität und zugleich blockierung der amplifikation in der pcr [25] . die resistenz der dna gegen ein mittel schließt seine wirksamkeit jedoch nicht aus, wie vergleiche mit schimpansenversuchen zeigten [26, 27] . für die validierung der hbv-inaktivierung stehen heute jedoch schimpansen de facto nicht mehr zur verfügung. auch primäre humane hepatozyten sind schwierig zu erhalten, wenig suszeptibel und von wechselnder qualität. dem menschlichen hbv ähnlich sind die hepadnaviren von gibbons, wollaffen und woodchucks. jedoch sind diese tiere schwierig zu halten und die primäre hepatozytenkulturen daraus ähnlich problematisch wie die des menschen. eine denkbare alternative sind primäre hepatozytenkulturen aus tupaialeber (tupaias -spitzhörnchen). einfacher hingegen ist die zucht von enten. entenhepatitis-b-virus (duck hepatitis-b-virus -dhbv) gehört wie das hbv des menschen zur familie der hepadnaviridae. der infektiositätstest mit dhbv ist in den usa und australien für die prüfung der hbv-wirksamkeit von desinfektionsmitteln anerkannt [28] . auch dhbv lässt sich, ähnlich wie hbv, nur in einem lebenden tier bzw. in primären hepatozytenkulturen vermehren. dhbv ist gut erforscht und hat den vorteil, weder human-noch tierpathogen zu sein und kann somit in der biologischen schutzstufe 1 gehandhabt werden. zum nachweis der erfolgten infektion der hepatozyten kann die immunfluoreszenz mit einem anti-dhbv-serum oder eine geeignete pcr dienen. die dvv organisiert gegenwärtig untersuchungen zur etablierung entsprechender prüfmethoden. als konsequenz aus der vorstehenden darlegung ergibt sich die forderung, auf die ausdrückliche deklaration "wirksam gegen hbv" künftig zugunsten der deklaration "begrenzt viruzid" zu verzichten, bis auf der grundlage der hier geschilderten untersuchungen eine aussagekräftige methode zur prüfung der wirksamkeit von desinfektionsmitteln gegen hbv etabliert ist. nach abschluss dieser untersuchungen ist eine überarbeitung der anforderungen für die deklaration "begrenzt viruzid" vorgesehen. derzeit liegen die folgenden prüfmethoden vor: 1. richtlinie des bundesgesundheitsamtes und der deutschen vereinigung zur bekämpfung der viruskrankheiten (dvv) zur prüfung von chemischen desinfektionsmitteln auf wirksamkeit gegen viren [11] die europäische norm ist im bereich der viruzidietestungen noch lückenhaft, sodass der hier publizierte vorschlag geeignet ist, impulse auch für die europäische viruzidienormung zu geben. die prüfung der wirksamkeit von für den humanmedizinischen bereich vorgesehenen desinfektionsmitteln ist weiterhin gemäß der gemeinsamen richtlinie des bga (jetzt rki) und der dvv [11, 12, 13] zu prüfen. die tabelle 1 enthält die für die jeweilige deklaration zu verwendenden testviren. handbuch der virusdesinfektion a test for the assessment of hygienic hand disinfection using rotavirus a study on the sensitivity of bovine rotavirus to some chemical agents the action of alcohols on rotavirus, astrovirus and enterovirus chemical disinfection of human rotaviruses: efficacy of commerciallyavailable products in suspension tests inactivation of a rotavirus by disinfectants inactivation of feline calicivirus, a surrogate of srsvs, by different types of alcohol. poster presented at the 5th int.conference of the hospital infection society inactivation of feline calicivirus, a norwalk virus surrogate anforderungen an die hygiene bei der aufbereitung von medizinprodukten anforderungen an die hygiene bei der reinigung und desinfektion von flächen richtlinie des bundesgesundheitsamtes und der deutschen vereinigung zur bekämpfung der viruskrankheiten zur prüfung von chemischen desinfektionsmitteln auf wirksamkeit gegen viren kommentar zur richtlinie des bundesgesundheitsamtes und der deutschen vereinigung zur bekämpfung des viruskrankheiten zur prüfung von chemischen desinfektionsmitteln auf wirksamkeit gegen viren bekanntmachung des fachausschusses "virusdesinfektion" der deutschen vereinigung zur bekämpfung der viruskrankheiten und des robert koch-institutes who containment of wild poliovirus stocks. who/polio/0202.www.who.org 15. who global action plan for laboratory containment of wild poliovirus annex 1 requirements for poliomyelitis vaccine (oral) (requirements for biological substances no hepatitis a virus: a test method for virucidal activity how contagious is vaccinia? cpmp/bwp/269/95 note for guidance on plasma-derived medical products measures for disinfection and control of viral hepatitis.in: block s (ed) disinfection, sterilisation and preservation, chapter 30 epidemiologischer bericht zur situation in deutschland bis zum jahr influence of different disinfection conditions on the structure of the hepatitis b virus (dane particle) as evaluated in the morphological alteration and disintergation test (madt) zerstörung der antigenität und beeinflussung der immunochemischen reaktivität von antigenen des hepatitis-b-virus (hbsag, hbcag und hbeag) durch desinfektionsmittel -ein prüfmodell methodological approaches to disinfection of human hepatitis b virus molecular approaches to validate disinfectants against human hepatis b virus comparision of the morphological alteration and disintegration test (madt) and the chimpanze infectvity test for determination of hepatitis b virucidual activity of chemical disinfectants inactivation of hepatitis b virus by intermediate-to-high-level disinfectant chemicals richtlinie des robert koch-institutes zur prüfung der viruzidie von chemischen flächendesinfektionsmitteln und instrumentendesinfektionsmitteln, die in die liste gemäß § 10c des bundes-seuchengesetzes aufgenommen werden sollen quantitativer suspensionsversuch auf viruzidie für in der humanmedizin verwendete chemische desinfektionsmittel und antiseptika, prüfverfahren und anforderungen richtlinien für die prüfung chemischer desinfektionsmittel,3.aufl.verlag der deutschen veterinärmedizinischen gesellschaft e be key: cord-297077-p604vvbi authors: tai, dar‐in; jeng, wen‐juei; lin, chun‐yen title: a global perspective on hepatitis b‐related single nucleotide polymorphisms and evolution during human migration date: 2017-11-06 journal: hepatol commun doi: 10.1002/hep4.1113 sha: doc_id: 297077 cord_uid: p604vvbi genome‐wide association studies have indicated that human leukocyte antigen (hla)‐dp and hla‐dq play roles in persistent hepatitis b virus (hbv) infection in asia. to understand the evolution of hbv‐related single nucleotide polymorphisms (snps) and to correlate these snps with chronic hbv infection among different populations, we conducted a global perspective study on hepatitis‐related snps. we selected 12 hbv‐related snps on the hla locus and two hbv and three hepatitis c virus immune‐related snps for analysis. five nasopharyngeal carcinoma‐related snps served as controls. all snp data worldwide from 26 populations were downloaded from 1,000 genomes. we found a dramatic difference in the allele frequency in most of the hbv‐ and hla‐related snps in east asia compared to the other continents. a sharp change in allele frequency in 8 of 12 snps was found between bengali populations in bangladesh and chinese dai populations in xishuangbanna, china (p < 0.001); these areas represent the junction of south and east asia. for the immune‐related snps, significant changes were found after leaving africa. most of these genes shifted from higher expression genotypes in africa to lower expression genotypes in either europe or south asia (p < 0.001). during this two‐stage adaptation, immunity adjusted toward a weak immune response, which could have been a survival strategy during human migration to east asia. the prevalence of chronic hbv infection in africa is as high as in asia; however, the hbv‐related snp genotypes are not present in africa, and so the genetic mechanism of chronic hbv infection in africa needs further exploration. conclusion: two stages of genetic changes toward a weak immune response occurred when humans migrated out of africa. these changes could be a survival strategy for avoiding cytokine storms and surviving in new environments. (hepatology communications 2017;1:1005–1013) c hronic hepatitis b virus (hbv) is a global disease. the majority of carriers of hepatitis b surface antigen (hbsag) are inhabitants of africa and asia. (1, 2) immune tolerance is a hallmark of persistent hbv infection. (3) typically, patients with chronic hepatitis b are infected through their parents in the early stage of life. (4) remarkably, the immune system of the host may respond to the hbv (5) but does not produce the immune clearance of hbv. hbv may replicate in host cells peacefully until they enter immune clearance phases 2-4 decades later. (3) if the hbv can be eradicated, hbv replication will be terminated, and ultimately 50% of hosts may clear hbsag by 80 years of age. (6) genome-wide association studies from asia have revealed that the human leukocyte antigen (hla)-dp and hla-dq loci play roles in persistent hbv infection. (7) (8) (9) (10) (11) (12) (13) our objective is to understand the evolution of the single nucleotide polymorphisms (snps) that were responsible for hbv-related immune tolerance during human migration and to correlate the hbv-related snps with a prevalence of chronic hbv infection among global populations. based on the data from 1,000 genomes collected worldwide, we conducted a global perspective study on the allele frequency of hepatitis-related snps. based on a literature review, 12 hbv-and hlarelated snps, (7) (8) (9) (10) (11) (12) (13) five hepatitis-and immune-related snps in complement factor b (cfb), clusters of differentiation molecule 40 (cd40), and interferon lambda 4 (ifnl4) loci (14) (15) (16) (17) (18) , and five nasopharyngeal carcinoma (npc)-related snps in hla regions (19) (20) (21) were selected for this analysis (tables 1 and 2 ). these snp data from around the world were downloaded from the phase 3 data of 1,000 genomes (http://www. 1000genomes.org/). (22) the subjects participating in the 1,000 genome project were older than 18 years and had three out of four grandparents who identified themselves as members of the group. the location of the 26 populations evaluated in the 1,000 genomes are shown by abbreviation on a global hbsag prevalence map reported by hou et al. (2) (fig. 1) . the allele frequencies of different geographic groups in viral hepatitis-related snps and npc-related snps are illustrated in fig. 2 . the snp genotype differences between groups are listed in tables 1 and 2 . we used interactive chi-square tests to calculate the difference in genotypes between groups (http://quantpsy.org). among two hbv-and immune-related snps in the cfb and cd40 regions (14, 15) and three hepatitis c virus-related snps in the ifnl4 regions, (16) (17) (18) allele type differences can be found between africa and europe or between africa and south asia ( fig. 2a ). all these immune-related snp genotypes differed significantly between esan in nigeria and toscani in italy and between luhya in webuye, kenya (lwk) and gujarati in india (gih) ( table 1 ; p < 0.001). among 12 hbv-and hla-related snps, (7) (8) (9) (10) (11) (12) (13) the allele frequency showed marked differences between south and east asian genome samples (fig. 2b) . eight of the 12 snps differed significantly between bengali in bangladesh (beb) and chinese dai in xishuangbanna, china (cdx); these areas represent the junction of south and east asia ( table 2 ; p < 0.001). three of the 12 hbv-and hla-related snps (fig. 2b , dotted lines; rs9276370, rs3128917, and rs9380343) also showed significant differences between lwk in africa and gih in south asia ( table 2 ; p < 0.001). in contrast, we found the allele frequency of npc-related snps (18) (19) (20) to be relatively stable among different populations (fig. 2c ). based on the well-known human migration pathways (23, 24) and the recent data from 1,000 genomes, (22) our analysis of hepatitis-and immune-related snps demonstrate a significant change in allele frequency shortly after the migration out of africa ( fig. 2a) . all genotypes of five immune-related snps differed significantly between esan in nigeria in africa and toscani in italy in europe and between lwk in africa and gih in south asia (table 1 ; p < 0.001). in addition, both cfb and cd40 shifted from a higher expression in african genotypes (rs12614:tt; rs1883832:cc) to a lower expression in european and south asian genotypes (rs12614:cc; rs1883832: tt). (14, 15) these changes conferred a decrease in the strength of immune responses. the cc genotype of rs12979860 (ifnl4), which is more prevalent in east asia, is associated with a lower baseline ifnl3 (interleukin-28b) expression. (16, 17) the ifnl4 open reading frame is truncated by a polymorphic frame-shift insertion (rs368234815), which turns ifnl4 into a polymorphic pseudogene in east asian populations. (18) because the prevalence of hbsag is higher in africa than in europe or south asia, these trends of decreased immune protein expression are not related to hbv-specific immune tolerance. although it is clear that europeans and south asians are two different races, they showed similar genetic adaptions when they migrated out of africa. these changes suggest that the decreased expression of immune-related genes might have been an important survival strategy when humans migrated into new territories and faced new pathogens. the contact between different races of humans may induce devastating diseases, for example, when the new world was discovered by christopher columbus in 1492. (25) a similar situation was well documented when japan sent troops to taiwan in 1874 and 1895; only 0.1% to 0.3% of soldiers died in battle, while around 10% died of diseases in a short period of time after arrival. (26) our second principal result is that the allele frequency of hbv-and hla-related snps show marked differences between south and east asian genome samples (fig. 2b) . eight of the 12 snps differed significantly between beb and cdx ( table 2 ; p < 0.001). these two populations are located at the junction of south and east asia. the unique allele types of hbv-related snps in east asian populations are different from those of other geographic populations. these genotypic changes could be related to antigen presentation and could be associated with persistent hbv infection. (7) (8) (9) (10) (11) (12) (13) our findings are in agreement with a higher prevalence of hbsag in east asia than in south asia (fig. 1) . these genotypic populations are generally overlapped in the y chromosome haplogroup o1-o3 distribution map (https:// en.wikipedia.org/wiki/human_y-chromosome_dna_ haplogroup) as they started in the indo-china peninsula and travelled to northern china and japan. given the results, we theorized on the reason behind the dramatic allele differences in hbv-related snps between beb in south asia and cdx in east asia. one possible explanation for this variation involves the consideration of environmental landscape factors. (27) for example, bangladesh is a predominately rich, fertile, and flat land, with many areas situated less than 12 m above sea level. on the other hand, xishuangbanna is situated in a mountainous and forested area that has the largest diversity of plants and animals in china. regions with higher plant and animal biodiversity are often accompanied by an increased range and abundance of vector-borne or nonvector-borne diseases. (28) (29) (30) (31) (32) (33) (34) accordingly, the inhabitants of these areas should be able to tolerate an increased number of unfamiliar microorganisms. we speculated that the subjects who demonstrate direct and strong immune responses may die of a cytokine storm in fulminant hepatitis, severe acute respiratory syndrome, influenza, and other infections. (30) (31) (32) (33) (34) this concept is supported by a lower mortality rate from influenza h1n1 in asia than in australia, new zealand, and north america. (35) cytokine storm was first described in graft-versushost disease and was soon also identified in many infectious diseases (36) ; many cytokines, chemokines, and complements are involved. (37) (38) (39) the immunerelated snps selected in this study that included ifn (ifnl4), tumor necrosis factor-receptor (cd40), and complements (cfb) are all participants in cytokine storms. hla class ii molecules are associated with antigen presentation and are also modulated by cytokines. (40) a cytokine storm is considered to be a hyperreaction of the immune response to a pathogen that may cause fulminant disease and mortality. (36) (37) (38) (39) when humans migrate to a new territory, they face many unfamiliar pathogens. those subjects with a strong immune response will die of disease, but those subjects with a weak immune response to the pathogens may survive. chronic hbv infection with an immune tolerance stage is an example of a weak immune response. (3) (4) (5) east asian populations carry similar allele types of hbv-related snps (fig. 2b) , although the environments of northern china and japan differ substantially from those of southern china and the indo-china peninsula. (41) we therefore propose that there was a significant physical block to gene flow on the indo-china peninsula. most of the survivors in east asia exhibit delayed hbv-related immune clearance genotypes. this could have been a survival strategy to pass through the indo-china peninsula and southern china during human migration. such hla class ii genotypes are aimed toward an immune tolerance strategy. (7) (8) (9) (10) (11) (12) (13) these changes were successful because this group of people spread to northern china and japan and have become the largest population in the world numerically. however, such a survival benefit may have been a trade-off with cold tolerance as these populations were unable to cross the bering strait in large numbers. indigenous americans do not show the same hbv-related allele pattern; they have a low prevalence of chronic hbv infection and high influenzarelated mortality rates. (1, 2, 35) overall, we identified two genetic adaptations that occurred during human migration. the first was the decreased expression of immune-related genes after leaving africa; the second was the evolution of an hla system with migration into the indo-china peninsula. both events may have aimed to decrease the strength of the immune response and avoid cytokine storms when facing different types of pathogens. the high prevalence of chronic hbv infection in east asia could be a consequence of such a strategy. however, persistent hbv infection-related hla genotypes are not present in the african population (fig. 2b) and cannot be responsible for the high prevalence of hbsag in africa. different genetic and nongenetic mechanisms of chronic hbv infection are presented between east asian and african populations. (4, (42) (43) (44) we summarize the differences on hbsag carriers between east asia and africa in table 3 . these differences may provide a clue for the mechanism of the function of snps in the persistent hbv infection. the high prevalence of lowexpression-type immune-related snps and chronic hbv infection-related snps on the hla locus may be a reason for a longer hepatitis b e antigen (hbeag)-positive phase in east asia. ifn-alpha has been recommended for treatment of hbeag-positive chronic hepatitis b. in a larger series from pediatric patients, ifn-alpha was found to be an effective therapy in chronic hepatitis b with severe inflammation that facilitates hbeag seroconversion in earlier life. (45) in addition, hbv-and hla-related snps are also associated with spontaneous hbeag seroconversion. (46) (47) (48) these genetic polymorphisms could be a reason for an early hbeag seroconversion and a lower vertical transmission in africa compared to east asia. it is well known that hbv genotypes a, b, and d show an earlier hbeag seroconversion compared to genotype c. (42, 44) this early hbeag seroconversion was suggested to be the reason of low vertical transmission in africa. (49) however, hbv genotype b also had an early hbeag seroconversion but had a high vertical transmission rate in east asia. (4) therefore, host factors rather than hbv genotypes alone should be considered for the high vertical transmission rate in east asia. most hbv-related genome-wide association studies were done in east asia. we need studies to understand the genetic roles in persistent hbv infection in african populations. our study found two stages of genetic changes toward a weak immune response when humans migrated out of africa. these changes could be a survival strategy for avoiding cytokine storms and surviving in new environments. estimations of worldwide prevalence of chronic hepatitis b virus infection: a systematic review of data published between epidemiology and prevention of hepatitis b virus infection natural history of chronic hepatitis b virus infection in taiwan: studies of hepatitis b virus dna in serum effects of sex and generation on hepatitis b viral load in families with hepatocellular carcinoma trained immunity in newborn infants of hbv-infected mothers relative roles of hbsag seroclearance and mortality in the decline of hbsag prevalence with increasing age a genome-wide association study identifies variants in the hla-dp locus associated with chronic hepatitis b in asians a genome-wide association study of chronic hepatitis b identified novel risk locus in a japanese population new loci associated with chronic hepatitis b virus infection in han chinese genome-wide association study confirming association of hla-dp with protection against chronic hepatitis b and viral clearance in japanese and korean a genome-wide association study identified new variants associated with the risk of chronic hepatitis b association between hla variations and chronic hepatitis b virus infection in saudi arabian patients a genome-wide association study on chronic hbv infection and its clinical progression in male han-taiwanese genetic variants in five novel loci including cfb and cd40 predispose to chronic hepatitis b association of cd40 -1c/t polymorphism in the 5 0 -untranslated region with chronic hbv infection genome-wide association of il28b with response to pegylated interferon-alpha and ribavirin therapy for chronic hepatitis c impaired induction of interleukin 28b and expression of interferon k 4 associated with nonresponse to interferon-based therapy in chronic hepatitis c selection on a variant associated with improved viral clearance drives local, adaptive pseudogenization of interferon lambda 4 (ifnl4) genome-wide association study reveals multiple nasopharyngeal carcinoma-associated loci within the hla region at chromosome 6p21.3 evaluation of human leukocyte antigen-a (hla-a), other non-hla markers on chromosome 6p21 and risk of nasopharyngeal carcinoma the principal genetic determinants for nasopharyngeal carcinoma in china involve the hla class i antigen recognition groove genomes project consortium a global reference for human genetic variation timing the first human migration into eastern asia late pleistocene climate drivers of early human migration the role of epidemic infectious diseases in the discovery of america germs of disaster: the impact of epidemics on japanese military campaigns in taiwan, 1874 and 1895 evolution and dispersal of the genus homo: a landscape approach vectors vs. humans in australia--who is on top down under? an update on vector-borne disease and research on vectors in australia influence of vectors' risk-spreading strategies and environmental stochasticity on the epidemiology and evolution of vector-borne diseases: the example of chagas' disease interleukin-17-producing cd4(1) t cells increase with severity of liver damage in patients with chronic hepatitis b serum interleukin (il)-9 and il-10, but not t-helper 9 (th9) cells, are associated with survival of patients with acute-on-chronic hepatitis b liver failure molecular pathology of emerging coronavirus infections a question of self-preservation: immunopathology in influenza virus infection cytokine storm plays a direct role in the morbidity and mortality from influenza virus infection and is chemically treatable with a single sphingosine-1-phosphate agonist molecule hospitalization fatality risk of influenza a(h1n1)pdm09: a systematic review and meta-analysis into the eye of the cytokine storm magnitude and quality of cytokine and chemokine storm during acute infection distinguish nonprogressive and progressive simian immunodeficiency virus infections of nonhuman primates influenza virus pathogenicity regulated by host cellular proteases, cytokines and metabolites, and its therapeutic options combined inhibition of complement and cd14 efficiently attenuated the inflammatory response induced by staphylococcus aureus in a human whole blood model antigen presentation and mhc class ii expression by human esophageal epithelial cells: role in eosinophilic esophagitis identification of spatial genetic boundaries using a multifractal model in human population genetics clearance of hepatitis b e antigen in patients with chronic hepatitis b and genotypes hepatitis b virus infection during pregnancy: transmission and prevention the risk of perinatal hepatitis b virus transmission: hepatitis b e antigen (hbeag) prevalence estimates for all world regions predictors of hepatitis b e antigen-negative hepatitis in chronic hepatitis b virus-infected patients from childhood to adulthood association between single-nucleotide polymorphisms and early spontaneous hepatitis b virus e antigen seroconversion in children effect of host and viral factors on hepatitis b e antigen-positive chronic hepatitis b patients receiving pegylated interferon-a-2a therapy effect of hla-dp and il28b gene polymorphisms on response to interferon treatment in hepatitis b e-antigen seropositive chronic hepatitis b patients epidemiology of hepatitis b virus and genotype author names in bold designate shared co-first authorship. key: cord-307044-4czeehkq authors: liu, jiaye; wang, tingyan; cai, qingxian; sun, liqin; huang, deliang; zhou, guangde; he, qing; wang, fu‐sheng; liu, lei; chen, jun title: longitudinal changes of liver function and hepatitis b reactivation in covid‐19 patients with pre‐existing chronic hbv infection date: 2020-08-06 journal: hepatol res doi: 10.1111/hepr.13553 sha: doc_id: 307044 cord_uid: 4czeehkq aim: with pandemic of covid‐19 currently and high endemic of chronic hbv infection worldwide, it is quite urgent to investigate liver function changes of covid‐19 patients with chronic hbv infection, and how sars‐cov‐2 infection in turn affects the course of chronic hbv infection. method: we conducted a retrospective study based on 347 covid‐19 patients (21 vs. 326 with vs. without chronic hbv infection). with the psm method, we yielded 20 and 51 matched patients for hbv group and non‐hbv group, respectively. results: at the end of follow‐up, all these 71 patients achieved sars‐cov‐2 clearance (p=0.1). during the follow‐up, 30% vs. 31.4% in hbv group vs. non‐hbv group progressed to severe covid‐19 (p=0.97). after psm, the longitudinal changes of median values for liver biochemistries were no significant difference between two groups. in hbv group vs. non‐hbv‐group, 35% (7/20) vs. 37.25% (19/51) (p = 0.86) had abnormal alt at least once during hospitalization, while 30% (6/20) vs. 31.37% (16/51) for abnormal ast (p = 0.91), 40% (8/20) vs. 37.25% (19/51) for abnormal ggt (p = 0.83), and 45% (9/20) vs. 39.22% (20/51) for abnormal tbil (p = 0.91). moreover, 3 patients in hbv group had hepatitis b reactivation. conclusions: liver dysfunction presented in covid‐19 patients with/without chronic hbv. moreover, those covid‐19 patients coinfected with chronic hbv could had a risk of hepatitis b reactivation. it is necessary to monitor liver function of covid‐19 patients, as well as hbv dna levels for those coinfected with hbv during the whole disease course. coronavirus disease 2019 (covid-19), an emerging respiratory disease caused by severe acute respiratory syndrome coronavirus 2 (sars-cov-2), has recently become a pandemic. a total of 14,348,858 confirmed cases and 603,691 deaths were reported globally as of july 20, 2020. 1 unfortunately, neither targeted drugs nor vaccines are available to date, and the number of infections is growing around the world. for the foreseeable future, covid-19 could constantly pose a great threat to the people of the world. covid-19 is typically characterized by the symptoms of viral pneumonia such as fever, fatigue, dry cough and anosmia, which may evolve to respiratory failure. unexpectedly, there is increasing evidence that some individuals with covid-19 have frequent abnormal liver function. [2] [3] [4] it was observed that the elevated liver biochemistries were more common in severe covid-19 cases than in mild cases. 5 the limited autopsy results of liver of covid-19 cases showed moderate microvascular steatosis, 6 or hepatocyte degeneration accompanied by lobular focal necrosis and neutrophil infiltration. 7 these histological characteristics of liver were not specific manifestations of liver damage caused by sars-cov-2. therefore, it is unclear currently whether liver damage/dysfunction of covid-19 patients is mainly due to the sars-cov-2 infection or other coexisting conditions. hepatitis b remains another major worldwide public health problem, with approximately 257 million individuals infected with hepatitis b virus (hbv), and more than 94 million suffer from chronic hepatitis b (chb). 8 a large cohort study from china reported that 2.1% (21/1 099) of enrolled covid-19 cases had pre-existing hepatitis b. 9 given the endemic and high burden of hbv infection, chb may be one important comorbidity of pre-existing liver diseases affecting the outcome of covid-19. it is confirmed that hbv infection can cause the damage of innate immune responses and imbalance of adaptive immune responses. 10 meanwhile, uncontrolled inflammatory innate responses and impaired adaptive immune responses causing by sars-cov-2 may lead to harmful tissue damage, both locally and systemically. 11 therefore, coinfection of sars-cov-2 and hbv may increase the damage of immune function and liver. however, to the best of our knowledge, no studies had been carried out on the impact of chronic hbv infection on the disease progression and liver function changes of covid-19 patients, and how the sars-cov-2 infection in turn affects the course of chronic hbv infection. more evidence is urgently needed to guide the screening of hbv coinfection and management of comorbidity of chb during the pandemic of covid-19. hence, in this study we aimed to assess the independent effect of hbv infection on the outcomes of covid-19 as well as the progression of hbv infection. all diagnosed covid-19 patients according to who interim guidance, with or without chronic hbv infection, who admitted to shenzhen third people's hospital during january 1 to march 1, 2020, were enrolled. chronic hbv infection was determined on the basis of testing positive for hbsag and/or hbv dna at hospital admission and medical history of chronic hbv infection. the clinical outcomes of covid-19 and dynamics of liver biochemistries were monitored up to april 12, 2020, the final date of follow-up. the inclusion criteria were as follows: (1) subjects diagnosed with covid-19, (2) the records were well documented, (3) subjects with longitudinal follow-up, i.e., liver function testing, chest computed tomography (ct) scan, or blood gas assay with at least across two days. the exclusion criteria were: (1) subjects without data available at baseline, i.e., blood routine examinations, liver biochemistries, ct score, 12 blood gas assay, (2) subjects coinfected with human immunodeficiency virus, (3) subjects coinfected with hepatitis virus other than hbv, or had liver diseases other than chb. the process of patients' enrolment was presented in baseline was defined as the first time of hospital admission due to covid-19. at baseline and during follow-up, all subjects included in this study underwent routine examination, monitoring of liver biochemistries, and sars-cov-2 nucleic acid testing with a median follow-up interval of 3 days. the primary outcome was progression to severe covid-19, and the secondary outcomes included clearance of sars-cov-2, liver injury, and hepatitis b reactivation. the time point of covid-19 onset was defined as the day of symptoms presence self-reported by patients who were further confirmed with sars-cov-2 after hospital admission. the virus clearance was defined by the presence of two consecutive negative results in quantitative pcr detection for sars-cov-2 rna at an interval of 24 hours, and the day of the first one of these two tests were considered as the clearance day. patients were discharged from hospital after the clearance of sars-cov-2. hepatitis b reactivation was defined as the abrupt reappearance of hbv dna viremia in a patient with previously inactive or resolved hbv infection, or an sudden and rapid rise of hbv dna level by at least 2 log10 in those with previously detectable. 13 according to the national guidelines for community-acquired pneumonia, and the diagnosis and treatment plan for the new coronavirus in china, all covid-19 patients were classified into severe or mild cases based on chest radiography, clinical examinations, and symptoms. 14, 15 we analyzed the dynamics of liver biochemistry indicators (i.e., alt, ast, total bilirubin [tbil], gamma-glutamyl transferase [ggt]) to investigate the liver function changes. the normal range of alt, ast, ggt and tbil in this study was 0-45 u/l, 0-45 u/l, 0-49 u/l, and 1.7-21 umol/l, respectively. as one patient coinfected with hbv was underwent liver biopsy, we investigated the pathological characteristics of liver injury of this patient. all statistical analysis was conducted using r 3.6.1. we performed propensity score matching (psm) on the selected 347 subjects so that the group coinfected with hbv is comparable to the group without hbv coinfection in terms of observed covariates at baseline. 16 the factors for propensity score calculation include age, gender, body mass index (bmi), time intervals between covid-19 onset to hospital admission, number of comorbidities except for chb, liver biochemistries (alt, ast, ggt, tbil), pao2/fio2 ratio, chest ct score, crp, lymphocyte count, and platelet count at baseline. the psm process was conducted by using r package matchit, with nearest-neighbour method, 1:3 matching ratio, and a caliper size of 0.1. for baseline characteristics, we used median (interquartile range [iqr]) for continuous variables and wilcoxon test for comparison, while we reported count (percentage) for categorical variables and fisher exact test for comparison. we used kaplan-meier (k-m) method to estimate cumulative probabilities for the clearance of sars-cov-2 and progression to severe covid-19 and compared the probabilities between hbv group and non-hbv group using a log-rank test. we use multivariable cox proportionalhazards model to compare the risk of progression to severe covid-19. to investigate the longitudinal changes over time, we first performed comparison of the median values of liver biochemistries (alt, ast, ggt, tbil) over time between groups using wilcoxon signed-rank test. then we compared the values of these indicators between groups at each time point (to examine difference between groups) and compared the values of these indicators at each time point to their baseline values within each group (to examine difference within groups) using wilcoxon test or kruskal−wallis test. in addition, we also reported the proportion of patients with abnormal values for liver biochemistries over time to examine the liver function changes, with using χ 2 test or fisher exact test to compare the proportions between groups. all significance tests performed were two-sided. p values less than 0.05 were deemed statistically significant and 95% confidence intervals (cis) were calculated for point estimates. a total of 347 covid-19 patients with/without hbv coinfection (21 vs. 326) were analysed before matching. in hbv coinfection group, 20 were diagnosed as hbeag-negative chronic hbv infection or hbeag-negative chb, and one patient had a pre-existing cirrhosis while did not receive any imaging examinations during the hospitalization of covid-19. we described the details of history of hbv infection and antiviral treatment, virological and serological testing at baseline in supplementary the propensity score matching of entire study population yielded 20 and 51 matched patients for hbv group and non-hbv group, and the covariates used for matching and not used for matching were comparable between the two groups after matching (table 1 , all p > 0.1). at the end of follow-up, all the patients in both groups achieved sars-cov-2 clearance and none of them died. the median time to sars-cov-2 clearance (21 days, 95% ci: 19-29) in hbv group was longer than that in non-hbv group (14 days, 95%ci: 13-21), however, no significant difference was observed regarding the probability of sars-cov-2 clearance over time between the two groups (p=0.1, figure 1a ). during the follow-up period, 30% (6/20) and 31.4% (16/51) of patients in hbv group and non-hbv group progressed to severe covid-19, respectively, and there was no difference between the two groups in the probability of progression to severe covid-19 over time (p=0.97, figure 1b ). by multivariate analysis, the risk of progression to severe covid-19 was not statistically table 3 ). in hbv group vs. non-hbv group, 35% (7/20) vs. 37.25% (19/51) had abnormal alt at least once during hospitalization, respectively (p = 0.86). the proportion of abnormal alt had a rise-fall trend in hbv group while a constantly increasing in non-hbv group since admission to hospital (figure 2a) , which was 18.18% and 19.23% at 15 days in the two groups, respectively (p = 0.94). figure 2d ). as the median of testing/assessing time intervals and follow-up durations were 3 days and 14 days for liver biochemistries (alt, ast, ggt, tbil), we compared the dynamic levels of these indicators within/between the two groups at baseline, 3, 6, 9, 12, 15 days during hospitalization. the median levels of liver biochemistries over time were no significant difference between two groups ( figure 3 ; wilcoxon signed-rank test, alt: p=0.56, ast: p=0.58, ggt: p=0.43, tbil: p=0. 16 ). in addition, we found no significant difference in the alt, ast, ggt and tbil levels between the two groups at each time point (supplementary figure 2a-2d) . for the 20 covid-19 patients with chronic hbv infection, 19 of whom had hbv dna viral load testing at least twice during hospitalization, however, one patient had not any test of hbv dna viral load. of the 19 patients, three patients had hbv reactivation, 15 patients had the hbv dna viral loads maintained at low levels (<300 iu/ml) or undetectable, and two patients' hbv dna viral loads were at high levels throughout the hospitalization. all the three patients with hepatitis b reactivation were hbeag negative and did not received any antiviral treatment for hbv before admission. we further described the dynamics of hbv dna viral load and liver biochemistries, and treatment information in figure 4 :  case 1: received methylprednisolone therapies during 3 to 6 days after admission, and interferon α-1b treatment (atomized inhalation) during 5 to 9 days after admission; this article is protected by copyright. all rights reserved. hbv dna viremia was undetectable on 9 days, but abruptly measured as 3.30 log10 iu/ml on 30 days, and finally as 4.05 log10 iu/ml when discharged; alt and ast respectively increased to 387 iu/l (8.6 xuln) and 497 iu/l (11 xuln) on 8 days after admission.  case 2: received methylprednisolone therapy during 2 to 5 days after admission, and interferon α-1b treatment (atomized inhalation) during 1 to 25 days after admission; hbv dna levels were at 3.5-5 log10 iu/ml in early time of hospitalization but had a rapid increase from 2.26 log10 iu/ml on 29 days to 6.65 log10 iu/ml on 31 days; alt and ast were mildly high (< 2xuln) at admission and then restored to normal levels since 3 days after admission.  case 3: received interferon α-1b treatment (atomized inhalation) during 1 to 53 days after admission; hbv dna viremia was undetectable at admission but hepatitis b reactivation (detectable as 1.30 log10 iu/ml) at 9 days after admission; alt and ast were persistently normal during hospitalization. one female patient who was 33 years old and whose bmi was 17.8 kg/m 2 at the admission to hospital, had a history of hbv infection over than 20 years but had not received antiviral treatment for chb previously. in addition, this patient had not any history of alcohol use. the maximum level of alt and ast of this patient was 31.8 u/l and 35.6 u/l during hospitalization, respectively. the patients discharged from hospital after sars-cov-2 clearance but readmitted to the hospital due to hepatalgia and had a liver biopsy 40 days after the clearance of sars-cov-2. the detailed information regarding her treatment course and laboratory tests was provided in supplementary figure 3 . the results of liver needle biopsy for this patient showed the structure of the hepatic lobules was clear, and the hepatocytes in the interlobular were arranged orderly, with some hepatocytes diffuse swelling (ballooning degeneration), and necrosis of isolated hepatocytes. no canalicular bile plugs and interface hepatitis were seen. reticulin staining and sirius red staining indicated periportal fibrosis. the portal tracts were infiltrated with few inflammatory cells. the immunohistochemical analysis showed positive for hbsag and negative for hbcag ( figure 5 ). this observational study found no significant difference in probability of sars-cov-2 clearance and progression to severe covid-19 over time in covid-19 patients with vs. without chronic hbv infection. we observed similar dynamics and non-significant difference at each time point on liver biochemistries (alt, ast, ggt, tbil) between the two groups. however, we observed a continuous abnormality of alt and ggt for both groups, which may be due to sars-cov-2 infection. more importantly, we identified three patients who underwent hepatitis b reactivation. this study provided preliminary evidence concerning the effect of chronic hbv infection on the outcomes and liver function of covid-19 patients and added important data to support the management of covid-19 patients with chronic hbv infection for physicians. investigation of sars-cov-2 shedding will be the key for determining the risk of transmission and formulating the criteria of releasing from quarantine. for the non-hbv covid-19 patients, we found the median time of sars-cov-2 clearance was 12 days after the onset of covid-19 symptoms, which was consistent with a study on eight discharged covid-19 patients from singapore (median, 14 days). 17 . despite the confirmed host immune dysfunction resulting from chronic hbv infection, our results reveal that chronic hbv infection could not delay the sars-cov-2 shedding for covid-19 patients, compared to those without chronic hbv. after excluding non-hbv related chronic liver diseases, we explored the independent impact of chronic hbv infection on the progression to severe covid-19 and found that chronic hbv infection did not increase the risk of progression to severe covid-19. together with these comparisons, we tend to conclude that the comorbidity of chronic hbv infection would not increase the risk of poor outcomes related to sars-cov-2. it is worth mentioning that only one patient in hbv group were cirrhotic in this study. patients with hbv related cirrhosis typically have poor immune function compared to those who had chronic hbv infection but without cirrhosis. therefore, further studies are necessary to examine the impact of hbv related cirrhosis on the outcomes of covid-19. previous studies have found that both hepatocytes and bile duct epithelial cells may also express the angiotensin-converting enzyme 2 (ace2) receptor, while the latter has a higher concentration. it suggests sars-cov-2 might cause the damage of both hepatocytes and bile duct epithelial cells. current studies showed that 6.2% -36.6% of patients had increased serum ast levels, while 21.3% -28.1% had elevated serum alt levels. 18 a few studies reported the abnormal proportions of tbil (4.9% to 10.53%) 4,19,20 and ggt (6.5% to14.8%) 4,19 at baseline. our study also identified the abnormality of the above-mentioned liver laboratory tests. moreover, with further analysis of longitudinal patterns, we found that the abnormality of ast and tbil manifested as transient elevation, while high proportions of patients with abnormal alt and ggt did not achieve the normalization of these two indicators. the dynamics of alt and ggt suggested that sars-cov-2 possibly caused a continuous damage of bile duct epithelial cells and hepatocytes during the disease course. although chronic hbv infection would not increase the injury of liver compared to non-hbv covid-19 patients as suggested in this study, liver function monitoring is still essential for both covid-19 patients with and without chronic hbv infection during the whole disease course. glucocorticoids have powerful anti-inflammatory effects, and have been confirmed to alleviate clinical symptoms, shorten treatment course, and improve the absorption of lung infiltrates for severe acute respiratory syndrome (sars) patients. 21, 22 in our study, six covid-19 patients with hbv received methylprednisolone, one type of corticosteroids. it is well known that moderate to high dose (≥10 mg) of methylprednisolone can lead to a high risk of hepatitis b reactivation. 23, 24 in our study, two of the three patients developed hepatitis b reactivation, which was possibly caused by methylprednisolone. however, one of the three patients who did not receive any corticosteroid also developed hepatitis b reactivation. our results suggested that for covid-19 patients who had chronic hbv infection, whether or not corticosteroids were used, they could have a risk of hepatitis b reactivation, therefore it is necessary to monitor the hbv dna levels for these patients, and for them physicians should take precautions to hepatitis b reactivation. this study is no without limitations. firstly, the number of patients in hbv group was small, although we expected to increase the test efficiency using psm designed with 1:3 matching ratio, and we validated our results by multivariable cox proportional-hazards model. secondly, we were unable to explore if the liver abnormality associated with covid-19 treatment drugs, as all the 71 patients in two groups had received them (supplementary table 2 clinical characteristics of non-icu hospitalized patients with coronavirus disease 2019 and liver injury: a retrospective study liver injury during highly pathogenic human coronavirus infections liver impairment in covid-19 patients: a retrospective analysis of 115 cases from a single center in wuhan city, china covid-19 and the liver: little cause for concern pathological findings of covid-19 associated with acute respiratory distress syndrome general anatomy report of novel coronavirus pneumonia patients polaris observatory collaborators. global prevalence, treatment, and prevention of hepatitis b virus infection in 2016: a modelling study clinical characteristics of coronavirus disease 2019 in china diagnosis and treatment of adults with community-acquired pneumonia. an official clinical practice guideline of the american thoracic society and infectious diseases society of america clinical epidemiology: the essentials epidemiologic features and clinical course of patients infected with sars-cov-2 in singapore covid-19 and liver dysfunction: current insights and emergent therapeutic strategies exploring the mechanism of liver enzyme abnormalities in patients with novel coronavirus-infected pneumonia hydrocortisone infusion for severe community-acquired pneumonia: a preliminary randomized study use of glucocorticoid in treatment of severe acute respiratory syndrome cases american gastroenterological association institute technical review on prevention and treatment of hepatitis b virus reactivation during immunosuppressive drug therapy cord blood transplantation rescued by medical treatment key: cord-022607-34hj17sn authors: wain‐hobson, simon; vartanian, jean‐pierre title: editing hbv into oblivion date: 2004-11-24 journal: hepatology doi: 10.1002/hep.20499 sha: doc_id: 22607 cord_uid: 34hj17sn nan hepatitis c virus (hcv) readily sets up persistent infection, and in doing so must evade both innate and adaptive immune responses. cellular (t-cell) immune responses are thought to play a significant role in determining clinical outcome, with strong and sustained responses typically associated with viral control. 1,2 cellular immune responses are also potentially involved in immunomediated pathogenesis, both directly and through recruitment or modulation of other inflammatory cells in the liver. consequently, much recent effort has been expended to attempt to analyze how the virus evades both cd8 ϩ and cd4 ϩ t cells and define the differences between "successful" and "unsuccessful" outcomes (i.e., spontaneous control of viremia vs. chronicity) . relatively fewer data are available describing how intrahepatic t-cell responses might be linked to pathology. a general consensus is emerging that in acute infection, regardless of outcome, cd8 ϩ t-cell responses can be readily detected; however, in those cases in which the virus is not controlled, such responses are not sustained at high levels in blood beyond a few weeks. 3 this could be explained partly by viral escape through mutation, as has been elegantly shown in animal models. 4 however, even in cases when epitopes appear to be intact, responses typically are weak or absent in blood ex vivo once chronicity is established. they do not appear to be entirely deleted, because they can be reconstituted in vitro through restimulation with antigen, or even fished out from blood directly using ultrasensitive detection techniques. 5 thus various groups have proposed that functional alterations in cd8 ϩ t cells may be associated with persistent infection. those include relatively weak interferon gamma (ifn-␥) production, 6,7 impaired proliferative capacity, 8 and a "stunted" maturation state. 6, 9, 10 it is not clear whether the lack of mature effector cells seen in the circulation is as a result of compartmentalization in the liver, (where they may be deleted) or failure to generate such cells in the first place-potentially through defects in antigen-presenting cells, inhibitory effects of viral gene products (such as core) 11 or failure of cd4 ϩ t-cell help. 1 things look slightly different in the liver itself. early studies showed it is possible to clone out cd8 ϩ t cells of diverse specificities from the liver of infected patients. 12, 13 it appears that antigen-specific t cells exist at higher frequencies infected livers-probably a relative increase of approximately 10-fold as a proportion of cd8 ϩ t cells. 14, 15 (it should be noted that enrichment of virusspecific memory t cells-for example, those specific for cytomegalovirus and epstein-barr virus-is seen even in normal livers in human and murine models. 16 ) interestingly, such t cells in both infected and normal livers appear to be activated, as judged by expression of cd69, although this effect is not antigen specific. 15 the questions that emerge then are: are such t cells fully functional in the intrahepatic environment, and how does such activity relate to disease progression? the study by accepezzato et al. is a large-scale analysis of intrahepatic cd8 ϩ t-cell populations using class i tetramers and intracellular cytokine staining to better understand exactly the functionality of the intrahepatic virus-specific t cells. these analyses are technically very demanding because of the very low cell yields available, and previously have only examined very limited patient numbers, compared with nearly 50 in this study. 14, 15 as previously, accepezzato et al. found low frequencies of virus-specific t cells in blood in most cases but found generally higher overall frequencies in liver. the maturation state in the liver appears to be more advanced than in blood, reflecting accumulation of "effector memory" (ccr7 ϫ ) cells in the liver. for example, some cells appear to be high in perforin, a situation that is very rarely found in blood among hcv-specific populations. 6, 10 the most interesting results, however, relate to the functionality of the cells. in addition to tetramer staining, the authors stimulated the t cells in vitro with peptide and analyzed the release of ifn-␥ or interleukin 10 (il-10). ifn-␥ is a classical antiviral cytokine that is believed to be of special relevance in the clearance of infected hepatocytes. 17 il-10 is a multifunctional cytokine associated with suppression of t helper 1-type responses. in the present study, three secretion patterns seemed to emerge. in some patients, there appeared to be very weak secretion of either cytokine, while in a few patients there appeared to be a dominance of ifn-␥; several other patients exhibited a dominant il-10 secretory response. interestingly, the overall proportion of cells secreting ifn-␥ in response to viral peptides correlated positively with the level of intrahepatic inflammation (histological activity index score); conversely, the frequency of il-10 secreting cells correlated inversely with the histological activity index score. what is the role of intrahepatic virus-specific cd8ϩ t cells in determining acute viral clearance and immunopathology? with regard to acute viral clearance, this is still very unclear and unlikely to be easily addressed in human studies. it would, for example, be very interesting to know whether the early emergence of il-10 -secreting populations in the liver was associated with failure to initially control the virus. as with many studies, it is very difficult to disentangle cause and effect-il-10 -secreting cells might reasonably emerge as a consequence of long-term inflammation. the observation that even in these chronically infected patients, several had intrahepatic t-cell populations that expressed either no cytokine or largely ifn-␥ suggests that induction of il-10 secretion cannot alone explain the propensity of hcv to evade cd8ϩ t cells. regarding pathology, il-10 -secreting cd8ϩ t cells may play an important role in suppression or regulation of inflammation-a feature that actually might represent an appropriate adaptation of t-cell responses to chronic antigen exposure. in this respect, they may be akin to the more classical cd4 ϩ t regulatory cells. such populations may have anti-self specificities; however, persistent stimulation may induce similar regulatory activity even in cd4 ϩ t cells specific for foreign antigens. a role for cd4 ϩ cd25 ϩ t cells in regulation of peripheral cd8 ϩ t-cell responses has recently been proposed. 18 why, then, might some patients generate il-10 -secreting t-cell populations and others not? one question arising from the study is whether the phenotype observed reflects an adaptation only of hcv-specific t cells, or whether it is a feature of the overall infiltrate. hcv-specific t cells appear to represent only a relatively small fraction of the overall intrahepatic cd8 ϩ t-cell response (about 1% in this study, although perhaps slightly higher than this if other epitopes were included). simply analyzing the overall cytokine preferences of intrahepatic t-cell infiltrates might be very informative. there are suggestions that polymorphisms in chemokine and chemokine receptor genes might influence intrahepatic pathology, so a genetic basis (e.g., in cytokine/receptor genes) for these distinct responses might be relevant. 19 alternatively, viral factors might lead to diverse outcomes; genotype did not appear to play an obvious role, although this issue is confounded by the fact that some of the peptides used are poorly cross-reactive. viral mutants (altered peptide ligands) emerging in vivo have been associated with modulation of cytokine secretion of t cells. 20 finally-looking forward-could the cytokine secretion profiles of intrahepatic t cells be potentially linked to treatment response? this is an intriguing question, given that it is observed that combination therapy for chronic intrahepatic t-cell decision-making. cd8 ϩ t-cell responses found in blood are usually weak and are low in markers of activation and maturation. in the liver, cd69 expression-indicating recent activation-is observed, and in the present study, perforin expression is also described. cytokine secretion appears to take one of two main paths: predominantly ifn-␥ or predominantly il-10. although the molecular and cellular pathways are not understood in detail, it is likely that ifn-␥ secretion has antiviral activity but is also proinflammatory, while il-10 is anti-inflammatory. the long-term effect on fibrosis (which was generally fairly mild in the present study) requires further analysis. disease boosts previously weak or undetectable t-cell responses in the periphery. 21, 22 it is still not clear to what extent such responses are reflected in the liver and how they link ultimately with sustained virological responses. nevertheless, it has been shown that the addition of ribavirin to treatment regimens reduces the il-10 secretion of recovered antiviral t cells. 22 thus, it seems plausible that treatment will shift the cytokine balance in the liver, which could influence significantly the overall success of therapy. one possible message from this study is that t cells in hcv appear to be able to adapt in the face of a persisting virus, and in doing so modulate the intrahepatic environment to one that is less inflammatory (fig. 1) . the relationship between host and virus in hcv infection is potentially a long-term one. as in human relationships, each partner is capable of making compromises to minimize confrontation. in some cases this behavior modification is more successful than others. it remains to be seen whether-in cases where the relationship is breaking down-we can but watch from the sidelines, or could possibly intervene to re-educate t cells into a more appropriate response. of polymerase errors. accordingly, their coding capacity is limited by the probability of generating a lethal mutation. genome sizes range from the 3 kb of hepatitis b virus (hbv) up to the 27 to 32 kb typical of the coronaviruses. the error threshold is that mutation rate just compatible with viable replication. chemical mutagenesis or the incorporation of ambiguous bases can displace mutation rates beyond the error threshold so resulting in the collapse of information. 1,2 given this, many have wondered whether nature has not seized upon this singular vulnerability of rna viruses and retroviruses to "going over the edge." for nearly 20 years it has been known that negative stranded genomes, particularly those of measles virus, may undergo genetic editing of adenosine in the context of double stranded rna. multiple adenosine residues would be deaminated, resulting in inosine. as inosine base pairs as guanosine, adenosine editing generated a3 g hypermutants. 3 some years later another form of hypermutation cropped up among the classical retroviruses. 4 massive and monotonous substitution of g for a, involving up to 60% of g residues, was distributed across the entire 10-kb hiv-1 genome. although the frequency and degree of g3 a hypermutation are most striking for the lentiviral subgroup of retroviruses, which includes human immunodeficiency virus (hiv), elsewhere g3 a hypermutants have been described for only a handful of retroviruses including the "other" human retrovirus, human t-cell leukemia virus (htlv). the situation took a fascinating turn when will's group sequenced a couple of subgenomic hbv dna molecules from the serum of a single patient. 5 the genomes showed signs of extensive g3 a substitution at a frequency typical of hiv g3 a hypermutants. since then, these two hypermutants have remained the only such examples despite a burgeoning hbv database. the fact that g3 a hypermutation is found among viruses with obligatory reverse transcription steps, notably hbv and the primate lentiviruses, suggests a common mechanism occurring in the cytoplasm. the conceptual break leading to an understanding of retroviral g3 a hypermutation has come recently in two stunning punches. first, the vif gene is conserved among all the primate lentiviruses, where vif is an abbreviation for "viral infectivity factor." some established t-cell lines are permissive for the replication of hiv-1 ⌬vif viruses while others are not, suggesting restriction by a host cell protein. using a subtractive screen malim's group in london showed that a single gene product, cem15, was responsible for restricted hiv replication. 6 when screened against the databases, cem15 proved to be identical to apobec3g, which is part of a 7-gene cluster that mapped to chromosome 22q13. 7 what are these genes, denoted apobec3a-g? the sequences of all seven show clear amino acid homology to cytidine deaminases, including that of escherichia coli, but particularly the mammalian enzyme apobec1. this name is derived from the fact that the protein is the catalytic subunit of the "apolipoprotein b editing complex" that specifically deaminates cytidine c6666 to uracil (u) in apolipoprotein b messenger rna (mrna). 8 second, a crop of five papers showed that when a hiv-1⌬vif virus was cotransfected along with a human apobec3g complementary dna (cdna) clone, the molecule was incorporated into budding virions. upon infection of a susceptible target cell, g3 a hypermutants were recovered with alacrity. as only g3 a substitutions were found, even though reverse transcription results in double strand (ds) dna formation, this suggested that only one strand was being edited. 9 -13 this was only (bio)logical if the nascent minus dna strand was being edited, which was rapidly confirmed. all groups showed that viral genomic rna was not edited. deamination of cytidine residues in neosynthesized minus strand dna yields uracil and occurs post-cdna synthesis in a manner independent of reverse transcriptase. 14 now as u base pairs with adenosine, when apobec3g-edited minus strand dna is copied into plus strand dna by reverse transcriptase, the multiple us are copied into a. although referred to as g3 a hypermutants the "action" concerns c residues on the minus dna strand. upon this vibrant stage, turelli et al. have come forth with an intriguing study of the effect of apobec3g expression on hbv replication. 15 they assayed core-associated hbv dna resulting from transfection of human hepatoma huh7 cells with a hbv-producing plasmid. when cotransfected with human apobec3g, hbv dna synthesis was strongly curtailed. important controls showed that apobec3g was incorporated into the core particles yet did not affect hepatitis b c antigen (hbcag) production. however, three findings suggest that hbv does not parallel the hiv hypermutation paradigm. firstly, g3 a hypermutated hbv dna was not found despite searching. secondly, core-associated hbv rna was reduced more than 10-fold, suggesting that the block in hbv dna synthesis results primarily from an inhibition of viral pregenomic rna packaging. finally and remarkably, serine substitutions of functionally critical cysteine residues in apobec3g failed to abrogate the antiviral activity for hbv but did so in the hiv control-so controls are useful! for the purist, a negative result, the inability to find hypermutated hbv dna-remains just that. however, the antiviral activity of the apobec3g serine mutants and reduced rna packaging represent positive results, which are challenging, to say the least. certainly the lack of hypermutants is coherent if the cytosine deamination activity of apobec3g is not involved in hbv restriction. the vexing point is that the experiments were driven with single strand (ss) dna cytosine deamination as the working hypothesis, even though hbv g3 a hypermutants do exist, albeit rarely. commenting on the science paper in the form of a "technical comment," rösler et al. identified bona fide g3 a hypermutants at low frequency in an analogous transfection protocol, albeit using the widely known cell line hepg2. 16 to complicate matters, they failed to identify hyermutants using huh7 cells, which led them to postulate a cell line effect. commenting on rösler et al., turelli et al. refuted this idea because they could achieve apobec3g restriction of hiv using huh-7 as a transfection support. 17 the latter comment is especially interesting in that it shows that hbv replication can be restricted by apobec3f. 17 now, among the apobec3 cluster of gene products, only apobec3f and 3g can restrict hiv replication. each has a subtle sequence bias in the way it deaminates dna. apobec3f shows a preference for cytidine in the context of tpc, while apobec3g prefers the cpc. interestingly, the two naturally hypermutated subgenomes showed an overall bias for tpc, indicating that they were probably edited more by apobec3f than by apobec3g. 5 this nicely fits with the new finding. as for hiv, the same two apobec3 members are involved in hbv restriction. at the low resolution of whole-liver mrna profiling, only apobec3c is strongly expressed, while apobec3f and apobec3g are expressed at borderline levels (http://genecards.bcgsc.bc.ca/). by contrast, immune cells express copious amounts of most apo-bec3 molecules. hence, apobec profiling of liver tissue might well reflect circulating lymphoid cells. if hepatocytes expressed little or no apobec3 molecules this would help explain the dearth of naturally observed hbv g3 a hypermutants in the databases. how can one square hbv restriction by apobec3g when there is little expression of apobec3g in the normal liver? perhaps the mrna profiling is too macroscopic, too low-resolution to be of much use. alternatively, the inflammatory response to hbv might upregulate apobec3g. certainly the pkca/␤i / mek / erk pathway has been shown control basal levels of apobec3g mrna in some t-cell lines, 18 which consequently declined when cells were treated with inhibitors or arrested in the g 0 state of the cell cycle by serum starvation. alternatively, given the expression of most apobec3 molecules in lymphoid tissue, rare and abortive infection of cd4 ϩ and cd8 ϩ t lymphocytes by hbv is another working hypothesis. 19 could apobec3g function by simply binding to c residues in hbv genomic rna so precluding it from becoming packaged? but if so, why should this not occur for hiv replication? we do not know. yet the parallel with human apobec1 is striking: when expressed alone in e. coli, it is highly mutagenic for dna, 20 yet if incorporated into an editing complex it edits a single c residue in the apolipoprotein b mrna. could it be that just beneath the plasma membrane apobec3g acts nonspecifically as a ssdna cytosine deaminase, whereas deep down in the endoplasmic reticulum where hbcag particles are assembled, it is part of a multiprotein complex that modulates the activity of the apobec3g subunit? an analysis of primate apobec3g gene sequences indicates that they are evolving under positive selection although selection is present in lineages for which there is no natural simian immunodeficiency virus (siv), such as orangutans and macaques. 21 these primates are of asian origin, whereas all naturally occurring sivs are found in equatorial africa. hbv has arguably been in primates for a longer period of time than has siv-the presence of hbv-like viruses in gibbon and orangutan are cases in point. 22, 23 the absence of hbv and siv in the macaque lineage suggests that selection on apobec3g is probably unrelated to retroviruses. the lack of restriction of single mouse homologue of apobec3g on murine retroviral vectors 24 suggests that a blanket interpretation of these molecules as part of innate antiretroviral immunity is too simplistic, at least for the moment. while no cellular function has been ascribed to apobec3g and its immediate paralogues, once in place some of them represent formidable barriers to retroviral infection. retroviruses have either to avoid cells in which apobec3 molecules are abundantly expressed or escalate and overcome the obstacle via the acquisition of some novel gene product. otherwise their genomes will be edited beyond the error threshold and into oblivion. the lentiviral vif gene fits the latter scenario. the paper by turelli et al. shows that there is far more to apobec3 genes than initially thought. these are exciting times with much to be done. it will be fascinating to see how the picture develops. different clinical behaviours of acute hcv infection are associated with different vigor of the anti-viral t cell response analysis of a successful immune response against hepatitis c virus ctl responses are induced during acute hcv infection but are not sustained the outcome of hepatitis c virus infection is predicted by escape mutations in epitopes targeted by cytotoxic t lymphocytes ultra-sensitive class i tetramer analysis reveals previously undetectable populations of antiviral cd8ϩ t cells sustained dysfunction of antiviral cd8ϩ t lymphocytes after infection with hepatitis c virus determinants of viral clearance and persistence during acute hepatitis c virus infection impaired effector function of hepatitis c virus-specific cd8ϩ t cells in chronic hepatitis c virus infection memory cd8ϩ t cells vary in differentiation phenotype in different persistent virus infections pervasive influence of hepatitis c virus on the phenotype of antiviral cd8ϩ t cells suppression of host immune response by the core protein of hepatitis c virus: possible implications for hepatitis c virus persistence hla class i-restricted cytotoxic t lymphocytes specific for hepatitis c virus. identification of multiple epitopes and characterization of patterns of cytokine release liver derived ctl in hcv infection; breadth and specificity of responses in a cohort of patients with chronic infection quantitative analysis of hcv-specific cd8ϩ t cells in peripheral blood and liver using peptide-mhc tetramers direct ex vivo comparison of the breadth and specificity of the t cells in the liver and peripheral blood of patients with chronic hcv infection virus-specific cd8 ϩ t lymphocytes within the normal human liver viral clearance without destruction of infected cells during acute hbv infection suppression of hcv-specific t cells without differential hierarchy demonstrated ex vivo in persistent hcv infection association of genetic variants of the chemokine receptor ccr5 and its ligands, rantes and mcp-2, with outcome of hcv infection immunobiology of hepatitis c virus (hcv) infection: the role of cd4 t cells in hcv infection the dynamics of t-lymphocyte responses during combination therapy for chronic hepatitis c virus infection hepatitis c virus-specific t-cell reactivity during interferon and ribavirin treatment in chronic hepatitis c the broad-spectrum antiviral ribonucleoside ribavirin is an rna virus mutagen lethal mutagenesis of hiv with mutagenic nucleoside analogs biased hypermutation and other genetic changes in defective measles virus in human brain infections wain-hobson s. selection, recombination, and g3 a hypermutation of human immunodeficiency virus type 1 genomes naturally occurring hepatitis b virus genomes bearing the hallmarks of retroviral g3 a hypermutation isolation of a human gene that inhibits hiv-1 infection and is suppressed by the viral vif protein an anthropoid-specific locus of orphan c to u rna-editing enzymes on chromosome 22 molecular cloning of an apolipoprotein b messenger rna editing protein hypermutation of hiv-1 dna in the absence of the vif protein the cytidine deaminase cem15 induces hypermutation in newly synthesized hiv-1 dna broad antiretroviral defence by human apobec3g through lethal editing of nascent reverse transcripts dna deamination mediates innate immunity to retroviral infection species-specific exclusion of apobec3g from hiv-1 virions by vif apobec3g is a single stranded dna cytidine deaminase and functions independently of hiv reverse transcriptase inhibition of hepatitis b virus replication by apobec3g comment on "inhibition of hepatitis b virus replication by apobec3g author reply to comment on "inhibition of hepatitis b virus replication by apobec3g transcriptional regulation of apobec3g, a cytidine deaminase that hypermutates human immunodeficiency virus distribution of hepatitis b virus dna sequences in different peripheral blood mononuclear cell subsets in hbs antigen-positive and negative patients rna editing enzyme apobec1 and some of its homologs can act as dna mutators rapid evolution of primate antiviral enzyme apobec3g a new group of hepadnaviruses naturally infecting orangutans (pongo pygmaeus) complete sequencing of a gibbon hepatitis b virus genome reveals a unique genotype distantly related to the chimpanzee hepatitis b virus apobec3g targets specific virus species key: cord-280643-n8qjorqk authors: wu, kai-lang; zhang, xue; zhang, jianlin; yang, yongbo; mu, yong-xin; liu, mo; lu, lu; li, yan; zhu, ying; wu, jianguo title: inhibition of hepatitis b virus gene expression by single and dual small interfering rna treatment date: 2005-04-26 journal: virus res doi: 10.1016/j.virusres.2005.04.001 sha: doc_id: 280643 cord_uid: n8qjorqk rna interference (rnai) has been successfully applied in suppression of hepatitis b virus (hbv) replication. to circumvent the problem that mutation in hbv genome may result in resistance when sirna is further developed as an anti-viral drug, in this study, we established a dual small interfering rna (sirna) expression system, which could simultaneously express two different sirna molecules that can specifically target two genes. to test the effectiveness of this system, we applied this new approach to express simultaneously two different 21-bp hairpin sirna duplexes that specifically attack the hbs and hbx genes of hbv, respectively, in bel-7402 and hepg2.2.15 cells. results indicated that dual sirna could simultaneously inhibit the expression of hbs and hbx gene by 83.7% and 87.5%, respectively, based on luciferase assays. in addition, dual sirna molecules were able to significantly reduce the amount of hbv core associated dna, which is considered as an intracellular replicative intermediate, and the viral dna in culture supernatant. therefore, this dual sirna system provides a more powerful tool for the study of gene function and implicates a potential application in the treatment of viral infection. rna interference (rnai) is a natural process of eukaryotic cells by which double-stranded rna initiates and directs the degradation of homologous mrna (hannon, 2002) . this rna silencing mechanism was first described in caenorhabditis elegans and drosophila melanogaster (fire et al., 1988) . it has many similarities to the posttranscriptional gene silencing in plants. specific inhibition of cellular mrna by rnai can be triggered in mammalian cells by the introduction of synthetic 21-to 23-nucleotide double-stranded small interfering rna (sirna) (elbashir et al., 2001; paul et al., 2002) or, alternatively, by the transcrip-tion of sirna from a dna construct driven by the rna polymerase cassette (brummelkamp et al., 2002) . these findings open up a new field for the analysis and control of the processes of gene expression, and perhaps pathogen infection. the replication of a growing number of human pathogenic viruses in cell culture was shown to be inhibited by rnai, including poliovirus (coburn and cullen, 2002) , hiv-1 (jacque et al., 2002; lee et al., 2002) , flock house virus (fhv) (dector et al., 2002) , rous sarcoma virus (hu et al., 2002) dengue virus (adelman et al., 2002) , hepatitis c virus (hcv) (kapadia et al., 2003) replicons, influenza virus (ge et al., 2003) , hepatitis b virus (hbv) (hamasaki et al., 2003; mccaffrey et al., 2003) , hpv (jiang and milner, 2002) . recently, it was reported that rnai could also induce transcriptional silencing of sars coronavirus (he et al., 2003) . in most above studies, synthetic 21-nucleotide doublestranded sirnas were applied. however, vector based rnai techniques were used more frequently in recent studies. each vector expresses unique sirna that can degrade a specific target. eight genotypes (a-h) of hbv have been described. the number of hbv carriers worldwide has been estimated to be more than 400 million. these individuals have a 15-25% risk of developing liver diseases such as liver cirrhosis and hepatocellular carcinoma (kao and chen, 2002) . although a few drugs were developed against hbv infection, the success rate of these treatments, however, is low and frequently infections reoccur (carreno et al., 1992; lai et al., 1997) . the fact that rnai can be applied for blocking the replication of hbv in several reports provided insights into the field of controlling infectious human hepatitis. nevertheless, mutations in hbv genome may result in viral resistance to sirna. it has been reported that hiv-1 can escape from rnai-mediated inhibition due to nucleotide change in the genome (das et al., 2004) . one strategy to circumvent the problem is to choose target in the relatively conserved dna sequence. the other approach is to produce multiple sirnas that target different sites or genes on the viral genome. we here established a system that can express two sirna duplexes simultaneously and target the s and x genes of hbv, respectively. to study the effects of dual rnai on hbv gene expression in a cell culture model, we used a derivative of the human hepg2 hepatoma cell line, hepg2.2.15, which has been stably transformed with several copies of the hbv genome and used as an in vitro model for hbv replication. the effects of dual sirna system on hbv gene expression were investigated in this study. two human hepatoma cell lines, bel-7402 and hepg2.2.15 were maintained in dulbecco's modified eagle medium (gibco/brl) supplemented with 100 units/ml penicillin, 100 g/ml streptomycin and 10% heat-inactivated fetal bovine serum at 37 • c under 5% co 2 . cells were seeded onto 24-well plates at a density of 1.0 × 10 5 or 4.0 × 10 5 cells per 24-well plate or 6-well plate and grown to the confluence reaching approximately 60% at the time of transfection. cells were transfected with 0.1 or 0.4 g of plasmid pcmv-hbs together with 0.45 or 1.2 g psliencer-2.1-u 6 -sirna, using sofast tm transfection reagent (xiamen sunma biotechnology co. ltd., china) according to the protocol provided by the manufacturer. the cells were harvested 48 h after transfection. full-length hbv genomic dna (subtype ayw) was cloned into the hindiii and saci sites of pbluescript (stratagene) to generate the plasmid pblue-hbv. hbs gene was cloned into the hindiii and saci sites of vector pcmv-tag2a (stratagene) fig. 1 . schematic diagrams of luciferase fusion genes, sirna targeting sites and dual sirna expression cassettes. (a) diagram of the two reporter fusion vectors, which contain targeted sequences of hbs or hbx gene and the luciferase report gene driving by the cmv promoter. (b) locations of rnai targeted sites and structure of the hbv genome. downward arrows indicate the locations of rnai target sites within the four hbv transcripts. the 3.5-kb transcript is the pregenomic rna that serves as the template for hbv viral dna replication. the hbv open reading frames are shown below aligned with the hbv mrnas. pol, polymerase; core, hbcag; s1, large presurface antigen; s2, mid pre-surface antigen; s, hb-sag; x, x gene. the numbers above the arrows indicate the sirna target sites. 1 = hbs 1 sirna, 2 = hbs 2 sirna, 3 = hbs 3 sirna, 4 = hbs 4 sirna, 5 = hbs 5 sirna, 6 = hbx 1 sirna, 7 = hbx 2 sirna, 8 = hbx 3 sirna. (c) diagram of dual sirna expression cassettes. to yield plasmid pcmv-hbs. hbx gene was cloned into pcmv-tag2a at ecori and xhoi sites to generate pcmv-hbx. two-pair of primers 5 -ctgcgagatctatggagagc-tcacatcaggattc-3 (sense), 5 -gttaggtcgacaa-tgtatacccaaagacaaaaagaa-3 (antisense) or 5 -gatcatacgcgtaagcttttcatttattgatcat-3 (sense), 5 -gtcggggcttcattcactcgtctagaac-tgat-3 (antisense) were used to amplify the hbs and hbx gene, respectively. the pcr products were then cloned into sali and bglii sites of plucf to generate plasmid plucf-hbs and plucf-hbx (fig. 1a) , in which the hbs or hbx were fused in frame with the luciferase gene and the expression of the fusion gene was drove by the cmv promoter (fig. 1a ). five regions of the hbs gene and three regions of the hbx gene were selected as the targeted sequences of sirna in this study (fig. 1b) . to construct single sirna expression vector, two 64nt primers, each containing a 19nt target sequence in the sense and antisense forms from different regions of the hbs gene or hbx gene as indicated below, were systhesized (invitrogen): 5 -gctcccgcgtgtcttggcc-3 (hbs 1 sirna); 5 -ggtggacttctctcaattt-3 (hbs 2 sirna); 5 -gccaaaattcgcagtccc-3 (hbs 3 sirna); 5 -gttgctgtaccaaacctt-3 (hbs 4 sirna); 5 -gctcagtttactagtgcca-3 (hbs 5 sirna); 5 -gcacttcgcttcacctctg-3 (hbx 1 sirna); 5 -gcaatgtcaacgaccgacc-3 (hbx 2 sirna); 5 -gtttaaagactgggaggag-3 (hbx 3 sirna). sense and antisense primers were then cloned into psilence-2.1-u 6 plasmid (amibion) at bamhi and hindiii sites after annealing according to the manufacturer's instructions. to generate the dual sirna expression plasmid, two primers 5 -gctgatgacgtcagtggaaagacgcg-3 -(sense) and 5 -tcagcgaattcacgccaagcttttcc-3 (antisense) were designed to amplify a dna fragment containing u6 promoter and hbx 2 sirna expression cassette from recombinant plasmid psilencer-2.1-u6-hbx 2 . the pcr product was then cloned into aatii and ecori sites of plasmid psilencer-2.1-u6-hbs 2 to generate recombinant plasmid psilencer-2.1-u6-hbsx, which carries two independent sirna expression cassettes (fig. 1c ). bel-7402 cells were co-transfected with reporter plasmids and sirna expression plasmids. cells were washed with pbs and lysed with luciferase cell culture lysis reagent (promega). ten microliters of the cell lysates and 100 l of luciferase assay substrate (promega) were mixed and fluorescence intensity was detected by the luminometer (turner t20/20). assays were performed in triplicate, and expressed as means ± s.d. relative to vector control as 100%. bel-7402 cells and hepg2.2.15 cells were transfected with sirna expression plasmids, the level of hbsag protein in culture media from transfected cells were then determined by enzyme-linked immunosorbent assay using a hbv diagnostic kit (shanghai kehua biotech co. ltd.). assays were performed in triplicate independent experiments. bel-7402 cells and hepg2.2.15 cells were transfected with sirna expression plasmids, total rna were then extracted from transfected cells by trizol reagent (invitrogen) according to the method described in the manufacturer's manual. reverse transcription were performed with total rna as the template. the cdnas were synthesized with hbs or hbx gene specific primers, 5 -gcggggtttttcttgttgac-3 (sense), 5 -ctacgaaccactgaacaaat-3 (antisense) or 5 -cctgcgcgggacgtcctttg-3 (sense), and 5 -cagtctttgaagtatgcctc-3 (antisense). to assay the effect of sirnas on hbv replication, intracellular core-associated hbv dna was extracted by the method described previously (pugh et al., 1988) . briefly, 1 × 10 5 transfected hepg2.2.15 cells were lysed and centrifuged at 25 • c. magnesium chloride was added to the supernatant. dna not protected by hbv core was treated digested with deoxyribonuclease (dnase i). then the lysates were treated with proteinase-k and, after phenol/chloroform extraction; core-associated hbv dna was recovered by ethanol precipitation, and quantified by real time-pcr (rt-pcr) as described by the manufacturer (pg biotech, shenzhen, china). the hbv dna in the supernatants was also quantified following the procedure provided by the manufacturer (pg biotech, shenzhen, china). primers used in rt-pcr were: p1, 5 -atcctgctgctatgcc-tcatctt-3 and p2, 5 -acagtggggaaagcccta-cgaa-3 . the probe was 5 -tggctagtttactagtgc-cattttg-3 . pcr reaction was carried out and analyzed by a pe gene amp 7700 (perkin-elmer, usa). to efficiently screen sirna molecules, selected targeting dna sequences were fused in frame with that of luciferase gene, in which luciferase activity was supposed to represent the level of hbs or hbx mrna expression. cells were co-transfected with plucf-hbs or plucf-hbx and eight single sirna expression vectors, respectively. luciferase activities were then determined from those transfected cells. result showed that hbs 1 sirna, hbs 2 sirna and hbx 2 sirna strongly inhibited luciferase activities by 81.5%, 80.5%, and 76.5%, respectively, comparing to that of vector control ( fig. 2a and b) . these results indicated that the three sirnas could efficiently degrade the mrna of hbs-luciferase or hbx-luciferase fusion gene. to evaluate the effects of dual sirna expression plasmid on the inhibition of hbs-luciferase or hbx-luciferase fusion gene expression, cells were co-transfected with plucf-hbs or plucf-hbx and the dual sirna expression plasmid phb-sxsirna. result from luciferase activity assays indicated that there was a further reduction in luciferase activity by dual fig. 2 . quantitative analysis of luciferase activity in cells after transfected with sirna expression plasmids. (a) bel-7402 cells were co-transfected with plucf-hbs plasmid and psliencer-2.1-u 6 -sirna (hbs 1 sirna, hbs 2 sirna, hbs 3 sirna, hbs 4 sirna, hbs 5 sirna) plasmids; psliencer-2.1-u 6 plasmid was used as a control. (b) bel-7402 cells were co-transfected with plucf-hbx plasmid and psliencer-2.1-u 6 -sirna (hbx 1 sirna, hbx 2 sirna, hbx 3 sirna) plasmids; psliencer-2.1-u 6 vector was used as a control. (c) bel-7402 cells were co-transfected with plucf-hbs and psliencer-2.1-u 6 -sirna (hbs 2 sirna, hbx 2 sirna, hbsxsirna) plasmids; psliencer-2.1-u 6 was used as vector control. (d) bel-7402 cells were co-transfected with plucf-hbx and psliencer-2.1-u 6 -sirna (hbx 2 sirna, hbsxsirna, hbs 2 sirna); psliencer-2.1-u 6 was used as control. forty-eight hrs after transfection, cells were lysed and luciferase activities were determined by luminometer. sirna duplexes (hbsxsirna) comparing to that of single sirna expression vectors (hbs 2 sirna or hbx 2 sirna). the reduction rate of luciferase activity caused by hb-sxsirna was 83.7% to hbs and 87.5% to hbx, respectively ( fig. 2c and d) . to evaluate the influence of rnai on hbs gene expression, bel-7402 cells were transfected with psilence2.1-u6-sirna, pcmv-hbs or hbsxsirna and hepg2.2.15 cells were transfected with psilence2.1-u6-sirna or hbsx sirna. hbsag concentrations in the culture media of transfected and control cells were measured 2 days after transfection by elisa using hbv diagnostic kit. results showed that hbsag level was decreased in the bel-7402 cells after transfection with hbs 1 sirna, hbs 2 sirna or hbsxsirna with reduction rate of 91.5%, 88.5% ,and 83.7%, respectively ( fig. 3a and d) . in hepg2.2.15 cells, transfection with hbs 1 sirna, hbs 2 sirna, or hbsxsirna reduced hbsag level by 75.4%, 85.7%, and 87.6%, respectively ( fig. 3b and c) . in addition, transfection with hbx 2 sirna reduced the level of hbsag production by 65.3% in hepg2.2.15 cells (fig. 3e) . to determine whether sirnas specificly degrade hbs or hbx mrna, we used semi-quentitation rt-pcr analyses to determine the levels of hbs or hbx mrna in two different cell lines, bel-7402 ( fig. 4a and b) and hepg2.2.15 ( fig. 4c and d) , 2 days after transfection. results indicate that the levels of hbs mrna were significantly decreased by the treatment of hbsxsirna (fig. 4a, lane 1) , hbs 1 sirna (fig. 4a, lane 2) , hbs 2 sirna (fig. 4a, lane 3) in bel-7402. the levels of hbx mrna were also decreased by the treatment of hbsxsirna (fig. 4b, lane 1) , hbx 2 sirna (fig. 4b, lane 2) , but not by that of psliencer-2.1-u 6 or untreated cells (fig. 4b, lanes 3 and 4) . similar results were also obtained in hepg2.2.15 cell lines under the same conditions of sirna treatments ( fig. 4c and d) . results showed that the levels of hbs mrna were dramatically reduced in hepg2.2.15 cells after the treatment of hbsxsirna (fig. 4c, lane 6) , hbs 1 sirna (fig. 4c, lane 7) and hbs 2 sirna (fig. 4c, lane 8) , respectively. the levels of hbx mrna in hepg2.2.15 cells were also reduced by the treatment of hbsxsirna (fig. 4d, lane 2) , hbx 2 sirna (fig. 4d, lane 3) , but not by that of psliencer-2.1-u 6 or untreated cells (fig. 4d, lanes 1 and 4) . in addition, our results showed that the inhibition effects of dual sirna, hbsxsirna on the levels of hbs and hbx mrna (fig. 4a (lane 1) , b (lane 1), c (lane 6), and d (lane 2)) were more sever than that of single sirna (fig. 4a, (lanes 2 and 3) , b (lane 2), c (lane 7 and 8), and d (lane 3)). to determine the effectiveness of sirnas on viral dna replication, hbv core associated dna (as an intracellular replicative intermediate) and hbv dna were extracted from hepg2.2.15 cells transfected with hb-sxsirna, hbs1sirna, hbs2sirna, hbx2sirna, and vector, respectively. the levels of hbv core associated dna and hbv dna were determined by real time pcr. results indicated that the levels of hbv core associ-ated dna were significantly decreased in the cells transfected by hbsxsirna, hbs 1 sirna, hbs 2 sirna, and hbx 2 sirna with reduction rate of 90.2%, 85.7 %, 81.3%, and 60.4%, respectively, compared with that of vector control (fig. 5a) . in hepg2.2.15 cells, transfection with hb-sxsirna, hbs 1 sirna, hbs 2 sirna and hbx 2 sirna reduced the level of viral dna in supernatants media by 88.7%, 82.6%, 78.4%, and 58.3%, respectively (fig. 5b) . it has been attracted considerable attentions in the use of rnai as therapeutics to treat a variety of diseases, including tumors and viral infections. hamasaki et al. (2003) demonstrated that rnai could attenuate the replication of hbv genome in cell culture. shlomai and shaul (2003) used a similar approach to inhibit the replication and expression of hbv in hepg2.2.15 cell line, in which all hbv proteins could be expressed. recently, mccaffrey et al. (2003) went further in this field by showing that rnai were function well in transgenic mice. these reports demonstrate that sirna treatments can be used to suppress hbv in cell cultures and animal models as well as provided insights into the application of controlling infectious human hepatitis. in this study, we applied a different approach by designing a pair of 64nt primers that contain a specific 19nt target sequence from hbv genome to create recombinant psilencer-u6 plasmid. primers were annealed and cloned into bamhi-hindiii sites of the psilencer2.1-u6 vector. in order to construct a useful tool to choose the most effective sirna molecules, we created a quick screening vector plucf by fusing the targeted sequence and the reporter luciferase gene together to produce recombinant plucf plasmid, which could express hbs-luciferase or hbx-luciferase fusion mrnas. therefore, we can initially select the suitable sirna duplexes rapidly by simply analyzing the activities of lucifearse. by using this approach, we have identified two sirna molecules (hbs 1 sirna and hbs 2 sirna) having significant impact on the hbs-luciferase fusion gene expression and one sirna duplex (hbx 2 sirna) having effects on the expression of hbx-luciferase fusion gene. this provides a quick approach to select effective sirna in the study of gene expression and function analysis. to further study the effects of selected rnai molecules on hbv gene expression and viral replication in a cell culture models, we used a derivative of the human hepg2 hepatoma cell line, hepg2.2.15, which has been stably transformed with several copies of the hbv genome and used as an in vitro model for hbv replication. the effects of dual sirna system on hbv gene expression and viral replication were studied thoroughly by the analyzing the levels of viral protein production through enzyme-linked immunosorbent assay and the levels of viral rna expression by semi-quantitated rt-pcr analysis. all results indicated that hbs 1 sirna, hbs 2 sirna, and hbx 2 sirna had significant reduction effects on viral mrna expression, and viral protein production. the fact that mutation in hbv genome may result in resistance if sirna molecules were further developed as antiviral drugs raised our concerns. our strategies to address such potential problems are to choose targets in the relatively conserved dna sequences and to generate multiple sirna molecules that can target different sites or genes on the viral genome. to test our approach, in this study we established a system that can simultaneously express two sirna duplexes from a single vector that can attack the s and x genes of hbv, respectively. results from luciferase activity assay, enzyme-linked immunosorbent assay and semiquantitated rt-pcr analysis were consistently showed that the dual sirna molecules had synergetic effects or more efficient on the targeted viral protein production and hbs and hbx gene expression comparing to that of the single sirna molecules. more importantly, dual sirna could simultaneously inhibit the expression of hbs and hbx gene by 83.7% and 87.5%, respectively. therefore, this dual sirna system could provide a more powerful tool for the study of gene function and could be used as a potential application in the treatment of viral infection. in the last 20 years, hbv infection affects millions of people each year worldwide. current therapies of hbv infection including immune modulators such as interferon alfa, or nucleoside analogs such as lamivudine have provided some degree of cures, but the efficiency of treatment was limited. as a potential therapy, sirna seems to be a hopeful alternative strategy. we believe that our approach presented in this study could be broadly used. for example, it could be used to generate more than two sirnas duplexes that could silent more genes in order to study the interactions of genes and their functions. such strategies of constructing multiple-sirna vectors can confront the evading mechanism of virus infections. obviously, this cocktail approach would be benefit to application of sirna therapy in viral infections, especially to those viruses with high mutation rate. in addition, this approach could also used to deal with two or more viruses, which are especially useful in the treatment of co-infections by two or more pathogens, such as hbv-hiv and hcv-hiv. we are in the process of testing these approaches. rna silencing of dengue virus type 2 replication in transformed c6/36 mosquito cells transcribing an inverted-repeat rna derived from the virus genome asystem for stable expression of short interfering rnas in mammalian cells long-term follow-up of hepatitis b chronic carriers who responded to interferon therapy potent and specific inhibition of human immunodeficiency virus type 1 replication by rna interference human immunodeficiency virus type 1 escapes from rna interference-mediated inhibition rotavirus gene silencing by small interfering rnas duplexes of 21-nucleotide rnas mediate rna interference in cultured mammalian cells potent and specific genetic interference by doublestranded rna in caenorbabditis elegans rna interference of influenza virus production by directly targeting mrna for degradation and indirectly inhibiting all viral rna transcription short interfering rna-directed inhibition of hepatitis b virus replication rna interference inhibition of sars-associated coronavirus infection and replication by rna interference inhibition of retroviral pathogenesis by rna interference modulation of hiv-1 replication by rna interference selective silencing of viral gene expression in hpv-positive human cervical carcinoma cells treated with sirna, a primer of rna interference global control of hepatitis b virus infection interference of hepatitis c virus rna replication by short interfering rnas lamivudine is effective in suppressing hepatitis b virus dna in chinese hepatitis b surface antigen carriers: a placebocontrolled trial expression of small interfering rnas targeted against hiv-1 rev transcripts in human cells inhibition of hepatitis b virus in mice by rna interference effective expression of small interfering rna in human cells duck hepatitis b virus(dhbv) particles produced by transient expreesion of dhbv dna in a human hepatoma cell line are infectious in vitro inhibition of hepatitis b virus expression and replication by rna interference this study was supported by the research funds from the ministry of education and wuhan university. key: cord-025634-31n5fvex authors: zhuge, shurui; ge, congcong; yang, yuting; cui, yuxia; yue, xiaomei; zhang, zhenzhen; xu, hongmei; huang, ailong; zhao, yao title: the prevalence of occult hbv infection in immunized children with hbsag-positive parents: a hospital-based analysis date: 2020-05-29 journal: hepatol int doi: 10.1007/s12072-020-10055-9 sha: doc_id: 25634 cord_uid: 31n5fvex background and object: the risk of occult hbv infection (obi) in children whose mothers are hbv carriers has received more widespread attention, but there were few reports to focus on the children with hbsag-positive parents. in this study, we aimed to investigate the prevalence of obi in immunized children with hbsag-positive parents. methods: hbv-vaccinated chinese hospitalized children with hbsag-positive parents were analyzed in our investigation. eligible subjects were tested using a standard nested pcr for all hbv genes, and analyzed by direct sequencing. results: there were 327 hbsag-negative children included in the study out of about 9800 involved hbv-vaccinated hospitalized children. the positive rate of obi was 3.1% (10/327) in the eligible children and 14.1% (46/327) with hbv dna detectable. no significant differences were found between one and at least two regions positive groups (p > 0.05). the proportions of hbv dna detectable in children with hbv father-carriers and mother-carriers were similar. the risk factors for hbv dna-positive children could be male, anti-hbs levels, and anti-hbc positive. conclusion: there are 3.1% of obis and 14.1% of suspected obi in vaccinated children with hbsag-positive parents. the potential risk of suspected obi in children with hbsag-positive father should not be ignored. anti-hbc positivity may be a useful seromarker for suspected obi screening in vaccinated children. to prevent hbv breakthrough infection, accurate and convenient method is needed to detect obi timely and exhaustively. electronic supplementary material: the online version of this article (10.1007/s12072-020-10055-9) contains supplementary material, which is available to authorized users. chronic hepatitis b virus (hbv) infection is a major global health concern. occult hbv infection (obi) is regarded as the fifth phase of the natural history of chronic hbv infection [1] , which is defined as the presence of hbv dna in the liver (either with or without detectable hbv dna in the serum) of people who test negative for hepatitis b surface shurui zhuge, congcong ge, yuting yang and yuxia cui contributed equally to this work. the online version of this article (https ://doi.org/10.1007/s1207 2-020-10055 -9) contains supplementary material, which is available to authorized users. antigen (hbsag). on the basis of the hbv antibody profile, obi distinguished as: seropositive-obi, (hepatitis b core antigen antibodies [anti-hbc] and/or hepatitis b surface antigen antibodies [anti-hbs] positive) and seronegative-obi (anti-hbc and anti-hbs negative) [2] . the amount of hbv dna in serum is usually very low (< 200 iu/ml). nowadays, the available assays for occult hbv testing is the analysis of dna extracts from liver as well as blood, and samples amplify in two subsequent rounds of pcr ("nested" pcr) or by a "real-time pcr" technique. different clinical conditions have been involved in occult hbv infection: some studies suggest that obi has the potential to reactivate and cause severe acute disease under immune suppression; transmission of the infection by blood transfusion or organ transplantation; and contribute to the development of cirrhosis, hcc [1, 3] . the majority of hbv infections in children are contracted either during perinatal period or early childhood, and individuals from hbv hyper-endemic areas may be more likely with occult hbv infections [4] . in china, hepatitis b routine immunization began in 1992 and is free for all newborn babies since 2002. the national serosurvey (carried out in 2006) showed that the prevalence of hbsag fell from 9.8 to 7.2% for people aged 1-59 years between 1992 and 2006, and the infection in children under 5 years of age is only 1.0% [5] . currently the first vaccine dose was administered within 24 h of birth and subsequent doses at 1 and 6 months, and newborns with hbsag-positive mothers were recommended to receive hepatitis b immunoglobulin (hbig) within 24 h. in recent years, occult hbv infection was presented worldwide despite immunization against hbv, and varying proportions of infants born to hbsag-positive mothers have been reported with obi [6] [7] [8] . data are scanty on the risk of obi in children with hbv-positive father. in this study, we aimed at exploring the prevalence of obi in hepatitis b-vaccinated children with hbv-positive mothers and/or fathers, trying to identify the risk factors of obi. we had taken about 2.5 years to ask hospitalized children and their parents one by one, from april 2013 to november 2015. the inclusion criteria: (1) negative for hbsag, (2) from hbsag-positive parents (mother and/or father), (3) 3-dose hepatitis b vaccination immunized after birth, (4) other factors that may get infections such as blood transfusions, (5)with other pathogen infections, e.g., hepatitis c virus (hcv) and human immunodeficiency virus (hiv). serological markers (hbsag, anti-hbs, hepatitis b e antigen [hbeag] , hepatitis b e antibody [anti-hbe], and anti-hbc) were detected using commercial chemiluminescence microparticle immuno assay (cmia) kits (abbott gmbh & co. kg, wiesbaden, germany). subjects were considered hbsag-positive at values > 0.05 iu/ml, anti-hbs-positive or seroprotected at values ≥ 10 miu/ml, hbeag-positive at values ≥ 1 s/co (sample rate/cut off rate), anti-hbe-positive at values ≤ 1 s/co, and anti-hbcpositive at values ≥ 1 s/co. viral dna was extracted from 200 µl of serum using the qiaamp dna blood mini kit (qiagen inc., germany), according to the manufacturer's instructions. all dna samples were aliquoted and kept at − 20 °c prior to amplification and sequencing. specific primers were designed to target the x and c regions of the hbv genome using primer premier 5. primers targeting the s and pre-s regions were designed by shahmoradi et al. [9] . all primers (supplement table 1 ) were synthesized by sangon biotech co., ltd (shanghai, china). the sensitivity of the pcr assay was determined by serial dilutions of serum samples containing known concentrations of the hbv genome: 1 × 10 7 , 1 × 10 6 , 1 × 10 5 , 1 × 10 4 , 1 × 10 3 , 1 × 10 2 , 1 × 10 1 , iu/ml. the limit of detection for the nested pcr assay was approximately 10 iu/ml. the pcr mix was the same for all reactions and comprised 12.5 µl of 2 × taq pcr master mix (tiagen, beijing, china), and the first and the second-round primers (10 pm). five microliters of hbv dna were used in the first round pcr, and 5 µl of the first round pcr product was used as the template for the second round. amplification was performed for 35 cycles of denaturation at 94 ℃ for 30 s, annealing at 55 ℃ for 30 s, and elongation at 72 ℃ for 1 min, followed by a final extension at 72 ℃ for 5 min. finally, 5 µl of pcr product was analyzed by electrophoresis in 1% agarose gel. precautions were taken to avoid cross-contamination during sample collection, dna extraction, pcr, and gel electrophoresis. to avoid the effect of cross-contamination on the results, negative and blank controls were included in each assay. only reproducible data from assays with "clean" negative controls were analyzed. the positive test result was repeated three times. pcr products were directly sequenced in an automated dna sequencer (abi 3730) and the data were analyzed using chromas 2.4.1 software (technelysium pty ltd., south brisbane, australia). sequences were analyzed by the blast tool of ncbi and molecular evolutionary genetics analysis (mega, version 6.0). hbv sequences from obi children were aligned and compared with genbank reference sequences (genotypes a-h). phylogenetic analysis was performed using the neighbor-joining method based on the nucleotide sequence of the amplified s, c, and pre-s region. bootstrap resampling and reconstruction were performed 1000 times to confirm the reliability of the phylogenetic analysis. genetic distances were evaluated using kimura 2-parameter corrections. the accession numbers for the reference sequences are as follows: af090842, d00330, ab033556, x65259, x75657, x69798, af160501, ay090454. all experiments were performed in accordance with relevant guidelines and regulations. two forms of informed consent were prepared, one was for parents when the child is less than 8 years, and another was to obtain both the children's and parents' informed information when the child is older than 8 years. the parents of the patients with obi were informed when their children's results were positive. statistical analyses were performed using the statistical package for social science (spss) for windows, version 20.0 (spss inc., chicago, usa). anti-hbs values ≥ 1000 miu/ ml were calculated as 1000 miu/ml. non-normal variables were expressed as median (interquartile range, iqr) and analyzed using mann-whitney u test. categorical variables were analyzed using the chi-squared (χ 2 ) test or fisher's exact test when the expected count in one cell was less than 5; yates correction was applied when appropriate. candidate variables with a p value < 0.25 on univariate analysis were included in multivariate logistic regression model. all statistical tests were two-tailed. a value of p < 0.05 was considered statistically significant. the sample selection and diagnostic workflow of tests in hepatitis b-vaccinated children were shown in fig. 1 . from april 2013 to november 2015, 9800 hospitalized children were given hbv seromarker test, and 400 hbv-vaccinated children whose mother, father, or both were hbsag-positive met. there are 21 children with blood transfusion were excluded, and 49 children could not involve in the research due to the rejection of their parents. finally, a total of 327 hbsag-negative children were involved in the study. within the 327 samples, there were 52.60% of children with hbsag-positive mothers, 44.95% with hbsagpositive fathers, and 2.45% with parents-carriers. all of these children received three doses of hepatitis b vaccine as planned and most (70.03%) received full prophylactic coverage (vaccine plus hbig). hbv seromarkers were identified in the children, and positive rate was 74.62% (244/351) in anti-hbs (≥ 10 miu/ml), 7.12% (25/351) in anti-hbc (s/co ≥ 1), and 0.85% (7/351) in anti-hbe (s/ co ≤ 1), respectively. all 327 samples were analyzed to determine the existence of hbv dna by nested pcr, and hbv dna was detected in 46 [14.1%; 95% confidence interval (ci) 10.3-17.9%] children ( fig. 1, table 1 ); using nested pcr, 20 (43.5%; 95% ci: 28.6-58.4%), 23 (50.0%; 95% ci 35.0-65.0%), and 16 (34.8%; 95% ci 20.5-49.1%) children were found positive for surface, core/pre-core, and pre-s regions (supplement fig. 1 ), none of sample amplified positive for hbv complete genome and x region. overall, three (6.5%) samples were positive for three regions, seven (15.2%) samples were positive for two regions, 36 (78.3%) were positive for one region ( table 2) . the nested pcr amplification products of hbv s, and c, pre-s gene fragments in the 46 serum samples were successfully sequenced. all sequence information had been retrieved on national center for biotechnology information (ncbi), and accession numbers were from mg738731 to mg738789. different fragments of sequence information were used to construct the phylogenetic tree separately, and compared with standard sequences of hbv genotypes a-h (supplement fig. 2 ). there were 22 (47.8%) genotype b and 24 (52.2%) genotype c. samples with sufficient blood were quantified for hbv-dna using commercially real-time pcr-based detection kit, and mutation analysis at amino acid levels with the s, c, pre-s gene sequencing information was done. one 'a' determinant (amino acids 124-147) variant m133l was detected in isolate p77, which was associated with vaccine escape. p77 harbored an 'a' determinant variant and with a high level of hbv dna (11,800 miu/ml) was categorized as "false" obi. demographic, epidemiological data, serological markers, and parent-carrier status identification within the 46 children were shown in table 2 , 87.0% (40/46) in anti-hbs positive, 13.0% (6/46) in anti-hbc positive, and no children were anti-hbc positive alone. comparison was done between one region positive group (n = 10) and ≥ two regions positive group (n = 36) detected by nested pcr, and no significant differences were found including age, gender, hbig usage, anti-hbs titer, positive rate of alt, ast and anti-hbc, maternal and paternal factors in those children ( forty-six [14.10% (95% ci 10.3-17.9%)] hbsag-negative children were detected hbv dna positive by nested pcr, which were confirmed through sequencing analysis. there were 5 (5/9, 55.6%), 15 (15/35, 42 .9%), and 20 (20/44, 45 .5%) children with hbv carrier fathers detected ≥ two regions positive, one region positive, and ≥ one region positive by nested pcr, respectively (fig. 2) . the proportions of hbv dna detectable in children with hbv father-carriers and mother-carriers were similar, and no statistical difference were found (p > 0.05). for hbv dna detectable children, 20 (13.6%, 95% ci 8.0-19.2%), 24 (14.0%, 95% ci 8.7-19.2%) were found with hbv father-carriers, mother-carriers. univariate statistical analysis was done between the hbv dna detectable and undetectable children, and no statistically significant difference was found in the basic characteristics (gender, age, hbig usage, serum anti-hbc, ast, alt, maternal and paternal factors) (p > 0.05), except for anti-hbs titer. (supplement table 2 ). . 1 the diagnostic workflow of tests in hbsag-negative children. serum samples were obtained from 327 hbsagnegative children whose mother, father, or both were hbsagpositive. children not accord with the criteria were excluded. the remaining samples were examined by nested pcr to identify the risk factors that may affect hbv dnapositive children, variables were explored with multivariate logistic regression model, and the dependent variable being the weighted in the hbv dna detectable children. independent variables included age, gender, anti-hbs, anti-hbc (variables for inclusion were carefully chosen, to ensure parsimony of the final model). results showed that male [odds ratio (or) 4.24], anti-hbs titer (or 3.67), and anti-hbc-positive (or 4.81) had higher risk with hbv dna detectable than females (p < 0.05) ( table 4 ). firstly, identified in the 1970s, more and more evidence has suggested that the clinical significance of obi, which has become a major health issue attracting much attention. in recent years, variable proportions of obi had been reported in immunized children with hbv-positive mothers. to our acknowledgement, this is the first study to explore the prevalence of obi among hepatitis b vaccinated children with hbsag-positive parents lived in hbv highly endemic areas. in this study, results of nested pcr amplification show 14.10% (46/327; 95% ci 10.3-17.9%) of hbsag-negative children with ≥ one gene fragment positive. detection ≥ two regions of hbv genome by nested pcr is considered as the standard for hbv infection, only ten children (3.1%) would be considered as having obi if definition is followed. recently, the results of the quantitative rt-pcr for severe acute respiratory syndrome coronavirus 2 (sars-cov-2) nucleic acid show that 87.5% of patients were finally defined as sars-cov-2 positive, in whom originally had only one positive target [10] . thus, to examine the possibility of whether one hbv gene fragment detectable could indicate the existing occult hbv infection, we did the following analysis. first, there were 36 (11.0%; 95% ci 7.6-14.4%) and 10 (3.10%; 95% ci 1.2-4.9%) patients tested positive for one and ≥ two hbv gene fragments with strict quality control during the experiment, and no statistical differences were found between the two groups. second, results of previous studies had found that one hepatitis b fragment positive also could indicate occult hbv infection: jazayeri et al. detected hbv dna in 28% (21/75) children by real-time pcr quantitatively, while some of the samples only amplified one segment [9] ; for other researches amplified one hbv fragment with the samples, and the positive amplicons were confirmed from hbv genome by sequencing analysis [11, 12] . the sensitivity of nested-pcr assays may not be consistent, and thus there could be 14.1% of suspected obis in children with hbsag-positive parents. the risk of suspected obi in children with hbsag-positive parents should not be ignored. considering the significant reservoir of hbv infections, the status of hbv infection in many countries is still not optimistic. relatively high prevalence of obi was found previously, range from 7.7 to 28% [6, 9, 13] . in china, hbv infection is still a severe public health burden with 97 million hbv carriers, and 14.1% of suspected obi may exist in immunized children with hbsag-positive parents. obi may be involved in different clinical contexts, the development of cirrhosis and hepatocellular carcinoma [1] . therefore, it could be important to have long term follow-up in children after uncovering obi despite vaccination to prevent chronic complication in adulthood. there is an equal potential risk of occult hbv infection in children with the hbsag-positive father and mother. the positive rate of suspected obi in father carriers was equal to mother carriers (13.6% vs. 14.0%), and 25% in both parents were hbv carriers. in china, it has been reported that 23.2% of hbsag-positive families contained more than two hbv carriers [14] . the pattern of father-to-child transmission may not be ignored [15] [16] [17] [18] . it is not uncommon that hbv integration was detected in pbmcs and cellular genes in hcc cases [19, 20] . hbv dna integrates into the paternal dna and causes the neonatal be infected through the sperm is possible. many independent factors had been analyzed between the suspected obi positive and negative children in the study. similar to hbv highly endemic areas, obi in children living in hbv low prevalence regions are also more common than "overt" hbv infection, and the risk of obi could be closely related to the parents' infection status [21, 22] . results in previous study conducted in hbv low prevalence regions have shown that the risk factors for obi could include whether to get hepatitis b vaccine, the genotype of hbv, while none of those found significant difference in this study [21] . the titer of anti-hbs was higher in the suspected obipositive than obi-negative (p < 0.05). the escape mutations in hbv s gene needs to take attention [7, 9, 13, 23] . hbcag is the most immunogenic hbv component during infection [24] . in recent years, some researches have suggested that anti-hbc was a very useful marker for obi screening in hbsag-negative subjects [25] [26] [27] . the risk of suspected obi in anti-hbc-positive children may need to pay more attention, while it has to be stressed that not all anti-hbc positive individuals are found to be hbv dna positive (anti-hbc negative also does not exclude obi), and that anti-hbc tests may provide false-positive results. there are some limitations exist in the study. first, this study is related to the hospital-based study design and children who are hospitalized may not represent children in the general population. anyway, we had tried to avoid other factors that might get infections such as blood transfusions. second, exploring the risk of obi with one region positive and sequence analysis may be insufficient in this study, while it may be the more convenient and accurate method for suspected obi detection. three, in this study, although the transmission of hbv was mainly from parental carriers, the influence of other persons could not exclude, e.g., family members other than parents. nevertheless, most chinese children live with their parents and vertical transmission is the main way in asian areas [28] . thus, the children in this study with occult hbv infection were more likely from parent-to-child transmission. in conclusion, a relatively high prevalence of suspected obi may exist in hepatitis b-vaccinated chinese children with hbsag-positive parents, and the importance of monitoring obi should be taken into account, especially for hbv hypo-endemic areas. paternal factors should not be ignored with an equal potential risk of suspected obi in children with hbsag-positive father and (or) mother. anti-hbc seropositivity may be a useful marker for suspected obi screening in vaccinated children. diagnosis of obi with one hbv region amplifying positive using nested pcr may be reliable. to prevent hbv breakthrough infection, accurate and convenient method is needed to detect obi timely and exhaustively. the clinical significance of occult hbv infection statements from the taormina expert meeting on occult hepatitis b virus infection association between occult hepatitis b infection and the risk of hepatocellular carcinoma: a metaanalysis occult hepatitis b epidemiological serosurvey of hepatitis b in china-declining hbv prevalence due to hepatitis b vaccination occult hbv infection in immunized neonates born to hbsag-positive mothers: a prospective and follow-up study occult hepatitis b virus infection in anti-hbs-positive infants born to hbsag-positive mothers in china occult hepatitis b virus infection in children born to hbsag-positive mothers after neonatal passive-active immunoprophylaxis high prevalence of occult hepatitis b virus infection in children born to hbsagpositive mothers despite prophylaxis with hepatitis b vaccination and hbig epidemiological and clinical features of the 2019 novel coronavirus outbreak in china occult hbv infection status among chronic hepatitis c and hemodialysis patients in northeastern egypt: regional and national overview characterization of occult hepatitis b virus infection among hiv positive patients in cameroon occult hepatitis b virus infection in hepatitis b vaccinated children in taiwan the global burden of liver disease: the major impact of china hepatitis b virus infection among children born in the united states to southeast asian refugees the analysis of s gene phylogenetic tree of hbv in transmission from father to infant molecular evidence of father-to-child transmission of hepatitis b virus hepatitis b virus infections in families in which the mothers are negative but the fathers are positive for hbsag detection and sequence analysis of hepatitis b virus integration in peripheral blood mononuclear cells large scaled analysis of hepatitis b virus (hbv) dna integration in hbv related hepatocellular carcinomas high prevalence of occult hepatitis b virus genotype h infection among children with clinical hepatitis in west mexico risk factors associated with horizontal transmission of hepatitis b viral infection from parents to children in mexico impact of hepatitis b virus surface protein mutations on the diagnosis of occult hepatitis b virus infection the nucleocapsid of hepatitis b virus is both a t-cell-independent and a t-cell-dependent antigen universal infant immunization and occult hepatitis b virus infection in children and adolescents: a population-based study transmission of hepatitis b by transplantation of livers from donors positive for antibody to hepatitis b core antigen hepatitis b reactivation in occult viral carriers undergoing hematopoietic stem cell transplantation: a prospective study natural history of chronic hepatitis b in euro-mediterranean and african countries acknowledgements we wish to thank yu shi for sample collection and junjie tan for assisting with the quantification of hbv. we also thank professor xiaodong zhao for helpful discussion. conflict of interest shurui zhuge, congcong ge, yuting yang, yuxia cui, xiaomei yue, zhenzhen zhang, hongmei xu, ailong huang, yao zhao declare no competing interests.ethical approval all procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional and/or national research committee and with the 1964 helsinki declaration and its later amendments or comparable ethical standards. all included subjects gave informed consent for their participation in the study, and we checked hbv infection of the mothers and/or fathers again. the study was approved by the ethics committee of the children's hospital of chongqing medical university.informed consent informed consent was obtained from all individual participants included in the study. all authors reviewed and approved the final version of the manuscript. key: cord-258665-8q3tsggm authors: aydın, hakan berk; cheema, jamal ahmed; ammanath, gopal; toklucu, cihan; yucel, muge; özenler, sezer; palaniappan, alagappan; liedberg, bo; yildiz, umit hakan title: pixelated colorimetric nucleic acid assay date: 2020-03-01 journal: talanta doi: 10.1016/j.talanta.2019.120581 sha: doc_id: 258665 cord_uid: 8q3tsggm abstract conjugated polyelectrolytes (cpes) have been widely used as reporters in colorimetric assays targeting nucleic acids. cpes provide naked eye detection possibility by their superior optical properties however, as concentration of target analytes decrease, trace amounts of nucleic acid typically yield colorimetric responses that are not readily perceivable by naked eye. herein, we report a pixelated analysis approach for correlating colorimetric responses of cpe with nucleic acid concentrations down to 1 nm, in plasma samples, utilizing a smart phone with an algorithm that can perform analytical testing and data processing. the detection strategy employed relies on conformational transitions between single stranded nucleic acid-cationic cpe duplexes and double stranded nucleic acid-cpe triplexes that yield distinct colorimetric responses for enabling naked eye detection of nucleic acids. cationic poly[n,n,n-triethyl-3-((4-methylthiophen-3-yl)oxy)propan-1-aminium bromide] is utilized as the cpe reporter deposited on a polyvinylidene fluoride (pvdf) membrane for nucleic acid assay. a smart phone application is developed to capture and digitize the colorimetric response of the individual pixels of the digital images of cpe on the pvdf membrane, followed by an analysis using the algorithm. the proposed pixelated approach enables precise quantification of nucleic acid assay concentrations, thereby eliminating the margin of error involved in conventional methodologies adopted for interpretation of colorimetric responses, for instance, rgb analysis. the obtained results illustrate that a ubiquitous smart phone could be utilized for point of care colorimetric nucleic acids assays in complex matrices without requiring sophisticated software or instrumentation. bio-sensors play an essential role in medical diagnostics, environmental monitoring and food safety analysis [1, 2] . nucleic acid assays are key targets in biosensing that enables viral load monitoring and disease diagnosis [3, 4] . conventional assays such as polymerase chain reaction (pcr), phenol-chloroform extraction and electrophoresis are reliable, but requires laboratory techniques that are time consuming [5] . rapid disease diagnostic tests are however required for monitoring infections such as hepatitis, dengue, etc. [6] [7] [8] [9] furthermore, developing countries often lack infrastructure as well as properly trained personnel to provide accurate diagnosis [10, 11] . recently, the concept of "lab on paper" has generated significant interest for nucleic acid assaying due to its ease of use and cost effectiveness, especially for applications in resource limited settings [12] [13] [14] [15] [16] [17] . conjugated polyelectrolytes such as cationic polythiophene have been explored for biosensing applications due to its unique optical and electronic properties [18, 19] . the colorimetric response of cpe relies on conformational alternations in the backbone of the polymer [20, 21] . the conformational transitions are usually followed by changes in fluorescence intensity and the extent of the conformational alternations in backbone depend on the energy required for interring twisting. xia et al. [22] . suggested a strategy for colorimetric detection of dna, protein and small molecules by incorporating water-soluble conjugated polyelectrolyte and gold nanoparticle with the target molecules. although the target analytes could be colorimetrically ascertained for subnm concentrations, assaying in solution state is tedious and yields optimal responses only in a controlled laboratory condition [22] . therefore, polythiophene-mirna complexation on a paper-based platform for detection of mir21 sequence was first evaluated by yildiz et al. [23] . the complementary peptide nucleic acid (pna) sequence to mir21 was deposited on the cpe impregnated pvdf paper. naked eye perceivable colorimetric responses were obtained at clinically relevant concentration ranges upon addition of mir21 in buffer solutions [23] . in a subsequent study, the colorimetric responses were evaluated by an image processing software that enabled quantification of nucleic acids in plasma samples [24] . other reports for detection of oligonucleotide which are related to middle east respiratory syndrome coronavirus (mers-cov), mycobacterium tuberculosis (mtb) and human papillomavirus (hpv) also indicate the potential applications for paper based sensors [25] . however, most of the current paper-based assays are dependent on either naked eye interpretation of colorimetric responses or an image processing software for analysis, which may introduce artefacts thereby inhibiting accurate quantification of colorimetric responses. furthermore, conventional image processing software requires a server or a computer as well as several intermediate data transfer steps for diagnosis [26, 27] . recently, smart phone based detection methodologies have attracted significant attention [28] [29] [30] [31] . herein, we propose a smart phone application algorithm that evaluates the colorimetric responses based on a pixel level analysis approach, enabling quantification of nucleic acids with high precision at clinically relevant concentration ranges. the algorithm analyzes color differences and retrieves the color profiles of the pixels of the sample droplet pattern of the cpe on pvdf membrane for reliable and sensitive interpretation of colorimetric responses. the cpe employed herein is cationic poly [n,n,n-triethyl-3-((4-methylthiophen-3-yl)oxy)propan-1-aminium bromide], referred to as pt. pt as an active layer on pvdf membrane incorporated within a cartridge (scheme 1) generates two distinct optical signals with a color transition from orange to pink/grey, in case of hbv dna-pt duplex formation or intact orange color in case of hbv dna-pna-pt triplex formation (pna, complementary to target hepatitis b viral dna is used as a model system). hence, the orange color (hbv dna-pna-pt) and the significantly different pink/grey color (pna-pt) enables colorimetric or naked eye detection of target hbv dna. however, trace amounts of nucleic acids often yield weak colorimetric responses that are not perceivable by naked eye indicating the requirement of additional image processing protocols. in this study, an algorithm has been developed for precise interpretation of colorimetric response of pt on pvdf membranes. experimental results suggest that the developed algorithm enables reliable determination of colorimetric responses that are not readily perceivable by the naked eye nor by conventional rgb analysis. the smart phone application based on the described algorithm has been developed and validated for the detection of hbv dna. the algorithm could be installed in an application format on any smartphone with a camera for capture and analysis of colorimetric responses, and for enabling point of care nucleic acids assays in complex matrices. furthermore, the proposed cartridge-based assay and smart phone application offer great potential for rapid and point of care screening of infectious diseases. pt was synthesized as described elsewhere [23] . all the chemicals for pt synthesis were purchased from sigma-aldrich and used without further purification. deionized (di) milliq water (resistivity of 18 mω cm) was used for buffer preparation and pt synthesis. the following hbv dna and pna sequences were purchased from idt and panagene, respectively. hbv pvdf filter centrifugal columns were purchased from merck millipore. sony xperia x compact (android 7.1.1 nougat, chipset: qualcomm msm8956 snapdragon 650, cpu: hexa-core (4 × 1.4 ghz cortex-a53 & 2 × 1.8 ghz cortex-a72), gpu: adreno 510, ram: 3gb) camera was utilized for capturing digital images of the samples. the uv chamber and cartridges were fabricated by using 2 mm thick black poly (methylmethacrylate) panels that were laser cut by epilog laser cutter. the pvdf membranes were then mounted on top of the cartridge and stored at 4°c. human plasma was obtained from genetex, taiwan. pt was coated onto pvdf centrifugal tubes by adding 200 μl of varying concentrations of pt. tubes were centrifuged at 8000 rpm for 3 min. the filtrate was again added to the tube and centrifuged to obtain a homogeneous deposition of pt on pvdf membrane. this process was repeated several times to optimize pt coating on pvdf membrane based on the fluorescence intensities. subsequently, the deposited films were washed 5 times with di water by centrifuging at 8000 rpm for 3 min 2 μl of hbv dna at varying concentrations in plasma samples were then dropped on pt incorporated pvdf membrane to serve as control spots. pvdf membranes with 2 μl of prehybridized hbv dna and pna was also prepared as a reference sample to serve as sample spots. as illustrated in scheme 1, the sample is dropped on to the center of control and sample spots of the pmma cartridge and placed in the uv chamber prior mounting the smart phone. the developed smartphone application named biorgb is then activated for recording the images for pixelated analysis. all the images are captured by a digital camera with a resolution of 2000 × 2000 pixels. scheme 1 illustrates the proposed detection methodology, utilizing a smart phone attached to a uv-led chamber and a cartridge consisting of pmma cover and pt impregnated pvdf membrane. the cartridge has three spots: reference spot, control spot, (hbv dna) and sample spot (hbv dna + pna). an optical transition occurs upon dropping the sample on the cartridge, and then it is subsequently quantified by mobile application. unlike previous report that utilize an image processing software, for instance imagej software, to quantify optical transition of pt at nm concentration levels of nucleic acids based on selected regions of interest, the proposed mobile application scans the individual pixels of the sample droplet pattern. the pixelated analysis of droplet pattern yields high statistical precision to set up corroborating correlation between control and sample spots. analysis of individual pixels is of utmost importance in colorimetric assaying as the color transitions are usually weak at low analyte concentrations. the process of color analysis by the smart phone application is illustrated in fig. 1a . the application is designed to run on a three-step operation modes. in the first step, the algorithm locates the vertical centroid of the digital image via analysis of rgb components of individual pixels along the vertical direction. a horizontal red line along the vertical centroid is illustrated in fig. 1a fig. 1a , are recorded for the pixels corresponding to the pt deposited on pvdf membrane. upon recoding rgb color codes of all the pixels along the vertical centroid, the algorithm records additional nine sets of horizontal axis pixel color codes, that correspond to four pixels above and five pixels below the vertical centroid in order to ascertain the colorimetric responses. the algorithm then constructs a 10 × 2000 matrix to determine red, green blue component of all the individual pixels along the scanning direction (detailed description of image processing is provided in the supporting information; fig. s1 (a)-(e)). finally, the algorithm executes an averaging operation to yield a pixelated color code that is displayed at the user interface in form of a bar chart. in order to test the microstain recognition performance of the smart phone application, 4x4 pixel microstain has been created artificially on the image shown in fig. 1b (25x magnification is shown in fig. 1c) . rgb color codes were found to be as [221, 165, 79] on microstain region while it was [250, 187, 90] on the rest of the image. as shown in fig. 1c , the red intensity profile centered at 250 drops significantly to 220 for the microstain region, assuring that the microstain with a slight color difference with respect to the background can be recognized by the smart phone application. the next validation experiments for the smart phone applications was conducted by creating an artificial droplet pattern as shown in fig. 1d . the red, green and blue intensity profiles of the artificial droplet pattern exhibit two symmetrical minima corresponding to the outer and inner edges of the rim of the droplet pattern. these results show that the smart phone application is capable of recognition of both microstains and droplet patterns and might be subsequently utilized for colorimetric analysis of pt droplets on pvdf membranes. the red component exhibits the steepest change as compared to blue and green since the optical transition of pt is in the range of 500-600 nm. the algorithm is therefore set to utilize the red components for analysis and quantification of nucleic acids. in next step, we conducted experiments by using hbv dna to validate smart phone application for pixelated nucleic acid assay. fig. 2a shows a typical image analysis of reference, control, and sample spots (from left to right) in which hbv dna concentration is 1 μμ. the red intensity of control spot (pt + hbv dna), is substantially lower than reference (pt) and sample (pt + hbv dna + pna) spots, indicating significant quenching of pt by hbv dna at a concentration of 1 μμ. the red intensity variation of control spot from 240 (pt) to 160 (pt + hbv dna), as evaluated by the algorithm, concurs with the dark red color of the droplet profile observed from the corresponding digital images. however, at lower hbv dna concentrations shown in fig. 2b , naked eye interpretation of colorimetric response of the control spots may not be readily feasible. therefore, in order to maximize the colorimetric responses, the stoichiometric ratio of pt with respect to hbv dna concentration to be evaluated (pt concentration on pvdf) and the homogeneity of pt on pvdf membrane is optimized by adopting a multi-coating approach. fig. 2b shows the images of 5, 6, 7 and 8 times pt centrifuged pvdf membranes with varying concentration of hbv dna between 0 and 50 nm. the red intensity profile of 5 and 6 times pt centrifuged pvdf membranes changes from 189 to 182 and 188 to 186, respectively, upon consecutive addition of hbv dna, whereas 7 and 8 times pt centrifuged pvdf membrane yield significantly larger changes in red intensity with increasing hbv dna concentrations, from 189 to 154 and 188 to 155, respectively. fig. 2c illustrates that there is no significant difference in red intensity changes upon addition of hbv dna between 7 and 8 times pt centrifuged pvdf membrane. fig. 2d scheme 1. schematic illustration of cartridge and smart phone-assisted nucleic acid assay. step 1 illustrates the assembly of plastic cartridge consisting of three layers; step 2 shows the transfer of hbv dna sample to the cartridge and step 3 shows the mounting cartridge on the uv-led chamber that serves as an accessory for mounting the smart phone. step 4 illustrates the smart-phone assisted biorgb analysis yielding bar graphs that represents the pixelated (and averaged) red intensities of the three sample spots. indicates that the total color response or hue of 5 and 6 times pt deposited pvdf membrane is lower than 7 and 8 times pt centrifuged pvdf membrane, further ascertaining that there is no substantial difference in colorimetric response upon hbv dna addition between 7 and 8 times pt centrifuged pvdf membrane. therefore, 7 times pt centrifuged pvdf membranes are utilized for the proposed pixelated nucleic acid assay. fig. 3a shows the biorgb output of the 7 times pt centrifuged pvdf membranes in the form of bar graphs that correspond to averaged red intensities of the individual pixels of the digital images of the membranes. as for sample and control membrane, the algorithm is set to yield a color code of 10 × 1000 pixels (starting from the edge of the droplet pattern, fig. s1 (e) , as a droplet of sample typically spreads to over 1000 pixel diameter area). the algorithm eventually displays the averaged values of 500 pixels along the horizontal axis as 20 bar graphs for visual interpretation of colorimetric responses, as illustrated in fig. 3a. δ red values (fig. 3b shows the illustration of algebraic derivation of color matrix for obtaining δ red values by subtracting rgb color codes of control from that of sample) increases with hbv dna concentration providing a linear correlation between hbv dna concentration and δ red values. fig. 3c illustrates the residual plots that show a δ red scattering of less than 1% over the concentration range of interest. the residual plot ascertains that biorgb application is reproducible, with responses varying within 1% for the 1 nm to 1 μm concentration range of hbv dna. the calibration curve illustrated in fig. 3d , obtained from the average δ red values of corresponding concentrations shown in fig. 3a , indicates good linearity within the concentration ranges of interest. the final validation of proposed methodology was conducted using the hbv dna spiked into plasma. fig. 4a illustrates that the digital image does not reveal a definite droplet shaped pattern for membrane upon addition of hbv dna, and that visual identification of hbv dna is not feasible for lower concentrations (around 1 nm). however, biorgb analysis yields distinguishable δ red signals for 1, 10, 100 and 1000 nm as 10, 25, 50 and 60, respectively (fig. 4b , difference between control and sample). it is to be noted that the algorithm analyzes the response from all the individual pixels rather than by the averaging regions of interest, an approach adopted by typical image analysis software. as concentration increases from 1 nm to 1 μm, the color saturation and darkening occurs, and therefore the control spot (hbv dna) and sample spot (hbv dna + pna) are distinguishable by biorgb. as shown in the residual plot in fig. 4c , the scattering of δ red values are 2.5%, which is larger than for the responses obtained in di. the major reason of the increase in scattering may due to increase in refractive index (turbidity) in plasma samples. however, the scattering observed in plasma samples does not deteriorate the data-driven decision of biorgb. fig. 4b illustrates that the proposed biorgb smartphone application possesses a scattering of less than 2.5% (reproducibility of over 97.5%) within the hbv dna concentration range of 1 nm to 1 μm. in the next step control experiments have been performed. the first control experiment perfomed with dna1 (dna1: 5' -ttt ata gaa gta gtg gta cc-3′ non complementary sequence to pna) shows that the responses of dna1-pna are much lower than hbv dna-pna (see s2 ). this result demonstrates that pna is specific to hbv dna sequence. the interference experiment has performed in the co-existence of target hbv dna sequence and dna1. the result shown in s3 reveals that the non-complementary dna1 does not associating complementary pna as compared to target hbv dna and the effect of noncomplementary dna1 on red intensity value is marginal. the response of the proposed assay to longer dna sequence (dna 31 = 31 base pairs) has been also tested since the real samples may contain longer sequence. the result shown in fig. s4 demonstrated that red intensity for hbv dna (shorter sequence) and dna 31-pna 31 (longer sequence) are nearly identical and this assures the proposed assay is applicable for the longer dna sequences as well. the colorimetric responses shown in fig. 4a are then analyzed by imagej software in order to validate the biorgb analysis. rgb analysis yielded red intensity variations of 15, 25, 45 and 65 for 1, 10, 100 and 1000 nm of dna, respectively, which are comparable to those obtained using biorgb. however, these values tend to vary depending on the regions of interest that are subjective to human judgement. furthermore, scattering intensities in rgb based colorimetric analysis are prone to be higher owing to manual section of pixels (as observed from fig. s5 , for concentration of 10 nm and higher), which compromises the overall sensitivity and robustness of the assay. in contrary, the proposed methodology eliminates the error involved in defining the regions of interest for image analysis approach and also yields a sensitive approach for analyzing colorimetric responses. a cartridge-based point of care assay for colorimetric detection of nucleic acids has been developed using a smart phone algorithm. the sensor approach is ideal for use in resource limited settings, where colorimetric response can be captured and interpreted using a simple smartphone. the smartphone application is capable of capturing and digitizing the colorimetric responses followed by an analysis of the individual pixels using an in-built algorithm. the proposed pixelated approach yields quantitative dna concentration read outs, thereby eliminating the margin of error involved in conventional methodologies adopted for interpretation of colorimetric responses. the developed algorithm can be installed in an application format in any smartphone with a camera, for capture and analysis of colorimetric responses, enabling point of care nucleic acids assays in complex matrices. the obtained results illustrate that a ubiquitous smartphone can be utilized for colorimetric nucleic acids assays in complex matrices via the developed application that perform point of care without requiring sophisticated software nor instrumentation. successful detection of hbv dna was demonstrated in plasma, mimicking clinical samples, with a detection limit of 1 nm. the recent hbv detection methodologies in table 1 demonstrate a comparison between present study and others. the major advantage of our method appears as instrument-free detection at nm to μm., our strategy can be expanded for detection of other nucleic acid sequences of interest by incorporating appropriate complementary pna probes on the cartridges. overall, the proposed methodology significantly accelerates diagnosis at near patient location within seconds making them facile, inexpensive and ideal for applications in point of care diagnosis. the manuscript describes a smart phone based methodology for point-of-care nucleic acid assay without laborious lab settings. the methodology suggested here is suitable for cost-effective, rapid and facile screening of infectious diseases at clinical levels. the authors declare no conflict of interest. biosensors and their applications -a review critical overview on the application of sensors and biosensors for clinical analysis advances in biosensing strategies for hiv-1 detection, diagnosis, and therapeutic monitoring biosensor for dengue virus detection: sensitive, rapid, and serotype specific paperbased sample-to-answer molecular diagnostic platform for point-of-care diagnostics advances and challenges in biosensorbased diagnosis of infectious diseases diagnosing dengue virus infection: rapid tests and the role of micro/nanotechnologies recent advances in micro/nanotechnologies for global control of hepatitis b infection point-of-care nucleic acid testing for infectious diseases diagnostics for developing countries nucleic acid testing-benefits and constraints 3d capillary-driven paper-based sequential microfluidic device for electrochemical sensing applications diagnostics for the developing world: microfluidic paper-based analytical devices equipment-free detection of k+ on microfluidic paper-based analytical devices based on exhaustive replacement with ionic dye in ion-selective capillary sensors a fully disposable and integrated paper-based device for nucleic acid extraction, amplification and detection single-step recombinase polymerase amplification assay based on a paper chip for simultaneous detection of multiple foodborne pathogens ultrasensitive paper based nucleic acid detection realized by three-dimensional dna-aunps network amplification conjugated polyelectrolytes: synthesis, photophysics, and applications optical detection of dna and proteins with cationic polythiophenes recent advances in fluorescent and colorimetric conjugated polymer-based biosensors twisting of conjugated oligomers and polymers: case study of oligo-and polythiophene colorimetric detection of dna, small molecules, proteins, and ions using unmodified gold nanoparticles and conjugated polyelectrolytes naked eye detection of lung cancer associated mirna by paper based biosensing platform tailoring conformation-induced chromism of polythiophene copolymers for nucleic acid assay at resource limited settings multiplex paper-based colorimetric dna sensor using pyrrolidinyl peptide nucleic acid-induced agnps aggregation for detecting mers-cov, mtb, and hpv oligonucleotides flow-through colorimetric assay for detection of nucleic acids in plasma luminescent device for the detection of oxidative stress biomarkers in artificial urine smart phone assisted detection and quantification of cyanide in drinking water by paper based sensing platform smartphone instrument for portable enzymelinked immunosorbent assays smartphone spectrometer for colorimetric biosensing smartphone-based food diagnostic technologies: a review detection of hepatitis b virus dna with a paper electrochemical sensor flow-through colorimetric assay for detection of nucleic acids in plasma clinical evaluation of micro-scale chip-based pcr system for rapid detection of hepatitis b virus ultrasensitive paper based nucleic acid detection realized by three-dimensional dna-aunps network amplification hepatitis b plasmonic biosensor for the analysis of clinical serum samples colorimetric detection of hepatitis b virus (hbv) dna based on dna-templated copper nanoclusters gold aggregating gold: a novel nanoparticle biosensor approach for the direct quantification of hepatitis c virus rna in clinical samples this work has been supported by the the scientific and technological research council of turkey tubi̇tak project no:116z547. authors hba, sö, my, and uhy also acknowledge to material research center iyte-mam for imaging facility services. authors sö, my are yök 100/2000 scholarship holders. this research was also supported by the nithm interdisciplinary diabetes and metabolic diseases grant (2016), nanyang technological university, singapore. supplementary data to this article can be found online at https:// doi.org/10.1016/j.talanta.2019.120581. key: cord-275104-imqmyqhz authors: fioravanti, jessica; di lucia, pietro; magini, diletta; moalli, federica; boni, carolina; benechet, alexandre pierre; fumagalli, valeria; inverso, donato; vecchi, andrea; fiocchi, amleto; wieland, stefan; purcell, robert; ferrari, carlo; chisari, francis v.; guidotti, luca g.; iannacone, matteo title: effector cd8+ t cell-derived interleukin-10 enhances acute liver immunopathology date: 2017-09-30 journal: journal of hepatology doi: 10.1016/j.jhep.2017.04.020 sha: doc_id: 275104 cord_uid: imqmyqhz background & aims besides secreting pro-inflammatory cytokines, chemokines and effector molecules, effector cd8+ t cells that arise upon acute infection with certain viruses have been shown to produce the regulatory cytokine interleukin (il)-10 and, therefore, contain immunopathology. whether the same occurs during acute hepatitis b virus (hbv) infection and role that il-10 might play in liver disease is currently unknown. methods mouse models of acute hbv pathogenesis, as well as chimpanzees and patients acutely infected with hbv, were used to analyse the role of cd8+ t cell-derived il-10 in liver immunopathology. results mouse hbv-specific effector cd8+ t cells produce significant amounts of il-10 upon in vivo antigen encounter. this is corroborated by longitudinal data in a chimpanzee acutely infected with hbv, where serum il-10 was readily detectable and correlated with intrahepatic cd8+ t cell infiltration and liver disease severity. unexpectedly, mouse and human cd8+ t cell-derived il-10 was found to act in an autocrine/paracrine fashion to enhance il-2 responsiveness, thus preventing antigen-induced hbv-specific effector cd8+ t cell apoptosis. accordingly, the use of mouse models of hbv pathogenesis revealed that the il-10 produced by effector cd8+ t cells promoted their own intrahepatic survival and, thus supported, rather than suppressed liver immunopathology. conclusion effector cd8+ t cell-derived il-10 enhances acute liver immunopathology. altogether, these results extend our understanding of the celland tissue-specific role that il-10 exerts in immune regulation. lay summary: interleukin-10 is mostly regarded as an immunosuppressive cytokine. we show here that hbv-specific cd8+ t cells produce il-10 upon antigen recognition and that this cytokine enhances cd8+ t cell survival. as such, il-10 paradoxically promotes rather than suppresses liver disease. it is widely recognized that hepatitis b virus (hbv) replicates non-cytopathically in the hepatocyte. most of the clinical complications related to this infection is reflected in the adaptive immune response, particularly the virus-specific effector cd8 + t cell response. [1] [2] [3] [4] [5] indeed, by killing infected cells and secreting antiviral cytokines, effector cd8 + t cells (cd8 t e ) reaching the infection sites are major contributors to viral clearance as well as tissue immunopathology. [1] [2] [3] [4] [5] paradoxically, during some acute viral infections (e.g. those caused by influenza virus, respiratory syncytial virus, coronavirus and vaccinia virus), cd8 t e have been shown to produce the regulatory cytokine interleukin (il)-10, [6] [7] [8] [9] [10] [11] in addition to pro-inflammatory cytokines, chemokines and effector molecules. cd8 t e -derived il-10 is generally thought to limit tissue damage, 6, 7, 11 however the net effect induced by this cytokine might depend on the pathophysiological context. 12 whether hbv-specific cd8 t e produce il-10 upon hepatocellular antigen (ag) recognition and the role that this cytokine plays in liver immunopathology are currently unknown. we show here that serum il-10 is readily detectable in an acutely hbv-infected adult chimpanzee in a manner that coincides with intrahepatic cd8 + t cell infiltration. using mouse models of acute hbv pathogenesis, we confirmed that il-10 is indeed produced by hbv-specific cd8 t e upon hepatocellular ag recognition in vivo. to our surprise, il-10 blockade ameliorated rather than worsened liver disease. ex vivo analyses of hbv-specific cd8 t e isolated from the livers of hbv replication-competent transgenic mice or from the blood of acutely infected patients revealed that il-10 acts in an autocrine/paracrine fashion to increase il-2 responsiveness and rescue cd8 t e from ag-induced apoptosis. chimpanzees chimpanzee a0a006 has already been described. 13 the animal was handled according to humane use and care guidelines specified by animal research committees at the national institutes of health, the scripps research institute, and bioqual laboratories. the chimpanzee was individually housed at bioqual laboratories (rockville, md), an american association for accreditation of laboratory animal care international-accredited institution under contract to the national institute of allergy and infectious diseases. chimpanzee a0a006 was inoculated with 10 10 genome equivalents of hbv obtained from an hbv-positive serum of chimpanzee 5835 that was previously inoculated with a monoclonal hbv isolate (genotype d, ayw subtype; genbank accession no. v01460) 25 contained in hbv transgenic mouse serum, 14 as described. blood was obtained by venipuncture and analyzed for serum il-10 (see below). mice c57bl/6, cd45.1 (inbred c57bl/6), and balb/c mice were purchased from charles river. il-10 à/à mice (b6.129p2-il10 tm1cgn /j) were purchased from the jackson laboratory. hbv replication-competent transgenic mice (lineage 1.3.32, inbred c57bl/6, h-2 b ), that express all of the hbv antigens and replicate hbv in the liver at high levels without any evidence of cytopathology, were previously described. 13, 14 in indicated experiments, these mice were used as c57bl/6 x balb/c h-2 bxd f1 hybrids. hbv nucleocapsid (cor)-specific (referred to as cor93 cells) t cell receptor (tcr) transgenic mice (lineage bc10.3, inbred cd45.1), in which >98% of the splenic cd8 + t cells recognize a k b -restricted epitope located between residues 93-100 in the hbv core protein (mglkfrql), were previously described. 17 env28 (envelope) tcr transgenic mice (lineage 6c2.36, inbred balb/ c), in which $83% of the splenic cd8 + t cells recognize a l d -restricted epitope located between residues 28-39 of hbsag (ipqsldswwtsl), were previously described. 17 in indicated experiments, lineage bc10.3 or lineage 1.3.32 were crossed with il-10 à/à mice. mice were housed under specific pathogen-free conditions and used at 8-10 weeks of age. in all experiments, mice were matched for age, sex and (for the 1.3.32 animals) serum hbeag levels before experimental manipulations. all experimental animal procedures were approved by the institutional animal committee of san raffaele scientific institute. five patients with acute self-limited hbv infection were enrolled at the unit of infectious diseases and hepatology in parma, italy. patients had clinical, biochemical, and virological evidence of acute hbv infection (aminotransferase levels at least 10 times the upper normal limit and detection of hbsag and igm anti-hbcag ab in the serum). patients were negative for anti-hcv, anti-delta virus, anti-hiv-1 and anti-hiv-2 ab and for other markers of viral or autoimmune hepatitis. t cell response was tested one month from the time of acute illness. the study was approved by the ethical committee of the azienda ospedaliero-universitaria of parma, and all subjects gave written informed consent. in vitro generation of cd8 t e was performed as described. 16, 26 briefly, splenocytes from cor93 or env28 tcr transgenic mice were incubated with 10 lg/ml of cor93-100 (k b ; mglkfrql) or env28-39 (l d ; ipqsldswwtsl) peptides (primm), respectively, at 37°c for 1 h, washed, and cultured in complete rpmi 1640 (10% fbs, 2 mm l-glutamine, 50 lm 2-mercaptoethanol, hepes 10 mm, non essential amino acid 100 lm and penicillin plus streptomycin). two days later, cells were cultured in fresh medium supplemented with 2.5% el-4 supernatant. media sup-plemented with cytokines were replaced every 2 days. after 8 or 9 days of culture, cells were tested for the expression of cd8, cd69, cd25, cd44, cd62l, ccr7, ifnc and granzyme b by facs prior to subsequent use, as described. 16 10 7 cells of each cell type were injected intravenously into recipient animals. total rna was isolated from cultured cells or frozen livers (left lobe) with relia-prep rna miniprep system (promega) following the manufacturer's instructions. for quantitative rt-pcr, 1 lg of total rna was reverse transcribed prior to qpcr analysis for mouse il10 and ifng (taqman mm01288386 and mm01168134 probes, applied biosystems) in an abi 7900ht fast real-time pcr system (applied biosystems). all experiments were performed in triplicate and normalized to the reference gene gapdh. enzyme-linked immunosorbent assays il-10 and ifn-c in mouse sera or cell supernatants were measured by elisa (biolegend and r&d, respectively), according to the manufacturer's instructions. hbeag in mouse sera was measured by elisa (diapro) following the manufacturer's instructions. il-10 in chimpanzee sera was measured using a human il-10 elisa (r&d systems) according to the manufacturer's instructions. the extent of hepatocellular injury was monitored by measuring serum alanine aminotransferase (alt) activity at multiple time points after treatment, as previously described. 16 in vivo il-10r-specific antibody treatment primary hepatocytes were isolated from wild-type or il-10 à/à hbv replicationcompetent transgenic mice (inbred c57bl/6) exactly as described. 16 hepatocyte purity (assessed by flow cytometry-based parameters of size) and viability (assessed by light microscopy-based morphology and trypan blue dye exclusion) were routinely greater than 70% and 80%, respectively. hepatocytes (10 6 cells/ml) were incubated at a 1:2 ratio with cor93 cd8 t e for 4 h in the presence of 10 lg/ml brefeldin a (bfa, sigma) prior to intracellular ifn-c staining. single-cell suspensions of livers were generated as described. 18 for analysis of ex vivo intracellular cytokine production, cell suspensions of livers were obtained as described above except that 1 lg/ml of bfa (sigma) was included in the digestion buffer. all flow cytometry stainings of surface-expressed and intracellular molecules were performed as described. 27 antibodies (abs) used included pb-and pe-conjugated anti-cd8a (53-6.7), alexa fluor 488-, percp-, and apc-cy7-conjugated anti-cd45.1 (a20), alexa fluor 488-, and alexa fluor 647-conjugated anti-ifn-c (xmg1.2), pe-and pb-conjugated anti-cd25 (pc61), apc-conjugated annexin v (eos9.1), 7aad (bd pharmingen). all abs were purchased from biolegend, unless otherwise indicated. for phosphorylated stat5 analysis, cells were fixed with 4% paraformaldehyde, permeabilized with absolute methanol and stained with pe-cy7-conjugated anti-phosphostat5 (47/stat5py694, ebioscience). all flow cytometry analyses were performed in facs buffer containing pbs with 2 mm edta and 2% fbs on a facs canto (bd pharmingen) and analyzed with flowjo software (treestar). for haemotoxylin and eosin staining, livers were perfused with pbs, harvested in zn-formalin and transferred into 70% ethanol 24 h later. tissue was then processed, embedded in paraffin and stained as previously described. 16 bright-field images were acquired through an aperio scanscope system cs2 microscope and an imagescope program (leica biosystem) following the manufacturer's instructions. the extent of hepatocellular injury was monitored by histopathological and quantitative morphometric analyses as described. 18 the number of injured hepatocytes (identified as either apoptotic or necrotic based on standard cytopathological criteria) and intrahepatic inflammatory cells (mononuclear and polymorphonuclear) were counted in at least 50 high power fields of liver tissue (corresponding to about 2 mm 2 ). results are expressed as number of cells per mm 2 . in vitro cell culture assays with murine cd8 t e to test the expression and production of il-10 and ifn-c by cor93 t e , cells were incubated in complete rpmi 1640 media with 2 lg/ml of rhil-2 (roche) at 5â10 6 cells/ml for 4 h at 37°c in the presence or absence of the cor93 peptide. to assess the effect of il-10 on ag-induced apoptosis, cor93 cd8 t e (10 7 cells/ ml) were incubated for 1 h at 37°c with 18 lg/ml of anti-il-10r ab (bioxcell), 400 ng/ml of recombinant mil-10 (biolegend) or left untreated prior to the addition of cor93 peptide (1 mg/ml) and human il-2 (1 mg/ml). for the assessment of cell viability, cells were harvested 8 h later and stained with annexin v and 7aad, as described above. for the assessment of cd25 expression, cells were harvested 24 h after peptide stimulation. for stat5 phosphorylation, cor93 cd8 t e were cultured overnight in serum-free rpmi complete medium (gibco, life technologies), prior to treating them as described above. cells were harvested 15 min after peptide stimulation. to measure the effect of il-10 on ag-induced apoptosis, peripheral blood mononuclear cells (pbmc) from five hla-a201 + patients with acute self-limited hepatitis b (concentration of 2â10 6 /ml) were incubated for 1 h at 37°c with 20 lg/ml of anti-il-10r ab (bd pharmingen), 200 ng/ml of recombinant human il-10 (biolegend) or left untreated prior to the addition of core 18-27 peptide (1 lg/ml) and human il-2 (100 iu/ml). after a 5 h incubation, cells were extensively washed, stained with core 18-27 dextramer, anti-cd8 and anti-cd3 mouse abs for 15 min in the dark, then stained with annexin v and 7aad (bd pharmingen), according to the annexin v staining protocol (bd pharmingen). the cells were acquired immediately on a facscanto ii multicolor flow cytometer and were analyzed with the diva software (bd biosciences, immunocytometry systems, ca, usa). total dna was isolated from frozen livers (left lobe) for southern blot analysis, as previously described. 18 results are expressed as mean + sem. all statistical analyses were performed in prism 5 (graphpad software). means between two groups were compared with two-tailed t test. means among three or more groups were compared with oneway or two-way analysis of variance (anova) with bonferroni's post-hoc test. some data were analyzed using fisher's least significant difference (lsd) test we first assessed whether il-10 is produced upon acute hbv infection. we longitudinally analyzed the sera of a chimpanzee (a0a006) that had been inoculated with a monoclonal hbv inoculum of 10 10 ge of hbv dna, as described. 13 serum il-10 was not detectable until cd8 + t cells accumulated in the liver and its appearance coincided with the onset of a necroinflammatory liver disease (fig. 1a) , suggesting that this cytokine might have been produced by virus-specific cd8 t e upon hepatocellular ag recognition. to test this hypothesis and to assess the role of il-10 in liver immunopathology, we employed a well-established model of acute hbv pathogenesis, i.e. the adoptive transfer of hbv-specific cd8 + t e into hbv replication-competent transgenic mice. 14-16 naïve cd8 + t cells from hbv nucleocapsid (cor)specific tcr transgenic mice 17 (referred to as cor93 cells) were differentiated in vitro into bona fide cd8 t e . upon intravenous injection of 10 7 cor93 cd8 t e into hbv replication-competent transgenic mice, the hepatic mrna expression of the il10 gene increased sharply, reaching peak levels at 4-8 h after t cell transfer and mirroring the kinetics of the prototypical cd8 t e -derived pro-inflammatory and antiviral cytokine gene ifng (fig. 1b) . accordingly, il-10 was also detected in the serum of these mice between 4 and 8 h after t cell transfer, again echoing the ifn-c kinetics (fig. 1c) . consistent with the hypothesis that il-10 is produced by cd8 t e upon hepatocellular antigen recognition, we found that cor93 t e cells stimulated for 4 h in vitro with the cognate cor93 peptide produced both cytokines (fig. 1d-g; fig. s1 ). finally, to unambiguously identify the cellular source of the il-10 detected in the liver of hbv replication-competent transgenic mice upon adoptive transfer of cor93 cd8 t e , we genetically deleted the il10 gene in hbv replication-competent recipient mice, in cor93 cd8 t e or in both. by using this approach, we could demonstrate that the transferred cd8 t e cells are the unique source of il-10 in this experimental setting, as il10 expression was only detected when the transferred t cells were il10-competent, regardless of the recipient genotype (fig. 1h) . to gain insight into the role of cd8 t e -derived il-10 expression in liver immunopathology, we selectively blocked il-10 receptor signaling by injecting hbv replication-competent transgenic mice with an anti-il-10ra ab 2 h prior to cor93 t e transfer. to our surprise, we found that il-10 blockade decreased, rather than increased, liver damage by about 3-fold at the peak of the disease ( fig. 2a) . of note, anti-il-10ra ab injection did not affect the total number of circulating cor93 t e cells (data not shown), indicating that this treatment did not deplete the transferred t cells. also, anti-il-10ra ab treatment significantly reduced liver disease when hbv envelope-specific tcr transgenic 16, 17 or polyclonal cd8 t e 18 were injected into hbv replication-competent transgenic mice instead of cor93 t e (data not shown). moreover, consistent with il-10 being produced exclusively by the transferred cd8 t e in this model, deletion of the il10 gene in hbv replication-competent recipient mice -which did not alter the ag presentation capacity of hepatocytes (fig. s2 ) -did not affect the severity of liver disease induced by cor93 t e transfer (fig. 2b) . to explore the mechanisms underlying this il-10-mediated increase in liver immunopathology, we quantified the number, function and viability of intrahepatic cor93 cd8 t e 2, 8, and 24 h after adoptive transfer into hbv replication-competent transgenic mice that were or were not subjected to anti-il-10ra ab treatment. il-10r blockade significantly decreased the number of total and ifn-c + intrahepatic cor93 cd8 t e cells recovered 24 h after injection ( fig. 2c and d) . we next addressed if this reflected an increase in cell death. indeed, the percentage of intrahepatic cor93 cd8 t e that underwent apoptosis at 8 and 24 h after transfer was significantly increased by il-10r blockade ( fig. 2e; fig. s3 ), and this was reflected by a lower disease severity ( fig. 2f and g) . although the number of intrahepatic cor93 t e was reduced upon il-10r blockade, these cells probably produced enough ifn-c to abolish viral replication (fig. s4 ). to explore if cd8 t e -derived il-10 directly decreased ag-induced apoptosis, we exposed purified cor93 cd8 t e to ag in the presence or absence of il-10r blockade or exogenous il-10. as shown in fig. 3a , ag exposure for 8 h triggered cor93 cd8 t e apoptosis. notably, il-10r blockade increased the percentage of cor93 cd8 t e that became apoptotic, whereas the addition of exogenous recombinant il-10 decreased cor93 cd8 t e apoptosis ( fig. 3a and fig. s5a) . we next set out to determine the mechanism whereby il-10 prevents cd8 t e from dying. since il-10 has been proposed to enhance the growth of activated cd8 + t cells in the presence of il-2, [19] [20] [21] we reasoned that cd8 t e -derived il-10 might increase il-2 responsiveness by, for instance, modulating il-2 receptor expression. indeed, ag-induced il-2ra (cd25) upregulation on cd8 t e was lower upon il-10r blockade, whereas the addition of exogenous recombinant il-10 increased cd25 upregulation (fig. 3b and fig. s5b ). accordingly, blocking il-10r signaling decreased the capacity of cd8 t e to respond to il-2 (as assessed by stat5 phosphorylation), and il-10 treatment increased il-2 sensitivity ( fig. 3c; fig. s5c ). finally, we explored whether the capacity of cd8 t e -derived il-10 to act in an autocrine/paracrine fashion to rescue cd8 t e from ag-triggered apoptosis was restricted to murine cd8 t e or it extended to hbv-specific cd8 t e isolated from acutely infected patients. to this end, pbmcs from 5 hla-a201 + patients with acute hepatitis b, in whom hbv-specific cd8 + t cells can be specifically visualized by hbv-specific dextramers 22 (fig. s6 ), were stimulated with the cognate cor18 peptide in the presence or absence of anti-il-10ra abs or exogenous il-10. the results mirrored those obtained with murine cd8 t e , in that il-10r blockade increased ag-induced apoptosis, whereas the addition of recombinant il-10 partially rescued cd8 t e from cell death (fig. 3d ). in conclusion, our results indicate that cd8 t e -derived il-10 acts in an autocrine/paracrine fashion to increase il-2 responsiveness, rescuing cd8 t e from ag-induced apoptosis. although the net contribution that il-10 plays during a natural hbv infection -where this cytokine may be produced by additional cell types 23,24 -remains to be determined, the results described herein suggest that il-10 may promote rather than suppress liver immunopathology. with medium (white), anti-il-10ra (20 lg/ml, light blue), or ril-10 (200 ng/ml, dark blue). after 1 h cor18-27 peptide (1 lg/ml) was added (+cor18) or not (ctrl). the percentage of annexin v+ (apoptotic) cells was determined on core 18-27 dextramer + cells 5 h later. results are representative of 2 independent experiments. results are expressed as mean + sem. *p .05, **p .01, ***p .001. means between two groups were compared with two-tailed t test. means among three or more groups were compared with one-way or two-way analysis of variance with bonferroni's post-hoc test. data in fig. 3d were analyzed using fisher's least significant difference (lsd) test. european molecular biology organization (embo) young investigator program (to m.i.), embo long-term fellowships altf 694-2016 (to a.b.) and altf 1018-2016 (to d.i.), a marie curie intra-european fellowship (ief) for career development 327336 immunobiology and pathogenesis of viral hepatitis mouse models of hepatitis b virus pathogenesis immune outcomes in the liver: is cd8 t cell fate determined by the environment? cd8(+) t cells mediate viral clearance and disease pathogenesis during acute hepatitis b virus infection cd8(+) t cell control of hepatitis b virus replication: direct comparison between cytolytic and noncytolytic functions effector t cells control lung inflammation during acute influenza virus infection by producing il-10 autocrine regulation of pulmonary inflammation by effector t-cell derived il-10 during infection with respiratory syncytial virus shifting hierarchies of interleukin-10-producing t cell populations in the central nervous system during acute and persistent viral encephalomyelitis locally produced il-10 limits cutaneous vaccinia virus spread cd8+ treg cells suppress cd8 + t cell-responses by il-10-dependent mechanism during h5n1 influenza virus infection highly activated cytotoxic cd8 t cells express protective il-10 at the peak of coronavirus-induced encephalitis hepatoprotective and anti-inflammatory cytokines in alcoholic liver disease the size of the viral inoculum contributes to the outcome of hepatitis b virus infection high-level hepatitis b virus replication in transgenic mice intracellular inactivation of the hepatitis b virus by cytotoxic t lymphocytes immunosurveillance of the liver by intravascular effector cd8(+) t cells cd40 activation rescues antiviral cd8 + t cells from pd-1-mediated exhaustion platelets mediate cytotoxic t lymphocyte-induced liver damage il-10: a novel cytotoxic t cell differentiation factor inhibitory and stimulatory effects of il-10 on human cd8+ t cells the light and the dark sides of interleukin-10 in immune-mediated diseases and cancer characterization of hepatitis b virus (hbv)-specific t-cell dysfunction in chronic hbv infection interleukin-10 and the interleukin-10 receptor the regulation of il-10 expression nucleotide sequence of the hepatitis b virus genome (subtype ayw) cloned in e. coli effector differentiation is not prerequisite for generation of memory cytotoxic t lymphocytes bisphosphonates target b cells to enhance humoral immune responses we thank l. giustini, m. mainetti and m. raso for technical support; m. silva for secretarial assistance and the members of the iannacone laboratory for helpful discussions. flow cytometry was carried out at fractal, a flow cytometry resource and advanced cytometry technical applications laboratory established by the san raffaele scientific institute. supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.jhep.2017.04. 020. the authors who have taken part in this study declared that they do not have anything to disclose regarding funding or conflict of interest with respect to this manuscript.please refer to the accompanying icmje disclosure forms for further details. key: cord-002253-ll5a0urm authors: kunanopparat, areerat; kimkong, ingorn; palaga, tanapat; tangkijvanich, pisit; sirichindakul, boonchoo; hirankarn, nattiya title: increased atg5-atg12 in hepatitis b virus-associated hepatocellular carcinoma and their role in apoptosis date: 2016-10-07 journal: world j gastroenterol doi: 10.3748/wjg.v22.i37.8361 sha: doc_id: 2253 cord_uid: ll5a0urm aim: to investigate autophagy-related genes, particularly atg12, in apoptosis and cell cycle in hepatitis b virus (hbv)-associated hepatocellular carcinoma (hcc) and non-hbv-hcc cell lines. methods: the expression of autophagy-related genes in hbv-associated hepatocellular carcinoma and non-hbv-hcc cell lines and human liver tissues was examined by quantitative real-time reverse transcriptase-polymerase chain reaction (qrt-pcr) and western blotting. the silencing of target genes was used to examine the function of various genes in apoptosis and cell cycle progression. results: the expression of autophagy related genes atg5, atg12, atg9a and atg4b expression was analyzed in hepg2.2.15 cells and compared with hepg2 and thle cells. we found that atg5 and atg12 mrna expression was significantly increased in hepg2.2.15 cells compared to hepg2 cells (p < 0.005). moreover, atg5-atg12 protein levels were increased in tumor liver tissues compared to adjacent non-tumor tissues mainly from hcc patients with hbv infection. we also analyzed the function of atg12 in cell apoptosis and cell cycle progression. the percentage of apoptotic cells increased by 11.4% in atg12-silenced hepg2.2.15 cells (p < 0.005) but did not change in atg12-silenced hepg2 cells under starvation with earle’s balanced salt solution. however, the combination blockade of notch signaling and atg12 decreased the apoptotic rate of hepg2.2.15 cells from 55.6% to 50.4% (p < 0.05). conclusion: atg12 is important for hbv-associated apoptosis and a potential drug target for hbv-hcc. combination inhibition of atg12/notch signaling had no additional effect on hepg2.2.15 apoptosis. previous studies have reported that hbv expression is correlated with autophagy induction [1] [2] [3] . hbv enhances and uses autophagy for its replication via the hbx protein, which binds and activates phosphatidylinositol-3-kinase class 3 (pik3c3), an enzyme important for the initiation of autophagy. autophagy inhibitors or the silencing of enzymes essential for the formation of autophagosomes suppresses hbv dna synthesis with a minimal effect on the hbv mrna levels [2] . the role of autophagy in the production of hbv virions was demonstrated in hbv transgenic mice with a liverspecific deficiency of atg5 [4] . we recently confirmed that atg12 knock down reduced hbv dna levels in hepg2.2.15 cells and induced the interferon signaling pathway, suggesting that autophagy machinery may aid hbv survival by reducing antiviral innate immunity [5] . many studies have provided evidence to support the role of autophagy in human cancer. beclin-1 was the first mammalian autophagy gene to be identified. the monoallelic deletion of beclin-1 at chromosome 17q21 is sporadically observed in approximately 75% of ovarian cancers [6, 7] , 50% of breast cancers [8] , and 40% of prostate cancers [9] . other mutations in autophagy genes such as atg5, atg12, atg9b are frequent in gastric and colon cancers [10] . uvrag, a beclin1-interacting protein [10, 11] and atg4c were also shown to suppress tumor gene activity [12] . liverspecific beclin-1 knockout heterozygous mice showed increased rates of hepatocellular carcinoma in old aged mice [13, 14] . furthermore, mosaic atg5 -/mice developed benign liver tumors at 6-mo of age [15] and atg7 hepatocyte-specific knockout mice also developed liver tumors later in life [15] . these data support the idea that autophagy defects contribute to tumorigenesis. however, autophagy deficient cells can occur via cellular damage caused by dysfunctional mitochondria, oxidative stress, endoplasmic reticulum stress, necrosis and p62 accumulation [16] . the accumulation of cell damage can lead to chromosome instability [17] and inflammatory responses [18] , resulting in tumor development. although, autophagy functions as a tumor suppressor in primary cells, it is important for cancer cell survival. interestingly, spontaneously occurring liver tumors did not progress in chimeric mice with atg5 or atg7 loss [15] . this finding implies that autophagy is required for tumor progression. additionally, autophagy is required for cancer progression of other types of cancers. for example, an atg3 deletion in hematopoietic cells prevents bcr-abl-mediated leukemia [19] . some tumor cells are susceptible to growth inhibition or death when autophagy is inhibited. guo et al [20] , found that ras-driven tumors required autophagy for tumor cell survival upon starvation. therefore, autophagy has a dual-function in cancer. it functions as a tumor suppressor during cancer initiation, but also functions to promote tumor progression and metastasis later in the development process. because hbv infection is associated with hepatocellular carcinoma (hcc) and requires the induction of autophagy for its survival, we investigated the involvement of autophagic genes in cancer cell survival using hbv-associated hcc and non hbv-hcc cell lines and liver tissues. to induce starvation conditions, the cells were incubated in serum-free earle's balanced salt solution (ebss; starvation medium; invitrogen, united states) for the indicated number of hours (between 4-8 h). total cellular rna was extracted using real genomics total rna extraction kit (rbc bioscience, taiwan). the quantity of rna was measured using a spectrophotometer. rna concentrations in a solution were read and a 260 nm absorbance reading of 1.0 was equivalent to about 40 µg/ml of rna and the ratio of absorbance at 260 and 280 nm was used to assess the rna purity of rna preparations. then 1 µg of total rna was converted to cdna using high-capacity cdna reverse transcription kits (applied biosystems, united states). pcr reactions were performed in a 20 µl reaction volume in a 96-well plate (applied biosystems, united states). the pcr mixture contained 2 µl of cdna template, 10 µl of commercial (2 ×) power sybr ® green pcr master mix (applied biosystems), and each primer at a final concentration of 0.5 µmol/l. real-time pcr runs were carried out using an abi thermal cycler 7500 real-time pcr instrument (applied biosystems). the conditions for thermal cycling were as follows: initial denaturation at 95 ℃ for 10 min, followed by 40 amplification cycles at 95 ℃ for 15 s and then 60 ℃ for 1 min. for each pcr run, a negative (notemplate) control was used to test for false-positive results or contamination. the absence of nonspecific amplification was confirmed by generating a melt curve using the applied biosystems real-time pcr system software. the primers utilized in this study are summarized in table 1 . to analyze the relative gene expression data, we used real-time quantitative pcr and the 2 -δδc t method [21] . the ct values were obtained from real-time pcr instrumentation. the quantity of mrna relative to a reference gene was calculated using the formula 2 -δc t , october 7, 2016|volume 22|issue 37| wjg|www.wjgnet.com beclin-1 becn1-f ggatcaggaggaagc becn1-r gatgtggaaggttgc atg5 atg5-f gcttcgagatgtgtggtttgg atg5-r actttgtcagttaccaacgtca atg12 atg12-f ttgtggcctcagaacagttg atg12-r gagagttccaacttcttggtctg atg9a atg9a-f cgtgtgggaaggacag atg9a-r ggcgctttctccactc atg4b atg4b-f tccataggccagtggtacg atg4b-r tgcacaaccttctgatttcc b-actin b-actin-f accaactgggacgacatggagaa bsignificant differences were determined by unpaired t test with graphpad prism software, version 5.0 (san diego, ca, united states). statistical significance was set at a p value of < 0.05. to investigate the involvement of autophagy in hcc, we used beclin-1 as a marker for hbv-induced autophagy under starvation conditions. we analyzed beclin-1 mrna expression in hbv-transfected hepg2.2.15 cells and the parental cell line, hepg2. at 4 h post-starvation, beclin-1 was up regulated in both cell lines and was then down regulated at 8 h (data not shown). thus, we selected autophagy induction with starvation in ebss for 4 h for all subsequent experiments. autophagy related genes that represent each major part of the autophagy machinery including (1) induction step (beclin1); (2) the first ubiquitin-like conjugation molecules (atg5 and atg12); (3) the cysteine protease that catalyzes the second ubiquitinlike conjugation molecules (atg4b); and (4) the transporter membrane required for autophagosome where δc t = (ct target rna -ct reference rna). comparison of gene expression was based on a comparative ct method (δδc t ), and the relative rna expression was quantified according to the formula of 2 -δδc t , where δδc t = (ct target rna (experimental group) -ct reference rna (experimental group)) -(ct target rna (control group) -ct reference rna (control group)). genes with high expression levels were selected for the functional study. all cell lines and human liver tissues samples were lysed with ripa buffer (25 mmol/l tris-hcl, ph 7.6, 150 mmol/l nacl, 1% np-40, 1% sodium deoxycholate, 0.1% sodium dodecyl sulfate). after sonication, protein concentrations of cell lysates were measured using bca assay (thermo scientific, united states). then 20 µg of protein from each cell line was loaded onto a 12% polyacrylamide gel and run at 130 v for 80 min. the proteins were transferred onto nitrocellulose membranes and were immunoblotted with primary mab against atg9a, atg12, cnotch1, gapdh (dilution, 1:1000; rabbit mab; cell signaling technologies, united states) and atg4b (dilution, 1:1000; mouse mab; abcam, united states). after washing, the membranes were incubated with secondary antibodies conjugated with horseradish peroxidase (dilution 1:2000) and were analyzed with enhanced chemiluminescence (ecl) substrate (supersignal west femto chemiluminescent substrate; thermo scientific). images were quantified using a licor-odyssey image system (li-cor ® , united states). hepg2 cells were grown in dmem supplemented with 10% fbs, antibiotic-free at 37 ℃ in 5% co2 for 24 h. hepg2 cells were transfected with 500-1000 ng of pgfp-hbx plasmids (addgene, ma, united states) or pgfp (negative control) using 1-3 µl of lipofectamine hepg2 and hepg2.2.15 cells were transiently transfected with 500 ng of short hairpin rna (shrna) formation (atg9a) were tested. the mrna expression levels of these selected molecules were determined at baseline and at 4 h post-culture in ebss. there were no significant differences at baseline (data not shown). at 4 h post starvation, beclin1 mrna was down regulated in hepg2.2.15 compared to thle2 and hepg2 (p = 0.0213 and p = 0.0236, respectively) ( figure 1a ). no significant difference was observed for atg4b expression between hbv-transfected hepg2.2.15 and hepg2, but it was significantly increased in hepg2 and hepg2.2.15 compared with thle-2 (p = 0.0002 and p = 0.0007, respectively) ( figure 1e ). atg9a mrna expression was higher in hepg2 and hepg2.2.15 compared to thle2 but significantly down regulated in hbv-transfected hepg2.2.15 compared with hepg2 (p = 0.0013) ( figure 1d ). only the mrna expression of atg5 and atg12 was significantly increased in hbv-transfected hepg2.2.15 compared with hepg2 cells (p = 0.0027 ( figure 1b) and p = 0.0039 ( figure 1c ), respectively). the results of mrna levels were confirmed by western blot analysis. atg5-atg12 proteins were up regulated in hbv-transfected hepg2.2.15 whereas atg9a were down regulated compared to hepg2 cells. there was no difference in atg4b protein expression between hbv-transfected hepg2.2.15 and hepg2 ( figure 1f ). next, we analyzed atg5-atg12 levels in tumor tissues compared to adjacent non-tumor tissues from hcc patients with or without hbv infection. in hbvassociated hcc tissues, atg5-atg12 protein levels were increased in the majority of tumor liver tissues compared to adjacent non-tumor tissues (9/10 sample pairs) (figure 2a and c). in non-hbv hcc, atg5-atg12 protein levels were only increased in 3/8 tumor liver tissue samples ( figure 2b and c). these results suggested that atg5-atg12 proteins might have a selective advantage in hbv-associated hcc compared to non-hbv hcc. the x protein was shown to induce hbv replication by increasing beclin-1 transcription leading to the induction of autophagy [1] . in this study, we analyzed the effect of hbx on beclin-1 and on atg12 by transfection of hepg2 cells with the pgfp-hbx plasmid. then, we analyzed beclin-1 and atg12 mrna expressions using quantitative real-time rt-pcr. we found that beclin-1 (p = 0.0027) ( figure 3a ) and atg12 (p = 0.0139) ( figure 3b ) mrna expression were significantly increased in hepg2-gfp-hbx compared with hepg2-gfp after 48 h of transfection. these results suggested that hbx plays a role in atg12 induction, either directly or indirectly through beclin1. next, we studied the functional role of the atg12 autophagic gene by monitoring the biological effect after knockdown of its expression. cells containing plasmids with the greatest silencing efficiency were subjected to western blot analysis for protein expression. the transfection efficiency was estimated by monitoring gfp expression under inverted fluorescence microscope (data not shown). the protein level of atg12 in transfected hepg2 and hepg2.2.15 cells was decreased compared with mock controls ( figure 4a ). we investigated apoptosis and cell cycle progression in hepg2.2.15 cells compare to hepg2 cells after the silencing of atg12. the percentage of apoptotic cells was slightly increased (8.3%) in atg12-silenced hepg2 but unchanged in hepg2.2.15 under normal conditions, which is similar to what we have previously reported [5] . under starvation conditions with ebss, the percentage of apoptotic cells increased 11.4% in atg12-silenced hepg2.2.15 but did not change in atg12-silenced hepg2 ( figure 4b ). no significant changes in cell cycle progression were observed in either cell line ( figure 5 ). these results suggest that atg5-atg12 proteins are important for the survival of hbv-associated hcc during states of limited tumor nutrients. we recently reported that notch signaling played a role in cell cycle progression and apoptosis, particularly in hbv-associated hcc [22] . because atg12 was up regulated in hepg2.2.15 compared to hepg2, and plays a role in cell apoptosis, we assessed the effect of atg12 silencing in combination with a notch inhibitor in the hepg2.2.15 cell line. gamma-secretase inhibitors, also known as n-[n-(3,5-difluorophenacetyl)-l-alanyl]-s-phenylglycine t-butyl ester; dapt, is used to block the notch pathway [23] . when using dapt combined with gene silencing of atg12 under starvation conditions, hepg2 cell apoptosis was increased from 38.5% to 48.3%, compared to dapt treatment alone, although there was no synergistic effect ( figure 6) . interestingly, the combination blockade of dapt and atg12 gave the opposite result by decreasing the apoptosis rate in hepg2.2.15 from 55.6% to 50.4% ( figure 6 ). no significant changes in cell cycle progression were observed for the combination treatment of atg12 sirna and dapt (figure 7) . these results suggested that autophagy and notch signaling are independent from each other in hbv-expressing cells compared to non-hbv hcc. finally, we analyzed atg12 expression after treatment with dapt and detected cleaved notch1 expression after silencing atg12 genes at baseline. atg12 mrna was decreased by dapt treatment in hepg2.2.15 ( figure 8a ). moreover, cleaved notch1 was diminished in atg12-silenced hepg2.2.15 under autophagy has been reported to be associated with hbv and hcc [13, 15, 24] . however, the mechanism is still poorly understood. moreover, recent evidence suggests that specific atg genes might contribute differently to viral infection and cancer development [25] [26] [27] [28] . some atg genes have autophagy independent functions [29] [30] [31] [32] . in this study, we focused on the atg5-atg12 complex that was up regulated in hepg2.2.15 and were highly expressed in hbv-associated hcc compared to non-hbv cell lines and hcc. hbx appears to play a role in atg12 induction, probably indirectly through the stimulation of beclin-1 and pik3c3 [1, 2] . we showed that silencing of atg12, which represented the elimination of the atg5-atg12 western blotting with specific antibodies was used to analyze atg12 protein expression in hbv-associated hcc and non-hbv hcc. gapdh was used as a protein loading control. graphs showing the intensity band ratio (tumor tissue/adjacent non-tumor tissue) quantified using the li-cor ® image system from western blot analysis were shown in a and b. representative western blot results were shown in c. hbv: hepatitis b virus; hcc: hepatocellular carcinoma. [34] they showed that hepg2 and huh6 induced autophagy (beclin-1, atg5 and lc3b expression) for cell survival under starvation conditions with serum-free medium or chemotherapy. the inhibition of autophagy via the silencing of autophagic genes (beclin-1 and atg5) or 3-ma treatment induced huh6 cell apoptosis under starvation conditions [34] . a study by liu et al [35] demonstrated that starvation with serum-free medium for 48 h induced autophagy although atg12 has been demonstrated to have pro-apoptotic activity through the atg12-atg3 conjugate [36] , atg12 also has anti-apoptotic activity. in mammalian hela cells, disruption of autophagy by silencing atg12 promotes cells to die via apoptosis under starvation conditions [37] . atg12 and other autophagic proteins (lc3 and atg5) are associated with mitochondrial quality control of human umbilical vein endothelial cells. atg12, atg5 and lc3b were up-regulated after mitochondrial damage, leading to increased anti-apoptotic effects and increased life span in an in vitro aging model [38] . the combination of trastuzumab with silencing of atg12 reduces cell viability and tumor growth in nude mice [39] . therefore, we suggest that the inhibition of atg12 might be a good target for the treatment of hbv-associated hcc. many cancer drug treatments increase tumor cell autophagy to protect cancer cells from apoptosis. autophagy inhibitors in combination with chemotherapy are designed to induce apoptosis in human cancers. for example, autophagy inhibition was previously shown to enhance the growth inhibitory effects of sorafenib [40] as well as the combination of vorinostat with sorafenib in hcc cell lines [41] . in this study, we examined apoptosis cell death after the inhibition of atg12 in combination with notch signaling in hepg2 and hepg2.2.15 cell lines. the combination treatment increased cell apoptosis in hepg2 cells. however, when we blocked both notch signaling and atg12 under starvation conditions, cell apoptosis did not increase. there appears to be some interaction between atg12 and notch signaling, specifically in hepg2.2.12, because the notch inhibitor dapt caused the down-regulation of atg12 mrna but this was not observed in hepg2. in addition, the inhibition of atg12 impaired notch activation in hepg2.2.15 but increased notch activation in hepg2. this observation regarding the regulation between autophagy and notch signaling in hepg2.2.15 was unexpected. both autophagy and notch signaling are highly conserved signaling pathways in eukaryotic cells. the core notch signaling pathway is through the binding of notch ligand to notch receptor which induces two proteolytic cleavages, metalloprotease and g-secretase, to release the notch intracellular domain, which translocates to the nucleus and binds to dna to regulate the transcription of target genes [42] . the notch pathway is associated with both tumor suppression and tumorigenesis in hcc [43, 44] . the connection of autophagy and notch signaling was demonstrated in drosophila where the atg4 mutation enhanced the notched-wing phenotype resulting in defective notch signaling [45] . in contrast, the overexpression of atg1 enhanced the notchedwing phenotype [46] , suggesting that some autophagic proteins have additional functions independent of autophagy that are related to the enhancement or suppression of notch signaling. mammalian target of rapamycin (mtor) is a positive regulator of notch signaling [47] and a negative regulator of autophagy [48] . previous reports have shown that silencing of notch1 activated phosphorylated akt and decreased mtor to induce glioblastoma cell apoptosis [49] . the inhibition of notch signaling induced autophagy via pten-pi3k/akt/mtor pathway to promote the adipogenic differentiation of bm-mscs [50] . other studies have demonstrated that autophagy regulates notch signaling by reducing the impact of notch1 on stem cell differentiation. the silencing of autophagy (atg7 or atg16l1) induced notch1 and cleaved notch1 in hek cells [51] . the unexpected relationship between autophagy and notch signaling in hepg2.2.15 was different from hepg2 and might be explained by the hbv genome. the hbv x protein activates the nf-κb pathway (p65 and p50) via notch signaling through a specific ligand and receptor to promote cell survival [52] . after treatment with dapt, nf-κb expression was decreased [53] . thus, the activation of nf-κb can either stimulate or inhibit autophagy via the upregulation of beclin-1 in t-cells [54] , whereas prolonged nf-κb activation suppresses atg5 and beclin-1 expression in macrophages [55] . however, the connection between hbv and notch related autophagy needs further study. in conclusion, our previous study demonstrated the role of autophagy machinery in hbv replication. we found that atg12-knockdown reduced hbv dna . moreover, this study demonstrated that autophagy is related to hbv-associated cell death responses. atg12 silenced hepg2.2.15 showed increased apoptosis under starvation conditions. the function of atg12 seems to be dominated in hbvassociated hcc. these results suggested that atg5-atg12 is important for the survival of hbv-associated hcc during states of limited tumor nutrients. however, as mentioned previously that autophagy has a dualfunction in cancer. despite its role as tumor promotion in the later phase, it can act as a tumor suppressor during cancer initiation. therefore, the therapeutic intervention that target autophagy has to take this information into consideration too. moreover, our result showed that the use of autophagy inhibition in combination with other anti-tumor therapies such as notch inhibitor, might not be a good strategy. further characterization of hbv and notch related autophagy is needed. hepatitis b virus (hbv) infection is associated with hepatocellular carcinoma (hcc) and has been proved to induce autophagy for its replication and survival. the involvement of some autophagic genes on cancer cell survival is still unknown. therefore, we investigated the role of atg genes in hbv-associated hcc and non hbv-hcc in this study. autophagy is a catabolic process for cell survival under nutrient limitation or stress conditions. however, autophagy can act as either an oncogene or tumor suppressor gene. a recent report showed that hbv used the autophagic pathway for its own benefit; however the molecular mechanism is still unclear. atg5-atg12 protein was up regulated in hepg2.2.15 and expressed in a high percentage of hbv-associated hcc compared to non-hbv cell lines and hcc. the atg12 silenced hepg2.2.15 cell line had increased apoptosis under starvation conditions. this is the first study to show a function of atg12 in apoptosis in hbv-associated hcc. these findings raise the possibility of targeting the autophagic pathway for the treatment of hbv-associated hcc patients. this paper reported that atg5-atg12 protein expression was increased in hbv-transfected hepg2.2.15 cells compared to hepg2 cells and was increased in tumor liver tissues compared to adjacent non-tumor tissues from hcc patients with hbv infection. the silencing of atg12 increased cell apoptosis under starvation conditions in hepg2.2.15 cells but not in hepg2 cells. their results suggest that atg5-atg12 is important for the survival of hbv-associated hcc in the state of tumor nutrient limitation. the inhibition of atg12 might be a good target for hbv-associated hcc. hepatitis b virus x protein sensitizes cells to starvation-induced autophagy via up-regulation of beclin 1 expression the early autophagic pathway is activated by hepatitis b virus and required for viral dna replication subversion of cellular autophagy machinery by hepatitis b virus for viral envelopment autophagy required for hepatitis b virus replication in transgenic mice autophagy machinery impaired interferon signalling pathways to benefit hepatitis b virus replication cloning and genomic organization of beclin 1, a candidate tumor suppressor gene on chromosome 17q21 early loss of heterozygosity on 17q in ovarian cancer. the abe ovarian cancer genetics group detailed deletion mapping of chromosome 17q in ovarian and breast cancers: 2-cm region on 17q21.3 often and commonly deleted in tumors loss of heterozygosity of the brca1 and other loci on chromosome 17q in human prostate cancer here, there be dragons: charting autophagy-related alterations in human tumors manipulation of nonsense mediated decay identifies gene mutations in colon cancer cells with microsatellite instability tissue-specific autophagy alterations and increased tumorigenesis in mice promotion of tumorigenesis by heterozygous disruption of the beclin 1 autophagy gene beclin 1, an autophagy gene essential for early embryonic development, is a haploinsufficient tumor suppressor autophagy-deficient mice develop multiple liver tumors autophagy and tumorigenesis autophagy suppresses tumor progression by limiting chromosomal instability growth factor regulation of autophagy and cell survival in the absence of apoptosis autophagy is essential to suppress cell stress and to allow bcr-abl-mediated leukemogenesis activated ras requires autophagy to maintain oxidative metabolism and tumorigenesis analysis of relative gene expression data using real-time quantitative pcr and the 2 hepatitis b virus hbx activates notch signaling via delta-like 4/notch1 in hepatocellular carcinoma notch inhibition as a promising new approach to cancer therapy autophagy and apoptosis-related genes in chronic liver disease and hepatocellular carcinoma wipi-1alpha (wipi49), a member of the novel 7-bladed wipi protein family, is aberrantly expressed in human cancer and is linked to starvation-induced autophagy radiation-induced autophagy is associated with lc3 and its inhibition sensitizes malignant glioma cells coronaviruses hijack the lc3-i-positive edemosomes, er-derived vesicles exporting short-lived erad regulators, for replication impact of the autophagy machinery on hepatitis c virus infection the atg5 atg12 conjugate associates with innate antiviral immune responses the non-canonical role of atg family members as suppressors of innate antiviral immune signaling nondegradative role of atg5-atg12/ atg16l1 autophagy protein complex in antiviral activity of interferon gamma autophagosomal membrane serves as platform for intracellular death-inducing signaling complex (idisc)-mediated caspase-8 activation and apoptosis hepatitis b virus x protein reduces starvation-induced cell death through activation of autophagy and inhibition of mitochondrial apoptotic pathway inhibition of autophagy may suppress the development of hepatoblastoma phosphorylated akt inhibits the apoptosis induced by dram-mediated mitophagy in hepatocellular carcinoma by preventing the translocation of dram to mitochondria atg12 conjugation to atg3 regulates mitochondrial homeostasis and cell death inhibition of macroautophagy triggers apoptosis autophagy proteins lc3b, atg5 and atg12 participate in quality control after mitochondrial damage and influence lifespan autophagyrelated gene 12 (atg12) is a novel determinant of primary resistance to her2-targeted therapies: utility of transcriptome analysis of the autophagy interactome to guide breast cancer treatment targeting autophagy enhances sorafenib lethality for hepatocellular carcinoma via er stress-related apoptosis inhibition of autophagy significantly enhances combination therapy with sorafenib and hdac inhibitors for human hepatoma cells notch signalling: a simple pathway becomes complex notch signaling inhibits hepatocellular carcinoma following inactivation of the rb pathway notch signaling in hepatocellular carcinoma: guilty in association the loss of drosophila apg4/aut2 function modifies the phenotypes of cut and notch signaling pathway mutants a targeted genetic modifier screen links the swi2/snf2 protein domino to growth and autophagy genes in drosophila melanogaster mammalian target of rapamycin regulates murine and human cell differentiation through stat3/p63/jagged/notch cascade amp-activated protein kinase and the regulation of autophagic proteolysis akt-mtor signaling is involved in notch-1-mediated glioma cell survival and proliferation inhibition of notch signaling promotes the adipogenic differentiation of mesenchymal stem cells through autophagy activation and pten-pi3k/akt/mtor pathway autophagy regulates notch degradation and modulates stem cell development and neurogenesis hepatitis b virus x protein promotes the growth of hepatocellular carcinoma by modulation of the notch signaling pathway the hepatitis b virus x protein downregulates nf-κb signaling pathways through decreasing the notch signaling pathway in hbxtransformed l02 cells p65/ rela modulates becn1 transcription and autophagy prolonged classical nf-kappab activation prevents autophagy upon e. coli stimulation in vitro: a potential resolving mechanism of inflammation. mediators infla m m 20 08 key: cord-009813-o8ai730r authors: wang, wei; xiong, liang; wang, pengyun; wang, fubing; ma, qingfeng title: major vault protein plays important roles in viral infection date: 2019-11-26 journal: iubmb life doi: 10.1002/iub.2200 sha: doc_id: 9813 cord_uid: o8ai730r viral replication and related protein expression inside the host cells, and host antiviral immune responses can lead to the occurrence of diverse diseases. with the outbreak of viral infection, a large number of newly diagnosed and died patients infected with various viruses are still reported every year. viral infection has already been one of the major global public health issues and lead to huge economic and social burdens. studying of viral pathogenesis is a very important way to find methods for prevention, diagnosis, and cure of viral infection; more evidence has confirmed that major vault protein (mvp) is closely associated with viral infection and pathogenesis, and this review is intended to provide a broad relationship between viruses and mvp to stimulate the interest of related researchers. viruses are acellular that cannot naturally reproduce outside of the living host cells and only assemble themselves depending on the host cellular metabolism. 1 virion, known as the complete viral particle, consists of nucleic acid surrounded by capsid, which is enveloped with lipids in some viruses. virion is less than 300 nm in diameter, and its self-assembly is very fast, viral replication inside of the host cells may manipulate and damage the host cells, and the antiviral immune response of the host can damage tissue simultaneously. under the effort of viral toxicity and host immunity, the host is prone to get many kinds of diseases. hepatitis b virus (hbv) and hepatitis c virus (hcv) can cause chronic infection, which can lead to liver cirrhosis and subsequently develop hepatocarcinoma, the patients with viral hepatitis serve as reservoirs of infectious virus. 2 some viruses, including hepatitis a virus (hav), human enterovirus, ebola virus, sars virus, and avian influenza, can cause an outbreak of epidemic infection. [3] [4] [5] [6] the typical antibiotics are not effective of antiviral infection, antigenic drift of viruses can make effective treatments ineffective, 7 and treatment of viral infection is still one of challenges for humanity. abbreviations: aids, acquired immunodeficiency syndrome; atf, activating transcription factors; c/ebpβ, ccaat-enhancer-binding protein β; egf, endothelial growth factor; eif4a, eukaryotic initiation factor 4a; erk, extracellular signal-related kinase; irf7, interferon regulatory factor 7; mapk, mitogen-activated protein kinase; mda5, melanoma differentiation-associated protein 5; mdm, monocytederived macrophages; mvp, major vault protein; myd88, myeloid differentiation primary response 88; nf-kb, nuclear factor kappa-lightchain-enhancer of activated b cells; pbmc, peripheral blood mononuclear cells; pkm2, pyruvate kinase isozyme m2; prrs, pattern recognition receptors; pten, phosphatase and tensin homolog deleted on chromosome 10; srsfs, serine/arginine-rich splicing factors; stat-1, signal transducer and activator of transcription-1 . recent studies have shown that many host-encoded proteins are associated with viruses: heat shock protein 70 is incorporated into the virions of human immunodeficiency virus type 1 (hiv-1) 8 ; serine/arginine-rich splicing factors (srsfs) are related to viral replication, srsf2 promotes anogenital tumorigenesis by maintaining the stability of e6e7 mrnas of human papillomavirus 16 (hpv16), which is the pathogen of anogenital cancer; hiv-1 replication is increased by srsf1, srsf4, and srsf10 within the host cells 9 ; 36 host-encoded proteins are presented in influenza virions 10 ; mvp is involved in antiviral immune response 11 ; and the study of hostencoded proteins in relation to viruses contributes to finding novel targets for antiviral drugs. vaults, the large ribonucleoprotein particles, are composed with mvp, poly (adp-ribose) polymerase, telomerase-associated protein-1 (tep1), and one or more noncoding rna. 12, 13 the human mvp, encoded by mvp gene that is located in chromosome 16p11.2, 14 is highly conserved during evolution 15, 16 and predominant component of vaults. [17] [18] [19] [20] the expression of mvp is very strong and widespread, 21 the mvp is mainly located in the cytoplasm and associated with the cytoskeleton, and a small amount is localized at or around the nuclear membrane and the nuclear pore complex. 22, 23 current studies have confirmed that mvps are associated with multidrug resistance in treatment of non-small lung cancer, 24 human colon cancer, 25 and mesial temporal lobe epilepsy with hippocampal sclerosis. 26 mvp/vaults play important roles in several signal transduction pathways, suppress c-jun-mediated ap-1 transactivation by associating with cop1, 27 participate the phosphoinositide 3-kinase pathway by interacting with endogenous phosphatase and tensin homolog deleted on chromosome 10 (pten) with the help of ca2+ modulation, 28 act as a signaling scaffold protein of extracellular signal-related kinase (erk)/mitogen-activated protein kinase (mapk) pathway by interacting with src in response to endothelial growth factor (egf), 29 and affect the jak-stat signaling pathway by responding and interfering the interferon (ifn)-gamma-mediated stat1 signals. 30 growing evidences also confirmed that mvp is closely associated with other multiple cellular processes, such as nuclear-cytoplasmic transport, 31 malignant transformation, 32 senescence/ aging, 33 autophagy, 34 and innate immunity. 35 interestingly, mvp has been linked to several types of viral infectious diseases as well as to virus-mediated immune responses. 29, 36 here, we focus on the roles of mvp in the intracellular viral replication and host immune responses. the innate immune response, including the production of ifn-1, is the first barrier of eliminating invaded pathogens early. 37 in host cells, tlrs, rig-1 (rig-i-like receptor dsrna helicase enzyme), and mda5 (melanoma differentiation-associated protein 5) act as pattern recognition receptors (prrs), ifn-stimulated proteins, and sensors for viral infection. [38] [39] [40] the interferon regulatory factor 7 (irf7) plays the master transcriptional role in viral infection-induced ifn production and immune responses, [41] [42] [43] activates ifn-β production mediated by myd88 (myeloid differentiation primary response 88)independent rig-1/mda5 pathway, also activates ifn-α production mediated by the myd88-dependent tlrs pathway. [44] [45] [46] the ifn-1 inhibits viral replication (including hcv, influenza a virus [iav], and hiv) by the production of ifn-stimulated effective proteins. 11, 47, 48 after host cells or tissues are infected by hcv, prrs of host cells recognize stimulation signals of products of hcv processing, the interaction between prrs and stimulation signals activates ikba kinase to phosphorylate ikbα, 49 which is associated with nf-kb protein complex in the cytoplasm, phosphorylated ikbα is released from nf-kb complex and degraded by ubiquitin-proteasome pathway, 50 free nf-kb complex translocates to the nucleus, and subsequently activates mvp transcription under coactivators including hcv protein ns5a. 11 hcv infection also induces mvp expression through the sp1 signal pathways, and the infection of vesicular stomatitis virus (vsv), iav, and enterovirus 71 (ev71) has the same effect with hcv infection. 11 inducible mvp is helpful for the nuclear translocation of irf7 and nf-kb, and performs antiviral activity by promoting endogenous ifn-1 production and expression of the ifn-stimulated genes. the production of ifn is the critical step in an innate immune response, and mvp plays strong antiviral activity in an ifn-1-dependent manner. with the advent of effectively prophylactic vaccines and antiviral drugs, hbv infection remains a global public health problem, 51,52 an estimated 240 million people with chronic hbv infection are hbv carriers, 53 deadly complications of hbv chronic infection (including cirrhosis and hepatocellular carcinoma) result in approximately 600,000 deaths per year, 54 and hbv infection brings heavy economic pressure for individuals and heavy social burden for the world. as a type of pathogen, hbv causes host cells to produce ifns to increase protective defense of host immune system, 55 ifns play important roles of antivirus by regulating the host immune system, and have been used to treat some cancers 56 and hbv infection. 57, 58 hbv virus infection leads to the production of type 1 ifns by two main pathways. toll-like receptors 3/4 (tlr 3/4) recognize viral nucleotides and glycolipids and recruit the adaptor protein trif (tir-domaincontaining adapter-inducing ifn-β), trif interacts with traf6 (tumor necrosis factor [tnf] receptor-associated factor 6) to activate nf-kb (nuclear factor kappa-lightchain enhancer of activated b cells), and activated nf-kb provokes ifnb production. 59, 60 another pathway is triggered by tlr7/8 and tlr9, tlrs recognized viral nucleotides in the endosome recruit myd88, 61 in turn recruit irak1/4 (interleukin-1 receptor-associated kinase 1/4) 62 to the complex and interact with traf6 (tnf receptorassociated factor 6), 63, 64 and then activate irf5/7 (ifn regulatory factor 5/7) to induce ifnα expression. mvp is a virus-induced protein, and the level of mvp in peripheral blood mononuclear cells (pbmcs), sera, and liver tissue derived from patients with chronic hepatitis b (chb) is higher than healthy individuals; mvp expression is also increased in hbv stable expression cell lines (hepg2.2.15 and huh7.37) and hbv-infected hepatocarcinoma cell lines (hepg2 and huh7). 11 during hbv infection, tlrs recruit and activate myd88, which interacts with irak1/4, irf5/7, and traf6 to form a complex, 62 the middle domain (aa 310-620) of mvp can interact with myd88, high expressed mvp joins the myd88-mediated complex by interacting with myd88 to promote ifn-1 production through translocation of irf7 and nf-kb from the cytoplasm to the nucleus. 11, 65 however, hbsag and hbeag competitively bind the myd88-binding region of mvp and suppress the ifn-1 production by disrupting mvp/myd88 interaction; the ifn-1 increment effect induced by mvp is counterattacked through hbeag and hbsag binding to mvp 11 (figure 1 ). evidence suggests that hbv has other strategies to suppress the host immune response. hbv polymerase (pol) may inhibit ifn-ɑ-induced myd88 induction, 66 hbeag suppresses tlr-induced ifn-β, 67 hbsag can block the irf-7 mediated ifn-ɑ production pathway, 68 and multiple mechanisms lead to hbv immune escape. when the host is attacked by harmful pathogens including viral infection, one of protective immune response is inflammation to eliminate damage. 69 ifn to interfere viral replication, 55 interleukin 6 (il-6) acted as a proinflammatory cytokine, 70 and interleukin 8 (il-8) served as a chemokine for neutrophils and monocytes 71 are important mediators of immune response, and activation of il-6 and il-8 gene expression is regulated by transcription factors. 72, 73 activator protein 1 (ap-1), composed of proteins belonging to c-fos, c-jun, activating transcription factors (atf) and maf families, 74 is a heterodimeric complex and acts as a transcription factor. 75 the function of ap-1 complex is heavily dependent on the c-fos and c-jun subunits, 76 ap-1 complex binds dna at ap-1 specific sites at the promoter and enhancer regions of target genes and increases target gene expression, 77, 78 and researchers had confirmed that the ap-1 complex is involved in il-6 and il-8 regulation. 79, 80 ccaatenhancer-binding protein β (c/ebpβ) is a member of the c/ebp transcription factor family, the gene of c/ebpβ can be translated into three polypeptides: the 38 kda and 34 kda liver-enriched transcriptional activating proteins (laps), and the 20-kda liver-enriched transcriptional inhibitory protein (lip). 81 c/ebp proteins interact with certain gene promoters containing ccaat box motif, then recruit co-activators to promote gene expression. 81 the promoters of il-6 and il-8 consists of the ccaat box motif region, wherein c/ebpβ can bind and affect il-6 and il-8 expression. 82 f i g u r e 1 hbsag and hbeag weaken the effect of mvp on promoting ifn production in order to restrict the spread of infected virus, some activated transcription factors contribute to the production of inflammatory-related cytokines and chemokines. iav, as a kind of negative single-stranded rna viruses (ssrna), produces replicative intermediate double-stranded rna (dsrna) in the infected cells, 83 dsrna and the synthetic dsrna analog polyinosinic-polycytidylic acid (poly[i:c]) are recognized by tlr3, 29, 84 then activate the tlr3-ifn production pathway to robustly express type i ifns. 59, 60 mvp, as a regulator in the proinflammatory response and an effector in ifn signaling pathway, increases to against viral replication during viral infection. 65 mvp has been proven to be a nuclear-cytoplasmic transport protein 30 and interacts with c-fos of the ap-1 complex components and c/ebpβ-laps. 48 the interaction promotes the ap-1 complex and c/ebpβ-laps translocation from the cytoplasm to nucleus and follows to activate the il-6 and il-8 expression by the ap-1 complex and c/ebpβ-laps binding to the il6 and il8 promoters, and mvp plays a synergistic role in the expression of il-6 and il-8. 48 the expression of mvp, il-6, and il-8 increases simultaneously in iavinfected a549 or dsrna-stimulated pbmcs, and the expression of il-6 and il-8 is impaired in mvp knockdown cells and knockout mice 48 ; mvp plays a pivotal role in virus-triggered proinflammatory response by mediating the ap-1 and c/ebpβ signaling pathways. the model of mvp functions for proinflammatory response is summarized in figure 2 . hepatitis e virus (hev), belonged to the genus hepevirus, is classified as a positive-strand rna virus ([+] ssrna virus), 85 and hev infection is an important public health problem. hev is mostly transmitted via the fecal-oral route in developing countries under poor sanitary conditions, 86, 87 and often spread in many countries by food borne, 88 blood transfusion, 89, 90 and zoonotic origin. 91 hev can cause chronic infection in immunosuppressed patients, pegylated ifn-alpha-2b is used in the treatments for chronic hepatitis e (che) virus infection in liver transplant patients, 92 pegylated ifn-alpha-2a is used in the treatments for che virus infection in a hemodialysis patient, 93 and ribavirin as monotherapy may be effective in the treatment for che virus infection in solid-organ transplant patients. 94 silvestrol is a natural cyclopenta(b)benzofuran and acts as an inhibitor of the eukaryotic initiation factor 4a (eif4a) via hindering translation initiation from the 5 0capped and 5 0 -utr of mrnas. 95 the hev is a (+) ssrna virus containing 5 0 -cap and 5 0 -utr structure, 96 the released hev particles from persistently hev-infected a549 cells treated with silvestrol are robustly reduced, which are caused by the decrease of the intracellular hev capsid protein. 97 silvestrol also affect the expression and localization of antiviral host factor mvp, the mvp amount of the cytoplasm is reduced after treating with silvestrol in hev-infected cells, and the mvp transfers from the cytoplasm to the perinuclear area 97 that affects mvp-mediated ifn production. 98 the translation of mvp is highly activated to play an antiviral role by hev infection; however, the change of translation and cytoplasmic localization affected by the silvestrol treatment counteracts part of antiviral effect, mvp plays a complex interplay between the anti-hev replication and the effect of treating with silvestrol for hev infection. the infection of hiv is the pathogenesis of acquired immunodeficiency syndrome (aids) and one of major global public health issues. 99 hiv infected immune cells, including monocytes, lymphocytes, and macrophages, act as stable rival reservoirs, 100 and are main barrier to f i g u r e 2 mvp plays a pivotal role in the proinflammatory response caused by (−) ssrna viral infection eradicate virus by antiviral therapy. 101 the level of cystatin b, a cysteine protease inhibitor, is higher in blood monocyte-derived macrophages (mdm) than in placental macrophages, which are more resistant to hiv-1 infection than mdm. 102, 103 the expression of cystatin b is upregulated in hiv-1-infected mdm, 104 and cystatin b promotes hiv-1 replication by interacting with pyruvate kinase isozyme m2 (pkm2), 105 which is associated with the cocaine enhancement of hiv-1 replication. 106 in hiv-infected mdm, upregulated cystatin b interacts with mvp 105 and signal transducer and activator of transcription-1 (stat-1). 103 mvp, as an ifn-responsive protein, directly inhibits tyrosine phosphorylation of stat-1 to weaken ifn-induced antiviral response by interfering the jak/stat signal pathway, 29 then promote hiv replication. cystatin b directly interacts and decreases tyrosine phosphorylation of stat-1, and inhibits ifn-β response and stat-1 translocation from the cytoplasm to nucleus to reduce jak/stat signal pathway activity, and ultimately promote hiv replication. 105 under the cooperation of the cystatin b and mvp, hiv replication is activated by the damage of jak/stat signal pathway activity mediated by the low tyrosine phosphorylation of stat-1. mvp is involved in the diversely cellular processes, including multiresistant cancers, 24-26 signal transmission pathways, [27] [28] [29] [30] and immune response associated with viral infection and treatment. 11, 48, 65, 97, 105 viruses with divergent virulence and spreadways can cause diverse human diseases with different types and degrees of damage, as a response of viral infection, studies have confirmed that mvp is enhanced in diverse viral infection, including hbv, hcv, hiv, iav and vsv, and so on. the infection of (−) ssrna viruses (including hcv, vsv, iav, and ev71) or dsrna stimulation activates proinflammatory response by inducing the expression of mvp, il-6, and il-8, enhanced mvp further increase the expression of il-6 and il-8 by translocating transregulatory elements (ap-1 protein complex and c/ebpβ-laps) to the nucleus, 65 and lipopolysaccharide synthesized during viral replication also activates the tlr4 signaling pathway to induce cytokines, chemokines, and ifn-1 against iav replication 107 ; however, the value of mvp in the diagnosis, treatment, and prognosis of viral infection remains unclear and additional studies are still required. hbsag and hbeag compete to bind with mvp, facilitate hbv replication and survival by attenuating the effect of mvp-induced ifn, 48 and ifn and nucleotide analogs (nas) are used for the treatment of patients infected with hbv, the stage of liver diseases is important in guiding antiviral therapy 108 ; however, the effect of mvp on the severity of liver disease and the efficacy of different treatments is unclear. silvestrol, as a potent antiviral compound, inhibits hev assembly by interfering hev capsid protein translation, but deactivates the antiviral effect of mvp by translocating mvp to the perinuclear membrane 97 ; cystatin b, as a cysteine protease inhibitor, increases hiv replication by interacting with mvp and pkm2 to inhibit ifn response and tyrosine phosphorylation of stat-1. 105 mvp plays an opposite role in hiv infection by comparing with iva and hbv infection, weakens the antiviral efficacy of silvestrol in the treatment of hev infection, and additional studies are necessary to clarify the role of mvp more clearly in viral infection. i would like to thank my collaborators for their kind help to organize the thoughts and concepts. synthetic viruses: a new opportunity to understand and prevent viral disease significance of hbv dna by pcr over serological markers of hbv in acute and chronic patients. indian outbreak of infection with hepatitis a virus (hav) associated with a foodhandler and confirmed by sequence analysis reveals a new hav genotype ib variant survey of enterovirus infections from hand, foot and mouth disease outbreak in china who ebola response team. ebola virus disease in west africa -the first 9 months of the epidemic and forward projections cross-species virus transmission and the emergence of new epidemic diseases the influenza viruses specific incorporation of heat shock protein 70 family members into primate lentiviral virions physiological and pathological function of serine/arginine-rich splicing factor 4 and related diseases cellular proteins in influenza virus particles human hepatitis b virus surface and e antigens inhibit major vault protein signaling in interferon induction pathways isolation and characterization of a novel ribonucleoprotein particle: large structures contain a single species of small rna the vault complex the lrp gene encoding a major vault protein associated with drug resistance maps proximal to mrp on chromosome 16: evidence that chromosome breakage plays a key role in mrp or lrp gene amplification vaults. ii. ribonucleoprotein structures are highly conserved among higher and lower eukaryotes cryoelectron microscopy imaging of recombinant and tissue derived vaults: localization of the mvp n termini and vparp the drug resistance-related protein lrp is the human major vault protein the 193-kd vault protein, vparp, is a novel poly(adp-ribose) polymerase characterization of mvp and vparp assembly into vault ribonucleoprotein complexes vaults and telomerase share a common subunit, tep1 vaults are upregulated in multidrugresistant cancer cell lines evidence that vault ribonucleoprotein particles localize to the nuclear pore complex characterization of the sea urchin major vault protein: a possible role for vault ribonucleoprotein particles in nucleocytoplasmic transport mechanisms underlying lung resistance-related protein (lrp)-mediated doxorubicin resistance of non-small cell lung cancer cells molecular basis for the expression of major vault protein induced by hyperosmotic stress in sw620 human colon cancer cells major vault protein (mvp) gene polymorphisms and drug resistance in mesial temporal lobe epilepsy with hippocampal sclerosis major vault protein, in concert with constitutively photomorphogenic 1, negatively regulates c-jun-mediated activator protein 1 transcription in mammalian cells pten associates with the vault particles in hela cells crosstalk between src and major vault protein in epidermal growth factordependent cell signalling the major vault protein is responsive to and interferes with interferon-gamma-mediated stat1 signals phosphatase and tensin homologue deleted on chromosome 10 (pten) has nuclear localization signal-like sequences for nuclear import mediated by major vault protein lung resistance-related protein as a predictor of clinical outcome in advanced testicular germcell tumours on the role of major vault protein in the resistance of senescent human diploid fibroblasts to apoptosis listeria and autophagy escape: involvement of inlk, an internalin-like protein host resistance to lung infection mediated by major vault protein in epithelial cells evaluation of mdr1, lrp, mrp, and topoisomerase iialpha gene mrna transcripts before and after interferonalpha, and correlation with the mrna expression level of the telomerase subunits htertand tep1 in five unselected human melanoma cell lines innate immunity to virus infection pathogen recognition and innate immunity rig-i-mediated antiviral responses to single-stranded rna bearing 5 0 -phosphates length-dependent recognition of double-stranded ribonucleic acids by retinoic acid-inducible gene-i and melanoma differentiation-associated gene 5 irf-7 is the master regulator of type-i interferon-dependent immune responses irf family of transcription factors as regulators of host defense convergence of the nf-kappab and irf pathways in the regulation of the innate antiviral response toll-like receptors in innate immunity the immunobiology of the tlr9 subfamily pattern recognition receptors and control of adaptive immunity a diverse range of gene products are effectors of the type i interferon antiviral response inducible major vault protein plays a pivotal role in double-stranded rna-or virus-induced proinflammatory response nf-kappab regulation in the immune system ikk-1 and ikk-2: cytokine-activated ikappab kinases essential for nf-kappab activation global epidemiology of hepatitis b virus infection: new estimates of agespecific hbsag seroprevalence and endemicity time trends of chronic hbv infection over prior decades-a global analysis estimations of worldwide prevalence of chronic hepatitis b virus infection: a systematic review of data published between hepatitis b virus infection an overview of the immune system the role of interferon in cancer therapy: a current perspective the role of interferon therapy in hepatitis b combination therapy (interferon alfa and ribavirin) in the treatment of chronic hepatitis c: a rapid and systematic review distinct poly(i-c) and virus-activated signaling pathways leading to interferonbeta production in hepatocytes the host type i interferon response to viral and bacterial infections the family of five: tir-domaincontaining adaptors in toll-like receptor signalling the ikappab kinase complex regulates the stability of cytokineencoding mrna induced by tlr-il-1r by controlling degradation of regnase-1 sequential control of toll-like receptor-dependent responses by irak1 and irak2 traf6 is a signal transducer for interleukin-1 major vault protein: a virusinduced host factor against viral replication through the induction of type-i interferon hepatitis b virus polymerase impairs interferon-alpha-induced stat activation through inhibition of importin-alpha5 and protein kinase c-delta hepatitis b virus suppresses toll-like receptor-mediated innate immune responses in murine parenchymal and nonparenchymal liver cells hbsag inhibits tlr9-mediated activation and ifn-alpha production in plasmacytoid dendritic cells chronic inflammation: importance of nod2 and nalp3 in interleukin-1beta generation the pro-and anti-inflammatory properties of the cytokine interleukin-6 tumor-produced interleukin-8 attracts human myeloid-derived suppressor cells and elicits extrusion of neutrophil extracellular traps (nets) activation of il-8 gene expression by helicobacter pylori is regulated by transcription factor nuclear factor-kappa b in gastric epithelial cells transcription factors nf-il6 and nf-kappa b synergistically activate transcription of the inflammatory cytokines, interleukin 6 and interleukin 8 fos/ap-1 proteins in bone and the immune system ap-1 subunits: quarrel and harmony among siblings the role of jun, fos and the ap-1 complex in cell-proliferation and transformation the c-fos protein interacts with c-jun/ap-1 to stimulate transcription of ap-1 responsive genes translational regulation mechanisms of ap-1 proteins effects of il-10 and il-4 on lps-induced transcription factors (ap-1, nf-il6 and nf-kappa b) which are involved in il-6 regulation. leukemia human cytomegalovirus induces interleukin-8 production by a human monocytic cell line, thp-1, through acting concurrently on ap-1 and nf-kappab-binding sites of the interleukin-8 gene ccaat/enhancer binding proteins are critical components of the transcriptional regulation of hematopoiesis the c/ebpb isoform 34-kda lap is responsible for nf-il-6-mediated gene induction in activated macrophages, but is not essential for intracellular bacteria killing cutting edge: influenza a virus activates tlr3-dependent inflammatory and rig-i-dependent antiviral responses in human lung epithelial cells detrimental contribution of the toll-like receptor (tlr)3 to influenza a virus-induced acute pneumonia hepatitis e virus (hev): molecular cloning and sequencing of the full-length viral genome hepatitis e virus hepatitis e: discovery, global impact, control and cure public health risks associated with hepatitis e virus (hev) as a food-borne pathogen seroprevalence of hepatitis e virus (hev) and detection of hev rna with a transcriptionmediated amplification assay in blood donors from catalonia hepatitis e virus in blood components: a prevalence and transmission study in southeast england chronic hepatitis e with cirrhosis in a kidney-transplant recipient treatment of chronic hepatitis e in liver transplant recipients with pegylated interferon alpha-2b three-month pegylated interferon-alpha-2a therapy for chronic hepatitis e virus infection in a haemodialysis patient ribavirin for chronic hepatitis e virus infection in transplant recipients antitumor activity and mechanism of action of the cyclopentabbenzofuran, silvestrol hepatitis e virus (hev) protease: a chymotrypsinlike enzyme that processes both non-structural (porf1) and capsid (porf2) protein inhibition of hepatitis e virus spread by the natural compound silvestrol nuclear localization of the major vault protein in u373 cells emerging concepts in the immunopathogenesis of aids quantification of latent tissue reservoirs and total body viral load in hiv-1 infection the latent reservoir for hiv-1: how immunologic memory and clonal expansion contribute to hiv-1 persistence proteomic analyses associate cystatin b with restricted hiv-1-1 replication in placental macrophages cystatin b associates with signal transducer and activator of transcription 1 in monocytederived and placental macrophages restricted hiv-1 replication in placental macrophages is caused by inefficient viral transcription inhibition of interferon response by cystatin b: implication in hiv replication of macrophage reservoirs enhancement of hiv-1 replication by opiates and cocaine: the cytokine connection the tlr4-trif pathway protects against h5n1 influenza virus infection update on prevention, diagnosis, and treatment of chronic hepatitis b: aasld 2018 hepatitis b guidance the authors declare no potential conflict of interest.orcid pengyun wang https://orcid.org/0000-0001-6801-0705 fubing wang https://orcid.org/0000-0002-5971-2622 qingfeng ma https://orcid.org/0000-0002-1676-3235 key: cord-001247-pxzbirqd authors: sun, lu; zhang, yu; zhao, bao; deng, mengmeng; liu, jun; li, xin; hou, junwei; gui, mingming; zhang, shuijun; li, xiaodong; gao, george f.; meng, songdong title: a new unconventional hla-a2-restricted epitope from hbv core protein elicits antiviral cytotoxic t lymphocytes date: 2014-03-22 journal: protein cell doi: 10.1007/s13238-014-0041-4 sha: doc_id: 1247 cord_uid: pxzbirqd cytotoxic t cells (ctls) play a key role in the control of hepatitis b virus (hbv) infection and viral clearance. however, most of identified ctl epitopes are derived from hbv of genotypes a and d, and few have been defined in virus of genotypes b and c which are more prevalent in asia. as hbv core protein (hbc) is the most conservative and immunogenic component, in this study we used an overlapping 9-mer peptide pool covering hbc to screen and identify specific ctl epitopes. an unconventional hla-a2-restricted epitope hbc141–149 was discovered and structurally characterized by crystallization analysis. the immunogenicity and anti-hbv activity were further determined in hbv and hla-a2 transgenic mice. finally, we show that mutations in hbc141–149 epitope are associated with viral parameters and disease progression in hbv infected patients. our data therefore provide insights into the structure characteristics of this unconventional epitope binding to mhc-i molecules, as well as epitope specific ctl activity that orchestrate t cell response and immune evasion in hbv infected patients. around 350 million people worldwide are chronically infected with hepatitis b virus (hbv). chronic hbv infection is a major cause of cirrhosis, liver failure, and hepatocellular carcinoma (hcc) (lavanchy, 2005; neuveut et al., 2010) . hbv-specific cd8 + t lymphocytes (ctl)-mediated immune response is multi-specific, polyclonal, and vigorous during acute hepatitis b (ahb), which plays a vital role in viral control and viral clearance, as well as disease pathogenesis (yukihiro, 2012; westover and hughes, 2007; tan et al., 2008) . whereas hbv-specific ctl response is minimal or undetectable in chronic hepatitis b (chb) with viral persistence and immune tolerance, indicating the key role of hbvspecific t-cell response in determination of disease progression and outcome (bertoletti and gehring, 2006; . the hbv genome of ∼3.2 kb in length efficiently encodes several overlapping viral proteins, including the polymerase, core, hbe, envelope (pre-s1, s2, s), and x proteins. analysis of ctls specific for viral epitopes within core (sendi et al., 2009; liu et al., 2012; ) , envelope (liu et al., 2008) , polymerase (rehermann et al., 1995) , and x (hwang et al., 2002) proteins showed that the highly conserved hbv core protein (hbc) elicits the strongest ctl responses than other viral proteins, suggesting that hbc-specific t cell response may play a leading role in viral control and clearance. to identify immune-dominant hbv-specific ctl epitopes, especially epitopes from hbc protein, is therefore necessary for monitoring t cell responses during disease progression, as well as for developing epitope-based therapeutic vaccines against chb (inchauspe and michel, 2007; gordon et al., 2013; liu et al., 2013a, b) . so far 60 hbv-specific human leukocyte antigen (hla) class i restricted and 32 hbv-specific hla class ii restricted epitopes have been identified in all 8 hbv genotypes (desmond et al., 2008; liu et al., 2008; guo et al., 2011; chen et al., 2013; tan et al., 2013) . however, most of these identified epitopes are derived from hbv of genotypes a and d, few hla class i restricted epitopes have been defined in virus of genotypes b and c, which are more prevalent in asia. meanwhile, currently the mostly used methods to predict and identify t cell epitopes are either by computer algorithms based on the mode of peptide binding to mhc molecules, or measurement of t cell responses of pbmcs simulated with panels of overlapping peptides (liu et al., 2011) . these epitope identification strategies may ignore unconventional t cell epitopes as computational analysis is largely based on the characteristic of anchor residues. in this study, an overlapping 9-mer peptide pool was used to screen and identify hbv genotypes b-and c-derived t cell epitopes. a new unconventional cd8 + t cell epitope hbc141-149 derived from viral core protein, which shares partial sequence identity with previously reported hbc141-151 (bertoni et al., 1997) and hbc139-148 (lee et al., 1997) , was discovered. its immunological function and clinical relevance were further assessed. identification of a new hla-a*0201-restricted epitope from hbv core protein hbv core protein is the most conservative and immunogenic component of hbv proteins. we used an overlapping 9-mer peptide pool covering the whole length of core protein (aa 1-150) and its variants (totally 191 peptides) for t2 binding assay to screen genotype b-and c virus-derived hbcag-specific t cell epitopes , as shown in fig. 1a . several peptides were found to have high affinity for binding to hla-a*0201 molecules, as evidenced by the fi (0.72 for hbc183-191, 2.41 for hbc141-149, 2.64 for hbc60-68 (v60), 2.47 for hbc18-27, and 0.04 for hbc82-90), as shown in fig. 1b . hbc141-149 spanning from hbc aa 141 to 149 was chosen as the focus of this study due to its high binding affinity among the top hits from screening. to determine the minimal sequence length of the epitope, panels of n-or c-terminally truncated or extended peptides of hbc141-149 were synthesized. the fis of truncated peptide hbc141-148 (stlpettv) and hbc142-149 (tlpettvv) were only 0.124 and 0.151, respectively (fig. 1c) . the fis of decapeptides hbc140-149 (lstlpettvv) and hbc141-150 (stlpettvvr) were only 0.033 and 0.005, respectively (fig. 1d ). all hbc141-149 truncated and extended peptides displayed little binding to hla-a*0201, which indicates that the 9-mer peptide hbc141-149 is the optimized epitope in length. in addition to t2 cell binding assay, the capability of hbc141-149 to bind to hla-a*0201 was observed in the refolding assay (fig. 1e ). the structure of hla-a*0201/hbc141-149 complex next, the complex of hla-a2 and hbc141-149 was prepared for crystallization to characterize the binding features of hbc141-149. the crystal structure of the hla complex was determined to 2.3 å resolution (table 1 ). the structure of hla-a*0201/hbc141-149 shows that hbc141-149 possesses a typical conformation of an hla-a2-restricted 9-mer epitope ( fig. 2a and 2b ). the unambiguous electron densities of hbc141-149 clearly show that position 2 (t2) and position 9 (v9) are buried in pockets b and f, respectively (fig. 2c ). compared to the typical hla-a2-restricted epitopes which have an anchor residue leu or met at position 2, hbc141-149 has thr at position 2. the side chain oh of thr does not disrupt its inserting into the hydrophobic pocket b properly (fig. 2d) . instead, the side chain oh of thr can form a strong hydrogen bond interaction with h atom of glu on the α1 domain of the heavy chain, which helps hbc141-149 binding to the hla-a2 heavy chain and stabilizes the entire complex. the side chains of amino acids p4, e5, and v8 protrude out from the hla-a2 surface and may be involved in t cell receptor (tcr) attachment and recognition. to the best of our knowledge, this is the first structure showing the binding features of hla-a2 to hbc141-149 with an unconventional p2 anchor thr. hbc141-149 peptide generates specific ctl response in hla-a2.1/kb transgenic mice then, the immunogenicity of hbc141-149 epitope was determined in vivo. female hla-a2.1/kb transgenic mice were immunized with hbc dna-prime/hbc141-149 peptide boost regimen three times, using heat shock protein gp96 as adjuvant (li et al., 2011) . hbc141-149-specific ctl was detected by elispot assay 1 week after the last immunization. as can be seen in fig. 3a , similar to the hbc18-27 peptide-immunized mice (positive control), a strong ctl response was observed in splenocytes from hbc141-149 peptide-immunized mice (sfc, 145.4 ± 58.6) . no peptidespecific cd8 + t cell response was detected from hbc82-90 peptide-immunized mice (negative control). similar results were observed in the killing assay using hbv plasmidtransfected 293t cells (fig. 3b ) or hbc141-149 peptidepulsed t2 cells (fig. 3c ) as target cells. to further determine the epitope-specific ctls, fresh pbmcs from hla-a2 + ahb patients were stimulated with hbc141-149 peptide and detected by ex vivo ifn-γ elispot assays. as shown in fig. 3d , a much higher peptide-specific ctl response was observed in pbmcs stimulated with hbc141-149 or the immunodominant peptide hbc18-27 as the positive control than negative control peptide hbc82-90 (119.68 ± 76.66 for hbc141-149 or 164.58 ± 112.41 for hbc18-27 vs. 20.94 ± 17.57 for hbc82-90, both p < 0.01). the high standard deviations observed in elispot assay may reflect the random between-patient variation. taken together, these results indicate that hbc141-149 is an hla-a2-restricted cd8 + tcell epitope and is naturally processed in patients with hbv infection. hbc141-149 epitope elicits antiviral t cell immunity in hla-a2.1/hbv transgenic mice next, we examined whether hbc141-149 epitope was able to induce anti-hbv t cell response using f1 hybrids of hbv transgenic balb/c mice and hla-a2.1/kb transgenic mice as the experimental model, which are hbv immunotolerant. hla-a2.1/hbv transgenic mice were immunized with an hbc dna prime/ hbc141-149 peptide boost formulation. as shown in fig. 4a , compared to mice immunized with negative control peptide, the number of sfcs increased by around 6-fold in hbc141-149 peptide-immunized mice. similar result was obtained in cytotoxicity assay using hbv plasmid-transfected 293t cells as target cells. we then evaluated hbc141-149 peptide-induced tcell response could lead to inhibition of hbv. immunization with hbc141-149 led to a 35.5% decrease in serum hbsag levels (p < 0.05) (fig. 4c) , and a significant reduction of viral dna levels (p < 0.05) (fig. 4d ) at week 8 compared to the negative control. meanwhile, significant lower levels of serum hbsag and viral dna were observed after immunization (at week 8) than those before immunization (at week 0) in hbc141-149-treated mice but not in control peptidetreated mice. and these results indicate that the epitope-specific ctl response induced by the hbc141-149 could significantly inhibit hbv replication in the transgenic mice. in vitro refolding of hbc141-149 peptide with hla-a*0201 heavy chain and β2m. gel filtration chromatography was used to analyze the refolded complexes on a superdex200 16/60 column. the hla complex with the expected molecular mass of 45 kda eluted at the volume of 15.9 ml. the hla complex (peak 2) was analyzed by sds-page electrophoresis and coomassie blue staining (line 2). finally, to address the clinical relevance of the hbc141-149 epitope in chb, mutations within this epitope were analyzed in 197 chb and 64 aclf patients (table 2 ). in chb, compared to patients infected with wild-type isolates (hbc141-149, stlpettvv), patients infected with hbc141-149 mutants had much higher alt levels (247.7 ± 18.62 vs. 545.2 ± 137.7, p < 0.05) (fig. 5a ) and aspartate aminotransferase (ast) levels (187.6 ± 13.78 vs. 1668 ± 700.5, p < 0.05) (fig. 5b) . notably, compared to chb patients infected with hbc141-149 wild-type viruses, patients with hbc141-149 mutants had much higher (approximately 3.3-fold) hbv dna loads (p < 0.05) (fig. 5c ). there were no statistical differences in sex and age between patients infected with the wild-type and mutant isolates. the prevalence of the hbc141-149 mutations increased with the disease progression in hbv-infected patients (fig. 5d ). to investigate the impact of these sequence variations within hbc141-149 epitope on its immunogenicity, three 9-mer peptides containing main epitope variations of hbcv149i, hbct147a, and hbct147c in chb patients were synthesized, respectively, for hla-a2.1/kb transgenic mice immunization. as seen in fig. 5e , compared to the wild-type hbc141-149 peptide-immunized mice (sfc, 96.7 ± 6.02), ctl responses by elispot assay were significantly decreased in hbcv149i mutant peptide-(sfc, 66.3 ± 5.69) or hbct147a mutant peptide-immunized mice (sfc, 73 ± 7.81). taken together, these results suggest that the hbc141-149 mutations associated with necroinflammation and higher hbv levels, and it may also be associated with poor prognosis, which may be due to viral immune evasion. in this study, we identified a new hla-a2-restricted cd8 + t cell epitope hbc141-149 by screening an overlapping 9-mer peptide pool covering hbv core protein. this unconventional hla-a2 restricted epitope was further determined and structurally characterized by hla-a2 transgenic mouse model and crystallographic analysis. moreover, we demonstrated that the hbc141-149 epitope exhibits antiviral capability in hla-a2.1/hbv transgenic mice. finally, our results show that mutations in hbc141-149 epitope correlate with clinically relevant parameters in chb. our work may therefore provide a comprehensive evaluation of the impact of the newly defined epitope on viral specific t cell response and suggests a possible immune evasion for maintenance of viral persistence in patients with hbv infection. the identification of hbv-specific t cell epitopes is mostly based on the binding mode of the peptides to mhc molecules in silico prediction or assessing t cell responses with panels of overlapping peptides in hbv-infected patients. these methods are effective and rapid to purposefully identify epitopes, however, a considerable number of atypical or unconventional epitopes may be ignored or missed by these methods due to the limitation of anchor residues analysis-based computation (liu et al., 2011) . in this study, an overlapping 9-mer peptide pool was used to screen b and c genotype-derived hbc-specific ctl epitopes, and hbc141-149 was identified as a new 9-mer hla-a2restricted t cell epitope. importantly, similar numbers of hbc141-149-specific and immunodominant epitope hbc18-27-specific cd8 + t cells were observed in ahb patients (fig. 3c) , indicating that hbc141-149 is an immunodominant epitope in hbv-infected patients. however, the newly defined epitope hbc141-149 (stlpettvv) in this study possesses thr at position 2. different t cell epitope prediction programs, including syfpeithi (http://www.syfpeithi. de/scripts/mhcserver.dll/epitope-prediction.htm), net-mhc (http://www.cbs.dtu.dk/services/netmhc/), and bimas (http: //www-bimas.cit.nih.gov) show the binding score of the epitope hbc141-149 to hla-a2 is only 0, 1.465, and 0.414, respectively. as hbc141-149 does not get a high score, it could be omitted in conventional screening. interestingly, as for hbc141-149 (stlpettvv), the side chain oh of thr2 can form a stronger hydrogen bond interaction with glu on α1 domain of the heavy chain, which helps its inserting into lu sun et al. pocket b (fig. 2d ) of hla-a*0201 and stabilize the entire complex. therefore, our data indicated that thr may also act as a dominant role as a p2 anchor for hla-a2-binding peptides, which may be taken into consideration in the future designation of these online prediction programs. cd8 + t cells are the main effector cells responsible for viral clearance as well as disease pathogenesis during hbv infection (thimme et al., 2003; harari et al., 2006; ouyang et al., 2013) . as a consequence of long-term interaction between hbv and infected patients, the virus evolves mutations to reduce epitopes for evading immune detection and clearance, especially escape from t cell recognition (maman et al., 2011; westover and hughes, 2007) . indeed, nonsynonymous mutations in hbv epitope have been found to be associated with disease progression in chb (kim et al., 2011; frelin et al., 2009) . consistent to these studies, we found that mutations in the newly defined epitope are positively related to viral parameters and pathogenesis of liver disease. the effect of mutations within hbc141-149 on viral replication capability, as well as the potential impact of the epitope-specific ctls on the interplay of hbv and chronically infected patients remains to be addressed. in summary, this study indicates that hbc141-149 is an immunodominant hla-a2-restricted ctl epitope with atypical binding characteristics to hla-a2 molecules, has potent anti-hbv immune activity and the clinical significance in patients with hbv infection. we further demonstrated that mutations within this epitope may affect disease progression in chb. given the key role of cd8 + t cells in viral clearance, our work provides valuable insight for the functional implications of hbc141-149 epitope-specific t cell response in hbv infection. understanding the epitope-specific ctl function in the complex regulation networks that orchestrate t cell response, viral persistence and immunoevasion in chb will allow to predict disease progression and develop immunotherapeutic approaches against hbv infection. all the enrolled patients' clinical characteristics are described in table 2 . a total of 29 ahb patients were enrolled for blood collection, which were divided into two groups: hla-a2-positive (n = 19) and hla-a2-negative (n = 10). all patients were negative for hcv, hdv, and hiv-1 infection. 10 ml of blood samples were collected from each patient. all patients were hospitalized in beijing 302 hospital from september 2010 to september 2011. all study participants have written informed consent and the study was approved by the ethics committee of beijing 302 hospital. hbv transgenic balb/c mice were purchased from transgenic engineering lab, infectious disease center (guangzhou, china), which were generated with a viral dna construct, phbv1.3, containing 1.3 copies of the hbv genome. serum hbv s antigen (hbsag) and viral dna, as well as hbc expression in hepatocytes in mice's liver, were tested positive for all transgenic mice. the hla-a2.1/kb transgenic mice (zhang et al., 2007) , and t2 cells labeled with cfse were loaded with 20 μg/ml peptide at 37°c for 1 h as target cells (c). the target cells were then mixed with hbc141-149-stimulated splenocytes at different ratios: 1:1, 1:10, and 1:20, or hbc18-27, hbc82-90-stimulated splenocytes served as positive or negative controls. after 4 h, the mixed samples were stained with pi, and the killing of target cells were analyzed by facs. the data shown are the mean ± sd of five mice. (d) ahb patients (n = 29) were divided into hla-a2-positive (n = 19) and hla-a2-negative (n = 10) groups. pbmcs (2 × 10 5 /well) from these patients were stimulated with the indicated peptides for detection of peptide-specific ctls by elispot assay. hbc82-90 peptide served as negative control for background evaluation in elispot assay. pbmcs from hla-a2-patients were used for specificity evaluation of ctls. paired samples t-tests were used for elispot assay in ahb patients. *p < 0.05 and **p < 0.01 by t-test. data are representative of two independent experiments. by professor huang wl (imcas, beijing, china). the hla-a2.1/kb mice and hbv transgenic mice were crossed to gain the f1 hybrids of hla-a2.1/hbv transgenic mice. all f1 hybrids were screened for serum hbsag by elisa, viral dna by real-time pcr, and hla-a2 by pcr-ssp (protrans, deutschland) before experimental manipulations. the wild-type hbc gene was cloned into pcdna3.1 (invitrogen) and the recombinant plasmid was designated pcdna3.1-hbc. phbv1.3 containing 1.3 copies of the full-length hbv genomic sequence was maintained in the lab. the hbc sequences of genotypes b and c were attained using the protein database from ncbi and a total of 171 hbc sequences of genotype b and 159 hbc sequences of genotype c included. the sequences were compared and served as a basis on peptide synthesis. if the variation rate of a certain amino acid (aa) was more than 10%, a series of peptides associated with this variation would be synthesized. we adopted the overlapping method (8-aa overlap) to synthesize a total of 191 nonapeptides (9-mers) covering hbc1-150 aa . all of these peptides were synthesized at jier biological (shanghai, china), and their purity was determined as >95%. the hbc18-27 (flpsdffpsv) and hbc82-90 (rel-vvsyvn) peptides were used as positive and negative controls, respectively. the 293t fig. 3 . fresh splenocytes (5 × 10 5 ) isolated from immunized mice were stimulated with wild-type or mutant peptide, respectively. peptide-specific ctls were detected by ifn-γ elispot assay. by the manufacturer. cells and supernatants were harvested at 24 h, 48 h, and 72 h after transfection, respectively. t2 cells were used to perform mhc stabilization assays as previously described (zhou et al., 2006) . the binding activity of each peptide was calculated as the fluorescent index (fi), and the fi was determined by: (mean fitc fluorescence with the given peptide − mean fitc fluorescence without peptide) (mean fitc fluorescence without peptide). peptides regarded as epitopes with high affinity should meet the following criteria: fi ≥1. refolding, protein crystallography, and structure determination recombinant proteins of hla-a*0201 heavy chain and β2m were expressed in escherichia coli (garboczi et al., 1992.) and the gradual dilution method was performed during refolding process (liu et al., 2012) . then, superdex 200 10/300 gl gel filtration chromatography followed by resource-q anion-exchanged chromatography (ge healthcare) was used for the concentration and purification of the soluble portion of the refolded complex. the hanging-drop vapor diffusion method was performed at 18°c to crystallize the purified complexes. at a final concentration of 10 mg/ml in 0.1 mol/l bis-tris (ph 6.5) and 25% (w/v) polyethylene glycol 3350, hla-a0201/hbc141-149 crystals were obtained. equipped with an r-axis v||++ image-plate detector, rigaku micromax007 rotating-anode x-ray generator was operated at 40 kv and 20 ma (cu κα; λ = 1.5418 å) to collect crystallographic data at 100 k in house. with protein data bank (pdb) entry 1jf1 as the search model, the structure of hla-a*0201/hbc141-149 was determined by molecular replacement with the program molrep. mice (6-8 weeks old) were immunized i.m. with 50 μg of plasmid pcdna3.1-hbc or pcdna3.1 (control) at week 1 and subcutaneously with 50 μg of hbc141-149 peptide bound to 30 μg of heat shock protein gp96 as adjuvant (li et al., 2011) at weeks 3 and 4, respectively. mice were sacrificed 1 week after the last immunization. splenocytes were isolated as previously described (liu et al., 2009) . each group contained five to seven mice. to detect epitope-specific t cells, enzyme-linked immunosorbent spot (elispot) assay was performed according to the manufacturer's instruction. briefly, ninety-six well pvdf plates (bd-pharmigen, san diego, ca) were precoated overnight at 4°c with the coating ab and blocked for 1 h at 37°c. patient pbmcs (2 × 10 5 ) or murine splenocytes (10 6 ) were added to each well together with 50 μg/ml of peptide and incubated at 37°c for 24-48 h with phytohemagglutinin (pha)-stimulated t cells as positive controls. each test was performed at least in triplicate. the spots were counted and analyzed using an elispot reader (cellular technology ltd, usa). 293t cells were labeled with 2 μmol/l cfse as target cells after transfection with phbv1.3 and seeded into a 96-well plate. then ctls were added at different ratios: 1:1, 10:1, and 20:1. plates were incubated for 4-6 h at 37°c, and cfse positive target cells were stained with propidium iodide (pi) using a vybrant apoptosis assay kit (invitrogen, usa). in addition, t2 cells were loaded with 20 μg/ml hbc141-149 peptide at 37°c for 1 h as target cells, and seeded into a 96-well plate. the cytotoxicity assay was performed as described above. each assay was performed in triplicate. detection of hbsag and hbeag by elisa, and hbv dna by realtime pcr elisas and real-time pcr for detection of serum hbsag, hbeag and viral dna copies were performed as described (fan et al., 2013) . differences between groups were determined using student's t-test. pearson's χ test was used to detect the correlation between variation rate and disease progress in hbv infected patients. clinical statistical analyses were performed with spss version 16.0 software (spss inc., chicago, illinois). p values <0.05 were considered significant. the immune response during hepatitis b virus infection human histocompatibility leukocyte antigen-binding supermotifs predict broadly cross-reactive cytotoxic t lymphocyte responses in patients with acute hepatitis an immunodominant hla-a*1101-restricted cd8 + t cell response targeting hepatitis b surface antigen in chronic hepatitis b patients a systematic review of t-cell epitopes in hepatitis b virus: identification, genotypic variation and relevance to antiviral therapeutics increased expression of gp96 by hbx-induced nf-κb activation feedback enhances hepatitis b virus production a mechanism to explain the selection of the hepatitis e antigen-negative mutant during chronic hepatitis b virus infection hla-a2-peptide complexes: refolding and crystallization of molecules expressed in escherichia coli and complexed with single antigenic peptides antiviral therapy for chronic hbv infection and development of hepatocellular carcinoma in a u.s. population identification and functional studies of hla-a0201 restricted ctl epitopes in the x protein of hepatitis b virus functional signatures of protective antiviral t-cell immunity in human virus infections hla-a2 1 restricted peptides from the hbx antigen induce specific ctl responses in vitro and in vivo vaccines and immunotherapies against hepatitis b and hepatitis c viruses number of mutations within ctl-defined epitopes of the hepatitis b virus (hbv) core region is associated with hbv disease progression worldwide epidemiology of hbv infection, disease burden, and vaccine prevention peptide-specific ctl induction in hbv-seropositive pbmc by stimulation with peptides in vitro: novel epitopes identified from chronic carriers hansenula polymorpha expressed heat shock protein gp96 exerts potent t cell activation activity as an adjuvant a mutant hbs antigen (hbsag)183-191 epitope elicits specific cytotoxic t lymphocytes in acute hepatitis b patients treg suppress ctl responses upon immunization with hsp gp96 revival of the identification of cytotoxic t-lymphocyte epitopes for immunological diagnosis identification of hla-a*0201-restricted cd8 + t-cell epitope c64-72 from hepatitis b virus core protein conserved epitopes dominate cross-cd8+ t-cell responses against influenza a h1n1 virus among asian populations cross-allele cytotoxic t lymphocyte responses against 2009 pandemic h1n1 influenza a virus among hla-a24 and hla-a3 supertype-positive individuals immune-induced evolutionary selection focused on a single reading frame in overlapping hepatitis b virus proteins mechanisms of hbv-related hepatocarcinogenesis cd8(low) t-cell subpopulation is increased in patients with chronic hepatitis b virus infection the cytotoxic t lymphocyte response to multiple hepatitis b virus polymerase epitopes during and after acute viral hepatitis ctl escape mutations of core protein are more frequent in strains of hbeag negative patients with low levels of hbv dna host ethnicity and virus genotype shape the hepatitis b virus-specific t-cell repertoire immunoprevalence and immunodominance of hla-cw0801 restricted t cell response targeting the hbv envelope transmembrane region abbreviations aclf, acute on chronic liver failure; ahb, acute hepatitis b; ctl, cytotoxic t lymphocyte; elispot, enzyme-linked immunosorbent spot; fi, fluorescent index; hbc, hbv core protein; hbeag, hbv e antigen; hbsag, hbv s antigen; hbv, hepatitis b virus; sfc, spotforming cells. lu sun, yu zhang, bao zhao, mengmeng deng, jun liu, xin li, junwei hou, mingming gui, shuijun zhang, xiaodong li, george f. gao, and songdong meng declare that they have no conflict of interest. for studies with human subjects in this article: all patients were hospitalized in beijing 302 hospital from september 2010 to september 2011. written informed consent was provided by all study participants. the study was approved by the ethics committee of beijing 302 hospital.for studies with animals in this article: animals received humane care, and the study of mice was in strict accordance with "the this article is distributed under the terms of the creative commons attribution license which permits any use, distribution, and reproduction in any medium, provided the original author(s) and the source are credited. key: cord-264713-38dlh3wg authors: vernet, guy title: molecular diagnostics in virology date: 2004-08-20 journal: j clin virol doi: 10.1016/j.jcv.2004.06.003 sha: doc_id: 264713 cord_uid: 38dlh3wg molecular biology has significantly improved diagnosis in the field of clinical virology. virus discovery and rapid implementation of diagnostic tests for newly discovered viruses has strongly beneficiated from the development of molecular techniques. viral load and antiviral resistance or subtyping assays are now part of the biological monitoring of patients chronically infected by human immunodeficiency virus (hiv), hepatitis b virus (hbv), hepatitis c virus (hcv) and cmv. it will be important to add to this panel assays for other viruses of the herpesviridae family. qualitative assays for the detection of blood-borne viruses have increased safety of blood donation and organ transplantation. screening of other blood-borne viruses (parvovirus b19, hav), multiplexing of detection and test automation to improve practicability and reduce costs will be the next steps. a major evolution in the near future will be the generalization of nat for the diagnosis of viral etiology in patients, mostly with respiratory, cns or gastro-intestinal diseases. major technical improvements have been made to avoid obstacles that still limit this generalization, i.e. genetic variability of viruses, multiplex detection, contamination risk. commercial offers already exist but menus must be extended to limit the validation and documentation work associated with home-brew assays. real-time amplification has allowed the development of new nat platforms but automation and integration of all steps of the reaction are still required to reduce hands-on-time, time-to-result and costs, and to increase throughput. molecular biology has revolutionized all domains of viruses diagnosis including the rapid identification of emerging or re-emerging viruses, viral safety of blood products or organ transplants and viral disease management. one of the major driving forces for the introduction of molecular techniques in virology has been the absence of easy and performing multiplication techniques similar to those developed for bacteriology. the most striking illustration of the power of molecular techniques concerns blood transmitted viruses-human immunodeficiency virus (hiv), hepatitis b virus (hbv) and hepatitis c virus (hcv) for which spectacular progresses in the detection and treatment of viral diseases have been made following the introduction of qualitative and quantitative nucleic acid tests (nat). the recent discovery of a new human coronavirus responsible for severe acute respiratory syndrome (sars) epidemic is another example. it is obvious that nat will encourage the development of antiviral drugs which, compared to antibiotics, has been delayed partly because performing efficiency assessment techniques were lacking. during the last 15 years, many new human pathogens have been discovered among which eight were viruses with various pathogenicity. molecular techniques have played a central role in their discovery (table 1) . the construction of cdna libraries by cloning techniques has been used to identify hcv and hepatitis e virus. representational difference analysis (rda) was successful in identifying human herpes virus 8 (hhv-8), and the hepatic viruses gbv-c and ttv. rda allows the detection of viral sequences by comparing whole nucleic acids sequences in cells from humans or animals before and after infection. reverse-trancription polymerase chain reaction (rt-pcr) with random or degenerate primers has been used to identify human metapneumovirus (hmpv), the virus sen and the coronavirus associated to sars (sars-cov). molecular techniques alone have allowed the characterization of very important human pathogens like hhv-8, responsible of kaposi sarcoma or hcv which induce acute or chronic hepatitis, cirrhosis and hepatocarcinoma. however, other viruses detected in a similar way are still waiting for the demonstration of their clinical importance. this illustrates the need to verify koch's postulate and the importance of keeping laboratory competencies for classical virology-tissue culture, electron microscopy and animal experiments-which plays a major role in virus discovery, together with epidemiological studies. large epidemiological studies are also required to assess the clinical interest of new pathogens. molecular diagnostics have been very rapidly implemented in clinical virology laboratories following the discovery of hmpv (van den hoogen et al., 2001; peiris et al., 2003; boivin et al., 2003) and sars-cov (ksiazek et al., 2003; drosten et al., 2003; anderson, 2003) . a prospective study on the prevalence of hmpv could be initiated as early as during the 2000-2001 winter, although the virus has been discovered in 2000 only. there has been only a few weeks lag between sequencing sars-cov and availability of the first commercial nat. nat are more and more used to exclude blood donations from patients infected by viruses (allain, 2003) . hcv and hiv testing has been implemented as part of routine screening in blood banks in 14 and 7 european countries respectively. in france, two commercial offers -procleix (gen-probe, inc. usa) and nuclisens extractor (biomerieux, france) associated with cobas ampliscreen (roche diagnostics, switzerland)-are used to screen donations for hiv and hcv infections. this allowed the reduction of residual risk from 1 in 400,000 to 1 in 2.5 millions for hiv and 1 in 760,000 to 1 in 5 millions for hcv (assal et al., 2003) . however, there is room from improvement as few contaminated blood units are still missed due to the lack of sensitivity induced by pooling strategies. cost constraints must also be considered if further improvements are to be considered. cost effectiveness of hiv and hcv nat addition to serology testing is already very low: in usa it has been calculated that the cost of each saved life is 4.7-11.2 millions us$ per year (jackson et al., 2003) . hepatitis b virus screening using molecular biology should also be included as even the most recent antigen assays (hbsag) assays miss infected blood units. as an example, single-sample hbv testing would allow the detection of 35-50 additional contaminated units among 10 7 units tested (biswas et al., 2003) . monovalent or trivalent assays (hiv, hbv, hcv) are proposed by roche diagnostics (ampli nat) and gen-probe (procleix ultrio) but blood units should not be pooled to provide sufficient sensitivity. procleix ultrio detects single seroconversions 20 days earlier than abbott prism-hbsag but only 13 days in pools of 8 and 11.5 days in pools of 24 (cambié, 2002) . alternatively, an ultracentrifugation step could be introduced following pooling to obtain a higher sensitivity compared to current antigen assays (roth et al., 2002) . screening for west-nile virus contamination has been implemented in us blood banks. from late june to mid-september 2003, approximately 2.5 million donations were screened. twelve hundred eighty-five (0.05%) were initially reactive for wnv by using nucleic acid-amplification tests and 601 (0.02% of the total donations) are considered presumptive viremic donations (i.e. a donation that is repeatedly reactive by the primary and/or alternate nat assay or a primary nat assay with a very high signal) (cdc, 2003) .other viruses (parvovirus b19, hepatitis a virus) are also transmitted by blood donation and may be part of the screening in a near future. however, nat may not always be the best diagnosis approach and antigen tests or antibody tests may be efficient and less expensive alternatives. automation and integration of nat is necessary to reduce costs and quarantine delays for blood units supply. in this respect, the recent approval by us food and drug administration (fda) of the tigris molecular diagnostic system (gen-probe, san diego, usa) is a major breakthrough as it has been designed to process 500 samples in 8 h. integration and time-to-result are also very important parameters to be considered to insure viral safety of transplant organs, especially lung, heart and liver. it is very important to determine the status of transplants regarding infection by hiv, hbv, hcv and viruses from the herpesviridae family. nat have significantly improved identification of viruses as etiologic agents of human diseases affecting various organs, especially respiratory and gastro-enteric tracts and central nervous system (cns). as a consequence, rapid antiviral treatments can be initiated and considerably reduce morbidity and mortality as, for example, in the case of herpes encephalitis. the increasing number of available antiviral drugs will even accentuate the need for positive viral identification. similarly, unnecessary antibiotic treatments can be avoided or reduced and hospitalisation durations shorten. treatments of chronic viral diseases are very efficiently monitored by viral load assays. however there are still obstacles that prevent a wider dissemination of molecular assays. the extreme genetic variability of some viruses, especially rna viruses (which rna-polymerases have no proofreading activity), often makes their diagnosis difficult. the most striking examples are found in the norovirus family which contains viruses responsible for the vast majority of gastro-intestinal epidemics in adults. hiv diagnosis is also quite difficult to achieve due to its high genetic variability. gardner et al. (2003) have deduced from sequence alignments that a real-time taqman assay should contain not less than nine primer and probe sets to detect with the same sensitivity all hiv strains in a geographically representative panel. to reduce the impact of variability on amplification and detection efficiency, one can use primers and probes with 2 o-methyl bases, degenerate bases or "universal" bases, such as inosine or nebularine. touchdown pcr protocols, in which the annealing temperature slightly decreases during the successive amplification cycles to bracket the melting temperature tm of the reaction, provides sensitivity even when primers have mismatches with target sequences of divergent species in a viral family. finally, degenerate primers or probes, with mixtures of the bases found in sequence databases among various species, may be useful to detect all species of a viral family. it is often desirable to provide the capability for panel detection, i.e. to detect several viruses that can be responsible for a disease. for example, coyle et al. have described at the winter meeting of european society for clinical virology (copenhagen, january 2004) a molecular viral respiratory strip for the detection of 12 common respiratory viruses. whenever possible, consensus primers able to detect all viruses from a family or genus must be used. there are several examples of such consensus primers for enterovirus (kammerer et al., 1994) , flavivirus (scaramozzino et al., 2001) or herpesviridae (tenorio et al., 1993) . however, their ability to amplify all viruses with the same efficiency must be carefully evaluated. if such an approach is not possible, two different possibilities exist for panel detection: multiplex detection in single tubes or parallel detection in individual tubes. mixing primers in a single amplification tube to achieve multiplex detection of viruses usually results in decreased sensitivity of assays compared to single tests. for example, we have observed, using a dna-microarray assay (see below), that the analytical sensitivity of multiplex rt-pcr detection of six viruses, i.e. influenza a, influenza b, rsv a/b, parainfluenza 1, 2 and 3 is reduced by a factor of <1-2 logs compared to single detections, depending on the virus. nevertheless, this multiplex assay was able to identify correctly 21/22 infections in respiratory specimen (one rsv b infection was misidentified as rsv a; unpublished data). the formation of primer dimers is generally considered as the major cause of sensitivity loss but careful optimisation of all parameters of amplification including primer, enzymes, nucleotides and salts concentrations as well as protocol conditions are required to obtain expected performances. realtime assays (see below) that monitor signal apparition during the amplification step are also limited in their capacity to realize multiplex detection by the number of available wavelengths in existing equipments which currently allows the detection of three viruses only. instead of mixing several pairs of primers in a single tube, nucleic acids purified from the original clinical specimen can be distributed into several tubes for independent amplification and detection. major drawbacks of this approach are the reduction of sensitivity because of lower amounts of nucleic acid available for each individual amplification, higher hands-on times required to manipulate all the different tubes, difficulty to automate the distribution of small volumes of purified nucleic acids without introducing cross-contaminations and higher costs due to the need for enzymes in each tube. internal controls (ic) are important components to monitor each step of the assay from extraction of nucleic acids to detection. because inhibitors of the amplification reaction, which are frequent in some specimen types, will also impact its amplification, the presence of an ic is a strong validation in case of negative result. niesters (2002) has described an original approach for internal control of nat: the use of viral universal controls that can be added to each specimen and be amplified with specific primers, preferably in a multiplex format with primers for the virus to detect. seal herpes virus 1 and phocine distemper virus can be used to control nat for dna and rna viruses respectively. of course, animal viruses which can not infect humans are required. other strategies for ic involve synthetic materials, i.e. plasmids or transcripts which contain sequences able to bind the test primers and a specific probe. clinical virology laboratories have high expectations in term of automation and integration of molecular assays. a major bottleneck in the workflow of these laboratories is at the level of sample preparation. table 2 shows automated systems for nucleic acid purification that are currently commercialised. most of them use the nucleic acid binding properties of silica (boom et al., 1990) . as many as 96 samples can be handled in a single run on the biorobot 9604 (qiagen gmbh, germany). time-to-result and, more important, hands-on-time tend to decrease, with the most recent equipments requiring no longer than 20 min of technician time for more than 24 samples. new labelling technologies that do not need solid-phase separation have allowed the development of real-time molecular assays in which the detection of amplicons is done as soon as they appear during amplification. the most simple real-time detection chemistry uses the sybr green dye which specifically binds during double-stranded dna generated during pcr. several probe technologies (fig. 1 ) have also been designed for real-time assays like taqman ( fig. 1a ) or molecular beacons (fig. 1b) in which a quencher molecule is removed from the vicinity of the fluorescent marker upon binding to rna or dna generated during amplification cycles. in the fret technology (fig. 1c) , two probes, one with a fluorescence donor and one with a fluorescence acceptor molecule are designed to bind adjacent sequences of the amplified material to generate signal (mackay et al., 2002) . real-time techniques have been designed for pcr or nasba amplification and have several advantages which facilitate automation and reduce time-toresult (30-120 min) and hands-on-times. they are performed in closed devices which do not need to be opened to transfer amplified material for end-point detection, thus reducing the risk of laboratory or samples cross-contamination. the use of real-time platforms makes the general organisation of molecular biology laboratories easier by reducing the constraints on activities segregation in different rooms to control contaminations. table 3 shows existing real-time automates. the next generation of nat platforms will integrate sample preparation, amplification and detection in a single test device genexpert (cepheid, usa) is the first fully integrated system which allows the detection of bacillus anthracis or group b streptococcus in approximately 45 min directly from clinical specimen. several viral assays based on real-time nasba on this platform will soon be available from biomerieux. several ivd companies offer commercial nat for the diagnosis of viral diseases. besides technical difficulties, another obstacle to the development of molecular assays is the importance of resources needed to optimise, produce and validate home-brew assays and to build up documentation required for qualification of techniques and laboratories. new european community regulations will even increase this need. it is the role of in vitro diagnostic (ivd) companies to provide reagents which are the results of careful optimisation and are produced according to high quality manufacturing procedures. they have clinical and regulatory affairs departments that conduct validation studies and assemble documentation required to get approval of the reagents. however, even for ivd companies, the conception and validation process is time-consuming and timeto-market may be long. this is especially a problem when a diagnostic tool is urgently needed in case of emergence of a new virus. one possibility to reduce time-to-market is to release "research use only" (ruo) assays or assays that have the "ce analytical" approval in europe or the status of "analyte specific reagent" (asr) in the usa. in this case, commercial products that have excellent analytical sensitivity and are manufactured according to quality standards of the ivd industry can be used by clinical virology laboratories, which have the responsibility to validate their use as diagnostic tools and obtain authorization to use them. infections by hiv and hepatitis b and c viruses are usually well diagnosed using serology. only diagnosis of early primo-infections may benefit from nat. platforms like amplicor amplicor from roche diagnostics or easyq from biomerieux that are usually used for viral load measurement during therapy (see below) are also suitable for the early detection of hiv or hcv infections. many other infections and especially acute infections for which igm appear only several days after onset of symptoms cannot be efficiently diagnosed using serology assays. forty to sixty percent of community acquired pneumonia that require hospitalisation 2 have no known aetiology despite intensive investigation and this percentage is even higher when less severe lower respiratory tract infections (lrti) are considered (l. kaiser, personal communication). in a recent study, henrickson et al. (2004) , have shown, using multiplex rt-pcr that 40% of children hospitalised for lrti are infected with the seven most common respiratory viruses. similarly, a recent survey of encephalitis leading to hospitalisation in the usa from 1988 to 1997 has revealed that nearly 60% had no aetiology (khetsuriani et al., 2002) . absence of specific antiviral treatments for most viruses, which limits prescription of biological tests and weak performances of diagnostic tests based on viral culture or serology are major explanations of this situation. nat, which have been implemented by many large european hospitals, significantly improve viral diagnosis. however, there are several obstacles to the generalization of molecular diagnostics in smaller, decentralized laboratories. a major obstacle is the fact that, except for hiv, hbv, hcv and cmv, virology nat are most often home-brew assays which sometimes suffer from bad performances and poor batch to batch consistency. however, quality of nat is the percentage of false-positive results which reflects laboratory or cross-contaminations and used to be high, dropped to 5.5% (wallace et al., 2003) . table 5 shows some products currently commercialised by major companies for viruses other than hiv, hbv and hcv, although the list may not be exhaustive. most of them are asr or ruo kits although some are ec marked. the majority of these reagents have been designed to run on realtime platforms. results shown by liolios et al. in 2001 illustrate the interest of multiplex detection of respiratory viruses by nat. one hundred forty-three clinical specimen were tested using the hexaplex assay from prodesse inc. (usa) which detects six viruses in a single tube using pcr and detection with microplate capture and peroxidase-labelled probes. 9 samples were detected with the prodesse assay only and not with immunofluorescence or viral culture (table 6) . table 6 multiplex nat for the detection of respiratory viruses (hexaplex, prodesse inc.) dna-microarrays or dna-chips are very powerful detection tools that can be combined with amplification techniques to detect viruses or virus variants (reviewed in clewley, 2004) . wang et al. (2002) have described a microarray spotted with 70-mer oligonucleotides which represent the five most conserved sequences (more than 20/70 bases are conserved among all representative sequences in a virus sequence alignment) of each virus of interest. the chip contains 1600 different probes. following pcr amplification of genetic material in the clinical specimen using random primers, hybridisation onto the microarray was able to identify respiratory viruses in the enterovirus, rhinovirus, paramyxovirus, adenovirus and herpesvirus families. however, this technique has not yet been extensively validated for routine diagnosis in a clinical virology laboratory. we have developed assays combining rt-pcr and dna-microarrays for the detection of viruses. the arrays are manufactured using the photolithography in situ synthesis technology (affymetrix, usa) and contain 20-mer oligonucleotides. sequence signatures are identified using extensive sequence databases because they are conserved in all viruses of a genus or family or in all subtypes or isolates of a virus and are not found in other viruses. for each base of the signature, probes perfectly matching the target and probes with a mismatch at the interrogated position are present on the array. if polymorphisms are present in or near the signature, variant probes may also be present. consensus primers have been designed for enterovirus, flavivirus, herpesviridae, parainfluenza and influenza virus, rsv and adenovirus. they can be combined in multiplex detection pcr or rt-pcr assays for the diagnosis of viral respiratory or cns infections. following amplification, dna is labelled using a newly developed diazomethyl chemistry (laayoun et al., 2003) . a complete line of instruments (sample preparation, thermocycler, hybridisation station and laser scanner) is available to perform the assay. as described above, a respiratory assay designed to detect six major viruses (parainfluenza 1, 2 and 3, rsv a/b, influenza a and b) in a single specimen has demonstrated high clinical sensitivity in preliminary evaluation. fig. 2 illustrates the discriminatory capacity of this technology for cns viruses. assays for the identification of human papilloma virus (hpv) are commercialised by several companies. the detection of a highly pathogenic hpv type has a very high predictive value for cervical carcinoma. however, the number of hpv types that are more or less closely associated to cervical cancer is high. dna-microarrays may thus be appropriate for the multiplex detection of all these types. such an assay has been described by and is distributed by biomedlab co. (south-korea). it is based on a consensus amplification and on 30-mer probes that are able to detect and discriminate 22 hpv types and has shown an association of 92.5-97.5% between hpv positivity and lesions of different severity or carcinoma whereas hpv infection was only found in 35.1% of cases when cytology was normal. viral load platforms are available from several ivd companies (versant from bayer diagnostics; cobas ampliprep/ amplicor from roche diagnostics, minimag/nuclisens easyq from biomerieux). significant progress have been made in the ability of most hiv assays to detect all subtypes of hiv-1 but no commercial assay exist for hiv-2. the analytical sensitivity of hbv viral load assays should be increased to reach the same performances as those of hiv assays, especially in the case of infections by variants with low replication competencies. for efficient treatment monitoring of immunosuppressed patients, for example in the case of organ transplantation, viral load assays should also be developed for epstein-barr virus, varicella-zooster virus and hhv6. genotyping tests are now commercially available and are part of the biological follow-up of treated patients although home-brew assays are still used in most laboratories (korn et al., 2003) . hiv and hbv resistance assays as well as hcv subtyping assays are generally based on the sequencing technology (trugene hiv and hbv from bayer healthcare; vi-roseq hiv-1 from celera diagnostics; 5 genotyping hcv kit from bayer healthcare). hybridisation techniques, such as lipa assays (innogenetics, belgium) are also used. however, the number of probes that can be spotted on nitrocellulose strips is limited and only few polymorphisms can be detected which is convenient for hcv subtyping but does not for resistance tests which are based on the detection of a high number of mutations. in addition, hiv and hbv have highly variable genomes and naturally occurring polymorphisms that are present in the vicinity of resistance mutations may affect the binding efficiency of probes. dna-microarrays are an alternative for resistance or typing reagents for viruses or bacteria . we have developed an assay based on rt-pcr and detection with fig. 2 . biomerieux dna-microarray for the detection of neurotropic viruses. following nucleic acid purification, amplification is performed by pcr using a single touchdown protocol in three tubes, one for herpesviridae (one primer pair for hhv 1, 2, 3, 5 and 6), one for enteroviruses (one primer pair for all serotypes) and one for flaviviruses (one primer pair for all viruses). amplification products are combined and labelled using diazomethyl chemistry and hybridised on a dna-microaaray which contains 20-mer oligonucleotides. two or four probes are used for the detection of each base of sequence signatures determined for each virus. a total of 20,000 probes are synthesised on this dna-microarray which has been designed for the simultaneous detection of viruses from the herpesviridae family and from the flavivirus, enterovirus, paramyxovirus, poliomavirus, bunyavirus and orthopoxvirus genus. a: amplicons generated resolved using the bioanalyzer (agilent technologies). b: image of the dna-microarray obtained with a confocal laser reader. c: resolution capability of the array. closely related viruses hybridise with very different efficiency on heterologous probes. high density probe arrays, designed to detect 204 antiretroviral resistance mutations simultaneously in gag cleavage sites, protease, reverse transcriptase, integrase and gp41. this assay has been tested on a panel of 99 hiv-1 patients on a total of 4465 relevant codons in comparison with the classic sequence-based method. key resistance mutations were correctly identified in 95 and 92% of codons in protease and reverse transcriptase, respectively (gonzalez et al., 2004) . we have also developed a similar assay for the detection of polymorphisms in the complete hbv genome: 78 antiviral resistance mutations in pol gene, 146 vaccine, diagnostic or immunotherapy mutation in s gene and 209 mutations in basic core promoter, pre-core, core, x, pre-s1 and pre-s2 regions that may have an impact on disease evolution or treatment efficiency. this assay is currently under evaluation in the frame of hepbvar a european collaborative group for the study of emerging variants of hepatitis b virus. in the coming years, more and more laboratories will offer to clinicians viral diagnosis based on nucleic acid tests. many biological and instrumentation problems that have slowed the generalization of molecular assays have been resolved but several others remain and need to be addressed. major im-provements are expected in the integration and automation of nat diagnostic platforms to reduce hands-on-time, time-toresult and costs and to increase throughput. ivd companies have engaged in development programs to provide clinical virologists with equipments and application menus adapted to their diagnosis needs. technical constraints and recent improvements of molecular assays transfusion risks of yesterday and of today correlation of cervical carcinoma and precancerous lesions with human papillomavirus (hpv) genotypes detected with the hpv dna chip microarray method a novel coronavirus associated with severe acute respiratory syndrome application de la biologie moléculaireà la sécurité virale transfusionnelle: le dépistage génomique viral comparative sensitivity of hbv nats and hbsag assays for detection of acute hbv infection human metapneumovirus infections in hospitalized children rapid and simple method for purification of nucleic acids update: detection of west nile virus in blood donations-united states a role for arrays in clinical virology: fact or fiction identification of a novel coronavirus in patients with severe acute respiratory syndrome limitations of taq-man pcr for detecting divergent viral pathogens illustrated by hepatitis a, b, c, and e viruses and human immunodeficiency virus detection of hiv-1 antiretroviral resistance mutations with highdensity dna probe arrays national disease burden of respiratory viruses detected in children by polymerase chain reaction the cost-effectiveness of nat for hiv, hcv, and hbv in whole-blood donations nested pcr for specific detection and rapid identification of human picornaviruses burden of encephalitisassociated hospitalizations in the united states quality control trial for human immunodeficiency virus type 1 drug resistance testing using clinical samples reveals problems with detecting minority species and interpretation of test results characterization of a novel coronavirus associated with severe acute respiratory syndrome aryldiazomethanes for universal labeling of nucleic acids and analysis on dna chips comparison of a multiplex reverse transcription-pcr-enzyme hybridization assay with conventional viral culture and immunofluorescence techniques for the detection of seven viral respiratory pathogens real-time pcr in virology clinical virology in real-time children with respiratory disease associated with metapneumovirus in hong kong nat for hbv and anti-hbc testing increase blood safety comparison of flavivirus universal primer pairs and development of a rapid, highly sensitive heminested reverse transcription-pcr assay for detection of flaviviruses targeted to a conserved region of the ns5 gene sequences a newly discovered human pneumovirus isolated from young children with respiratory tract disease species differentiation and antibiotic susceptibility testing with dna microarrays linkage between the journal and quality control molecular diagnostics (qcmd) microarray-based detection and genotyping of viral pathogens key: cord-264488-989t9ld1 authors: park, il-hyun; kwon, young-chan; ryu, wang-shick; ahn, byung-yoon title: inhibition of hepatitis b virus replication by ligand-mediated activation of rnase l date: 2014-02-06 journal: antiviral res doi: 10.1016/j.antiviral.2014.01.021 sha: doc_id: 264488 cord_uid: 989t9ld1 rnase l is a cellular endoribonuclease that is activated by 2′,5′-linked oligoadenylates (2–5a), which are unique and specific ligands synthesized by a family of interferon-inducible, dsrna-activated enzymes named oligoadenylate synthetases. in the typical antiviral pathway, activated rnase l degrades viral and cellular rnas, thus limiting viral replication and spread. although the antiviral activity of rnase l has been demonstrated for several rna viruses, there is little evidence regarding its role against dna viruses. in the present study, the potential antiviral activity of rnase l against hepatitis b virus (hbv) was explored utilizing the recently reported infection protocol based on human hepatoma hepg2 cells stably complemented with the virus entry factor ntcp. viral replication and expression in this cell type was markedly inhibited by poly(i:c)or 2–5a-mediated activation of rnase l; however, the inhibition was significantly reversed by rnase l knockdown. further analysis in hbv1.2-transfected huh-7 hepatoma cells indicated that the antiviral activity of rnase l depends on its ribonuclease function. we also provide evidence for the specific roles of oas family members in this process. these results suggest that hbv replication can be regulated through interferon-mediated rna decay pathways and that activation of these host antiviral factors may represent a novel therapeutic strategy for hbv infection. rnase l is a latent endoribonuclease that is constitutively expressed in almost all mammalian cells. this enzyme is activated upon the binding of a specific ligand, 2 0 ,5 0 -linked oligoadenylate (2-5a), which is synthesized by a family of enzymes named oligoadenylate synthetases (oass). oas expression is induced by type i interferons (ifn-a/b), but the enzymes require dsrna for the activation of their catalytic activity (kristiansen et al., 2011) . in the typical antiviral pathway, viral dsrna binds to an oas, which results in the activation of the oas and the synthesis of 2-5a. rnase l, activated upon binding to 2-5a, degrades viral and cellular rnas, thus limiting viral replication and spread (chakrabarti et al., 2011) . in addition to the direct antiviral effect, rnase l can activate intracellular signaling pathways through the small rna cleavage products that it generates, leading to the induction of type i ifn production (malathi et al., 2007) . the antiviral role of rnase l has been established for a number of rna viruses. rnase l-deficient mice exhibited increased susceptibility to infection by these viruses (e.g., the picornavirus emcv and the flavivirus wnv) (silverman, 2007) . recent findings of viral functions that antagonize oas or rnase l, most notably the murine mhv coronavirus ns2-encoded phosphodiesterase that can degrade 2-5a, underscore the importance of rnase l pathway in antiviral immunity (zhao et al., 2012) . compared to its roles against rna viruses, evidence regarding the antiviral role of rnase l against dna viruses (e.g., herpesviruses and vaccinia virus) is limited (rasmussen et al., 2009; xiang et al., 2002; zheng et al., 2001) , although dna viruses can produce dsrna (weber et al., 2006) . hepatitis b virus (hbv) is a hepatotropic dna virus that can cause acute and chronic hepatitis in humans. more than 350 million people worldwide are chronic carriers of the virus and are at risk of progression of the infection to liver cirrhosis and hepatocarcinoma (lok and mcmahon, 2007) . ifn-a is currently the approved treatment for chronic hepatitis b (perrillo, 2009) . however, the mechanism by which ifn-a inhibits hbv replication is not completely understood. a recent etiological study that aimed to identify a potential link between naturally occurring rnase l gene variations (e.g., r462q) and prostate cancer suggested that this gene is correlated with chronic hepatitis b and hiv infections (arredondo et al., 2012) . however, there are few experimental data on the association between hbv and rnase l. in an early study, hbv replication was notably inhibited following poly(i:c) http://dx.doi.org/10.1016/j.antiviral.2014.01.021 0166-3542/ó 2014 elsevier b.v. all rights reserved. administration to hbv transgenic mice, but the extent of inhibition was not significantly different between groups of mice that were rnase l +/+ or rnase l à/à (guidotti et al., 2002) . while these data indicated that rnase l is not likely to mediate the antiviral activity of ifn against hbv, it was not determined whether the catalytic activity of rnase l was activated in these mice. in the present study, we adopted human hepatoma cells that permit hbv infection to address whether the oas/rnase l system plays a role in the inhibition of hbv, although hbv is not known to carry or produce dsrna. our data indicate that ligand-mediated activation of these enzymes results in a marked inhibition of hbv replication in both infected and transfected cells. we also provided evidence for differential roles of oas family members in this process. these results suggest that hbv replication can be regulated through the activation of rnase l-mediated rna decay pathways. hbv stock was prepared from the culture supernatant of hepg2.2.15 cells (sells et al., 1987) . the cells were maintained in dmem supplemented with 10% fbs (hyclone), 200 lg/ml g418 (a.g. scientific) and 50 lg/ml gentamicin (invitrogen). the cells were split 1:4 every 7 days, and the culture supernatant was concentrated as described (vincent et al., 2011) . to prepare viral dna the viral stock was treated with 200 lg/ml proteinase k for 1 h at 37°c in 10 mm tris (ph 7.5), 10 mm edta and 1% sds, followed by phenol/chloroform/isoamyl alcohol (pci) treatment. viral dna was measured by real-time qpcr with a sybr qpcr kit (kapa biosystems) and a myiq system (bio-rad laboratories) using hbv-specific primers (suppl. table 1 ). pcr was conducted by denaturation at 95°c for 30 s, followed by 40 cycles of denaturation at 95°c for 3 s and annealing/elongation at 60°c for 20 s. the viral genome copy number was calculated based on a standard curve generated with pgem-hbv1.2 and was indicated as genome equivalents (geq). for the infection assay, hepg2 cells (atcc hb-8065) were stably transfected with the ntcp gene (a generous gift from wenhui li of nibs, china) and maintained in dmem with 2 lg/ml blasticidin (invivogen). the ntcp-supplemented cells were incubated for 7 days before infection in primary hepatocyte maintenance media (pmm). pmm consists of williams e medium supplemented with 10% fbs, 10 ng/ml egf (invitrogen), 5 lg/ml transferrin, 3 lg/ml insulin, 2 mm l-glutamine, 18 lg/ml hydrocortisone, 40 ng/ml dexamethasone, 5 ng/ml sodium selenite, 2% dmso (all from sigma) and 50 lg/ml gentamicin. the cells were seeded in 24-well plates ($10 5 cells/well) and inoculated the following day with hbv at $2000 geq/cell in pmm (without dmso) containing 4% peg8000. the viral inoculum was removed 16 h later, and the cells were further incubated (up to 9 days in most experiments) in pmm; the media was changed every 3 days. for the transfection assay, huh-7 cells grown in dmem with 5% fbs were transfected with 1 lg/well of pgem-hbv1.2, a replicon containing the 1.2-mer hbv genome. viral polymerase gene expression was nullified in the hbv1.2(p-) construct due to a t to c mutation in the first atg codon and a deletion of t from the second atg codon; these changes did not alter the expression of the core gene that overlaps in the same region of the genome (ryu et al., 2008) . in hbv1.2(x-), the expression of the viral x gene was blocked with two stop codons introduced adjacent to the first and second atg codons of the x gene by substitution of t for c at nt positions 22 and 259 (cha et al., 2009 ). hbv1.2(c-42) expresses an assembly-defective core protein due to deletion of the 42nd codon (leu) of the capsid gene (koschel et al., 2000) . capsid-associated viral dna was extracted from infected cells that were lysed for 20 min on ice in buffer [50 mm tris-hcl (ph 7.5), 1 mm edta, 0.2% np-40 and 150 mm nacl]. the lysate was clarified by centrifugation at 15,000g, and the supernatant was transferred to a new tube and gently mixed for 12 h with an anti-hbc antibody (dako) and protein a/g plus-agarose (santa cruz biotechnology). the beads were collected by centrifugation at 1000g and washed 3 times in the lysis buffer. viral dna was hbcag merge extracted with 200 lg/ml of proteinase k for 1 h at 37°c in 10 mm tris (ph 7.5), 10 mm edta and 1% sds; it was then extracted by pci and measured by southern blot and real-time pcr as described above. viral cccdna was extracted by pci from infected cells that were lysed for 4 h at 65°c in lysis buffer [50 mm tris-hcl (ph 8.0), 50 mm edta, 100 mm nacl and 1% sds] supplemented with proteinase k (200 lg/ml). the extracted dna ($500 ng) was treated with 10 u of plasmid-safe dnase (epicentre technologies) for 8 h at 37°c followed by dnase inactivation at 70°c for 30 min. an aliquot ($20 ng) of extracted dna was denatured at 95°c for 5 min and amplified by qpcr using cccdna-specific primers (suppl. table 1 ). the amplification protocol included 45 cycles of denaturation at 95°c for 30 s, annealing at 62°c for 25 s and elongation at 72°c for 45 s. the hbv cccdna copy number was calculated based on a standard curve generated with pgem-hbv1.2. viral pgrna was measured by real-time qpcr. total rna was extracted from infected cells with rnaiso plus (takara), treated with rq1 dnase and reverse transcribed with the improm-ii rt system (promega). cdna derived from 50 ng of total rna was amplified by qpcr as described for the capsid dna assay. transcripts of rnase l, p53, oas1, oas2 and oas3 were measured by real-time pcr from 1 lg of total cellular rna under the same conditions described above. gapdh mrna was used as a normalization control. viral rna and capsid dna were measured by northern and southern blotting as previously described (park et al., 2011) . infected cells were fixed with 3.7% paraformaldehyde, permeabilized with 0.5% triton x-100 and immunostained with anti-hbcag (dako) followed by alexa 568-conjugated goat anti-rabbit igg (invitrogen). rnase l was immunoblotted and detected with anti-rnase l (invitrogen) or anti-flag antibody (sigma). tubulin was probed with an antibody obtained from applied biological materials. the rnase l expression plasmid p3xflag-rnase l and a nuclease-defective construct, r667a, have been previously described (kwon et al., 2013) . poly(i:c) was obtained from sigma. trimeric 2 0 ,5 0 adenylates, either in 5 0 -monophosphorylated (p2-5a) or . intracellular pgrna at 9 days post-infection was measured by rt-qpcr ( ⁄ p < 0.05, ⁄⁄ p < 0.01). (b) aliquots of huh-7 or hepg2 cells either grown in dmem or further incubated in pmm for 5 days were immunoblotted for rnase l ($82 kda). human lung carcinoma (a549) cells grown in dmem were also probed. tubulin served as a loading control. (c) rnase l mrna levels in hepg2 cells incubated in pmm for the indicated periods were measured by rt-qpcr and are shown as fold-induction relative to the initial level. for comparative purposes, p53 mrna is also shown. unphosphorylated (2-5a) forms were provided by chemgenes corp. pcr primers and sirnas were purchased from integrated dna technologies and genepharma, respectively, and their nucleotide sequences are shown in suppl. table 1 . jetpei (polyplus) was used for dna transfection. lipofectamine 2000 (invitrogen) was used for transfection of poly(i:c), 2-5as and sirnas. ifn-a was obtained from r&d systems, inc. studies on hbv have been hampered by the lack of a robust cell culture system that permits the full life cycle of viral growth. a recent study identified a bile acid transporter protein named sodium taurocholate cotransporting polypeptide (ntcp) that binds the nterminal pre-s1 domain of hbv envelope protein l and mediates the entry of hbv and its surrogate virus hdv (yan et al., 2012) . it was shown that supplementation of human hepatoma cells such as huh-7 and hepg2 with ntcp supports hbv infection. to address the role of rnase l in this process, we prepared a pool of hepg2 cells stably transfected with the ntcp gene. while the ntcpexpressing cells were routinely maintained in dmem, for experiments involving hbv infection, the cells were incubated in pmm for several days before infection, which appeared to render the cells more susceptible to viral infection. infected cells were further incubated (up to 9 days in most experiments) in pmm, and the media was changed every 3 days. immunostaining indicated that the number of cells positive for hbcag, the viral capsid protein, increased with time, although it was less than 5% of the total cells at 9 days post-infection (fig. 1a) . to follow viral replication, we measured the viral pregenomic rna (pgrna) by rt-qpcr. at 9 days post-infection, pgrna reached up to $2 â 10 6 copies per lg of total cellular rna (fig. 1b) . in contrast to these results, expression of hbcag and pgrna was markedly reduced when infected cells were transfected with poly(i:c). viral dna in the capsids, measured by real-time pcr of intracellular viral capsids immunoprecipitated with anti-hbc antibody, was similarly decreased. intracellular viral cccdna was also significantly reduced at 9 days post-infection, while no inhibition was observed at 2 days post-infection (suppl. fig. s1 ). these results demonstrate the profound antiviral effect of poly(i:c) on hbv expression and replication in this cell-based infection system. the antiviral effect of poly(i:c) observed above was likely due to the type i ifn-inducing response mediated by dsrna-binding cellular receptor proteins such as tlr3 and rig-i. indeed, we observed strong induction of ifn-b and oas2 mrnas in hepg2-ntcp cells approximately 12 h after poly(i:c) transfection (suppl. fig. s2 ). among the ifn-related cellular factors, we focused on rnase l because while the induction of oas depends on the ifn response, the activation of its endonuclease function requires dsrna. to more specifically address the antiviral activity, if any, of rnase l against hbv, we transfected the infected cells with synthetic 5 0 -monophosphorylated trimeric 2 0 ,5 0 -adenylates (p2-5a), a specific activator of rnase l. viral pgrna expression was inhibited by up to $70% in a p2-5a dose-dependent manner, whereas no inhibition was observed in the cells either mock-transfected or transfected with unphosphorylated 2-5a ( fig. 2a) . because p2-5a is a unique and specific activator for rnase l, these results strongly indicated that the observed inhibition of hbv was the result of rnase l activation. however, unlike the situation in liver tissue, where abundant expression of rnase l was observed, huh-7 and hepg2 cells express only low levels of rnase l (kwon et al., 2013; malathi et al., 2007; zhou et al., 2005) . interestingly, we identified rnase l proteins in an amount that was detectable by immunoblotting of hepatoma cells that were incubated for 5 days in pmm, whereas it was not detected in the same type of cells grown in dmem (fig. 2b) . our analysis indicated a steady increase of rnase l mrna in the two hepatoma cell lines during incubation in pmm (up to $50-fold in 8 days), whereas the level of p53 mrna remained stable (fig. 2c) . although we could not explain this phenomenon, the elevated expression of rnase l provided an opportunity to address the role of rnase l through sirna-mediated suppression. inhibition of pgrna by p2-5a was almost fully reversed in the rnase l knockdown cells, demonstrating a specific role for rnase l in the inhibition of hbv (fig. 3) . compared with this result, poly(i:c)-mediated inhibition was rescued by $50%, suggesting that other effectors in addition to rnase l also contributed to the inhibition. the antiviral activity of rnase l was further characterized in another hepatoma cell line, huh-7, following transient transfection of the viral genome construct hbv1.2. including the 3.5-kb pgrna, all viral mrnas (2.4, 2.1 and 0.9 kb in length) were markedly reduced when the replicon cells were further transfected with rnase l (fig. 4a) . as in the infection experiments, poly(i:c) was required for the antiviral activity of rnase l, although a mild inhibitory effect was observed even without poly(i:c) (fig. 4b ). this mild inhibitory effect of rnase l (shown in the lane 2 vs. lane 1 of fig. 4a) suggested that some oas activation occurred under these conditions, most likely due to non-specific dsrnas (e.g., read-through transcripts) produced off the plasmid dna templates. in contrast, no inhibition was observed with r667a, which harbors a missense mutation in the ribonuclease domain of rnase l (dong et al., 2001) . the strong antiviral effect and concomitant occurrence of rrna cleavage (shown in the lane 5) confirmed the poly(i:c)-mediated activation of ectopically expressed rnase l. poly(i:c) alone (without ectopic rnase l expression) had no effect (lanes 1 vs. 4; lanes 3 vs. 6). this result is consistent with the low level of endogenous rnase l expression, as we reported previously (kwon et al., 2013) , and no induction of ifn-b or isg expression was observed in this type of hepatoma cell upon poly(i:c) transfection (described below) as reported (li et al., 2005) . therefore, the observed antiviral activity of transfected poly(i:c) was primarily contributed by the activated ribonuclease function of rnase l. the activation of rnase l was also confirmed with p2-5a transfected huh-7 cells (suppl. fig. s3 ). because the first step in the hbv replication cycle is the synthesis of viral mrna and pgrna off the viral genome, downregulation of viral transcripts by rnase l would subsequently affect viral dna replication as well. as expected, the capsid-associated viral dna was barely detectable in rnase l-activated cells, indicating that the downregulation of viral transcripts resulted in the severe inhibition of viral dna synthesis, including the new synthesis of viral relaxed-circular (rc) and duplex-linear (dl) dnas (fig. 4c, 2nd lane of the southern blot). to further substantiate this result, we examined hbv with mutations that have critical effects on viral dna replication. hbv1.2(p-) is incapable of dna replication because viral pol gene expression is nullified due to a t to c mutation in the first atg codon and a t deletion in the second atg codon; however, these mutations do not alter the expression of the core gene that overlaps the same region (ryu et al., 2008) . hbv1.2(c-42) is also replication-defective because the core gene lacks the 42nd codon (leu) and thus cannot form assembled capsids (koschel et al., 2000) . our analyses indicated that the transcripts of these mutants, which were not affected despite their replication defects, were degraded by poly(i:c) and rnase l similar to those of the wild-type genome. a similar result was obtained for the third mutant, hbv1.2(x-), in which the viral x gene was nullified due to stop codons introduced adjacent to the first and second atg codons (cha et al., 2009) . despite nullification of this critical protein, viral transcription and dna replication were not affected as reported previously for this type of hepatoma cell (melegari et al., 1998) . likewise, all viral transcripts of this mutant were degraded by poly(i:c) and rnase l similar to those of the wild-type genome. thus, rnase l-dependent downregulation of viral rnas (and dna) as observed for wild-type hbv was observed for all three mutants regardless of their replication capability. rnase l activation requires 2-5a, which is synthesized by oas. in humans, three closely related and linked genes, oas1, oas2 and oas3, code for oas proteins. oas expression is induced by type i ifns, but dsrna is required for the activation of their catalytic activity. our rt-pcr analysis showed that oas1 and oas3, but not oas2, were constitutively expressed in huh-7 and hepg2 cells before all three genes were further induced by ifn-a treatment (fig. 5) . as mentioned above, poly(i:c) had no effect on the expression pattern of the three oas genes in huh-7 cells, yet it induced all three oas genes in hepg2 cells. therefore, it is likely that in huh-7 cells, the constitutively expressed endogenous oas1 and/or oas3 proteins were catalytically activated by poly(i:c) and contributed to rnase l activation as observed above. to address this hypothesis, we attempted to knock down oas expression using a specific sirna. despite the notable suppression of oas1 (by up to 60%), inhibition mediated by rnase l and poly(i:c) was not affected (fig. 6) , suggesting that oas1 does not play a major role in this process. interestingly, a moderate rescue of viral rna was observed in the oas1 knockdown cells even prior to the transfection of rnase l and poly(i:c). most likely, oas1 was activated by non-specific dsr-nas produced off the plasmid dna templates, resulting in the activation of endogenous rnase l that was present at a low level. compared with oas1, viral transcripts were partially but significantly rescued by oas3 sirnas, although smearing of the signals might be still indicative of rna degradation, consistent with incomplete suppression of oas3 (fig. 7) . this result indicated that oas3 plays an important role in activating rnase l in the presence of poly(i:c). however, unlike oas1, oas3 knockdown had no effect without poly(i:c). because both oas1 and oas3 are constitutively expressed in these cells prior to poly(i:c) treatment, as shown in fig. 5 , these results suggest that the two enzymes differ in their requirement for dsrna; specifically, oas3 might be activated more efficiently with poly(i:c). in vitro data indicated that oas3 was more sensitive to dsrna ($100 times less dsrna is required for activation) (marie et al., 1997) . to examine the role of oas2, we stimulated its expression by ifn-a treatment following transfection with oas2 sirna. viral rna was partially rescued with one of the two sirnas, and this rescue was correlated with the extent of oas2 mrna suppression (fig. 8) . ifn-a treatment alone did not show apparent inhibition of hbv transcripts, as we previously reported for this type of hepatoma cell (park et al., 2011) . our results indicate that oas2 and oas3, but not oas1, are dependent on poly(i:c) under these conditions. thus, oas family members differ in their requirement for dsrna and contribute differentially to rnase l activation under different conditions. among ifn-related cellular factors, rnase l has been shown to inhibit a number of rna viruses and few dna viruses. in the typical antiviral pathway, viral dsrna activates oas, which in turn activates rnase l through the synthesis of 2-5a. it is thought that rnase l-mediated viral rna decay leads to the inhibition of these viruses. in this study, we attempted to address whether the oas/ rnase l system plays a role in cellular restriction or ifn-mediated inhibition of hbv, although hbv is not known to carry or produce dsrna. with the newly established hepg2-ntcp cell culture system, which permits hbv infection, we showed that viral gene expression and replication can be profoundly reduced by 2-5aor poly(i:c)-mediated activation of rnase l. in hbv1.2-transfected huh-7 cells, it was further confirmed that this type of inhibition occurred mostly through viral rna degradation via the ribonuclease function of rnase l. in contrast to the effect of the specific ligand 2-5a, the poly(i:c)-mediated antiviral effect was not fully rescued by rnase l knock down. while the latter result implies that other effectors also contribute to the inhibition observed, it might be worth considering the ways by which poly(i:c) might have functioned in our study and in previous studies performed with hbv-transgenic animals. intravenous administration of poly(i:c) resulted in a dramatic reduction of viral replication; however, no significant difference was observed between groups of rnase l +/+ or rnase l à/à animals with respect to the extent of inhibition (guidotti et al., 2002) . a subsequent study showed that poly(i:c) inhibited hbv through induction of type i ifn responses, as evidenced by intrahepatic isg expression and requirement for the cytokine receptors in this process (isogawa et al., 2005) . while these data indicate that rnase l is not likely to mediate the antiviral activity of ifn against hbv, it was not determined whether the catalytic activity of rnase l was activated in these mice. most likely, poly(i:c) that was injected intravenously into the animals triggered ifn induction via tlr signaling. however, the lack of apparent difference in viral replication between rnase l +/+ or rnase l à/à animals (despite intrahepatic induction of oas) suggested that rnase l was most likely not activated. consistent with this notion, the steady state level of viral rna was not affected in these animals, whereas hbv dna was profoundly inhibited. in contrast, all forms of hbv rnas were profoundly reduced in our cell-based assays, indicating the efficient activation of rnase l in poly(i:c)transfected cells. this direct rnase l-activating effect of poly(i:c) was more evident in the huh-7 cell, in which tlr3-mediated signaling is known to be inefficient (li et al., 2005) . our rnase l knockdown experiment performed in hepg2 cells, showed $50% rescue of poly(i:c)-mediated viral rna reduction, suggesting that other factors in addition to rnase l contributed to the inhibition. indeed, we observed strong induction of ifn-a and oas2 mrnas in hepg2 cells within 12 h of poly(i:c) transfection. studies exploring how the ifn-mediated antiviral responses (those triggered by the secreted ifns or by the direct activation of prr with pamp) inhibit hbv indicated that various steps of viral replication are affected (reviewed in chang et al., 2012) . although many of these studies highlight posttranscriptional inhibition mechanisms, cellular effectors responsible for this type of regulation have not been identified. recently, it was reported that zinc finger antiviral protein (zap), a cellular protein known initially as a retroviral restriction factor, inhibits hbv through the viral rna decay process (mao et al., 2013) . while zap itself retains no ribonuclease activity, it is known to bind viral (and cellular) rnas through its n-terminal domain, which contains four zinc finger motifs and stimulates rna degradation by recruiting various host rna processing machineries, including exosomes. according to these authors, expression of at least one isoform of zap was induced by ifn signaling, and ectopic expression of zap markedly reduced viral rna. while rnase l differs from zap in that it requires specific ligands to activate its ribonuclease function, it is also possible that rnase l acts in combination with other cellular factors or as part of the cellular machinery during viral rna decay. regarding the suggested relationship between naturally occurring rnase l gene variation (e.g., r462q) and chronic hepatitis b (arredondo et al., 2012) , we did not find any defect in hbv inhibition with this variant in our transfection assay (data not shown). this result was consistent with the reduced 2-5a-mediated oligomerization activity but intact ribonuclease function of this allele (xiang et al., 2003) . we showed that oas1 and oas3 were constitutively expressed in huh-7 cells before their expression was further induced, along with that of oas2, by ifn-a treatment. elevated oas activity has been found in the sera of hepatitis c patients following ifn therapy, and the level of oas activity was found to be correlated with their virological responses to this therapy (kim et al., 2006) . among chronic hepatitis b patients, the frequency of a nonsense mutation in the r567 codon of oas3 was reported to be higher among non-responders to ifn therapy compared with responders (ren et al., 2011) . although we did not test this allele of oas3, our knockdown data support the role of oas3, along with that of oas2, in the activation of rnase l. in summary, our data indicated that hbv replication can be regulated through the activation of rnase l-mediated rna decay pathways with exogenously provided ligands. specifically, small molecules that mimic natural ligands (such as 2-5a) would represent a novel therapeutic strategy. short communication: rnasel alleles and susceptibility to infection by human retroviruses and hepatitis viruses stimulation of hepatitis b virus genome replication by hbx is linked to both nuclear and cytoplasmic hbx expression new insights into the role of rnase l in innate immunity the innate immune response to hepatitis b virus infection: implication for pathogenesis and therapy basis for regulated rna cleavage by functional analysis of rnase l and ire1p interferon-regulated pathways that control hepatitis b virus replication in transgenic mice toll-like receptor signaling inhibits hepatitis b virus replication in vivo 0 -,5 0 -oligoadenylate synthetase response ratio predicting virological response to peg-interferon-alpha2b plus ribavirin therapy in patients with chronic hepatitis c hepatitis b virus core gene mutations which block nucleocapsid envelopment the oligoadenylate synthetase family: an ancient protein family with multiple antiviral activities the ribonuclease l-dependent antiviral roles of human 2 0 ,5 0 -oligoadenylate synthetase family members against hepatitis c virus distinct poly(i-c) and virusactivated signaling pathways leading to interferon-beta production in hepatocytes chronic hepatitis b small self-rna generated by rnase l amplifies antiviral innate immunity inhibition of hepatitis b virus replication by the host zinc finger antiviral protein 69-kda and 100-kda isoforms of interferon-induced (2 0 -5 0 )oligoadenylate synthetase exhibit differential catalytic parameters cloning and characterization of a novel hepatitis b virus x binding protein that inhibits viral replication pkr-dependent mechanisms of interferon-alpha for inhibiting hepatitis b virus replication benefits and risks of interferon therapy for hepatitis b herpes simplex virus infection is sensed by both toll-like receptors and retinoic acid-inducible gene-like receptors, which synergize to induce type i interferon production polymorphisms of interferon-inducible genes oas associated with interferonalpha treatment response in chronic hbv infection hepatitis b virus polymerase suppresses translation of pregenomic rna via a mechanism involving its interaction with 5 0 stem-loop structure production of hepatitis b virus particles in hep g2 cells transfected with cloned hepatitis b virus dna viral encounters with 2 0 ,5 0 -oligoadenylate synthetase and rnase l during the interferon antiviral response hepatitis b virus impairs tlr9 expression and function in plasmacytoid dendritic cells doublestranded rna is produced by positive-strand rna viruses and dna viruses but not in detectable amounts by negative-strand rna viruses blockade of interferon induction and action by the e3l double-stranded rna binding proteins of vaccinia virus effects of rnase l mutations associated with prostate cancer on apoptosis induced by 2 0 ,5 0 -oligoadenylates sodium taurocholate cotransporting polypeptide is a functional receptor for human hepatitis b and d virus antagonism of the interferon-induced oas-rnase l pathway by murine coronavirus ns2 protein is required for virus replication and liver pathology increased severity of hsv-1 keratitis and mortality in mice lacking the 2-5a-dependent rnase l gene mapping of the human rnasel promoter and expression in cancer and normal cells we are grateful to wenhui li for providing us with the ntcpexpressing plasmid. this work was supported by the basic science research program of the national research foundation (#2012-008126) of the republic of korea. some preliminary studies were supported by a grant from korea university in 2011-2012. supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.antiviral.20 14.01.021. key: cord-252586-fuaoelgb authors: phillips, sandra; chokshi, shilpa; chatterji, udayan; riva, antonio; bobardt, michael; williams, roger; gallay, philippe; naoumov, nikolai v. title: alisporivir inhibition of hepatocyte cyclophilins reduces hbv replication and hepatitis b surface antigen production date: 2014-10-08 journal: gastroenterology doi: 10.1053/j.gastro.2014.10.004 sha: doc_id: 252586 cord_uid: fuaoelgb background & aims: cyclophilins are host factors required for hepatitis c virus replication. cyclophilin inhibitors such as alisporivir have shown strong anti–hepatitis c virus activity in vitro and in clinical studies. however, little is known about whether hepatocyte cyclophilins are involved in the hepatitis b virus (hbv) life cycle. we investigated the effects of 2 cyclophilin inhibitors (alisporivir and nim811) on hbv replication and hepatitis b surface antigen (hbsag) production in cell lines. methods: liver-derived cell lines producing full-length hbv and hbsag particles, owing to stable (hepg2215) or transient (huh-7) transfection, or infected with hbv (heparg cells; invitrogen [carlsbad, ca]), were incubated with alisporivir or nim811 alone, or alisporivir in combination with a direct antiviral (telbivudine). the roles of individual cyclophilins in drug response was evaluated by small interfering rna knockdown of cyclophilin (cyp)a, cypc, or cypd in hepg2215 cells, or cypa knockdown in huh-7 cells. the kinetics of antiviral activity were assessed based on levels of hbv dna and hbsag and southern blot analysis. results: in hepg2215, huh-7, and heparg cells, alisporivir reduced intracellular and secreted hbv dna, in a dose-dependent manner. knockdown of cypa, cypc, or cypd (reduced by 80%) significantly reduced levels of hbv dna and secreted hbsag. knockdown of cypa significantly reduced secretion of hbsag, leading to accumulation of intracellular hbsag; the addition of alisporivir greatly reduced levels of hbsag in these cells. the combination of alisporivir and telbivudine had greater antiviral effects than those of telbivudine or alisporivir alone. conclusions: alisporivir inhibition of cyclophilins in hepatocyte cell lines reduces replication of hbv dna and hbsag production and secretion. these effects are potentiated in combination with direct antiviral agents that target hbv-dna polymerase. t he cyclophilins are a group of cellular proteins with peptidyl-prolyl isomerase enzymatic activity, which catalyze the cis to trans conversion of proline-containing peptides and facilitate protein folding. 1, 2 there are 7 main cyclophilins in human beings: cyclophilin a (cyp)a, cypb, cypc, cypd, cype, cyp40, and cyp natural killer (nk), 1 which are localized in different cellular compartments. for example, cypa and cyp40 are present in the cytosol, cypb and cypc reside in the lumen of the endoplasmic reticulum, cypd is present in the mitochondria, and cype is localized in the nucleus. cyclophilins are involved in the life cycle of a wide range of viruses including hepatitis c virus (hcv), human immunodeficiency virus, vaccinia virus, coronaviruses, and polyomavirus bk, acting as host co-factors essential for virus replication. [3] [4] [5] [6] [7] [8] cypa is the main cyclophilin that is involved directly in the life cycle of hcv 2-4 and inhibition of its peptidyl-prolyl isomerase activity with cyclophilin inhibitors was shown to interfere at multiple sites of the hcv life cycle in hepatocytes, affecting not only replication but also the hcv secretion from infected cells. [9] [10] [11] [12] [13] the role of cellular cyclophilins in the hepatitis b virus (hbv) life cycle, however, is poorly understood. in the present study we investigated whether hepatocyte cyclophilins are involved in hbv replication, hepatitis b surface antigen (hbsag) production and secretion, and the effects of nonimmunosuppressive cyclophilin inhibitors alone and in combination with a direct antiviral agent targeting hbv polymerase. four human hepatoma cell lines that produce full hbv virions and hbsag subviral particles were used in this study: (1) huh-7 cells (japan health science research resources bank, osaka, japan), and (2) huh-7 with stable knockdown (kd) of cypa using a short hairpin, 11 both cell lines were transfected with hbv dna; (3) hepg2215 cells, which are stably transfected with hbv dna; and (4) heparg cells (invitrogen, carlsbad, ca), which were infected with hbv. the huh-7 and hepg2215 cells were cultured at 37 c and 5% co 2 in dulbecco's modified eagle's medium (dmem; life technologies, paisley, uk) with 10% fetal calf serum (fcs) (life technologies), as described previously. 14 the huh-7 cypa kd cells were cultured in dmem/10% fcs plus 1â nonessential amino acids and 1 mg/ml of the selection marker puromycin (life technologies). heparg cells are terminally differentiated and were purchased from invitrogen (carlsbad, ca). the cells were cultured according to the manufacturer's instructions (heparg cell user guide; invitrogen) on collagen i-coated plates. initially, cells were grown in william's medium e with heparg thaw, plate&general purpose medium supplement and gluta-max (invitrogen), and prepared in a standardized 2-step process. after 7 days, cells were maintained in william's medium e with heparg maintenance medium supplement plus glutamax. huh-7 and huh-7 cypa kd cells were transfected with a hbv plasmid, psm2 (kindly provided by professor hans will), which contained a head-to-tail hbv-dna dimer. 15 briefly, huh-7 cells, at a density of 1.5 â 10 5 /well, were seeded onto 24-well plates and cultured for 48 hours at 37 c to reach confluency. the cells then were transfected with 0.5 mg of psm2 with fugene 6 (roche, burgess hill, uk) according to the manufacturer's instructions. the transfection efficiency was determined using a b-gal staining kit (life technologies). heparg cells were infected with hbv derived from 5-day culture supernatants of ad38 cells, as described. 16 hepg2215 and hbv-infected heparg cells were seeded at 1 and 0.3 â10 6 cells, respectively, onto 24-well plates and maintained at 37 c. the cell lines subsequently were treated as described later. hepg2215 cells were transfected with cypa, b, c, or d small interfering rna (sirna) (sigenome smart pool; thermo scientific dharmacon, epsom, uk). to optimize the knockdown effect of cyclophilin expression, preliminary experiments with a range of sirna concentrations, specific for each cyclophilin, were conducted by testing 30, 60, 100, and 150 nmol/l over 96 hours (see the supplementary materials and methods section). the cyclophilin messenger rna (mrna) expression at baseline and at different time points after sirna transfection was assessed by realtime polymerase chain reaction (pcr) with primers specific for each cypa, b, c, and d. after these optimization experiments, sirna stock solutions of 20 mmol/l were diluted in 50 ml opti-mem medium (life technologies) for a final concentration of 60 nmol/l for cypa and cypd sirna, and 100 nmol/l for cypc. lipofectamine 2000 (invitrogen, life technologies) was diluted into 50 ml opti-mem medium and incubated for 5 minutes at room temperature. combined diluted sirna and diluted lipofectamine were incubated for 30 minutes at room temperature. hepg2215 cells (1 â 10 5 cells per well) then were treated with the sirna-lipofectamine complex and incubated for 48 hours at 37 c. nontargeting scrambled sirna was used as a negative control; glyceraldehyde-3-phosphate dehydrogenase sirna and siglo (thermo scientific dharmacon) green were used as positive controls for sirna delivery and transfection, respectively. the specificity of sirna silencing was crosschecked using real-time pcr and primers specific for cypa, cypc, cypd mrna with hepg2215 cells transfected with cypa, cypc, or cypd sirna, respectively. this confirmed that each sirna selectively decreased only targeted cyclophilin mrna (by approximately 80%), whereas the other cyclophilin (cypa, cypc, or cypd) mrna expression was comparable with the control (scramble sirna). the knock-down effect for cypa protein was tested further by western blotting 11 and by enzyme-linked immunosorbent assay (elisa), as described later. alisporivir and nim811 are nonimmunosuppressive cyclophilin inhibitors 9 ; telbivudine, a nucleoside analog, is a potent inhibitor of hbv-dna polymerase. 17 all compounds were provided by novartis (basel, switzerland). in a series of experiments, the cells used (stably transfected hepg2215, transiently transfected huh-7, huh-7 cypa kd cells, and hbv-infected heparg cells) were cultured alone and with several concentrations of alisporivir or nim811. alisporivir and nim811 stock solutions were prepared as 2000â stocks in 100% dimethyl sulfoxide (dmso) and the final working concentrations of alisporivir and nim811 (0.25, 1, 5, and 20 mg/ml) were prepared daily in dmem/10% fcs with a final dmso concentration of 0.05%. the control also contained 0.05% dmso. the culture media were replaced every 24 hours with 1.5 ml of fresh alisporivir-containing or nim-containing medium. supernatants and cells were collected at baseline (bl), and at 24, 48, and 72 hours. hbvinfected heparg cells were treated with alisporivir or nim811 for 7 days, cells and supernatants were collected at bl, and at 24, 72, 120, and 168 hours (supplementary figure 1 ). for all conditions and time points, hepg2215 and huh-7 cells were tested in at least 3 independent experiments with each condition run in triplicate wells. heparg and huh-7 cypa kd cells were tested in duplicates. because the culture medium was replaced every 24 hours, the graphic representations of the results for viral particles secreted in supernatants are shown with each time point starting from zero after each medium change. cytotoxicity was assessed by microscopic observation of the cells, trypan blue exclusion, and/or by lactate dehydrogenase (ldh) release in supernatants using the ldh-cytotoxicity assay kit (biovision research products, mountain view, ca). before treating hepg2215 cells with the combination of alisporivir (alv) and telbivudine, we first tested the antiviral activity of a range of telbivudine concentrations in the current model. stock solutions with 2000â telbivudine in 100% dmso were used to prepare 6 working concentrations daily, ranging from 0.04 to 20 mmol/l telbivudine (supplementary figure 2) . the cell culture medium containing these working concentrations was replaced daily and samples were collected at bl, and at 24, 48, and 72 hours. based on this experiment, in the subsequent combination experiments telbivudine was used at 10 mmol/l (2.42 mg/ml), which corresponds to the maximum concentration levels observed in clinical studies (see supplementary materials and methods section). to test the antiviral activity of alv in combination with telbivudine, hepg2215 cells were treated for 72 hours with the following: alv 0.25 mg/ml/telbivudine 10 mmol/l, alv 1 mg/ml/telbivudine 10 mmol/l, alv 5 mg/ml/telbivudine 10 mmol/l, and alv 20 mg/ml/telbivudine 10 mmol/l. intracellular, nucleocapsid-associated viral dna was extracted from transfected huh-7 and 2215 cells or hbv-infected heparg cells, as described previously. 14, 18 the culture supernatants were treated with dnase i for 1 hour at 37 c, 10 minutes at 75 c, and then placed on ice for 1 minute. the supernatants were centrifuged at 10,000 rpm and the pellets were discarded. the dna was extracted from the supernatants using the qiaamp dna mini qiagen kit (qiagen, sussex, uk). hbv dna was quantitated by taqman real-time polymerase chain reaction (applied biosystems 7500; applied biosystems, paisley, uk) using the eurohep hbv standard and hbv-dna plasmid. 14, 18 for southern blot analysis, 20 mg of hind iii-treated intracellular dna was analyzed on a 1% agarose gel and transferred to a hybond-xl (ge healthcare life sciences, pittsburgh, pa) membrane, as described. 19 radioactive hbvspecific probes were generated from a sac i-hind iii fragment derived from psp65-ayw-1.3 by nick translation and purified by spin column chromatography. prehybridization, hybridization, and washes were as described previously. 20 quantitation of hbsag, cypa, and cypb by elisa hbsag secreted during cell culture (shbsag) and intracellular hbsag (ihbsag) were quantitated using a commercially available hbsag elisa (abazyme, needham, ma). hbsag levels were quantitated in triplicates of the culture supernatants and cytoplasmic extracts of stably and transiently transfected cells. a standard curve was established by using a serial dilution of a known quantity of purified hbsag protein (american research products, belmont, ma). the intracellular cypa and cypb levels in supernatants were quantitated by elisa, as described previously. 21 statistical analyses were performed using the spss package (ibm, new york, ny). one-way analysis of variance was used, followed by dunnett's post hoc test to compare one treatment group with the nontreated group and the tukey post hoc test was used for multiple comparisons between groups. 22 a p value less than .05 was considered statistically significant. alisporivir treatment of hepg2215 cells resulted in a progressive reduction of secreted and intracellular, nucleocapsid-associated hbv dna dependent on both drug concentration and time of drug exposure ( figure 1a and b). the secreted viral dna was reduced by 52% after 72 hours of treatment with alisporivir 20 mg/ml, compared with cells incubated with medium only (p < .01). the level of intracellular hbv dna also was reduced by approximately 60% after 72 hours of treatment with 5 and 20 mg/ml of alisporivir (p < .01). nim811 treatment of hepg2215 and of heparg cells also reduced the secreted and intracellular nucleocapsidassociated hbv dna, however, its antiviral effect was lower than alisporivir (supplementary figure 3) . the difference between nim811 and alisporivir in reducing hbv-dna level was particularly apparent with hepg2215 cells at 5 mg/ml: 6% vs 34% hbv-dna reduction at 48 hours. in huh-7 cell cultures, the control experiments for transfection efficiency (b-gal staining) showed hbv replication in 30%-40% of cells. alisporivir treatment of hbvtransfected huh-7 cells also resulted in a dose-dependent reduction of secreted and intracellular hbv dna. the most profound reduction was observed after 72 hours of treatment with alisporivir at 5 mg/ml (58% and 73%, respectively) and 20 mg/ml (64% and 58%, respectively) ( figure 1c and d) . overall, the alisporivir antiviral activity was greater in transiently transfected huh-7 cells in comparison with stably transfected hepg2215 cells (p ¼ .038 for secreted hbv dna and p < .001 for cytoplasmic hbv dna). as stated earlier, alisporivir at 5 mg/ml reduced intracellular hbv-dna levels by 73% and 58% in huh-7 and hepg2215 cells, respectively, after 72 hours of treatment ( figure 1b and d) . this difference was even more apparent at earlier time points. after 24 hours, the intracellular hbv-dna reduction in hepg2215 cells and huh-7 cells was 16% and 64%, respectively ( figure 1b and d) . importantly, the southern blot analysis of intracellular dna supports the quantitative real-time pcr results outlined earlier because alisporivir reduced intracellular hbv dna in a dose-dependent manner ( figure 1e ). hbv-infected heparg cells were treated with alisporivir or nim811 for 7 days, starting 16 hours after hbv inoculation (supplementary figure 1) . also in this model, the cyclophilin inhibitors reduced hbv-dna level ( figure 1f and supplementary figure 3) . after 120 and 168 hours of treatment with the highest concentration of alisporivir, intracellular nucleocapsid-associated hbv dna was reduced by 80% and 90%, respectively, similar to the effect of nim811: 70% and 90% reduction, respectively. in hepg2215 cells, there were minimal changes in shbsag or ihbsag levels (figure 2a and b) . the magnitude of reduction of shbsag by both alisporivir and nim811 was lower than the reduction of hbv-dna level ( supplementary figures 3 and 4) . in huh-7 cells, significant reductions in both shbsag and ihbsag were observed with the two highest alisporivir concentrations ( figure 2c and d) . the most significant change was seen after 72 hours of treatment with 20 mg/ml alisporivir, in which shbsag was reduced by 69% and ihbsag was reduced by 53%. in all experiments, alisporivir treatment was not cytotoxic for hepg2215 and hbv-transfected huh-7 cells, as shown by ldh release assay (supplementary figure 5) . to determine the relative involvement of different cyclophilins in hbv replication, the expression of cypa, b, c, and d were silenced selectively with a respective sirna. the figure 6) . the efficiency of the transfection and the sirna delivery were assessed with siglo and glyceraldehyde-3-phosphate dehydrogenase, respectively (supplementary figure 6d and e) . the expression of cypa, c, or d mrna in hepg2215 cells was reduced markedly (by !80%) in comparison with the controls treated with nontargeting, scrambled sirna for the duration of the experiment (supplementary figure 7a) . the cypa gene silencing also efficiently reduced the intracellular cypa protein when tested by elisa (supplementary figure 7b) , or by western blot (supplementary figure 7c) . both secreted and intracellular hbv-dna levels were reduced by 80% and 97%, respectively, in cypa-silenced cells ( figure 3a and 3b) . secreted hbsag was reduced by 65% in the same cells ( figure 3c ). the cypa-silenced cells were treated with alisporivir and compared with the cypasilenced cells without alisporivir (cypa þ no alisporivir) to determine whether alisporivir inhibition of other cellular cyclophilins would enhance the antiviral effect of silencing cypa. the addition of alv did not result in any further decrease in the levels of secreted and intracellular nucleocapsid-associated hbv dna and shbsag (figure 3) . we also used huh-7 cells with stable cypa kd (supplementary figure 7d) and assessed the impact on hbv replication and hbsag. the secreted hbv dna was reduced by 50% in these cells in comparison with normal huh-7 cells (figure 4a ), and adding alisporivir had only a marginal effect. intracellular nucleocapsid-associated hbv dna was affected even more in this cell line with a 90% reduction ( figure 4b ). secreted hbsag also was reduced alisporivir inhibits hbv replication 407 significantly (90%) whereas intracellular hbsag accumulated in these cells ( figure 4c and d) . interestingly, treatment of the cypa kd cells with alisporivir (20 mg/ml) profoundly decreased intracellular hbsag levels. in cypcsilenced cells, secreted and intracellular nucleocapsidassociated hbv dna were reduced by 61% and 93%, respectively, compared with negative controls (figure 5a and b) and hbsag levels were reduced by 30% ( figure 5c ). the result of silencing cypd was similar to silencing cypcas secreted and intracellular nucleocapsid-associated hbv dna and shbsag, which were reduced by 62%, 96%, and 30%, respectively ( figure 5d -f). cypa silencing with sirna resulted in a greater reduction in secreted hbv dna and shbsag compared with sirna silencing of cypc or cypd. as stated earlier, at 72 hours treatment, the silencing of cypa reduced secreted hbv dna by 80% ( figure 3a ) compared with 60% in cypc or cypd-silenced cells ( figure 5a and d) . at the same time point, shbsag was reduced by 65% ( figure 3c ) compared with 30% in cypc or cypd silenced cells ( figures 5c and f, respectively) . interestingly, adding alisporivir to cypc and cypd-silenced cells further reduced the 3 viral parameters measured ( figure 5 ). this increased effect in the presence of alisporivir was seen only when the levels of secreted and intracellular dna as well as shbsag were still increased in the cyclophilin-silenced cells such as at 24 hours for intracellular nucleocapsid-associated dna and 48 and 72 hours for shbsag. this additional effect of alisporivir, however, disappeared when the levels of secreted and intracellular nucleocapsid-associated hbv dna became very low in cyclophilin-silenced cells. because cypa represents a key target for cyclophilin inhibitors, we analyzed the changes of intracellular cypa levels in untreated and alisporivir-treated hepg2215 and huh-7 cells. in hepg2215 cells, the cypa levels were 16 times lower than in huh-7 cells (figure 6a and b) and were not affected by the alisporivir treatment, whereas in huh-7 cells the alisporivir treatment resulted in a dose-dependent decrease of intracellular cypa levels. the corresponding levels of cypb in culture supernatants of huh-7 cells increased steadily, dependent on time and alisporivir concentration ( figure 6c ), in accordance with the previous findings of cypb release from alisporivir-treated cells. 21 in heparg cells, the cypa and cypb levels were similar to those in huh-7 (data not shown). a significantly greater reduction of hbv replication was observed with alisporivir in combination with a direct antiviral agent, telbivudine, compared with alisporivir alone. this was more apparent at the lower concentrations of alisporivir: 0.25 and 1 mg/ml (figure 7) . secreted viral dna and intracellular nucleocapsid-associated hbv dna were reduced by 39% and 62%, respectively, in cells treated with 0.25 mg/ml alisporivir plus 10 mmol/l telbivudine vs 9% and 0% in cells treated with alisporivir alone at 48 hours ( figure 7a and b compared with figure 1a and b) . furthermore, at 48 hours, the reduction of secreted hbv dna was more apparent with alisporivir plus telbivudine, compared with telbivudine alone ( figure 7a ). the combination of alisporivir plus telbivudine had a similar effect on shbsag and ihbsag levels compared with alisporivir alone ( figure 7c and d compared with figure 2a and b). hbv is the smallest human dna virus with a unique genomic organization and replication mechanism. 23 viral replication takes place in the cytoplasm of infected hepatocytes with 3 subsets of hbv-rna transcripts: pregenomic rna, envelope pres/s rnas, and hbx mrna, encoding all structural and nonstructural viral proteins. characteristic of hbv infection are the spheric and filamentous subviral particles composed exclusively of viral envelope proteins and host-derived lipids, which are produced 10 3 -to 10 6 -fold in excess to full virions and secreted from hepatocytes. 23 by using 3 different in vitro hbv models: stably transfected (hepg2215), transiently transfected (huh-7) , and hbvinfected (heparg) cells, the present study shows that alisporivir inhibits hbv replication 411 cellular cyclophilins have a major role in the hbv life cycle in hepatocytes. blocking cyclophilins' enzymatic activity with small molecules, alisporivir or nim811, or the selective silencing of individual cyclophilins with sirna, markedly reduced hbv-dna replication, as well as hbsag production and secretion from cells. cypa is one of the most abundant cytosolic proteins (approximately 0.1% of cell proteins) 2 and the present study shows the major utilization of cyclophilin a both in hbv replication and in hbv envelope protein secretion from hepatocytes. the experiments using huh-7 cells with stable cypa kd, and the findings that alv enhanced hbv dna and hbsag reduction in cypc and cypd-silenced cells show that cypa is important for the formation of intracellular, nucleocapsid-associated hbv dna and viral secretion, as well as for hbsag secretion from cells. the quantitation of intracellular cypa showed a greater amount in huh-7 than in hepg2215 cells, which is the likely explanation for the much greater effect of alisporivir on hbsag secretion from huh-7 compared with hepg2215 cells. importantly, cyclophilin inhibitors, such as alisporivir and nim811, block all cellular cyclophilins and in hepg2215 cells there was a dose-dependent reduction in hbv dna. the data thus suggest that, in this model, the antiviral effect was primarily a result of alisporivir and nim811 targeting other cyclophilins (eg, cypd and/or cypc), leading to the observed hbv-dna reduction in these cells. the results from the present study together with previously published data indicate that the mechanisms by which alisporivir and nim811 impact hbv replication and hbsag production are likely to involve interference at multiple sites of the hbv life cycle. first, the finding that cyclophilin inhibition reduces intracellular nucleocapsidassociated hbv dna in the cytoplasm suggests an antiviral effect on the production of new virions and a reduction in the recirculation of hbv nucleocapsids from the cytoplasm to the nucleus, which is a key mechanism to replenish the viral template. we found a marked reduction of intracellular hbv dna in cells with stable cypa kd, along with intracellular hbsag accumulation. previous studies have shown the intracellular interaction between cypa and hbsag and their close association during secretion from liver cells. 24 thus, cyclophilin inhibitors will disrupt the cypa/hbsag complex and reduce envelope protein secretion. second, hepatitis b x antigen (hbxag), which is essential for hbv replication, associates with the outer membrane of mitochondria, and by regulating cytosolic calcium and signaling it drives hbv replication. [25] [26] [27] nim811 was shown to block cytosolic calcium signaling and the opening of mitochondrial permeability transition pores as a result of its inhibition of cypd. 28 therefore, blocking cypd interferes with hbxag regulation of calcium and will impact hbv replication negatively. third, cypa is an important co-factor for lipids and apolipoprotein b (apob) trafficking and nim811 was shown to decrease apob secretion, as well as the egress of hcv particles from jfh1-hcv-infected cells. 13 because cellular lipids are part of the hbv envelope proteins, the impact of cyclophilin inhibition on apob secretion is likely to interfere with the intracellular formation and secretion of lipoproteins part of hbv viral and subviral particles. fourth, recent findings have shown that the sodium taurocholate cotransporting polypeptide, a membrane bile acid transporter expressed in the liver, is a functional receptor for hbv and hepatitis delta virus, via pre-s1 binding. 29, 30 moreover, cyclosporin a and nonimmunosuppressive analogues, such as alisporivir, recently were shown to inhibit hbv entry into cells by blocking the sodium taurocholate cotransporting polypeptide, which is a cyclophilin-independent mechanism. 31, 32 the ultimate treatment goal of patients with chronic hepatitis b is to prevent the development of cirrhosis, liver failure, and hepatocellular carcinoma. hbsag is the hallmark of hbv infection and hbsag loss, with or without seroconversion to antibody to hepatitis b surface antigen, is the ideal treatment end point, is associated with improved longterm outcome, [33] [34] [35] shows markedly enhanced antiviral tcell reactivity, 36 and it allows therapy to be stopped with a minimal risk of relapse. although the nucleos(t)ide polymerase antivirals are potent inhibitors of hbv replication and result in a profound reduction of circulating hbv, they have little effect on hbsag transcription/subviral particle production. hbsag loss has been reported to occur in 2%-8% of hbeag-positive patients and in 0%-5% of hbeagnegative patients after 3-5 years of continuous treatment. 33, 37 the clinical implication of the present study is that it provides in vitro evidence supporting a new therapeutic approach in chronic hepatitis b with a combination of a direct antiviral agent (such as the hbv-dna polymerase inhibitors) with a host-targeting antiviral (such as alisporivir), which is likely to increase the rate of hbsag clearance. alisporivir is a host-targeting antiviral agent currently in development for the treatment of chronic hepatitis c. analyses of the clinical database, involving more than 2000 patients, show that alisporivir is well tolerated and has a markedly better safety profile when given as interferon-free treatment than with interferon-containing treatment. 38 a combination treatment with an hbv nucleos(t)ide polymerase inhibitor plus alisporivir could be beneficial because of the interference at multiple sites of the hbv life cycle, especially the additional effects in reducing hbsag production and secretion, plus blocking hbv entry into noninfected hepatocytes. in the present study, the combination of alisporivir plus telbivudine showed greater impact on hbsag and supports the potential utility of this combination, which deserves to be tested in clinical studies. in conclusion, cyclophilins are involved in multiple steps of the hbv life cycle in infected hepatocytes and blocking their enzymatic activity using nonimmunosuppressive cyclophilin inhibitors reduces viral replication and hbv envelope protein production and secretion. the combination of alisporivir, a host-targeting agent, and an hbv polymerase inhibitor, was found to decrease hbsag production markedly, as well as hbv replication, indicating a potential utility for a more effective therapy in chronic hepatitis b. note: to access the supplementary material accompanying this article, visit the online version of gastroenterology at www.gastrojournal.org, and at http://dx.doi.org/10.1053/ j.gastro.2014.10.004. the cyclophilins curing a viral infection by targeting the host: the example of cyclophilin inhibitors multiple cyclophilins involved in different cellular pathways mediate hcv replication completion of the entire hepatitis c virus life cycle in genetically humanized mice redistribution of cyclophilin a to viral factories during vaccinia virus infection and its incorporation into mature particles cyclophilin a and viral infections cyclophilin a and nuclear factor of activated t cells are essential in cyclosporinemediated suppression of polyomavirus bk replication the sarscoronavirus-host interactome: identification of cyclophilins as target for pan-coronavirus inhibitors profile of alisporivir and its potential in the treatment of hepatitis c debio 025, a cyclophilin binding molecule, is highly efficient in clearing hepatitis c virus (hcv) replicon-containing cells when used alone or in combination with specifically targeted antiviral therapy for hcv (stat-c) inhibitors the isomerase active site of cyclophilin a is critical for hepatitis c virus replication essential role of cyclophilin a for hepatitis c virus replication and virus production and possible link to polyprotein cleavage kinetics inhibition of cyclophilins alters lipid trafficking and blocks hepatitis c virus secretion cd8(þ) t cell control of hepatitis b virus replication: direct comparison between cytolytic and noncytolytic functions effect of interferon alpha on hepatitis b virus replication and gene expression in transiently transfected human hepatoma cells persistence of the hepatitis b virus covalently closed circular dna in heparg human hepatocyte-like cells telbivudine, a nucleoside analog inhibitor of hbv polymerase, has a different in vitro cross-resistance profile than the nucleotide analog inhibitors adefovir and tenofovir apobec and inos are not the main intracellular effectors of ifn-gammamediated inactivation of hepatitis b virus replication detection of specific sequences among dna fragments separated by gel electrophoresis molecular cloning: a laboratory manual the cyclophilin inhibitor debio-025 shows potent anti-hepatitis c effect in patients coinfected with hepatitis c and human immunodeficiency virus multiple comparison analysis testing in anova new insight in the pathobiology of hepatitis b virus infection hepatitis b virus (hbv) surface antigen interacts with and promotes cyclophilin a secretion: possible link to pathogenesis of hbv infection calcium signaling by hbx protein in hepatitis b virus dna replication hepatitis b virus x protein is essential to initiate and maintain virus replication after infection hepatitis b virus hbx protein localizes to mitochondria in primary rat hepatocytes and modulates mitochondrial membrane potential activation and inhibition of cellular calcium and tyrosine kinase signaling pathways identify targets of the hbx protein involved in hepatitis b virus replication hepatitis b and d viruses exploit sodium taurocholate co-transporting polypeptide for species-specific entry into hepatocytes sodium taurocholate cotransporting polypeptide is a functional receptor for human hepatitis b and d virus cyclosporin a inhibits hepatitis b and hepatitis d virus entry by cyclophilin-independent interference with the ntcp receptor cyclosporin a and its analogs inhibit hepatitis b virus entry into cultured hepatocytes through targeting a membrane transporter, sodium taurocholate cotransporting polypeptide (ntcp) asian-pacific consensus statement on the management of chronic hepatitis b: a 2008 update easl clinical practice guidelines: management of chronic hepatitis b virus infection chronic hepatitis b: update 2009 kinetics of hepatitis b surface antigen decline during 3 years of telbivudine treatment in hepatitis b e antigen-positive patients effectiveness of hepatitis b treatment in clinical practice interferon (ifn)-free alisporivir has a better overall safety profile compared to ifn-containing treatment: a pooled analysis of the alv development program supplementary figure 6. dose-dependent inhibition of cellular cyclophilin expression by cyclophilin-specific sirna. inhibition of glyceraldehyde-3-phosphate dehydrogenase (gapdh) by gapdh-specific sirna and transfection efficiency (siglo) 150 nmol/l for 24, 48, 72, and 96 hours. (a) cypa, (b) cypc, and (c) cypd expressions were measured in the cyclophilin sirna-treated cells by real-time pcr. as controls. hepg2215 cells were transfected with gapdh sirna and siglo transfection indicator for 48 hours. (d) gapdh expression was measured in gapdh and cypa sirna-treated cells at bl (48 h after transfection), and at 24, 48, and 72 hours by real-time pcr. (e) transfection efficiency was measured by flow cytometry at bl and 72 hours. nd, not done. the mean values and the sd of 2 independent experiments are shown. fitc the authors thank professor hans will (hamburg, germany) for providing the psm2 plasmid and the hepg2215 cells. these authors disclose the following: shilpa chokshi has received a research grant from novartis, and nikolai naoumov is an employee of novartis pharma ag, basel, switzerland. the remaining authors disclose no conflicts. this work was supported in part by a research grant from novartis pharma ag, basel, switzerland. the sirna oligonucleotides for cypa, cypb, cypc, and cypd (m-004979-01-0005; m-004606-00-0005; m-008819-00-0005; m-009708-00-0005; sigenome smart pool; thermo scientific dharmacon) were prepared in opti-mem medium at the following concentrations: 300, 600, 1000, and 1500 nmol/l. lipofectamine was diluted in opti-mem medium at a ratio of 1:50 for 5 minutes. each sirna concentration was mixed with the lipofectamine complex, gently mixed, and incubated for 30 minutes. hepg2215 cells seeded at a density of 1 â 10 5 cells per well were treated to this sirna:lipofectamine complex and incubated for 24, 48, 72, and 96 hours at 37 c. the cells also were transfected at these different time points with siglo green to assess the transfection efficiency. the cellular rna was extracted from the cells, reverse-transcribed, and quantitated by real-time pcr as previously described. 1 the primers used were commercially available (hsppia_1_sg; hsppib_1_sg; hsppic_1_sg; hsppif_1_sg; and b-actin as the housekeeping gene hb-actb_1_sg; qiagen). telbivudine stock solutions of 2000â were made in 100% dmso and diluted to prepare the following working concentrations: 0.04 mmol/l (9.6 â 10 -3 mg/ml), 0.16 mmol/l (0.038 mg/ml), 0.65 mmol/l (0.157 mg/ml), 2.5 mmol/l (0.605 mg/ml), 10 mmol/l (2.42 mg/ml), and 20 mmol/l (4.84 mg/ml). hepg2215 cells were treated with these working solutions of telbivudine at bl, and at 24, 48, and 72 hours. the telbivudine-containing media were replaced every 24 hours. the supernatants were collected at every time point and the hbv dna extracted from the supernatants was quantitated by real-time pcr. key: cord-003018-qrt07zmz authors: miyakawa, kei; matsunaga, satoko; yamaoka, yutaro; dairaku, mina; fukano, kento; kimura, hirokazu; chimuro, tomoyuki; nishitsuji, hironori; watashi, koichi; shimotohno, kunitada; wakita, takaji; ryo, akihide title: development of a cell-based assay to identify hepatitis b virus entry inhibitors targeting the sodium taurocholate cotransporting polypeptide date: 2018-05-04 journal: oncotarget doi: 10.18632/oncotarget.25348 sha: doc_id: 3018 cord_uid: qrt07zmz sodium taurocholate cotransporting polypeptide (ntcp) is a major entry receptor of hepatitis b virus (hbv) and one of the most attractive targets for anti-hbv drugs. we developed a cell-mediated drug screening method to monitor ntcp expression on the cell surface by generating a hepg2 cell line with tetracycline-inducible expression of ntcp and a monoclonal antibody that specifically detects cell-surface ntcp. using this system, we screened a small molecule library for compounds that protected against hbv infection by targeting ntcp. we found that glabridin, a licorice-derived isoflavane, could suppress viral infection by inducing caveolar endocytosis of cell-surface ntcp with an ic(50) of ~40 μm. we also found that glabridin could attenuate the inhibitory effect of taurocholate on type i interferon signaling by depleting the level of cell-surface ntcp. these results demonstrate that our screening system could be a powerful tool for discovering drugs targeting hbv entry. hepatitis b virus (hbv) is the causative agent of chronic hepatitis b (chb), which can lead to liver cirrhosis and hepatocellular carcinoma. the world health organization reported that over 240 million people worldwide have chronic hbv [1] . despite the effectiveness of the hbv vaccine, worldwide prevalence of the disease remains high, and chb is a major global health problem. current therapeutic regimens for chb include pegylated interferon (ifn) and nucleoside/ nucleotide analogues. both treatments aim to prevent progression of the disease to liver failure, cirrhosis, and hepatocellular carcinoma. however, these treatments have limited effectiveness for hbv clearance [2] . in fact, pegylated ifn maintains viral suppression only in approximately 25% of patients [3] . nucleoside and nucleotide analogues inhibit hbv replication by targeting viral dna polymerase, but long-term treatment is required to achieve clinical benefits. for example, a 12-month course of lamivudine achieves clearance of hepatitis b e antigen (hbeag) in approximately 30% of patients with chb [4] . moreover, long-term treatment can be associated with a higher risk of side effects and emergence of drug resistant viruses, resulting in treatment failure and disease progression. therefore, it is vital to research paper www.oncotarget.com develop new types of antiviral drugs for hepatitis b treatment. in the hbv life cycle, the hepatitis b surface antigen (hbsag) initially attaches to heparan sulfate proteoglycans on the host cell surface [5] . this attachment seems to be relatively low affinity and reversible, but is essential for the subsequent more specific interaction between hbs and the hepatocyte-specific bile acid transporter sodium taurocholate cotransporting polypeptide (ntcp) [6] . although various membrane proteins have been reported to be hbv entry receptors, accumulating evidence now suggests that ntcp is an essential receptor for hbv infection [7] . discovery of this receptor has dramatically increased our understanding of the molecular basis of hbv entry. viral entry is currently one of the most important targets in the search for new drugs to treat viral infections and identification of ntcp has kindled interest in exploring compounds that inhibit hbv entry. ntcp is exclusively expressed at the basolateral membrane of hepatocytes [8] [9] [10] , and is involved in reuptake of conjugated bile acids from the bloodstream into hepatocytes [11] . ntcp is one of the factors that highly restrict host tropism of hbv to hepatocytes. the specific interaction of the pres1 domain of hbsag with ntcp triggers hbv attachment and initiates entry into hepatocytes. the synthetic peptide drug myrcludex b exhibits significant anti-hbv activity by competitively inhibiting this interaction, both in vitro and in vivo, and is currently undergoing a phase ii clinical trial for chronically hbv-infected patients [12, 13] . physiological substrates of ntcp such as taurocholic and glycocholic acids can also inhibit hbv infection, suggesting the competitive binding of bile acids and pres1 to ntcp [14] . interestingly, pres1-ntcp binding could trigger type i ifn signaling, whereas bile acid treatment does not [15] . bile acid intake via ntcp was found to inhibit the ifn pathway in the physiologically relevant range of concentrations [16] . these observations support the possibility that ntcp also takes part in the ifn-mediated innate antiviral response. because high expression often causes cell cycle inhibition, there are very few conventional hepatocellular carcinoma cell lines with ectopic expression of high levels of ntcp. moreover, there are no commercially available monoclonal antibodies (mabs) specifically recognizing cell-surface ntcp due to the difficulty of producing full-length ntcp protein with native structure. in the current study, we generated hbv-susceptible hepg2 cells with a tetracycline-inducible ntcp gene (intcp cells) without affecting cell growth. we also generated a high quality mab (clone 9a8) to efficiently detect cell-surface ntcp. using these tools, we identified the compound glabridin, which significantly inhibits hbv infection through the downregulation of ntcp from the cell surface. endogenous ntcp expression is rarely detectable in hepatoma cell lines such as hepg2 and huh7, and these cells are not susceptible to hbv infection. therefore, we generated the intcp cell line, a hepg2based cell line harboring a tetracycline-inducible human ntcp gene ( figure 1a) . treatment of the intcp cell line with the tetracycline analogue doxycycline (dox) caused expression of ntcp in a dox-dependent manner, and ntcp expression was 20-to 100-fold higher than endogenous expression in differentiated heparg cells and primary hepatocytes, as revealed by western blot and quantitative reverse transcription-pcr ( figure 1b-1d) . to determine whether dox-induced ntcp protein localized to the plasma membrane, we performed a pres1 peptide binding assay. we found that the pres1 peptide detected dox-treated intcp cells but not untreated cells, indicating the presence of ntcp on the cell surface ( figure 1e ). consistent with a previous report [6] , a western blot of ntcp showed major bands of 60-80 kd that were shifted to a single band of 30-40 kd after treatment with peptide n-glycosidase (pngase), implying that ntcp was modified by n-glycosylation (supplementary figure 1a) . although ntcp expression has been reported to affect cell proliferation [17] , intcp cells showed no differences in cell cycle progression or cell expansion with or without dox treatment ( figure 1f, 1g) . we subsequently examined the susceptibility of intcp cells to hbv infection. at an moi of 6000 geq/cell, intcp cells showed high susceptibility to hbv infection (~80% infected) without dmso treatment ( figure 1h , supplementary figure 1b ). this infection was significantly inhibited by pres1 peptide treatment ( figure 1h ), which indicates that hbv infection was ntcp-mediated. taken together, these results show that dox-induced ntcp proteins are exposed on the cell surface and functionally interact with pres1. although the above results suggest that ntcp proteins localize on the cell surface, this could not be directly demonstrated due to the lack of suitable antibodies for flow cytometry or immunofluorescence microscopy analysis. therefore, we generated a monoclonal antibody (mab) for this purpose. because recombinant ntcp protein tends to form insoluble aggregates, we utilized the wheat germ cell-free system, which has been shown to have advantages for the production of membrane proteins [18, 19] . the synthesized ntcp proteins were purified and used to immunize mice, and more than 140 hybridoma clones were established (figure 2a ). using a www.oncotarget.com flow cytometer-based screening assay with dox-treated and untreated intcp cells, we identified a hybridoma clone producing anti-ntcp mab, clone 9a8 ( figure 2b ). the 9a8 mab could recognize endogenous ntcp in differentiated heparg cells (supplementary figure 2) . we performed immunofluorescence microscopy using the 9a8 mab in various cell lines and cell-surface ntcp was clearly observed ( figure 2c , 2d). because the three-dimensional organoid culture recapitulates cell-cell interactions and recent studies have indicated some advantages of hepatoma organoids in hepatitis virus infection [20] , we investigated the localization of ntcp in hepatoma organoids. we embedded intcp cells in hydrogel before performing immunofluorescence microscopy with the 9a8 mab to visualize ntcp. ntcp localization was widespread in the membrane of internal cells as well as on the surface of the organoid ( figure 2e ). epitope mapping using recombinant ntcp mutants revealed that the 9a8 mab recognizes amino acids 317-326 of ntcp ( figure 2f ). to test whether the 9a8 antibody can inhibit hbv infection, we pretreated intcp cells and primary human hepatocytes with 9a8 mab and subsequently infected cells with wild type hbv and hbv encoding a luciferase reporter gene (hbv-nl) [21] . the 9a8 mab failed to inhibit hbv infection ( figure 2g , 2h), suggesting that the interaction between 9a8 mab and ntcp neither blocks hbv-host cell interaction nor causes downregulation of ntcp from the cell surface. because the 9a8 mab binds ntcp but does not interfere with its localization and function, it can be used to screen for antiviral compounds that modulate the level of cell-surface ntcp. briefly, intcp cells were treated with 102 different low-molecular-weight chemical compounds from a library derived from natural plant extracts for 24 hours and we subsequently quantified cell viability and the amount of cell-surface ntcp using the 9a8 mab ( figure 3a ). we identified two compounds, geraldol and glabridin, that could decrease the amount of cell-surface ntcp without observable cytotoxicity ( figure 3b ). flow cytometry analysis using the 9a8 mab demonstrated that both geraldol and glabridin decrease the levels of cell-surface ntcp in a dose-dependent fashion ( figure 3c ), but further analysis revealed that geraldol negatively regulates the tetracycline-responsive promoter activity ( figure 3d ). microscale thermophoresis analysis of the biomolecular interaction [22] revealed that glabridin could weakly but directly interact with ntcp ( figure 3e ). therefore, we focused on glabridin for further functional analyses. flow cytometry analysis showed that glabridin downregulated the amount of cell-surface ntcp in hepg2-hntcp-c4 [23] and heparg cells with ic 50 values of 28 µm and 34 µm, respectively ( figure 4a ). notably, treatment with 50 µm glabridin had no effect on the level of ntcp mrna (supplementary figure 3a) , suggesting that glabridin affects ntcp protein rather than ntcp gene expression. consistently, treatment with glabridin rapidly (within three hours) modulated the membrane localization of ntcp, but not that of the transferrin receptor ( figure 4b ). similar results were obtained with cell-surface biotinylation analysis in which only cell-surface proteins were purified and detected by western blotting (supplementary figure 3b ). immunofluorescence microscopy using the 9a8 mab showed that in glabridin-treated cells, ntcp mainly accumulated in the cytoplasm ( figure 4c ). to test the role of endocytosis in ntcp localization, we treated cells concurrently with glabridin and inhibitors of clathrinmediated or caveolar endocytosis. we found that genistein, a specific inhibitor of caveolar endocytosis, completely disrupted ntcp internalization ( figure 4d ), suggesting that glabridin causes the internalization of ntcp through caveolar endocytosis. because internalized membrane proteins are typically trafficked to degradation or recycling pathways, we next performed a cycloheximide chase assay. interestingly, ntcp protein levels were relatively stable in control cells, but the half-life of ntcp was significantly shorter in glabridin-treated cells ( figure 4e ). this suggests that glabridin reduces the amount of ntcp on the cell surface by promoting its endocytosis and subsequent intracellular degradation. previous reports have indicated that glabridin induces apoptosis in certain cancer cells [24] , but we observed no negative effect on cell viability under our experimental conditions ( figure 4f ). we next assessed the impact of glabridin on hbv infection in hepatocytes. time-of-addition experiments demonstrated that 50 µm glabridin inhibited hbv infection when added early in infection but became less effective when added later ( figure 5a ), suggesting that it acts at an early stage of the viral life cycle. indeed, when glabridin was added to hbv-producing cells, it did not affect the amounts of core-associated viral dna and/or rna (supplementary figure 4) . consistent with these observations, intcp cells treated with glabridin three hours prior to infection showed a significant reduction in the percentage of infected cells and the amount of hbsag secretion ( figure 5b , 5c). we performed a parallel analysis with differentiated heparg cells and confirmed that glabridin blocked hbv infection and downregulated endogenous ntcp with an ic 50 value of 33 µm ( figure 5d ). these results suggest that glabridin inhibits hbv infection by removing ntcp from the cell surface. ntcp is a transporter for bile acid uptake. we investigated the effect of glabridin on ntcp-mediated www.oncotarget.com anti-ntcp mab generation. using a wheat germ cell-free protein production system, large amounts of ntcp were synthesized with high solubility. following mouse immunization, we established over 140 hybridoma clones. (b) selection of 9a8 clones producing anti-ntcp mab. culture supernatants of hybridoma clones were used as primary antibodies for flow cytometry analysis of dox-treated (red line) or -untreated intcp cells (blue line). (c-e) immunofluorescence staining of cell-surface ntcp by 9a8 mab on intcp cells (c), hepg2-hntcp-c4 cells (d), and intcp-derived spheroid (e). scale bars: 10 µm. (f) epitope mapping of 9a8 mab. recombinant wild-type or partially truncated ntcp proteins tagged with his were generated using wheat germ extracts and subjected to western blotting using anti-his or 9a8 antibodies. the predicted epitope of 9a8 mab is shown in pink. (g, h) 9a8 mab fails to inhibit hbv infection. intcp cells (g) and primary human hepatocytes (h) were infected with hbv or its reporter virus (hbv-nl) respectively, in the presence of 9a8 mab. anti-hbs mab (clone 33a4, which recognizes the pres1 domain) was used as a control. viral infectivity was determined by intracellular hbcag staining (g) or nanoluc activity (h) of infected cells. uptake of taurocholate (tca) in a sodium-containing condition and found that glabridin reduced tca uptake in a dose-and time-dependent manner ( figure 6a ). a previous study has shown that ntcp-mediated bile acid transport affects the expression of ifn stimulatory genes (isgs) in primary human hepatocytes [15] , so we investigated whether glabridin counteracts this function of bile acid. primary human hepatocytes were treated with type i ifn and tca in the presence or absence of glabridin. treatment with ifn upregulated various isg proteins including mx1 and bst2, which are known to inhibit hbv replication [25] [26] [27] [28] , while concurrent treatment with tca reduced this effect ( figure 6b ), in accordance with previous observations [15] . interestingly, the addition of 50 µm glabridin partially cancelled the effect of tca in isg expression ( figure 6b ). these findings suggest that glabridin enhances the innate immune response by suppressing bile acid uptake in hepatocytes through the downregulation of cell-surface ntcp. in this study, we generated intcp cells, which have high ntcp expression and high susceptibility to hbv infection, and also developed a monoclonal antibody (mab) that recognizes cell-surface ntcp. using these tools, we identified glabridin as a compound that inhibits hbv infection by downregulating levels of its entry receptor, ntcp. although primary hepatocytes express ntcp at low levels for the uptake of bile acids, endogenous ntcp in hepatocellular carcinoma cell lines is not sufficient to achieve successful infection with hbv in vitro. hepatocellular carcinoma cell lines stably expressing ntcp have been created, and exhibited increased susceptibility to hbv infection [29] , but it has been shown that continuous ntcp expression can induce cell cycle arrest at the g0/g1 phase [17] , indicating that ectopic ntcp expression may be unfavorable for the long-term culture. to overcome these issues, we created the intcp cell line, featuring inducible ntcp expression, using the third-generation tetracyclineinducible gene expression system in hepg2 cells. upon transient treatment with tetracycline derivatives, this cell line exhibits high expression of cell-surface ntcp and becomes highly susceptible to hbv infection without any observable cell cycle arrest. this unique feature of our newly developed cell line makes it a useful tool for further biological analysis of ntcp in hepatic cells. we created a new mab recognizing cell-surface ntcp by using a wheat germ cell-free protein production system to synthesize full-length recombinant ntcp protein, which was then used to immunize mice. generally, the quality of an antibody is determined largely by the antigen used for immunization. preparation of immunogens derived from highly insoluble membrane proteins is challenging, and ntcp tends to be insoluble in conventional cell expression systems due to its multiple transmembrane domains. there are several methods for preparing antigens derived from insoluble proteins, including use of synthetic peptides containing the predicted immunogenic epitope of extracellular domains [30] , but synthetic peptides are structurally linear and do not recapitulate the native structural features of membrane proteins. by contrast, the wheat germ cell-free protein production system utilizes a eukaryotic translation system to synthesize structurally intact and biologically active proteins similar to those expressed in mammalian cells [31, 32] . this approach enabled us to create a mab capable of detecting a spatial antigen within the region of ntcp exposed on the cell surface. our work demonstrates the advantage of the cell-free system in the production of proteins with multiple transmembrane domains [18, 19] . the three-dimensional structure of ntcp protein has not been well characterized and the number of transmembrane domains is controversial at present. several groups have predicted that ntcp has 7-9 transmembrane domains and that the c-terminus of ntcp is located in the cytoplasm [33, 34] . we found that our 9a8 mab recognizes amino acids 317-326 of ntcp on intact cells without membrane permeabilization, implying that this epitope is possibly exposed to the extracellular space. more precise structural biological studies should be carried out to elucidate the topology of the ntcp protein. immunofluorescence microscopy experiments using our 9a8 antibody revealed that ntcp localized on the plasma membrane, frequently at cell-cell contact sites. this localization was more obvious in a hepatocyte organoid culture system, suggesting that the localization of ntcp may depend on cell polarity. because the threedimensional culture system recapitulates cell polarity, it is useful for analyzing the function of ntcp in sodium taurocholate transport as well as hbv infection. recent studies demonstrated that the three-dimensional culture system is suitable for analyzing polarized hbv transmission [35, 36] . it is not well established whether ntcp plays a role in viral transmission in polarized cells, and our newly developed 9a8 mab may be useful for pursuing this intriguing question. several compounds have been shown to target ntcp. recent studies demonstrated that antagonists of retinoic acid receptor ro41-5253 [37] or the cytokine interleukin-6 [38] could reduce ntcp expression. a previous report also indicated that the green tea extract epigallocatechin-3-gallate (egcg) also inhibited hbv entry into primary human hepatocytes [39] . interestingly, egcg induced endocytosis of ntcp from the plasma membrane followed by protein degradation. in the current study, we found that glabridin, a compound from licorice extract, also causes ntcp receptor downregulation. although the precise mechanisms are unclear, our findings intcp cells were treated with glabridin (10, 25, and 50 µm) for three or 20 hours. after incubation with [ 3 h]-taurocholate (tca) for 15 minutes, cells were washed and intracellular radioactivity was quantified. cyclosporin a (csa, 10 µm) was used as a positive control in this assay. * p < 0.05, ** p < 0.01, two-tailed unpaired t-test. (b) glabridin counteracts bile acids to promote innate immune signaling. primary human hepatocytes were sequentially treated with ifn-β (100 u/ml), tca, and glabridin (50 µm), as shown in left panel. the expression of representative isgs, including mx1 and bst2, was quantified using qpcr. ns, not significant; ** p < 0.01, two-tailed unpaired t-test. www.oncotarget.com suggest that glabridin directly binds ntcp and causes its internalization by caveolar endocytosis. by estimating protein turnover using a cycloheximide chase assay, we were able to infer that glabridin promotes the intracellular degradation of ntcp. interestingly, glabridin is orally bioavailable and is known to rapidly accumulate in the liver [40] [41] [42] . since ic 50 value of glabridin for inhibiting of hbv entry is relatively high (~40 µm), this compound might have little translational benefit in hbv research. however, the data obtained from our study demonstrates the potential scope of our current methodology in drug discovery for hbv therapeutics. it is possible that the internalization of ntcp could inhibit its transporting activity thereby causing unfavorable effects on hepatocytes. however, people with i223t or s267f mutations in the ntcp gene show decreased surface expression and transporting activity of ntcp, but there have been no reports of serious diseases resulting from these mutations to date [43, 44] . the frequent occurrence of physiological downregulation of ntcp is also notable. this downregulation is typically controlled by transcription factors, such as hnf4α, under cholestasis conditions [45] . furthermore, recent papers have shown that ntcp is the main transporter for conjugated bile acids into the liver, but other auxiliary transporters, such as oatp, may compensate when ntcp is absent [46, 47] . although these reports hint that transient downregulation of ntcp might not induce immediate adverse effects on the liver, the effect should be further investigated in in vivo models to determine whether ntcp inhibition is a reasonable anti-hbv drug target. in conclusion, we identified as glabridin as a natural compound capable of inhibiting hbv infection by impairing viral entry into host cells, with an additional effect of enhancing the antiviral immune response. furthermore, our data demonstrate that our newly developed cell line and antibody will serve as powerful tools for drug discovery targeting hbv entry and for exploring molecular mechanisms underlying hbv spread. to generate intcp cells, a hepg2 tet-on advanced cell (clontech) parental cell line was transduced with a retroviral vector encoding the ntcp gene fused to a tetracycline-responsive element, then was selected with puromycin (1 µg/ml), and cultured with dmem (wako) supplemented with 10% fbs. unless otherwise indicated, intcp cells were treated with doxycycline (sigma-aldrich) for 24 hours before experiments. the intcp spheroid was made using the 3-d life dextran-cd hydrogel sg kit (cellendes) and cultured for seven days on a chamber slide (thermo fisher scientific). primary human hepatocytes (pxb-cells) were purchased from phoenixbio. heparg cells were purchased from biopredic international and differentiated according to the manufacturer's instructions. the chemical compound library from natural plant extracts was obtained from tokiwa phytochemical. nocodazole, cyclosporin a, genistein, and pitstop2 were purchased from sigma-aldrich. glabridin, staurosporine, and ifn-β were obtained from wako. a protemist xe robotic protein synthesizer (cellfree sciences) was used for the generation of full length ntcp and its truncated derivatives as previously described [48, 49] . immunization of balb/c mice with recombinant ntcp and generation of hybridoma cells producing anti-ntcp antibody were performed as previously described [48] . purification of antibodies in the culture supernatant of the hybridoma clones was performed by centrifugation at 8,000 rpm for 15 minutes and elution with acrosep hyper df columns (pall). samples were then concentrated using amicon ultra filters (merck millipore). immunoglobulin characterization was carried out using the isostrip mouse monoclonal antibody isotyping kit (roche). cells were fixed with 4% paraformaldehyde, blocked with 10% normal goat serum (thermo fisher scientific), and stained with either anti-ntcp mab (clone 9a8) or anti-hbcag polyclonal antibody (dako) and alexa fluor-conjugated secondary antibodies (thermo fisher scientific). alexa fluor 594-conjugated phalloidin (thermo fisher scientific) was used for f-actin staining. for intracellular staining, cells were permeabilized with 0.5% triton x-100 before blocking. for the pres1-peptide binding assay, intcp cells pretreated with 5 µg/ml dox for 24 hours were incubated with 400 nm fitc-conjugated pres1 peptide (the first 59 amino acid residues of small hbs domain fused with n-terminal myristoyl group and c-terminal fitc) at 37° c for two hours. cells were then washed with pbs and fixed with 4% paraformaldehyde. microscopic imaging was performed with an fv1000-d confocal laser scanning microscope (olympus) or bz-9000 fluorescence microscope (keyence). cells were detached with 5 mm edta in pbs and fixed with 4% formaldehyde before incubation with either anti-ntcp (9a8) or anti-transferrin receptor (genetex) antibodies at 4° c. cells were then stained with pe-conjugated secondary antibody and analyzed using a facscanto ii instrument (bd biosciences). for the drug screen, cells were treated with candidate compounds www.oncotarget.com (50 µm) 24 hours before analysis. data were analyzed with flowjo software (treestar). wild-type hbv was derived from the supernatants of hepg2.2.15 cells, which were stably transfected with a complete hbv genome. hbv reporter viruses (hbv-nl) were produced by transient transfection of hepg2 cells with puc1.2-hbv/nl and puc-hbv-d, as previously described [21] . the collected supernatants were filtered through a 0.45-μm filter (merck millipore), and concentrated approximately 100 times using a peg virus precipitation kit (biovision). cells were infected with wild-type hbv at a concentration of 5,000 genome equivalents per cell in the presence of 4% peg8000 for 16 hours. alternatively, cells in a 96-well plate were inoculated with 5 µl of hbv-nl in the presence of 4% peg8000 for 16 hours. hbv-infected cells were cultured in fresh medium for an additional 5-6 days and their infectivity was determined by intracellular hbcag staining or extracellular hbsag quantification, as previously described [28] . the infectivity of hbv-nl was quantified using the nano-glo luciferase system (promega), according to the manufacturer's instructions. samples in sds loading buffer were loaded onto 10% polyacrylamide gels, electrophoresed, and blotted onto pvdf membranes (merck millipore), as previously described [28] . membranes were probed with primary antibodies and horseradish peroxidase-conjugated secondary antibodies (ge healthcare). for protein degradation analysis, cycloheximide (100 µg/ml) was added 2-6 hours before harvesting cells. the primary antibodies used were as follows: anti-ntcp, anti-vinculin, anti-α-tubulin (sigma-aldrich) and anti-his (genetex). detected proteins were visualized using a fluorchem digital imaging system (alpha innotech). band analysis was performed with imagej software (national institutes of health). messenger rna extraction and subsequent cdna synthesis was performed using trizol reagent (thermo fisher scientific) and revertra ace (toyobo), respectively, according to each manufacturer's instructions. gene expression was then analyzed by qpcr using sybr premix ex taq ii (takara) and a cfx96 real-time pcr detection system (bio-rad). the primer pairs used were 5′-ggacttcgagcaagagatgg-3′ and 5′-agcactgtgttggcgtacag-3′ for actb; 5′-atggaggcccacaacg cgtctgccc-3′ and 5′-cagaaggtggagcaggtggtcatcac-3′ for ntcp; 5′-ggctgtttaccagactccgaca-3′ and 5′-cacaaa gcctggcagctctcta-3′ for mx1; and 5′-tctcctgcaaca agagctgacc-3′ and 5'-tctctgcatccagggaagccat-3' for bst2. recombinant ntcp-gfp and gfp proteins were incubated with different concentrations of compounds in 50 mm potassium phosphate buffer (ph 7.0) containing 100 mm nacl, 0.2% bsa, and 0.005% ddm (n-dodecylβ-d-maltopyranoside) for one hour at room temperature. samples were loaded on monolith nt.115 standard treated capillaries (nano temper technologies) and analyzed with a monolith nt.115 blue red microscale thermophoresis instrument. cell cycle analysis was performed with a tali image-based cytometer (thermo fisher scientific). cell viability was measured with cell counting kit-8 (dojindo) or celltiter-glo assay (promega) according to the manufacturer's instructions. cells were treated with [ 3 h]-taurocholic acid (tca) in a sodium-free or sodium-containing buffer at 37ºc for 15 minutes to allow tca uptake into cells. cells were washed and intracellular radioactivity was measured using a liquid scintillation counter. all graphs represent means and standard deviations. the statistical significance of differences between two groups was tested using a two-tailed unpaired t test with prism 6 software (graphpad). km designed and performed research, analyzed data, and wrote the manuscript; sm, yy, md, and kf performed research and analyzed data; hk and tc analyzed data; hn, kw, ks, and tw contributed reagents and analyzed data; and ar designed and supervised the research, analyzed the data, and wrote the manuscript. global epidemiology of hepatitis b virus infection: new estimates of age-specific hbsag seroprevalence and endemicity virologic monitoring of hepatitis b virus therapy in clinical trials and practice: recommendations for a standardized approach pegylated interferon alfa-2b alone or in combination with lamivudine for hbeag-positive chronic hepatitis b: a randomised trial nucleoside analogues for chronic hepatitis b: antiviral efficacy and viral resistance entry of hepatitis b and hepatitis d virus into hepatocytes: basic insights and clinical implications sodium taurocholate cotransporting polypeptide is a functional receptor for human hepatitis b and d virus hepatitis b and d viruses exploit sodium taurocholate co-transporting polypeptide for speciesspecific entry into hepatocytes characterization of cloned rat liver na(+)-bile acid cotransporter using peptide and fusion protein antibodies in situ localization of the hepatocytic na+/ taurocholate cotransporting polypeptide in rat liver chlorambucil-taurocholate is transported by bile acid carriers expressed in human hepatocellular carcinomas sinusoidal (basolateral) bile salt uptake systems of hepatocytes first-in-human application of the novel hepatitis b and hepatitis d virus entry inhibitor myrcludex b treatment of chronic hepatitis d with the entry inhibitor myrcludex b: first results of a phase ib/iia study kinetics of the bile acid transporter and hepatitis b virus receptor na+/taurocholate cotransporting polypeptide (ntcp) in hepatocytes solute carrier ntcp regulates innate antiviral immune responses targeting hepatitis c virus infection of hepatocytes bile acids modulate the interferon signalling pathway down-regulation of ntcp expression by cyclin d1 in hepatitis b virus-related hepatocellular www.oncotarget.com carcinoma has clinical significance production and partial purification of membrane proteins using a liposome-supplemented wheat cell-free translation system a cell-free translation and proteoliposome reconstitution system for functional analysis of plant solute transporters single particle imaging of polarized hepatoma organoids upon hepatitis c virus infection reveals an ordered and sequential entry process novel reporter system to monitor early stages of the hepatitis b virus life cycle molecular interaction studies using microscale thermophoresis evaluation and identification of hepatitis b virus entry inhibitors using hepg2 cells overexpressing a membrane transporter ntcp glabridin mediate caspases activation and induces apoptosis through jnk1/2 and p38 mapk pathway in human promyelocytic leukemia cells mxa inhibits hepatitis b virus replication by interaction with hepatitis b core antigen the interferon-inducible protein tetherin inhibits hepatitis b virus virion secretion identification of bst-2/tetherin-induced hepatitis b virus restriction and hepatocyte-specific bst-2 inactivation molecular dissection of hbv evasion from restriction factor tetherin: a new perspective for antiviral cell therapy cell culture models for the investigation of hepatitis b and d virus infection generation and identification of peptide-based monoclonal antibodies against vacuolar proton pyrophosphatase of toxoplasma gondii advances in genome-wide protein expression using the wheat germ cell-free system cell-free expression systems for eukaryotic protein production organization of the membrane domain of the human liver sodium/bile acid cotransporter cloning and functional characterization of human sodium-dependent organic anion transporter (slc10a6) concise review: organoids are a powerful tool for the study of liver disease and personalized treatment design in humans and animals cultivation of hepg2.2.15 on cytodex-3: higher yield of hepatitis b virus and less subviral particles compared to conventional culture methods dysregulation of retinoic acid receptor diminishes hepatocyte permissiveness to hepatitis b virus infection through modulation of sodium taurocholate cotransporting polypeptide (ntcp) expression interleukin 6 inhibits hbv entry through ntcp down regulation epigallocatechin-3-gallate inhibits entry of hepatitis b virus into hepatocytes determination of glabridin in human plasma by solidphase extraction and lc-ms/ms role of p-glycoprotein in limiting the brain penetration of glabridin, an active isoflavan from the root of glycyrrhiza glabra role of p-glycoprotein in the intestinal absorption of glabridin, an active flavonoid from the root of glycyrrhiza glabra ethnicity-dependent polymorphism in na+-taurocholate cotransporting polypeptide (slc10a1) reveals a domain critical for bile acid substrate recognition genetic polymorphisms in na+-taurocholate co-transporting polypeptide (ntcp) and ileal apical sodium-dependent bile acid transporter (asbt) and ethnic comparisons of functional variants of ntcp among asian populations hepatocyte nuclear factor-4alpha is a central transactivator of the mouse ntcp gene sodium taurocholate cotransporting polypeptide (slc10a1) deficiency: conjugated hypercholanemia without a clear clinical phenotype hepatic uptake of conjugated bile acids is mediated by both sodium taurocholate cotransporting polypeptide and organic anion transporting polypeptides and modulated by intestinal sensing of plasma bile acid levels in mice wheat germ cell-free system-based production of hemagglutininneuraminidase glycoprotein of human parainfluenza virus type 3 for generation and characterization of monoclonal antibody development of monoclonal antibody and diagnostic test for middle east respiratory syndrome coronavirus using cell-free synthesized nucleocapsid antigen www.oncotarget.com we thank naohito nozaki for antibody production and haruka sato, kyoko ohnishi, and sho nonoyama for their technical assistance. the authors declare that they have no competing interests. this work was supported in part by an amed grant-in-aid for the program on the innovative development and the application of new drugs for hepatitis b (jp17fk0310103 to ar and jp17fk0310104 to km), the creation of innovation centers for advanced interdisciplinary research areas program (to ar), and by a gsk japan research grant (to km). key: cord-331731-c2r0kfaz authors: anugwom, chimaobi m; aby, elizabeth s; debes, jose d title: inverse association between chronic hepatitis b infection and covid-19: immune-exhaustion or coincidence? date: 2020-06-05 journal: clin infect dis doi: 10.1093/cid/ciaa592 sha: doc_id: 331731 cord_uid: c2r0kfaz nan m a n u s c r i p t dear editor, we read with great interest the report by zhao et al, regarding a case of delayed immune response to sars-cov-2 in a patient with hiv and hcv co-infection [1] . the authors stipulate the previous hiv and hcv infection could confer immune dysfunction providing a differential immune response during covid-19 development. this report, as most initial reports, originate in china which has an intermediate-high prevalence of chronic hepatitis b (hbv) infection [2] . we evaluated all peer-reviewed articles, written in the english language, reporting cases of covid-19 infection and specifically defining rates of hbv infection and hospital admission, since december 1 st , 2019 until march 25 th , 2020 and found a surprisingly low prevalence of chronic hbv in covid-19 cases admitted to the hospital. indeed, of the 2054 cases that were reported with this information, only 28 patients (1.36%) were reported positive for hbv. several of these studies reported 0% incidence of hbv among individuals infected with covid-19. we matched the hbv-rates in covid-19 subjects to age-specific rates of hbv reported in the respective geographic areas of origin ( table 1 ). the median age of covid-19 infected individuals in the evaluated studies ranged between 47-51 years, corresponding to hbv rates ranging from 7-11% while the hbv rates of those with covid-19 remained between 0-1.3%. it is unclear whether this is a simple epidemiological "misconnection" or if being chronically infected with hbv impacts the chances of clinically significant infection with sars-cov-2 leading to less hospital admissions, in a similar fashion as that reported by zhao et al to hiv and hcv. in this regard, research has documented that, chronic hbv infection leads to a reduced or absent virus specific t-cell reactivity (although hbv-specific t cells). this phenomenon, a c c e p t e d m a n u s c r i p t known as "immune exhaustion", is manifested by an impaired ability of t-lymphocytes to produce appropriate cytokines secondary to years of continuous, yet inefficient, immune reaction to the virus [3] . immune exhaustion is also frequently observed in chronic hcv infection [4] . in this setting, it is plausible that the exhaustion of t-lymphocytes may affect their ability to respond to other viruses and reduce the degree of "cytokine storm" that has been noticed in covid-19 patients, thus culminating in a less severe disease. similar patterns of immune co-interaction with consequences in clinical presentation and prognosis have been reported in individuals infected with hbv and schistosomiasis [5] . a c c e p t e d m a n u s c r i p t early virus clearance and delayed antibody response in a case of covid-19 with a history of co-infection with hiv-1 and hcv prevalence of hepatitis b virus infection in molecular and transcriptional basis of cd4⁺ t cell dysfunction during chronic infection the path to cancer and back: immune modulation during hepatitis c virus infection, progression to fibrosis and cancer, and unexpected roles of new antivirals helminth-induced immune modulation influences the outcome of acute and chronic hepatitis b virus infection a comparative study on the clinical features of covid-19 pneumonia to other pneumonias clinical characteristics of coronavirus disease 2019 in china epidemiological and clinical characteristics of 99 cases of 2019 novel coronavirus pneumonia in wuhan, china: a descriptive study clinical findings in a group of patients infected with the 2019 novel coronavirus (sars-cov-2) outside of wuhan, china: retrospective case series clinical progression of patients with covid-19 in epidemiologic features and clinical course of patients infected with sars-cov-2 in singapore we thank drs. lanjuan li (wuhan, china) and barnaby young (singapore, singapore) for providing information from their manuscripts regarding hbv. a c c e p t e d m a n u s c r i p t a c c e p t e d m a n u s c r i p t key: cord-350393-j80k2v21 authors: chen, liping; huang, shaoping; yang, jingmao; cheng, xin; shang, zhiyin; lu, hongzhou; cheng, jilin title: clinical characteristics in patients with sars‐cov‐2/hbv co‐infection date: 2020-07-15 journal: j viral hepat doi: 10.1111/jvh.13362 sha: doc_id: 350393 cord_uid: j80k2v21 covid‐19 has become a global pandemic and garnered international attention. although the clinical features of covid‐19 related liver injury have been investigated, there have been no reports and studies on the clinical characteristics of covid‐19 patients co‐infected with hepatitis b virus (hbv). this study aimed to evaluate whether sars‐cov‐2/hbv co‐infection could influence liver function and the disease outcome. all 326 confirmed covid‐19 cases in shanghai public health clinical center (the covid‐19 designated hospital in shanghai, china) from january 20, 2020 to february 24, 2020 were enrolled and followed up until february 29 in this study. the clinical, laboratory data and the length of stay were collected and analyzed retrospectively. 20 patients with hbv co‐infection (6.1%) and 306 patients (93.9%) without hbv infection showed no differences in the level of liver function parameters. however, compared with hbsag‐ patients [145.4 mg/l (103.9‐179.2)], hbsag+ patients had a lower level of prealbumin [(102.3 mg/l (76.22‐160.2), p=.0367]. there were also no significant differences for the discharge rate and the length of stay between two groups. taken together, we found no evidence that sars‐cov‐2/hbv co‐infection could aggravate liver injury or extend duration of hospitalization. since the first covid-19 case was reported in wuhan, hubei province, china in december 2019, coronavirus pneumonia caused by sars-cov-2 infection has become prevalent globally 1 . so far, there have been almost 2 million patients infected by sars-cov-2 2 , becoming a huge threat to global health. in addition to fever, dry cough, weakness, and breathing difficulty, abnormal liver function may occur in considerable proportion of sars-cov-2 infected patients (14.8%-76.3%) [3] [4] [5] [6] [7] . although the exact mechanism of covid-19 related liver damage is still unknown, the abnormal liver function was associated with severe disease and mortality risk in covid-19 patients [5] [6] [7] . hepatitis b virus (hbv) has a worldwide distribution and remains a leading public health problem, with a high prevalence of hbsag at about 6.0% in china 8 . huang reported sars patients with hbv infection were more prone to develop higher degree of liver injury and severe hepatitis, however, the data of the prevalence of sars-cov-2/hbv co-infection in covid-19 patients is still absent 9 . in our previous study 7 (138 cases), there were only 9 (6.1%) cases (too small) with underlying liver diseases, so no further analysis was made accepted article over the clinical features of covid-19 patients with hbv infection. in view of the current pandemic of sars-cov-2, the clinical characteristics of sars-cov-2 coinfection with hbv should be identified. in this retrospective study, we expanded the sample size and aimed to evaluate the influence of sars-cov-2/hbv co-infection on the clinical characteristics including liver function and disease outcome. this is a retrospective, single-center study. a total of 326 patients with sars-cov-2-positive results, admitted to shanghai public health clinical center (shphc) from january 20, 2020 to february 24, 2020 were included and followed up until february 29. the clinical criteria of diagnosis and di scharge refer to the standards for "diagnosis and treatment scheme of new coronavirus infected pneumonia" (trial version 6). this study was approved by the ethics committee of the shanghai public health clinical center (2019-s047-02, review date: jan 13, 2020) and was exempted from the need for informed consent from patients. the basic information and clinical characteristics of patients, including demographic, clinical, laboratory data and the length of stay were collected by electronic medical records. the continuous data were presented as the mean ± standard deviation (sd), median and interquartile range (iqr), as appropriate. the independent sample t test or mann-whitney u test were used to compare the differences between two groups; the categorical variables were expressed by frequency and percentage, and compared by the chi-square test or fisher exact test. p < 0.05 was determined as with statistically significant differences. statistical analysis software graphpad prism 6 was used for all analyses in this study. of the 326 patients, 20 cases (6.1%) were hbv infected (hbsag-positive, hbeag-negative with undetectable hbv viral load (vl<100 iu/ml; icycler device, bio-rad, usa; lower limit of quantification: 100 iu/ml). as shown in table 1 , 20 patients with hbv co-infection (6.1%) and 306 patients (93.9%) without hbv infection didn't show any differences regarding age and gender distribution (p>.05). there were also no differences in the level of liver function in hbsag-patients, 245 cases (80%) were discharged with the median hospital stays of 14 days (11) (12) (13) (14) (15) (16) (17) (18) (19) . neither the discharge rate nor length of stay show any difference between the two groups. infection, there is still a presumption that several cell types in other humoral organs can be attacked by sars-cov-2. as for liver, the abundant protein levels of ace-2, a functional receptor of sars-cov-2, in bile ducts have been observed 10 . in addition, a recent study based on the analysis of online single cell rna sequencing date from healthy liver tissues also confirmed that the level of ace-2 mrna in bile duct cells is comparable to atii cells, but not in hepatocytes. these results suggest that abnormal liver function may be caused by sars-cov-2 preferentially binding to cholangiocytes. however, according to recent reports, the bile duct injury related specific index, such as alp, was not frequently elevated in covid-19 patients 1 . in general, whether sars-cov-2 can directly infect liver cells and leads to the abnormal liver function is a controversial issue due to the absence of histological evidence of covid-19 patients. this article is protected by copyright. all rights reserved according to our recent study 7 , we found elevated alt, ast were more common in covid-19 patients with abnormal liver function and liver damage can also occur in mild covid-19 patients without any related medications before hospitalization. there's reason to believe sars-cov-2 may attack the liver. taken into consideration that viral co-infection can exacerbate liver injury thus have a big impact on disease progression and outcome 11, 12 , we investigated the prevalence of hbv infection in covid-19 patients and found that there was a comparable rate of sars-cov-2/hbv co-infection to that of general population (6.1% vs 6%). these observations suggested that sars-cov-2/hbv co-infection is common in covid-19 patients, although we couldn't assess whether existence of hbv infection increases susceptibility to sars-cov-2 infection. as for liver function parameters, there were no significant differences in related indices, except for the prealbumin, which is frequently measured as indicators of liver reserve and more sensitive than other indicators. the level of prealbumin was lower in patients with co-infection than that in the control group, which indicates that the liver reserve capacity was weak in covid-19 patients with hbv co-infection. so in our study, no evidence showed coexistence of hbv infection increases the liver injury in covid-19 patients. the outcomes of covid-19 patients with/without hbv infection were also compared in our current study，and sars-cov-2/hbv co-infection had no effect on the course and prognosis of covid-19, including the rates of severe/critically ill, mortality and discharged and hospital stays. however, previous study 12 this article is protected by copyright. all rights reserved although this study is a single-center, retrospective study, it is convincing as this center is the only designated hospital for covid-19 treatment in shanghai, china and a cohort of more than 300 cases were analyzed. moreover, the positive rate of hbsag in covid-19 patients were also close to the that in the general population. taken together, our study is the first to elaborate on the clinical characteristics of sars-cov-2/hbv co-infection patients and demonstrate that the coinfection with hbv slightly affect liver function, showing no impact on the covid-19 outcome. clinical characteristics of 138 hospitalized patients with 2019 novel coronavirus-infected pneumonia in wuhan, china coronavirus disease 2019 liver injury during highly pathogenic human coronavirus infections. liver international : official journal of the international association for the study of the covid-19 in a designated infectious diseases hospital outside hubei province longitudinal association between markers of liver injury and mortality in covid-19 in china covid-19: abnormal liver function tests clinical features of covid-19-related liver functional abnormality. clinical gastroenterology and hepatology : the official clinical practice journal of the american gastroenterological association 2020 hepatitis b virus serological screen in a general hospital in beijing from 2008 to 2018, and challenges to our vaccination policy liver injury in covid-19: management and challenges tissue distribution of ace2 protein, the functional receptor for sars coronavirus. a first step in understanding sars pathogenesis hepatitis b virus coinfection in human immunodeficiency virus-infected patients: a review study of the relationship sars and hepatitis virus b accepted article key: cord-000736-6f8vyziv authors: pripuzova, natalia; wang, richard; tsai, shien; li, bingjie; hung, guo-chiuan; ptak, roger g.; lo, shyh-ching title: development of real-time pcr array for simultaneous detection of eight human blood-borne viral pathogens date: 2012-08-17 journal: plos one doi: 10.1371/journal.pone.0043246 sha: doc_id: 736 cord_uid: 6f8vyziv background: real-time pcr array for rapid detection of multiple viral pathogens should be highly useful in cases where the sample volume and the time of testing are limited, i.e. in the eligibility testing of tissue and organ donors. findings: we developed a real-time pcr array capable of simultaneously detecting eight human viral pathogens: human immunodeficiency virus types 1 and 2 (hiv-1 and -2), hepatitis b virus (hbv), hepatitis c virus (hcv), human t-cell leukemia virus-1 and -2 (htlv-1 and -2), vaccinia virus (vacv) and west nile virus (wnv). one hundred twenty (120) primers were designed using a combination of bioinformatics approaches, and, after experimental testing, 24 primer sets targeting eight viral pathogens were selected to set up the array with sybr green chemistry. the specificity and sensitivity of the virus-specific primer sets selected for the array were evaluated using analytical panels with known amounts of viruses spiked into human plasma. the array detected: 10 genome equivalents (geq)/ml of hiv-2 and hcv, 50 geq of hiv-1 (subtype b), hbv (genotype a) and wnv. it detected 100–1,000 geq/ml of plasma of hiv-1 subtypes (a – g), group n and crf (ae and ag) isolates. further evaluation with a panel consisting of 28 hiv-1 and hiv-2 clinical isolates revealed no cross-reactivity of hiv-1 or hiv-2 specific primers with another type of hiv. all 28 viral isolates were identified with specific primer sets targeting the most conserved genome areas. the pcr array correctly identified viral infections in a panel of 17 previously quantified clinical plasma samples positive for hiv-1, hcv or hbv at as low as several geq per pcr reaction. conclusions: the viral array described here demonstrated adequate performance in the testing of donors’ clinical samples. further improvement in its sensitivity for the broad spectrum of hiv-1 subtypes is under development. rapid progress and improvement in molecular technologies have allowed researchers to switch from the traditional approaches of virus detection in clinical samples to multiplexing for simultaneous detection of multiple pathogens in a single assay. a number of different pcr based assays for detection and discovery of multiple pathogens have been developed [1] [2] [3] [4] . detection microarrays are proven to be useful in the identification and discovery of viruses homologous to known species. they have been used to guide the selection of samples for further analysis by sequencing [1] [2] [3] 5] . however, microarrays based on nucleic acid hybridization are too complex in design and performance for the routine donors testing, and exhibit a comparatively low sensitivity of detection, usually around 10021,000 genome copies of target virus per analyzed sample [1] [2] . several pcr based assays coupled with oligonucleotide microarray technology (so called resequencing arrays) have been designed to allow simultaneous detection or genotyping of a target group of viruses, such as some critical blood-borne pathogens (3 viruses) [6] , respiratory viruses (16-21 viruses) [7] [8] , and respiratory adenoviruses (6 different serotypes) [9] . such pcr based approach allows increasing the sensitivity of detection down to 10-100 copies of the target rna or dna in a sample. pcr multiplexing should be highly useful when both the volume of the samples and the time of testing are critical, as in the donor eligibility (de) testing for tissue or organ transplantation [10] . current regulation requires that de testing be performed using assays approved and licensed by the u.s. food and drug administration (fda). however, the automated assay systems that are designed to screen large numbers of samples, without the strict limitation of sample volumes, may not be completely suitable or ideal for the needs of de testing for tissue or organ transplantation. the main goal of the study presented here was to evaluate the feasibility of developing a sensitive and specific assay for rapid detection and identification of a group of target viral pathogens. the following viral pathogens were included in our array: human immunodeficiency virus types 1 and 2 (hiv-1 and hiv-2), human t-cell leukemia virus-1 and -2 (htlv-1 and htlv-2), hepatitis c virus (hcv) and west nile virus (wnv), all with singlestranded rna genome; vaccinia virus (vacv) and hepatitis b virus (hbv), both with double-stranded dna genome, hbv also has single-stranded rna stage. some of the listed viruses are included to the required de testing for tissue transplantation. besides, historically, some of the targeted viruses have been found to be allograft-transmitted to recipients [11] [12] . in the present study, a real-time pcr array with sybr-green chemistry targeting these eight viral pathogens listed above was developed and evaluated with analytical and clinical panels. the array demonstrated acceptable performance in the testing with both analytical panels and donors' clinical samples. the research study conducted at fda using previously frozen blood samples was reviewed by department of health and human services, food and drug administration, research involving human subjects committee (rishc protocol #10-008b entitled ''detection of infectious agents in previously frozen blood samples from patients with various illnesses and healthy blood donors''). the 17 clinical plasma samples positive for hbv, hcv or hiv-1 used in this study were existing clinical diagnostic samples kept in nih blood bank. information of these left over samples had been recorded in such a manner that subjects can not be identified, directly or through identifiers. the written informed consent from the participants was waived under 45 cfr 46.101 (b) (4) . the six plasma samples positive for hiv-1 were estimated to contain 50 to ,90,000 genome copy numbers per ml; six plasma samples positive for hcv were estimated to contain 780 to ,123,000 genome copy number/ml and five plasma samples positive for hbv were estimated to contain ,150 to 16,000 copy number/ml. the copy numbers of viruses in these samples were provided by the nih blood bank. no information about the subtypes or genotypes of these viruses was available. the amount of each clinical sample was sufficient to be tested only once by the pcr array in the study. all positive pcr products obtained in the testing using the pcr array were confirmed for validity by sequencing in the facility for biotechnology resources of fda/ cber. we used the ''insignia'' program (http://insignia.cbcb.umd. edu/query.php), a bioinformatics on line tool developed in the center for bioinformatics and computational biology, university of maryland [13] to choose a specific dna or rna ''signature'' (a sequence, with customized length and g/c content) for targeted viruses. comparative sequence analysis of the complete genomes was performed using mvista (http://genome.lbl.gov/vista/ mvista/submit.shtml). multiple nucleotide sequence alignments (nsas) were then created to visualize the most conserved genome areas using mega4 (http://www.megasoftware.net). specific criteria for the primers and amplicon selection for the sybr green based pcr array were: 1) the same range of annealing temperature (t) -57-60uc -for all primers, 2) high g/c content for primers, allowing higher specificity of annealing, and 3) an amplicon size in the range of 100-200 b.p. in order to have a high pcr amplification efficiency and to sufficiently distinguish the products from primer dimers based on melting t peak (tm). all primers were checked for potential dimer formation using ''primer express'' software (version 3.0, applied biosystems). after design, all primers were again checked using the national center for biotechnology information (ncbi) basic local alignment search tool (blast) (http://blast.ncbi.nlm.nih.gov/blast.cgi) to avoid any cross-reactivity with other species. newly designed and previously published primer sets adapted for the final version of the real-time pcr array are listed in table 1 . in addition, primers specific for the human beta-globin gene were included in the array as an internal control for the quality of dna/rna preparation as well as for estimation of viral copy number per host cell if needed (the last row of table 1 ). total cellular dna of the chronically infected cell cultures (for hiv-1, hiv-2; htlv-1, htlv-2 and vacv), viral genome cdna copy spiked into human dna (for hcv and wnv), and dna isolated from human plasma of the infected individual (for hbv) were used as the positive templates in the initial testing and are listed in the last column of table s1 . dna or rna panels were created by cloning of specific synthetic templates for each virus into the pgem-t-easy vector (promega) by ta cloning, following by in vitro transcription to obtain rna standards for hcv and wnv. all created plasmids are listed in table s1 . nucleotide numbers in table s1 refer to the location of the partial viral genome cloned into pgem-t-easy vector according to the following complete genome sequences available in genbank: htlv-1 -l03562.2, htlv-2 -m10060.1, hiv-1 -k02083.1, hiv-2 -j03654.1, hbv -af462041.1, hcv -af271632.1, vacv -ay243312.1, wnv -hq596519.1. to establish the real-time pcr standard curve the copy number was calculated for each plasmid carrying one copy of the specific viral gene. the size of each plasmid (x b.p.) was used to determine the molecular weight in daltons (g/mol): w (g/mol) = x b.p. (330 da 6 2). the copy number of the target viral gene (molecules/ml) was determined from the plasmid concentration (c dna ) and the molecular weight of each plasmid molecule: copy number = c dna (ng/ml) 6 6.02 6 10 23 (avogadro's number)/w. knowing the number of plasmid molecules with the target viral gene in a ml, a series of dilutions was made to generate a pcr standard curve. the developed analytical standards were used to calculate the intra and inter-assay reproducibility of quantification for each virus-specific primer set. mean c(t) values, standard deviation (sd) and coefficient of variation (cv) were calculated from the data obtained in three replicates of each standard dilution for the intraassay reproducibility, and in three real-time pcr assays consisted of three replicates each (nine total) for the inter-assay reproducibility. cv was calculated as sd/mean c (t) * 100%. preparation of viral rna/dna for pcr array analysis 0.5-1 ml of human plasma was used for the total viral rna/ dna extraction using ''qiaamp viral rna mini-kit'' (qiagen) and trna (sigma) was used as a carrier rna during the preparation. after the final elution step rna/dna in 160 ml of buffer ave was precipitated with 100% ethanol and 3 mm nacl at 220uc overnight. an rna/dna pellet was washed with 70% ethanol, dissolved in 10 ml of depc-treated water and then immediately used for cdna synthesis with superscript ii rt (invitrogen) and random hexamers (invitrogen) in a total reaction volume of 20 ml. the volume of cdna/dna sample was then adjusted up to 30 ml with depc-treated water and the whole pcr was performed using ''bio-rad cfx96 real-time system'' with ''power sybr green pcr master mix'' (applied biosystems). one reaction (25 ml total) contained: 12.5 ml of pcr master mix, 0.5 mm of each primer and 1.25 ml of dna/cdna template. in the single virus testing (sections 3 and 4 of the ''results'') we used 2.5 ml of dna/cdna template from 20 ml of sample after cdna synthesis. ''universal'' pcr conditions for all primer sets included to the array were: 95uc for 8 min (one cycle), then 50 cycles of: denaturation at 95uc for 15 s, annealing and extension at 60uc for 1 min, followed by melting curve read from 65uc to 95uc with increment 0.2uc for 5 s. real-time pcr data were downloaded in 96-well plate format from ''bio-rad cfx manager 2.1'' to ms excel and analyzed manually. two types of samples served as the background control for determination of the c(t) cut off. the 1 st type of negative control was 50 ng of human cellular dna. the 2 nd type of negative control was negative donors' plasma. data were collected in separate experiments from 8 human cellular dna controls and 3 negative donors' plasma. to standardized the c(t) cut off for all primers the threshold was set at the pcr machine default setting. based on a false positive rate of less than 5% the following method [14] was used to estimate the c(t) cut off from the range of c(t) obtained with negative samples for all 24 primer sets in the array: 1. calculate the margin of error of the confidence interval (ci), w = t* 6 sd/!n, where: n -number of obtained c(t) values, sd-standard deviation, df = n21, and t* (for 95% confidence) is a ''critical value of the t distribution'' [14] . 2. one side ci covers this range: m-w, where m is sample mean. the c(t) cut off calculated from the range (n = 50) of the 1 st type of negative control data was c(t)#41.03. the c(t) cut off calculated from the range (n = 50) of the 2 nd type of negative control data was c(t)#42.7. even some overlap between the c(t) measurements of truly positive and truly negative samples was detected in pcr array data, the tm parameter was used to define if the obtained pcr product is specific by comparison to the expected tm peak range. the analytical sensitivity of each primer set was determined in the single virus testing using fda/cber panels (kindly provided by dr. stephen kerby, fda/cber) consisting of various amounts of the viruses (0-1,000 genome copies/ml) spiked into the ''normal'' human plasma. panels for the following viruses were used in testing: hiv-1 (three different panels), hiv-2, hbv (based on genotype a), hcv (genotype 1b), and wnv (based on strain hu2002). these panels have been used for testing of commercially licensed nat assays and their development was described previously [15] . three separate hiv-1 rna panels were used for testing. the first consisted of various amounts of an hiv-1 group m subtype b isolate: 0, 5, 10, 25, 50, 100, and 500 copies/ml. the second consisted of 25 samples representing various concentrations of hiv-1 groups o and n, and group m subtypes a, c, d, e, f and g: 10, 100 and 1,000 copies/ml for each virus. the third panel consisted of hiv-1 circulating recombinant forms (crfs) ae and ag: 100, 1,000, and 10,000 copies/ml for each crf. np24 caacttcatccacgtttcacc a -to simplify the process of evaluation we used our primer names with sequential numbers, however some of the primers have been designed previously with their original names in the articles listed in the last column of this [25] [26] . hiv-1 groups and subtypes are based on designations reported by the nih arrrp. low passage virus stocks were prepared and median tissue culture infective dose (tcid 50 )/ml of virus containing supernatant determined in fresh human pbmcs isolated as previously described [27] . infectious unit (iu) of the virus stocks in tcid 50 s were titrated for each isolate and the number of iu used for viral rna isolation and pcr was calculated based on the dilution factor (1:100) and ranged from ,10 to 2,500 or 1 to 3.4 log 10 tcid 50 per pcr reaction. pcr approach based on sybr green chemistry, allowing simultaneous detection of multiple targets, was chosen to be applied for the array performance. virus-specific primer sets targeting at least three different genomic sites for each viral pathogen were designed for the real-time pcr array. we used the ''insignia'' program, a bioinformatics tool that helps to choose a specific dna or rna ''signature'' for different bacteria and viral pathogens that are included in the pre-built ''insignia'' database [13] . sequences of the highly conserved regions, such as coding viral polymerase or structural proteins were selected to design the candidate primers. in addition, we performed nucleotide sequence alignments (nsa) of the complete viral genomes and of the most conserved genome areas for different subtypes/genotypes or different isolates of all targeted viruses. some previously published primers designed for pcr detection of the target viruses were also adapted and evaluated. overall, a total of 120 primers were initially designed using specific criteria for the current real-time pcr array (see materials and methods) to cover the eight targeted viruses: hiv-1, hiv-2, hbv, hcv, htlv-1, htlv -2, wnv, and vacv. the primers were designed and tested for their effectiveness and specificity of amplifying the respective target under uniform pcr conditions (using the same annealing temperature for all primers). each candidate primer pair was first tested for its specificity and sensitivity of pcr amplification. this was assessed in a real-time pcr cross-testing against human pbmc dna (50 ng/pcr reaction) from a healthy donor, dna from human cell cultures infected by various target viruses, or human dna spiked with a known amount of genome copies of various viruses. it was important to ensure that the selected primers targeting a specific virus would not non-specifically amplify any dna in a sample. the melting temperature (tm) peak of the product amplified from the target virus should be clearly differentiable from the tm peak of primer dimers or any non-specific products produced in pcr. dna or rna panels were created from the cloned synthetic templates (listed in table s1 ) by spiking of 2-10 4 genome copies of each virus into 50 ng of human background dna. the sensitivity of each candidate primer set for each target virus was assessed using these panels. example of the experimental testing of hiv-1 specific primer set targeting gag gene (np3/4) for its sensitivity with dna analytical standards is shown in figure s1 . serial dilutions of a plasmid dna corresponding to 5-10 4 hiv-1 genome copies spiked into 50 ng of normal human dna, hiv-1 infected cells (h9/iiib) (''positive'' control dna) and uninfected human pbmc (''negative'' control dna) are used in the experiment. only a single melting peak tm = 72.5uc corresponding to hiv-1 specific product was observed and no unspecific amplification was registered. figure s1b revealed a standard curve showing the correlation between copy number of the target gene and ct values with a slope = 23.77. the limit of sensitivity was determined in this assay to be 10 viral genome copies/pcr. after evaluation, a total of 24 primer pairs targeting the eight different viruses were chosen for the real-time pcr array based on their specificity and sensitivity (table 1) . among them, five of the primer sets were previously published and the other 19 primer sets were originally designed in the current study. table 1 shows the sequences of the previously published primer sets selected for the real-time pcr array with the reference to the original source. analytical sensitivity expressed in genome copy/pcr for each primer set (table 1 ) was estimated using dna/rna analytical panels, as described above. coverage of variants (i.e., different subtypes or genotypes) for each virus (table 1 ) was estimated using the nsas. degenerative nucleotides were introduced into some of the primer sets based on the nsas performed in-house to obtain a broader coverage. the tm peak range of the product stated in table 1 for each primer set was established during further testing of selected primers with analytical and clinical panels. in addition, the intra and inter-assay reproducibility of quantification for all primer sets was evaluated using three replicates of each standard dilution (of dna or rna analytical standards) in each of three real-time pcr assay runs. the coefficient of variation (cv) for the c (t) values was #3.3% and #6.7% for intra-and inter-assay, respectively. all the data depicting mean c (t), standard deviation (sd), and cv for each primer set selected for the real-time pcr array with each standard concentration are shown in table s2 . to further evaluate the sensitivity of the selected primers, we used fda/cber panels (kindly provided by dr. stephen kerby, fda), consisting of various amounts of viruses spiked into ''normal'' human plasma, that are specifically developed and used for the evaluation of commercially licensed nat assays. table 2 summarizes the testing results for the selected primers against the target viruses. one out of four primer sets targeting hiv-1, np3/4, could detect the subtype b hiv-1 rna at the concentration of 50 copies/ml of human plasma. two other hiv-1 specific primer sets (np51/52 and np170/171) detected the hiv-1 rna at 100 copies/ml of plasma. the 4th primer set, np175/174, (targeting the conserved pol region and containing degenerative nucleotides to support broader variant coverage) could detect the virus only at 500 viral genome copies/ml of plasma. hiv-2 rna was detected with primer set np86/87 at the concentration of 10 copies/ml and with the primer set np76/77 at the concentration of 50 copies/ml. another primer set (np84/ 85) detected hiv-2 at 100 copies/ml. hbv (genotype a) dna was detected with the primer set np11/97 at 50 copies/ml and with np94/100 at 100 copies/ml. the third hbv specific primer set (np11/97-mod) detected hbv at 500 copies/ml of plasma. both hcv specific primer sets targeting the viral 59ntr detected hcv rna at the concentration of 10 copies/ml of plasma. two of the wnv-specific primer sets (np21/22, targeting e protein gene, and np176/177, targeting ns5) detected wnv at 50 copies/ml and the third primer set (np178/179, also targeting ns5) gave a positive signal at 100 copies/ml of plasma. the four hiv-1 specific primer sets were further evaluated by testing them against another fda/cber analytical panel containing a broad spectrum of hiv-1 subtypes. as summarized in table 3 , the hiv-1 subtype f (group m) and group o isolates in table 2 . the results of sensitivity testing of the real-time pcr array primer sets specific for hiv-1, hiv-2, hbv, hcv, and wnv the with fda/cber analytical plasma panels. table 3 . sensitivity of four hiv-1 specific primer sets selected for the real-time pcr array in testing with fda/cber analytical hiv-1 broad spectrum panel. detection limit (copy number/ml of plasma) was evaluated using fda/cber analytical panel, containing pre-set copy number of hiv-1 spiked into 1 ml of ''normal'' human plasma. rna from 1 ml of plasma was converted to cdna and divided into eight pcr reactions; two pcr repeats were performed for each primer set. the estimated copy number per pcr reaction is shown in parentheses. the panel could not be successfully amplified by any of the four selected primer sets (detection limit is .1,000 rna copy/ml of plasma). all other subtypes and crfs of group m, and the group n isolate could be amplified with at least one out of the four primer sets at 50 to 1,000 rna copies/ml of plasma (table 3) . the tm peaks of the pcr products amplified from different subtypes of hiv-1 varied within 1.5uc ( table 3 ). all of the four selected hiv-1 specific primer sets amplified hiv-1 subtype b (group m) with the highest sensitivity (50-500 copies/ml of plasma). to examine the specificity and the ability of the array to detect different isolates within subtypes of hiv-1 and different isolates of hiv-2 by the array, we additionally tested our primers with another panel, developed by the southern research institute. this panel contained three different isolates from each subtype (a to g) of hiv-1 group m, three isolates from hiv-1 group o, one isolate from hiv-1 group n and three different isolates of hiv-2. the infectious dose of each hiv isolate in the panel was determined by tcid 50 (median tissue culture infective dose) titration and the dose of virus used in each pcr reaction was calculated. the results of testing of hiv-1 specific primers are shown in figure 1 . in this experiment we evaluated the coverage of hiv-1 variants and estimated the relative sensitivity of the four hiv-1 specific primer sets based on cycle threshold (c(t)) values obtained with each isolate tested. two primer sets targeting the conserved pol regions (np170/171 and np175/174) were able to detect most of the hiv-1 subtypes with a high sensitivity (c(t) = 15-25). only one primer set (np175/174) detected both the group n isolate and all three isolates of group o with ct = 20-35. we did not detect crossreactivity of hiv-1 or hiv-2 specific primers with the other type of hiv. all three hiv-2 isolates studied (1-3 log 10 tcid 50 /pcr input) were detected with all hiv-2 specific primer sets with a low ct value: 12-20 (data not shown). after completion of sensitivity testing of primer sets with analytical panels we finalized the expected tm peaks range for each amplicon and arranged a working array in 96-well plate format ( figure s2 ). to evaluate the specificity and possible crossreactivity of primers in the array, 20-100 genome copies of each virus were spiked into 50 ng of human dna to be used as positive templates and the same amount of human dna was used as a negative control in each experiment. the array was tested with all targeted viruses using dna standards (listed in table s1 ). each positive template was tested in duplicate; one human dna negative control and one no-template control (ntc) were included in every testing. in these experiments the definition of ''positive'' signal was set up as the threshold cycle cut-off of c(t)#41 (see materials and methods) and all tm peaks are within the expected range ( figure s2) . no cross-reactivity was detected for any primer sets in the array using dna standards with this setting (data not shown). seventeen (17) clinical plasma samples (obtained from nih blood bank) from donors who tested positive for hiv-1, hbv, or hcv were used to evaluate the array sensitivity and specificity. the genome copy of each virus in virus-positive plasma samples was previously determined by the nih blood bank using commercial assays approved for donor screening. representative results from the testing of three hbv-positive plasma samples (pt.#13-pt.#15) using our array are shown on figure 2 . the threshold cycle cut off of the assay performed with plasma samples was set up as c(t)#43 (see materials and methods). the wells with c(t) lower than the cut-off and the obtained tm peaks within the expected tm range indicate positive amplification of hbv target genes and are highlighted with blue circles (figure 2 , green color code for hbv). for samples #13 and #14 tm peaks of the products, obtained with only two hbv specific primer sets (wells g2, g3-pt.#13 and wells g5, g6-pt.#14), were within the expected range, with c(t) values of 36.7-42.9 and 36.5-36.6 respectively. for sample #15, all three hbv specific primer sets gave the tm peaks within the expected range (wells g7, g8 and g9), and the c(t) values range was 33.8-34.2. the genome copy number of hbv in plasma samples #13-15 was 151-518 copies/ ml, corresponding to 6-21 copies/pcr. the wells (white color code, red circles) with the human beta-globin gene specific primer set, serving as the internal control, produced positive signals from all three plasma samples tested, with c(t) values of 25.5-26.3 (wells h3, h6 and h9 figure 2 ), which shows that the quality of the rna/dna sample preparation was equally good for the plasma of these three patients. the final tm range for each primer set was adjusted after testing of this clinical panel. based on the results from the testing of clinical samples and according to nsa performed during the design, two primer sets targeting the s gene region of hbv (np11/97 and np11/97-mod) have two different tm ranges depending on the hbv genotype ( figure 2 -wells g1 and g3). the lower tm range (74.5-75.5uc) was detected for genotype a and the higher tm range (76.8-77.4uc) -for genotypes b, c, and d. the difference in tm ranges occurred due to single nucleotide polymorphism (snp) in the amplicon sequence leading to a difference in the g/c nucleotide content of the products. table 4 summarizes the results from testing the 17 virus-positive clinical samples using the developed array. at least two different specific primer sets could detect a target virus in all cases, with one exception: one hiv-1 positive sample (#4) with ,4 viral genome copies per pcr reaction was amplified with only one primer set (np175/174). hiv-1 positive clinical samples (#1-#3) with 51-80 viral genome copies/ml of plasma or 2-3 copies/pcr reaction were detected with at least two primer sets. all six hcv-positive samples (#7 to #12) with 16-2,570 viral genome copies/ml of plasma tested positive with both hcv-specific primer sets. three hbv-positive samples (#15, #16, #17) at 21-66 copies/pcr tested positive by the three hbv-specific primer sets and two hbv-positive samples (#13, #14) with 6-10 copies/pcr tested positive with two out of three hbv-specific primer sets. it is important to note that none of the primer sets showed any crossreactivity with other viruses in the panel of clinical samples tested. in the study presented here we applied a real-time pcr array approach in a 96-well plate platform for detection of a group of target viral pathogens. in contrast to taqman pcr, which is commonly used for viral diagnostics, this platform based on pcr with sybr green chemistry supports simultaneous detection and identification of 24 different targets corresponding to eight different viruses. pcr based on sybr green staining of the double stranded dna is economically affordable and allows for the detection of mutants with snps within the amplicon sequence [34] . the strategy of primer selection for the array included the sequential use of different bioinformatics programs to identify highly-specific primer sets with a maximal variants' coverage of the targeted viruses, while working under ''universal'' pcr conditions. experimental selection process using a panel of dna or rna analytical standards allowed choosing two to four most sensitive and specific primer sets for each targeted virus. the sensitivity (in copy number per pcr reaction) and the intra and inter-assay reproducibility of quantification were characterized for each primer set selected for the array. fda/cber analytical plasma panels were used to assess the detection sensitivity of the primer sets selected for the working array. the hiv-2 and hcv rna was detected at as low as 10 genome copies/ml of human plasma by one out of three and two out two primer sets, respectively. similarly, wnv rna and hbv dna were detected at 50 genome copies/ml of plasma by two out of three and one out of three selected primer sets respectively. all four of the selected hiv-1 specific primer sets detected group m, subtype b, the most common subtype of hiv-1 in the americas and western europe [35] , at 50-00 genome copies/ml of plasma. however, the array was able to amplify all other subtypes, excluding subtype f, of hiv-1 group m with only one primer set (np170/171), targeting the conserved pol region, at 100-1,000 genome copies/ml of plasma. in addition, the array amplified the group n isolate at 1,000 copies/ml with another primer set (np175/174) targeting the conserved pol region. all the selected hiv-1 specific primer sets of the array failed to amplify the group o isolate (detection limit is .1,000 copies/ml of plasma). in comparison, the limit of detection (lod) of recently improved commercial multiplex nat assays for the broad spectrum of hiv-1 group m isolates is 40 copies/ml, and the lod for group o is 200 copies/ml [36] [37] [38] . thus, specific primer sets targeting group o isolates of hiv-1, as well as subtype f (group m) will need to be included in the array to increase the coverage of all existing subtypes/groups of the hiv-1. no crossreactivity was shown for hiv-1 or hiv-2 specific primers with the other type of hiv in a testing with medically relevant levels of viruses in a diversity panel containing 25 different hiv-1 isolates and three natural hiv-2 isolates collected worldwide. there is presently no us food and drug administration (fda) approved pcr-based nat testing for blood donors' screening for htlv-1 and htlv-2. there is no official fda (or world health organization (who)) viral panel released for these two viruses. it is also difficult to obtain htlv-1 or htlv-2 positive blood donors' samples in the united states. in the absence of the analytical panels and clinical samples we tested htlv-1, htlv-2 and vacv specific primers only with cell culture derived dna and with dna standards. the minimum detection limit of htlv-1 and htlv-2 specific primer sets estimated with analytical dna standards was 5-10 genome copies/pcr reaction, which is in the same range as for other primers included to the array. the coverage of the viral variants for the primers targeting these viruses was estimated in silico using multiple sequence alignments performed with complete genome sequences available in gen bank. the working array arranged in 96-well plate format was subsequently tested for specificity and potential cross-reactivity with human dna and with each of the targeted viruses. none of the primer sets selected for a particular target virus in the array produced non-specific cross-reaction toward the other viruses. comparative performance of the array was also evaluated through the testing of 17 clinical specimens from the united states patient population. all 17 samples were correctly identified in our pcr array with a high sensitivity to contain hiv-1, hcv, or hbv. we found that a combination of several primer sets targeting each virus in the array allows for the detection of different variants of the virus; however, it makes the absolute quantification with uniform dna/rna standards a challenge. quantification by the assay is not always possible when the genetic group of the viral isolate being tested is different than the assay standards. this is one of the reasons why in certain cases the commercial assays underestimate viral loads by up to 1-10 log 10 copies per ml [37] [38] [39] . nevertheless, relative quantification can be done using all primer sets selected for the array, and the absolute quantification can be performed with dna/rna standards using the primers targeting the most conserved genome areas. there are several commercial qualitative multiplex nat assays now available on the market simultaneously targeting three most important blood-borne viral pathogens (hiv-1, hcv and hbv) [40] . one of them was recently approved by u.s. fda for screening of blood and organ donors (http://www.fda.gov/biologicsblood vaccines/bloodbloodproducts/approvedproducts/licensedproduc tsblas/blooddonorscreening/infectiousdisease/ucm306073.htm). we compared the lod of these multiplex nat assays [40] with the results of our working pcr array in sensitivity of testing against these important viruses. the lod for hbv are 38.1-195 geq/ml by ''procleix ultrio tigris'' and 9.2-37. other pcr-coupled techniques have been developed previously for highly-sensitive pathogens' detection that could reach the sensitivity of the assay up to 1 genome copy per pcr reaction. for example the bioactive amplification with probing (bap), utilizing a nested pcr and magnetic bead-based hybridization with the specific probe, has been developed for the detection of bovine and avian viruses [41] [42] [43] . in spite of the exceeding sensitivity of such assays targeting a single virus, it may be difficult to adapt the approach or method to meet the main objective of simultaneous detection of multiple target viral pathogens by an array using universal pcr conditions. it is important to note that this array was developed to be adapted by any laboratory. comparison of experimentally obtained tm peaks to the range of expected specific tm peaks allows rapid identification or exclusion of the viral pathogen in a sample. this is an initial study to examine the suitability of using pcr arrays for the detection of a group of target viruses. the current array was developed utilizing five previously published and table 4 . tm and c(t) values obtained with primer sets specific for hiv-1, hcv, or hbv in testing of 17 human clinical samples in the format of pcr array targeting eight different viruses. 19 originally designed primers sets. however, it can be expanded to a larger number of targets for the same virus. targeting of several genome areas increases the detection sensitivity of the target virus and provides an intra-assay confirmation of positive signals. additionally, any new virus of interest can be added to the list of targeted pathogens. efforts are underway to test the utility of this real-time pcr array using samples with more diverse biological origin and pathogen content. panmicrobial oligonucleotide array for diagnosis of infectious diseases testing and validation of high density resequencing microarray for broad range biothreat agents' detection crossspecies transmission of a novel adenovirus associated with a fulminant pneumonia outbreak in a new world monkey colony identification of pathogenic vibrio species by multilocus pcr-electrospray ionization mass spectrometry and its application to aquatic environments of the former soviet republic of georgia pan-viral screening of respiratory tract infections in adults with and without asthma reveals unexpected human coronavirus and human rhinovirus diversity an oligonucleotide microarray for multiplex real-time pcr identification of hiv-1, hbv, and hcv a low density oligonucleotide microarray for the detection of viral and atypical bacterial respiratory pathogens application of taqman low density arrays for simultaneous detection of multiple respiratory pathogens use of oligonucleotide microarrays for rapid detection and serotyping of acute respiratory disease-associated adenoviruses eligibility determination for donors of human cells, tissues, and cellular and tissue-based products; final rule and notice. 21 cfr part 1271 infections and human tissue transplants: review of fda medwatch reports reported infections after human tissue transplantation before and after new food and drug administration (fda) regulations, united states insignia: a dna signature search web server for diagnostic assay development intuitive biostatistics development and evaluation of hiv-1 subtype rna panels for the standardization of hiv-1 nat assays genetic variation of hiv type 1 in four world health organization-sponsored vaccine evaluation sites: generation of functional envelope (glycoprotein 160) clones representative of sequence subtypes a, b, c, and e. who network for hiv isolation and characterization human immunodeficiency virus type 1 t-cell tropism is determined by events prior to provirus formation dual infection of the central nervous system by aids viruses with distinct cellular tropisms biologic and genetic characterization of a panel of 60 human immunodeficiency virus type 1 isolates, representing clades a, b, c, d, crf01_ae, and crf02_ag, for the development and assessment of candidate vaccines subgroup g hiv type 1 isolates from nigeria variability of human immunodeficiency virus type 1 group o strains isolated from cameroonian patients living in france identification of a new human immunodeficiency virus type 1 distinct from group m and group o biological and molecular variability of human immunodeficiency virus type 2 isolates from the gambia genetically divergent strains of human immunodeficiency virus type 2 use multiple coreceptors for viral entry aids verursacht durch hiv-2 preliminary characterization of an hiv-2 isolate derived from a german virus carrier development of hexadecyloxypropyl tenofovir (cmx157) for treatment of infection caused by wild-type and nucleoside/nucleotide-resistant hiv dna amplification for direct detection of hiv-1 in dna of peripheral blood mononuclear cells quantitation of hepatitis b virus dna in plasma using a sensitive cost-effective ''in-house'' realtime pcr assay a genotypeindependent real-time pcr assay for quantification of hepatitis b virus dna rapid detection of west nile virus from human clinical specimens, field-collected mosquitoes, and avian samples by a taqman reverse transcriptase-pcr assay hpv dna detection and typing in cervical scrapes complete coding sequences of the rabbit pox virus genome sybr green-based real-time quantitative pcr assay for detection of west nile virus circumvents falsenegative results due to strain variability human immunodeficiency virus type 1 subtype distribution in the worldwide epidemic: pathogenetic and therapeutic implications evaluation of the roche cobas taqman and abbott realtime extraction-quantification systems for hiv-1 subtypes comparative rna quantification of hiv-1 group m and non-m with the roche cobas ampli prep/cobas taqman hiv-1 v2.0 and abbott real-time hiv-1 pcr assays a new real-time quantitative pcr for the diagnosis and monitoring of hiv-1 group o infection performance characteristics and comparison of abbott and artus real-time systems for hepatitis b virus dna quantification comparison of the analytical and operational performance of two viral nucleic acid test blood screening systems: procleix tigris and cobas s 201 development of a reliable assay protocol for identification of diseases (rapid)-bioactive amplification with probing (bap) for detection of bovine ephemeral fever virus development of a reliable assay protocol for identification of diseases (rapid)-bioactive amplification with probing for detection of avian reovirus development of a reliable assay protocol for identification of diseases (rapid)-bioactive amplification with probing (bap) for detection of newcastle disease virus key: cord-001515-x11t9pbv authors: kosinska, anna d.; liu, jia; lu, mengji; roggendorf, michael title: therapeutic vaccination and immunomodulation in the treatment of chronic hepatitis b: preclinical studies in the woodchuck date: 2014-12-23 journal: med microbiol immunol doi: 10.1007/s00430-014-0379-5 sha: doc_id: 1515 cord_uid: x11t9pbv infection with hepatitis b virus (hbv) may lead to subclinical, acute or chronic hepatitis. in the prevaccination era, hbv infections were endemic due to frequent mother to child transmission in large regions of the world. however, there are still estimated 240 million chronic hbv carriers today and ca. 620,000 patients die per year due to hbv-related liver diseases. recommended treatment of chronic hepatitis b with interferon-α and/or nucleos(t)ide analogues does not lead to satisfactory results. induction of hbv-specific t cells by therapeutic vaccination or immunomodulation may be an innovative strategy to overcome virus persistence. vaccination with commercially available hbv vaccines in patients with or without therapeutic reduction of viral load did not result in effective immune control of hbv infection, suggesting that combination of antiviral treatment with new formulations of therapeutic vaccines is needed. the woodchuck (marmota monax) and its hbv-like woodchuck hepatitis virus are a useful preclinical animal model for developing new therapeutic approaches in chronic hepadnaviral infections. several innovative approaches combining antiviral treatments using nucleos(t)ide analogues, with prime-boost vaccination using dna vaccines, new hepadnaviral antigens or recombinant adenoviral vectors were tested in the woodchuck model. in this review, we summarize these encouraging results obtained with these therapeutic vaccines. in addition, we present potential innovations in immunostimulatory strategies by blocking the interaction of the inhibitory programmed death receptor 1 with its ligand in this animal model. more than 240 million people worldwide are persistently infected with hepatitis b virus (hbv) and are at risk of developing chronic liver disease, cirrhosis and hepatocellular carcinoma (hcc) [1] . an effective and affordable therapy to achieve sustained suppression of hbv replication and remission of liver disease is urgently needed. pegylated interferon-alpha 2a (ifn-a) is recommended for the treatment of chronic hepatitis b (chb) in the current consensus guidelines of many countries. compared with conventional recombinant ifn-a, however, pegylated ifn-a alone or in combination with nucleoside analogues does not significantly increase the rate of sustained response [2, 3] . nucleos(t)ide analogues, such as, entecavir and tenofovir, suppress hbv replication and result in the improvement of liver architecture. however, these agents cannot eradicate hbv genomes from the liver and may further limited by the development increasingly select drug-resistant mutants with prolonged use [4, 5] . therapy with additional antiviral drugs targeting other steps in the viral life cycle, in combination with immunomodulatory options, might be more beneficial and effective. more than 90 % of acutely infected adults resolve clinical symptoms and maintain lifelong protective immunity by mounting a vigorous, multi-specific immune response abstract infection with hepatitis b virus (hbv) may lead to subclinical, acute or chronic hepatitis. in the prevaccination era, hbv infections were endemic due to frequent mother to child transmission in large regions of the world. however, there are still estimated 240 million chronic hbv carriers today and ca. 620,000 patients die per year due to hbv-related liver diseases. recommended treatment of chronic hepatitis b with interferon-α and/ or nucleos(t)ide analogues does not lead to satisfactory results. induction of hbv-specific t cells by therapeutic vaccination or immunomodulation may be an innovative strategy to overcome virus persistence. vaccination with commercially available hbv vaccines in patients with or without therapeutic reduction of viral load did not result in effective immune control of hbv infection, suggesting that combination of antiviral treatment with new formulations of therapeutic vaccines is needed. the woodchuck (marmota monax) and its hbv-like woodchuck hepatitis virus are a useful preclinical animal model for developing new therapeutic approaches in chronic hepadnaviral infections. several innovative approaches combining antiviral treatments using nucleos(t)ide analogues, with primeboost vaccination using dna vaccines, new hepadnaviral antigens or recombinant adenoviral vectors were tested in the woodchuck model. in this review, we summarize these encouraging results obtained with these therapeutic vaccines. in addition, we present potential innovations this article is part of the special issue "therapeutic vaccination in chronic hepatitis b-approaches, problems and new perspectives". to hbv proteins. by contrast, patients with chronic hepatitis b tend to have delayed, transient or narrowly focused t cell responses [6] [7] [8] . patients who spontaneously recover from hbv infection might experience reactivation of hbv under immunosuppressive treatments. thus, the specific immune responses to hbv remain crucial for the long-term control of hbv infection even after resolution of the acute infection. for chronically infected patients, immunostimulatory and immunomodulatory strategies to boost or to broaden the weak virus-specific t cell response have been proposed to reach an effective control of viral infection. since more than 20 years, numerous clinical trials exploited the conventional prophylactic vaccine based on the hepatitis b surface antigen (hbsag) for therapeutic vaccination (table 1) . these studies demonstrated reductions in viremia, seroconversion of the hepatitis b "e" antigen (hbeag) to anti-hbe and hbv-specific t cell responses in some patients after vaccination. however, the antiviral effect was only transient and did not lead to an effective control of the hbv [9] [10] [11] [12] [13] [14] [15] [16] [17] . a more sophisticated therapeutic vaccination based on hbsag complexed with human anti-hbs was proposed by the group of wen et al. [18] . immunogenic complexes (ic) stimulate robust t cell responses by increasing uptake of hbsag through fc receptors on antigen-presenting cells (apc) and, therefore, enhance hbsag processing and presentation. it was demonstrated that this vaccine administered to hbeag-positive patients led to decrease of hbv dna in serum and hbeag seroconversion in some subjects [19] . in a phase ii b clinical trial, hbeag seroconversion was observed in about 21.6 % of treated patients. moreover, a moderate decrease in serum hbv dna and hbsag levels was observed after treatment [20, 21] . very recently, a large phase iii clinical trial with 12 injections of ic complex failed to show any therapeutic efficacy when compared to the placebo control injected only with alum [22] . overstimulation with ic-based vaccine did not increase but decreased efficacy of the therapeutic vaccination. these results underline that an appropriate immunization protocol is crucial for the efficacy of therapeutic vaccination. dna vaccines using plasmids expressing viral proteins have gained popularity given their ability to induce strong cellular and humoral immune responses. several phase i clinical studies investigated the therapeutic efficacy of plasmid dna vaccines expressing hbsag in chronic hbv carriers. these studies showed evidence for the safety of hbv dna vaccination (for details see below), but t cell responses were restored or activated at only a low level. furthermore, dna vaccines expressing only hbsag did not result in significant suppression of viremia in chronic carriers of hbv [23, 24] . from results of these studies, it can be concluded that the therapeutic vaccination alone is not sufficient to achieve pre-s1/pre-s2/s, hbcag, polymerase yoon et al. [27] the control over hbv. high load of virus particles and large amounts of hbsag in the liver and peripheral blood may be responsible for the immune tolerant status in the patients. therefore, pretreatment with nucleos(t)ide analogues has been proposed to achieve better cd8 t cell response and subsequent therapeutic efficacy after administration of dna vaccines. recently, the results of the trial of this combination therapy have been published. in a large double-blind study, 70 patients were treated effectively with nucleos(t)ide analogues for a median of 3 years resulting in undetectable levels of hbv dna and thereafter randomized into two groups: one received five intramuscular injections of dna vaccine expressing hbsag and one received placebo. nucleos(t)ide analogues were stopped. although this combination therapy was fairly well tolerated, the hbv dna vaccine did not decrease the risk of relapse in hbv-treated patients and did not restore the anti-hbv immune response despite effective viral suppression by analogues [25, 26] . during a study in korea, 27 patients randomly received either adefovir (adv) alone or adv in combination with hbsag-expressing dna vaccine. therapeutic vaccination was safe and tolerable in chb patients. vaccine-induced hbv-specific t cell responses and hbeag seroconversion were weaker in korean patients than in caucasian patients [27] . asian patients, who are generally infected via vertical transmission, may have a higher level of immune tolerance than caucasians who are usually infected later in life. improved vaccines for breaking immune tolerance may be needed to develop effective therapeutic hbv dna vaccines. the aim of a study in vietnam was to evaluate viral suppression following combined treatment with a new vaccine containing all three envelope proteins of hbv (pre-s1/pre-s2/s) and lamivudine in chb patients. the enhanced suppression of viremia in the combination group was reversed after the discontinuation of vaccine treatment, suggesting that booster doses are required for a sustained viral response. anti-hbs was detected in 55/120 vaccine recipients, but only three patients demonstrated hbsag loss, indicating that the vaccine-induced anti-hbs was unable to completely neutralize hbsag in the serum [28]. the eastern woodchuck (marmota monax) is naturally infected by woodchuck hepatitis virus (whv) which was discovered in 1978 [29] . whv was found to be closely related to hepatitis b virus (hbv) [30] and classified as the second member of the genus ortho-hepadnavirus, family hepadnaviridae. in contrast to hbv-associated hcc in patients without a preferred integration site of hbv dna, a frequent integration of the whv genome close to the n-myc and c-myc gene has been observed in woodchucks developing hcc [31] . infections of woodchucks with whv have been shown to be endemic in the mid-atlantic states of the usa, whereas in the state of new york and new england woodchucks are rarely infected with whv. recently, a chinese marmot marmota himalayana was found to be susceptible to whv infection [32] (fig. 1 this review is focusing on the characterization of woodchuck genes related to innate and adaptive response, the recent development of new tools to determine virusspecific t cell response, therapeutic vaccines, and finally immunostimulatory and immunomodulatory approaches to treat chronic whv infection. these new findings in this preclinical model will help the development of new strategies to treat chronic hbv infection in patients. in recent years, many efforts have been devoted to cloning and characterization of components of the woodchuck immune system. a number of immune function-related genes including cytokines and their receptors, immune cell surface markers and other immune function-related proteins have been cloned and characterized. so far, important woodchuck cytokines and their receptors such as tnf-α, ifn-α, ifn-γ, il-12, il-15, gmcsf, lymphotoxin (lt)-α and il-10r have been cloned and tested for their biological activities [54] [55] [56] [57] [58] [59] [60] [61] . in patients, ifn has been used in the treatment of chb for many years. therefore, the ifn system has also been characterized in woodchucks. woodchuck ifn-α was shown to reduce whv surface antigen expression in a dose-dependent fashion in whv-infected woodchuck hepatocytes [62] . the woodchuck ifn-α/β system and their expression in peripheral blood lymphocytes (pbls) from naïve and whv-infected woodchucks have also been studied [63] . the woodchuck ifn-α genes could be classified into ten subtypes and three pseudotypes. poly(i:c) stimulation on naïve woodchuck pbls could induce ifn-α subtypes one, four and five production, indicating a selective expression of woodchuck ifn-α subtypes. moreover, pbls from chronically whv-infected woodchucks showed a reduced ability to produce woodchuck ifn when stimulated with poly(i:c). the complete or partial sequences of the type i ifn receptors (ifnars) of woodchucks were also obtained and analysed by fan et al. [64] . ifn-α or ifn-γ stimulation significantly upregulated ifnar2 expression in primary woodchuck hepatocytes. a decreased ifnar1 and ifnar2 expression was observed in woodchucks chronically infected with whv. these data are essential for studying type i ifn-related innate immunity and therapy in hepadnaviral infection in the woodchuck model. il-10 is a pleiotropic cytokine acting on a variety of immune cells through its cell surface receptor (il-10r). it has been suggested to resuscitate antiviral immunity by interfering with il-10/il-10r pathway. an increased production of il-10 was observed in patients with chb [65] , which hints that blockade of il-10r might become a feasible therapeutic approach for chb. very recently, jiang et al. [54] successfully cloned woodchuck il-10r and generated antibodies against this molecule. the blockade of woodchuck il-10r enhanced the proliferation and degranulation of specific t cells from chronically whv-infected woodchucks in vitro. this work provides a basis for potential therapeutic approaches in chronic hbv infection. important woodchuck immune cell surface molecules which have been cloned so far can be divided into two categories based on their function: molecules involved in innate immunity and molecules involved in adaptive immunity. toll-like receptors (tlrs) are a class of molecules that play a key role in the innate immune system. recent progress in this field revealed that there are significant interactions between the tlr system and pathogens in chronic viral infections [66] . so far, tlr2, tlr3, tlr4, tlr7, tlr8 and tlr9 have been successfully cloned in woodchucks [67] . in a recent study, zhang et al. [66] showed that tlr2 ligands induced the activation of nf-κb, pi3k/akt and different arms of mapk signalling pathways and the production of pro-inflammatory cytokines in woodchuck hepatocytes. tlr2-mediated innate immune responses reduced replication and gene expression of hbv in hepg2.2.15 cells and whv in primary woodchuck hepatocytes (see also article from zhang and lu, in this issue). in chronic whv carriers woodchuck model, relatively low levels of tlr2 expression were found in pbmcs and in liver tissues. tlr2 expression in pbmcs was inversely correlated with whv dna titres in acute whv infection and in entecavir-treated chronic whv carriers. an effective immune response against viral infections depends on the activation of cd8 t cells that can clear infection by killing virus-infected cells. therefore, sequence information of woodchuck cd3, cd4 and cd8 has been used to determine the kinetic of the influx of t cells into the liver during incubation period and acute or chronic whv infection. in week two post-infection, an influx of cd3+ lymphocytes could be observed and reached higher levels prior and during the recovery phase. the peak level of cd4+ and cd8+ t cells coincided with recovery. during transient infection, t cells can accumulate in the liver and reach up to two-thirds of the total number of liver cells [35] . in the adaptive immune response, cd28 and ctla-4 are known to play important roles for the regulation of t cell activation by delivering costimulatory signals. the complete coding regions of woodchuck cd28 and cytotoxic t-lymphocyte-associated antigen 4 (ctla-4) have been cloned and sequenced [68] . woodchuck cd28 showed a similarity of 76 and 70 % to its human and mouse homologues, respectively, according to the deduced amino acid sequences. woodchuck ctla-4 has a higher similarity of 86 and 75 % to the corresponding human and mouse ctla-4 molecules, respectively. the strict conservation of critical amino acid residues like cysteine and asparagine residues in woodchuck cd28 and ctla-4 suggests that both molecules may structurally resemble their human or mouse homologues. a hexapeptide motif mypppy which has been supposed to be essential for the interaction with cd80 is present in both woodchuck cd28 and ctla-4 [68] . the advances in sequencing technology provide new tools to characterize genes of the woodchuck immune system in large scale. fletcher et al. [69] performed the sequencing, assembly and annotation of the woodchuck transcriptome, together with the generation of custom woodchuck microarrays. by using this new platform, they characterized the transcriptional response to persistent whv infection and whv-induced hcc. liu et al. have also performed de novo woodchuck transcriptome assembly by using deep sequencing technology (unpublished data). with the help of this advanced technology, sequence information of important immune genes such as apobec3 of woodchucks has been revealed. it has been shown that upregulation of apobec3 led to specific and non-hepatotoxic degradation of nuclear hbv cccdna [70] . therefore, future cloning and characterizing of apobec3 in the woodchuck model will evaluate the therapeutic potential for chb. in summary, these efforts on establishing the translational value of the woodchuck model can provide new insight into characterizing immune pathways which may play a role in the persistence of hbv infection. studies in patients underline the important role of hbvspecific t cell response as a leading factor of viral clearance. for many years, the lack of appropriate methods to evaluate antigen-specific t cell responses was the serious limitation of this model. the establishment of the assays for monitoring of cellular immune response in woodchucks is of great importance for a reliable evaluation of therapeutic and immunomodulatory strategies for treatment of chb in the woodchuck model. development of the 2[ 3 h]-adenine-based proliferation assay enabled to detect the t-helper lymphocyte responses after stimulation of woodchuck pbmcs [39, 41] . in addition, several t-helper epitopes within whcag [39, 41] were identified in pbmcs from acutely whv-infected animals. significant progress in studying the t cell response of woodchucks was achieved by introduction of the flow cytometric cd107a degranulation assay that enables the detection of whv-specific cytotoxic t cells (ctls) in woodchuck pbmcs and splenocytes [38] . several studies demonstrated that detection of cd107a, as a degranulation marker, is a suitable method for determination of antigenspecific cytotoxic t lymphocytes [71, 72] . introduction of the immunological tools for studying of the t cell response in woodchucks revealed a significant similarity between the pathogenesis of whv infection in woodchucks and hbv in humans. it was demonstrated that acute self-limiting and resolved whv infections correlate with robust multifunctional t-helper and cytotoxic t cell responses, while whv chronic carriers demonstrate weak or no virus-specific t cell responses against the viral proteins (table 2) [38, 39, 41]. moreover, these studies confirmed that the efficient cellular immune response to viral antigens results in liver injury and is necessary for viral clearance. recently described advancements in the characterization and monitoring of the woodchuck immune system during the whv infection made this animal model particularly useful for development of the immunomodulatory approaches in chb. the pioneer investigations with therapeutic vaccines based on whv core [73] or surface [76, 77] reporting that the t cell response to hbv was successfully restored in patients treated with lamivudine. in addition, the quantity of antigen particularly the whv surface antigen (whsag) to which the immune system is exposed can induce different degrees of functional impairment of antiviral t cells, up to physical t cell deletion [78, 79] . combination therapy using lamivudine and serumderived whsag vaccination showed no effect on induction of anti-whs antibodies or reduction of whv dna [80] . our group evaluated the efficacy of the combination therapy in the woodchuck model by combining lamivudine treatment, dna vaccination (three plasmids expressing whsag, whcag and woodchuck ifn-γ) and whsag/ anti-whs immunogenic complexes vaccination [81] . the triple combination led to a decrease in whv viral load up to 2.9 log, in serum whsag up to 92 % and in development of anti-whs antibodies. nevertheless, these effects were not sustained and all parameters reached the baseline levels shortly after withdrawal of lamivudine treatment. in addition, the vaccination did not induce whv-specific t cell responses in the majority of woodchucks, even in animals that exhibited virological responses. later, we modified this protocol by using the more potent antiviral drug entecavir (etv) and increasing the number of the immunizations (with plasmids expressing whsag and whcag from three to six) (lu et al., unpublished results). a significant delay of the rebound of viremia was observed in woodchucks which received additional vaccination, compared to controls treated only with etv. in another study, chronic whv carriers received a treatment of the potent antiviral drug clevudine in combination with an alumadsorbed whsag vaccine. combination treatment resulted in significant and sustained reduction of whv dna loads and whsag concentrations in most treated animals. compared to vaccination alone, combination treatment induced a more robust anti-whs response [82, 83] . the results of these studies clearly showed that combination of antiviral treatment and vaccination is more effective in inducing virus-specific t cell responses than therapeutic vaccination alone. nevertheless, the efficacy of these approaches was still too limited when applied for treatment of chb. the vaccination strategies used in some of these studies were even not able to boost a functional antiviral t cell response. a significantly better induction of whcagspecific t cells using more potent vaccines, such as recombinant viral vectors, may be required to achieve sustained antiviral response and viral clearance. recombinant adenoviral vectors (adv) proved to elicit a vigorous and sustained humoral and t cell responses to the transduced antigen [84, 85] . adenoviral vectors also act as a natural adjuvants causing dc maturation, enhanced antigen presentation and secretion of antiviral cytokines, such as ifn-α, tnf-α and il-6 [86] . however, even single immunization with recombinant adenoviruses may induce immunity, predominantly neutralizing antibodies, against the vector itself. this negative effect of the adenovirusinduced immunity against the vaccine may be overcome by heterologous prime-boost regimen. in particular, subsequent priming immunizations with plasmid dna vaccine followed by a booster vaccination with adv seem to be a very promising strategy. dna prime-adenovirus boost regimen proved to induce more robust and potent immune response in comparison with plasmid dna alone and provided protection against the pathogen challenge in several animal models of infectious diseases [87] [88] [89] (see also article from e. barnes in this issue). recently, our group has investigated whether the heterologous prime-boost immunization strategy using plasmid dna and recombinant adenoviral vectors may improve the efficacy of the therapeutic vaccination in chb in the woodchuck model. a new dna plasmid (pcgwhc) and an adenoviral serotype 5 vector (ad5whc) and a chimeric ad5 displaying ad35 fibre (ad35whc) showing high expression levels of whcag were constructed [90] . the increased antigen expression was achieved by insertion of an intron sequence in the expression cassette of the vaccines. preliminary results showed that the new vaccines are able to induce strong and sustained whcag-specific t cell response in mice and naïve woodchucks. interestingly, immunization with advs led to rapid and massive production of anti-whs antibodies and as a result resolution of infection after the whv challenge [90] . the dna prime-adv boost immunization strategy was further used as a therapeutic vaccine against chronic whv infection in combination with antiviral treatment with etv. six chronically whv-infected woodchucks were treated for 23 weeks with etv. starting from week eight, four of the six etv-treated animals received subsequently nine intramuscular immunizations with: dna plasmids expressing whcag (pcgwhc) and whsag (pwhsim), ad5whc and ad35whc. whsag-and whcag-specific t-helper and cytotoxic t cell responses were detected in all chronic carriers that received immunizations, but not in etv only treated animals. in addition, woodchucks receiving the combination therapy showed a prolonged suppression of whv replication and lower whsag levels compared to controls. excitingly, two of four immunized carriers remained whv dna negative after the end of etv treatment and developed anti-whs antibodies [91] . these data are encouraging and demonstrate that the combined antiviral and vaccination approach efficiently elicited sustained immunological control of chronic hepadnaviral infection in woodchucks. persistent hbv infection is associated with functional exhaustion of virus-specific cd8 t cells [92] . this defect in virus-specific t cells is one of the primary reasons for the inability of the host to eliminate the persisting pathogen. although it has been shown that nucleoside analogues treatment can induce the recovery of hbv-specific ctl activity in patients [76] , this effect is only transient [77] . those findings are consistent with our data obtained from the woodchuck model, in which etv treatment alone only induced either only transient ctl responses [91] or no responses at all [93] . therefore, additional strategies that can potently enhance t cell response need to be enroled for the treatment of chb infection. recent studies in chronic virus infection models indicate that the interaction between the inhibitory receptor programmed death-1 (pd-1) and its ligands plays a critical role in t cell exhaustion [94] [95] [96] [97] . in chronic hbv infections, upregulation of pd-1 on virus-specific t cells was observed, and restoration of the t cell function has been achieved by blocking the pd-1/pd-ligand 1 (pd-l1) interaction in vitro [98] . recently, the therapeutic effect of pd-1/pd-l1 blockade has also been investigated for chronic hcv infection in chimpanzees [99] and in patients [100] . however, limited effect on restoring t cell function was observed in these studies which used only pd-1/pd-l1 blockade. it has been recently clarified that the proportion of cd8 t cells expressing pd-1 and the levels of pd-1 on virus-specific t cells are strongly correlated with viral load in the plasma [101] [102] [103] . antiretroviral treatment resulted in the dramatic decline of plasma viral load, coincident with a decrease in the pd-1 expression level on virus-specific cd8 t cells [101, 103] . in line with this, a better restoration of t cell functions upon in vitro anti-pd-l1 treatment was observed in chronic hbv patients with lower viremia [104] . therefore, a combination therapy that includes direct antiviral drug and pd-l1 blockade is a reasonable strategy for the treatment of chronic hbv infection. in line with these findings, zhang et al. [105] and liu et al. [93] successfully cloned and characterized the woodchuck pd-1/pd-l system in the whv infection woodchuck model. a significant positive correlation between the viral load and the pd-1 expression on total cd8 t cells in chronic whv infection was observed. both the proportion of pd-1+ cd8 t cells and the levels of pd-1 expression on cd8 t cells were significantly higher in the woodchucks with chronic whv infection compared to naïve animals and resolvers. more importantly, during etv treatment of those chronic carriers, a reduction of serum viral load was correlated with a dramatic decrease in the level of pd-1 expression on cd8 t cells [93] . in vitro blockade of woodchuck pd-1/pd-l1 pathway by using a rabbit polyclonal pd-l1 blocking antibody could partially restore the t cell function in whv-infected woodchucks [105] . moreover, in vivo blockade of the pd-1/pd-l1 pathway on cd8 t cells, in combination with nucleoside analogue treatment and dna vaccination, synergistically enhanced the function of virus-specific t cells. the combination therapy potently suppressed whv replication, leading to sustained immunological control of viral infection, anti-whs antibody development and complete viral clearance in some woodchucks [93] . although similar approaches have been tried in other viruses in the past, such as lcmv, the data presented here may be an advance for the hbv field to new approaches for eliminating the virus itself rather than only suppressing its replication. the woodchuck is a valuable preclinical model for developing new therapeutic approaches in chronic hepadnaviral infections. even though several innovative approaches combining antiviral treatment with nucleoside analogues, dna vaccines and protein vaccines were tested in chronically infected woodchucks, the effectiveness of those strategies was very limited. strategies investigated so far were often hampered by weak t cell responses observed after immunization, suggesting a strong need for alternative strategies to enhance t cell functions during chronic hbv infection. recently, our group published two independent proof-of-concept studies, showing that using a very potent t cell vaccine and blockade of negative signalling in t cells may lead to the resolution of chronic hepatitis b in some woodchucks (table 3) . these data are encouraging and implicate the feasibility and usefulness of the immunotherapeutic strategies for the treatment of chronically hbv-infected patients. nevertheless, which factors influence the effect of therapeutic vaccination remains to be further investigated. it has been noticed that satisfactory therapeutic effects could not be documented in the studies using hbsagbased prophylactic vaccines. in the mean time, evidence has supported that hbcag-specific immunity is endowed with antiviral and liver-protecting capacities in chb patients and animal models. with the increasing number of available vaccine formulation, a more crucial question raised recently: what is the optimal combination of these vaccines. obviously, it is necessary to test the mutual influences of different types of vaccines to maximize their effects and avoid the negative interference between the vaccines. also, the question how hbv infection leads to defective immune responses to hbv proteins remains to be investigated. this issue is the key to a more rational design of new therapeutic approaches. figure 2 summarizes the ideas of a potential combination treatment for patients with chronic hepatitis b. the presence of viral components may be a main reason for t cell tolerance in chronic hbv infection. antiviral treatment with nucleoside analogues efficiently reduce hbv replication and release of new virions and may partly restore hbv-specific cd8 and cd4 t cell responses, thereby allowing successful therapeutic vaccination. however, hbv proteins are still produced as the transcription of mrnas for the s protein and the core protein on hbv cccdna is not affected by antiviral treatment. even when hbv dna disappears during antiviral treatment, hbsag and hbcag/hbeag are present in the liver or in blood at high levels. it is proposed to reduce hbv protein load by small interfering rnas (sirnas), which lead to the sequence-specific degradation of homologous mrna. using this rna interference (rnai) with chemically synthesized or vector-expressed sirnas, many clinically relevant viruses including the human immunodeficiency virus, hbv and hcv could be inhibited. in in vitro experiments showed that whv transcripts could be degraded by sirnas [106] . at the same time, the degradation of viral rnas resulted in the activation of multiple pathways of host innate immune responses [107] . however, future in vivo studies are required to demonstrate the usefulness of this technology. combining gene-silencing approach with nucleoside analogues may further facilitate the stimulation of the immune system by therapeutic vaccines. the epigenetic regulation provides an alternative to interfere with hbv gene expression. hbv minichromosome in hepatocytes is under the complex control of epigenetic mechanisms, and its transcriptional activity could be influenced by methylation, histone acetylation and other mechanisms [108] . therefore, exploring epigenetic drugs to modify, these regulatory processes may achieve an effective suppression of hbv gene expression and thereby replace antiviral treatment with nucleoside analogues. the stimulation of innate immune responses may contribute to the control of hbv infection. in this special issue, zhang and lu provided a review dedicating to the role of tlr system. interferons and interferon-stimulated genes (isgs) represent still an important part for anti-hbv treatment. a recent review about this aspect described the current progress (pei et al., in press) . recently, the antiviral functions of isgs are under studies. for example, interferon-induced protein with tetratricopeptide repeats 1 and 2 is a cellular factor that was shown to limit hepatitis b virus replication in hepatoma cells [109] . another recent report by lucifora et al. [70] about the role of apobecs in the degradation of cccdna was highly interesting, but remained to be controversial [110, 111] . future investigation is required to elucidate the functions of isgs and their relative contribution for control of hbv infection, before exploring these genes for antiviral treatment. global epidemiology of hepatitis b virus infection: new estimates of age-specific hbsag seroprevalence and endemicity pegylated interferon alfa-2b alone or in combination with lamivudine for hbeag-positive chronic hepatitis b: a randomised trial peginterferon alfa-2a, lamivudine, and the combination for hbeag-positive chronic hepatitis b cellular and virological mechanisms of hbv drug resistance hepatitis b virus resistance to nucleos(t)ide analogues long-lasting memory t cell responses following selflimited acute hepatitis b the hepatitis b virus persists for decades after patients' recovery from acute viral hepatitis despite active maintenance of a cytotoxic t-lymphocyte response cytotoxic t lymphocyte responsiveness after resolution of chronic hepatitis b virus infection specific vaccine therapy in chronic hepatitis b: induction of expression and purification of woodchuck tumour necrosis factor alpha molecular cloning of the woodchuck cytokines: tnf-alpha, ifn-gamma, and il-6 woodchuck gamma interferon upregulates major histocompatibility complex class i transcription but is unable to deplete woodchuck hepatitis virus replication intermediates and rnas in persistently infected woodchuck primary hepatocytes molecular characterization of woodchuck interleukin 15 (wil-15) and detection of its expression in liver samples of woodchucks infected with woodchuck hepatitis virus (whv) molecular cloning and expression of woodchuck granulocyte-macrophage colony stimulating factor expression of a new woodchuck ifn-alpha gene by a helper-dependent adenoviral vector in woodchuck hepatitis virus-infected primary hepatocytes molecular characterization of woodchuck type i interferons and their expression by woodchuck peripheral blood lymphocytes molecular characterization of the type i ifn receptor in two woodchuck species and detection of its expression in liver samples from woodchucks infected with woodchuck hepatitis virus (whv) hepatitis b virus-specific t-cell proliferation and cytokine secretion in chronic hepatitis b e antibody-positive patients treated with ribavirin and interferon alpha role of tolllike receptor 2 in the immune response against hepadnaviral infection lipopolysaccharide-induced innate immune responses in primary hepatocytes downregulates woodchuck hepatitis virus replication via interferon-independent pathways molecular characterization of cd28 and cytotoxic t-lymphocyte-associated antigen 4 (ctla-4) of woodchuck (marmota monax) transcriptomic analysis of the woodchuck model of chronic hepatitis b specific and nonhepatotoxic degradation of nuclear hepatitis b virus cccdna sensitive and viable identification of antigen-specific cd8+ t cells by a flow cytometric assay for degranulation ex vivo identification, isolation and analysis of tumor-cytolytic t cells the woodchuck: an animal model for hepatitis b virus infection in man therapeutic vaccination of woodchucks against chronic woodchuck hepatitis virus infection induction of antibodies to the pres region of surface antigens of woodchuck hepatitis virus (whv) in chronic carrier woodchucks by immunizations with whv surface antigens lamivudine treatment can overcome cytotoxic t-cell hyporesponsiveness in chronic hepatitis b: new perspectives for immune therapy transient restoration of anti-viral t cell responses induced by lamivudine therapy in chronic hepatitis b molecular signature of cd8+ t cell exhaustion during chronic viral infection reinvigorating exhausted hiv-specific t cells via pd-1-pd-1 ligand blockade t-helper cell response to woodchuck hepatitis virus antigens after therapeutic vaccination of chronically-infected animals treated with lamivudine combination of an antiviral drug and immunomodulation against hepadnaviral infection in the woodchuck model immunization with surface antigen vaccine alone and after treatment with 1-(2-fluoro-5-methyl-beta-larabinofuranosyl)-uracil (l-fmau) breaks humoral and cellmediated immune tolerance in chronic woodchuck hepatitis virus infection immunogenic effects of woodchuck hepatitis virus surface antigen vaccine in combination with antiviral therapy: breaking of humoral and cellular immune tolerance in chronic woodchuck hepatitis virus infection replication-incompetent adenoviral vaccine vector elicits effective anti-immunodeficiency-virus immunity augmentation of immune responses to sars coronavirus by a combination of dna and whole killed virus vaccines recombinant adenovirus induces maturation of dendritic cells via an nf-kappab-dependent pathway development of a preventive vaccine for ebola virus infection in primates attenuation of simian immunodeficiency virus siv-mac239 infection by prophylactic immunization with dna and recombinant adenoviral vaccine vectors expressing gag prime-boost vaccination with plasmid dna and a chimeric adenovirus type 5 vector with type 35 fiber induces protective immunity against hiv dna prime-adenovirus boost immunization induces a vigorous and multifunctional t-cell response against hepadnaviral proteins in the mouse and woodchuck model combination of dna prime-adenovirus boost immunization with entecavir elicits sustained control of chronic hepatitis b in the woodchuck model t cells and viral persistence: lessons from diverse infections enhancing virus-specific immunity in vivo by combining therapeutic vaccination and pd-l1 blockade in chronic hepadnaviral infection restoring function in exhausted cd8 t cells during chronic viral infection pd-1 blockade in rhesus macaques: impact on chronic infection and prophylactic vaccination pd-1:pd-l1 interactions contribute to the functional suppression of virus-specific cd8+ t lymphocytes in the liver enhancing siv-specific immunity in vivo by pd-1 blockade characterization of hepatitis b virus (hbv)-specific t-cell dysfunction in chronic hbv infection immunotherapy of chronic hepatitis c virus infection with antibodies against programmed cell death a randomized, double-blind, placebo-controlled assessment of bms-936558, a fully human monoclonal antibody to programmed death-1 (pd-1), in patients with chronic hepatitis c virus infection pd-1 expression on hiv-specific t cells is associated with t-cell exhaustion and disease progression dysfunction and functional restoration of hcv-specific cd8 responses in chronic hepatitis c virus infection pd-1 is a regulator of virus-specific cd8+ t cell survival in hiv infection antiviral intrahepatic t-cell responses can be restored by blocking programmed death-1 pathway in chronic hepatitis b the expression of pd-1 ligands and their involvement in regulation of t cell functions in acute and chronic woodchuck hepatitis virus infection inhibition of woodchuck hepatitis virus gene expression in primary hepatocytes by sirna enhances the cellular gene expression rnai induces innate immunity through multiple cellular signaling pathways regulation of hepatitis b virus replication by epigenetic mechanisms and micrornas interferon-induced proteins with tetratricopeptide repeats 1 and 2 are cellular factors that limit hepatitis b virus replication specific and nonhepatotoxic degradation of nuclear hepatitis b virus cccdna virology. response to comment on "specific and nonhepatotoxic degradation of nuclear hepatitis b virus cccdna a pilot study of the cy-1899 t-cell vaccine in subjects chronically infected with hepatitis b virus. the cy1899 t cell vaccine study group clinical and immunological efficacy of intradermal vaccine plus lamivudine with or without interleukin-2 in patients with chronic hepatitis b in vivo immunization by vaccine therapy following virus suppression by lamivudine: a novel approach for treating patients with chronic hepatitis b therapeutic vaccination of chronic hepatitis b patients with virus suppression by antiviral therapy: a randomized, controlled study of co-administration of hbsag/as02 candidate vaccine and lamivudine the authors thank dr. wolfram gerlich for his critical comments on this manuscript. a number of studies cited in this review were funded by deutsche forschungsgemeinschaft (gk 1045 and sfb/trr60). open access this article is distributed under the terms of the creative commons attribution license which permits any use, distribution, and reproduction in any medium, provided the original author(s) and the source are credited. key: cord-017948-fqhl1qb4 authors: hu, yuan title: molecular techniques for blood and blood product screening date: 2012-04-05 journal: advanced techniques in diagnostic microbiology doi: 10.1007/978-1-4614-3970-7_28 sha: doc_id: 17948 cord_uid: fqhl1qb4 the food and drug administration (fda) is responsible for ensuring the safety of the more than 15 million units of blood and blood components donated each year in the united states. “blood banking has become a manufacturing industry, an industry that must conform to high standards and quality control requirements comparable to those of pharmaceutical companies or other regulated industries,” said david a. kessler, md, former fda commissioner [1]. screening donated blood for infectious diseases that can be transmitted through blood transfusion is a very important step in ensuring safety. the united states has the safest blood supply in the world [1] and the fda is striving to keep it safe by decreasing the risk of infectious disease transmission. the regulatory agency is continuously updating its requirements and standards for collecting and processing blood. as mentioned earlier, an important step in ensuring safety is the screening of donated blood for infectious diseases. in the united states, tests for infectious diseases are routinely conducted on each unit of donated blood, and these tests are designed to comply with regulatory requirements (table 28.1). the field of clinical microbiology and virology are now focusing on molecular technology. currently, nucleic acid testing techniques have been developed to screen blood and plasma products for evidence of very recent viral infections that could be missed by conventional serologic tests. it is time for all blood safety procedures to include molecular detection techniques. this approach can significantly aid in blood safety to reduce the risk of transmission of serious disease by transfusion. this chapter reviews the current antigen/antibody-based technology, molecular biological technology, and published regulatory policy data for blood safety. the food and drug administration (fda) is responsible for ensuring the safety of the more than 15 million units of blood and blood components donated each year in the united states. "blood banking has become a manufacturing industry, an industry that must conform to high standards and quality control requirements comparable to those of pharmaceutical companies or other regulated industries," said david a. kessler, md, former fda commissioner [ 1 ] . screening donated blood for infectious diseases that can be transmitted through blood transfusion is a very important step in ensuring safety. the united states has the safest blood supply in the world [ 1 ] and the fda is striving to keep it safe by decreasing the risk of infectious disease transmission. the regulatory agency is continuously updating its requirements and standards for collecting and processing blood. as mentioned earlier, an important step in ensuring safety is the screening of donated blood for infectious diseases. in the united states, tests for infectious diseases are routinely conducted on each unit of donated blood, and these tests are designed to comply with regulatory requirements (table 28 .1 ). the fi eld of clinical microbiology and virology are now focusing on molecular technology. currently, nucleic acid testing techniques have been developed to screen blood and plasma products for evidence of very recent viral infections that could be missed by conventional serologic tests. it is time for all blood safety procedures to include molecular detection techniques. y. hu (*) u.s. food and drug administration, northeast regional laboratory , 158-15 liberty avenue , jamaica , ny 11433 , usa e-mail: yuan.hu@fda.hhs.gov no of fi cial support or endorsement of this article by the food and drug administration is intended or should be inferred. this approach can signi fi cantly aid in blood safety to reduce the risk of transmission of serious disease by transfusion. this chapter reviews the current antigen/antibody-based technology, molecular biological technology, and published regulatory policy data for blood safety. direct detection of viral antigens and virus speci fi c antibodies has been a common tool for the diagnosis of virus infections in the past 40 years. there are some limitations. for direct detection of virus antigens, shortly after virus infection, only a few viruses release antigens in amounts suf fi ciently detectable in the body by an antibodymediated assay. for indirect virus detection by virus speci fi c antibodies (e.g., an immuno fl uorescence assay or enzyme immunoassay (eia), etc.), there is a problem in that shortly after infection by a pathogenic virus, there is a window period in which antibody generation is insuf fi cient for detection [ 2 ] . to reduce this window period of low detection, direct nucleic acid tests are needed. through the application of molecular biology, biological and biochemical analyses have been revolutionized, and nucleic acid, gene-based techniques have been developed to screen blood and plasma donations for evidence of very recent and earlier viral infections that might otherwise be missed by conventional serologic testing. the nucleic acid tests can also provide evidence for genetic variation in viruses. molecular methods include the use of nucleic acid probes as well as ampli fi cation-based and dna sequence-based techniques. an increasing number of molecular diagnostic methods are now available commercially. in comparison to classical methods, molecular biological methods are superior in terms of rapidness, speci fi city, and sensitivity. the current nucleic acid detection methods in the fi eld may be grouped into two major classes: amplifying techniques such as pcr and nonamplifying techniques such as southern blot hybridization. amplifying techniques are more sensitive than nonamplifying techniques. there are two different types of amplifying methods [ 3 ] , target ampli fi cation methods and signal ampli fi cation methods. target amplifying techniques include pcr, nucleic acid sequence-based ampli fi cation (nasba) [ 4, 5 ] , self-sustaining sequence ampli fi cation (3sr), transcription-based ampli fi cation (tas), transcription-mediated ampli fi cation (tma), strand displacement ampli fi cation (sda), and ligase chain reaction (lcr). signal ampli fi cation methods include branched dna (bdna) signal ampli fi cation [ 6 ] , cleavage-based signal ampli fi cation (cycling probe technologies and invader assay), qß replicase, hybrid capture, cycling probe technologies (cpt), and rolling-circle ampli fi cation (rca) [ 7 ] . to further insure the safety of blood products, it is of importance to further improve these and other types of nucleic acid testing. southern blotting [ 8 ] was named after edward m. southern who developed this procedure at edinburgh university in the 1970s. this technique is used to detect speci fi c sequences within mixtures of dna, which is size-fractionated by gel electrophoresis and then transferred by capillary action to a suitable membrane. after blocking of nonspeci fi c binding sites, the nitrocellulose replica of the original gel electrophoresis experiment is then allowed to hybridize with an oligonucleotide probe representing the speci fi c dna sequence of interest. should speci fi c dna be present on the blot, it will combine with the labeled probe and be detectable. by coelectrophoresing dna fragments of known molecular weight, the size(s) of the hybridizing band(s) can then be determined. southern blotting hybridization technology is one of the major tools that have already helped clinical staffs worldwide interpret genomic information. other competing methodologies include in situ hybridization and solution hybridization. important clinical examples of the use of this technology are dna fi ngerprinting and the ability to detect dna gene rearrangements. in 1983, dr. kary mullis at cetus corporation conceived of polymerase chain reaction [ 9 ] . there is not a single technique that has had a greater impact on the practice of molecular biology than pcr. with this technique, we can detect infectious diseases agents at an extremely low level. it is based on the ability of sense and antisense dna primers to hybridize to a dna of interest. following extension from the primers on the dna template by dna polymerase, the reaction is heat-denatured and allowed to anneal with the primers once again. another round of extension leads to a multiplicative increase in dna products. therefore, a minute amount of dna can be ef fi ciently ampli fi ed in an exponential fashion to result in larger amounts of dna that are more easily manipulated. by including critical controls, the technique can be made quantitative. the current level of the sensitivity and detection limit is as low as 10-50 copies per ml blood in hiv testing [ 1, 10, 11 ] . important clinical examples of the use of pcr are detection of hiv and hcv [12] [13] [14] . pcr techniques have evolved into different branches. some of them are now widely in use for virus detection in clinical diagnostics. these are real-time pcr by taqman (roche), light cycler (roche) and smart cycler (cepheid), and in situ pcr, nested-pcr, nested-real time pcr [ 15 ] , broad-range pcr, multiplex pcr, rt-pcr, arbitrarily primer pcr, long pcr, and quantitative pcr. real-time sequence technology will be coming soon for more detailed detection. in the past, identi fi cation of viral serotypes was restricted to investigative methods using antibody detection and restriction fragment length polymorphism (rflp). with real-time sequences technology, we will be able to detect a virus early as well as to obtain the viral sequence. microarrays were developed at stanford university by schena and coworkers in the early 1990s [ 16 ] . for medical applications, a microarray analysis offers a very accurate screening technology. it allows hundreds or thousands of nucleic acid hybridization reaction to be performed on a solid substrate. it promises to be a fast and accurate diagnostic tool in the fi eld of clinical microbiology and virology. applied to infection safety for blood and blood products, it will be able to screen for the presence of viral pathogens by matching genetic sequences. compared with existing technologies, it allows for a wider variety of speci fi c tests to be carried out simultaneously to determine the quality of the blood and will provide consumers with extra safety. with the use of molecular biology protocols, the microarray will permit the detection of lower concentrations of microorganisms in the blood and the accurate identi fi cation of many types of pathogenic contaminants. in the near future, progress can be expected in the application of microarray technology for screening of donated blood for infectious agents. it can provide vast information about the identity of bloodborne pathogens as well as their gene expression pro fi les [ 17 ] . to ensure a safe blood supply for those who may need a transfusion, an important step in ensuring safety is the screening of donated blood for infectious agents. after donation, each unit of donated blood undergoes a series of tests for bloodborne agents such as human immunode fi ciency virus (hiv)-1, hiv-2, hepatitis b virus (hbv), hepatitis c virus (hcv), human t-cell lymphotropic virus (htlv)-1 and htlv-ii, west nile virus (wnv), and treponema pallidum , the agent of syphilis. all of the above tests are referred to as screening tests, and are designed to detect as many infectious agents as possible. because these tests are so sensitive, some donors may have a false-positive result, even when the donor has never been exposed to the particular infection. in order to sort out true infections from such false-positive test results, screening tests that are reactive may be followed up with more speci fi c tests called con fi rmatory tests. thus, con fi rmatory tests help determine whether a donor is truly infected. if any one of these tests fails, affected blood products are considered unsuitable for transfusion [ 18 ] . nucleic acid testing (nat) employs testing technology that directly detects the genomes of viruses. because nat detects a virus's genetic material instead of waiting for the body's response, the formation of antibodies, as with many current tests, it offers the opportunity to reduce the window period during which an infecting agent is undetectable by traditional tests [ 19 ] , thus further improving blood safety. nat will become the gold standard because of greater sensitivity compared to antibody tests. since 1999, nat has been approved by the fda and used to detect hiv-1 and hcv; this technology currently is under investigation for detecting other infectious disease agents. we know that for many viral infections, viral rna appears very early in the infection, in 1-2 weeks, but the antibody does not appear until 10-12 weeks, e.g., hiv and hcv [ 20 ] . in order to virtually prevent infection by all the transfusion associated viruses, we need to detect the viruses in their window period, and a nat or gene-based testing method is needed. nat also provides an opportunity for the viral, e.g., hiv or hcv, infected donor to seek early treatment. on the other hand, nat is not only a sensitive method, but also a rapid method which is suitable for a blood bank laboratory because the turnaround time for maintaining blood donations is extremely critical. the hbv is a highly infectious and often nonsymptomatic virus that is transmitted primarily through blood and blood-derived fl uids and is a leading cause of liver infection worldwide. the world health organization (who) estimates that two billion people worldwide have been infected with hbv and 350,000,000 people are chronically infected. chronic infection results in a high risk for liver cancer and cirrhosis of the liver, which cause about 1,000,000 deaths each year. each year up to 200,000 people become newly infected in the united states alone. since the beginning of screening for hbv in 1969, the rate of infection through blood transfusions has greatly decreased. however, as of 2000, hbv is still transmitted through blood transfusions in 1 out of 137,000 units of blood. one reason for this is that currently available blood screening technologies detect core antibodies or surface antigens, which appear up to 8 weeks after infection. serologic tests for hbv include hepatitis b surface antigen (hbsag) and hepatitis b core antibody (hbcab). hbv, which mainly infects the liver, has an inner core and an outer envelope (the surface). the hbsag test detects the outer envelope, identifying an individual infected with the hbv. this virus can cause in fl ammation of the liver, and in the earliest stage of the disease, infected people may feel ill or even have yellow discoloration of the skin or eyes, a condition known as jaundice. fortunately, most patients recover completely and test negative for hbsag within a few months after the illness. a small percentage of people become chronic carriers of the virus, and in these cases, the test may remain positive for years. chronically infected people can develop severe liver disease as time passes, and need to be followed carefully by an experienced physician. to reduce the occurrence of posttransfusion hepatitis, it is essential to screen all blood donations for hbsag by the most sensitive and speci fi c assays. blood donations that are found to be reactive in the hbsag test are automatically con fi rmed by the hbsag con fi rmatory assay. if the specimen is neutralizable in the con fi rmatory test, the specimen is considered positive for hbsag. hbsag testing of donated blood has begun in 1975 (table 28.1 ) . currently, all blood donors are screened for hbsag, but occasional transmission of hbv still occurs due to the inclusion of window period donations (i.e., blood from recently infected donors who are antibody negative but still viremic). detection of early hbv infection of blood donors is still a major problem of blood transfusion. the current third-generation licensed hbsag tests (mostly radioimmunoassay and enzyme immunoassays) can not detect hbv in the window period for hbv infection. this is a strong motivation for introducing molecular detection techniques to the fi eld. there are some commercially available test methods for detecting hbv dna in the market now, such as chiron's quantiplex hbv dna [ 21 ] , digene's hybrid capture, abbott's hbv dna assay, and roche's amplicor hbv monitor. using these commercial hybridization or pcr-based assays, hbv dna can be detected 1-3 weeks before the appearance of hbsag [ 22 ] . some chronically infected patients who have lost their hbsag remain hbv dna positive, but are disquali fi ed as potential blood donors. molecular detection of hbv dna is more sensitive than current methods employed for hbsag screening. determination of antibodies to the hepatitis b core antigen (anti-hbc) (total) is also used to monitor the progress of the hepatitis b viral infection. determination of anti-hbc (igm) is employed to distinguish an acute hepatitis b infection from a chronic infection. the anti-hbc test developed in 1987 detects an antibody to the hbv that is produced during and after infection. if an individual has a positive anti-hbc test, but the hbsag test is negative, it may mean that the person once had hepatitis b, but has recovered from the infection. of the individuals with a positive test for anti-hbc, many have not been exposed to the hbv; thus, there is a frequent problem of false positives. although the individual may be permanently deferred from donating blood, it is unlikely that the person's health will be negatively affected. (note: this antibody is not produced following vaccination against hepatitis b). the hcv is a member of the flaviviridae family of viruses, which are associated with both human and animal diseases. hepatitis caused by hcv is the most common chronic bloodborne infection in the united states. over four million americans are believed to be infected. hcv can also be transmitted through blood transfusion. hcv causes in fl ammation of the liver, and up to 80% of those exposed to the virus develop a chronic infection, which can lead to liver in fl ammation, cirrhosis, cancer, and death. eventually, up to 20% of people with hcv may develop cirrhosis of the liver or other severe liver diseases. as in other forms of hepatitis, individuals may be infected with the virus, but may not realize they are carriers since they do not have any symptoms. because of the risk of serious illness, people with hcv need to be followed closely by a physician with experience evaluating this infection. since the fi rst cloning of fulllength hcv cdna in 1989, signi fi cant progress has been made in characterizing its molecular biology [ 11 ] . but, the natural history of hcv infection is still largely unclear and current treatment options for patients are limited. there is no vaccine for hcv, and the only available treatment, a combination of alpha interferon and ribavirin, is ef fi cacious in only a minority of patients [ 23 ] . the life cycle of the hcv is poorly understood due to the lack of an ef fi cient cell culture system [ 24 ] . there is an urgent need to develop a highly sensitive detection method for studying possible extrahepatic sites for the replication of hcv. we have recently established a cell culture system for the replication of hcv by using human t and b leukemia cell lines [ 25 ] . this model should represent a valuable tool for the detailed study of the initial steps of the hcv replication cycle and for the evaluation of antiviral molecules. currently, appropriate vaccine strategies for hcv have not been developed. early detection and prevention of hcv infection are most important for blood safety. it is a formidable task to design primers and probes for sensitive nucleic acid level diagnostic assays throughout the open reading frame of the hcv genome because of a high mutation rate in this genomic region. however, the untranslated region of about 341 nucleotides contains highly conserved domains which allows for stable primer design for qualitative and quantitative diagnostic tests which have equivalent sensitivity against the known six various genotypes of hcv. in 1990, the fi rst speci fi c test for hcv, the major cause of "non-a, non-b" hepatitis was introduced. now, a third generation elisa kit is available to detect antibodies to hcv and screening blood for hcv antibodies is recommended. these assays are based on detection of serum antibody to various hcv antigens because these antibodies are nearly universally present in patients who are chronically infected with hcv [ 26 ] . the hcv screening tests are known to have signi fi cant limitations and positive samples should be further tested by hcv con fi rmatory tests. guidelines provided by the cdc recommend that hcv antibody screening test positive samples should be con fi rmed with serologic or nucleic acid supplemental testing. hcv con fi rmatory tests include the recombinant immunoblot assay in which several recombinant peptide antigens are applied on a strip that is then probed with the patient's serum. in this way, the response to individual antigens can be recognized, and some false-positive elisa results can be eliminated (e.g., riba, chiron hcv 3.0, and pcr assay) (e.g., roche cobas amplicor hcv test, version 2.0). laboratories can choose to perform this testing on all positive specimens or based on screening test positive (signal to cutoff) ratios. the positive predictive values (s/co) can vary depending on the prevalence of infection in the population being screened. hcv antibodies are not generally detectable for at least 6 weeks and may not appear for several months. acute hcv infections are relatively rare among blood donors, but the antibody tests often fail to detect these patients in the window period between the time of infection and the time of appearance of antibody detectable by the above assays. high sensitivity detection of hcv during the window period is a longterm technical challenge in the fi eld. tests for hcv rna genome detection based on the pcr or other highly sensitive rna detection systems have been used for the diagnosis of acute hepatitis [ 26 ] . sensitive detection of hcv rna based on rt-pcr or other nucleic acid ampli fi cation techniques can be readily accomplished with kits that are now available commercially. for example, in 1999 the fda approved roche's amplicor hiv-1 monitor ultra sensitive quantitative assay. it can measure hiv levels at as few as 50 copies/ml and another commercial kit, the lcx hiv rna quantitative assay from abbott laboratories, also has a detection limit at 50 copies/ml. some studies even showed a sensitivity limit at 1 copy [ 27 ] . in fact, a qualitative assay should be much more sensitive than a quantitative assay for hiv/hcv screening. a sensitive qualitative hcv molecular detection assay will possibly interdict and virtually prevent all transfusion-associated hiv/hcv. the current sensitivity standard for clinical diagnostics is 100 copies/ml, but since there has been an improvement in technology, this would be the time to change sensitivity standard to 50 copies/ml. hiv-1 and/or hiv-2 virus cause acquired immunode fi ciency syndrome, or aids. the test is designed to detect antibodies directed against antigens of the hiv-1 or hiv-2 viruses. hiv-1 is much more common in the united states, whereas hiv-2 is prevalent in western africa. donors are tested for both viruses because both are transmitted by infected blood, and a few cases of hiv-2 have been identi fi ed in us residents. in1985, the fi rst blood-screening eia test to detect hiv was licensed and quickly implemented by blood banks to protect the blood supply. in 1992, testing of donor blood for both hiv-1 and hiv-2 antibodies (anti-hiv-1 and anti-hiv-2) was implemented. in 1996, hiv p24 antigen testing of donated blood was mandated. now, the p24 antigen testing is going to be compared with a pcr-based test for their ability to detect hiv in the window period. htlv retroviruses are endemic in japan and the caribbean but relatively uncommon in the united states. they cause adult t-cell leukemia/lymphoma and a neurological disorder similar to multiple sclerosis. the infection can persist for a lifetime but rarely causes major illnesses in most people who are infected. in rare instances, the virus may, after many years of infection, cause nervous system disease or an unusual type of leukemia. htlv-ii infections are usually associated with intravenous drug usage, especially among people who share needles or syringes. disease associations with htlv-ii have been hard to con fi rm, but the virus may cause subtle abnormalities of immunity that lead to frequent infections, or rare cases of neurological disease. in 1989, human-t-lymphotropic-virus-antibody testing of donated blood was begun. blood is now routinely screened for antibodies to htlv-i/ii. these test screens for antibodies directed against epitopes of the htlv-i/ii viruses. several commercial assays based on the enzyme-linked immunosorbent assay (elisa) or particle agglutination formats are used for screening of htlv antibodies, followed by con fi rmatory assays using western blotting. in some infected individuals, the serologic response to htlv infection is very low. these problems have been solved by the application of pcr ampli fi cation of speci fi c sequences in the virus genome. pcr can be used to detect htlv-i/ii proviruses and is now the method of choice for detection of htlv dna directly from blood and many other tissues. commercial pcr kits for htlv are available [ 28 ] . the wnv is a single-stranded rna virus of the flaviviridae family and is the most recent emerging infectious disease threat to public health and, potentially, to the safety of our blood supply. in 2002, wnv was identi fi ed as transfusion transmissible. it is transmitted by mosquitoes to birds and other animals through a mosquito bite. the virus can infect people, horses, many types of birds, and some other animals. wnv was shown in 2002 to be transmissible by blood [ 29 ] , with an estimated mean risk of 2/10,000-5/10,000 in outbreak regions in the united states. the most common symptoms of transfusion-transmitted cases of wnv were fever and headache. detection of wnv includes either a measurement of wnv antibodies or of wnv nucleic acid (detecting genetic material from the virus itself). there are two types of wnv antibody testing: igm and igg. in most individuals, igm antibodies will be present within 8 days after the initial exposure to wnv, followed by igg production several weeks later. but, the antibodies tested to detect wnv are not expedient for donor blood screening. nat involves amplifying and measuring the wnv's genetic material to detect the presence of the virus in blood or tissue. wnv nat will be negative in the blood once clinical illness has occurred. in this situation, both nat and igm antibody testing may be needed. nucleic acid tests to screen blood for wnv are commercially available and in current use. but, the viral yield for wnv infection is much lower than other viruses. consequently, a more sensitive wnv nat system for donor blood screening will be required, which could further reduce the risks of transfusion transmitted wnv. serum samples from all blood units should be subjected to either the venereal disease research laboratory (vdrl) test or a treponemal test, such as the t. pallidum haemagglutination (tpha) test before transfusion. any unit found positive should be discarded as per standard safety procedures. this test is done to detect evidence of infection with the spirochete that causes syphilis. blood centers began testing for this shortly after world war ii, when syphilis rates in the general population were much higher. the risk of transmitting syphilis through a blood transfusion is exceedingly small (no cases have been recognized in this country for many years) because the infection is very rare in blood donors, and because the spirochete is fragile and unlikely to survive blood storage conditions. sensitivity and speci fi city of serologic tests vary depending on the type of test performed and the stage of the disease. if the donor has spirochetemia, their serologic tests are usually negative, and if the donors are antibody positive, their blood is not infectious. syphilis serological tests for donors have less clinical signi fi cance. a nucleic acid test for accurately detecting syphilis is needed. it can be used to determine whether a blood donor is currently or has recently been infected with the spirochete. in recent years, numerous infectious agents found worldwide have been identi fi ed as potential threats to the blood supply and among these are several newly discovered hepatitis viruses that present unique challenges in assessing possible risks. even if the hepatitis virus test is negative for all known a-e hepatitis agents, there are some unidenti fi ed hepatitis viruses, called non a-e hepatitis viruses that can still be transmitted by blood transfusion. in the future, advances in nat may allow rapid discovery of the unknown hepatitis viruses. hepatitis delta virus (hdv) is a small rna virus that can infect only individuals who have hbv; worldwide more than 15 million people are coinfected [ 30 ] . hdv is clinically important because it generally makes hbv infections more damaging to the liver. increased understanding of the molecular virology of hdv will identify novel therapeutic targets for this most severe form of chronic viral hepatitis. pcr and real-time pcr methods are available for hdv rna detection [ 31 ] . tt virus (ttv) [ 32 ] , named for the patient from whom it was fi rst isolated with non-a-e and g posttransfusion hepatitis in japan in 1997, is a newly discovered transfusion transmitted, single-stranded and circular dna virus [ 33 ] . ttv is nonenveloped and its entire sequence of ~3.9 kb has been determined. it is also often interpreted as a transfusion-transmitted virus [ 32 ] . at least 16 genotypes have been identi fi ed, and ttv is now found all over the world. ttv infection was sought by detection of ttv dna in serum by polymerase chain reaction using primers generated from a conserved region of the ttv genome, e.g., the utr region [ 34 ] . donor blood and blood product can be screened for ttv dna by using pcr or real-time pcr. the signi fi cance of positive fi ndings is still unclear, because high level ttv carriers in healthy populations are currently found [ 35, 36 ] . whether ttv actually causes hepatitis remains to be determined. cytomegalovirus (cmv) is a virus belonging to the herpes group that is rarely transmitted by blood transfusion. donor blood is not routinely tested for cmv, and the prevalence of cmv antibody ranges from 50 to 80 % of the population. but, blood contaminated with cmv can cause problems in neonates or immunocompromised patients. it also remains a major pathogen for solid-organ transplant recipients causing febrile syndromes, hepatitis, pneumonitis, retinitis and colitis. potential problems in selected patient populations can be prevented by transfusing cmv negative blood or frozen, deglycerolized red blood cells. serologic tests for antibody to cmv are useful for determining whether a patient had cmv infection in the past, a determination of great clinical importance for organ and blood donors, and in the pretransplant evaluation of prospective transplant recipients [ 37 ] . commercial nat kits are available for cmv [ 3 ] , and these include the amplicor pcr cmv monitor test and hybrid capture system cmv dna test. sensitive screening tests for malaria are neither commercially available nor of fi cially approved yet. the most effective way of screening donors is to take a proper history of malaria or of fever that could be due to malaria. donor selection criteria should be designed to exclude potentially infectious individuals from donating red blood cells for transfusion. because there are no practical laboratory tests available to test donor blood, donors traveling to high risk malaria areas are excluded from donating blood for 6 months. however, there is a need to develop suitable screening tests, especially for use in an endemic area. a number of clinical research approaches have been developed for the extraction, ampli fi cation and detection of malaria parasite dna from blood products [ 37 ] . variant creutzfeldt-jakob disease (vcjd-a rare but fatal brain infection) [ 38 ] was fi rst described in 1996 in the united kingdom. vcjd is strongly linked with exposure to the bovine spongiform encephalopathy (bse) agent. bse is a transmissible spongiform encephalopathy (tse) affecting cattle and was fi rst reported in the uk in 1986. it has different clinical and pathologic characteristics from classic vcjd. each disease also has a particular genetic pro fi le of the prion protein gene. in recent years, questions have been raised concerning the potential risk of vcjd disease for recipients of plasma-derived clotting factors, including united states licensed factor eight (pdfviii), factor nine (pdfix), and other plasma-derived products such as immune globulins and albumin. in the past 10 years, there have been some reported cases of probable vcjd transmission by red blood cell transfusions in the united kingdom. prion infections are associated with long and clinically silent incubations. the number of asymptomatic individuals with vcjd prion infection is unknown, posing risk to others through blood transfusion, blood products, organ or tissue grafts, and contaminated medical instruments. in order to decrease the risk, there is a need to establish a blood-based molecular assay for detection of vcjd prion infection. recently research papers have shown that sensitivity detection methods are available for vcjd prion [ 39 ] . however, commercial detection kits are not yet available. the dengue virus (denv) is a member of the virus family flaviviridae and is transmitted to people through the bite of an infected mosquito. the dengue virus has been shown to have four subtypes. these subtypes are different strains of dengue virus that have 60-80 % homology between each other. dengue has emerged as a worldwide problem only since the 1950s. with more than one-third of the world's population living in areas at risk for transmission, dengue infection is a leading cause of illness and death in the tropics and subtropics. according to cdc, as many as 100 million people are infected yearly. dengue is caused by any one of four related viruses transmitted by mosquitoes. there are not yet any vaccines to prevent denv infection, and the most effective protective measure is to avoid mosquito bites. there have been healthcare-related transmissions, including transmission by blood products [ 40 ] . dengue infection has a viremic phase that lasts 4-8 days, and blood collected during this phase may be infective when transfused into susceptible hosts [ 40 ] . there are currently no tests for direct detection of dengue virus, but there are however, commercial elisa tests to detect antibodies of the dengue virus in blood samples from patients. recently, research papers have shown that pcr detection methods are available for any dengue virus strain [ 41 ] . babesia is a protozoan parasite of the blood that causes a hemolytic disease known as babesiosis. babesiosis is a malaria-like parasitic disease, and there are over 100 species of babesia identi fi ed. in the united states, babesia microti is the agent most commonly reported to cause human infection. clinical confusion between human babesiosis and malaria is often reported in literature [ 42 ] . babesia infection can also be acquired by blood transfusion. in fact, there have been many cases of transfusioninduced babesiosis documented [ 43 ] . risk of developing this clinical infection is increased for elderly, asplenic, or immunosuppressed patients. current standards issued by the american association of blood banks (aabb) require the inde fi nite deferral of a blood donor with a history of babesiosis. [ 44 ] there is a need to develop methods for identi fi cation b. microti in order to reduce the risk of transmission of babesiosis by transfusion. diagnosis depends upon fi nding parasites on blood fi lm examination which can be detected 2-4 weeks after a tick bite. hamster inoculation and serology have also been used for diagnosis. the indirect fluorescent antibody test (ifat) is available for b. microti and is the most useful serological test for early diagnosis. also, the pcr screen tests for babesiosis are technically available in the fi eld [ 45 ] . chagas disease is named after the brazilian physician carlos chagas, who discovered the disease in 1909. chagas disease is spread mainly by blood-sucking insects infected with trypanosoma cruzi . chagas disease can also be spread through blood transfusion, organ transplants, and from a mother to an unborn child. national screening of the blood supply was instituted in early 2007 by fda, and more than 1,000 donors with t. cruzi infection have been identi fi ed within the past 3 years of testing. "screening for t. cruzi is an important safety measure to help protect our blood supply and to help prevent the spread of chagas disease," says karen midthun, m.d., acting director of the fda's center for biologics evaluation and research. currently, serological elisa tests are available for diagnose chronic chagas disease. pcr test is not a tool for diagnosis of chronic chagas disease in clinical practice yet, although some research results have showed that pcr is a very sensitive parasitological test for chagas' disease in active transmission regions [ 46 ] . more studies are needed for the development of this molecular method. coronavirus is an rna virus known to be associated with respiratory disease. severe acute respiratory syndrome (sars) is a newly recognized coronavirus whose genome sequence does not belong to any of the known coronavirus groups and which quickly spread all over the world from asia in 2003. there has been no evidence that this infection is transmitted from blood donors to transfusion recipients, but the virus associated with sars is present in the blood of people who are sick, and it is possible that the virus could be present in blood immediately before a person gets sick, so that an individual with infection but no symptoms possibly could transmit sars through a blood donation. to help determine whether or not an individual might be infected with sars, a blood collection facility will ask a potential donor orally or in writing about any travel to a sars-affected country or a history of sars or possible exposure to sars. enzyme-linked immunoassays for detection of speci fi c igg and igm antibodies and rt-pcr for detection of sars coronavirus speci fi c rna in the sars patients has been developed. rapid, sensitive, and speci fi c identi fi cation of sars and other novel coronaviruses by molecular methods will be very important in the future. based on past history, it is not just a hypothetical risk that many people have been infected with unrecognized viruses, for example, many patients with symptoms of non a-e, g, and ttv posttransfusion hepatitis. it is still possible that unexplained cases of posttransfusion hepatitis may be caused by a new, undiscovered pathogen. in recent years, numerous new infectious agents found worldwide have been identi fi ed through time-consuming procedures. by the time a new virus, such as hcv, hiv and sars, is found, many people are infected and there could be a large number of fatalities. there is an urgent need to develop methods for rapid identi fi cation and characterization of previously unknown pathogenic viruses. the most recent technologies for detecting and identifying previously unrecognized pathogens are expression library screening, representational difference analysis (rda), and broad-range polymerase chain reaction (br-pcr). but they are all time-consuming approaches. the new unrecognized and uncharacterized viral agents can be rapid identi fi ed by some of the new molecular approaches, e.g., subtraction hybridization [ 47 ] and dna microarray. ensuring the safety and ef fi cacy of blood and blood products is a critical regulatory challenge. the high safety level of the blood supply is the result of continued improvements in blood donor screening and testing. it will be achieved by introducing more updated nucleic acid tests to the fi eld of blood safety. nat is a method of testing blood that is more sensitive and speci fi c than conventional tests that require the presence of antibodies to trigger a positive test result. also, nat works by detecting the low levels of viral genetic material present when an infection occurs but before the body develops an immune response to a virus. this improved sensitivity should enable us to signi fi cantly decrease the infection window period, allowing for earlier detection of the infection and diminishing the chances for transmission of the agent via transfusion. we are to protect the blood supply from not only known pathogens but also the emergence of new and unrecognized and uncharacterized infectious agents. the nat methods are more sensitive and speci fi c compared with non-nat. in the future, nat technology, such as pcr, may allow routine screening of donors for all the known and unknown pathogens of concern to blood safety. progress in blood supply safety emerging infectious disease issues in blood safety white tj (eds) molecular microbiology: diagnostic principles and practice evaluation of a new nasba assay for the qualitative detection of hepatitis c virus based on the nuclisens basic kit reagents detection of piscine nodaviruses by real-time nucleic acid sequence based ampli fi cation (nasba) molecular-based methods for quantifying hiv viral load molecular diagnostics of infectious diseases dna, 50 years of the double helix: from the concept of molecular hybridization to microarrays in vitro nucleic acid ampli fi cation techniques multicenter evaluation of the performance characteristics of the nuclisens hiv-1 qt assay used for quantitation of human immunode fi ciency virus type 1 rna serological and molecular biology screening techniques for hcv infection clinical evaluation of an hiv-1 and hcv assay and demonstration of signi fi cant reduction of the hcv detection window before seroconversion hiv-1 monitor ultrasensitive quantitative assay. roche, nutley 14. lcx hiv rna quantitative assay from nested real-time pcr for hepatitis a detection introduction to microarray analysis development and validation of a diagnostic dna microarray to detect quinolone-resistant escherichia coli among clinical isolates testing requirements for communicable disease agents detection of hiv-1 and hcv infections among antibody-negative blood donors by nucleic acid-ampli fi cation testing immunization of health-care workers: recommendations of the advisory committee on immunization practices (acip) and the hospital infection control practices advisory committee (hicpac) assessment of hepatitis b virus dna stability in serum by the chiron quantiplex branched-dna assay section two: speci fi c virus families recent advances in prevention and treatment of hepatitis c virus infections the scienti fi c challenge of hepatitis c hirsh fi eld i (2003) detection of extrahepatic hcv replication by a novel highly sensitive single tube nested-pcr section two: speci fi c virus families new real-time reverse transcriptase-initiated pcr assay with single-copy sensitivity for human immunode fi ciency virus type 1 rna in plasma human t-cell leukemia virus types 1 and 2 (chap. 58) estimated risk of transmission of the west nile virus through blood transfusion in the us hepatitis delta virus quanti fi cation of hepatitis delta virus rna in serum by consensus real-time pcr indicates different patterns of virological response to interferon therapy in chronically infected patients ttv-a virus searching for a disease a novel unenveloped dna virus (tt virus) associated with acute and chronic non-a to g hepatitis role of transfusion-transmitted virus in acute viral hepatitis and fulminant hepatic failure of unknown etiology a novel dna virus (ttv) associated with elevated transaminase levels in posttransfusion hepatitis of unknown etiology tt virus section two: speci fi c virus families emerging infectious disease agents and their potential threat to transfusion safety detection of prion infection in variant creutzfeldt-jakob disease: a blood-based assay threat of dengue to blood safety in dengue-endemic countries pcr detection of nearly any dengue virus strain using a highly sensitive primer cocktail do babesiosis and malaria share a common disease process? babesia infection through blood transfusions: reports received by the us food and drug administration transfusion-transmitted babesia spp.: bull's-eye on babesia microti detection of babesia species from infected dog blood by polymerase chain reaction pcr-based diagnosis for chagas' disease in bolivian children living in an active transmission area: comparison with conventional serological and parasitological diagnosis rapid approach to identify an unrecognized viral agent complete list of donor screening assays for infectious agents and hiv diagnostic assays key: cord-255697-trig04hd authors: cheng, vincent chi-chung; chan, jasper fuk-woo; hung, ivan fan-ngai; yuen, kwok-yung title: viral infections, an overview with a focus on prevention of transmission date: 2016-10-24 journal: international encyclopedia of public health doi: 10.1016/b978-0-12-803678-5.00514-2 sha: doc_id: 255697 cord_uid: trig04hd viruses are obligatory intracellular pathogens with a simple structure consisting of assembled proteins enclosing the nucleic acid genome with or without a lipid envelope. despite increasing availability of rapid nucleic acid amplification assays for laboratory diagnosis, effective antivirals, and safe vaccines, the control of most viral infections depends on time-honored surveillance and infection control measures. moreover most viruses can be readily destroyed by common disinfectants. this article is focused on the epidemiology, diagnosis, and control of common and emerging viral diseases. traditionally, the epidemiological control of most viral infections depends on the isolation of cases, quarantine of contacts, personal protection by infection control measures and mass vaccination, because specific antiviral treatment is generally not available for most viral infections ( table 1) . this scenario is rapidly changing with the increasing availability of rapid diagnostic tests which use nucleic acid amplification, and the development of an increasing number of effective antiviral agents. common acute viral diseases such as respiratory, diarrheal, exanthematous, or neurological infections can overlap with each other and appear as seasonal epidemics, which peak in incidence every few years and coincide with the accumulation of sufficient number of nonimmune hosts in the young population. arboviral disease activity often coincides with arthropod vector activity such as mosquito breeding in hot rainy seasons which are associated with increased incidence of hemorrhagic fever or neurological diseases such as dengue hemorrhagic fever, west nile virus, or japanese encephalitis in southeast asia. many chronic blood-borne viral illnesses such as human immunodeficiency virus (hiv), hepatitis b virus (hbv), and hepatitis c virus (hcv) are still taking a major toll in certain geographical regions due to specific human behaviors or vertical transmission. some of these chronic viral infections such as hbv, hcv, hiv, polyomaviruses, and papillomaviruses are also linked to the genesis of cancers. over 70% of emerging viral infections such as the ebola virus, severe acute respiratory syndrome (sars) coronavirus, and middle east respiratory syndrome coronavirus (mers-cov) are associated with acute explosive outbreaks after the virus jumped the species barrier from bats or other animals into humans ( table 2) . this article will focus on the prevention and control of viral infections, while other articles in this encyclopedia will cover information on specific viruses. unlike bacteria, fungi, and parasites, viruses are too small to be visible under light microscopy. moreover, viruses are obligate intracellular pathogens and do not grow in artificial culture medium. collecting the correct clinical specimens during the peak of viral shedding in appropriate viral transport medium is crucial for accurate diagnosis. electron microscopy is not sensitive and has a limited role in the examination of feces from viral gastroenteritis and vesicular fluid from skin lesions caused by herpesviruses and poxviruses. virus isolation in cell lines or chick embryo is the gold standard for virological diagnosis but seldom alters clinical management due to its long turnaround time. viral antigen detection by immunofluorescence, enzyme immunoassay, and point-of-care rapid lateral flow immunochromatographic assays has significant impact on therapeutic and infection control strategies. the most important rapid virological tests are nucleic acid amplification tests such as real-time or multiplex reverse transcription-polymerase chain reaction (rt-pcr) assays that are useful for accurate diagnosis and subsequent viral load monitoring during antiviral treatment. genotyping by nucleic acid amplification and sequencing for detection of mutations associated with antiviral resistance directly from clinical specimens are now available for many antiviral agents and are routine for antiretroviral drugs used to treat hiv infection. though nucleic acid amplification tests still have practical limitations in the field settings of developing areas, such tests are now routine in most hospitals in developed countries. antibody testing by enzyme immunoassay for igm in acute infection, igg for immune status of exposed individuals, and retrospective diagnosis by the presence of rising antibody titers in paired acute and convalescent sera of symptomatic patients is useful for making clinical and epidemiological decisions. antibody screening is especially important in antenatal visits of expectant mothers, blood donors, and organ donors and recipients before transplantation. next-generation sequencing performed directly on clinical specimens may revolutionize virological diagnosis in the coming decade. the timely and accurate diagnosis of viral infections has important implications for effective epidemiological control in the community and infection control for hospital outbreaks. transmission of blood-borne viruses can result from sexual intercourse and maternal-fetal transmission in the community setting, needle stick injury, and other exposure-prone procedures in the health-care setting. in a study from the usa, the annual death rate of health-care workers from occupational events was estimated to be 17-57 per 1 million workers, and most of these deaths resulted from infection-related complications of blood-borne viruses (sepkowitz and eisenberg, 2005) . the overall risk of transmission of blood-borne viruses by hollow needle stick injury is 33%, 3%, and 0.3% if the source is a hepatitis carrier with positive hbe antigen or high viral load, hepatitis c carrier with viremia, and hiv, respectively. compliance with standard precautions including wearing gloves when handling blood during patient care practice, disposing sharp needles into puncture-resistant box, and avoidance of recapping needles remain the most important ways to prevent nosocomial acquisition of blood-borne viruses (garner, 1996) . active immunization for hbv can protect health-care workers from hbv infection with an efficacy of 80-95% (dienstag et al., 1984; sabido et al., 2007; shim et al., 2011) . postimmunization anti-hbs antibody level should be measured at 4-8 weeks after completion of the 3-dose immunization regimen given at baseline, 1 month, and 6 months. a good responder is defined as a person whose anti-hbs antibody level is greater than 100 iu/l. if the hepatitis b antibody level is between 10 and 100 iu/l, a booster dose of vaccine should be given. for nonresponders whose anti-hbs antibody is less than 10 iu/l, another course of hbv vaccine should be given. the response rate is about 61% in repeated hbv vaccination by the same route as the initial vaccination (struve et al., 1994) . alternatively, immunization with high-dose intradermal recombinant hbv vaccine, given in up to four doses, can achieve immunity in 88% of health-care workers who failed to respond to intramuscular vaccination and boosters (levitz et al., 1995) . the anti-hbs titer was persistently higher than the protective level for at least 10 years after primary hbv vaccination (floreani et al., 2004) . when a health-care worker sustains a needle stick injury, he/ she should be advised to rinse the wound with tap water and allow natural bleeding. the source patient's blood is collected to check for the presence of hiv, hbv, and hcv. if the status of blood-borne viruses of the source patient is positive or unknown, postexposure prophylaxis (pep) should be offered according to current guidelines (kuhar et al., 2013 ). the exposed health-care worker will be closely followed up for counseling, baseline and follow-up hiv testing, and monitoring for drug toxicity. if a newer fourth-generation combination hiv p24 antigen-hiv antibody test is utilized for follow-up hiv testing, it may be concluded 4 months after exposure. otherwise, follow-up hiv testing is performed 6 months after the exposure (kuhar et al., 2013) . for hbv, pep with hepatitis b immune globulin (hbig) and/or hbv vaccination should be considered for occupational exposures after evaluation of the hbsag status of the source, and the vaccination and vaccine-response status of the exposed person (2001). for hcv, pep is not currently recommended. however, an open-label pilot trial was conducted to determine the safety, tolerability, and acceptance of peginterferon alfa-2b as pep. among 213 health-care workers exposed to an hcv antibody-positive source, 51 hcws enrolled in the study and 44 (86%) elected to undergo peginterferon alfa-2b as the study group. seven subjects who elected not to undergo pep were treated as the control group. in this pilot study, peginterferon alfa-2b was proven to be safe without serious adverse rural residents with contact with bats (organ transplantation) dietzschold and koprowski (2004) and kusne and smilack (2005) effects. however, the lack of hcv transmission in both the study and control groups did not support the routine use of pep in health-care workers after hcv exposure (corey et al., 2009) . it is likely that the new polymerase and protease inhibitors used in the treatment of hcv infection will result in new strategies for pep of hcv exposures. blood-borne viruses can also be transmitted from healthcare workers to patients, especially during exposure-prone procedures in dental and cardiothoracic operations. the most well-known example involved an hiv-positive dentist working in florida, usa, who infected five of his patients after performing invasive dental procedures on them . sequencing of the hiv proviral envelope gene showed that the viruses infecting the dentist and the five patients were closely related . however, the overall risk for transmission of hiv from a health-care worker to a patient is very small. in a study conducted by the centers for disease control and prevention (cdc) of 22 171 patients being cared by 51 hiv-positive health-care workers, 113 (0.5%) patients became hiv positive. epidemiologic investigation did not implicate health-care workers as the source of infection in any of these patients (robert et al., 1995) . in contrast, transmission of hbv and hcv from health-care workers to patients was more frequently documented. between august 1991 and july 1992, 19 of 144 (13%) patients who were operated on by a thoracic surgeon with acute hbv infection became hbvinfected. sequencing of 160 bases in the core region of hbv showed an indistinguishable pattern among the strains of the surgeon and nine infected patients (harpaz et al., 1996) . subsequently, numerous health-care worker-to-patient transmissions of hbv and hcv were reported. among all these reported cases, the viral loads of the index health-care workers were more than 10 6 genome copies per ml (buster et al., 2003; gunson et al., 2003) . in this connection, the society for healthcare epidemiology of america (shea) issued a guideline for the management of health-care workers who are infected with hiv, hbv, and hcv to impose restriction on different categories of exposure-prone procedures according to the viral load (henderson et al., 2010) . epidemiologically important respiratory viruses such as influenza a virus are predominantly transmitted by the droplet route. by definition, the virus can spread within 1 m from the index case. however, individuals infected with influenza a virus may produce as many as 40 000 droplets of 0.5-12 mm in size and expel them at a velocity of 100 m s à1 upon sneezing (tang et al., 2006) . droplet nuclei of less than 3 mm may suspend in air and do not settle onto the ground (knight, 1980) . therefore, an explosive outbreak with high clinical attack rate as a result of aerosol transmission may occur under special conditions. in a jet airliner with nonfunctioning ventilation system, 72% of 54 passengers developed influenza-like illness within 72 h after being kept on ground for 3 h due to delay in flight time (moser et al., 1979) . as the virus may survive on inanimate surfaces for 12-48 h, and on the surface of hands for 10-15 min (kampf and kramer, 2004; kramer et al., 2006) , influenza virus can be transmitted indirectly by contact with hands from the contaminated environment to the pharyngeal mucosa. symptomatic influenza may develop after intranasal inoculation of 1 tcid 50 of influenza a virus (tellier, 2006) . hand hygiene is always the core component of infection control measures in both community and hospitals to prevent the transmission of influenza a virus. wearing face masks by either the index case as source control or the health-care workers as contacts has shown to be equally effective in the control of nosocomial transmission of pandemic influenza a h1n1 (cheng et al., 2010) . hand hygiene and face masks have been shown to prevent household transmission of influenza virus when implemented within 36 h of the index patient's symptom onset . oseltamivir pep halted an outbreak of pandemic influenza a h1n1 in a secondary school (asiedu-bekoe et al., 2012), but not in nursing homes (van der sande et al., 2014) . prevention of nosocomial transmission of influenza a virus requires multiple actions. early identification of symptomatic cases by direct antigen detection from nasopharyngeal specimens and initiation of droplet precautions by wearing surgical masks, along with staff education, could achieve reductions in nosocomial pandemic influenza to near zero (cheng et al., 2010) , while a similar protocol was also effective in minimizing the risk of nosocomial transmission of avian influenza a/h7n9 virus (cheng et al., 2015) . to ensure hand hygiene compliance, directly observed hand hygiene was adopted to control the spread of respiratory viruses in hospitals (cheng et al., 2010 (cheng et al., , 2007b . alcohol-based hand rub is delivered to every health-care worker and conscious patient once every 2-3 h in the clinical areas, which may further reduce the spread of respiratory viruses. varicella zoster virus (vzv) and measles are predominantly transmitted by aerosols and deposited in distal airways (roy and milton, 2004) . the exact mechanism of airborne transmission remains to be elucidated. however, an early study demonstrated that nosocomial outbreak of vzv occurred even when the index case was strictly isolated in a single room (gustafson et al., 1982) . there was a lack of nosocomial spread of vzv when all index cases were placed in negative pressure airborne infection isolation rooms (anderson et al., 1985) . measles virus can survive in the air for at least 1 h, as shown in an outbreak where three susceptible children who contracted measles were never in the same room with the source patient and one of the three arrived at the office 1 h after the source patient had left (bloch et al., 1985) . a massive community outbreak of measles occurred in a modern suburban elementary school in new york in spring, 1974, when the index case produced 28 secondary cases in 14 different classrooms. the epidemic subsided after two subsequent generations when 60 children had been infected. from estimates of major physical and biologic factors, it was possible to calculate that the index case produced approximately 93 units of airborne infection (quanta) per minute, which was higher than that of patients with laryngeal tuberculosis (riley et al., 1978 (riley et al., , 1962 . early recognition and placement in airborne infection isolation room of index case of vzv and measles may reduce the risk of nosocomial outbreaks. standard and transmission-based precautions are important to prevent the spread of respiratory and gastrointestinal viral infection ( table 3) . some of the respiratory viruses such as respiratory syncytial virus (rsv), parainfluenza virus, and the gastrointestinal viruses, norovirus, and rotavirus are predominantly spread by direct contact. as an illustrative example, rsv is the most frequent cause of nosocomial infection in pediatric wards and causes lower respiratory tract disease in 40% of young children. prolonged shedding of rsv for 3-11 days has been observed in immunocompetent children (hall, 2000) , and the virus can survive on inanimate surfaces for 6 h (kramer et al., 2006) . all these factors contribute to fomite-mediated transmission of rsv in the hospital. the risk of nosocomial rsv transmission was not related to age or underlying disease, but to length of hospitalization (hall et al., 1975) . contact precautions with cohort nursing and wearing gloves and gowns during patient care resulted in a significant reduction in nosocomial transmission of rsv in three consecutive winters (madge et al., 1992) . in another study, the incidence of nosocomial acquisition of rsv was significantly decreased after implementation of wearing gloves and gowns and isolation of cases even though the duration of rsv shedding remained unchanged before and after the intervention (leclair et al., 1987) . for the gastrointestinal viruses, norovirus is the most famous agent to cause outbreaks in the community and hospital. transmission is predominantly by the fecal-oral route. numerous community outbreaks of norovirus have been reported in restaurants, resorts, cruise ships, schools, and nursing homes (arvelo et al., 2012; britton et al., 2014; kuo et al., 2009; lai et al., 2013; wikswo et al., 2011) . the emergence of a new variant of norovirus, genogroup ii, type 4 (gii.4), in australia, europe, and north america associated with increased acute gastroenteritis activity has been reported since 2006 (bruggink and marshall, 2010; hasing et al., 2013; kanerva et al., 2009; yen et al., 2011) . norovirus is a nonenveloped rna virus which is relevantly resistant to common disinfectants. as norovirus is unculturable, feline calicivirus has been used as a surrogate for in vitro and in vivo testing for different preparations of disinfectants (gehrke et al., 2004; lages et al., 2008) . in the who formulation ahr, formula i preparation contains ethanol (80% v/v) which, based on the above studies, may possess reasonable virucidal activity for norovirus when the contact time is prolonged for up to 30 s. successful control of nosocomial outbreaks of norovirus by directly observed hand hygiene has been reported, especially during high-risk nursing care practices such as changing napkins and feeding . a proactive infection control approach with the provision of 'added test' was implemented to prevent the occurrence of nosocomial outbreak when the new variant of norovirus, table 3 infection control measures for transmission-based precautions in resource-poor areas (cheng et al., 2011) . rt-pcr for norovirus was performed as an 'added test' by the microbiology laboratory for all fecal specimens that were requested for bacterial culture, clostridium difficile culture or cytotoxin, and rotavirus antigen detection without a request for norovirus detection. during the study period, almost 50% of newly diagnosed norovirus infections were detected by the added test. timely implementation of infection control measures by single room isolation of index case with strict contact precautions significantly reduced the incidence of hospital-acquired norovirus infection from 131 (baseline) to 16 cases per 1000 potentially infectious patient-days (p < 0.001) (cheng et al., 2011) . disease outbreak such as sars, pandemic influenza, and ebola the outbreak of sars in 2003 was the first emergence of an important human pathogen in the twenty-first century. sars emerged as an outbreak of atypical acute community-acquired pneumonia in late 2002. the epidemic may have started when a bat sars coronavirus jumped into caged palm civets in a wildlife market and became adapted and amplified to jump from civet to human. infected chefs and animal handlers transmitted the adapted virus to health-care workers and then the epidemic became amplified into the community. the epidemic was rapidly and globally disseminated when a 'super-spreader' of sars, who was a medical professor from a teaching hospital in guangzhou, went to hong kong on 21 february 2003. during his stay in hotel m, he transmitted sars-cov to other residents, and the secondary cases spread the disease to hospitalized patients in hong kong, and to other countries including vietnam, singapore, and canada. eventually, a total of 8096 patients were infected in over 30 countries among five continents and 774 (9.5%) of them died (cheng et al., 2007a) . nosocomial outbreaks were reported in many parts of the world including toronto, hong kong, guangzhou, kaohsiung, singapore, and vietnam during the sars epidemic. there were a total of 716 secondary and tertiary cases of sars as a result of the admission of infected index patients. health-care workers constituted 410 (52.3%) of the secondary and tertiary cases (cheng et al., 2013) . as there were no known effective antiviral agents or vaccine for the treatment and prevention of sars, infection control measures and extensive tracing to quarantine the contact person became the most important interventions for sars control. the longitudinal follow-up of sars patients revealed that the viral load gradually increased on day 5 after symptom onset and peaked at day 10. early isolation of source patients can prevent ongoing transmission of sars in the community. in hospitals, temporary suspension of clinical services in both inpatient and outpatient settings was adopted (gopalakrishna et al., 2004; liu et al., 2006; nishiura et al., 2005; reynolds et al., 2006) , while home quarantine of health-care workers who had contact with sars patients was also mandated in some centers (dwosh et al., 2003) . provision of personal protective equipment (ppe) such as n95 respirators, gloves, gowns, and goggles, and placement of suspected or confirmed cases of sars in airborne infection isolation rooms were enforced when resources were available. the appropriate use of ppe was also important for staff protection. many health-care workers apparently lacked a clear understanding of how best to remove ppe without contaminating themselves. little information about the appropriate sequence of removing ppe was available at that time (puro and nicastri, 2004) . infection control measures are particularly important for emerging viral infections without effective antiviral therapy and vaccine. recently, the largest outbreak of ebola virus disease (evd) in west africa (guinea, sierra leone, liberia, nigeria, and équateur province of democratic republic of the congo) resulted in a total of 21 724 cases and 8641 deaths as of 21 january 2015. ebola virus is transmitted via contact with contaminated body fluid or the contaminated environment, and therefore the practice of contact precautions with appropriate ppe is of utmost importance when handling suspected or confirmed evd cases. health-care workers should preferably work in pairs so as to mutually observed against lapses in infection control measures. they are required to put on the ppe in the following sequence: n95 respirator, water-repellent cap or hood, fulllength shoe cover or boot, water-resistant gown, face shield, and finally long nitrile gloves. if the patient has hemorrhagic symptoms, double nitrile gloves should be worn. in view of the high virulence and mortality, patients suspected to have evd should be isolated in airborne isolation rooms, although the who allows cohorted nursing in designated areas with dedicated instruments, where access should be restricted in developing countries with limited isolation facilities. degowning remains the most critical procedure for healthcare workers. the most contaminated ppe should be removed first, starting with the long nitrite gloves, water-resistant gown, full-length shoe cover or boot, face shield, water-repellent cap or hood, and finally n95 respirator. hand hygiene with alcohol-based hand rub should be performed in each step of degowning. when the hand is visibly soiled, it should be washed with soap and water. health-care workers must be well trained and audited for the proper procedure of gowning and degowning. when the suspected or confirmed case of evd dies, the health-care and mortuary workers are required to wear ppe as described above. the dead body is placed in double bags with leak-proof characteristic of no less than 150 mm thick. absorbent material should be put under the body and placed in the first bag. the surface of each body bag is wiped with 10 000 ppm sodium hypochlorite solution. the bags are sealed and labeled with the indication of highly infectious material (category 3) and moved to the mortuary immediately. viewing in funeral parlor, embalming and hygienic preparation are not allowed. the dead body should not be removed from the body bag and should be sent to cremation as soon as possible. in august 2014, who declared the evd outbreak in west africa a public health emergency of international concern. preparedness and response plans were made available by health authorities in nearly all countries worldwide. the aim was to detect the first imported case for early isolation in order to prevent local transmission in the community and healthcare settings. therefore, risk assessment at ports, emergency rooms, and outpatient clinics for any patient fulfilling both clinical and epidemiological criteria for evd is important. for the clinical definition, patient suffering from elevated body temperature or subjective fever or symptoms including severe headache, fatigue, muscle pain, vomiting, diarrhea, abdominal pain, or unexplained hemorrhage should be alerted, while the epidemiological definition includes close contact with a confirmed or probable case of evd or residence in or history of travel to an affected area or countries (guinea, liberia, sierra leone) within 21 days before symptom onset. for health-care workers working in volunteer medical services or nongovernment organizations, who have had direct contact with patients in the affected areas or countries, should also perform medical surveillance or be placed in quarantine for at least 21 days after leaving the affected areas or countries. medical evaluation should be sought promptly if there are any symptoms of fever, diarrhea, vomiting, or bleeding during quarantine or medical surveillance. with reference to the experience in the community spread of pandemic influenza a virus infection, nonpharmacological interventions with social distancing, such as school closures, have been evaluated in previous modeling and epidemiological studies (bell et al., 2009; bootsma and ferguson, 2007; ferguson et al., 2006; markel et al., 2007) . during the influenza pandemic in 2009, school closures were practiced in the usa and australia (borse et al., 2011; effler et al., 2010) , because school closures were associated with a 65% reduction in the mean total number of contacts for each student as reported in a retrospective questionnaire survey in the united kingdom (jackson et al., 2011) . in hong kong, kindergartens and primary schools were closed when local transmission of influenza a virus was identified in 2009, followed shortly afterward by secondary school closures for summer vacations. influenza a virus transmission was estimated to be reduced by 25% (wu et al., 2010) . home quarantine was also shown to reduce the incidence of pandemic influenza a in the workplace (miyaki et al., 2011) . in fact, home quarantine has been used to control the community spread of sars in beijing, taiwan, singapore, and toronto (centers for disease control and prevention (cdc), 2003; cava et al., 2005; hsu et al., 2006) . home quarantine can be considered for the control of the spread of ebola virus in affected countries although in resource-limited settings effectively implementing these strategies can be challenging. the local government and health authorities have already implemented home quarantine for 3 days as an urgent infection control measure. however, if it is technically and politically feasible, home quarantine may be extended for up to 21 days (one incubation period) for ebola virus disease. however, public health staff is expected to face unprecedented challenges in implementing an extensive quarantine policy, as they have a dual role of monitoring compliance and providing support to people in quarantine. countries in close proximity to the affected areas require implementing border control measures to screen for any suspected case of ebola virus or even considering closing the border for 21 days. although these measures may adversely affect international travel and local economies, it may be worthwhile to implement such strict measures to control this reemerging infectious disease with high mortality and psychological fear in a timely manner. currently available antivirals against influenza a include the adamantanes (amantadine and rimantadine), neuraminidase inhibitors (oseltamivir, zanamivir, and peramivir) and a pyrazinecarboxamide derivative (favipiravir). only the neuraminidase inhibitors and pyrazinecarboxamide derivatives are active against currently circulating influenza a viruses. oseltamivir and favipiravir are available orally. zanamivir is available either as a dry powder that is delivered by oral inhalation or recently, intravenous formulation is available. peramivir is only available in the intravenous formulation. randomized controlled trials in patients with seasonal influenza suggested that the use of neuraminidase inhibitor can shorten the duration of illness by approximately 1 day. a recent meta-analysis had demonstrated that early neuraminidase inhibitor treatment (within 2 days of symptom onset) was associated with a reduction in mortality (muthuri et al., 2014) . two prospective clinical trials have demonstrated that treatment with convalescent plasma or hyperimmune intravenous immunoglobulin for patients with severe influenza infection was associated with lower viral load, cytokine level, and reduced mortality . clinical trials on various antiviral treatments against evd are underway. these agents include bcx4430 (a novel nucleoside analog) (julander et al., 2014) , brincidofovir, favipiravir, tkm-ebola, and zmapp (a chimeric monoclonal antibody) in guinea, sierra leone, and liberia (bishop, 2015) . when there is no highly effective antiviral for the treatment of a severe viral illness, especially in patients at the extremes of age or with medical comorbidities, and infection control measures are difficult to implement or comply with, vaccination is the final option to prevent massive outbreaks. influenza vaccine is the most widely used annual vaccine in the community and health-care setting to protect at risk or any person to develop influenza-related complications and prevent institutional outbreaks. seasonal influenza-related excess hospitalization and death were estimated to be 10 000 and 1100 per year, respectively, in hong kong, a subtropical city (chiu et al., 2002; wong et al., 2004 wong et al., , 2006 . in a meta-analysis assessing influenza vaccine efficacy and effectiveness in elderly patients, the inactivated influenza vaccine could reduce the risk of hospitalization as a result of pneumonia by 21-38%, and cardiovascular disease by 18-30%, and all cause of mortality by 39-56% (nichol, 2008) . control of virus disease outbreak by vaccination is particularly valuable for exposed individuals, when the viral diseases have a long enough incubation period so that the exposed individuals have sufficient time to develop protective immune responses before symptomatic disease set in. measles (incubation period of 7-18 days), mumps (incubation period of 12-25 days), rubella (incubation period of 14-23 days), and varicella (incubation period of 10-21 days) are relevant examples. reactive vaccination for measles outbreak has been shown to be an effective measure to reduce the scale of outbreaks. in the democratic republic of congo, weekly reported cases reduced respectively by 89.3% and 68.9% in the 3 weeks following mass vaccination campaigns (alberti et al., 2010) . similarly, nationwide mass vaccination interrupted the transmission of paralytic poliomyelitis in albania. in 1996, a total of 138 paralytic cases occurred with an attack rate of 10 per 100 000 population among adults aged 19-25 years. the epidemic was controlled by two rounds of mass vaccination with trivalent oral poliovirus vaccine targeted to persons aged 0-50 years (prevots et al., 1998) . while routine laboratory diagnostic tests and specific antimicrobial agents are generally available for the treatment of bacterial, fungal, and parasitic infections, we are just entering the stage when rapid nucleic acid tests and a greater array of antiviral agents are available for tackling viral infections. the broad array of viruses worldwide causes substantial morbidity and mortality, ranging from respiratory viruses, arthropod-related viruses, to the most deadly blood-borne viruses. novel emerging or reemerging viruses are causing major epidemics from time to time especially in densely populated areas where human populations have close contact with wild animals (wildlife markets) and food animals (wet markets and abattoirs). such epidemics such as the ebola virus disease can be explosive in countries with failed governance and poor health infrastructures. currently, there is a lack of antiviral treatment for most of these infections. therefore, prevention by implementing effective infection control and vaccination is of utmost importance to contain these viruses. see also: arboviruses; hiv safety guidelines; hepatitis, viral; influenza; measles; mumps; rabies; respiratory syncytial virus; rubella. reactive vaccination as an effective tool for measles outbreak control in measles mortality reduction settings lack of nosocomial spread of varicella in a pediatric hospital with negative pressure ventilated patient rooms norovirus outbreak of probable waterborne transmission with high attack rate in a guatemalan resort mass oseltamivir prophylaxis halts pandemic influenza a h1n1 2009 outbreak in a secondary school in ashanti region pandemic influenza as 21st century urban public health crisis potential and emerging treatment options for ebola virus disease measles outbreak in a pediatric practice: airborne transmission in an office setting the effect of public health measures on the 1918 influenza pandemic in u.s. cities closing schools in response to the 2009 pandemic influenza a h1n1 virus in new york city: economic impact on households norovirus outbreak at a wildland fire base camp ignites investigation of restaurant inspection policies doctor to patient transmission of hepatitis b virus: implications of hbv dna levels and potential new solutions the experience of quarantine for individuals affected by sars in toronto clinical management and infection control of sars: lessons learned severe acute respiratory syndrome coronavirus as an agent of emerging and reemerging infection outbreak of human metapneumovirus infection in psychiatric inpatients: implications for directly observed use of alcohol hand rub in prevention of nosocomial outbreaks successful control of norovirus outbreak in an infirmary with the use of alcohol-based hand rub prevention of nosocomial transmission of swine-origin pandemic influenza virus a/h1n1 by infection control bundle infection control preparedness for human infection of influenza a h7n9 in hong kong prevention of nosocomial transmission of norovirus by strategic infection control measures influenza-related hospitalizations among children in hong kong transmission of human immunodeficiency virus in a dental practice pilot study of postexposure prophylaxis for hepatitis c virus in healthcare workers facemasks and hand hygiene to prevent influenza transmission in households: a cluster randomized trial efficiency of quarantine during an epidemic of severe acute respiratory syndrome-beijing, china hepatitis b vaccine in health care personnel: safety, immunogenicity, and indicators of efficacy rabies transmission from organ transplants in the usa identification and containment of an outbreak of sars in a community hospital household responses to pandemic (h1n1) 2009-related school closures ebola virus: from discovery to vaccine strategies for mitigating an influenza pandemic long-term persistence of anti-hbs after vaccination against hbv: an 18 year experience in health care workers guideline for isolation precautions in hospitals. part i. evolution of isolation practices, hospital infection control practices advisory committee inactivation of feline calicivirus, a surrogate of norovirus (formerly norwalk-like viruses), by different types of alcohol in vitro and in vivo clinical features of nipah virus encephalitis among pig farmers in malaysia isolation and characterization of viruses related to the sars coronavirus from animals in southern china hepatitis b virus (hbv) and hepatitis c virus (hcv) infections in health care workers (hcws): guidelines for prevention of transmission of hbv and hcv from hcw to patients an outbreak of airborne nosocomial varicella nosocomial respiratory syncytial virus infections: the "cold war" has not ended nosocomial respiratory syncytial virus infections isolation of hendra virus from pteropid bats: a natural reservoir of hendra virus transmission of hepatitis b virus to multiple patients from a surgeon without evidence of inadequate infection control emergence of a new norovirus gii.4 variant and changes in the historical biennial pattern of norovirus outbreak activity in alberta shea guideline for management of healthcare workers who are infected with hepatitis b virus, hepatitis c virus, and/or human immunodeficiency virus identification and molecular characterization of hendra virus in a horse in queensland confidence in controlling a sars outbreak: experiences of public health nurses in managing home quarantine measures in taiwan convalescent plasma treatment reduced mortality in patients with severe pandemic influenza a (h1n1) 2009 virus infection hyperimmune iv immunoglobulin treatment: a multicenter double-blind randomized controlled trial for patients with severe school closures and student contact patterns bcx4430, a novel nucleoside analog, effectively treats yellow fever in a hamster model epidemiologic background of hand hygiene and evaluation of the most important agents for scrubs and rubs prolonged norovirus outbreak in a finnish tertiary care hospital caused by gii.4-2006b subvariants viruses as agents of airborne contagion how long do nosocomial pathogens persist on inanimate surfaces? a systematic review updated us public health service guidelines for the management of occupational exposures to human immunodeficiency virus and recommendations for postexposure prophylaxis a non-foodborne norovirus outbreak among school children during a skiing holiday transmission of rabies virus from an organ donor to four transplant recipients in-vivo efficacy of hand sanitisers against feline calicivirus: a surrogate for norovirus a norovirus outbreak in a nursing home: norovirus shedding time associated with age severe acute respiratory syndrome coronavirus-like virus in chinese horseshoe bats prevention of nosocomial respiratory syncytial virus infections through compliance with glove and gown isolation precautions immunization with high-dose intradermal recombinant hepatitis b vaccine in healthcare workers who failed to respond to intramuscular vaccination epidemiologic study and containment of a nosocomial outbreak of severe acute respiratory prospective controlled study of four infection-control procedures to prevent nosocomial infection with respiratory syncytial virus nonpharmaceutical interventions implemented by us cities during the 1918-1919 influenza pandemic an effective quarantine measure reduced the total incidence of influenza a h1n1 in the workplace: another way to control the h1n1 flu pandemic an outbreak of influenza aboard a commercial airliner efficacy and effectiveness of influenza vaccination rapid awareness and transmission of severe acute respiratory syndrome in hanoi french hospital, vietnam. am molecular epidemiology of hiv transmission in a dental practice outbreak of paralytic poliomyelitis in albania, 1996: high attack rate among adults and apparent interruption of transmission following nationwide mass vaccination sars and the removal of personal protective equipment factors associated with nosocomial sars-cov transmission among healthcare workers in hanoi airborne spread of measles in a suburban elementary school infectiousness of air from a tuberculosis ward. ultraviolet irradiation of infected air: comparative infectiousness of different patients investigations of patients of health care workers infected with hiv. the centers for disease control and prevention database airborne transmission of communicable infection-the elusive pathway timing of hepatitis b vaccination: its effect on vaccine response in health care workers occupational deaths among healthcare workers anti-hepatitis b core antibody is not required for prevaccination screening in healthcare workers seroconversion after additional vaccine doses to non-responders to three doses of intradermally or intramuscularly administered recombinant hepatitis b vaccine. scand effectiveness of postexposition prophylaxis with oseltamivir in nursing homes: a randomised controlled trial over four seasons factors involved in the aerosol transmission of infection and control of ventilation in healthcare premises review of aerosol transmission of influenza a virus updated u.s. public health service guidelines for the management of occupational exposures to hbv, hcv, and hiv and recommendations for postexposure prophylaxis disease transmission and passenger behaviors during a high morbidity norovirus outbreak on a cruise ship influenza-associated mortality in hong kong influenza-associated hospitalization in a subtropical city school closure and mitigation of pandemic (h1n1) impact of an emergent norovirus variant in 2009 on norovirus outbreak activity in the united states key: cord-267709-i2loz1xb authors: li, tongya; ke, zunlong; liu, weiyong; xiong, ying; zhu, ying; liu, yingle title: human hepatitis b virus core protein inhibits ifnα-induced ifitm1 expression by interacting with baf200 date: 2019-05-09 journal: viruses doi: 10.3390/v11050427 sha: doc_id: 267709 cord_uid: i2loz1xb human hepatitis b virus core protein (hbc) is a structural protein of the hepatitis b virus (hbv) and contributes to hbv regulation of host-cell transcription. however, the mechanisms of transcriptional regulation remain poorly characterized. to dissect the function of hbc, a yeast two-hybrid was performed to identify hbc-binding proteins, and the c-terminal of brg1/hbrm-associated factors 200 (baf200c) was identified. then, the existence of hbc interactions with baf200c and full-length baf200 was confirmed via co-immunoprecipitation assays in 293t, hepg2 and hepg2-ntcp cells. furthermore, we show that the binding between hbc and baf200 was of vital importance to hbc mediated downregulation of interferon-induced transmembrane protein 1 (ifitm1) expression, and the mechanisms for the downregulation were disclosed as follows. basal level of ifitm1 expression depends on baf200, rather than the jak–stat1 pathway. the interaction of hbc with baf200 disturbs the stability of the polybromo-associated baf (pbaf) complex and results in the suppression of iftm1 transcription. finally, the antiviral effects of ifitm1 on cell proliferation and hbv replication were found to be partially restored when hbc was co-transfected with baf200. collectively, our findings indicate that hbc plays a role in hbv resistance against the antiviral activities of ifnα, providing details about hbv evasion of host innate immunity. the human hepatitis b virus (hbv) is a double stranded dna virus in the hepadnaviridae family [1] . hbv infection could cause acute and chronic hepatitis b (chb), which can progress to cirrhosis and hepatocellular carcinoma, leading to high mortality rates worldwide. antiviral therapy with interferon aims to induce permanent immune control of hbv infection through stimulation of the hosts' innate immune response. nevertheless, experimental data from hbv infected chimpanzees and urokinase-type plasminogen activator/severe combined immunodeficiency (upa-scid) mice have shown that hbv infection does not induce an intrahepatic innate immune response that can be detected [2, 3] . this is because early in infection it acts like a stealth virus, remaining undetected and spreading until the onset of the adaptive immune response several weeks later [4] . besides acting as a stealth pathogen, recent developments have shown that hbv can avoid recognition by the host innate immune system. however, the precise mechanisms are largely unknown. human hepatitis b virus core protein (hbc) is 183 amino acids in length and dimeric in solution [5] . hbc dimers assemble into t = 4 (120 copies) or t = 3 (90 copies) capsids of hbv, with t = 4 capsids being the predominant form in vivo [6] . hbc is composed of an assembly domain (aa 1-149) and a nucleic acid-binding domain (aa 150-183) (figure 1a) , moreover, it not only acts as a structural protein of hbv, but also works as an essential regulator in viral replication [5, 7] . the nucleic acid-binding harbors a nuclear localization sequence (nls), which mediates the transport of hbc into the nucleus [7, 8] . in vitro studies have shown that hbc binds directly to the covalently closed circular dna (cccdna) upon entering the nucleus, such as the camp response element of hbv, enh i [9] , and the nuclear factor kappa b binding site of hbv, enh ii [10] , to regulate hbv transcription. in addition, hbc appears to regulate the activities of host cells by interacting directly with the host genome [11] . however, the details of hbc function in host transcriptional regulation are not well understood. human swi/snf (mating-type switching (swi) and sucrose non-fermenting (snf)) complexes regulate the expression of numerous interferon (ifn)-inducible genes by mediating atp-dependent chromatin remodeling, exposing the binding sites to the transcriptional machinery. swi/snf complexes are critical for proliferation, differentiation, tumorigenesis, and dna repair [12] . there are two forms of swi/snf complexes: brg1/hbrm-associated factors (baf) and polybromo-associated baf (pbaf). only pbaf can facilitate the ligand-dependent transcriptional activation by interacting with the nuclear receptors [13] . baf and pbaf complexes share most of their subunits and are distinguished by the presence of two specific subunits-baf180 and baf200-both of which only exist in pbaf [14] . furthermore, baf200, but not baf180, is essential for the stability of pbaf, and the depletion of baf200 leads to the complete inactivation of pbaf [13] . baf200 is encoded by arid2. besides the n-terminal at-rich interactive domain (arid), baf200 contains multiple lxxll motifs, which have been shown to participate in the regulation of protein-protein interaction [15] . additionally, baf200 has been reported to be a potential tumor suppressor and involved in the ifn signal pathway [16] . ifns are essential components of the innate immune response and act as the first line of defense against invading microorganisms or pathogens. interestingly, hbv escapes the host innate immune response merely by preventing the induction of ifns [17] . ifns modulate host defenses against microbial infection through the induction of ifn-stimulated genes (isgs) by the janus kinase (jak)-signal transducer and activator of transcription (stat) signaling pathway. among these isgs, interferon-induced transmembrane protein (ifitm) 1, 2, and 3, which are a cluster of genes encoding membrane proteins, exhibit antiviral capabilities mainly through the inhibition of virus entry [18] . ifitm1 restricts the infection of various viruses, including type 1 human immunodeficiency virus [19] , hepatitis c virus [20] , severe acute respiratory syndrome (sars) coronavirus [21] , and influenza a virus [21, 22] . however, whether ifitms inhibit hbv infection has not been reported. in this study, we start with the discovery that hbc can interact with baf200. then, we focus on functions of the interaction and disclose that overexpressed hbc downregulates the baf200-dependent expression of ifitm1 via disruption of pbaf complex stability. finally, our data demonstrates that the antiviral effects of ifitm1 on cellular proliferation and hbv replication are partially restored when hbc is co-expressed with baf200 in hbv-infected cells. these findings enrich details about how hbv counteracts human natural immunity, revealing a potential target for novel therapeutic strategies of hbv infection. baf200c (4255-5319 nt of arid2) was amplified from the fragment screened by the yeast two-hybrid system using primers-sense, 5'-gatccatggcaaactcgacggggaa-3' and antisense, 5'-aattctcactgcagcatttctga-3'-and inserted into a pcmv-flag vector (stratagene, san diego, ca, usa). baf200 (full-length arid2) and hbc cdnas (taxonomy id: 489463) were synthesized by genscript co. ltd. (nanjing, china). pgc-fu-flag and the phbv1.31 vector were kindly gifted by prof. r xiang (xiangya school of medicine of central south university, china). the pgc-fu-flag vector was ligated and constructed with baf200 at restriction enzyme site agei. the full-length of hbc was cloned into the pgbkt7 (clontech, clontech laboratories, inc., mountain view, ca, usa) vector with primers-sense, 5'-acttccagacttctagggagac-3' and antisense, 5'-ctgccctgtgacggaattga-3'-and cloned into the pcmv-ha vector (clontech) with primers-sense, 5'-gatccatggacattgaccactataaa-3' and antisense, 5'-tcgacctaacattgagattcccgaga-3'. the matchmaker gal4 two-hybrid system 3 (clontech) was used for the screening of a human fetal brain cdna library (clontech) with pgbkt7-hbc as bait. co-transformants were selected on synthetic dropout (sd), media lacking leucine, and tryptophan (sd/-leu/-trp) and were validated by growth on sd, media lacking leucine, tryptophan, adenine, and histidine (sd/-leu/-trp/-ade/-his) and containing 5-bromo-4-chloro-3-indolyl-α-d-galactoside (x-α-gal). then, positive colonies were sequenced (invitrogen, carlsbad, ca, usa). hepg2 cells and 293t cells, purchased from cctcc, were cultured in dulbecco's modified eagle medium (dmem, gibco, thermo fisher scientific, waltham, ma, usa), supplemented with 10% (v/v) fetal bovine serum ((fbs, gibco), 1% penicillin and 0.1 mg/ml streptomycin in a humidified incubator maintained at 37 • c with 5% co 2 . hepg2.2.15 cells, obtained from prof. r xiang, were cultured in 1640 medium (gbico) in the presence of g418 (200 µg/ml, sigma-aldrich, st. louis, mo, usa) in a humidified incubator maintained at 37 • c with 5% co 2 . hepg2-ntcp cells and hepaad38 cells, provided by prof. y zhu (wuhan university, china), were cultured in dmem (gibco), supplemented with 10% heat-inactivated fetal calf serum (gibco), 100 u/ml penicillin, and 100 µg/ml streptomycin sulfate at 37 • c in 5% co 2 . all the transfection reactions were performed on indicated cells (2 × 10 6 ) in log phase, using lipofectamine 2000 (invitrogen) according to the manufacturer's protocol. co-transfection was performed using a total of 5 µg of plasmids or vectors in a 1:1 (w/w) ratio: the pcmv-ha-hbc or pcmv-ha vectors were co-transfected with pcmv-flag-baf200c or pgc-fu-flag-baf200 into indicated cells. the medium was refreshed with serum-free dmem/1640 6 h after transfection. the supernatant was harvested 36 h post incubation for co-immunoprecipitation or western blot analyses. the supernatants of hepaad38 cells were concentrated 100-fold by ultracentrifugation as hbv inoculums. hbv stock titer (genome equivalents [geq] per milliliter) was measured by using qpcr. for infection, hepg2-ntcp cells of a low passage number were seeded onto precooling collagen i-coated plates and incubated in dmem for 6 h, then the medium was replaced by primary hepatocyte maintenance medium (pmm) with 2% fbs (gibco) for 12 h. after this, cells were infected with 1000 geq per cell of hbv in pmm containing 4% (w/v) polyethylene glycol 8000 (peg 8000) for 16 h. after the virus-containing medium was removed, cells were washed several times and cultured in fresh pmm. the medium was changed every other day [23, 24] . pmm is williams' e medium supplemented with an insulin-transferrin-selenium solution (thermo, waltham, ma, usa), 10 ng/ml of human epidermal growth factor (egf, peprotech, rocky hill, nj, usa), 2 mm l-glutamine (thermo), 18 µg/ml of hydrocortisone, 2% dimethyl sulfoxide (dmso), 40 ng/ml of dexamethasone, 100 µg/ml of streptomycin, and 100 u/ml of penicillin. after transfection, cells were washed with ice-cold pbs after 36 h, harvested by scraping, then lysed using an ripa lysis buffer (50 mm tris-hcl [ph 7.4], 150 mm nacl, 1% np40, 0.1% sds) supplemented with a protease inhibitor cocktail (thermo scientific). after centrifugation at 13,000 rpm at 4 • c for 5 min, supernatants were incubated with primary antibody or igg (santa cruz, santa cruz, ca, usa) and protein g agarose beads (ge healthcare, chicago, il, usa) at 4 • c overnight. immunoprecipitates were washed with a washing buffer (50 mm tris-hcl [ph 7.4], 150 mm nacl) three times, then whole cell lysate and immunoprecipitated fractions were used for western blot analysis. the following primary antibodies were used: anti-ha (catalog no. h6908, sigma-aldrich), anti-flag (catalog no. f1804, sigma-aldrich), anti-baf200 (catalog no. a302-230a, bethyl), anti-hbc (catalog no. b0586, dako). in order to make sure the loading amounts of the protein were comparable, the protein concentration was quantified by bradford assay [25] . thirty micrograms of protein was separated by sds polyacrylamide gel electrophoresis and then transferred to polyvinylidene difluoride (pvdf, thermo scientific) membranes. after blocking with 5% gelatin in tbst, the membranes were incubated with the indicated primary antibodies at 4 • c overnight. the membranes were washed three times, incubated with secondary antibodies (1:8000) conjugated with horseradish peroxidase (hrp) for 1 h at room temperature, and visualized with the ecl system (biorad, hercules, ca, usa) according to manufacturer's instructions. blots were probed with hrp-conjugated secondary antibodies. the following antibodies were used: anti-ifitm1, 2, 3, (catalog no.13126, 13530, 59212, cell signaling technology, danvers, ma, usa), anti-baf180 (catalog no. a301-591a, bethyl), anti-stat1 (catalog no. 9172, cell signaling technology), and anti-phospho-stat1 (catalog no. 9167, cell signaling technology), and β-actin (catalog no. 60008-1-ig, proteintech group). the gray density of the western blots was measured by using imagej software (national institutes of health, bethesda, md, usa). rt-pcr assays were performed to determine the relative mrna levels. total rna was extracted by trizol (invitrogen) according to the manufacturer's instructions. the quantity of the rna samples was detected by nanodrop 2000 (thermo scientific). one microgram of rna was reverse transcribed using random hexamer primers (fermentas, waltham, ma, usa) and m-mulv reverse transcriptase. the levels of ifitms mrna and intracellular hbv genomic dna were determined by rt-qpcr analysis using sybr green premix (takara, tokyo, japan) on a lightcycler®480ii (roche, basel, switzerland) system. the expression of the target genes was normalized to glyceraldehyde 3-phosphate dehydrogenase (gapdh) by the ∆∆ct method. β-actin was used as control. primers were as follows: ifitm1, forward: 5'-ccccaaagccagaagatgcacaaggag-3', reverse: 5'-cgtcgccaaccatcttcctgtccctag-3'; ifitm2, forward: 5'-catcatcatcccagtgttgg-3', reverse: 5'-gataaagggctgatgcagga-3'; ifitm3, forward: 5'-caaggaggagcacgagg-3', reverse: 5'-ttgaacagggaccagacg-3'; β-actin, forward: 5'-ctcttccagccttccttcct-3', reverse: 5'-agcactgtgttggcgtacag-3'; gapdh, forward: 5'-gatggcaagatcttctgcgtg-3', reverse: 5'-ccgtcgactcacaggaaatagtcggc-3'. the sirnas were designed using oligo 6.0 software, and synthesized by genscript co. ltd. (nanjing, china) as follows: siifitm1: sirna1: 5'-aaaccuucacucaacacuuccuu-3', sirna2: 5'-aaacuuaagagaaauacacacuu-3'; sihbc: sirna1: 5'-aaacuuuacugggcuuuauucuu-3', sirna2: 5'-aagagaaacuguccuugaguauu-3'; viruses 2019, 11, 427 5 of 15 sicontrol: 5'-guauauaagcaagcauuacuu-3'. all the sirnas were transfected using rnaimax (invitrogen) according to the manufacturer's instructions. one hundred microliters of hepg2 or hepg2.2.15 cells of the same passage number were seeded into 96-well plates at a density of 2 × 10 3 cells per well. after culturing for 24 h, cells were transfected with pgc-fu-flag vector, sirna, or pgc -fu-flag-baf200 and incubated for 24 h, then treated with 0, 200, 400, 600, 800, or 1000 u/ml ifnα for 24 h. afterwards, cell viability was assessed using the mtt assay. the medium was refreshed and 5 mg/ml 3-(4,5-dimethlthiazol-2-yl)-2,5-diphenyltetrazolium bromide (mtt, sigma-aldrich) was added at 20 µl per well. after incubating for 2 h, the medium was removed, and cells were lysed in 100 µl dmso. finally, absorbance was measured by a microplate reader (thermo scientific) at 490 nm. to ensure the results of the mtt assays, a trypan blue exclusion assay was performed. after the transfection and treatment of ifnα, cells were harvested. then trypan blue (sigma-aldrich) was added to the cell suspension to a final concentration of 0.04% (w/v), and the mixture incubated at room temperature for 5 min. ten microliters of the suspension was transferred to a hemocytometer and viable cells were counted. the test was repeated at least three times. hepg2 cells were transfected with phbv1.31 and pgc-fu-flag-baf200, or together with pcmv-hbc-ha, in a 1:1 ratio. after treatment with ifnα for 72 h, the supernatant was collected to detect the levels of the hepatitis b surface antigen (hbsag) and hepatitis b e antigen (hbeag) using a commercial elisa kit (neobioscience, hangzhou, china) and the hbv dna copy number was quantified by real-time pcr with a commercial pcr-fluorescence quantification kit (bioer, hangzhou, china). for the extraction of the nucleic acid, hepg2 cells were collected at 96 h post-transfection and lysed in a precooling lysis buffer (0.5% np-40, 50 mm tris-hcl [ph 7.0]). after centrifugation at 10,000× g for 1 min, the nuclei were pelleted, and the supernatant was adjusted with 10 mm mgcl 2 and treated with dnase i for 1 h at 37 • c to remove the free dna. the mixture was incubated at 75 • c for 15 min in the presence of 10 mm edta to inactivate the enzymes, then cultured with proteinase k in the presence of 1% sds to digest proteins. at last, the nucleic acids were purified by phenol-chloroform extraction and ethanol precipitation. for the extraction of extracellular encapsidated hbv dna, free dna and enzymes of 10 µl cell culture supernatant were removed according to the methods mentioned above. then, the mixture was added to 100 µl of a lysis buffer (20 mm edta, 20 mm tris-hcl, 0.5% sds, and 50 mm nacl) containing proteinase k and incubated at 50 • c overnight. after this, hbv dna was isolated by phenol-chloroform extraction and ethanol precipitation. hbv dna was subjected to real-time by pcr using primers (5'-agaaacaacacatagcgcctcat-3' and 5'-tgccccatgctgtagatcttg-3') and probe (5'-tgtgggtcaccatattcttggg-3'). data were presented as mean ± standard deviation (sd). all experiments were repeated three times. the statistical analysis was assessed using the student's t-test. differences were considered statistically significant at p < 0.01 (**). to dissect the function of hbc (figure 1a ), we screened a human fetal brain cdna library for novel hbc-interacting proteins using a yeast two-hybrid system. co-transformants were selected on sd/-leu/-trp and were validated by growth on sd/-leu/-trp/-ade/-his/x-α-gal ( figure 1b) . then, positive colonies were sequenced. finally, the c-terminal of baf200 (baf200c, aa 1419-1773) was identified as one of the strongest binding partners of hbc in ah109. baf200c contains znf domains and can bind to dna, rna, or proteins [15] (figure 1a ). because this interaction might play an important role in hbv-infected hepatocytes, our studies focused on the function of hbc interaction with baf200. to verify the two-hybrid results, co-ip assays were performed. first, baf200c was co-transfected with either empty vectors or hbc into 293t cells, then the whole cell lysate was immunoprecipitated by an anti-flag antibody and then subjected to western blot by anti-ha antibodies to detect the interacting proteins. the results indicate that the expressed c-terminal of baf200 co-precipitated with hbc ( figure 1c ). then, hbc interaction with full-length baf200 was further assessed in hepg2 cells. ip was performed against ha-tagged hbc and the co-precipitation was detected with the anti-flag antibody. the data showed that overexpressed baf200 co-precipitated with hbc ( figure 1d ). to investigate the endogenous interaction of baf200 and hbc, hepg2-ntcp cells were infected with or without hbv by inoculation with or without the supernatants of hepaad38 cells. exogenous expression of sodium taurocholate co-transporting polypeptide (ntcp) in human hepg2 cells (hepg2-ntcp) rendered them susceptible to hbv/hdv infection [24] . hepg2-ntcp cells were infected with hbv by inoculation with or without the supernatants of hepaad38 cells [23, 24] . the lysates of hepg2-ntcp cells were immunoprecipitated by hbc antibodies or baf200 antibodies, then subjected to western blot by baf200 antibodies or hbc antibodies to detect the interacting proteins ( figure 1e ). the result indicated that endogenous baf200 also co-precipitated with endogenous hbc, as seen in overexpressed proteins. collectively, the co-ip results confirm the binding between hbc and baf200. and can bind to dna, rna, or proteins [15] (figure 1a ). because this interaction might play an important role in hbv-infected hepatocytes, our studies focused on the function of hbc interaction with baf200. to verify the two-hybrid results, co-ip assays were performed. first, baf200c was cotransfected with either empty vectors or hbc into 293t cells, then the whole cell lysate was immunoprecipitated by an anti-flag antibody and then subjected to western blot by anti-ha antibodies to detect the interacting proteins. the results indicate that the expressed c-terminal of baf200 co-precipitated with hbc ( figure 1c) . then, hbc interaction with full-length baf200 was further assessed in hepg2 cells. ip was performed against ha-tagged hbc and the co-precipitation was detected with the anti-flag antibody. the data showed that overexpressed baf200 coprecipitated with hbc ( figure 1d) . to investigate the endogenous interaction of baf200 and hbc, hepg2-ntcp cells were infected with or without hbv by inoculation with or without the supernatants of hepaad38 cells. exogenous expression of sodium taurocholate co-transporting polypeptide (ntcp) in human hepg2 cells (hepg2-ntcp) rendered them susceptible to hbv/hdv infection [24] . hepg2-ntcp cells were infected with hbv by inoculation with or without the supernatants of hepaad38 cells [23, 24] . the lysates of hepg2-ntcp cells were immunoprecipitated by hbc antibodies or baf200 antibodies, then subjected to western blot by baf200 antibodies or hbc antibodies to detect the interacting proteins (figure 1e ). the result indicated that endogenous baf200 also co-precipitated with endogenous hbc, as seen in overexpressed proteins. collectively, the co-ip results confirm the binding between hbc and baf200. hbc-interacting partners were tested for β-galactosidase activity on an sd/-leu/-trp/-ade/-his/x-α-gal plate. vector: pgadt7; positive control: pgbkt7-53 and pgadt7-t co-transformant; negative control: pgbkt7-lam and pgadt7-t transformant. (c) 293t cells were co-transfected with pcmv-flag-baf200c and pcmv-ha vector or pcmv-ha-hbc, and co-ip assays were performed with anti-flag antibody or control igg. immuno-complexes were detected by western blot assays using the anti-ha antibody or anti-flag antibody (control). (d) hepg2 cells were co-transfected with the pgc-fu-flag-baf200 and pcmv-ha vectors or pcmv-ha-hbc, and co-ip assays were carried out with anti-ha antibody or igg. immuno-complexes were detected by western blot assays using the anti-flag antibody or anti-ha antibody (control). (e) hepg2-ntcp cells were incubated with supernatants isolated from the supernatants of hepaad38 cells cultures (containing hbv) at 1000 geq for 16 h or not (mock). co-ip assays were performed with hbc antibody or baf200 antibody, immuno-complexes were detected by western blot assays using baf200 antibody or hbc antibody. input control assays were performed in whole cell lysates (wcl). because baf200 was reported to be a critical regulator of ifn signaling [13] , we first focused on the effect of baf200 on the expression of ifitms, which are ifnα effectors. the impact of overexpressed baf200 on ifitm1, 2, and 3 was examined via protein ( figure 2a ) and mrna (figure 2b ) levels. the results demonstrated that baf200 up-regulated ifitm1 protein expression (figure 2a) and significantly increased the mrna expression ( figure 2b ). however, no apparent effect of baf200 was observed on the expression of ifitm2 and ifitm3 (figure 2b) . furthermore, we observed that the ifitm1 expression level was suppressed 2.1-fold when endogenous baf200 was silenced in hepg2 cells (figure 2c) . the data suggest that baf200 specifically mediates basal level expression of ifitm1. next, the effect of the hbc interaction with baf200 on ifitm1 expression was further investigated. we co-transfected hbc and baf200 into hepg2 cells, treated the cells with 500 u/ml ifnα, and detected the expression of ifitm1 by western blot (figure 2d ). the results indicate that baf200 enhanced ifitm1 expression, while the enhancement was partially reduced when hbc was co-transfected. to further examine the effect of ifnα on hbc function, we treated the transfected cells with ifnα at various concentrations from 200 u/ml to 1000 u/ml for 24 h and examined the ifitm1 mrna levels ( figure 2e ). as expected, hbc impaired the enhancement of ifitm1 mrna expression by baf200. however, compared to the control, expression was inhibited to a similar degree upon ifnα stimulation with different concentrations. taken together, the data demonstrates that hbc can down-regulate ifitm1 expression via binding to baf200, whereas the binding is irrelevant to the stimulation of ifnα. ifnα at various concentrations from 200 u/ml to 1000 u/ml for 24 h and examined the ifitm1 mrna levels (figure 2e ). as expected, hbc impaired the enhancement of ifitm1 mrna expression by baf200. however, compared to the control, expression was inhibited to a similar degree upon ifnα stimulation with different concentrations. taken together, the data demonstrates that hbc can down-regulate ifitm1 expression via binding to baf200, whereas the binding is irrelevant to the stimulation of ifnα. furthermore, the mechanism about how hbc regulated ifitm1 expression was explored. since the jak-stat1 signaling pathway has been reported to be essential to ifnα-induced antiviral activities [26] , we examined whether it was involved in baf200-mediated ifitm1 expression. since the phosphorylation of stat1 is a necessary step for jak-stat1 signaling, we used western blot assays to detect phosphorylated stat1 (pstat1) in hepg2 cells with or without baf200 (figure 3a) . the results showed that pstat1 appeared only upon ifnα stimulation, independent of the presence of baf200. it has been shown that baf200 is essential for the stability of pbaf, and the depletion of baf200 leads to the complete inactivation of pbaf [13] . hence, we predicted that the interaction of hbc with baf200 would interrupt the stability of pbaf complexes, leading to potential baf200-dependent ifitm1 expression. to verify this hypothesis, co-ip assays were carried out to analyze the effect of hb on baf180-baf200 immuno-complexes in hepg2 cells (figure 3b) . ip was performed against flag-baf200 and the co-precipitation of baf180 was probed. it demonstrated that hbc co-transfection along with baf200 profoundly reduced the co-precipitation of baf180-baf200 immuno-complexes when compared with the baf200 transfected alone condition. endogenous baf180-baf200 interaction was further assessed in hbv infected hepg2-ntcp cells (figure 3e) . the co-ip assay showed that the concentration of baf180-baf200 complexes was reduced more than 50-fold compared to the non-infected mock control. these results imply that hbc de-stabilizes the pbaf complex by preventing the baf180-baf200 interaction, probably by competitive binding to baf200. we next determined whether overexpression of hbc regulated ifitm1 transcription in vitro. flag-baf200 was transfected with or without ha-hbc into hepg2 cells. cells were later treated with ifnα (500 u/ml) and total mrna was extracted to detect transcription levels of ifitm1, 2, and 3 by rt-qpcr. the data indicates that, upon ifnα stimulation, the suppression of ifitm1 expression by hbc is specific (figure 3c ) and statistically significant (figure 3d ) in vitro. collectively, the data demonstrates that hbc interacts with baf200, and the hbc-baf200 interaction prevents the baf180-baf200 interactions that might abolish pbaf complex stability, which in turn regulates the suppression of ifitm1 transcription. the pcmv-flag vector and pcmv-flag-baf200 were transfected into hepg2 cells, with or without ifnα (500 u/ml) treatment for 24 h. phosphorylation of stat1 was detected via western blot using antibodies against phosphorylated stat1 (pstat1). meanwhile, stat1 and baf200 were detected using anti-flag and anti-stat1 antibodies as control. (b) hepg2 cells were co-transfected with pgc-fu-flag-baf200 and pcmv-ha vector or pcmv-ha-hbc, with or without ifnα (500 u/ml) treatment for 24 h. co-ip assays were performed with anti-flag antibody, then baf200-baf180 immuno-complexes were detected by western blot assays using anti-baf180 antibody or anti-flag antibodies (control). input control assays were performed in wcl using anti-ha or anti-baf180 antibodies. meanwhile, total mrna was extracted to examine the effect of baf200 and hbc combination on ifitm1, 2, 3 transcriptions by rt-pcr (c). β-actin was detected as control. ifitm1 transcription level was determined using rt-qpcr and normalized to the gapdh mrna level. (d) the flag-baf200 transfection with ifnα treatment was designated as 1. *, p < 0.05; **, p < 0.01. nd = not detected. (e) hepg2-ntcp cells were incubated with supernatants isolated from the supernatants of hepaad38 cells cultures (containing hbv) at 1000 geq for 16 h or not (mock). co-ip assays were performed with baf200 antibodies, and immuno-complexes were detected by western blot assays using baf180 antibodies or baf200 antibodies. input control assays were performed in wcl using hbc antibody or baf180 antibody. finally, we evaluated the effect of hbc on the antiviral activities of iftim1 in hbv-infected cells. firstly, the impact of hbc on the anti-proliferation action of ifitm1 was investigated via sirnamediated knockdown in hepg2 cells and hepg2.2.15 cells. proliferation of indicated cells was assessed by mtt assays and viable cell counting. indeed, in hepg2 cells and hepg2.2.15 cells, the data from direct cell counting were consistent with those obtained from mtt assays (figure 4a, 4c, 4d, 4e) . in hepg2 cells, the cell viability increased with the time of ifnα stimulation (figure 4a) and decreased with the concentration of ifnα (figure 4c) . unter treatment of 500 u/ml ifnα, baf200 enhanced the inhibitory effect of ifnα, and overexpression of hbc partially recovered the cell the pcmv-flag vector and pcmv-flag-baf200 were transfected into hepg2 cells, with or without ifnα (500 u/ml) treatment for 24 h. phosphorylation of stat1 was detected via western blot using antibodies against phosphorylated stat1 (pstat1). meanwhile, stat1 and baf200 were detected using anti-flag and anti-stat1 antibodies as control. (b) hepg2 cells were co-transfected with pgc-fu-flag-baf200 and pcmv-ha vector or pcmv-ha-hbc, with or without ifnα (500 u/ml) treatment for 24 h. co-ip assays were performed with anti-flag antibody, then baf200-baf180 immuno-complexes were detected by western blot assays using anti-baf180 antibody or anti-flag antibodies (control). input control assays were performed in wcl using anti-ha or anti-baf180 antibodies. meanwhile, total mrna was extracted to examine the effect of baf200 and hbc combination on ifitm1, 2, 3 transcriptions by rt-pcr (c). β-actin was detected as control. ifitm1 transcription level was determined using rt-qpcr and normalized to the gapdh mrna level. (d) the flag-baf200 transfection with ifnα treatment was designated as 1. *, p < 0.05; **, p < 0.01. nd = not detected. (e) hepg2-ntcp cells were incubated with supernatants isolated from the supernatants of hepaad38 cells cultures (containing hbv) at 1000 geq for 16 h or not (mock). co-ip assays were performed with baf200 antibodies, and immuno-complexes were detected by western blot assays using baf180 antibodies or baf200 antibodies. input control assays were performed in wcl using hbc antibody or baf180 antibody. finally, we evaluated the effect of hbc on the antiviral activities of iftim1 in hbv-infected cells. firstly, the impact of hbc on the anti-proliferation action of ifitm1 was investigated via sirna-mediated knockdown in hepg2 cells and hepg2.2.15 cells. proliferation of indicated cells was assessed by mtt assays and viable cell counting. indeed, in hepg2 cells and hepg2.2.15 cells, the data from direct cell counting were consistent with those obtained from mtt assays (figure 4a,c,d,e) . in hepg2 cells, the cell viability increased with the time of ifnα stimulation (figure 4a) and decreased with the concentration of ifnα (figure 4c) . unter treatment of 500 u/ml ifnα, baf200 enhanced the inhibitory effect of ifnα, and overexpression of hbc partially recovered the cell viability (figure 4a) , however, the sirna mediated knock down of iftim1 increased the cell viability robustly, about two-four-fold compared to the control (figure 4c) . the results suggest that ifitm1 makes major contributions to ifnα inhibitory activities for hbv replication. next, we focused on the role of hb. in hepg2.2.15 cells, which contain a stably integrated hbv genome and produce endogenous hbc, overexpression of baf200 promoted the inhibition of ifnα (figure 4d ), however when hbc was silenced by sihbc, cell viability was reduced substantially (figure 4e) . consequently, the results demonstrate that hbc antagonizes the suppression of iftim1 and the proliferation of hbv-infected cells in vitro. next, the hbc effects on the inhibition of ifitm1 on hbv replication were measured. in figure 4e , phbv1.31, which contains 1.3-fold hbv genome and can produce endogenous hbc, was co-transfected with empty vector flag-baf200 or ha-hbc into hepg2 cells. after treating the cells with 500 u/ml ifnα for 72 h, supernatants were collected to determine the hbv replication level by detecting the quantitation of hbsag, hbeag, and hbv dna copy numbers (figure 4f ). in the control, empty vector and phbv1.31 were co-transfected, and it was observed that ifnα stimulation inhibited the hbv replication level significantly. in contrast to the control, when baf200 was overexpressed, the concentration of hbsag and hbeag in the supernatant was reduced about one-fold, and hbv dna copies were also suppressed up to five-fold. as expected, the ifnα inhibition was restored when hbc was co-transfected with baf200. notably, hbsag and hbeag levels increased to similar levels as the control, with a slight elevation in the hbv dna copy numbers. collectively, the results illustrate that hbv evades ifnα mediated antiviral activity in vitro by downregulating the expression of ifnα effector. however, overexpressed hbc had little observed impact on the recovery of hbv dna levels, implying that ifitm1 is not the only primary ifnα-inducible isg that suppresses hbv dna replication. hbv replication is not directly cytotoxic to cells, while the host immune responses in infected hepatocytes are the main determinants of hepatocellular injury and hbv pathogenesis. innate , then treated with ifnα in indicated concentration for 24 h. afterwards, the cell viability was measured using mtt assay and direct cell counting via trypan blue exclusion assay (a,c-e). (f) hepg2 cells were transfected with phbv1.31 and pgc-fu-flag-baf200, or co-transfected with pcmv-ha-hbc, then treated with 500 u/ml ifnα for 72 h. hbv replication levels were determined in the supernatants by measuring hbsag and hbeag concentration using elisa and hbv dna copy numbers using rt-qpcr. the empty vector and phbv1.31 were co-transfected in the non-ifnα induced condition as control. the control without ifnα treatment was designed as 100% (a,c-f). *, p < 0.05, **, p < 0.01, ns = non-significant. hbv replication is not directly cytotoxic to cells, while the host immune responses in infected hepatocytes are the main determinants of hepatocellular injury and hbv pathogenesis. innate immunity is important in controlling viral spread immediately after infection and initiates efficient development of an adaptive immune response. the early phase of a viral infection is mainly characterized by the production of cytokines, type i ifn, and natural killer (nk) cells [27] . type i ifns can be triggered directly by virus replication through the detection of viral rna or dna, and play a critical role in the immune recognition of hbv. they can be triggered directly by viral replication via detecting the presence of viral rna or dna and induce a large number of effectors working in combination to achieve a fully functional antiviral state [4, 28] . ifn effectors target different steps of the viral life cycle, limiting the propagation and spread of the virus and restricting viral infection. therefore, interferon therapy remains one of the therapeutic strategies for hbv infection. in fact, the majority of chb patients treated with ifnα cannot acquire a long-lasting sustained response, especially those with a high viral load. data from animal models have shown that ifn effectors were rapidly induced upon infection with hbv [28] . however, the hbv-induced ifn responses are weak [29] , and that is why acute hbv infections usually show a lack of clinical symptoms. studies have shown that the clinical outcomes in chb patients are primarily determined by the interaction between hbv replication and host immune responses [30] . as an important effector of type i ifns, mxa exhibits strong anti-viral activity against hbv, however, hbv down-regulates mxa expression significantly via the interactions between hbc and the interferon-inducible mxa promoter [31, 32] . in addition, reports have indicated that under the stimulation of ifnα, the ifn-signaling pathway is generally blocked, however the formation of stat1 and isgf3 were evenly enhanced in hepg2.2.15 cells [33] . here, our study shows that hbc inhibits the ifnα-induced ifitm1 transcription through disturbing the stability of pbaf complex in vitro, independent of the jak-stat1 pathway (figure 4a ). moreover, hbc exhibits anti-apoptosis activity by inhibiting trail-induced expression of the pathway-related death receptor in hepatocytes [34] . hbc acts as a tumor suppressor as well, by blocking the transcription of the human tumorigenesis-associated genes, ifnβ and p53 [11, 35] . notably, our data indicates that the inhibitory effect of ifitm1 on hbv dna replication seems weak. a potential explanation is hbv integration into the host genome. the hbv genome can present as non-integrated cccdna, which serves as a template for replication and can persist even after hbsag loss [36, 37] . hbv manages to escape immunological recognition in early infection, remaining undetected and spreading for nearly five weeks [38] . the use of cccdna as a transcriptional template in the nucleus likely contributes to hbv's capacity to limit detection in hepatocytes [37] . in addition, hbv evades the host response through a complex combination of processes that include signaling interference, effector modulation, and continual viral genetic variation [37] . reports have shown that hbv polymerase and hbx protein directly inhibit the cellular machinery that detects replication intermediates [29, 33] . here, our study provides novel evidence that hbv counteracts ifnα antiviral activities through effector modulation, i.e., the downregulation of ifitm1 expression by hbc. the mechanism of the downregulation is illustrated as follows. under normal conditions, ifnα induction activates pbaf complexes, which consist of baf200, baf180, and other subunits. the activation of the pbaf complex triggers histone sliding on chromatin dna, leading to the exposure of interferon-stimulated response elements (isre). in this way, pbaf complexes facilitate the initiation of ifitm1 transcription (figure 5a) . actually, baf200 is essential for the stability of the pbaf complex. under hbv-infected condition, the interaction of hbc with baf200 competes against the binding between baf180 and baf200, resulting in the loss in pbaf complex stability. thus, the efficient process of the pbaf complex is interrupted, leading to the suppression of ifitm1 transcription (figure 5b ). it provides details for the mechanism of hbv escape from ifnα-induced immune elimination. moreover, our future work will continue to explore the intrahepatic effect of hbc on hbv replication using hbv-transgenic mice. were evenly enhanced in hepg2.2.15 cells [33] . here, our study shows that hbc inhibits the ifnαinduced ifitm1 transcription through disturbing the stability of pbaf complex in vitro, independent of the jak-stat1 pathway (figure 4a) . moreover, hbc exhibits anti-apoptosis activity by inhibiting trail-induced expression of the pathway-related death receptor in hepatocytes [34] . hbc acts as a tumor suppressor as well, by blocking the transcription of the human tumorigenesis-associated genes, ifnβ and p53 [11, 35] . taken together, our data demonstrate that hbc downregulates ifitm1 expression through interactions with baf200, rather than the jak-stat1 pathway. the results also show that hbc partially restores ifitm1 antiviral effects on cell proliferation and hbv replication in infected cells in vitro by disturbing the stability of pbaf. it enriches the mechanism that hbv counteracts the innate immunity of ifnα, revealing a potential target for novel therapeutic strategies of hbv infection. nuclear import of hepatitis b virus capsids and genome genomic analysis of the host response to hepatitis b virus infection efficacy of nvr 3-778, alone and in combination with pegylated interferon, vs entecavir in upa/scid mice with humanized livers and hbv infection innate immune responses in hepatitis b virus (hbv) infection full-length hepatitis b virus core protein packages viral and heterologous rna with similarly high levels of cooperativity morphological irregularities in dane particle cores hepatitis b virus core protein phosphorylation sites affect capsid stability and transient exposure of the c-terminal domain nuclear export and import of human hepatitis b virus capsid protein and particles the hepatitis b virus (hbv) core protein enhances the transcription activation of cre via the cre/creb/cbp pathway hepatitis b viral core protein activates the hepatitis b viral enhancer ii/pregenomic promoter through the nuclear factor kappab binding site hepatitis b viral core protein disrupts human host gene expression by binding to promoter regions exome sequencing identifies frequent mutation of the swi/snf complex gene pbrm1 in renal carcinoma pbaf chromatin-remodeling complex requires a novel specificity subunit, baf200, to regulate expression of selective interferon-responsive genes selectivity of chromatin-remodelling cofactors for ligand-activated transcription expressing the human genome arid2: a new tumor suppressor gene in hepatocellular carcinoma noncytolytic control of viral infections by the innate and adaptive immune response ifitms restrict the replication of multiple pathogenic viruses ifitm proteins restrict hiv-1 infection by antagonizing the envelope glycoprotein ifitm1 is a tight junction protein that inhibits hepatitis c virus entry distinct patterns of ifitm-mediated restriction of filoviruses, sars coronavirus, and influenza a virus ifitm proteins mediate the innate immune response to influenza a h1n1 virus, west nile virus and dengue virus hepatitis b and d viruses exploit sodium taurocholate co-transporting polypeptide for species-specific entry into hepatocytes sodium taurocholate cotransporting polypeptide is a functional receptor for human hepatitis b and d virus a rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding ifn-alpha inhibits hbv transcription and replication in cell culture and in humanized mice by targeting the epigenetic regulation of the nuclear cccdna minichromosome viruses and interferon: a fight for supremacy interferon-stimulated genes: a complex web of host defenses temporal analysis of early immune responses in patients with acute hepatitis b virus infection innate and adaptive immune responses in chronic hepatitis b virus infections: towards restoration of immune control of viral infection mxa inhibits hepatitis b virus replication by interaction with hepatitis b core antigen human mxa protein participates to the interferon-related inhibition of hepatitis b virus replication in female transgenic mice interferon-alpha response in chronic hepatitis b-transfected hepg2.2.15 cells is partially restored by lamivudine treatment hepatitis b virus core protein inhibits trail-induced apoptosis of hepatocytes by blocking dr5 expression transcriptional repression of the human p53 gene by hepatitis b viral core protein (hbc) in human liver cells persistence of cccdna during the natural history of chronic hepatitis b and decline during adefovir dipivoxil therapy hepatitis b virus infection and the immune response: the big questions viral clearance without destruction of infected cells during acute hbv infection this article is an open access article distributed under the terms and conditions of the creative commons attribution (cc by) license we are grateful to r xiang for kindly providing hepg2.2.15 and phbv3.1 plasmids, a francis and r dillard for their invaluable comments on the manuscript. the authors declare no conflict of interest. key: cord-002706-m3y35ozx authors: guo, fang; zhao, qiong; sheraz, muhammad; cheng, junjun; qi, yonghe; su, qing; cuconati, andrea; wei, lai; du, yanming; li, wenhui; chang, jinhong; guo, ju-tao title: hbv core protein allosteric modulators differentially alter cccdna biosynthesis from de novo infection and intracellular amplification pathways date: 2017-09-25 journal: plos pathog doi: 10.1371/journal.ppat.1006658 sha: doc_id: 2706 cord_uid: m3y35ozx hepatitis b virus (hbv) core protein assembles viral pre-genomic (pg) rna and dna polymerase into nucleocapsids for reverse transcriptional dna replication to take place. several chemotypes of small molecules, including heteroaryldihydropyrimidines (haps) and sulfamoylbenzamides (sbas), have been discovered to allosterically modulate core protein structure and consequentially alter the kinetics and pathway of core protein assembly, resulting in formation of irregularly-shaped core protein aggregates or “empty” capsids devoid of pre-genomic rna and viral dna polymerase. interestingly, in addition to inhibiting nucleocapsid assembly and subsequent viral genome replication, we have now demonstrated that haps and sbas differentially modulate the biosynthesis of covalently closed circular (ccc) dna from de novo infection and intracellular amplification pathways by inducing disassembly of nucleocapsids derived from virions as well as double-stranded dna-containing progeny nucleocapsids in the cytoplasm. specifically, the mistimed cuing of nucleocapsid uncoating prevents cccdna formation during de novo infection of hepatocytes, while transiently accelerating cccdna synthesis from cytoplasmic progeny nucleocapsids. our studies indicate that elongation of positive-stranded dna induces structural changes of nucleocapsids, which confers ability of mature nucleocapsids to bind cpams and triggers its disassembly. understanding the molecular mechanism underlying the dual effects of the core protein allosteric modulators on nucleocapsid assembly and disassembly will facilitate the discovery of novel core protein-targeting antiviral agents that can more efficiently suppress cccdna synthesis and cure chronic hepatitis b. hepatitis b virus (hbv) is a small dna virus that chronically infects 240 million people worldwide and causes approximately 686,000 deaths annually due to various severe liver diseases, including cirrhosis, hepatocellular carcinoma (hcc) and liver failure [1] . currently approved direct-acting antiviral agents against hbv are six nucleos(t)ide analogues that inhibit viral dna polymerase with varying potency and barriers to drug resistance [2] . although those viral dna polymerase inhibitors significantly reduce viral load and prevent liver disease progression, they rarely cure hbv infection due to their inability to eradicate cccdna [3] . hbv core protein is a small polypeptide of 183 amino acid residues. it exists in infected hepatocytes as several distinct quaternary structures and plays multiple roles in the viral replication cycle [4] . the best characterized function of core protein is the assembly of pre-genomic (pg) rna and viral dna polymerase complex into nucleocapsids where hbv dna synthesis takes place [5] . moreover, temporally and spatially regulated disassembly (or uncoating) of nucleocapsids is essential for delivery of viral relaxed circular (rc) genomic dna into the nuclei of infected hepatocytes [6, 7] , where it is converted to covalently closed circular (ccc) dna [8, 9] . furthermore, it has also been suggested that core proteins may associate with cccdna minichromosomes, in an as-yet undefined structural manner, to regulate its transcription [10] . interestingly, it was also reported that core protein can be hijacked by host immune responses to recruit cytokine-induced dna cytosine deaminase apobec3a to cccdna minichromosomes, which results in cytosine deamination and decay of cccdna [11, 12] . due to their unique structures and essential roles in viral replication, disruption of, or interference with, nucleocapsid assembly and/or disassembly with small molecular core protein allosteric modulators (cpams) represents a new frontier in development of novel antiviral agents against hbv [13, 14] . over the last two decades, at least five chemotypes of cpams have been reported [13] . those compounds bind to a hydrophobic pocket, designated as the hap pocket, at the dimer-dimer interface near the c-termini of core protein subunits [15, 16] . binding of these molecules in the hap pocket induces large scale allosteric conformational changes in core protein subunits and alters the capsid assembly kinetics and pathways [4, 17] . while heteroaryldihydropyrimidines (haps), such as bay 41-4109 and gls4, misdirect capsid assembly to form non-capsid polymers of core proteins [17, 18] , all other chemotypes of cpams, including sulfamoylbenzamides (sbas) and phenylpropenamides (ppas), represented by enan-34017 and at-61, respectively (s1 fig), induce the formation of morphologically "normal" empty capsids with distinct quaternary and/or tertiary structural changes and thus, preclude viral dna replication [19, 20] . thus far, several haps and sbas have been shown to inhibit hbv replication in animal models and are currently under preclinical or clinical development [14, 21] . inspired by the observation that a small molecule compound targeting the capsid protein of dengue virus has dual effects on both the assembly and disassembly (or uncoating) of the viral capsids [22] , we hypothesized that hbv cpams may not only disrupt capsid assembly, but also alter the structure and function of assembled nucleocapsids and consequentially affect viral dna replication and/or cccdna synthesis. indeed, we have now obtained evidence showing that haps and sbas, but not ppas, induce disassembly of nucleocapsids from virions as well as double-stranded dna-containing cytoplasmic progeny nucleocapsids and consequentially interfere with cccdna biosynthesis from de novo infection and intracellular amplification pathways. discovery of human sodium taurocholate cotransporting polypeptide (hntcp) as the bona fide receptor for hbv infection of hepatocytes allows for establishment of convenient hepg2derived hbv infection cell culture systems [23, 24] . we have thus established a novel ntcpexpressing human cell line, designated as c3a hntcp , and demonstrated its susceptibility to hbv infection. the parental cell line, c3a, is a subclone of hepg2 cells that exhibits strong contact inhibition of growth and metabolic features that are more similar to normal hepatocytes [25] . as shown in s2 fig, cccdna became detectable as early as 1 day and reached maximum levels at 2 day post infection by qpcr and conventional southern blot assays. hbv pgrna and core-associated viral dna replication intermediates as well as core protein also accumulated sequentially in infected cultures. hbsag was readily detectable by elisa as a product of hbv infection in the culture media. in order to investigate the effects of cpams on hbv infection, particularly cccdna synthesis from a de novo infection, c3a hntcp cells were mock-treated or treated with representative hap (bay 41-4109, gls4) or sba (enan-34017) and control compounds entecavir (etv) or myrcludex b (myrb), starting at 24 h before hbv infection until harvesting at day 3 and day 6 post infection. as expected (fig 1) , myrb, an acylated peptide derived from the hbv large envelope protein blocks virus entry [26] , inhibited cccdna formation and consequential accumulation of pgrna and core dna. also as anticipated, etv, an hbv dna polymerase inhibitor, did not affect the synthesis of cccdna and accumulation of pgrna, but inhibited the synthesis of core dna [27] . interestingly, gls4, bay 41-4109 and enan-34107 significantly reduced the amounts of cccdna. viral pgrna and core dna were also proportionally reduced. a more detailed time course study spanning the first four days post infection revealed that the three cpams significantly inhibited cccdna formation, whereas etv and ifn-α did not (s3 fig) (fig 1d, lanes 5 and 9) . however, while etv did not reduce viral rna, ifn-α reduced the levels of viral pgrna and 2.4/2.1 kb mrna, presumably due to suppression of cccdna transcription [28, 29] . to further characterize the inhibitory effect of cpams on cccdna biosynthesis, time-ofaddition and dose response experiments were performed. in agreement with its mode of action, myrb treatment starting at 24 h before or at the time of infection efficiently blocked cccdna formation, whereas delayed treatment starting at 24 h post infection completely failed to inhibit cccdna formation (fig 2a) . consistent with the kinetics of cccdna formation in this cell culture system (s3 fig), while cpam treatment starting at 24 h before or at the time of infection reduced cccdna formation at similar efficiency, their inhibitory effects were significantly reduced when the treatment started at 24 h post infection. moreover, all the three cpams inhibited cccdna formation in a concentration dependent manner (fig 2b) . those results are in agreement with a report published during the preparation of this manuscript that bay 41-4109 and sba derivative jnj-632 inhibited hbv cccdna synthesis during hbv infection of human primary hepatocytes [30] . to investigate the possibility that the observed inhibition of cpams on cccdna formation is due to inhibition of ntcp-mediated hbv entry, we examined their effects on hepatitis d virus (hdv) infection of c3a hntcp cells. the results demonstrated that while myrb efficiently and cytoplasmic core dna (c) were quantified by real-time pcr assays. differences in viral cccdna, core dna or pgrna between mock-treated control and treated groups were statistically analyzed (t-test, * p <0.05, ** p <0.01, *** p <0.001). (d) hybridization analyses of hbv replication intermediates in cells harvested at 6 dpi. upper panel, hirt dna extracted from the cells harvested at 6 dpi were denatured at 88˚c for 5 min to denature dp-rcdna to single-stranded dna and followed by restriction with ecori to convert cccdna into unit-length double stranded linear dna and detected by southern blot hybridization (labeled as ccc/ecori). unit-length hbv linear dna served as a molecular weight marker. lower panel, hbv rnas, pre-genomic rna (pgrna), 2.4 and 2.1kb mrna specifying envelope proteins were determined by northern blot hybridization. 28s and 18s ribosomal rna (rrna) served as loading controls. https://doi.org/10.1371/journal.ppat.1006658.g001 reduced genomic and antigenomic hdv rna by more than 3 log, etv and ifn-α as well as bay-41-4109 and enan-34017 did not apparently alter the amounts of hdv rna in the infected cultures (s4 fig). the results thus imply that inhibition of cccdna synthesis by the cpams is due to their interaction with hbv-specific components, most possibly nucleocapsids, but not the host cellular factor(s) in the entry pathway shared by hbv and hdv. cpams accelerate intracellular cccdna synthesis from cytoplasmic progeny nucleocapsid rcdna besides being synthesized from incoming virion dna in the de novo infection, cccdna in infected hepatocytes can also be amplified by delivery of rcdna from cytoplasmic progeny nucleocapsids into the nucleus and conversion to cccdna [31] [32] [33] . this intracellular cccdna amplification pathway has been demonstrated to function in cultured cells and in vivo in duck hepatitis b virus (dhbv)-infected ducks, and is regulated by the large envelope protein and host cellular factors [33, 34] . because cpams inhibit pgrna encapsidation and thus preclude viral dna replication and intracellular amplification of cccdna, their effects on intracellular progeny nucleocapsids and cccdna amplification cannot be investigated in cells directly treated with those compounds [35] . to circumvent this problem, as depicted in fig 3a, we first arrested hbv dna replication by culturing hepad38 cells in medium without tetracycline, but containing the reversible viral dna polymerase inhibitor foscarnet (trisodium phosphonoformate, or pfa for short) for four days, which arrested hbv dna replication predominantly at the stages of incomplete and complete minus-strand dna (fig 3b) [36] . the cells were then cultured in the presence of tetracycline to stop hbv pgrna transcription from integrated transgene in cellular chromosome, and also in the absence of pfa to allow viral dna replication and cccdna synthesis to resume. at the time of pfa withdrawal, mock treatment or treatment with etv, bay-41-4109, enan-34017 was initiated and cells were harvested at the indicated time points for analyses of hbv core dna and cccdna. synthesis and identity of cccdna in this cell culture system were confirmed by its resistance to heat denaturing and conversion into 3.2kb unit-length dna after heat denaturing and ecori digestion (s5 fig). as shown in fig 3b, upon removal of pfa from culture medium, the incomplete and complete minus strand, partial double-strand and complete double strand hbv dna species (including rcdna) sequentially increased from 3 to 12 h (fig 3b) . deproteinized rcdna (dp-rcdna) and cccdna became readily detectable at 9 and 12 h, respectively ( fig 3c) . as expected, etv treatment inhibited the elongation of arrested hbv dna species and prevented the production of rcdna as well as dp-rcdna and cccdna. interestingly, although bay-41-4109 or enan-34017 treatment did not inhibit elongation of minus-strand and partial double-strand dna in the cytoplasmic nucleocapsids, the rcdna was not accumulated in those cells ( fig 3b) . however, analysis of hirt dna indicated that the amount of dp-rcdna was not apparently reduced by cpam treatment and to our surprise, the cccdna was readily detected as early as 9 h after the removal of pfa in cpam-treated cells. experiments with additional cpams and extended treatment duration further supported the notion that the selected hap and sba compounds reduced the accumulation of cytoplasmic rcdna-containing nucleocapsids (s6 fig cpams do not inhibit completion of positive strand dna synthesis, but confer dnase i sensitivity of mature forms of viral dna the apparent contradicting effects of cpams on cytoplasmic rcdna-containing nucleocapsid accumulation and kinetics of cccdna synthesis in hepad38 cells prompted us to investigate whether those compounds inhibited the completion of rcdna synthesis and/or destabilized the nucleocapsids containing mature forms of double-stranded dna. this latter possibility may explain the observed acceleration of cccdna formation from intracellular progeny nucleocapsids [7, 37] . to this end, hbv capsids were purified from the cytoplasmic fraction of pfatreated cells and an endogenous dna polymerase assay were performed in vitro in the absence or presence of cpams. to probe the integrity of nucleocapsids, the accessibility of viral dna to dnase i digestion were tested at the completion of endogenous dna polymerase reaction, but before extraction of viral dna. southern blot analysis of viral dna species indicated that rcdna can be efficiently synthesized in the in vitro endogenous dna polymerase reaction when dntps were provided ( fig 5a) . furthermore, the presence of bay 41-4109, enan-34017 or at-61 did not inhibit rcdna synthesis. however, the rcdna synthesized in the presence of bay 41-4109 and enan-34017, but not at-61, was susceptible to dnase i digestion (fig 5a and 5b ). hence, our results indicate that cpams do not inhibit hbv dna synthesis, but favor a hypothesis that the selected cpams specifically alter the structure of, and destabilize mature rcdna-containing nucleocapsids and facilitate rcdna nuclear delivery and synthesis of cccdna. because the mature rcdna-containing nucleocapsids only constitute a small fraction of total cytoplasmic capsids [38] , it is not surprise that the cpam treatment did not alter the amounts and migration mobility of capsids, as revealed by a native agarose gel electrophoresis-based particle gel assay (fig 5a and 5b , lower panels) [35, 39] . the differential effects of cpams on cccdna synthesis from the de novo infection and intracellular amplification pathways argues that the compounds may have a different effect on the nucleocapsids in virions and in the cytoplasm. to investigate this possibility, we purified hbv virion particles from the blood of a chronic hbv carrier and examined the effects of cpams on rcdna synthesis and integrity of nucleocapsids in an in vitro endogenous dna polymerase reaction as described above. similar to the results obtained with cytoplasmic nucleocapsids, the presence of bay 41-4109, enan-34017 or gls4 did not inhibit rcdna synthesis from partially double-stranded virion dna, but conferred susceptibility of virion rcdna to dnase i digestion in a concentration-dependent manner ( fig 6a) . to further investigate whether cpams can directly induce structural change of the partially double-stranded dna-containing nucelocapsids, virion particles prepared from the patient serum were treated with the cpams in an endogenous dna polymerase reaction without dntp and followed by dnase i treatment prior to dna extraction. the results showed that each of the three tested cpams rendered all virion dna species susceptible to dnase i digestion in a concentration-dependent manner (fig 6b) . hence, the results indicate that irrespective to the maturation stage of viral dna, the nucleocapsids derived from virion particles are sensitive to cpam-induced structural changes that expose viral dna for dnase i digestion. elongation of positive-stranded dna gradually increases the vulnerability of cytoplasmic nucleocapsids to cpams encouraged by the observation that the cpam-induced virion dna susceptibility to dnase i did not depend on active dna polymerase reaction or ongoing dna chain elongation ( fig 6b) , we further examined the effects of cpams on capsids purified from the cytoplasm of hepad38 cells in an endogenous dna polymerase reaction buffer without dntps. as shown in fig 7a, while rcdna became susceptible to dnase i digestion at lower concentrations of [35, 39, 40] . a kinetics study further revealed that while up to 6 h incubation was required for enan-34017 to induce significant exposure of rcdna, 1 to 2 h exposure was sufficient for gls4 and bay 41-4109 to induce an extensive exposure of rcdna ( fig 7b) . to determine the kinetics of cpams induction of rcdna exposure in cells, hepad38 cells cultured in tet-free medium for 6 days were treated with gls4 for the indicated periods of time. the cytoplasmic lysates were mock-treated or treated with dnase i before extraction of dna. as shown in s8 fig, treatment of gls4 for 6 h induced extensive rcdna exposure for dnase i digestion. cpams promote uncoating of mature nucleocapsids although results presented above indicate that cpam treatment induces the exposure of rcdna in nucleocapsids to dnase i digestion, the extent of disruption on the structure of mature nucleocapsids by the different cpams remains to be determined. we therefore examined whether the mature viral dna species, rcdna and double-stranded linear (dsl) dna, were still associated with capsids after cpam treatment. the assumption is that if cpam treatment severely disrupts the mature nuclocapsids and results in releasing of viral dna, we anticipate that rcdna and dsldna species will not co-sediment with any form of capsids. however, if cpam treatment only mildly disrupts the mature nucleocapsids and causes the exposure of viral dna that is still associated with capsid structure, we anticipate to see the rcdna and/or dsldna species will co-sediment with capsids. to this end, hbv capsids prepared from hepad38 cells were mock treated or incubated with enan-34017, bay 41-4109 or gls4 in endogenous dna polymerase reactions without dntps. the reactions were then fractionated by sucrose density gradient ultracentrifugation. the amounts of total capsids and capsid-associated dna in each of the fractions were analyzed by a 1.5% native agarose gel electrophoresis-based particle gel assay [39] . as shown in the upper panels of fig 8 a to 8d , compared to mock-treated control, treatment with any of the three cpams did not alter the sedimentation profile of capsids and capsid associated hbv dna. these results are consistent with the observation that cpams only affect the mature nuclocapsids that constitute only a small portion of total capsids (fig 7 and s7 fig) . however, analysis of viral dna by southern blot hybridization in each of the fractions revealed that rcdna and dsldna were lost or reduced from capsids sedimenting to 21% to 25% sucrose after bay 41-4109 or gls4 treatment, but the majority of rcdna and dsldna still co-sediment with capsids after enan34017 treatment (fig 8 a to 8d, lower panels) . due to the small amounts of rcdna and dsldna and low sensitivity of southern blot hybridization assay, we were not able to identify the location or distribution of the disassociated dna species in the gradients. nevertheless, those results indicate that while bay 41-4109 or gls4 treatment most likely induced structural changes that were significant enough to cause loss of rcdna and dsldna from majority of the mature nucleocapsids, the less active compound enan-34017 might only induce structural changes that render the dna content susceptible to dnase digestion. these two distinct degrees of conformational alteration may correspond to a subtle increase in "capsid breathing" for enan-34017, versus extensive rearrangement of the capsid subunit organization for bay-41-4109 and gls4 [41] . the genomes of all viruses are wrapped with capsid protein(s) to form nucleocapsids. unlike viral enzymes that often have host cellular homologues, host cells do not encode proteins that are structurally and functionally similar to viral capsid proteins. therefore, viral capsid proteins are ideal and highly selective antiviral targets [42] . in addition to serving as a vehicle for transmission of viral genomes between host cells, hbv nucleocapsids have other unique functions in the viral life cycle [4, 9, 27] . as illustrated in fig 9, first, hbv dna replication occurs exclusively within the cytoplasmic nucleocapsids, by reverse transcription of viral pgrna first into negative-strand dna and then double-stranded rcdna. second, unlike all other viruses where the progeny nucleocapsids have only one destination, i.e., to be secreted as virions, the hbv progeny nucleocapsids can also deliver their rcdna into the nuclei to synthesize cccdna. due to superinfection exclusion [43, 44] , it is reasonable to consider that the activity of the intracellular amplification pathway is the key determinant of cccdna pool size in infected hepatocytes [45] . due to the large amounts of progeny nucleocapsids in the cytoplasm, this intracellular cccdna amplification pathway must be, and actually is, tightly controlled by viral and host factors [7, 34, 37, 46] . finally, the exclusive replication in nucleocapsids and the spatially-controlled disassembly and delivery of rcdna into nuclei at nuclear pore complexes protect the viral dna from recognition by cytoplasmic dna sensors, and thus favor the persistent infection by hbv [8, 9, 47] . hence, it has been speculated that targeting hbv core protein may disrupt multiple steps of hbv replication and activate innate immune response in virally infected cells. however, as mentioned, while several distinct chemotypes of hbv cpams have been shown to disrupt viral nucleocapsid assembly and consequentially inhibit viral genome replication, their effects on other aspects of nucleocapsid function have not been investigated. herein, we provide evidence suggesting that selected haps and sbas are able to interact with nucleocapsids from virions and mature forms of rcdna-containing nucleocapsids in the cytoplasm and subsequently interfere with their function of delivering viral rcdna to the nuclei for cccdna synthesis. although the structural basis for the cpams to target the highly selected sub-populations of nucleocapsids remains to be determined, our results are consistent with previous findings that mature hbv nucleocapsids are intrinsically unstable or fragile [48] , probably due to the stiffness of rc and dsldna, which imposes bending energy and electrostatic repulsion to the capsid shell [49] . moreover, viral dna synthesis in the nucleocapsids assembled from mutant dhbv core proteins with a serial n-terminal inertions destabilized mutant nucleocapsids, rendering mature viral dna selectively sensitive to nuclease digestion [50] . therefore, it is possible that the intrinsic instability of mature nucleocapsids, due to the completion of double-stranded dna, confers the selective sensitivity for cpams to induce disassembly. considering the result that cpam treatment induces the accessibility of all forms of virion dna, either rcdna or partially double-stranded dna, to dnase i digestion, a possible explanation is that like many other viruses, structural shifts or maturation of nucleocapsids may occur during or after virion assembly and secretion, and confer susceptibility to cpams [51] . moreover, a recent report showed that the carboxyl-terminal domain of core proteins is hypophosphorylated in dna-containing virions, but remains hyperphosphorylated in intracellular dna-containing nucleocapsids [52] . although the c-terminal arginine-rich domain of hbv core protein is not directly involved in the binding of cpams [39] , the dephosphorylation may alter the interaction between core protein and viral dna [53] , and thus affect the nucleocapsid structure in a manner distinct from that of the hyperphosphorylated state [54] . in addition, the sensitivity of partially double-stranded dna-containing cytoplasmic nucleocapsids to the increased concentrations of cpams strongly suggests that elongation of positive-stranded dna toward rcdna induces incremental, or gradual, structural changes favoring specific interaction with cpams. structural biology studies with purified double stranded dna-containing capsids may reveal those important structure differences. however, it is technically challenging to purify sufficient amounts rcdna-containing hbv capsids for cryo-em analyses. although our study revealed correlations between altered cccdna synthesis and induction of nucleocapsid destablization by cpams, the molecular mechanisms on how the cpaminduced nucleocapsid structural changes disrupt cccdna formation in de novo infection, but accelerate cccdna synthesis from progeny intracellular nucleocapsids remain to be determined. however, reasonable speculations can be made based on current knowledge. as illustrated in fig 9, on one hand, in de novo infection, cpams may interact with nucleocapsids in virions during endocytic entry or immediately after their release into the cytoplasm to induce viral dna exposure or release from nucleocapsids. the premature disassembly of nucleocapsids results in viral dna release and decay by cytoplasmic dnases before its arrival to the nuclear pore complex for nuclear import and subsequent cccdna synthesis. on the other hand, due to the shorter distance traveled as compared to the de novo infection, the intracellular progeny rcdna-containing nucleocapsids may reach nuclear pore complexes before a certain stage of their disassembly and cpam-induced uncoating actually accelerates the release of rcdna into the nuclei and thus cccdna formation. of course, a fraction of rcdna decay in the cytoplasm may also occur. in fact, this interpretation is in agreement with recent findings that enhanced destabilization of mature rcdna containing nucleocapsids, due to unidentified host cellular factors in mouse hepatocytes or a single amino acid substitution (i126a) in core protein, significantly reduced the accumulation of rcdna, but increased the dp-rcdna and cccdna synthesis [7, 37] . it had not escaped our attention that the released or exposed rc/dsldna in the cytoplasm may activate innate dna sensors [55] [56] [57] [58] . however, cytokine response was not detected in cpam-treated cells. whether this is due to the deficiency of cyclic gmp-amp synthase (cgas)-stimulator of interferon genes (sting) pathway in hepatocytes and hepatoma cells [59] [60] [61] or efficient digestion of the released viral dna by cytoplasmic nucleases [62] is currently under investigation. while inhibition of cccdna synthesis from de novo infection is obviously a beneficial therapeutic effect, the acceleration of intracellular cccdna amplification is detrimental. however, the potent inhibition of pgrna encapsidation by cpams will quickly block viral dna replication and production of mature progeny nucleocapsids and consequential cccdna synthesis. therefore, the only chance for cpams to accelerate cccdna synthesis during antiviral therapy is at the initial period of treatment to promote cccdna synthesis from pre-existing mature nucleocapsids in hbv infected cells. fortunately, treatment of hepad38 cells supporting steady-state hbv dna replication with etv and cpams to mimic the initial stage of antiviral treatment in vivo did not observe a significant increase of cccdna accumulation within first 24 h of treatment. instead, similar to etv, cpams prevented amplification of cccdna pool during a prolonged treatment, as compared with mock-treated control (s9 fig). in fact, those results are consistent with the observation that cpam treatment of primary human hepatocytes after establishment of hbv infection did not alter the amount of cccdna [30] . taking together, the results imply that cpams only significantly increase the amount of cccdna by acceleration of ongoing cccdna synthesis, such as under the condition of fast cccdna synthesis after release from pfa arrested hbv dna replication, but cannot accelerate the very low (or negligible) rate of cccdna synthesis to significantly increase the amount of cccdna in cells with established hbv infection. mechanistically, as stated above, it is possible that only when cpam-induced disassembly of mature nucleocapsids occurs at or near the nuclear pore complex may facilitate the import of rcdna into the nuclus for cccdna synthesis, but the mature nucleocapsids at such status may not exist in a significant amount in hepatocytes with established infection. nevertheless, careful monitoring of cccdna synthesis during the early phase of cpam treatment in vivo in animals and in clinical trials and pretreatment or combination with viral dna polymerase inhibitors might be considered. the hepad38 cell line (obtained from dr. christoph seeger at fox chase cancer center, philadelphia) supporting hbv pgrna transcription and subsequent viral dna replication in a tetracycline (tet)-inducible manner was maintained as previously described [63] . c3a cell line [a derivative of hepg2 (atcc hb-8065)] (atcc crl-10741) was maintained in dmem/f-12 (1:1) medium supplemented with 10% fbs (gemini bio-products), 100 u/ml penicillin, 100 μg/ml streptomycin. entecavir (etv) is a gift from dr. william s. mason at fox chase cancer center, philadelphia [64] . foscarnet was purchased from sigma. capsid assembly modulators enan-34017 and bay41-4109, gls4 and at-61 were described previously [35, 65] . myrcludex b is a gift of dr. stephan urban at heidelberg university, germany [26] . alpha-interferon (ifn-α) was purchased from pbl assay science. rabbit anti-hbc antibody was obtained from dako (b0586). human sodium taurocholate cotransporting polypeptide (ntcp) gene coding sequence was amplified from a cdna clone purchased from origene (sc118232). a carboxyl-terminal c9 tag was added by pcr amplification with the primers harboring c9 tag sequence and noti & bam hi restriction enzyme sites. the purified pcr fragments were digested with restriction enzymes not i and bam hi and subsequently cloned into a pqcxip vector (clontech). vsv g protein pseudotyped retroviruses were packaged in gp2-293 cells as previously described [66] . c3a hntcp cell line stably expressing human ntcp was established by infection of c3a cell line with the pseudotyped retroviruses and selected with medium containing 2 μg/ml of puromycin. puromycin-resistant cells were expanded into cell line and designated as c3a hntcp . proper expression of ntcp was confirmed by immunofluorescence and western blot assays. c3a hntcp cells were seeded into collagen-coated 24-well plates at a density of 4×10 5 cells per well and cultured in complete dmem medium containing 3% dimethyl sulfoxide (dmso). one day later, the cells were infected with hbv prepared from hepad38 cell culture media at a moi of 500 genome equivalents per cell in dmem containing 4% peg-8000. the inoculums were removed at 24 h post infection and the cultures were maintained in complete dmem medium containing 3% dmso until harvesting. extraction and analyses of hbv dna and rna by hybridization and realtime pcr assays hbv core dna and rna extraction from infected c3a hntcp or hepad38 cells, southern blot hybridization, and real-time pcr analyses were performed as described previously [35, 65] . hbv cccdna from hbv-infected c3a hntcp cells and hepad38 cells were extracted by a modified hirt dna extraction procedure [33] . a fraction of hirt dna preparation was digested with 1 unit of plasmid-safe adenosine triphosphate (atp)-dependent deoxyribonuclease (psad) (epicentre technologies) in a 25 μl reaction for 1 h at 37˚c to remove rcdna. the dnase was inactivated by incubation of the reactions for 30 min at 70˚c. cccdna in the psad-treated samples were quantified by a real time pcr assay with primer sequences ggggcgcacctctcttta (forward) and ccacccaggtagctagagtcattag (reverse). the real-time pcr was performed using the sybr premix ex taq on a lightcycler 480 ii (roche) as the following reaction procedure: 95˚c for 10 min then 45 cycles of 95˚c for 30 s, 60˚c for 5 s, and 72˚c for 30 s. the amount of hbv cccdna in a dna preparation was determined by real-time pcr using a plasmid containing hbv genotype d genome as the standard. for southern blot hybridization, the hirt dna samples were denatured at 88˚c for 5 minutes and chilled in ice. this procedure completely denatures deproteinized rc-dna (dp-rcdna) into single stranded dna, whereas cccdna will remain as double stranded circular dna [67] . the denatured hirt dna samples without or with further digestion with restriction enzyme eco ri to linearize cccdna into double-stranded linear dna were resolved in 1.5% agarose gel and transferred onto hybond-xl membrane. the membrane was probed with α-32 p-utp labeled minus strand specific full-length hbv riboprobe. hdv production, infection and rna quantification. cell culture derived hdv particles were generated as described previously [68] . briefly, huh7 cells (obtained from dr. christoph seeger at fox chase cancer center, philadelphia) were co-transfected with a plasmid containing three copies of hdv cdna sequence (psvld3) and a plasmid expressing hbv envelope proteins l, m and s (psv45h) [69] . hdv particles were harvested from the media between 6 to 9 and 9 to 12 days post transfection. after clarification by centrifugation, particles were precipitated in the presence of 10% peg-8000 and the pellet was dissolved in tan buffer (50 mm tris-hcl, ph 8.0 and 100 mm nacl) at 1% volume of the original culture medium. for infection, c3a hntcp cells were seeded into collagen-coated 24-well plates at a density of 4×10 5 cells per well and cultured in complete dmem medium containing 3% dimethyl sulfoxide (dmso). one day later, the cells were infected with hdv at a moi of 500 genome equivalents per cell in dmem containing 4% peg-8000. the inoculums were removed at 24 h post infection and the cultures were maintained in complete dmem medium containing 3% dmso until harvesting. intracellular hdv genomic and antigenomic rnas were quantified by qrt-pcr using strand-specific primers as described previously [68] . purification of hbv virions and cytoplasmic capsids. hbv virions were prepared from a hbv carrier's serum (from bioreclamation ivt, the complete resources for all biologicals) by sucrose gradient centrifugation. briefly, 1 ml of human sera was layered onto a 2-ml 20% (wt/vol) sucrose cushion in 0.15 m nacl, 0.02 m tris-hcl, ph 7.4, and centrifuged for 3 h at 45,000 rpm in sw55 rotor at 4˚c. the supernatant fluid was removed and pellet was dissolved in tne buffer (0.15 m nacl; 0.01 m tris-hcl, ph 7.4; and 0.1 mm edta). to prepare intracellular hbv capsids, hepad38 cells were cultured in tetracycline-free medium with or without 2 mm foscarnet (pfa) for 6 days with daily medium change. the cells were then lysed with chilled lysis buffer containing 10 mm tris-hcl (ph 8.0), 1 mm edta, 0.1% nonidet p-40 and 8% sucrose on ice for 10 minutes, the lysate was centrifuged at 10,000 g for 5 min to remove the nuclei and cell debris. the clarified supernatant was overlaid onto a 10-55% (w/w) sucrose gradient and centrifuged at 24,000 rpm for 16 h at 4˚c using a beckman sw28 rotor. nineteen 2-ml fractions were collected from the bottom of the cushion. ten microliters of each fraction was dot-blotted onto the nitrocellulose membrane and hbv core protein was detected by incubation with a rabbit antibody against hbv core protein (dako, b0586). the bound antibody was detected by irdye secondary antibodies and visualized by li-cor odyssey system. hbv core protein-positive fractions were pooled together and the sucrose concentration was adjusted to 10% by addition of tne buffer. the diluted sample was overlaid on a 20% sucrose cushion and centrifuged at 45,000 rpm for 3 h at 4˚c using beckman sw55 rotor. the pellet was resuspended in tne buffer. endogenous dna polymerase reaction. an endogenous dna polymerase reaction (epr) mixture was assembled with 20 μl of hbv virion or capsid preparation, 25 μl of 2x epr buffer which consisted of 0.15 m nacl, 0.1 m tris-hcl (ph 8.0), 20 mm mgcl2, 2 mm dithiothreitol, 0.2% (vol/vol) nonidet p-40. dntp and capsid assembly modulators were added, as indicated, to 0.1 mm or a specified final concentration, respectively. water was added to bring the reaction volume to 50 μl. after incubation at 37˚c for an indicated period of time, the reaction was subjected for extraction of viral dna with or without prior dnase i digestion at 37˚c for 30 min. the viral dna were resolved in 1.5% agarose gel and transferred onto hybond-xl membrane. the membrane was probed with α-32 p-utp labeled minus strand specific fulllength hbv riboprobe. particle gel assay. the cytoplasmic hbv capsids were analyzed by a native agarose gel electrophoresis-based assay. briefly, ten microliters of endogenous dna polymerase reaction or fraction of sucrose gradient centrifugation were resolved by electrophoresis through a 1.5% agarose gel and transferred to a nitrocellulose membrane by blotting with tne buffer (10 mm tris-hcl, ph 7.5, 150 mm nacl, and 1 mm edta). hbv capsids on the membrane were detected with a procedure described previously [65] . ultracentrifugation analysis of hbv capsid integrity. two hundred microliters of the purified hbv capsids were mixed with 250 μl of reaction buffer containing 0.15 m nacl, 0.1 m tris-hcl (ph 8.0), 20 mm mgcl 2 , 2 mm dithiothreitol, 0.2% (vol/vol) nonidet p-40. capsid assembly modulators were added as indicated and water was provided to bring the reaction volume to 500 μl. after incubation at 37˚c for the indicated period of time, the reaction was loaded onto a 15% to 30% linear sucrose gradient in tne buffer and spun at 27,000 rpm for 4 hr (beckman, rotor sw28). 1.5ml fractions were collected from the bottom of the centrifugation tube by blood collection set. sucrose concentration of each fraction was measured by refractor (mettler toledo). the rest of each fraction was mixed with 3ml tne buffer and pelleted by centrifugation at 46,000 rpm for 3 hr. pellet was dissolved in 40 μl tne buffer. 20μl of capsid solution were fractionated in a 1.5% agarose gel electrophoresis and transferred to a nitrocellulose membrane to detect hbv capsid by probing with anti-hbcag antibody. viral dna was extracted from the remaining sample of reactions and detected by southern blot hybridization with α-32 p-utp-labeled minus strand-specific full-length hbv riboprobe. and cytoplasmic core dna (c) were quantified by real-time pcr assays. hbsag in culture medium was measured by using an elisa assay kit (autobio) (d). (e) the infected cells were fixed at 3 and 8 days post infection (dpi) and hbcag was detected by indirect immunofluorescent staining (red). the cell nuclei were stained with dapi (blue). the images were captured with a nikon x71 microscopy. (f) detection of hbv replication intermediates by hybridization assays. top panel, hirt dna extracted from the cells was denatured at 88˚c for 5 min to denature dp-rcdna into single stranded dna and followed by restriction with ecori to convert cccdna into unit-length dsldna (labeled as ccc/ecori) and detected by southern blot hybridization. unit-length hbv linear dna served as a molecular weight marker. middle panel, hbv pgrna and mrnas specifying envelope proteins (envrnas) were detected by northern blot hybridization. 28s and 18s ribosomal rna (rrna) served as loading controls. global epidemiology of hepatitis b virus infection: new estimates of age-specific hbsag seroprevalence and endemicity hepatitis b virus resistance to nucleos(t)ide analogues therapeutic strategies for a functional cure of chronic hepatitis b virus infection core protein: a pleiotropic keystone in the hbv lifecycle molecular biology of hepatitis b virus infection nuclear import of hepatitis b virus capsids and release of the viral genome alteration of mature nucleocapsid and enhancement of covalently closed circular dna formation by hepatitis b virus core mutants defective in complete-virion formation hbv cccdna: viral persistence reservoir and key obstacle for a cure of chronic hepatitis b metabolism and function of hepatitis b virus cccdna: implications for the development of cccdna-targeting antiviral therapeutics structural organization of the hepatitis b virus minichromosome specific and nonhepatotoxic degradation of nuclear hepatitis b virus cccdna interferon-gamma and tumor necrosis factor-alpha produced by t cells reduce the hbv persistence form, cccdna, without cytolysis the current status and future directions of hepatitis b antiviral drug discovery present and future therapies of hepatitis b: from discovery to cure high-resolution crystal structure of a hepatitis b virus replication inhibitor bound to the viral core protein small-molecule effectors of hepatitis b virus capsid assembly give insight into virus life cycle a heteroaryldihydropyrimidine activates and can misdirect hepatitis b virus capsid assembly hepatitis b virus capsids have diverse structural responses to small-molecule ligands bound to the heteroaryldihydropyrimidine pocket assembly-directed antivirals differentially bind quasiequivalent pockets to modify hepatitis b virus capsid tertiary and quaternary structure heteroaryldihydropyrimidine (hap) and sulfamoylbenzamide (sba) inhibit hepatitis b virus replication by different molecular mechanisms discovery and pre-clinical characterization of third-generation 4-h heteroaryldihydropyrimidine (hap) analogues as hepatitis b virus (hbv) capsid inhibitors a novel inhibitor of dengue virus replication that targets the capsid protein sodium taurocholate cotransporting polypeptide is a functional receptor for human hepatitis b and d virus. elife 1: e00049 hepatitis b and d viruses exploit sodium taurocholate co-transporting polypeptide for species-specific entry into hepatocytes reversal of fulminant hepatic failure using an extracorporeal liver assist device prevention of hepatitis b virus infection in vivo by entry inhibitors derived from the large envelope protein dna polymerase kappa is a key cellular factor for the formation of covalently closed circular dna of hepatitis b virus ifn-alpha inhibits hbv transcription and replication in cell culture and in humanized mice by targeting the epigenetic regulation of the nuclear cccdna minichromosome alpha-interferon suppresses hepadnavirus transcription by altering epigenetic modification of cccdna minichromosomes capsid assembly modulators have a dual mechanism of action in primary human hepatocytes infected with hepatitis b virus in hepatocytes infected with duck hepatitis b virus, the template for viral rna synthesis is amplified by an intracellular pathway formation of hepatitis b virus covalently closed circular dna: removal of genome-linked characterization of the intracellular deproteinized relaxed circular dna of hepatitis b virus: an intermediate of covalently closed circular dna formation hepadnavirus envelope proteins regulate covalently closed circular dna amplification sulfamoylbenzamide derivatives inhibit the assembly of hepatitis b virus nucleocapsids conditional replication of duck hepatitis b virus in hepatoma cells hepatitis b virus covalently closed circular dna formation in immortalized mouse hepatocytes associated with nucleocapsid destabilization secretion of genome-free hepatitis b virus -single strand blocking model for virion morphogenesis of para-retrovirus discovery and mechanistic study of benzamide derivatives that modulate hepatitis b virus capsid assembly preclinical characterization of gls4, an inhibitor of hepatitis b virus core particle assembly weak protein-protein interactions are sufficient to drive assembly of hepatitis b virus capsids capsid proteins of enveloped viruses as antiviral drug targets superinfection with woodchuck hepatitis virus strain whvny of livers chronically infected with strain whv7 superinfection exclusion in duck hepatitis b virus infection is mediated by the large surface antigen formation of the pool of covalently closed circular viral dna in hepadnavirus-infected cells production and function of the cytoplasmic deproteinized relaxed circular dna of hepadnaviruses the innate immune response to hepatitis b virus infection: implications for pathogenesis and therapy maturation-associated destabilization of hepatitis b virus nucleocapsid differential assembly of hepatitis b virus core protein on single-and double-stranded nucleic acid suggest the dsdna-filled core is spring-loaded duck hepatitis b virus nucleocapsids formed by n-terminally extended or c-terminally truncated core proteins disintegrate during viral dna maturation the structural biology of hiv assembly capsid phosphorylation state and hepadnavirus virion secretion hepatitis b virus core protein phosphorylation sites affect capsid stability and transient exposure of the c-terminal domain complete and incomplete hepatitis b virus particles: formation, function, and application mita/sting and its alternative splicing isoform mrp restrict hepatitis b virus replication inhibition of hepatitis b virus replication by activation of the cgas-sting pathway the cyclic gmp-amp synthetase-sting signaling pathway is required for both the innate immune response against hbv and the suppression of hbv assembly viral dna-dependent induction of innate immune response to hepatitis b virus in immortalized mouse hepatocytes lack of immunological dna sensing in hepatocytes facilitates hepatitis b virus infection activation of sting in hepatocytes suppresses the replication of hepatitis b virus hepatitis b virus evades innate immunity of hepatocytes but activates cytokine production by macrophages trex1 regulates lysosomal biogenesis and interferon-independent activation of antiviral genes inducible expression of human hepatitis b virus (hbv) in stably transfected hepatoblastoma cells: a novel system for screening potential inhibitors of hbv replication the amount of hepatocyte turnover that occurred during resolution of transient hepadnavirus infections was lower when virus replication was inhibited with entecavir interferons accelerate decay of replication-competent nucleocapsids of hepatitis b virus interferon induction of ifitm proteins promotes infection by human coronavirus oc43 hepatitis b virus e antigen production is dependent upon covalently closed circular (ccc) dna in hepad38 cell cultures and may serve as a cccdna surrogate in antiviral screening assays assembly of hepatitis delta virus: particle characterization, including the ability to infect primary human hepatocytes effect of alpha interferon on the hepatitis c virus replicon we thank dr. eain a. murphy for critical reading and comments on the manuscript. conceptualization: fang guo, jinhong chang, ju-tao guo. key: cord-026112-58sa5z03 authors: dehghani-dehej, farzaneh; hosseini, zinat; mortazkar, poupak; khanaliha, khadijeh; esghaei, maryam; fakhim, atousa; bokharaei-salim, farah title: prevalence of hcv and/or hbv coinfection in iranian hiv-infected patients date: 2020-04-24 journal: nan doi: 10.2217/fvl-2019-0066 sha: doc_id: 26112 cord_uid: 58sa5z03 aim: hiv-infected patients risk coinfection with hbv and hcv. this study aimed to investigate molecular epidemiology of hbv and hcv coinfection in iranian hiv-infected individuals. materials & methods: in this cross-sectional study, serological markers of hbv and hcv infection (hepatitis b surface antigen [hbsag], hepatitis b e-antigen [hbeag], hepatitis b e-antibody [hbeab] and hepatitis b core antibody [hbcab]) and anti-hcv antibodies [anti-hcv abs] were tested in 198 iranian hiv-infected patients. from plasma, hbv viral load was determined using cobas taqman 48, and hcv-rna was detected by reverse transcriptase-nested pcr. results: 85 out of 198 (42.9%) patients were anti-hcv ab positive and 42/198 (21.2%) had detectable hcv-rna. eight (4.0%) had traceable hbv-dna. all these patients were infected by hbv genotype d. 55 (27.8%) were hbcab positive. nine (4.4%) were hbsag and anti-hcv ab positive. conclusion: none were hiv-rna/hcv-rna/hbv-dna positive, 21.2% were hiv-rna/hcv-rna positive and 4.0% were hiv-rna/hbv-dna positive. therefore, studies on diagnosing these infections in hiv-infected individuals may be valuable. epidemiology of the infection [11, 12] . hepatitis c has a global impact in terms of mortality and morbidity with over 70 million people infected all around the world [13] . according to studies in iran, the prevalence of hcv infection is nearly 0.5% (1.0% in men and 0.1% in women) [14, 15] . for hcv infection and the liver damage associated with it, the leading cause of mortality and morbidity is among hiv-infected patients. according to available evidence, hiv/hcv-coinfected patients are at higher risk for liver cirrhosis and hepatocellular carcinoma (hcc) [16, 17] . given that the transmission routes of hiv, hbv and hcv viruses are common, these infections can occur simultaneously. worldwide, nearly 40 million people are living with hiv, about 2.6 million people are infected with hbv and about 2.8 million people are hcv-infected [2] . hiv infection intensifies natural history of hbv infection, which can lead to an increase in rates of hbv persistence, relapse of hbv (resurgence of hepatitis b surface antigen [hbsag] , hepatitis b e-antigen [hbeag] or hbv-dna) and considerable clinical disease. previous studies of the hbv/hiv coinfection have shown that hiv leads to a lack of protective immunity against hbv, increased risk of cirrhosis and hcc and liver-related mortality [18, 19] . the effect of antiretroviral therapies (arts) on the natural history of hbv-related disease have been different, in some studies, it leads to recovery from hbv infection and in other studies, with relapse of hepatitis b [18, 20] . the death rate in hiv-positive patients decreased after taking combination arts, but only in those with hiv/hbv or hiv/hcv coinfection. the mortality rate is high due to liver damage. hiv/hbv-coinfected people have a higher rate of progression to liver fibrosis, cirrhosis, hcc, less clearance of hbsag and occult hbv infections (obi) are more frequent in these patients [13] . therefore, it seems that screening for hbv infection in the hiv-infected individuals should be done. testing hbsag, hbeag and ab and determining hbv viral load are an essential part of hbv infection assessment in hiv/hbv-coinfected patients. obviously, determination of cd4 counts and hiv viral load are necessary along with the antiretroviral drug-resistant response [21] . according to evidence, hcv/hiv-coinfected patients are at higher risk for cirrhosis and hcc [22] . hiv infection exacerbates natural history of hcv infection. hcv-rna loads in these patients are higher and clearance of hepatitis c viremia after acute infection in hiv-positive patients are less, and liver diseases in these patients show more progress than patients with hiv infection alone [20] . it is known that hbv and hcv infections have been associated with various clinical manifestations in people with hiv infection including impaired immune response during arts, and also increased susceptibility to artsrelated liver toxicity [23] . therefore, prior to the administration of art, patients should be tested for the presence of these infections. the aim for this study is to investigate the prevalence of hcv and/or hbv coinfection in iranian hiv-infected individuals. from september 2015 to june 2018, 198 consecutive iranian hiv-positive individuals who were referred to hospitals affiliated with iran university of medical sciences (iums), tehran, iran, were entered to this study. the research was approved by the iums' ethical committee, and all of the studied population were informed about this survey, and a written informed consent was obtained from all the subjects and also from parents of hiv-infected children in this cross-sectional study. collection of the specimens 5 ml of the patient's blood was taken from each participant into an edta-containing vacutainer tube. after separation of the plasma by centrifugation (5 min at 3000 rpm), plasma was stored at -80 • c until analysis. plasma specimens from ten individuals who were infected with hcv, and ten subjects who were infected with hbv were used as positive controls, and also plasma samples from ten healthy blood donors were used as negative controls for the experiments. serologic tests by enzyme immunoassay serological markers of hbv and hcv infection such as hbsag, hbeag, hepatitis b e-antibody (hbeab), hepatitis b core antibody (hbcab) and anti-hepatitis c virus antibodies (anti-hcv) abs were tested by the commercial enzyme immunoassay kits (dia. pro, milano, italy), according to the manufacturer's protocols. hbv viral load was assessed in 500 μl of the studied subjects plasma specimens using the high pure dna extraction kit and cobas taqman 48 kit (roche diagnostics, ca, usa) according to the manufacturer's procedure [24] . this test is a real-time pcr assay that is based on dual-labeled hybridization probe that targets two regions (precore and core) of hbv. the detection limit of the cobas taqman 48 kit is 6 to >1 × 10 8 iu/ml [25] . the hbv genotyping was determined in hbv-dna-positive specimens using the inno-lipa™ hbv kit (innogenetics, ghent, belgium) according to the manufacturer's protocols [26] . hcv detection by reverse transcriptase-nested pcr method & hcv genotyping with restriction fragment length polymorphism assay to detect genomic hcv-rna in the plasma samples of studied subjects, the viral rna was isolated from 140 μl of plasma using the qiaamp viral rna isolation kit (qiagen gmbh, hilden, germany) based on the manufacturer's procedure. the quantity and quality of the extracted rna was evaluated using the nanodrop™ spectrophotometer (thermo fisher scientific, wilmington, nc, usa) [27] . the hcv-rna was detected in extracted rna of plasma samples by the reverse transcriptase-nested pcr (rt-nested pcr) assay using two sets of primers for the 5non-translated region (5 -ntr) of hcv, as previously described in detail [28, 29] . the amplified pcr products of subjects' samples, negative and positive control specimens, and 100 bp dna size marker were electrophoresed on a 2.2% gel agarose and then stained with syber green and visualized by a uv transilluminator. the genotyping of hcv was determined in hcv-positive samples with restriction fragment length polymorphism (rflp) assay, based on a protocol that previously described in detail [28, 29] . the statistical analysis was performed using spss software version 20 (spss inc., il, usa). the kolmogorov-smirnov test was conducted to determine the quantitative variables' normality. the analysis of continuous variables was done using kruskal-wallis and one-way analysis of variance (anova) tests. the statistical differences between the two groups were evaluated by fisher's exact test and chi-square test when appropriate. p-values <0.05 were considered statistically significant. from september 2015 to june 2018, a total of 198 hiv-infected individuals (anti-hiv abs and hiv-rna positive) were enrolled in this cross-sectional study. the mean age of subjects was 35.3 ± 13.5 years (a range of 1-68 years old). out of 198 studied individuals, 126 (63.6%) were male. complete information of the demographic, laboratory and epidemiological characteristics were presented in table 1 . a significant association was observed between the sex of the participants and alanine aminotransferase (alt), aspartate aminotransferase (ast) level, anti-hcv abs, hcv-rna (p < 0.001) in plasma samples, and also in epidemiological parameters such as history of having unprotected sex, history of imprisonment, injection drug users (idus), idu sexual partners, history of tattooing, history of needle stick (p < 0.001) and history of transfusion (p = 0.034) ( table 1) . a significant relationship was observed between coinfection with hcv or hbv in hiv-infected patients and cd4 + t-cell count (p = 0.044), in other words, cd4 + t-cell count was very low in patients with these coinfections. a strong association was observed between the sex of the participants and level of education (p = 0.042) and marital status (p < 0.001) ( table 2) . 85 (42.9%) of studied subjects were positive for anti-hcv abs in plasma samples; and 42 (21.2%) had detectable hcv-rna in the plasma ( table 1 ). the hcv genotyping was performed using rflp assay for hcv-rna-positive specimens, and the results of hcv genotyping are presented in table 3 . eight (4.0%) of the studied cases had detectable hbv-dna in the plasma samples ( table 1 ). the hbv genotyping was carried out for these samples by the inno-lipa hbv kit. all these patients were infected by hbv genotype d. 55 (27.8%) of the participants were hbcab positive, and a strong relationship was observed between the sex of the studied participants and anti-hbcab in plasma specimens (p < 0.001) ( table 1) . this survey demonstrated that none of the iranian hiv-infected individuals were hiv-rna/hcv-rna/hbv-dna positive simultaneously, 21.2% were hiv-rna/hcv-rna positive and 4.0% were hiv-rna/hbv-dna positive. no significant association was observed between the hiv viral load in coinfected patients and monoinfected patients (p = 0.054). nine (4.4%) of the studied hiv-infected patients were hbsag and anti-hcv ab positive. all the information about demographic and laboratory parameters of these patients are presented in table 4 . despite the existence of successful prevention and treatment methods, the simultaneous infection of hiv, hbv and hcv is still a worldwide health issue. with the use of antiretroviral medicines and longer life expectancy in 10 hiv-infected patients, the complications of this chronic disease and its intersection with other viral infections are more evident [30] . in iran, the prevalence of hiv and other blood-related viral infections, such as hcv is relatively low in the general population [31] . the present survey was conducted on 198 individuals who were infected with hiv to investigate the molecular epidemiology of hcv/hbv coinfection in these individuals. this study showed that none of the hiv-infected people were hiv-rna/hcv-rna/hbv-dna positive simultaneously, 4.0% were hiv-rna/hbv-dna positive and 21.2% were hiv-rna/hcv-rna positive. hcv infection is more common in people infected with hiv than in hiv-negative individuals [32] . the rate of hcv/hiv coinfection is different around the world and is heavily dependent on geographical location, socioeconomic conditions of that particular location and high-risk groups [32] . nearly 37 million people are infected with hiv so far and about 70 million people all over the world are infected with hcv [2, 13] . approximately 2,278,400 people have hiv/hcv coinfection in the world, and about 62% of them are people that have been infected through injecting drugs [32] . the present study showed that approximately 81 (40.9%) of the patients are those who have injected drugs and about 46 (23.2%) of them are those who had idu sexual partner (that includes only women) ( table 1 ). the epidemiologic parameters such as injection drug abuse, needle sharing, tattooing, history of imprisonment and history of having unprotected sex revealed higher prevalence of hcv-coinfection in these patients compared with monoinfected cases. in the coinfected patients, the level of liver enzymes alt/ast was significantly high. while the first way of hiv transmission in iran is from sharing injection needles among idus [33] , hiv transmission cases in idus has begun to decline from 2005, a trend that has continued so far, and today hiv transmission through unprotected sexual contact is increasing (36.8%) [34, 35] . in this study the number of idus was 81 (40.9%). since the transmission of hcv by sexual contact is a rare phenomenon, the number of people coinfected with hcv/hiv is expected to decrease in the future [3, 36] . in the current study, 75 (37.9%) of the hiv-positive patients had a history of unprotected sex and probably the hiv virus in these patients transferred through unprotected sex. perhaps this is the reason for the decrease in the number of patients with hcv/hiv coinfection (21.2%) compared with previous reports [37, 38] . of course, in recent years, the increase in the transmission of hcv in males that have sexual intercourse with other males has been seen due to high-risk sexual behaviors. in addition, there have been cases of hcv spontaneous clearance in people who inject drugs (pwid) after art [39, 40] . the hcv genotyping on the plasma specimens showed a prevalence for subtypes, 1a (40.5%), 1b (16.7%) and 3a (33.3%). in four samples, the divergence genotype detected a mixed infection of two subtypes (1a/3a-1ab/3a) ( [41] [42] [43] . according to various reports from around the world, it seems that more research is required in this field with a wider population. like hcv infection, all hiv-infected patients should be screened for hbv infection. cirrhosis, hcc and hepatotoxicity after arts are the effects of hbv/hiv coinfection [44] . hbv vaccination should be done in all hiv individuals with hbv-negative laboratory tests. similar to hcv, hcc occurs in hbv/hiv-coinfected patients without cirrhosis [45] . hbv viral load is higher in hiv/hbv-coinfected patients than hbv-monoinfected individuals [46] . the present study found that 55 (27.8%) of these patients have anti-hbcab and 25 (12.6%) of them have hbsag. in some people, antibodies of the hbv core can be detected without anti-hbsag and hbeag [47] . our study confirms previous reports that male subjects are at high risk of developing hbv infection. typical methods for the transmission of both hbv and hiv are the sexual pathway and injection drug abuse [48] , while transmission of hcv by sexual pathway is unusual and given that in recent years the pathway for hiv transmission has changed, the prevalence of hcv is changing, but a significant change in the prevalence of hbv is unlikely to occur [49] . in a study on blood donors with an nat test in tehran, the incidence and residual risk for hiv was lower than those in developed countries, whereas hbv and hcv was higher compared to developed countries. in the iranian population, hiv infection is lower than the other countries, and screening tests are effective for blood donors. in the case of hcv, an increased incidence of hcv infection has been observed in the iranian society and in blood donors in recent years; this may be due to the highest number of idus in iran compared to other middle eastern countries [50] . incidence and high residual risk in iran indicates the nature of the endemic hbv virus. due to the launch of hbv vaccination in iran in 1993, we have to wait for the effects of the vaccination among the iranian population. based on that study, blood donors should have a more accurate technique similar to the accurate nat-screening techniques [51] . in patients with coinfection of hiv with hcv and/or chronic hbv, progressive liver fibrosis, cirrhosis and hcc can occur and coinfection of hiv with hbv and/or hcv can affect the management of hiv infection and complicate it [44, 52] . therefore, it is best to identify infection of hepatitis as quickly as possible. the result of this study revealed that none of the participants were hiv-rna/hcv-rna/hbv-dna positive simultaneously. to the best of our knowledge, the current survey is the first research that has analyzed the presence of the molecular epidemiology of hcv/hbv coinfection in iranian hiv-infected individuals; therefore, the results of this study cannot be compared with the result of other iranian research. there have been reports of coinfection with hbv and hcv in hiv-positive people, for example, 0.5% in singapore [53] , 0.62% in germany [54] and 1.7% in serbia [55] . it seems that further research focusing on this issue is needed. although there are studies that indicate seroprevalence of hiv/hcv/hbv coinfection in iran. for example, bakhti et al. found that 8% of hiv-infected individuals are coinfected with hcv/hbv (hbsag and anti-hcv ab positive), and in a meta-analysis, bagheri amiri et al. reported that coinfection of hiv/hbv/hiv was close to zero in the general population, street children and healthcare workers, while it peaked to 1.25% in pwid [56] . this study revealed that in iranian hiv-infected individuals, 4.4% of the individuals are seropositive for hbv/hcv (hbsag and anti-hcv ab positive). according to a previous study, prevalence of cirrhosis in hiv/hbv/hcv triple-infected patients was higher than hiv/hbv-or hiv/hcv-coinfected individuals [57] . therefore, prevention programs for hiv/hbv/hcv coinfection are in need of development. this study reveals that there is a high prevalence of hcv infection (21.2%) in hiv-infected individuals (hiv-rna/hcv-rna positive), as well as 4% of these people infected with hbv (hiv-rna/hbv-dna positive). also, the result of this survey highlighted that none of the hiv-infected subjects were hcv-rna/hbv-dna positive simultaneously. therefore, it seems that in hiv-positive patients, in addition to routine diagnosis of all the authors of this article are very grateful to those who volunteered to participate in this research. the current research was funded by research deputy of iran university of medical sciences (iums), tehran, iran with grant number 8921215087. the authors have no other relevant affiliations or financial involvement with any organization or entity with a financial interest in or financial conflict with the subject matter or materials discussed in the manuscript apart from those disclosed. no writing assistance was utilized in the production of this manuscript. ethical approval for this research was obtained from the local ethics committee of iran university of medical sciences (iums), tehran, iran, that is accordance with helsinki declaration (ethical code: ir.iums.fmd.rec 1396. 8921215087). all of the volunteers participating in this study were informed about this research prior to their enrollment. in addition, for investigations involving human subjects, informed consent has been obtained from the participants involved. hiv diagnosis and treatment through advanced technologies world health organization global health observatory current diagnostic methods for hiv interference of apoptosis by hepatitis b virus characterization of hepatitis b virus with complex structural variations hiv-hepatitis b virus coinfection: epidemiology, pathogenesis, and treatment global epidemiology of hepatitis b virus infection: new estimates of age-specific hbsag seroprevalence and endemicity hepatitis b: screening, awareness, and the need to treat hepatitis b virus infection in the general population of iran: an updated systematic review and meta-analysis hepatitis c virus (hcv) genotyping by annealing reverse transcription-pcr products with genotype-specific capture probes identification of a novel hepatitis c virus genotype from punjab, india: expanding classification of hepatitis c virus into 8 genotypes molecular epidemiology of hepatitis c virus in cambodia during 2016-2017 hepatitis b, hepatitis c, and mortality among hiv-positive individuals seroprevalence of hepatitis c virus: the first population-based study from iran the impact of ifn-γ gene polymorphisms on spontaneous clearance of hcv infection in fars province, southern of iran the presence of autoantibodies to cytoplasmic rod and ring particles in the serum of patients with chronic hepatitis c virus infection hepatocellular carcinoma after sustained virological response with interferon-free regimens in hiv/hepatitis c virus-coinfected patients hiv-1, hepatitis b virus, and risk of liver-related mortality in the multicenter cohort study (macs) hepatitis b and long-term hiv outcomes in co-infected haart recipients survival in patients with hiv infection and viral hepatitis b or c: a cohort study management of hiv and hepatitis virus coinfection human immunodeficiency virus/hepatitis c virus (hcv) co-infected patients with cirrhosis are no longer at higher risk for hepatocellular carcinoma or end-stage liver disease as compared to hcv mono-infected patients liver fibrosis and hepatitis b coinfection among art naive hiv-infected patients at a tertiary level hospital in northwestern tanzania: a cross-sectional study detection of hepatitis b virus covalently closed circular dna in the plasma of iranian hbeag-negative patients with chronic hepatitis b detection of hbv genome in the plasma and peripheral blood mononuclear cells of iranian hbsag negative patients with hiv infection: occult hbv infection distribution of hepatitis b virus genotypes in azerbaijani patients with chronic hepatitis b infection prevalence of jc polyomavirus large t antigen sequences among iranian patients with central nervous system tumors hepatitis c genotypes in finland determined by rflp occult hepatitis c virus infection in iranian patients with cryptogenic liver disease trends in underlying causes of death in people with hiv from co-infection of human immunodeficiency virus, hepatitis c and hepatitis b virus among injection drug users in drop in centers prevalence and burden of hcv co-infection in people living with hiv: a global systematic review and meta-analysis trend of hiv/aids prevalence and related interventions administered in prisons of iran − 13years' experience antiretroviral drug resistance mutations in naïve islamic republic of iran aids progress report hiv-1 genetic diversity and transmitted drug resistance frequency among iranian treatment-naive, sexually infected individuals epidemiological distribution and genotype characterization of the hepatitis c virus among hiv patients in kashan high prevalence of hcv coinfection in hiv-infected individuals in shiraz, islamic republic of iran sexually transmitted hepatitis c infection: the new epidemic in msm? occasional spontaneous clearance of chronic hepatitis c virus in hiv-infected individuals hiv and hcv coinfection: prevalence, associated factors and genotype characterization in the midwest region of brazil prevalence of hepatitis c virus (hcv) coinfection in hiv infected individuals in south india and characterization of hcv genotypes detection and analysis of hepatitis c virus in hiv-infected patients in the guangxi province of china long-term liver diseases after initiation of antiretroviral therapy in hiv-infected patients with and without hbv or hcv coinfection risk of hepatocellular carcinoma across a biological gradient of serum hepatitis b virus dna level hiv-hepatitis b virus co-infection: epidemiology, pathogenesis and treatment isolated antibody to hepatitis b core antigen in human immunodeficiency virus type-1− infected individuals hepatitis c, hepatitis b, and human immunodeficiency virus infections among non-intravenous drug-using patients attending clinics for sexually transmitted diseases epidemiology of hepatocellular carcinoma: new trends prevalence and trend of hepatitis c virus infection among blood donors in iran: a systematic review and meta-analysis incidence and residual risk of hiv, hbv and hcv infections among blood donors in tehran hepatic decompensation in antiretroviral-treated patients co-infected with hiv and hepatitis c virus compared with hepatitis c virus-monoinfected patients: a cohort study factors associated with hepatitis b and c co-infection among hiv-infected patients in singapore daclatasvir plus sofosbuvir, with or without ribavirin, in real-world patients with hiv-hcv coinfection and advanced liver disease comparison of demographic, epidemiological, immunological, and clinical characteristics of patients with hiv mono-infection versus patients co-infected with hcv or/and hbv: a serbian cohort study hbv and hcv coinfection prevalence in iran-a systematic review and meta-analysis hepatic decompensation in patients with hiv/hepatitis b virus (hbv)/hepatitis c virus (hcv) triple infection versus hiv/hcv coinfection and the effect of anti-hbv nucleos(t)ide therapy key: cord-003993-3bozjfv7 authors: cagliani, rachele; forni, diego; sironi, manuela title: mode and tempo of human hepatitis virus evolution date: 2019-10-25 journal: comput struct biotechnol j doi: 10.1016/j.csbj.2019.09.007 sha: doc_id: 3993 cord_uid: 3bozjfv7 human viral hepatitis, a major cause of morbidity and mortality worldwide, is caused by highly diverse viruses with different genetic, ecological, and pathogenetic features. technological advances that allow throughput sequencing of viral genomes, as well as the development of computational tools to analyze such genome data, have largely expanded our knowledge on the host range and evolutionary history of human hepatitis viruses. thus, with the exclusion of hepatitis d virus, close or distant relatives of these human pathogens were identified in a number of domestic and wild mammals. also, sequences of human viral strains isolated from different geographic locations and over different time-spans have allowed the application of phylogeographic and molecular dating approaches to large viral phylogenies. in this review, we summarize the most recent insights into our understanding of the evolutionary events and ecological contexts that determined the origin and spread of human hepatitis viruses. human hepatitis viruses are extremely diverse and consequently belong to different viral families (table 1 ). in recent years, the availability of high-throughput technologies has revealed that relatives of human hepatitis viruses can be found in a wide variety of animals. this finding, as well as the increasing availability of the genome sequences of human-infecting viruses sampled across different geographic areas, has largely expanded our knowledge about the genetic diversity and evolutionary origin of these human pathogens. in this review, we thus focus on the latest insights into the possible events and ecological contexts that determined the origin and spread of human hepatitis viruses. a short presentation of the most widely used approaches to estimate the ages of viral lineages is also provided to contextualize recent research efforts on these viruses. molecular dating analyses using virus genetic data can be particularly informative due to the rapid rate of evolution of many viral species. by converting genetic differences among sequences into time units, molecular dating provides information on the timing of viral spread or emergence. most molecular dating approaches are based on maximum-likelihood or bayesian phylogenetic frameworks [5, 6] , and they usually exploit two strategies: molecular clock calibration using the sampling dates of the viral sequences (tip dating) and/or calibration using information on some internal nodes of the phylogeny. tip dating is well-suited to study relatively recent events (e.g., epidemics or intra-host evolution), but requires that a temporal signal is present in the dataset (i.e., that the sequences have accumulated a measurable amount of change between sampling times) [6] . calibration using internal nodes can in principle allow to dig deeper into the past, but requires some a priori knowledge about the virus evolutionary history (e.g., host-virus co-evolution, paleontological information). the widespread use of molecular dating has however revealed that the relationship between genetic divergence and time is complex, as evolutionary rates tend to vary with the time frame of measurement. in particular, high evolutionary rates are observed in the short term, whereas low rates are inferred in long time span studies [7] [8] [9] . this pattern was observed for many viral lineages and is sometimes referred to as the time-dependent rate phenomenon (tdrp) [10] . failure to account for the tdrp can potentially lead to erroneous molecular dating results [10, 11] . the tdrp reflects mutation rate in very short timescales and substitution rate in very long timescales, during which transient deleterious mutations are removed by the action of natural selection, leading to lower rate estimates [12] . another factor most likely contributing to the tdrp is the saturation of nucleotide substitutions, which is extremely rapid in viral genomes, especially when the polymerase is error-prone [12] . thus, recent analyses indicated that, for all baltimore classification groups, viral evolutionary rates tend to decrease continuously with the timescale of measurement [10, 11] . because the rate of decay is consistent with a power law relationship between substitution rate and sampling timescale, a model using a simple regression was at first proposed to estimate the tdrp effect on viral phylogenies [10] . very recently, this approach was implemented in a bayesian statistical framework, in which evolutionary rates can vary among different time epochs [13] . before the introduction of such an approach, effective attempts to correct for the tdrp were performed by the use of nucleotide substitution models that allow site-and branch-specific variation in selective pressure (selectioninformed models). these models, which were applied to analyze the ancient evolution of some viral lineages, at least partially correct for the effects of both purifying selection and substitution saturation in branch length estimation [14] [15] [16] . hav is mainly transmitted via the faecal-oral route through exposure to contaminated food or water, or through direct contact with infected people. hav is a single-strand, positive rna virus with a genome of approximately 7.5 kb in length ( table 1 ). the hav genome contains a single orf flanked by a relatively long 5 0 utr and a 3 0 utr. the 5 0 utr harbors an internal ribosome entry site that directs the cap-independent translation of hav proteins. the orf encodes a polyprotein processed in 11 mature proteins: 5 structural proteins involved in capsid formation (vp4, vp2, vp3, vp1, and px, deriving from p1 segment) and 6 nonstructural proteins with a role in rna genome amplification (2b, 2c, 3a, 3b, 3cpro, and 3dpol, deriving from p2 and p3 segments) [4, 17] . based on genomic structure, hav belongs to the family picornaviridae within the genus hepatovirus. nevertheless, many characteristics distinguish hav (and hepatoviruses in general) from other picornaviridae family members. some peculiar features include the primary tropism for hepatocytes, the ability to shed as nonenveloped virus in feces and as enveloped particles in blood, as well as some genomic features such as low g/c ratio, low cpg levels, and strong codon bias [18, 19] . hav was identified as the etiologic agent of hepatitis a by feinstone and colleagues [20] in 1973. unlike hbv and hcv, which establish chronic infections in humans, hav infection is usually acute and generates lifelong immunity. this condition is able to determine the disappearance of the virus in small and isolated populations [21, 22] and did not probably favor its maintenance in early human communities. it is thus legitimate to wonder how hav survived and evolved during early human history, a question that remains presently unanswered. for a long time, it was thought that hepatoviruses were restricted to humans and non-human primates (nhps), with genetically distinct variants classified as six main different genotypes [23] : three isolated from humans (hav, genotype i-iii) and subclassified in 6 subgenotypes (ia, ib, iia, iib, iiia, iiib) and three of simian origin (shav, genotype iv-vi). however, despite genetic heterogeneity, hav viruses belong to a single common serotype. in recent years, the advent of new sequencing approaches has led to an exponential increase in the identification of new viral speacute cies, including highly diverse non-primate hepatoviruses. several hav-related viruses were identified in different mammalian orders. in particular, a number of hav-like viruses were recovered in placental mammals, mainly in bats and rodents, but also in tree shrews, hedgehogs, seals and chinese woodchucks [24] [25] [26] . recently, de oliveira carneiro and colleagues [27] identified a novel hav-related virus in didelphis aurita, a brazilian common opossum, further extending the host range of mammal-infecting hepatoviruses. moreover, viruses related to mammalian hepatoviruses were detected in reptiles, amphibians, and fish [28] . these advances allowed new insights into the evolutionary history of hav. the phylogenetic relationships among hepatovirus that infect small mammals only partially reflects those among their hosts, suggesting multiple, non-recent cross-species and cross-order host switches during hepatovirus evolution [24] . this observation is supported by recombination events observed in hepatoviruses that have been identified in genetically and geographically distant hosts [29] . these cross-species transmission events also involved the opossum hepatovirus, which most likely originated from an ancestral host switch from rodents into marsupials [27] . conversely, hepatovirus phylogenies suggest no host switch involving a primate donor. this evidence, the absence of recombination events between havs and non-primate hepatoviruses, as well as the observation that primate hepatoviruses form, regardless of the genomic region considered, a monophyletic group in the topology of hepatovirus phylogenies, support the hypothesis that humans and nhp have acquired hepatoviruses from other animal reservoirs relatively recently [24, 29] . however, if and when this hypothetical host-jump occurred into primates remains to be clarified. phylogenetic and ancestral state reconstruction suggested a likely cricetid rodent origin for primate havs and marsupial hepatoviruses, whereas a laurasiatherian host origin was proposed for all mammalian hepatoviruses [24, 27] (fig. 1) . in this scenario, the evolutionary history of hepatoviruses is evocative of that of hantaviruses, as the origin of mammalian hantaviruses is traced back to bats and insectivores [30] . thus, the supposed origin of hepatoviruses in insectivorous laurasiatherian mammals, as well as the preservation of some structural and functional characteristics similar to present-day insect picorna-like viruses (dicistroviridae) [31] led drexler and colleagues to hypothesize a more ancient evolutionary origin of havs, with an ancestry in a primordial insectborne virus [24] . in conclusion, hav emergence in humans likely represents a relatively recent evolutionary event, probably of zoonotic origin. nonetheless, the ancestor of human hepatoviruses has yet to be identified. the characterization of other hepatoviruses in primates, and mammals in general, will be instrumental to the identification of the hav ancestors and will clarify the evolutionary history of hepatoviruses. hbv was the first human hepatitis virus to be isolated and identified in 1970 [32] . hbv transmission varies depending on the prevalence of infection. in areas with a low prevalence (<2%), the most common mode of transmission is through infected blood or high-risk behaviors (e.g. unprotected sex or injecting drug use). in high-and intermediate-prevalence areas, hbv is commonly spread through perinatal and horizontal (especially among children) routes [33] . hbv belongs to the hepadnaviridae family, which comprises two genera: orthohepadnavirus (mammal-infecting viruses) and avihepadnavirus (bird-infecting viruses) ( fig. 2a) . its genome, a partially double-stranded circular dna of about 3.2 kb (table 1) , is composed of four overlapping frameshifted open reading frames (orfs) [34] . viral replication is carried out by a reverse transcriptase with no proofreading ability and considerable variability exists among strains. thus, at least nine genotypes (a-i) plus a tentative one (j), with a heterogeneous global distribution, have been described to date [35] [36] [37] [38] [39] (fig. 2b) . despite its worldwide diffusion and the accumulation of detailed knowledge on the associated pathologies, the origin and evolutionary history of hbv are still debated [34, 40] . hepadnaviruses were detected in several mammals, including nhps, rodents and bats, birds, fish, and reptiles [41, 42] (fig. 2a) . recently, lauber et al. discovered a family of fish viruses with genomic features similar to those of hbv, dating the origin of the hepdnaviridae family to at least 300 million years ago [43] ; this finding, together with the discovery of endogenous hepadnavirus elements integrated in the genome of birds and reptiles [44] [45] [46] [47] , suggests a long and complex relationship between this viral family and its hosts. concerning hbv, different theories were proposed to explain its origin, but all of them have some sort of limitation. hbv was initially thought to have emerged quite recently in the new world from genotypes f/h infecting amerindians [48, 49] ( fig. 2a and b). however, the discovery of an ancient strain in a 16th century asian mummy, as well as the worldwide diffusion of hepadnaviruses in nhps, questioned this hypothesis [50] (fig. 2a ). an alternative theory suggests that hbv followed the out-of-africa migration of modern humans, which occurred approximately 60,000 years ago [51] [52] [53] . in particular, paraskevis et al. found a good correspondence between the demographic histories of hbv and those of human populations [53] . these authors also showed that the substantial divergence of the f and h genotypes ( fig. 2a) , a major evidence in favor of the new world origin hypothesis [49] , was probably due to positive selection acting on those branches [54] . nonetheless, the extensive application of ancient dna sequencing revealed a more complex scenario. in fact, two european neolithic hbv genomes did not cluster with any extant human strain in the phylogenetic tree, but did cluster with nhp viruses [55] (fig. 2a ). other authors [9] , who sequenced 12 ancient hbv genomes of different ages (800-4500 years old), obtained a similar result, with the ancient strains clustering with known modern genotypes or forming new clades ( fig. 2a) . this implies that some hbv lineages of the past went extinct ( fig. 2a) . moreover, muhlemann and coworkers showed that the geographic distribution of ancient samples does not match the modern genotype distribution [9] . they thus suggested that early evolutionary scenarios can be concealed and overwritten by more recent migratory events [9] . a third hypothesis for the origin of hbv posits that hepadnaviruses co-speciated with their primate hosts in the new world and in the old world. thus, multiple zoonotic transmissions would have originated hbv genotypes found in humans [56] . this scenario is supported by the diffusion of hepadnaviruses in diverse primate species and by the inferred divergence time of the orthohepadnavirus and avihepadnavirus genera, that is very similar to that of their host classes [56] . however, the recent identification of a novel hepadnavirus in capuchin monkeys confirmed that new world monkeys are infected by viruses that are very distantly related to hbv ( fig. 2a) , indicating that they do not represent the direct ancestors of genotypes h and f [41] . instead, evolutionary analyses with human and nhp viral strains placed the origin of hbv ancestors in hominoid old world primates, preceding the formation of the human lineage [41] . in summary, although considerable progress was achieved in recent years, a high level of uncertainty concerning the ultimate origin of hbv still exists. the particular organization of the viral genome (i.e. overlapping reading frames in a short genome) limits the variability of most of nucleotide positions (i.e. to avoid the introduction of nonsynonymous mutations) and results in a relatively slow mutation rate. this characteristic, along with the action of natural selection on particular genotypes [54] , as well as the adaptation to different human populations [34] , contributes to hbv variability and complicates inferences about its origin. finally, different studies [9, 50, 57] have shown that, as for other viruses (see section 2), hbv substitution rates are affected by viral sampling time frames. indeed, the evolutionary rates generated using information from ancient hbv genomes were shown to fit well with the tdrp regression line calculated for baltimore group vi and vii viruses (i.e., reverse-transcribing viruses) [11] . crucially, these results indicate that, whereas tip calibration approaches have demonstrated to be useful in the reconstruction of recent epidemiological events [58] [59] [60] , limiting analysis to extant strains for the reconstruction of ancient hbv evolution can be misleading [9] and that approaches that correct for the tdrp should be envisaged. hcv is an enveloped virus belonging to the flaviviridae family (genus hepacivirus). in analogy to other members of the family, hcv has a 9.6 kb positive-stranded linear rna genome. the virus encodes a single polyprotein that is processed by cellular and viral proteases to yield at least 10 mature products. hcv was identified in 1989 by houghton and colleagues as a cause of non-a and non-b hepatitis [61] . if left untreated, hcv can persist lifelong in humans, often resulting in cirrhosis and hepatocellular carcinoma. presently, the hcv worldwide seroprevalence is estimated to be $1% [1] , with about 71 million persons living with chronic infection [1] . the hcv epidemic apparently started recently, in the 1930s-1940s, as a consequence of practices that determined parenteral or percutaneous exposure (e.g., blood transfusion, vaccination campaigns, and intravenous drug injection) [62] [63] [64] . for instance, one of the most affected countries is egypt, where the virus was most likely disseminated through nationwide vaccination programs or contaminated blood-derived products [65] . in fact, sexual or vertical transmission of hcv are relatively rare, and the overwhelming majority of infections occur via the parenteral/percutaneous route. thus, due to historical reasons and to the transmission pattern, a small number of so-called ''epidemic" hcv subtypes (1a, 1b, 3a, and 2a) account for most infections worldwide [64, 66] . hcv is, however, genetically heterogeneous and the epidemic subtypes represent a minor fraction of viral diversity. eight major hcv genotypes (hcv-1 to -8) have been described, and these are further divided into at least 90 subtypes (https://talk.ictvonline. org/ictv_wikis/flaviviridae/w/sg_flavi/56/hcv-classification) (fig. 3a) . several of these genotypes and subtypes were identified and classified only recently [67, 68] , suggesting that a considerable proportion of hcv diversity remains undescribed. moreover, a number of natural inter-genotype recombinants were reported [24, 27] was generated using phyml [136] . hepatovirus host silhouettes are colored according to taxonomic order. the human hav subgenotypes are also reported. (https://talk.ictvonline.org/ictv_wikis/flaviviridae/w/sg_flavi/38/ table-4-recombinant-rf-hcv-genomes). hcv genotypes display antigenic variability and viral genetic diversity is geographically structured: in sub-saharan africa and south-east asia highly divergent subtypes of the same genotype dominate transmissions across contiguous areas (fig. 3a) . these subtypes are referred to as ''endemic" [62, 64] and their presence is consistent with a long-standing association of hcv with populations living in these regions. because parenteral exposure became common only in the relatively recent past, several hypotheses were formulated to account for the maintenance of endemic hcv transmission. some authors proposed that traditional practices such as circumcision, tattooing, piercing or acupuncture facilitated and maintained hcv infection among human populations [64, 69] . others indicated that sexually transmitted infections (stis) that disrupt mucosal integrity are responsible for increased sexual hcv transmission [70] . this was indeed shown to be the case in modern high-risk populations [71] and stis have probably been common throughout human history [72] . an alternative scenario is that the bite of arthropods, especially those taking large blood [138] ). graphical representation of genotype (gt) diversity. the number of distinct recognized subtypes is represented on the y axis. circle size is proportional to the average pairwise distance between subtypes. genotype 7 is marked with an asterisk as only two subtypes are known. (b) phylogenetic tree of the rdrp domain of known hepaciviruses. the tree was obtained using raxml with 1000 bootstrap replicates [139] . nodes with support equal to or higher than 0.7 are marked with a black dot. (c) hypothetical viral phylogenies that illustrate the effect of viral lineage extinction on the evolutionary inference about the origin of hcv and ehv/chv. in the left panel, a horse-to human transmission event is hypothesized, with the following extinction of the transmitted ehv lineage. in the right panel, a reverse zoonosis introduces a hcv-like virus in horse populations; the following extinction of several ehv lineages accounts for the low genetic diversity of extant strains. meals, can mechanically transmit hcv, possibly from other animal reservoirs such as horses [73, 74] . hcv infection is in fact restricted to our species but, thanks to extensive field work, a number of hepaciviruses have been described in domestic and wild mammals, as well as in reptiles and fish [28, [75] [76] [77] [78] [79] [80] [81] [82] [83] [84] (fig. 3b ). at present, the largest diversity of hepacivirus species seems to be hosted by rodents and bats (fig. 3b) . instead, as previously noted [75] , the lowest genetic diversity is observed for hepaciviruses that infect cattle and horses (fig. 3b) , suggesting that husbandry practices may have resulted in the artificial selection of specific viral strains or facilitated recent viral transmission from some other animal source (e.g., commensal rodents). non-human primates also host hepaciviruses, but these are highly divergent from hcv. overall, the phylogenetic relationships among hepaciviruses poorly mirror those among their hosts (fig. 3b ), suggesting several crossspecies and cross-order host switches during viral evolution. up to now, the closest relatives of hcv were identified in horses/donkeys (equine hepacivirus, ehv) and dogs (canine hepacivirus, chv) (fig. 3b) . because chv is less genetically diverse than ehv, the canine virus possibility originated as a recent cross-species transmission from horses [85] , hinting at the ability of hepacivirus to shift among genetically distant hosts. despite these advances, the events that led to the origin of hcv are still unknown. taking as a fact the relatedness of the human virus to ehv/chv, possible scenarios include that: i) hcv originated from a cross-species transmission of ehv, ii) that ehv was transmitted to horses by humans infected with hcv, which leaves the question on hcv origin open; iii) that hcv and ehv originated from the cross-species transmissions of the same (or similar) virus, with subsequent host adaptation and divergence. if this were the case, multiple crossspecies transmission events may have originated distinct hcv genotypes [85] . teasing apart these possibilities clearly requires understanding of the timing and circumstances of hcv (and ehv) evolution. up to date, no archaeological sample carrying traces of hcv or ehv has been described and the oldest hcv sequence dates to 1953 [86] (1979 for ehv [82] ). thus, molecular dating efforts have relied on extant sequences, with the difficulties associated with the tdrp. studies that did not account for the tdrp provided estimates of the time to the most recent common ancestor (tmrca) of hcv genotypes in a range between $200 and 1000 years ago [63, 64, 76, 87, 88] ; the origin of the horse virus was dated around 1800 ce [85] . a study that separately accounted for the rate of synonymous and nonsynonymous substitutions estimated hcv to have originated at least 2000 years ago [89] . recently, a method based on an a selection-informed model was used to estimate the divergence time of hcv genotypes and the origin of extant ehv/chv strains [70] . this approach, provided estimates of $3000 years ago for the tmrca of extant hcv genotypes (with a low-bound estimate of $5000 years before present) and of $800 years ago for ehv/chv [70] . if these dates are taken to provide at least an indication of the real evolutionary scenario, the possibility that hcv was transmitted to humans by horses infected with ehv can be excluded, an observation in line with the low diversity of ehv/chv [82] . the origin of ehv/chv as reverse zoonosis (i.e., the transmission of a human virus to animals) seems also unlikely, as in this case horse viruses should cluster within hcv diversity, unless the hcv lineage that originated ehv went extinct in the last 800 years. indeed, as the hbv story exemplifies, viral lineage extinction can occur and was previously documented for other human pathogens such as parvovirus b19 [90] , and variola virus [91] . as anticipated above, breeding practices may facilitate this process in the case of animal viruses. we know, for instance, that a minimum of two horse lineages went extinct during the domestication process and that horse genetic diversity has largely been shaped by events that occurred in the last few centuries [92] . it is thus possible that human-mediated selection on the host also resulted in the artificial selection of viral lineages. this would explain the relatively recent origin of extant ehv strains and their low diversity. if viral lineage extinction did occur, the time frames of ehv and hcv evolution would be underestimated and the scenario of hcv originating as a zoonosis from horses (or ehv as a reverse zoonosis) may still hold (fig. 3c) . of course, the alternative possibility that ehv and hcv were transmitted independently to their present-day hosts by a third unknown reservoir is also in line with data on extant diversity and, if the transmission to horses occurred recently, does not require to postulate viral lineage extinction. thus, a number of open questions remain on the origin of hcv. hopefully, technological advances that allow sequencing of trace genetic material from ancient samples will provide information on viral strains hosted by humans and horses back in the past. at the same time, the extensive application of metagenomic approaches to different animal hosts across diverse geographic regions will expand our knowledge on hepacivirus diversity and eventually uncover the direct ancestor of hcv (if it still exists). indeed, the possibility that the different hcv genotypes derived from independent cross-species transmission events [85] would imply that viruses related to hcv are relatively common in the wild, thus giving good chances to be recovered in large field surveys. hdv is a defective virus incapable of autonomous propagation [93] . its genome, a self complementary circular rna of $1700 nucleotides, encodes a single protein (the hdv-encoded delta antigen) ( table 1) . hdv requires hbv surface proteins, that are complexed with the delta antigen, to form transmissible virions [94] . thus, hdv is usually considered a satellite of hbv, although recent data have shown that other enveloped viruses can promote hdv propagation, at least in vitro (e.g. hcv, dengue virus, vesicular stomatitis virus) [95] . genetic heterogeneity among strains is quite high for hdv, which is thus classified in eight different genotypes (from 1 to 8), although a three major genogroup classification was recently proposed (group 1 for previous genotype 1, group 2 for genotypes 2 and genotypes from 4 to 8, and group 3 for previous genotype 3) [96] hdv genetic diversity is highest in africa, suggesting that the defective virus emerged in and spread from this continent [40, 97] . the evolutionary origin of hdv is nonetheless unknown. hdv-like circular rnas were only recently described in birds, reptiles, amphibians, fish and insects [98] [99] [100] . however, these hdvlike elements were not found to be associated with hepadnavirus infection, reinforcing the idea the hdv is not necessarily only transmitted in conjunction with hbv-related viruses, at least in these animals [100] . current evidence suggests that hdv evolved from the human cellular transcriptome [101] . the first indications that a virus was responsible for waterborne, epidemic hepatitis came from studies of asian outbreaks in the 1950-70s and, in analogy to hcv, the agent was referred to as ''epidemic non-a, non-b hepatitis" [102] [103] [104] . hepatitis e virus was eventually isolated and sequenced in the early 1990s [105, 106] . since then, a number of hev strains responsible for human infection were identified. hev is a positive-strand rna virus belonging to the hepeviridae family (table 1) . in common with all other members of this viral family, the hev genome comprises three partially overlapping open reading frames (orfs): orf1 and orf2 encode a non-structural [136] . the piscihepevirus branch is in red, orthohepevirus branches are in blue. the enlargement shows phylogenetic relationships for viruses belonging to the orthohepevirus a species, with representative hosts. (b) geographic distribution of anthropotropic (hev-1 and hev-2) and enzootic (hev-3-hev-4) hev strains. genotypes were assigned to countries irrespective of their prevalence. thus, even if a single case was reported in a given country, the genotype was recorded as present. cases that could be clearly ascribed to migration/travels were excluded. data derive from forni et al. [121] , with updates from [110, [140] [141] [142] [143] [144] [145] [146] [147] [148] [149] [150] [151] . (c) time-scaled phylogenetic tree of a non-recombing orf1 region [121] . branch lengths represent evolutionary time. the time-frames of historical events mentioned in the text are reported. the rabbit and camel silhouettes mark the split of the rabbit-infecting and camel/dromedary-infecting genotypes. the pig silhouette marks the human-restricted/enzootic genotype split. polyprotein and the viral capsid, respectively, whereas orf3 codes for a small phosphoprotein. a fourth orf (orf4), overlapping the helicase domain in orf1, was recently described but seems to be specific for some hev genotypes (hev genotype 1, hev-1) [107] . members of the hepeviridae family are currently classified into two genera, orthohepevirus and piscihepevirus [108] (https://talk. ictvonline.org/ictv-reports/ictv_online_report/positive-sense-rnaviruses/w/hepeviridae). the piscihepevirus genus includes only one species (piscihepevirus a) with one member (cutthroat trout virus), whereas the orthohepevirus genus is divided into four species of viruses infecting mammals and birds (orthohepevirus a-d) [108] (fig. 4a) . this classification is, however, likely to change in the near future following the identification of novel hepeviruses in fish other than trout and in amphibians [28] (fig. 4a) . human-infecting hev strains are genetically heterogeneous and display distinct epidemiologic patterns, but all belong the orthohepevirus a species. orthohepeviruses a account for a minority of the overall diversity of hepeviruses that infect vertebrates and their closest relative is a presently unclassified virus detected in a swedish moose (fig. 4a ) [109] . field surveys revealed a high prevalence of hev in moose populations from sweden and other baltic regions [110, 111] . in general, ungulates represent major orthohepeviruses a reservoirs. at present, eight orthohepevirus a genotypes are recognized (hev-1 to -8) (fig. 4a ). hev-1 and hev-2 infect only humans and cause waterborne outbreaks mainly in tropical and subtropical regions (fig. 4b) . conversely, genotypes 3 and 4 account for the majority of hepatitis e human cases in industrialized countries. hev-3 and hev-4 also infect several other domestic (mainly pigs) and wild (e.g., ungulates and small carnivores) animals, their transmission to humans being usually zoonotic [2] (fig. 4a) . phylogenetic analyses showed that hev-3 and hev-4 sequences derived from human cases are interspersed within those isolated from swine, indicating that pig-infecting hev-3 and hev-4 can easily cross the species barrier and infect humans [112] . notably, though, evolutionary rates are higher for genotypes 3 and 4 than for the human-specific genotypes, suggesting cyclical adaptation to different mammalian hosts [113] . a distinct hev-3 clade, mainly detected in rabbits (hev-3ra), can also cause human hepatitis e [114] [115] [116] [117] (fig. 4a) . the remaining genotypes hev-5/hev-6 and hev-7/hev-8 have been detected in boars and camels, respectively [2] (fig. 4a) . however, they are also thought to have zoonotic potential, as hev-5 and hev-7 can infect cynomolgus monkeys [118, 119] and hev-7 was detected in a patient who consumed camel meat and milk [120] . thus, viruses belonging to all hev genotypes seem to be transmissible to humans. conversely, experimental infection with hev-1 and hev-2 indicated that these viruses have a host range restricted to primates [2] . hev genotypes are therefore usually referred to as enzootic (hev-3 and ã�4) or human-restricted/anthropotropic (hev-1 and -2). although several human hepatitis e cases have a zoonotic origin and orthohepeviruses a are found in diverse mammals, recent data indicated that one or more reverse zoonoses led to the emergence and radiation of hev genotypes [121] . in fact, character state reconstruction on a large phylogeny revealed that humans were the most likely hosts of the ancestor of extant orthohepeviruses a [121] . this notion is in line with the observation that most, if not all, hev genotypes can infect our species, whereas other animals are differentially susceptible to distinct hev genotypes. moreover, increasing evidence suggests that reverse zoonotic events (also known as zooanthroponoses) are all but rare, and examples include other rna viruses such as rotaviruses, enteroviruses, and human influenza viruses [122] [123] [124] [125] . for both swine influenza a viruses and swine vesicular disease virus onward transmission in pigs is well documented [123, 125] and is facilitated by intensive husbandry practices. molecular dating using a selection-informed method inferred that the ancestor of extant orthohepeviruses a existed $6800 to $3200 years ago, most likely in east asia [121] . these inferences well correlate with historical circumstances that may have favored hev emergence and host range expansion. in this period, sedentary agriculture promoted the appearance of large human settlements in several asian regions and pig husbandry practices started to intensify in east asia [126] [127] [128] [129] [130] (fig. 4c) . crowded living conditions and poor sanitation possibly favored the emergence and spread of the waterborne, human-specific hev strains. the close contact between humans and pigs most likely promoted hev zooanthroponotic transmission and emergence of the enzootic strains (fig. 4c) . additional reverse zoonotic transmissions may have also originated the camel-infecting and rabbit-infecting strains. in fact, the estimated timing of hev-7/8 emergence (4055 bce to 1192 bce) [121] encompasses the time of domestication of bactrian and dromedary camels [131] [132] [133] (fig. 4c) . as for hev-3ra, it was estimated to have diverged from hev-3 around 600 ce, in europe [121] . this time frame corresponds to the middle ages, when historical evidence indicates that rabbits were kept in warrens and bred for meat [134] (fig. 4c ). of course, these estimates do not necessarily imply that camels and rabbits acquired hev from humans, as the domestication process may have exposed these animals to various viral sources, including other domestic (e.g., pigs) and peridomestic mammals. these scenarios provide a credible framework for orthohepevirus a origin, as well as for the diversification of hev genotypes, and selection-informed methods should at least partially correct for the tdrp, as they explicitly model purifying selection [14] [15] [16] . nonetheless, the above-mentioned data on hbv [9] suggest caution in the inference of time and location of ancestral events based on extant viral diversity. also, pig infection with hev-3 and hev-4 is generally asymptomatic [135] , possibly indicating a long-standing host-virus association that might even predate swine husbandry development. it should also be noted that the ultimate origin of orthohepevirus a remains unknown. humans may have acquired hev through cross-species transmission from other animals. however, known orthohepeviruses that infect mammals and birds are distantly related to orthohepevirus a, indicating that none of them represents the source of human-infecting hev. likewise, the origin and evolutionary relationship between the moose virus and human-infecting orthohepeviruses remain unclear. by allowing the large-scale identification of novel viral species, as well as the sequencing of viral genomes from archaeological samples, technological advances have largely expanded our knowledge on the evolution and origin of human hepatitis viruses. these insights have been paralleled by the development of computational tools and theoretical frameworks to analyze and mine viral sequence data (e.g., the above-mentioned recognition of the tdrp and the development of approaches to correct for it). the overall picture emerging from these studies clearly indicates that, with the possible exception of hdv, viruses related to human hepatitis viruses infect several other mammalian and non mammalian vertebrates. the specific events that originated these human pathogens remain, however, largely unknown. for hcv and hev, the evolutionary history of the human viruses is likely intertwined with that of related viruses that infect domestic animals. conversely, in the case of hav and hbv, the closest relatives of the human viruses are found in nhps. in general, these observations indicate that a deeper understanding of the evolutionary dynamics of human viruses has a relevance not only to improve our ability to treat and prevent present infections, but also to gain insight into the ecological contexts that may fuel the emergence of novel human pathogens, with particular reference to zoonotic ones. the authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. world health organization (who) zoonotic hepatitis e virus: classification, animal reservoirs and transmission routes hepatitis a: old and new type a viral hepatitis: a summary and update on the molecular virology, epidemiology, pathogenesis and prevention bayesian molecular dating: opening up the black box inferences from tip-calibrated phylogenies: a review and a practical guide bayesian estimates of the evolutionary rate and age of hepatitis b virus enigmatic origin of hepatitis b virus: an ancient travelling companion or a recent encounter ancient hepatitis b viruses from the bronze age to the medieval period time-dependent rate phenomenon in viruses prisoners of war -host adaptation and its constraints on virus evolution time-dependent estimates of molecular evolutionary rates: evidence and causes bayesian inference of evolutionary histories under time-dependent substitution rates a case for the ancient origin of coronaviruses purifying selection can obscure the ancient age of viral lineages evolutionary origins of human herpes simplex viruses 1 and 2 hepatitis a virus genome organization and replication strategy a pathogenic picornavirus acquires an envelope by hijacking cellular membranes fine-tuning translation kinetics selection as the driving force of codon usage bias in the hepatitis a virus capsid hepatitis a: detection by immune electron microscopy of a viruslike antigen associated with acute illness hepatitis ain greenland: importance of specific antibody testing in epidemiologic surveillance prevalence of antibody to hepatitis a and hepatitis b viruses in selected populations of the south pacific genetic variability and molecular evolution of hepatitis a virus evolutionary origins of hepatitis a virus in small mammals discovery of a novel hepatovirus (phopivirus of seals) related to human hepatitis a virus a novel hepatovirus identified in wild woodchuck marmota himalayana a novel marsupial hepatitis a virus corroborates complex evolutionary patterns shaping the genus hepatovirus the evolutionary history of vertebrate rna viruses evolutionary origins of enteric hepatitis viruses phylogeny and origins of hantaviruses harbored by bats, insectivores, and rodents hepatitis a virus and the origins of picornaviruses virus-like particles in serum of patients with australia-antigen-associated hepatitis hepatitis b virus epidemiology hepatitis b virus: the challenge of an ancient virus with multiple faces and a remarkable replication strategy genotypes and genetic variability of hepatitis b virus heterogeneous recombination among hepatitis b virus genotypes a genetic variant of hepatitis b virus divergent from known human and ape genotypes isolated from a japanese patient and provisionally assigned to new genotype possible origins and evolution of the hepatitis b virus (hbv) the global hepatitis b virus genotype distribution approximated from available genotyping data origins and evolution of hepatitis b virus and hepatitis d virus a novel hepatitis b virus species discovered in capuchin monkeys sheds new light on the evolution of primate hepadnaviruses bat hepadnaviruses and the origins of primate hepatitis b viruses deciphering the origin and evolution of hepatitis b viruses by means of a family of nonenveloped fish viruses endogenous hepadnaviruses, bornaviruses and circoviruses in snakes early mesozoic coexistence of amniotes and hepadnaviridae endogenous hepadnaviruses in the genome of the budgerigar (melopsittacus undulatus) and the evolution of avian hepadnaviruses the first full-length endogenous hepadnaviruses: identification and analysis hepatitis b virus has a recent new world evolutionary origin reconstructing the origins of human hepatitis viruses tracing hepatitis b virus to the 16th century in a korean mummy complete genomes, phylogenetic relatedness, and structural proteins of six strains of the hepatitis b virus, four of which represent two new genotypes subtypes, genotypes and molecular epidemiology of the hepatitis b virus as reflected by sequence variability of the s-gene dating the origin and dispersal of hepatitis b virus infection in humans and primates dating the origin of hepatitis b virus reveals higher substitution rate and adaptation on the branch leading to f/h genotypes neolithic and medieval virus genomes reveal complex evolution of hepatitis detection of hepatitis b virus infection in wild-born chimpanzees phylogenetic relationships with human and other primate genotypes the paradox of hbv evolution as revealed from a 16th century mummy epidemic history and evolutionary dynamics of hepatitis b virus infection in two remote communities in rural nigeria molecular epidemiology of hepatitis b virus in misiones molecular diversity in irregular or refugee immigrant patients with hbvgenotype-e infection living in the metropolitan area of naples isolation of a cdna clone derived from a blood-borne non-a, non-b viral hepatitis genome phylogeny and molecular evolution of the hepatitis c virus the epidemic behavior of the hepatitis c virus the origin of hepatitis c virus genetic epidemiology of hepatitis c virus throughout egypt global distribution and prevalence of hepatitis c virus genotypes identification of a novel hepatitis c virus genotype from punjab, india: expanding classification of hepatitis c virus into 8 genotypes identification of 19 novel hepatitis c virus subtypes-further expanding hcv classification global epidemiology of hepatitis c virus infection evolutionary analysis provides insight into the origin and adaptation of hcv sexually acquired hepatitis c virus infection: a review infectious diseased and human population history investigating the endemic transmission of the hepatitis c virus exploring the possibility of arthropod transmission of hcv highly divergent hepaciviruses from african cattle characterization of a canine homolog of hepatitis c virus identification of rodent homologs of hepatitis c virus and pegiviruses surveying the global virome: identification and characterization of hcv-related animal hepaciviruses evidence for novel hepaciviruses in rodents bats are a major natural reservoir for hepaciviruses and pegiviruses serology-enabled discovery of genetically diverse hepaciviruses in a new host differential infection patterns and recent evolutionary origins of equine hepaciviruses in donkeys identification of a novel hepacivirus in domestic cattle from germany detection of non-primate hepaciviruses in uk dogs hepacivirus cross-species transmission and the origins of the hepatitis c virus evolutionary analysis of hepatitis c virus gene sequences from 1953 origin of hepatitis c virus genotype 3 in africa as estimated through an evolutionary analysis of the fulllength genomes of nine subtypes, including the newly sequenced 3d and 3e full-length genomes of 16 hepatitis c virus genotype 1 isolates representing subtypes 1c, 1d, 1e, 1g, 1h, 1i, 1j and 1k, and two new subtypes 1m and 1n, and four unclassified variants reveal ancestral relationships among subtypes the origin of hepatitis c virus genotypes ancient human parvovirus b19 in eurasia reveals its long-term association with humans 17(th) century variola virus reveals the recent history of smallpox tracking five millennia of horse management with extensive ancient genome time series transmission of the hepatitis b virus-associated delta antigen to chimpanzees hepatitis delta virus enveloped viruses distinct from hbv induce dissemination of hepatitis d virus in vivo a comprehensive bioinformatic analysis of hepatitis d virus full-length genomes genetic diversity and worldwide distribution of the deltavirus genus: a study of 2,152 clinical strains a divergent hepatitis d-like agent in birds identification of a novel deltavirus in boa constrictors novel hepatitis d-like agents in vertebrates and invertebrates hepatitis delta virus: a fascinating and neglected pathogen study of an epidemic of non-a, non-b hepatitis. possibility of another human hepatitis virus distinct from post-transfusion non-a, non-b type infectious hepatitis in delhi (1955-56): a critical studyepidemiology. 1957 epidemic and endemic hepatitis in india: evidence for a non-a, non-b hepatitis virus aetiology isolation of a cdna from the virus responsible for enterically transmitted non-a, non-b hepatitis hepatitis e virus (hev): molecular cloning and sequencing of the full-length viral genome endoplasmic reticulum stress induced synthesis of a novel viral factor mediates efficient replication of genotype-1 hepatitis e virus international committee on taxonomy of viruses hepeviridae study group novel hepatitis e like virus found in swedish moose prevalence and phylogenetic analysis of hepatitis e virus in pigs, wild boars, roe deer, red deer and moose in lithuania high prevalence of hepatitis e virus in swedish moose -a phylogenetic characterization and comparison of the virus from different regions close similarity between sequences of hepatitis e virus recovered from humans and swine genotypespecific evolution of hepatitis e virus rabbit hepatitis e virus infections in humans rabbit hev in immunosuppressed patients with hepatitis e acquired in switzerland transmission of hepatitis e virus from rabbits to cynomolgus macaques hepatitis e virus strains in rabbits and evidence of a closely related strain in humans genotype 5 hepatitis e virus produced by a reverse genetics system has the potential for zoonotic infection production of infectious dromedary camel hepatitis e virus by a reverse genetic system: potential for zoonotic infection chronic infection with camelid hepatitis e virus in a liver transplant recipient who regularly consumes camel meat and milk origin and dispersal of hepatitis e virus reverse zoonotic disease transmission (zooanthroponosis): a systematic review of seldom-documented human biological threats to animals reverse zoonosis of influenza to swine: new perspectives on the human-animal interface a systematic review of evidence that enteroviruses may be zoonotic evolutionary histories of coxsackievirus b5 and swine vesicular disease virus reconstructed by phylodynamic and sequence variation analyses bar-yosef of the neolithic demographic transition and its consequences rapid, global demographic expansions after the origins of agriculture changes in regional settlement patterns and the development of complex societies in southeastern shandong social complexification and pig (sus scrofa) husbandry in ancient china: a combined geometric morphometric and isotopic approach agricultural origins and the isotopic identity of domestication in northern china the prehistory of the silk road the history of the camel bone dating project the appearance of the domestic camel in southeast arabia rabbits and the specious origins of domestication recent knowledge on hepatitis e virus in suidae reservoirs and transmission routes to human estimating maximum likelihood phylogenies with phyml distribution of hbv genotypes in latin america global prevalence and genotype distribution of hepatitis c virus infection in 2015: a modelling study raxml version 8: a tool for phylogenetic analysis and postanalysis of large phylogenies complete genome sequence of a hepatitis e virus genotype 1e strain from an outbreak in nigeria hepatitis e in italy: 5 years of national epidemiological, virological and environmental surveillance hepatitis e virus genotypes and subgenotypes causing acute hepatitis quantification and genetic diversity of hepatitis e virus in wild boar (sus scrofa) hunted for domestic consumption in central italy dakovic rode o. genetic diversity of hepatitis e virus (hev) strains derived from humans, swine and wild boars in croatia from a case of incidental infection of hepatitis e virus (hev) genotype 1 in a domestic pig hepatitis e virus genotype 1 and hepatitis a virus dual infection in pediatric patients with a low socioeconomic status from mexico epidemiology and genotype 3 subtype dynamics of hepatitis e virus in belgium first detection of hepatitis e virus genotype 3 as a common infectious agent in patients with chronic liver damage in mexico a new hepatitis e virus genotype 2 strain identified from an outbreak in nigeria hepatitis e virus seroprevalence and correlates of anti-hev igg antibodies in the rakai district hepatitis e virus infection in different groups of estonian patients and people who inject drugs the worldwide burden of viral hepatitis in terms of death and disability is enormous. in 2015, viral hepatitis caused 1.34 million deaths, the majority of which imputable to the effects of chronic hbv (hepatitis b virus) and hcv (hepatitis c virus) infection [1] . an estimated 5% of hbv-infected persons are also co-infected with hdv (hepatitis delta virus), which worsens the clinical outcome compared to hbv monoinfection [1] . less than 5% of overall hepatitis mortality is caused by hav (hepatitis a virus) and hev (hepatitis e virus), that are usually associated with acute, self-limiting disease [1] . however, the case fatality rate of hev is particularly high in specific groups, notably pregnant women and elderly individuals [2] . although rare, infection with hav can also cause acute liver failure and death, and the risk increases with age [3] . despite the existence of a safe and effective vaccine, hav remains a common cause of acute viral hepatitis in many regions of the world [4] . key: cord-002282-ldfa616a authors: joung, young hee; park, se hee; moon, ki-beom; jeon, jae-heung; cho, hye-sun; kim, hyun-soon title: the last ten years of advancements in plant-derived recombinant vaccines against hepatitis b date: 2016-10-13 journal: int j mol sci doi: 10.3390/ijms17101715 sha: doc_id: 2282 cord_uid: ldfa616a disease prevention through vaccination is considered to be the greatest contribution to public health over the past century. every year more than 100 million children are vaccinated with the standard world health organization (who)-recommended vaccines including hepatitis b (hepb). hepb is the most serious type of liver infection caused by the hepatitis b virus (hbv), however, it can be prevented by currently available recombinant vaccine, which has an excellent record of safety and effectiveness. to date, recombinant vaccines are produced in many systems of bacteria, yeast, insect, and mammalian and plant cells. among these platforms, the use of plant cells has received considerable attention in terms of intrinsic safety, scalability, and appropriate modification of target proteins. research groups worldwide have attempted to develop more efficacious plant-derived vaccines for over 30 diseases, most frequently hepb and influenza. more inspiring, approximately 12 plant-made antigens have already been tested in clinical trials, with successful outcomes. in this study, the latest information from the last 10 years on plant-derived antigens, especially hepatitis b surface antigen, approaches are reviewed and breakthroughs regarding the weak points are also discussed. hepatitis b (hepb) is an infection with the hepatitis b virus (hbv), which attacks the liver and can cause both acute and chronic disease. the world health organization (who) estimates that 240 million persons are chronically infected with hbv and that more than 780,000 people die every year due to complications of hepb, including cirrhosis and liver cancer [1] . the point that needs the most attention is the high rates of chronic infection found in the sub-saharan africa and east asia, where between 5% and 10% of the adult population is infected, as well as in the amazon and the southern parts of eastern and central europe. otherwise, less than 1% of the population in western europe and north america is chronically infected [1] . hbv is a hepatotropic dna virus that replicates by reverse transcription. the human hbv is a small circular dna molecule of 3.2 kb [2] . its genome consists of four partially overlapping open reading frames (orfs), namely the envelope gene (pre-surface/surface (pre-s/s)), the core gene (pre-core/core (pre-c/c)), the polymerase gene (pol) and the transactivating protein x (x). the orf pre-s/s encodes pre-s1, pre-s2 and surface (s) proteins that form the surface antigen (hbsag), and hbsag protein is the main antigen to elicit virus-neutralizing and protective antibodies by the immune system [3, 4] . understanding the hbv genome and structure is an essential prerequisite for preventive or therapeutic vaccination against hepb. a vaccine against hepb has been available since 1982. this first licensed anti-hbv vaccine containing subviral particles of hbv purified from the inactivated serum of carriers revealed very high efficacy [5] , and a subsequent subunit vaccine made using the small surface antigen (s-hbsag) was developed in the early 1980s [6] . the yeast system for the recombinant antigen was to ensure safety and low cost. yeast-derived s-hbsag assembled into virus-like particles (vlps) were as immunogenic as natural subviral particles, and highly effective vaccines containing s-hbsag have been widely used as prophylactic vaccines against hbv infection [7] . however, some groups of vaccines do not develop protective immunity against the virus and immunosenescence frequently occurs in adults [8] . additionally, high cost limit and the necessity of accompanying infrastructure for the cold chain distribution and intravenous administration still constituted a barrier to vaccination approaches in developing countries. in order to successfully solve these problems, many research projects have been undertaken to develop more efficacious, easily administrated, and thermostable vaccines. a new recombinant hbv vaccine containing the pre-s/s has greater immunogenic potential than the conventional s antigen-based vaccines in terms of antibody induction and cellular immune response. middle (pre-s2 + s, m-hbsag) or large (pre-s1 + pre-s2 + s, l-hbsag) surface antigens [9] have been used as components of specific immunotherapeutic vaccines for chronic hbv carriers [10, 11] . additionally, chimeric protein created by fusing the hbv core antigen (hbcag) to the pre-s1 showed strong anti-hbc and moderate anti-pre-s1 immune responses [12] . although vaccination is one of the most powerful and cost-competitive achievements, some vaccines may still have certain limitations related to maintenance of the cold chain, downstream processing costs, administration risk, and expensive scalability [13] [14] [15] [16] [17] . from these reasons, the use of plant cells as alternative production platforms have received considerable attention in terms of intrinsic safety, scalability, and posttranslational modification of target proteins [17, 18] . plant systems can be scaled up quickly to generate large quantities of the protein product, are not susceptible to contamination with known human or mammalian pathogens and are resistant to enzymatic digestion in the gastrointestinal tract. in addition, transgenic plants can be engineered to express and translate multiple proteins concurrently with appropriate folding and assembly into multimeric proteins, especially the posttranslational adjustments of antibodies. not all recombinant antigens will benefit from plant-based systems, but the best production system for each recombinant protein should be chosen using a case-by-case approach [19] . merlin et al. [19] proposed that plants are the most the beneficial for the production of four major categories of pharmaceutical proteins: ones that are required in large quantities, that need to be rapid-response, that require complex posttranslational modifications, or that are intended for oral delivery. within these categories, they suggested appropriate candidates to meet a spectrum of research, development, commercial needs, such as human glutamic acid decarboxylase, norwalk virus-like particles, monoclonal antibody 2g12, and human interleukin-6. those plant-made antigens have already been tested in clinical trials, with successful outcomes ( table 1 ). the enzyme glucocerebrosidase for gaucher's disease, the first pmf-derived enzyme "elelyso™", has been approved and marketed by protalix in 2012. elelyso™ is based on the use of carrot cells to produce recombinant taliglucerase alpha, which is used in enzyme replacement therapy to treat adult patients. this special food and drug administration (fda) approval case was fast tracked based on its applicability to a rare genetic disease and the bioreactor production under stringent conditions [20, 21] . medicago has ongoing phase ii clinical trials for a plant-derived vlp quadrivalent seasonal influenza vaccine and an h5 pandemic influenza vaccine [22] . they are focusing on vlp vaccine development. vlps are self-assembled structures derived from viral antigens that mimic the native architecture of viruses but lack the viral genome and thus are not infective. another important advantage as emerging vaccine is the more effective activation of key aspects of the immune response to achieve potent immune stimulation and to provide immunological memory for long-lasting protection [22, 23] plant-based platforms including whole plant, organs or cell and expression technology to produce target antigens of interest are diverse [38] [39] [40] . representative plant species expressing the oral vaccine are potato, tomato, and tobacco; additionally, maize, rice, carrot, and soybean are also applied in this field [41] [42] [43] [44] [45] [46] [47] [48] [49] . those plants are mainly focused on traditional and usually eaten crops in human, because it is known that inexperienced plants sometimes have problems with certain plant allergies. target antigen proteins were expressed by a plant cell nuclear genome expression system in these plant species. edible plant vaccines are based on different parts of plants, such as fruits, seeds, and root vegetables. such food vaccines are prepared directly without expensive purification of the antigens, which is essentially required for parenteral administration of vaccines [50] . therefore, the lyophilization of organs expressing stable antigens would facilitate their processing, purification and storage, reducing costs and allowing more practical vaccines. although stable transformation into transgenic plants is commonly accepted, the low production level of the resultant recombinant protein remains an issue of concern. an efficient alternative to nuclear transformation for vaccine antigens and other therapeutic proteins is plastid transformation [51] . the highest expression of transgenes, up to more than 70% of total soluble protein, are reported in chloroplast transformation [52,53] otherwise, the universal expression level in most studies has been 1% of total soluble protein (tsp) or 50 µg/g fresh leaf tissue [54, 55] . chloroplast technology can also avoid the controversy related to transgene containment [40] and express multigenes as single operon [56] . waheed et al. [40] reviewed recent vaccine antigens against human diseases expressed via plastid genome since 2011. two plant species, tobacco (15 different antigens) and lettuce (four different antigens), have mainly been used in plastid transformation. these results suggest that more industrial interest is needed to strengthen the research/academia-industry linkages in the chloroplast-based vaccine market. stable transformation has its own advantages such as reliable harvest of target proteins over multiple generations and optimized protocols for delivery of foreign genes into various plant species. although there are problems with the time required, seed resources can be grown anywhere with minimal cost and labor once the plant has been developed for the first time [21] . most clinical trials, except for the three cases of eleyso, prx-102, and recombinant human intrinsic factor, have used a tobacco-based transient expression system (table 1 ). in recent years, interest in transient expression has increased due to the containment of the system and the possibility of rapid upscaling due to the short interval between transformation and expression, which are attractive features for the industrial scale production and approval of the expressed products, e.g., the mass production of tobacco by medicago and kentucky bioprocessing. pogue et al. [57] reviewed plant-based transient expression systems for the production of pharmaceutical-grade recombinant aprotinin and a monoclonal antibody product. transient expression provides a safe and environmentally friendly system for both indoor and outdoor application with high speed and low cost of the genetic manipulation, rapid manufacturing cycles, and economical production. transient production using an agrobacterium tumefaciens-mediated transfer-dna delivery system (agro-infiltration) and/or virus-based replicating systems, the two dominant approaches, guarantees both the quality of the resulting purified products and the speed of development [57, 58] . spiegel et al. [59] demonstrate the application of the classical nicotiana benthamiana/a. tumefaciens transient expression system to accelerate the development of a malaria vaccine candidate, with screens for expression, solubility, and stability using fluorescent fusion proteins. in marin viegas et al. [60], a transient expression system for the production of human tg2 in n. benthamiana leaves was optimized, and the reactivity of plant-produced tg2 in a cd screening test was evaluated. hence, transient expression performed in contained facilities satisfies good manufacturing practices, and quick expression can avoid the time-consuming stable transformation [58, 61] . in a comparison of productivity in terms of biomass production, hiatt and pauly [62] reported that grams of product may take only two weeks plus a few weeks more. in large-scale biomanufacturing systems, recombinant proteins can be produced at levels of 200-1000 mg/kg fresh weight tissue in as little as three months [57] . the transient expression of human interleukin-6 in n. benthamiana (7.8% tsp) produces 80-fold more than stable expression in tobacco plants (0.3 mg/g fresh weight (fw)) [63]. conversely, hgad65mut is expressed at higher levels in stable tobacco plants (143.6 µg/g fw) than in n. benthamiana (96.6 µg/g fw) [64] . this result suggests that expression potential or level varies case by case, depending on the target protein. in last decade, there has been a considerable increase in the use of transgenic plants to generate recombinant proteins for medical and veterinary use ( table 2) . research groups worldwide have attempted to develop more efficacious plant-derived vaccines for over 30 diseases, most frequently hepatitis b and influenza. in the case of hepatitis b, both stable and transient expression systems have been developed in various plants, including potato, lettuce, tobacco, tomato, carrot, and arabidopsis for stable expression and n. benthamiana for transient expression. a detailed review of hepatitis b will be presented in the next part of this article. influenza is also a main target of this field because it is a widely distributed viral infection of humans and animals, and a new epidemic strain appears every one to two years. this pattern requires the production of new vaccines at the same frequency, and a promising solution is to establish a rapid, flexible, and safe system. the production of various antigens such as hemagglutinin (ha) and the extracellular domain of matrix protein 2 (m2e) has mainly focused on transient expression systems using n. benthamiana leaves. using the medicago "proficia™" system, vaccine production can be initiated within less than three weeks from the identification of the genetic sequence of a pandemic or seasonal influenza strain [155]. vamvaka et al. [74] reported the development of transgenic rice plant expressing the hiv-neutralizing antibody 2g12 in the endosperm (42 µg/g dry seed weight) to evaluate the potential of rice seeds as a vehicle for inexpensive microbicide production. production is higher than the initial achievement of maize-derived 2g12 (30 µg/g) by rademacher et al. [156] . rubio-infante et al. [75] demonstrated the immunogenic potential of tobacco chloroplast-derived multi-hiv in an oral immunization scheme and proposed it as a vaccine prototype capable of inducing broad immune responses as it carries various b and t cell epitopes from several hiv strains. dengue has become a significant public health problem, and the threat of dengue fever is now increasing in temperate regions due to dramatic climate change. the rice codon-optimized consensus domain iii of dengue virus envelope glycoprotein (e) has been fused to the m cell-binding peptide via agroinfiltration with a plant virus-based expression system [157] [158] [159] . carrying these results a step further, kim et al. [159] generated an ebola ric-based denv vaccine in tobacco plants using a geminiviral vector expression system and reported its immunogenic properties as a self-adjuvanting dengue vaccine candidate. previously, phoolcharoen et al. [160] reported that plant-expressed ebola ric protected mice against a lethal ebola virus challenge. the expression of subunit vaccines for animal viral diseases, such as avian influenza [98, 161] , foot-and-mouth disease (fmd) [100] [101] [102] , and diarrhea [123, 126, 127] , which are considered to be the most important causes of economic losses in plants, has been frequently reported. the commercialization of veterinary vaccine is relatively easy compared with that of human vaccines. to date, four cases in clinical trials are ready to enter the market. [162] suggest that the highly immunogenic vp8 epitopes produced in n. benthamiana are candidates for a subunit vaccine, specifically for the g9p rotavirus strain. the greatest problem of plant-derived vaccine development is the extremely low expression level of the foreign protein in plants. for this reason, many researchers have studied how to improve protein expression levels in plants. in the case of plant-derived hbv vaccines, the first report was on the expression of the small hepatitis b surface antigen (s-hbsag) in transgenic tobacco plants. in this report, the hbsag produced in transgenic tobacco was antigenically and physically similar to the hbsag particles derived from human serum and recombinant yeast [163] . afterward, many research groups attempted hbsag expression in different tissues and plant species, such as tobacco, potato, lettuce, soybean, lupine, maize, tomato, peanut and laminaria japonica (table 3 ). in the transgenic tobacco plant transformed with the s-hbsag gene controlled by the 35s promoter, expression levels were very low: less than 0.01% total soluble protein and less than 10 ng/g fresh weight in leaf tissues. the expression levels of s-hbsag in other plant species were not significantly higher; in some species, expression levels were even lower than in tobacco. to improve vaccine production in plants, the most widely used strategies involve: (1) suitable promoters, such as strong constitutive promoters, tissue-specific promoters and promoters that are inducible by environmental factors; (2) targeting systems to specific organelles; (3) optimized codon usage; (4) alternative polyadenylation signals; (5) increased translation efficiency using leader sequences; and (6) different vector systems. many hbsag-overexpressing transgenic plants have been developed using strong constitutive promoters, such as the 35s promoter with enhancer [164] [165] [166] . in addition to tissue-specific promoters, the patatin promoter for potato tuber [165, 167] , globulin promoter for maize seed [168] and fruit-specific promoters [169, 170] were used. specific organelle-, endoplasmic reticulum (er)-, vacuole-and chloroplast-targeted strategies have also been tried [167, 171] . the hbsag has been expressed in non-edible plants, such as tobacco, using four different expression cassettes: the hbsag gene without er retention signal (hbs), the hbsag gene with er retention signal (her), and each gene controlled by the ubiquitin promoter (ubq) or ethylene forming enzyme promoter (efe) [172] . in this report, the maximum expression level (19.4 ng/g fw of leaves) was observed in efe-hbs transformed plant growth in vitro, but a higher proportion of the particulate form of the antigen was observed when it was expressed with an er retention signal. the efe promoter is more effective in in vitro-cultured plantlets, whereas the ubq promoter is more effective in greenhouse-grown plantlets. the maximum expression level was 2 µg/g fw in the ubq-her transformed nt-l cell suspension culture [173] . the expression level was increased up to 8 µg/g fw using hbsag fused with the 3 region from the soybean vegetative storage protein gene and was controlled by a chimeric ocs-mas promoter. upon transformation into a soybean cell culture using the same vector, the maximum expression level was 74 µg/g fw [174] . soybean cell/transgenic pmsi164/eha105 ubq3/er 700 ng/g fw n.a. [190] banana/transgenic pbi121/eha105 efe er 38 ng/g fw (leaf) n.a. [191] lupin/transgenic prok/c58 35s/n.a. 150 ng/g fw (callus) oral, igg antibodies in serum (maximum 19 miu/ml) [187] lupin/transgenic prok/gv3101, eha105, lba4404 35s/n.a. 2.5-6 µg/g fw (callus) n.a. [192] maize/transgenic n.a./eha101 3xglb1/cell wall 0.51% of tsp (seed) n.a. [168] maize/transgenic n.a./eha101 glob1/cell wall 0.46% of tsp (seed) oral (germ, bioencapsulated), iga and igg antibodies in serum (maximum 4632 miu/ml) [193] maize/transgenic n.a./eha101 3kbglb1/cell wall 0.41% of tsp (seed) oral (germ, wafer feeding), iga and igg antibodies in serum [194] maize/transgenic n.a./eha101 glob1/cell wall 0.46% of tsp (seed) oral (germ, wafer feeding), iga and igg antibodies in serum [195] cherry tomatillo/transgenic pcambia1301/eha105 35s/n.a. 10 ng/g fw (fruit) oral, igg antibodies in serum [196] tomato/transient pbi121/eha105 efe/er 0.5 µg/g dw (leaf) n.a. [169] tomato/transgenic pbinplus-ars/lba4404 35s/er n.a. n.a. [191] tomato/transgenic pbm/lba4404 d35s/n.a. 0.01%-0.05% of tsp (leaf) n.a. [181] tomato/transgenic pbinplus-ars/lba4404 35s/n.a. 0.3 µg/g dw (fruit) oral, iga and igg antibodies in serum (maximum 300 miu/ml) [193] carrot cell/transgenic ppcv812/n.a. mas/n.a. 25 ng/g fw n.a. [198] laminaria japonica/transgenic pcat/n.a. sv40/n.a. 0.05%-0.25% of tsp n.a. [199] peanut oral, igg antibodies in serum (maximum 800 miu/ml), oral, iga and igg antibodies in serum (maximum 558 miu/ml) [167, 202] lettuce/transgenic pgptv-bar/eha105 35s/n.a. 2-23 µg/g fw n.a. [201] tomato/transgenic pbinplus-ars/lba4404 35s/n.a. 0.002% of tsp (fruit) n.a. [203] tomato/transgenic pbinplus-ars/aglo 35s/n.a. 0.003%-0.021% of tsp (fruit) oral (freeze-dried material), igg antibodies in serum [204, 205] carrot/transgenic pbinplus-ars/n.a. 35s/er 42 ng/g fw (leaf) n.a. [206] l-hbsag hbsag has been expressed in vegetative crops, such as potato, tomato, soybean and lettuce. the expression level of transgenic potato tubers was 1-11 µg/g fw. the highest expression in a tuber was developed using a construct driven by the camv 35s promoter with dual enhancers, the tobacco etch virus 5 -utr, and the 3 region from the soybean vegetative storage protein gene [165] . expression level of hbv-protein in potato was little increased when controlled by the tuber specific promoter [167] . target dna is inserted into a genomic dna as a random event when a using agrobacterium-mediated transformation. for this reason, it is difficult to conclude what is the best method for increase of hbv-protein expression level because differences in the expression level between the transgenic lines even with the same vector construction. expression in tomato fruit has been reported at 0.5 µg/g dry weight. to achieve a higher level of expression, several strong and inducible promoters, such as the enhanced dual 35s, ubq and efe promoters, were tested, as well as organelle targeting sequences. the greatest improvement resulted from the hbsag gene with an er retention signal controlled by efe promoter [169] . sunil kumar et al. [170] reported hbsag transformation in banana. the maximum expression in banana leaves has been reported at 38 ng/g fw. the expression levels in banana fruits were not presented in this report, but the expression level was presumably lower than in the leaf tissue. as with leafy vegetables, a variety of expression technologies have not yet been applied. in lettuce, the maximum expression level was 60 µg/g fw, which is the maximum anti-hbsag antibody titer of 300 miu in immunized mice serum [188, 189, 201] . upon transformation into a soybean cell culture using a construct of hbsag fused with the 3 region from the soybean vegetative storage protein gene and as controlled by a chimeric ocs-mas promoter, the maximum expression level was 74 µg/g fw [174] . grains are a further option for the expression of candidate vaccine antigens. they have long stability of expressed recombinant proteins with low water content [212] . in maize seed, the maximum expression has been reported at 0.51% of total soluble protein (approximately 80 µg/g fw). this level of expression was achieved using a barley alpha amylase signal sequence-fused s-hbsag gene with a 3× globulin1 promoter [168] . all of the results suggest that the expression levels of hbsag are highly variable and depend on plant species, tissue types and culture conditions. the major recombinant hepatitis b vaccines contain s-hbsag; therefore, the expression of this protein has been the focus in plants. the proteins pres2-s, m-hbsag, and pres1-pres2-s, l-hbsag, have been much less studied than s-hbsag. m-hbsag and l-hbsag have been transformed into potato, tomato, and tobacco (table 3) . although the expression was optimized using suitable promoters, leader sequences and targeting signals, the expression levels of m-/l-hbsag were lower than for s-hbsag. however, hbcag induces a heightened immune response [213, 214] and spontaneously assembles into capsid-like particles [215] . for these reasons, efforts devoted to the production of an anti-hbv vaccine have focused on hbcag in the last few years. especially, hbcag has been abundantly produced using transient expression systems mediated by icon binary vectors [208] or viral vector systems [209] (table 3 ). transgenic tobacco plants-derived hbsag was antigenically and physically similar to the human serum and recombinant yeast derived-hbsag particles [163] . to analyze the immunological response in vivo, tobacco-expressed hbsag was purified and injected into balb/c mice. the anti-hepb response to the tobacco-derived hbsag was qualitatively similar to the response obtained by immunizing mice with commercialized yeast-derived hbsag vaccine [175] . these results showed a possibility of developing injected vaccines using plant-expressed hbsag. due to differences of the manufacturing processes between companies, the amount of hbsag protein per dose differs among the various hbv vaccine products [216] . for this reason, there is no international standard for the hbsag protein quantity in vaccines, but there is a standard based on protective efficacy of vaccination related to the anti-hepb antibodies induction. an anti-hbsag of ≥10 miu/ml measured 1-3 months after the last dose of the vaccine are considered to be immune to hepb. although no international standard of antigen concentration is defined, considering the feasibility and cost-effectiveness of the injected vaccine, the concentration of antigen should be over 40 µg/ml [217] . despite many attempts to increase hbsag expression in transgenic plants, the expression level remains too low for use as an injected vaccine. the currently used hbv vaccine contains hbsag and is produced by yeast cells. the yeast-derived hbv vaccine can be supplied inexpensively ($1-20 per single dose [218] ); therefore, it is difficult for plant-derived vaccines to have a competitive price. however, plant suspension cultures may be used as an alternative to yeast to produce antigens for purification. expression levels have approached 74 µg/g fw (22 mg/l culture medium) in transgenic soybean culture [174] . although the expression level (8 µg/g fw) was lower in transgenic tobacco cell suspension culture than in soybean [174] , the former has been used to secrete hbsag into the culture medium, with a six-fold increase in secretion in response to jasmonic acid or salicylic acid treatment during cell culture, and the amount of antigen secreted was 180 µg/l medium [170] . another breakthrough regarding expression problems was achieved through the utilization of virus-based transient expression systems for the robust production of hbv antigens, such as s-hbsag and hbcag, with yields as high as 2 mg/g fw [208, 209, 211] . tobacco-derived proteins showing the maximum anti-hbsag antibody titer of 1165 miu in immunized mice serum [211] are preferred the application of injection after purification process, rather than oral administration in order to remove many toxic alkaloids and phenolic substances which have a tobacco plant [219] . however, improvements of several orders of magnitude are still needed for plant cell culture systems to be competitive, particularly given the slow growth rates of plant cells compared with yeast. in transgenic suspension cell culture, the formation of vlps by hbv antigens made it possible to exploit relatively inexpensive protein purification techniques, such as the sucrose gradient [174, 182, 184] or cesium chloride gradient ultracentrifugation [173] . the highest expressed soybean cell culture was used for antigen purification, and the antigen was suitable for injection [174] , but the yield remained unsatisfactory and was not cost-effective. the biggest advantage of edible plant-derived vaccines is their easy application to oral delivery. the benefits of plant-derived edible vaccines are as follows: (1) during oral delivery, plant-derived vaccines are protected in the stomach by plant cell wall and slow release in the gut; (2) the plant tissue expressing antigen may be used as raw or dried food; (3) capsules can also be made from partially or fully purified vaccine proteins; (4) no need for cold chain systems for storage and delivery of the plant tissues or extracts; and (5) the plant-derived vaccines are cost efficient compared with traditional vaccines. edible plant-derived hbv antigens have been administered by oral injection or feeding in mice with/without adjuvants [41, [165] [166] [167] 193 ]. an oral vaccine candidate has also been administered to human volunteers in small-scale clinical trials without adjuvants. the first trial was administered to three human volunteers in row lettuce leaves in two doses (0.5-1 µg of s-hbsag/dose) without the use of an adjuvant. all volunteers responded, with two of them having serum responses in excess of the protective minimum level (10 miu/ml of serum). however, the antibody levels declined rapidly [187, 220] . in the second trial, previously vaccinated human volunteers were fed two or three doses of 100 g of raw potato tubers (approximately 1 mg of the s-hbsag/dose). more than half of the subjects showed increased antibody titers [221] . the animal experiments and trials showed the potential for plant-derived hbv antigens to be used as an oral vaccine for the prevention of hbv, but there remain many problems to be solved for practical application, such as the administration of bulky plant material, declining long-term responses, individual differences in the immune response and the difficulty of defining the antigen dose [222] . the expression level of plant-derived hbv antigen is only 1/20-1/25 of the expression of yeast-derived hbv antigen; however, the expression yield and plant production scale are still increasing [223, 224] . tomato is possible intake without any processing or cooking. therefore, tomato fruit is a very attractive crop to develop an oral vaccine. according to the study to date, the expression level of hbv antigen was very low as 10 ng/g fw ( table 3 ). the maximum titers of anti-hbsag antibody in serum is 300 miu using oral application. this antibody yield was high compared to the expression level of hbv antigen in tomato fruits [225] . hbv antigen expression in maize produced much higher levels of antigen, and the palatability and digestibility were better than for potato. that is, cereal crops can easily transport or storage in dry state. in addition, the maize system induced a strong immune response with 4632 miu of maximum titer by both injection and oral administration [193, 194] . this result suggests the possibility of providing a raw material for thermostable formulation at $0.01 per dose [193] . plant components such as saponin, flavonoids, and plant oils also function as adjuvants [226] [227] [228] and help maintain the immune response in the long term [195] . the lyophilization method is an excellent way to increase the stability and shelf life of the plant-derived vaccines. in the previous study, the storage stability of lyophilized powder form was limited at 4 • c [189] . in a recent study, successful long-term storage at 37 • c was achieved though improvements in the process [229] . it is easier to control the concentration and standardize antigen doses and process the antigen into a tablet or capsule form using a powdered tissue instead of freeze-drying [188] . despite over 20 years of effort, no commercial plant-based anti-hbv vaccine has been developed. to commercialize a plant-derived hbv vaccine, several points should be considered. first, the greatest barrier is the low expression levels of hbv antigen in plants; however, expression yield and plant production scale can still be increased using plant expression vector optimization, which should be focused on the target plant. the process can also be more competitive by improving the plant-derived antigen to increase the immune response to the vaccine. second, an hbv antigen expressed in an edible plant has the advantage of being usable as an oral vaccine without processing. it is first necessary to analyze the characteristics of the target plants and the expressed protein for the development of an oral vaccine because plant components, secondary metabolites and foreign protein expression characteristics vary with plant species. to obtain feasible and cost-effective vaccines, the target plants for edible vaccines should have a long shelf life, be heat stable and be edible as a raw material. candidate grain crops are maize and rice; candidate vegetative crops are tomato and banana. third, consideration should be made of the public's acceptance of gm crops, especially plant-derived edible vaccines. for injected vaccine development, the most cost-effective method is a suspension culture in a closed environment, according to the regulations of good manufacturing practice. further safety of plant-derived vaccines can be obtained by following the same regulations established for traditional vaccines. in addition, for oral vaccines produced from gm crops, environmental risk assessment and human risk assessment should be performed. for these reasons, plant-derived oral vaccines cannot be called cost efficient compared with traditional vaccines, and the current concern over the use of gm plants is now affecting research in this field. world health organization (who) compact organization of the hepatitis b virus genome. hepatotlogy structural and functional analysis of full-length hepatitis b virus genomes in patients: implications in pathogenesis overview of hepatitis b virus mutations and their implications in the management of infection the newly licensed hepatitis b vaccine: characterics and indications for use human hepatitis b vaccine from recombinant yeast recombinant hepatitis b triple antigen vaccine: hepacare comparative immunogenicity of a pres/s hepatitis b vaccine in non-and low responders to conventional vaccine hepatitis b virus morphogenesis specific vaccine therapy in chronic hepatitis b: induction of t cell proliferative responses specific for envelope antigens induction of strong hepatitis b virus (hbv) specific t helper cell and cytotoxic t lymphocyte responses by therapeutic vaccination in the trimera mouse model of chronic hbv infection recombinant hepatitis b core antigen carrying pres1 epitopes induce immune response against chronic hbv infection medical molecular farming: production of antibodies, biopharmaceuticals and edible vaccines in plants biological safety concepts of genetically modified live bacterial vaccines role of genetic factors and environmental conditions in recombinant protein production for molecular farming evolution of plant-made pharmaceuticals a perspective on the use of pleurotus for the development of convenient fungi-made oral subunit vaccines immunological aspects of using plant cells as delivery vehicles for oral vaccines comparative evaluation of recombinant protein production in different biofactories: the green perspective carrot cells: a pioneering platform for biopharmaceuticals production plants as factories for human pharmaceuticals: applications and challenges molecular pharming-vlps made in plants heat-precipitation allows the efficient purification of a functional plant-derived malaria transmission-blocking vaccine candidate fusion protein malaria vaccine candidate antigen targeting the pre-erythrocytic stage of plasmodium falciparum produced at high level in plants plant-based production of recombinant plasmodium surface protein pf38 and evaluation of its potential as a vaccine candidate a plant-produced pfs25 vlp malaria vaccine candidate induces persistent transmission blocking antibodies against plasmodium falciparum in immunized mice transgenic tomato plants expressing the antigen gene pfcp-2.9 of plasmodium falciparum production, characterisation and immunogenicity of a plant-made plasmodium antigen the 19 kda c-terminal fragment of plasmodium yoelii merozoite surface protein 1 a plant-produced pfs230 vaccine candidate blocks transmission of plasmodium falciparum production and characterization of an orally immunogenic plasmodium antigen in plants using a virus-based expression system rice endosperm produces an underglycosylated and potent form of the hiv-neutralizing monoclonal antibody 2g12 a plant-derived multi-hiv antigen induces broad immune responses in orally immunized mice oral delivery of plant-derived hiv-1 p24 antigen in low doses shows a superior priming effect in mice compared to high doses chloroplast expression of an hiv envelop-derived multiepitope protein: towards a multivalent plant-based vaccine biochemical and immunological characterization of the plant-derived candidate hiv-1 mucosal vaccine ctb-mpr anchorage to the cytosolic face of the endoplasmic reticulum membrane: a new strategy to stabilize a cytosolic recombinant antigen in plants expression of hiv-1 antigens in plants as potential subunit vaccines rapid high-yield expression of a candidate influenza vaccine based on the ectodomain of m2 protein linked to flagellin in plants using viral vectors high-yield expression of m2e peptide of avian influenza virus h5n1 in transgenic duckweed plants oral immunization of haemaggulutinin h5 expressed in plant endoplasmic reticulum with adjuvant saponin protects mice against highly pathogenic avian influenza a virus infection intranasal vaccination with a plant-derived h5 ha vaccine protects mice and ferrets against highly pathogenic avian influenza virus challenge. hum. vaccines immunother biochemical composition of haemagglutinin-based influenza virus-like particle vaccine produced by transient expression in tobacco plants plant-derived h7 vlp vaccine elicits protective immune response against h7n9 influenza virus in mice and ferrets safety and immunogenicity of a plant-produced recombinant monomer hemagglutinin-based influenza vaccine derived from influenza a (h1n1) pdm09 virus: a phase i dose-escalation study in healthy adults human antibody response to n-glycans present on plant-made influenza virus-like particle (vlp) vaccines. vaccine a plant-based system for rapid production of influenza vaccine antigens. influenza other respir the human potential of a recombinant pandemic influenza vaccine produced in tobacco plants setting up a platform for plant-based influenza virus vaccine production in south africa formulation development of a plant-derived h1n1 influenza vaccine containing purified recombinant hemagglutinin antigen. hum. vaccines immunother plant-produced recombinant influenza vaccine based on virus-like hbc particles carrying an extracellular domain of m2 protein preclinical and clinical development of plant-made virus-like particle vaccine against avian h5n1 influenza a plant-produced influenza subunit vaccine protects ferrets against virus challenge. influenza other respir plant-expressed ha as a seasonal influenza vaccine candidate highly pathogenic avian influenza as a zoonotic agent transient expression of the ectodomain of matrix protein 2 (m2e) of avian influenza a virus in plants a transgenic plant cell-suspension system for expression of epitopes on chimeric bamboo mosaic virus particles development of a new vector using soybean yellow common mosaic virus for gene function study or heterologous protein expression in soybeans expression of vp1 protein of serotype a and o of foot-and-mouth disease virus in transgenic sunnhemp plants and its immunogenicity for guinea pigs immunogenicity of foot-and-mouth disease virus structural polyprotein p1 expressed in transgenic rice foliar extracts from transgenic tomato plants expressing the structural polyprotein, p1-2a, and protease, 3c, from foot-and-mouth disease virus elicit a protective response in guinea pigs induction of protective immunity in swine by recombinant bamboo mosaic virus expressing foot-and-mouth disease virus epitopes optimization of ammonium sulfate concentration for purification of colorectal cancer vaccine candidate recombinant protein ga733-fck isolated from plants optimization of elisa conditions to quantify colorectal cancer antigen-antibody complex protein (ga733-fck) expressed in transgenic plant expression of ga733-fc fusion protein as a vaccine candidate for colorectal cancer in transgenic plants plant-derived epcam antigen induces protective anti-cancer response apple latent spherical virus vector as vaccine for the prevention and treatment of mosaic diseases in pea, broad bean, and eustoma plants by bean yellow mosaic virus generation of protective immune response against anthrax by oral immunization with protective antigen plant-based vaccine a plant based protective antigen [pa (div)] vaccine expressed in chloroplasts demonstrates protective immunity in mice against anthrax recombinant plants provide a new approach to the production of bacterial polysaccharide for vaccines production of a plant-derived immunogenic protein targeting apob100 and cetp: toward a plant-based atherosclerosis vaccine a plant-produced antigen elicits potent immune responses against west nile virus in mice suppression of inhibitor formation against fviii in a murine model of hemophilia a by oral delivery of antigens bioencapsulated in plant cells effects of plant cultivation density and light intensity on the production of a vaccine against swine edema disease in transgenic lettuce production of double repeated b subunit of shiga toxin 2e at high levels in transgenic lettuce plants as vaccine material for porcine edema disease immunogenicity of eit chimeric protein expressed in transplastomic tobacco plants towards development of an oral vaccine against escherichia coli o157:h7 induction of toxin-specific neutralizing immunity by molecularly uniform rice-based oral cholera toxin b subunit vaccine without plant-associated sugar modification oral immunogenicity and protective efficacy in mice of transgenic rice plants producing a vaccine candidate antigen (as16) of ascaris suum fused with cholera toxin b subunit synthesis and assembly of an adjuvanted porphyromonas gingivalis fimbrial antigen fusion protein in plants transient expression of vp2 in nicotiana benthamiana and its use as a plant-based vaccine against infectious bursal disease virus vp8 antigen produced in tobacco transplastomic plants confers protection against bovine rotavirus infection in a suckling mouse model greenhouse and field cultivations of antigen-expressing potatoes focusing on the variability in plant constituents and antigen expression oral administration of plant-based rotavirus vp6 induces antigen-specific igas, iggs and passive protection in mice efficacy of a bvdv subunit vaccine produced in alfalfa transgenic plants immunocompetent truncated e2 glycoprotein of bovine viral diarrhea virus (bvdv) expressed in nicotiana tabacum plants: a candidate antigen for new generation of veterinary vaccines the effect of plant tissue and vaccine formulation on the oral immunogenicity of a model plant-made antigen in sheep use of the wound-inducible ntqpt2 promoter from nicotiana tabacum for production of a plant-made vaccine the release and induced immune responses of a plant-made and delivered antigen in the mouse gut plant expressed coccidial antigens as potential vaccine candidates in protecting chicken against coccidiosis immunogenicity study of plant-made oral subunit vaccine against porcine reproductive and respiratory syndrome virus (prrsv) extraction, purification and characterization of the plant-produced hpv16 subunit vaccine candidate e7 ggg plastid expression of a double-pentameric vaccine candidate containing human papillomavirus-16 l1 antigen fused with ltb as adjuvant: transplastomic plants show pleiotropic phenotypes anti-cancer activity of plant-produced hpv16 e7 vaccine production of human rotavirus and salmonella antigens in plants and elicitation of fljb-specific humoral responses in mice piri, i. isolation of ompa gene from salmonella typhimurium and transformation into alfalfa in order to develop an edible plant based vaccine expression of helicobacter pylori tonb protein in transgenic arabidopsis thaliana: toward production of vaccine antigens in plants expression of an immunogenic f1-v fusion protein in lettuce as a plant-based vaccine against plague biopharmaceutical protein production under controlled environments: growth, development, and vaccine productivity of transgenic tomato plants grown hydroponically in a greenhouse plant-derived recombinant fl, v, and f1-v fusion antigens of yersinia pestis activate human cells of the innate and adaptive immune system effective plague vaccination via oral delivery of plant cells expressing f1-v antigens in chloroplasts a plant-produced plague vaccine candidate confers protection to monkeys plant-made subunit vaccine against pneumonic and bubonic plague is orally immunogenic in mice expression and immunogenicity of the mycobacterial ag85b/esat-6 antigens produced in transgenic plants by elastin-like peptide fusion strategy superexpression of tuberculosis antigens in plant leaves oral immunogenicity of a plant-made, subunit, tuberculosis vaccine continued expression of plant-made vaccines following long-term cryopreservation of antigen-expressing tobacco cell cultures toward the development of a plant-based vaccine against reovirus generation of plant-derived recombinant dtp subunit vaccine analysis and stability of the respiratory syncytial virus antigen in a t3 generation of transgenic tomato plants immunogenic properties of plant-derived recombinant smallpox vaccine candidate pb5 accumulation of recombinant sars-cov spike protein in plant cytosol and chloroplasts indicate potential for development of plant-derived oral vaccines clinical safety and immunogenicity of tumor-targeted, plant-made id-klh conjugate vaccines for follicular lymphoma recombinant antibody 2g12 produced in maize endosperm efficiently neutralizes hiv-1 and contains predominantly single-glcnac n-glycans m cell-targeting ligand and consensus dengue virus envelope protein domain iii fusion protein production in transgenic rice calli expression of a cholera toxin b subunit and consensus dengue virus envelope protein domain iii fusion gene in transgenic rice callus novel vaccination approach for dengue infection based on recombinant immune complex universal platform a nonreplicating subunit vaccine protects mice against lethal ebola virus challenge immunization with plant expressed hemagglutinin protects chickens from lethal highly pathogenic avian influenza virus h5n1 challenge infection engineering and expression of a human rotavirus candidate vaccine in nicotiana benthamiana expression of hepatitis b surface antigen in transgenic plants expression and characterization of hepatitis b surface antigen in transgenic potato plants production of hepatitis b surface antigen in transgenic plants for oral immunization oral immunization with hepatitis b surface antigen expressed in transgenic plants expression of the hepatitis b surface s and pres2 antigens in tubers of solanum tuberosum production of highly concentrated, heat-stable hepatitis b surface antigen in maize transient and stable expression of hepatitis b surface antigen in tomato (lycopersicon esculentum l.) expression of hepatitis b surface antigen in transgenic banana plants expression of the human hepatitis b virus large surface antigen gene in transgenic tomato plants hepatitis b surface expression in transgenic tobacco (nicotiana tabacum) plants using four different expression cassettes expression of hepatitis b surface antigen in transgenic banana plants and nt-1 cell line of tobacco hepatitis b surface antigen (hbsag) expression in plant cell culture: kinetics of antigen accumulation in batch culture and its intracellular form immunogenicity of transgenic plant-derived hepatitis b surface antigen analysis of transgenic tobacco plants carrying the gene for the surface antigen of the hepatitis b virus immunogenicity of parenterally delivered plant-derived small and medium surface antigens of hepatitis b virus oral administration of low doses of plant-based hbsag induced antigen-specific igas and iggs in mice, without increasing levels of regulatory t cells tissue specific expression of hepatitis b virus surface antigen in transgenic plant cells and tissue culture immunogenicity and tolerance following hiv-1/hbv plant-based oral vaccine administration production of marker-free plants expressing the gene of the hepatitis b virus surface antigen virus-like particles expression and assembly in plants: hepatitis b and norwalk viruses secretion of hepatitis b surface antigen in transformed tobacco cell suspension cultures a plant signal peptide-hepatitis b surface antigen fusion protein with enhanced stability and immunogenicity expressed in plant cells process options in hepatitis b surface antigen extraction from transgenic potato study of the immunogenicity of hepatitis b surface antigen synthesized in transgenic potato plants with increased biosafety a plant-derived edible vaccine against hepatitis b virus low-dose oral immunization with lyophilized tissue of herbicide-resistant lettuce expressing hepatitis b surface antigen for prototype plant-derived vaccine tablet formulation freeze-drying of plant tissue containing hbv surface antigen for the oral vaccine against hepatitis b analysis of the limitations of hepatitis b surface antigen expression in soybean cell suspension cultures obtaining tomato plants transgenic for the pres2-s-hdel gene, which synthesize the major hepatitis b surface antigen agrobacterium tumefaciens-mediated transformation of yellow lupin to generate callus tissue producing surface antigen of hbv in a long-term culture bioencapsulation of the hepatitis b surface antigen and its use as an effective oral immunogen supercritical fluid extraction provides an enhncement to the immune response for orally-delivered hepatitis b surface antigen oral delivery of wafers made from hbsag-expressing maize germ induces long-term immunological systemic and mucosal responses oral immunization of animals with transgenic cherry tomatillo expressing hbsag construction of a plant effective expression vector containing the gene of hepatitis b virus surface antigen the integration of a major hepatitis b virus gene into cell-cycle synchronized carrot cell suspension cultures and its expression in regenerated carrot plants expression of hepatitis b surface antigen gene (hbsag) in laminaria japonica (laminariales, phaeophyta) transforming hbsag into peanut and detection of its immunogenecity plant expression, lyophilisation and storage of hbv medium and large surface antigens for a prototype oral vaccine formulation oral immunogenicity of potato-derived hbsag middle protein in balb/c mice retention of the ability to synthesize hiv-1 and hbv antigens in generations of tomato plants transgenic for the tbi-hbs gene synthesis of hepatitis b virus surface antigen in tomato plants transgenic for the pres2-s gene candidate mucosal vaccine against hepatitis b based on tomatoes transgenic for the pres2-s gene comparative analysis of hbv m-antigen production in leaves of individual transgenic carrot plants application of the human hepatitis b virus core antigen from transgenic tobacco plants for serological diagnosis high-level production of hepatitis b core antigen in plant leaf and its immunogenicity in mice extremely high-level and rapid transient protein production in plants without the use of viral replication a dna replicon system for rapid high-level production of virus-like particles in plants tandem fusion of hepatitis b core antigen allows assembly of virus-like particles in bacteria and plants with enhanced capacity to accommodate foreign proteins seed-based expression systems for plant molecular farming the use of viral vectors to produce hepatitis b virus core particles in plants hbv core particles as a carrier for b cell/t cell epitopes envelopment of the hepatitis b virus nucleocapsid weekly epidemiological record; hepatitis b position paper world health organization (who) toward the global elimination of hepatitis b virus transmission optimization of elastin-like polypeptide fusions for expression and purification of recombinant proteins in plants plant-based edible vaccine against hbv oral immunization of human with transgenic lettuce expressing hepatitis b surface antigen the twenty-year story of a plant-based vaccine against hepatitis b: stagnation or promising prospects? recombinant hepatitis b vaccines: disease characterization and vaccine production. in production of recombinant proteins. novel microbial and eukaryotic systems plants as bioreactors for the production of vaccine antigens immunogenicity of a novel, bivalent, plant-based oral vaccine against hepatitis b and human immunodeficiency viruses saponin-adjuvanted particulate vaccines for clinical use immunomodulatory properties of vitamins, flavonoids and plant oils and their potential as vaccine adjuvants and delivery systems activation of antigen-presenting cells by immunostimulatory plant dna: a natural resource for potential adjuvant stability of s-hbsag in long-term stored lyophilised plant tissue key: cord-009636-5kddituy authors: shirbaghaee, zeinab; bolhassani, azam title: different applications of virus‐like particles in biology and medicine: vaccination and delivery systems date: 2015-12-22 journal: biopolymers doi: 10.1002/bip.22759 sha: doc_id: 9636 cord_uid: 5kddituy virus‐like particles (vlps) mimic the whole construct of virus particles devoid of viral genome as used in subunit vaccine design. vlps can elicit efficient protective immunity as direct immunogens compared to soluble antigens co‐administered with adjuvants in several booster injections. up to now, several prokaryotic and eukaryotic systems such as insect, yeast, plant, and e. coli were used to express recombinant proteins, especially for vlp production. recent studies are also generating vlps in plants using different transient expression vectors for edible vaccines. vlps and viral particles have been applied for different functions such as gene therapy, vaccination, nanotechnology, and diagnostics. herein, we describe vlp production in different systems as well as its applications in biology and medicine. © 2015 wiley periodicals, inc. biopolymers 105: 113–132, 2016. v irus-like particles (vlps) known as viral "empty shells" maintain the same structural properties of virions, without genome. these constructs are considered very efficient as vaccine platforms and therapeutic delivery systems. 1 many antigens can readily be displayed on the surface of vlps. these antigens can be genetically or chemically fused to the vlp. 2 regarding to the reports, the immune stimulation by vlps contains: (a) stimulation of innate immunity through tlrs and pattern recognition receptors (prrs) due to the expression of multivalent structures; (b) induction of strong humoral response and also igm in t-cell independent way; and (c) enhancement of the uptake, processing and presentation by apcs through mhc i and mhc ii cross-presentation pathway due to the particulate nature of vlps. 3 vlps can be subcutaneously or intramuscularly injected. their small diameter facilitates entry into lymphatic vessels and direct drainage into local lymph nodes. once in the lymph node, vlps are taken up by lymph node resident dendritic cells (dcs). this uptake is enhanced by the size and form of vlps. vlps stimulate cd4 t cells via the mhc ii pathway, as well as highly efficient cross-presentation on the mhc class i pathway. 3 generally, viral-like particles, are considered as vaccine candidates because their natural properties such as multimeric antigens and their specific structures are suitable for the stimulation of efficient humoral and cellular immunity. currently, the development of recombinant subunit vaccines (suvs) has been significantly increased using heterologous expression systems. antigens derived from many bacterial, viral, fungal and parasitic pathogens were used for safe and effective vaccination. five vlp-based vaccines have been already approved including three for hbv and two for hpv, while in the veterinary field; a vlp-based vaccine against porcine circovirus type 2 (pcv2) has been approved. some vlp-based vaccines targeting human and animal diseases are recently in late stages of clinical trials. vlps have a positive value as academic, industrial, and commercial systems especially in gene therapy and design of nanomaterials. however, the study of the vlp-based applications (vaccination, gene and drug delivery, and imaging) must be followed to show the reliability, and cost efficiency of this technology. furthermore, the expression systems would be improved to achieve the best strategy for vlp production from different viral genes. this review will focus on vlp characteristics and its applications especially as vaccines or delivery systems for dna, sirna and drugs. it should be noted that in the vaccination field whenever a viral-like particle carries genetic material is called "vectored vaccines 4 " and in gene therapy, they are called viral vectors. however, for simplicity in this review, we called all particles entitled as viral-like particles (vlps). viral-like particles (vlps) have been generated for over thirty various infectious viruses in animals and humans. 5 vlps are composed of one or more structural (/capsid) proteins possessing natural properties for self-assembly, and are morphologically similar to authentic viruses. 5, 6 comparing to live viruses, vlps are non-replicating and non-infective due to the lack of infectious genetic material. 5 virus-like particles have the potential to be used as safe vaccine candidates without the need for any adjuvant. 7, 8 different viruses present different structures for generation of viral-like particles such as: a. simple viral capsids with one or two major proteins (e.g., parvoviruses, papillomaviruses, circovirses, calciviruses, hepatitis e virus (hev) and polyomaviruses). b. complex viral capsids with various protein layers, encoded by many distinct mrnas, or generated from a single polyprotein (e.g., picornaviruses). c. viral capsids with lipid envelopes including a lipid bilayer obtained from the host cell, as well as viral glycoprotein spikes (e.g., influenza, hiv and hepatitis c). 5, 9 figure 1 shows the general model of vlp along with its applications. the selection of expression vector is one of the major factors in vlp generation. the reports showed the successful production of 174 vlps indicating that bacterial systems, yeast and insect systems are used in 28%, 20%, and 28% of the cases. in addition, mammalian cells (15%) and plants (9%) were usually applied to produce vlps with special properties. 8 bacterial systems are often included the commercial e.coli strains and expression vectors, to produce non-enveloped vlps in high levels compared to other systems (table i) . 5 in addition, bacterial cells have been applied for generation of vlps which need several types of structural proteins, such as the avibirnavirus ibdv vp2, vp4, and vp3-polyproteins. 54 the reports indicated that the expression of the hepatitis b virus (hbv) capsid protein in e. coli leads to the formation of structures similar to the hbv core (hbc) particle. 55 bacterial figure 1 general model of vlp along with its applications: the picture shows the recombinant hpv16 l1 pentamers assembled in vitro into capsid-like structures. self-assembly of recombinant viral coat proteins into empty capsids is a promising strategy for production of virus-like particles (vlps) in vaccine design. the resulting vlps can induce a protective immune response by mimicking the authentic epitopes of virions. systems are not always a desired plan for vlp production due to several factors, such as (a) lack of ability to generate recombinant proteins with mammalian-like post-translational modifications (ptm), (b) failure to produce the correct disulfide bonds, (c) drawbacks of protein solubility, and d) the existence of lipopolysaccharides (lps)/or endotoxins in production of recombinant proteins (rp). 5 viral coat proteins (cps) can be efficiently produced as insoluble inclusion bodies, purified under denaturing conditions, refolded, and selfassembled, as indicated in the parvovirus b19 and the ccmv and cmv plant viruses. 56 a simple change in the cultivation conditions such as low-temperature can solve the problem of inclusion bodies and induce the formation of soluble vlps, as performed for two viral systems, the densovirus ihhnv, 57 and the potyvirus pvy. 58 some factors including the resistance markers of the expression plasmids and the composition of the cultivation medium can also change the vlp assembly (e.g., bacteriophage qb). 59 another strategy applied to increase expression levels and solubility involves the use of different fusion protein systems, e.g., glutathione-s-transferase (gst) fusion proteins such as the papillomavirus l1, the polyomavirus mupyv, and the picornavirus fmdv. [60] [61] [62] [63] other prokaryotic hosts have been recently used to generate vlp, e.g., lactobacillus. 8 the intracellular assembly of hpv16 l1 vlp was reported in lactobacillus casei, a lactose-inducible expression strain. 5 furthermore, the production of l1 vlps using lactobacillus developed new live mucosal prophylactic vaccines (table i) . 29, 30 a pseudomonas fluorescens (p. fluorescens) expression system is an efficient choice against e. coli, because of simple manipulation, high yields of active and soluble proteins, and largescale cultivation. some differences between p. fluorescens and e. coli including the various sizes of genome, and diverse metabolic approaches can influence the generation of recombinant proteins. 64 the capsid protein of a plant bromovirus, the cowpea chlorotic mottle virus (ccmv), has been recently expressed as a soluble form in p. fluorescens, and assembled into vlps in vivo. this construct was structurally similar to the natural viral particles provided from plants. 64 eukaryotic expression systems are a striking alternative to bacteria, especially for solving the problem of bacterial endotoxins in vaccine development. some structural genes of mammalian viruses expressed in yeast are able to form the vlp. this expression host has been efficiently applied to generate the first licensed hbv vaccine. 65 hbsag is one of the antigens commonly utilized for production of vlp-based hbv vaccine. hbsag has been expressed in pichia pastoris (p. pastoris), sac-charomyces cerevisiae (s. cerevisiae) and hansenula polymorpha (h. polymorpha) (table i) . 5, 16 it is critical to consider that the viral-like particles are not always formed during the cultivation procedure of the yeast cells. these studies showed that the selfassembly of the vlps in pichia system should be completed during the protein purification. 16, [66] [67] [68] the expression and selfassembly of recombinant bacteriophage q coat protein (q-cp) was indicated in saccharomyces cerevisiae and pichia pastoris. the yeast-derived q-vlps were greatly immunogenic in mouse similar to that in e.coli-derived q-vlps. 69 ms2 vlps produced in saccharomyces cerevisiae could package functional heterologous mrnas. for example, the linkage of the ms2 packaging sequence to the human growth hormone mrna allowed the packaging of the mrna in ms2 vlps. indeed, the high stability of ms2 vlps suggests them as an efficient delivery system for rna-based vaccines. 70 the p. pastoris system was also utilized as a potent alternative for expression of ccmv coat protein vlps due to easy manipulation and high expression levels. 71 in addition, this system has been utilized to express efficiently the premembrane and envelope glycoproteins of dengue virus type 2 (denv-2), 72 hbsag, 73, 74 hccag 75 resulting in the generation of vlps. 72 the major advantage of yeast systems is the ptm including phosphorylation or glycosylation, as indicated in hbv vlps. 8 the studies indicated that hbc phosphorylation plays a major role in viral replication and capsid formation. such yeast-derived hbc vlps are valuable for vaccination and diagnostics. 76 furthermore, the potent multigene expression systems have been constructed in yeasts. for example, the expression of three rotavirus structural genes from a single plasmid vector led to the generation of triple layered vlps in saccharomyces cerevisiae. 8, 77 however, the multimerization of protein into vlps is not supported for the enveloped viruses (e.g., gag vlps of hiv-2), suggesting that yeast does not have the essential factors of host. 8 thus, the generation of enveloped hiv-1 pr55gag vlps has been performed using s. cerevisiae spheroplasts, morphologically similar to immature viral particles. 5, 78 in general, the construction of yeast expression systems, especially hansenula and pichia strains, are more difficult than bacterial vectors. in addition, the yield of vlp production is less than that in e.coli. 8 other limitation of yeast system is its dissimilarity with mammalian cells in the ptm of proteins, especially glycosylation. 79,80 therefore, this system is more suitable for the generation of non-enveloped viral-like particles. another attractive system utilized broadly for production of vlp is the baculovirus-insect cell expression system, due to 118 shirbaghaee and bolhassani some advantages, such as the rapid growth ratios, the culture preparation in large-scale, and the ptm of the target proteins similar to mammalian cells. [81] [82] [83] the results showed that both yeast and insect cells were previously used for the vp1 expression of several polyomaviruses, and its assembly into viral-like particle. 84 in addition, insect cells were used to provide vlpbased vaccines, e.g., the approved hpv vaccine, cervarix. indeed, insect cells are able to generate both vlp types (i.e., enveloped and non-enveloped). there are enveloped vlps in clinical trials. 9 the main limitation of insect cell system is protein contamination with the enveloped baculovirus particles, suggesting the development of efficient plans for purification of vlps. 85 recently, co-expression of four genes of human influenza h3n2 virus (i.e., ha, na, m1, and m2) in insect cells led to generate influenza vlps which protected mice against h3n2 virus challenge. 86 these data suggested that viral-like particles are a hopeful vaccine candidate for h9n2 influenza and probably other subtypes of virulent avian influenza viruses. 87 the non-infectious viral-like particles of the alphavirus sav was also generated using the recombinant baculoviruses expressing sav capsid protein and two major immunodominant viral glycoproteins (e1 and e2) in insect cells. 88 moreover, baculovirus expression system was utilized to generate vlps from cowpea mosaic virus (cpmv), tomato bushy stunt virus, and entorovirus271 (ev71). 8, 89, 90 recently, non-replicative baculovirus have been developed to cope with the problem of baculovirus contamination. 91 stable systems using insect cells have been also tested. 92 moreover, silkworm expression systems were efficiently applied to generate vlps and the surface of vlps could be changed by some strategies, irrespective if their constructs are enveloped or not. silkworms show a high capability for production of recombinant proteins, in comparison with insect cells, and also easy and inexpensive protein preparation similar to e.coli expression system. 81 for over two decades, different mammalian cell lines have been developed as a source of commercial therapeutic proteins for clinical applications, 93 because of their ability for proper protein folding, assembly and ptm (e.g., the correct glycosylation pattern). 8, 93 however, high costs of production and potential safety concerns remained a challenge for these systems. the mammalian cells were progressively utilized to produce vlpbased vaccines 5,94 , e.g., for influenza viruses. for instance, the generation of a stable mammalian cell line (e.g., vero cells) expressing four influenza structural proteins (ha, na, m1, and matrix 2 (m2)) led to form hybrid vlps containing matrix proteins, and surface glycoproteins of h3n2 and h5n1 influenza types, respectively. 8, 95 another examples are the produc97 and hiv-1 vlp in cos-7/vero cells, 98 and hbv vlp in cho cells. [99] [100] [101] plant systems plants were successfully used to express specific gene products. the feasibility of recombinant plants for generation of vaccine antigens were shown in tobacco plants, potato tubers, and others. 102 this approach develops vaccine strategies which can stimulate mucosal as well as systemic immune responses. in addition, it can be delivered orally as part of a normal biologic function in human. 102 the antigen expressed in plant systems shows extensive disulphide crosslinking and oligomerization for formation of virus-like particles. for example, the hepatitis b major surface antigen has been expressed in several plant systems. 103 plants are able to express and assemble both types of vlps (i.e., enveloped and non-enveloped) as multimeric and chimeric proteins. the high expression of vlps in plant is easy and rapid (e.g., 1-2 weeks) using a tobacco mosaic virus (tmv) rna replicon system and/or a bean yellow dwarf virus (beydv) dna replicon system. 104 another advantage of plants is the use of plant virus particles as a delivery system to present foreign epitopes. furthermore, the problem of plant-specific glycans has been partially solved using the development of transgenic plants with "humanized" glycosylation pathways. 104 plantderived vlps can be used for oral delivery of vaccines. virallike particles are more resistant to digestive enzymes than soluble proteins in body, because of their highly ordered and packed structures. for example, the gastrointestinal virusesderived vlps including noroviruses and rotaviruses were utilized orally as potent candidates for mucosal immunization. 105 plant-derived vlps showed the same structures with vlps generated in other expression systems accompanied by a comparable or higher immunogenicity. some plant-derived vlps could induce protective humoral and cellular immunity and also safety in clinics. 105 the studies showed that the level of protein expressed in the recombinant plants is variable and often low. therefore, further increase in expression will be necessary for practical and efficient products. 102 recent progress in the glyco-engineering of plants allows human-like glycol-modification and optimization of desired glycan structures for increasing safety and functionality of recombinant pharmaceutical glycoproteins. 1 some plantbased systems can stabilize antigen and thus reduce storage and distribution costs. 103 different applications of virus-like particles 119 toxoplasma gondii (t. gondii) is an obligate intracellular parasite infecting the nucleated cells of warm-blood vertebrates. this parasite is able to stimulate strong humoral, cellular and mucosal immunity, and thus it can be used as an efficient delivery system for heterologous antigens. t. gondii was applied as a vector for live vaccination against infectious pathogens. [104] [105] [106] [107] [108] [109] recently, a non-pathogenic kinetoplastida, leishmania tarentolae, was utilized to express heterologous proteins. the studies showed that expression of mammalian glycoproteins in this parasite leads to their modification with mammalian-like oligosaccharides. [110] [111] [112] [113] recently, our group has focused on its use as a live vector or killed vaccine, [114] [115] [116] and also generation of viral coat proteins and their assembly as vlp in this system. 117 virus-like particles show an efficient strategy to deliver antigens to the immune system, inducing both arms of the adaptive immunity. 118 indeed, vlps present antigenic epitopes in the proper conformation, leading to induce humoral responses. 5 for example, preclinical trials with influenza vlps indicated their capacity to induce both humoral and cellular immune responses at low antigen doses. several authors have reported antibody response to parenterally or orally administered plant-derived antigens. 119, 120 as exogenous antigens, vlps are taken up by professional antigen presenting cells (apcs), especially dcs, followed by antigen processing and presentation via mhc class ii molecules, dc activation and maturation through up-regulation of co-stimulatory molecules and cytokine production, and stimulation of cd41 t helper cells. all these events can efficiently induce both humoral and cellular immunity. 5 in addition, the exogenous vlps can enter the cytosol of dcs, be processed and presented by mhc class i molecules to cytotoxic t lymphocytes (ctls) using cross-presentation. 5, 121, 122 furthermore, the b-cell activation using vlps is robust enough to induce t cell-independent igm antibodies. 7, 8 dcs loaded with yeast-derived hiv vlps can alter gag-specific memory cd81 t cells into effector cells through cross-presentation in chronically hiv-infected individuals, although some gag-specific t cells in these patients did not show any response. 123 the reports showed that the expression system used for generation of vlp might significantly affect direction, type and outcome of immune responses. 121 for example, potent and specific immunomodulatory effects were assigned to yeast-derived hiv vlps in comparison with other expression systems. 123 on the other hand, plant-or insectderived vlps, consisting of the l1 capsid protein of hpv, were both immuno genic to an equal degree. half of mice fed trans-genic potatoes expressing hpv vlps developed l1-specific antibodies. 124 the studies indicated that the vlps are taken up by clathrin-dependent macropinocytosis and phagocytosis before being degraded in acidic lysosomal compartments. vlp-derived peptides are loaded onto mhc i that have been recycled from the cell surface. 125 a study showed that uptake and activation of dc by vlp involves proteoglycan receptors, tlr4 and nf-kb, and can be inhibited by heparin. 126 several data suggest different routes of vlp uptake by dc and langerhans cells (lc). 127 for example, lcs and dcs internalize similar amounts of hpv-vlps in vaccine design, albeit through different uptake mechanisms. 128, 129 vlp uptake by dcs results in activation and cross-presentation of mhc i-restricted peptides with co-stimulation to t-cells. on the other hand, vlp uptake by lc leads to cross-presentation in the absence of costimulation. efficient vlp cross-presentation by lcs with costimulation can be achieved by addition of cd40 ligand. 128 the lack of a protective immune response after viral contact with lcs may explain why some women fail to induce an immune response against the virus. lcs endocytose hpv vlps via a non-clathrin, non-caveolae, actin-independent pathway, whereas dcs take up hpv vlps both by a clathrin-mediated mechanism and via macropinocytosis in an actin-dependent manner. this difference in endocytosis resulted in processing and presenting hpv vlp peptides by lcs similar to that by dcs on their surface, but in the absence of co-stimulation. with the addition of cd40l, lcs incubated with hpv vlps generated the efficient amounts of the pro-inflammatory cytokine (il-12) and could stimulate a hpv-specific immune response after incubation with t cells. 128 despite these differences, vlps taken up by dc and lc were able to prime naive cd81 t cells and induce cytolytic effector t cells in vitro. 127 furthermore, hiv-1 pr55 gag virus-like particles could stimulate strong humoral and cellular immune responses. vlp expressed by recombinant baculoviruses activated human pbmc to release pro-inflammatory (il-6, tnf-a), antiinflammatory (il-10) and th1-polarizing (ifn-c) cytokines as well as gm-csf and mip-1a in a dose-and time-dependent manner. furthermore, vlp-induced monocyte activation was shown by up-regulation of molecules involved in antigen presentation (mhc ii, cd80, and cd86) and cell adhesion (cd54). exposure of vlp to serum inactivated its capacity to stimulate cytokine production. 130 the linking of vlps to adjuvant molecules was also shown to improve the immunogenicity of the nano-bioparticles. 131 adjuvanted vlps [e.g., cpg odn1826 or poly (i: c) adjuvants] elicited a higher titer of total specific igg compared to vlps alone. furthermore, while vlps alone induced a balanced th2 pattern, vlps formulated with adjuvant elicited a th1-biased igg subclasses (igg2a and igg3), with poly (i: c) more potent than cpg odn1826 in 120 shirbaghaee and bolhassani animal model. 118 in addition, mice immunization with chimeric simian immunodeficiency virus (siv) vlps containing gm-csf significantly induced siv env-specific antibodies as well as neutralizing activity at higher levels than those elicited by standard siv vlps, siv vlps containing cd40l, or standard vlps mixed with soluble gm-csf. on the other hand, the incorporation of immunostimulatory molecules showed significantly increased cd41 and cd81 t-cell responses to siv env, compared to standard siv vlps. 132 formulation of vlps with rough lps (r-lps) adjuvant as well as dna primed-vlp boosted regimen were led to increase specific immune responses as compared to vlps alone, but among them the vlp/r-lps highly enhanced immune response. 133 recent studies demonstrated the potential of the hbc vlps as an oral immunogen. intraperitoneal immunization with the hbc vlp induced a strong, mixed th1/th2 response. in contrast, oral administration of the hbc vlp generated a high humoral response with mainly igg2a antibodies, directing toward a th1 response which is essential in the control of intracellular pathogens. 134 in addition, the intranasal monovalent adjuvanted norwalk vlp vaccine was well tolerated and highly immunogenic. 135 the studies showed that chimeric hpv-vlps are able to elicit potent ctl responses in mice against hpv16transformed tumors; however, the mechanism of t cell priming has remained obscure. hpv vlp could bind to human mhc class ii-positive apcs through interaction with fccriii, and immature dcs were activated after incubation with hpv vlp. 136 it was shown that binding and uptake of vlp by dc from fccrii, fccriii, and fccrii/iii deficient mice are reduced by up to 50% compared with wild-type mice. in addition, maturation of murine dc from fccrii/iii-deficient mice by vlp is also reduced, indicating that dc maturation, and thus ag presentation, is diminished in the absence of expression of fccr. 136 poor immunogenicity of mucosally administered proteins has been a major barrier for development of efficient oral vaccines. one way to overcome this obstacle is the use of appropriate adjuvants. also, delivery of antigen to mucosal surfaces as vlp provides an efficient way of inducing mucosal immunity. after oral or intranasal immunization with norwalk vlp, or rotavirus vlp without adjuvant, intestinal iga was detected in immunized mice, which were protected from virus challenge. 137 in addition, the plasma cell precursors that migrate to the genital tract are derived primarily from mucosal lymphoid tissues and often secrete iga. 138 the studies indicated that immune responses generated by mucosal administration of vlp were generally weaker than systemic administration. vlp specific iga was higher in intestine washes following intrarectally (i.r.) than intravaginally (i.va.) immunization, and higher in vaginal washes following intramuscularly (i.m.) than i.r. or i.va immunization. some studies suggested that the immunogenicity of virus particles at mucosal surfaces is probably a property of particulate antigens assembled as multimers of subunits. indeed, vlp might be actively taken up by mucosal apc through the integrin receptors. 137 lipoparticles are stable, highly purified, homogeneous, and specialized vlps containing high concentrations of an integral membrane protein. integral membrane proteins are involved in different biological functions and are targeted by 50% of existing therapeutic drugs. however, because of their hydrophobic domains, membrane proteins are difficult to manipulate outside of living cells. lipoparticles can incorporate a wide variety of the membrane proteins, including g proteincoupled receptors, ion channels, and viral envelopes. lipoparticles provide a platform for different applications such as antibody screening, production of immunogens, and ligand binding assays. [139] [140] [141] during the assembly of enveloped viruses, lipid ordered domains of the host cell plasma membrane, known as lipid rafts, frequently function as a natural target for viral proteins. the role of lipid rafts in the organization of complex combinations of immune receptors during antigen presentation and t cell signaling is extensively recognized. 142 on the other hand, in order to improve the immunogenicity of hiv-1 envelope glycoproteins, the fusion of gp120 was performed to a carrier protein, hepatitis b surface antigen (hbsag) which is capable of spontaneous assembly into viruslike particles. the hbsag-gp120 hybrid proteins assembled efficiently into 20-30 nm particles. the particles resembled native hbsag particles in size and density, consistent with a lipid composition of about 25% and a gp120 content of about 100 per particle. particulate gp120 folded in its native conformation and was biologically active, as shown by high affinity binding of cd4. because the particles are lipoprotein micelles, an array of gp120 on their surface closely mimics gp120 on the surface of hiv-1 virions. these gp120-rich particles can enhance the quality, and also quantity of antibodies elicited by a gp120 vaccine. 143 virus-like particles show an expanding spectrum of applications such as gene therapy, nanotechnology, vaccination, and diagnostics. 55, 77 recently, the studies showed a pattern of direct conjugation of some ligands, including nucleic acids and proteins attached to vlp surface. 144, 145 in addition, because of the superior accessibility of cysteine and lysine residues on vlps, bio-conjugation has been performed by commercial homo-or hetero-bifunctional linkers. [146] [147] [148] [149] for example, three foreign proteins were chemically conjugated to the vlp surface of cpmv by proper bifunctional cross-linkers. 147 on the other hand, the researchers could produce an alphavirus vlp surrounding a functional gold nanoparticle. 150 vlps have been also used to stimulate immune responses and generate antitumor responses, e.g., alphavirus-based virus-like replicon particles (vrp) expressing various melanoma antigens. [151] [152] [153] it is interesting that the first viral-associated cancer vaccines were founded on hbv vlp and hpv vlp to prevent hbvassociated hepatocellular carcinoma (hcc) and hpvassociated cervical carcinoma, respectively. 153, 154 it should be noted that these vlp formulations are viral vaccines that prevent a viral infection that may progress to carcinoma after a long time. we indicate some applications of vlps against viral diseases as following: in several studies, specific vaccine antigens were generated by various expression systems to induce protective immune responses and apply in licensed recombinant viral vaccines. 100, 155 some examples of preventive vlp-based vaccines are recently commercialized worldwide including glaxos-mithkline's engerixv r (hbv) and cervarixv r (hpv), and merck and co., inc.'s recombivax hbv r (hbv) and gardasilv r (hpv). other vlp-based vaccines undergo preclinical evaluation or clinical trials, including parvovirus-, influenza-, norwalk-derived vlps and also different chimeric vlps. 156 for generation of immunogenic vlps, eukary otic expression hosts including yeast (s. cerevisiae, p. pastoris and h. polymorpha) and mammalian cells (chinese hamster ovary cell line [cho]) were used. the studies indicated that the recombinant hbsag generated in cho and h. polymorpha have significant differences in size, molecular weight (mw), and monomer number. furthermore, the cho-derived viral-like particles include a combination of glycosylated and non-glycosylated hbsag proteins, similar to those in patients' sera, while yeastderived antigens were reported to be non-glycosylated. chobased vaccines were provided by pasteur-m erieux aventis in france (genhevac bv r ) and scigen in israel (sci-b-vac tm ). both vaccines contained not only the hbsag s pro tein but also the m protein (genhevac b) or the m and l protein (sci-b-vac). 156 on the other hand, gardasil approved by the fda in 2006 is a quadri valent hpv types 6/11/16/18 l1 vlp vaccine produced in s. cerevisiae. cervarix is the other licensed hpv vaccine approved by the fda in 2009. 156 cervarix is a bivalent hpv types 16/18 l1 vlp vaccine expressed via a recombinant baculovirus vector. 25, 157 different experiments have been concentrated on hpv vlp vaccination in mouse and human models including: (a) activation of immature human dcs by chimeric hpv16 vlps, (b) determination of systemic cytokine pattern elicited by hpv l1 vlps, (c) identification of gene expression signatures in hpv16 l1 vlp-induced human pbmcs, (d) generation of potent and prolonged neutralizing l1 antibodies using a single intramuscular (im) mice injection with recombinant adenoassociated virus encoding hpv16 l1 protein (raav-16l1), (e) augmentation of immunogenicity of hpv l1 dna vaccines using genetic linkage to a chemokine and secretory signal peptide sequences, (f) potent stimulation of systemic and mucosal immune responses to vlp vaccines using the encapsulation of a genetic cytokine adjuvant (e.g., il-2), (g) improvement of hpv16 vlp immunogenicity by linkage to the modified adjuvant, and m) nasal immunization of mice with hpv16 vlps. 158 hpv16 l1-e7 chimeric virus-like particles (cvlp) could induce e7-and l1-specific ctls. the therapeutic potential of the cvlp also indicated a considerable safety in high grade cervical intraepithelial neoplasia patients (cin 2/ 3). 159 several improvements in vaccine design by vlp are still in preclinical trials. some main examples are referred as following: a. co-injection of the hpv16 l1 vlp with e. coli heatlabile enterotoxin (lt) as an adjuvant significantly increased the levels of serum igg and vaginal iga after nasal or bronchial mice immunization. 160 antigens (hiv-1 p17/p24: ty vlp) was also immunogenic and well-tolerated in phase i clinical trials. 24,169 g. several groups have focused on improving bacteriophagebased vlp vaccines, e.g., rna bacteriophage qb. these chimeric vlp vaccines were targeted against noninfectious diorders including hypertension, allergy, neurodegenerative and autoimmune diseases (e.g., diabetes mellitus type ii and alzheimer), cancer (e.g., melanoma). the vaccine candidate against alzheimer (cad-106) was constructed to display chemically coupled amyloid beta (ab1-6) peptide derived from the n-terminal b cell epitope of ab protein, on the surface of qb-cp vlps. this vaccine could stimulate ab-specific igg and decrease amyloid accumulation in animal models expressing ab precursor protein, without eliciting t-cells or inflammatory reactions in brain tissue. 170, 171 in addition, the angiotensin ii vaccine was synthesized by covalently conjugation of a peptide derived from angiotensin ii to the rna bacteriophage qb vlp capsid. this modified vlp could decrease blood pressure in spontaneously hypertensive rats. 172 table i shows preclinical and clinical studies of vlps in vaccine development. generally, a major application of vlps is the stimulation of immunity against foreign protein epitopes by genetically fusing or chemically conjugating them to vlps entitled as chimeric vlp (cvlps). 173 antigens can be fused to vlps through either covalent or non-covalent bonds. the most common covalent bond is generated by the heterobifunctional chemical cross-linkers with amine and sulfhydryl-reactive arms. 104 for instance, cysteine-containing antigens can be conjugated to lysine residues of vlps surface at a high density (e.g., three peptides per coat protein molecules). the non-covalent conjugation strategy contains the use of streptavidin as linkers to attach biotinylated antigens and vlps through their efficient and specific interactions. 104 sv40 vlps can also encapsulate various materials such as dna (5 kb) and proteins as antigens. insertion of a special exogenous peptide into the surface loops of vp1 produced sv40 vlps with the ability of cell targeting. moreover, sv40 vlps stimulated innate immunity as a natural adjuvant. indeed, sv40 vlps may be a promising vaccine candidate to deliver heterologous antigens followed by the induction of ctls without synthetic adjuvants. 174 several chimeric vlp vaccines have entered clinical trials, such as the anti-influenza a m2-hbcag vlp vaccine (hbcag vlps displaying m2 epitope of influenza a), the anti-hiv p17/p24: ty vlp, two anti-malaria vaccines (hbcag vlps displaying malaria epitopes), the nicotine-qb vlp and the anti-ang ii qb vlp. 175 genetic linkage contains a stable bond between vlp and antigen. the studies showed that only peptides shorter than 30 amino acids (small peptides) can be presented without interfering with the correct assembly of vlps. other limitations contain the improper folding of displayed antigens and the formation of cvlps with heterogeneous size. to prevent these issues (e.g., assembly problems), structural studies have identified domains for different vlps such as hbcag, hbsag and hiv gag that were not necessary for vlp assembly as well as allowed insertion of foreign antigens. 104 the simplest way for generation of single component cvlps, is the insertion of peptides at the n-or c-terminal regions of chimeric vlps. multiple fusion positions should be identified to produce multicomponent cvlps inducing broad immune responses. 104 the direction and intensity of the immune responses are significantly influenced by the vlp type, the foreign antigen density, and its accessibility on or within the vlp. furthermore, preexisting immunity against the epitopes of the vlp as a delivery system may importantly change the response against the heterogenous antigen. for example, hbcag was also utilized to display a neutralizing epitope of hpv16 l2 protein. the nasal delivery of hbcag-hpv16 l2 epitope cvlps expressed in tobacco induced antigen-specific antibody responses in mouse model. on the other hand, an hpv16 l1-based chimeric vlp was generated in transgenic tomato to present several t-cell epitopes from hpv16 e7 and e6 proteins. the hpv l1-e7/e6 vlps elicited a neutralizing antibody response similar to that from an equal amount of the commercial vaccine (gardasil) in preclinical study. moreover, the chimeric vlps induced ctl responses against the e7 and e6 epitopes. chimeric hpv l1 vlps were also designed using genetic fusion to display epitopes of influenza m2 protein. 104 to overcome the problems associated with genetic fusion including the antigen size, conformation and vlp assembly, different applications of virus-like particles chemical conjugation approaches were applied to construct cvlps. in this strategy, target antigens and native vlps were generated individually and coupled together by attachment of the antigen to the surface of the pre-assembled vlps. two main advantages of this strategy include: (a) various sizes and types of antigens can be exposed, and (b) the antigen-vlp binding site can be manipulated for further presentation of the conjugated antigen. for example, vlps were used to display full-length and correctly folded proteins, such as interleukin-17 (il-17). 104 generally, vlps were used for delivery of protein/peptide, dna, sirna and drugs as a brief description in following: viral-like particles were used as a peptide/protein carrier, in vitro and in vivo. there are several examples for delivery of protein/peptide using vlps as following: a. chimeric vlp vaccines have been improved based on rna bacteriophage ap205, presenting peptides of selfantigens or pathogens fused to either the n-or cterminal regions of ap205 coat protein. ap205-derived vlps were highly immunogenic in mice. furthermore, influenza m2 vlps stimulated an efficient m2-specific antibody response and full protection against lethal influenza virus challenge. 176 b. vlps containing flt3 ligand (fl-vlps), a dc growth factor, could effectively increase immunogenicity in mice. dcs exposed to vlps also produced high levels of il-6. 177 c. a plant vlp-based approach was used to develop respiratory syncytial virus (rsv) vaccine. a target peptide displaying amino acids 170-190 of the rsv g protein was delivered on the surface of recombinant alfalfa mosaic virus (almv) particles. this construct induced high pathogen-specific immune responses in immunized animals. 178,179 d. in a recent study, a peptide from an external loop of mouse ccr5 protein was inserted into a neutralizing epitope of hpv l1. the particles generated by this chimeric l1 could elicit high levels of ccr5 antibodies that specifically recognized the surface of ccr5transfected cells and blocked in vitro infection of an mtropic hiv strain in mice. 161 in addition, chimeric vlps containing the full length hpv16 e7 oncoprotein linked to l2, or the n-terminal region of e7 fused to l1, could induce antigen-specific protection of mice from lethal challenge with e7-expressing tumor cells. 180-182 e. a pre-s1 epitope of hbv was also inserted into the ef loop of hpv vlp recognized by hbv-specific antibody. 6 chimeric vlps produced in e.coli carried a virus-neutralizing hbv pre-s1 epitope in the major immunodominant region (mir) and a highly conserved n-terminal hcv core epitope (aa 1 to 60) at the c-terminal region of the truncated hbv core vlps (hbc). the presence of two different foreign epitopes within the hbc molecule did not interfere with its vlp-forming potential, with the hbv pre-s1 epitope exposed on the surface and the hcv core epitope buried within the vlps. mice vaccination showed a specific t cell activation by both foreign epitopes and a highlevel antibody response against the pre-s1 epitope, whereas an antibody response against the hbc carrier was inhibited. 183 f. the researchers have shown that the nanosized hbc-vlps bearing mycobacterial antigen cfp-10 (hbc-vlp: cfp-10 fusion protein) induced an increased immune response in balb/c mice compared to mixtures of native antigen. 184 g. chimeric papillomavirus vlps based on the bovine papillomavirus type 1 (bpv-1) l1 protein were designed by replacing the 23-carboxyl-terminal amino acids of the bpv1 major protein l1 with a synthetic "polytope" minigene, containing known ctl epitopes of human pv16 e7 protein, hiv iiib gp120 p18, nef, and reverse transcriptase (rt) proteins, and an hpv16 e7 linear b epitope. the chimeric l1 protein assembled into vlps in insect cells. polytope vlps could deliver multiple b and t epitopes as immunogens to the mhc class i and class ii pathways. this study has demonstrated that hybrid vlps can be used as an efficient antigen delivery system to transfer more than one ctl epitope through mhc class i pathways. 185 h. the chimeric hpv vlps were generated in which hpv16 l2 neutralization epitopes (l2 residues 69-81 or 108-120) are inserted within an immunodominant surface loop (between residues 133 and 134) of the l1 major capsid protein of bpv1. immunization of rabbits with assembled particles elicited high l2-specific serum antibody responses. 186 193 l. the studies showed that the c-terminal region of gag fused by t cell epitopes from human cytomegalovirus pp65 led to the formation of hybrid vlps activating antigen-specific cd81 memory t cells ex vivo. 161 regarding to previous studies, the gag polyprotein is the only retroviral protein required for vlp formation. [194] [195] [196] vlps, derived from an avian retrovirus, were applied to deliver proteins to cells, either as part of gag fusion proteins (intracellular delivery) or on the surface of vlps. the construct is an effective system because the vlps are completely made of the gag fusion protein, and a single vlp will deliver 2000-5000 copies of gag fusion protein into a transduced cell. 197 delivery of foreign genes to the digestive tract mucosa by oral administration of non-replicating gene transfer vectors would be a very useful method for vaccination and gene therapy. 198 the studies indicated that plasmid dna could be packaged in vitro into a vlp composed of open reading frame 2 (orf2) of hev, which is an orally transmissible virus. these vlps could deliver this foreign dna to the intestinal mucosa in vivo, eliciting high mucosal and systemic immunity in mice, without the use of adjuvants. an orally administered hiv dna vaccine encapsulated in hev-vlps could induce mucosal and systemic cellular and humoral immune responses. 198 moreover, the ability of hpv vlps was examined to mediate delivery and expression of dna plasmids in vitro and in vivo. 199 hpv pseudoviruses were provided by disrupting hpv-vlp, mixing them with dna plasmids and reassembling them into the pseudoviruses (vlps with plasmids inside). the pseudovirus induced more potent immune responses than dna vaccines. the pseudovirus could be used in gene therapy by transferring the therapeutic genes into lymphoid tissues in human. 5 in addition, the recombinant hpv16 l1 vlps, produced in insect cells, could efficiently encapsulate a plasmid harboring either a gene for the gfp or b-galactosidase during in vitro disassembly-reassembly of vlps. 200 vlp-mediated delivery of a gfp reporter construct in vitro showed to be highly dependent on the presence of full-length l2 protein within the vlps. similarly, expression of gfp and luciferase reporter plasmids in vivo was efficiently enhanced by co-administration of l1/l2 vlps. in addition, co-administration of vlps with a hpv16 e6-expressing plasmid increased significantly e6-specific cellular immune responses. 201 the reports indicated that the recombinant major structural protein of the bk polyomavirus (bkv vp1) was shown to self-assemble into vlps with a diameter of 45-50 nm. the potential of bkv vp1 vlps was investigated to transfer gene into cos-7 cells using three methods for the formation of pseudovirions: disassembly/reassembly, osmotic shock and direct interaction between vlps and plasmid dna. the most efficient method is the direct interaction between vlps and linearized plasmid dna. the findings generally demonstrated that bkv vlps have exogenous dnabinding activity, as a promising vehicle for gene transfer studies. 200 sirna delivery there is a major challenge to identify novel approaches for specific and effective delivery of new types of drugs like sirnas and peptides. systemic delivery of small interfering rna (sirna) was restricted by its poor stability and low cellpenetrating properties. to overcome these limitations, an efficient sirna delivery system was designed using polyethyleneimine (pei)-coated vlps derived from adeno-associated virus type 2 (pei-aav2-vlps). generally, one of the strategies to integrate sirna into nanoparticles was to coat these particles with positively charged polymers, including pei, poly b-amino different applications of virus-like particles ester, or poly l-lysine. electrostatic coating could increase the efficiency of systemic sirna delivery due to its protective effects and improved cellular uptake. an insect/baculovirus expression system was used to generate aav2-vlps. pei-aav2-vlps could condense sirna, protect it from enzymatic degradation, transfer it with high efficiency and induce cell death in mcf-7 breast cancer cells, for breast cancer therapy. 201 furthermore, micrornas (mirnas) play an essential role in immunoregulation and may be involved in the pathogen esis of systemic lupus erythematosus (sle). among these sle-related mirnas, mir-146a, acts as a significant inhibitor of autoimmunity, myeloproliferation, and cancer. a novel mirna-delivery approach was described via bacteriophage ms2 vlps for evaluation of the therapeutic effects of mir-146a, in bxsb lupus-prone mice. treatment with ms2-mir-146a vlp increased the level of mature mir-146a, leading to a significant reduction in the expression of autoantibodies and total igg. furthermore, the levels of inflammatory cytokines, including ifn-a, il-1b and il-6 were decreased in mice. the stimulation of dysregulated mirnas by an ms2 vlp-based delivery system may be considered as a novel therapy. [202] [203] [204] the use of ms2 vlps was reported for selective delivery of nanoparticles, chemotherapeutic drugs, sirna cocktails, and protein toxins to human hcc. 205 in addition, the researchers used jc virus (jcv) vlps as a vector for delivering rnai in silencing the il-10 cytokine gene. jcv vlps were non-toxic, and showed the therapeutic use as a gene therapy approach for autoimmune diseases (aid) including sle. 206, 207 drug delivery a major challenge in pharmacology is to find methods that drugs (especially anti-cancer drugs) can be delivered specifically to target tissues. a potential strategy would be to package or encapsulate the drug molecules inside a particle which is bound to the cancerous tissue. such encapsulation would protect the drug from degradation in blood. for this purpose, it will be necessary to develop particles which can be modified on their outer surface to carry drug molecules into the target cells. novel nanocarriers such as dendrimers, liposomes, polymersomes, micelles, and vlps indicated high potency in improving drug delivery, and targeting strategies. all of these delivery systems make drugs more biocompatible, watersoluble, or colloidal, indicating low toxicity and high uptake in cells. 208 different virus-based materials were studied for drug delivery such as: the ccmv, the cpmv, the red clover necrotic mosaic virus (rcnmv), ms2 rna-containing bacteriophage, the bacteriophage qb, m13 bacteriophage, the tmv. 208 drug cargo can be loaded through covalent attachment of drugs or their analogs to particular reactive residues on the capsid pro-teins. 209 several cancer cell targeting ligands were attached to different types of vlps, including small molecules, antibodies, peptides and proteins, as well as dna aptamers. folic acid (fa) was broadly used in drug delivery targeted to cancer cells. uptake of fa into cells is mediated by the folate receptor (fr). 210 recently, lactobionic acid (la) was applied for the specific targeting of a rotavirus capsid vp6 to hepatocytes or hepatoma cells bearing asialoglycoprotein receptors (asgprs). 211 human holo-transferrin (tfn) is essential for iron homeostasis. tfn is especially recognized by the tfn receptor (tfnr), which is over-expressed on the surface of various tumor cells and efficiently taken up by cells in the clathrinmediated endocytosis. 212, 213 tfn has been conjugated to cpmv 214 and bacteriophage qb. 215 the cellular uptake of the qb-tfn particles was relative to the tfn density; while the internalization was prevented by comparable concentrations of free tfn. antibodies contain another group of targeting proteins that could be chemically linked to vlps. for instance, a single-chain (scfv) antibody that recognizes the carcinoembryonic antigen (cea) over-expressed in a variety of tumor cells, has been attached to cpmv. 216 an important strategy to improve cellular uptake of therapeutic molecules is the use of cell-penetrating peptides (cpps). 217 the hiv-1 tat peptide is one of the cpps that were extensively used in the delivery of vlps. 218, 219 in general, virus-like particles represents an attractive system for drug delivery in vitro. 220 the efficient delivery of hydrophobic drugs into target cells without the use of organic solvents or chemical linkage to delivery carriers is a critical issue in the biological field. recently, the intracellular delivery of hydrophobic dyes or drugs encapsulated in vlps through cyclodextrins (cds) showed high efficiency. as a model anticancer drug, paclitaxel (ptx)-cd complexes encapsulated inside vlps exhibited a dose-dependent cytotoxic effect with a 20-fold smaller ic50 than that of free ptx dissolved in dmso. 221 cell targeting is aimed to effective uptake of therapeutic and/ or diagnostic reagent in a special location such as a tumor. 222 targeting can also be achieved using proteins (mainly antibodies), peptides, nucleic acids (aptamers), small molecules, vitamins and carbohydrates. by attachment of targeting ligands, specificity for cell targeting was obtained by receptor-mediated endocytosis. for instance, bacteriophage ms2 vlps, were chemically conjugated to a targeting peptide (sp94) for the selective delivery of nanoparticles, chemotherapeutic drugs, sirna cocktails and protein toxins to human hcc. [223] [224] [225] recently, the chemical conjugation of human epidermal growth factor (egf) to simian virus 40 vlps allowed for cell 126 shirbaghaee and bolhassani selective targeting. 226 simian viruses 40 vlps have attracted a great attention in gene delivery due to their high stability and low toxicity in blood. 172 in design of polymeric nanoassemblies, chemical modification is necessary to conjugate the dye or probe for in vitro and in vivo imaging. however, in the case of nanobioassemblies, chemical or genetic modification can be applied for bioconjugation of fluorescent dyes or other probes. another advantage of nanobioassemblies such as vlps for bioimaging is their biological compatibility. quantum dots (qds) and gfp were used broadly for in vitro and in vivo imaging as alternatives to labelling. for example, fluorescent chimeric vlps of canine parvovirus were expressed in insect cells. 227 to create the fluorescent chimeric vlps of canine parvovirus, gfp was genetically engineered onto the n-terminal region of the viral protein vp2, as a visualization tool to understand mechanisms of viral infections. gfp was also used to design chimeric hiv vlps allowing protein to be followed during assembly and transmission using live-cell imaging. 228, 229 advantages of vlps include: (a) no need to propagate pathogenic organisms, (b) repetitive and ordered surface structures, (c) multivalent as well as particulate in nature, (d) safer than other vaccines because of non-infectious and non-replicating properties: the studies showed that there is no risk of disease progress in vaccinated groups with vlp-based vaccines as compared to attenuated viral vaccines, because they lack the genomic material needed for the replication and the spread of the viruses, (e) stable in extreme environmental conditions, depending on vlp structure (i.e., envelope or non-envelope), and (f) as carrier to express foreign antigen. 230 the potential of vlps to target dcs is a main advantage of vlp vaccines, for activating the innate and adaptive immune responses. they have a special benefit against other delivery systems in size, stability, and capacity to transfer biological molecules across cell barriers. particles in the 20-200 nm range can stimulate cd41, cd81 cells and especially generate th1 responses. in addition, despite a limited number of vlp vaccines approved for human use, they represent a promising platform for the development of novel mucosal vaccine strategies. indeed, vlps are sufficiently small, and the composition of their surface chemistry can be designed to minimize hydrophobic and electrostatic adhesive interactions with mucus. they can also be engineered for recombinant expression of multiple antigenic epitopes and for incorporation of co-stimulatory and immuno-regulatory proteins. however, vlp technology can be limited by difficulties of scale-up and the need for purification from the expression systems. 231 other limitation in chimeric vlp vaccine is to determine the compatibility of peptide with assembly of vlp and its immunogenicity property. under the host immune defence, pathogens undergo mutation which render the vlp vaccine ineffective and will be effective for only highly conserved b or t cell epitopes. 230 the major challenge is to develop novel production platforms that can deliver vlp vaccines while significantly reducing production times and costs. 104 viral-like particles (vlps) have shown high ability for the improvement of vaccines against infectious and non-infectious diseases. several recombinant expression systems were successfully applied for vlp production, with different efficiency. the use of vlps in vaccine development showed that they are considered safe. in addition, nano-sized vlps, can act as an adjuvant as well as antigen delivery system through increasing the antigen uptake by apcs. thus, it is not necessary for the use of adjuvants along with vlps to stimulate potent immune responses. vlps have shown a natural affinity to target host cells, and this property has been used for cell-targeting applications. regarding the advantages of vlps, it is necessary for further studies in various aspects especially easy and low-cost purification of vlps as well as their application as a delivery system in vivo. different applications of virus-like particles hum vaccine hepatitis b virus vaccine ip recombinant (genetically engineered): enivac hb hepavax-genev r . summary of product characteristics revac-b1tm. available at prescribing information. merck prescribing information. glaxosmithkline medicago to present additional positive clinical data at the 2011 eswi influenza conference medicago inc. news release exp rev vaccine hum vaccine immunother different applications of virus-like particles antimicrob agents chemother intranasal norwalk vaccine hum alves, p. m. exp rev vaccine exp rev vaccines different applications of virus-like particles curr top microbiol immunol the authors are grateful to elnaz agi and negar zohrei (dept. of hepatitis and aids, pasteur institute of iran) for technical assistance. key: cord-351295-4toxlskr authors: lanave, gianvito; capozza, paolo; diakoudi, georgia; catella, cristiana; catucci, leonardo; ghergo, paola; stasi, fabio; barrs, vanessa; beatty, julia; decaro, nicola; buonavoglia, canio; martella, vito; camero, michele title: identification of hepadnavirus in the sera of cats date: 2019-07-23 journal: sci rep doi: 10.1038/s41598-019-47175-8 sha: doc_id: 351295 cord_uid: 4toxlskr hepadnaviruses infect several animal species. the prototype species, human hepatitis b virus (hbv), increases the risk of liver diseases and may cause cirrhosis and hepatocellular carcinoma. recently a novel hepadnavirus, similar to hbv, has been identified through transcriptomics studies in a domestic cat with large cell lymphoma in australia. herewith, a collection of 390 feline serum samples was screened for hepadnavirus. overall, the virus was identified in 10.8% of the sera with a significantly higher prevalence (17.8%) in the sera of animals with a clinical suspect of infectious disease. upon genome sequencing, the virus was closely related (97.0% nt identity) to the prototype australian feline virus sydney 2016. the mean and median values of hepadnavirus in the feline sera were 1.3 × 10(6) and 2.1 × 10(4) genome copies per ml (range 3.3 × 10(0)–2.5 × 10(7) genome copies per ml). for a subset of hepadnavirus-positive samples, information on the hemato-chemical parameters was available and in 10/20 animals a profile suggestive of liver damage was present. also, in 7/10 animals with suspected hepatic disease, virus load was >10(4) genome copies per ml, i.e. above the threshold considered at risk of active hepatitis and liver damage for hbv. overall, we detected hepadnavirus dna in 42/390 (10.8%) sera. dch dna was detected in 31 (17.8%) out of 174 sera collected with a request for diagnosis of infectious diseases (collection a) and in 11 (5.1%) out of 216 sera submitted to the laboratory for pre-surgical evaluation or for suspected metabolic or neoplastic disease (collection b) that were used to generate a baseline. the difference for dch prevalence was statistically extremely significant (p-value = 0.00006, or = 4.04005, ci95% = [1.96601; 8.30211]) when compared animals from collection a and collection b (fig. 1a) . moreover, there was no significant difference in terms of prevalence (p = 0.64125) between male (11.4%, 25/219) and female (9.9%, 17/171) individuals (fig. 1b) . we also analysed the distribution of hepadnavirus across various age groups (fig. 1c) . the prevalence of dch was higher in cats aged 4 to 7 months (20.5%, 8/39) although without statistically significant difference (p = 0.08061) compared to other age groups. we reconstructed the complete genome of the dch strain ita/2018/165-83, of approximately 3.2 kb (fig. 2) , which had 97.0% nucleotide sequence identity to the australian reference strain aus/2016/sydney across the entire genome. some differences were observed in the tree topologies between our analysis and previous studies 2 , likely accounted for by the alignment complexity. in the consensus phylogenetic tree (fig. 3) , a large group included bat and rodent viruses. the two feline hepadnaviruses segregated together in a defined branch within www.nature.com/scientificreports www.nature.com/scientificreports/ this large group. all the primate viruses were basal to this bat/rodent/feline group. also, there were two additional well-defined groups, encompassing avian and amphibian viruses, respectively. the findings of this study confirm that the novel hepadnavirus is a common component of the feline virome. the pathogenic role of this hepadnavirus, if any, is not yet known, but thus far, all hepadnaviruses have been reported to replicate preferentially in hepatocytes 1, 4 . in this study we observed a marked and significantly higher prevalence (17.8%, 31/174) in the cohort of cats with suspected infectious diseases (collection a) with respect to a group of animals (collection b) used as baseline. almost half of the sera positive for dch (14/31, 45 .2%) of this cohort were collected from cats with retroviral infection (fiv and/or feline leukemia virus, felv). in turn, the overall prevalence of retroviral infection in collection a was 24.1% (42/174), with 33.3% (14/42) being co-infections with dch with a statistically significant (p = 0.0048) correlation between dch and retrovirus positive cats. these findings echo what has been documented for hbv, which is more frequently observed in immunocompromised individuals 5 . reactivation of hbv is common in patients with immunosuppression 5 . even more interestingly, hepatopathy has been described in felv-infected cats, with icterus and various inflammatory and degenerative liver diseases 6 . feline retroviruses have been demonstrated to impair severely the immune system in infected cats and diseases associated with immune-suppression account for a large portion of the morbidity and mortality observed in felv-infected cats [7] [8] [9] . transmission of hbv in humans occurs through blood and other body fluids and contagion can also occur during sexual contact and by maternal/fetal route 1, 4 . transmission of fiv/felv in cats occurs with similar modalities, as the virus is present in blood and body fluids 9 . similar modalities of transmission might also be hypothesized for dch, since we found viremia in 10.8% of the cats. importantly, the presence of dch in the sera may pose unexpected risks in transfusion medicine. dch, along with feline retroviruses, bartonella spp. and feline hemoplasma, should be considered in the screening of donor subjects 10 . in cats there are not known viral agents strictly associated with hepatic disease, unlike what observed in human medicine where there are five major types of viral hepatitis (a to e) 11 . for diagnosis of hbv infection and for predicting the stage of infection in human patients, antigens, antibodies and viral genome are profiled/ quantified and this information is coupled with haematological and blood chemistry tests. in the case of dch, we can only use the molecular diagnostics and hematological and blood chemistry data, since there are no immunological reagents available for the diagnostics. out of 42 dch-infected cats, we could retrieve information on hematologic and serum biochemical parameters for 20 animals (table 1 ). in 10 of these, increased levels of markers indicative of structural or functional liver damage (i.e. ast, alt, alp, ggt and total bilirubin) were present. hbv load is considered relevant in infected human patients and varies markedly across the phases of hbv infection 1 . the lower threshold for risk of active hepatitis and liver damage is 10 4 viral genome equivalents of hbv per ml, equivalent to about 2000 iu (international unit)/ml 1 . usually, high hbv dna load in blood is found in acute infection, or in active chronic stages of disease, but the virus can reactivate after long periods of apparent remission, chiefly in immunosuppressed patients 1 . the mean and median values of dch viremia in feline sera figure 1 . results of the screening for dch in the feline sera. the prevalence of dch was evaluated in sera collected for the diagnosis of infectious diseases (collection a) and sera submitted to the laboratory for presurgical evaluation or for suspected metabolic or neoplastic disease (collection b) and used for comparison (panel a). the prevalence of dch was also evaluated in relation to sex (panel b) and age (panel c) of the animals. www.nature.com/scientificreports www.nature.com/scientificreports/ were 1.3 × 10 6 and 2.1 × 10 4 dna copies per ml (range 3.3 × 10 0 -2.5 × 10 7 dna copies per ml). in 7 out of 10 animals with suspected hepatic disease, dch load was >10 4 genome copies per ml. although this parallelism between hbv and dch is intriguing, whether a correlation also exists between dch replication and liver damage should be assessed in structured, larger observational studies. for instance, we also found the virus in cats with unaltered hepatic markers. this condition occurs in human patients with chronic hbv infection during the inactive "immune-control" phase, defined as the presence of hbv antigens in serum without alt elevation and with low viremic hbv-dna levels 12 . however, only in 3/10 cats with non-altered hepatic markers the virus titer was lower than 10 4 . the actual patho-biology of dch in cats should be determined in order to understand better the patterns of dch infection. several novel viruses have been discovered in cats in recent years 13, 14 . optimizing the diagnostic algorithms and gathering epidemiological data will help assessing the possible pathogenic role of these viruses in cats and eventually conceive strategies to protect their health. a total of 390 sera were collected from two different veterinary clinic laboratories located in apulia region, southern italy and tested upon request of the veterinarian practitioners after anamnesis, medical history and clinical examination. one-hundred seventy-four sera (collection a) had been collected for diagnosis of infectious diseases (fiv, felv, feline coronavirus (fcov), toxoplasmosis, hemoplasmosis, bacterial and fungal infections). a total of 147/174 (84.5%) sera were submitted with a suspect/request of diagnosis for fiv/felv, with 42 sera being positive for retrovirus. fisher's exact test was performed to the collection a to evaluate the correlation between dch positive cats and retrovirus positive cats. the significance level of the test was set at 0.05. of the other 27 sera (15.5%), 14 were sent for a suspect/request of diagnosis for coronavirus (with 7/14 being positive), 5 for toxoplasmosis (with 2/5 being positive), 2 for giardia (with 1/2 being positive). five sera were collected from animals with suspected bacterial/fungal infections and 1 serum (negative) was from a cat with suspected hemoplasmosis. a total of 216 sera (collection b) submitted to the laboratory for pre-surgical evaluation (n = 85) or for suspected metabolic (n = 127) or neoplastic (n = 4) disease was used for comparison to generate a baseline. information on the sera analyzed in the study is included in fig. 1 . the study was approved by the ethics committee of the department of veterinary medicine, university of bari (authorization 23/2018). all experiments were performed in accordance with relevant guidelines and regulations. www.nature.com/scientificreports www.nature.com/scientificreports/ total dna was extracted from collected sera by using qiaamp cador pathogen mini kit (qiagen, hilden, germany), according to the manufacturer's instructions. we performed sample screening using a pcr with consensus pan-hepadnavirus primers 2 and a pcr with primers specific for dch 3 . also, we screened sera using a quantitative pcr (qpcr) designed based on the sequence of the australian reference strain aus/2016/sydney (genbank accession nr. mh307930) ( table 2) . for qpcr, we calculated dch dna copy numbers on the basis of standard curves generated by 10-fold dilutions of a plasmid standard topo xl pcr containing a 1.4 kb long fragment of the polymerase region of the australian reference strain aus/2016/sydney (iq supermix; bio-rad laboratories srl, segrate, italy). we added 10 μl of sample dna or plasmid standard to the 15-μl reaction www.nature.com/scientificreports www.nature.com/scientificreports/ master mix (iq supermix; bio-rad laboratories srl, segrate, italy) containing 0.6 μmol/l of each primer and 0.1 μmol/l of probe. thermal cycling consisted of activation of itaq dna polymerase at 95 °c for 3 min and 42 cycles of denaturation at 95 °c for 10 s and annealing-extension at 60 °c for 30 s. we evaluated the specificity of the assay using a panel of feline dna viruses (parvovirus, herpesvirus and poxvirus). the qpcr assay was able to detect as few as 10 1 dna copies per ml of standard dna and 3.3 × 10 0 dna copies per ml of dna template extracted from clinical samples. dch quantification displayed acceptable levels of repeatability over a range of target dna concentrations, when calculating the intra-and inter-assay coefficients of variation within and between runs, respectively 15, 16 . we carried out inferential statistical analyses using the chi-squared test with yates' correction, the evaluation of the odds ratio (or) and 95% confidence interval (ci95%) with the online software medcalc easy-to-use statistical software (https://www.medcalc.org/calc/odds_ratio.php). the significance level of the test was set at 0.05. full genome sequences of hepadnaviruses were retrieved from the genbank database and aligned using geneious version 9.1.8 (biomatters ltd, auckland, new zealand) and the mafft algorithm 17 . a set of genome sequences used in a previous study 2 was integrated with additional genome sequences of hepadnaviruses of recent identification in mammalian, avian, amphibian species and in fish. the final dataset included 53 hepadnavirus genomes. phylogenetic analysis was performed using jmodel test (http://evomics.org/resources/software/ molecular-evolution-software/modeltest/) to evaluate the correct best-fit model of evolution for the entire dataset. bayesian analysis 18, 19 was therefore applied using four mcmc chains well-sampled and converging over www.nature.com/scientificreports www.nature.com/scientificreports/ one million generations (with the first 2000 trees discarded as "burn-in") and supplying statistical support with subsampling over 1000 replicates. the identified program settings for all partitions, under the akaike information criteria, included six-character states (general time-reversible model), a proportion of invariable sites and a gamma distribution of rate variation across sites (gtr + i + g). we also tried to perform phylogenetic analyses using other evolutionary models (maximum likelihood, neighbor joining) to compare the topology of phylogenetic trees. we could observe similar topologies with slight difference in bootstrap values at the nodes of the tree. accordingly, we did prefer to retain the bayesian tree. we deposited the nucleotide genome sequence of strain ita/2018/165-83 (mk117078) in genbank. all data generated or analyzed in this study are included in this published article. fields virology detection and genome characterization of four novel bat hepadnaviruses and a hepevirus in china a novel hepadnavirus identified in an immunocompromised domestic cat in australia hepatitis b virus: virology, molecular biology, life cycle and intrahepatic spread chronic hepatitis b: update 2009 diseases associated with spontaneous feline leukemia virus (felv) infection in cats isolation of a t-lymphotropic virus from domestic cats with an immunodeficiency-like syndrome clinical and immunologic aspects of felv-induced immunosuppression clinical aspects of feline retroviruses: a review blood transfusion in cats: abcd guidelines for minimising risk of infectious iatrogenic complications viral hepatitis in principles and practice of infectious diseases update on prevention, diagnosis, and treatment of chronic hepatitis b: aasld 2018 hepatitis b guidance seroprevalence for 2117-like vesiviruses in italian household dogs identification of a novel parvovirus in domestic cats novel parvovirus related to primate bufaviruses in dogs development and validation of a real-time pcr assay for specific and sensitive detection of canid herpesvirus 1 mafft: a novel method for rapid multiple sequence alignment based on fast fourier transform mrbayes 3: bayesian phylogenetic inference under mixed models mrbayes: bayesian inference of phylogenetic trees this study was supported by the grant ricerca corrente 2017 "nuovi flussi diagnostici in sanità animale: dalla ngs alla banca antigeni". reference grant number b45e17000060005 -izs am 06/17rc (italian ministry of health). in addition, the authors would like to thank professor donatella ferraro, university of palermo for providing hbv positive controls. the study was conceived by v.m. experiments were performed by g.l., p.c., g.d. and c.c. data analysis was performed by g.l., m.c. and p.c. sample collection was accomplished by l.c., p.g., f.s. support for experiments and scientific feedback were provided by v.b., j.b., n.d., c.b., v.m. the manuscript was written by v.m., g.l., p.c. and m.c. and reviewed and approved by all authors. competing interests: the authors declare no competing interests.publisher's note: springer nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.open access this article is licensed under a creative commons attribution 4.0 international license, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the creative commons license, and indicate if changes were made. the images or other third party material in this article are included in the article's creative commons license, unless indicated otherwise in a credit line to the material. if material is not included in the article's creative commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. to view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/. key: cord-285505-8norumv6 authors: vere hodge, r. anthony title: meeting report: 27th international conference on antiviral research, in raleigh, nc, usa date: 2014-09-16 journal: antiviral res doi: 10.1016/j.antiviral.2014.08.009 sha: doc_id: 285505 cord_uid: 8norumv6 the 27th international conference on antiviral research (icar) was held in raleigh, north carolina, usa from may 12 to 16, 2014. this article summarizes the principal invited lectures. john drach (elion award) described the early days of antiviral drugs and their novel modes of action. piet herdewijn (holý award) used evolutionary pressure to select dna polymerases that accept nucleoside analogs. replacing thymine by 5-chlorouracil led to the generation of a new form of escherichia coli. adrian ray (prusoff award) demonstrated how prodrugs can markedly improve both the efficacy and safety of potential drugs. the keynote addresses, by david margolis and myron cohen, tackled two emerging areas of hiv research, to find an hiv “cure” and to prevent hiv transmission, respectively. these topics were discussed further in other presentations – a cure seems to be a distant prospect but there are exciting developments for reducing hiv transmission. tdf-containing vaginal rings and gsk-744, as a long-lasting injection, offer great hope. there were three mini-symposia. although therapy with tdf/ftc gives excellent control of hbv replication, there are only a few patients who achieve a functional cure. myrcludex, an entry inhibitor, is active against both hbv and hdv. the recent progress with hbv replication in cell cultures has transformed the search for new antiviral compounds. the hbv capsid protein has been recognized as key player in hbv dna synthesis. unexpectedly, compounds which enhance capsid formation, markedly reduce hbv dna synthesis. the development of bcx4430, which is active against marburg and ebola viruses, is of great current interest. this article provides an overview of the invited lectures at the 27th international conference on antiviral research, sponsored by the international society for antiviral research (isar), which was held in raleigh, north carolina, usa from may 12 to 16, 2014 . it begins with reports of lectures by the recipients of isar's three major awards, held in memory of gertrude elion, antonín holý and william prusoff. these are followed by brief summaries of the keynote addresses and the three mini-symposia on ''hepatitis b virus'', ''research triangle park'' and ''challenges in hiv infection, treatment and prevention''. because this review article simply provides short accounts of oral presentations, it is not generally accompanied by references to the scientific literature. any descriptions of favorable treatment outcomes should not be taken as recommendations for clinical use. 2. gertrude elion memorial award lecture: collaborative antiviral studies for the discovery of drugs to treat cytomegalovirus infections john c. drach, ph.d., university of michigan, ann arbor, michigan, usa (fig. 1) . gertrude b. (trudy) elion was born in new york city and was pleased to work for the burroughs wellcome co. when based in new york but was concerned when it transferred to research triangle park, north carolina, not many miles from this year's meeting site. however, within just a few months she declared that she was ''at home'' in north carolina. she was awarded the nobel prize in physiology or medicine in 1988 for her pioneering work in purine biosynthesis which paved the way for the discovery of drugs to treat organ rejection, cancer and viral diseases. the focus of john's presentation was on the research conducted in his own and his collaborators' laboratories that ultimately led to the invention of three compounds which were discovered to have antiviral activity against human cytomegalovirus (hcmv) and which later entered clinical trials: bdcrb pyranoside (gw275175x) (phase i), maribavir (phases i, ii and iii) and cyclopropavir (phase i). his major collaborators included karen biron, charles shipman, leroy townsend, and jiri zemlicka. to date, there are only five fdaapproved drugs for treatment of hcmv infections: cidofovir, fomivirsen, foscarnet, ganciclovir and valganciclovir. being inspired by the presence of a naturally-occurring 5,6dimethylbenzimidazole nucleotide in vitamin b12, research on benzimidazole nucleosides was initiated by medicinal chemists in the 1950s and '60s. this led to the synthesis of a trichloro analog in townsend's laboratory at the university of utah and later the discovery of its activity against hcmv in john's laboratory. much work, in both their laboratories at the university of michigan, established that it and its 2-bromo analog (bdcrb) have excellent activity against hcmv with very low cytotoxicity. surprisingly, it was found to be inactive against other herpes viruses and it did not need conversion to a triphosphate to be active against hcmv. collaborative studies with karen biron at burroughs wellcome established that, unlike many other anti-virals that inhibit viral dna synthesis such as ganciclovir (gcv), these compounds acted by a novel mechanism, inhibition of viral dna processing. it was the viral resistance studies which revealed the viral targets, pul89 and pul56. these two proteins, with pul104, form a complex known as the terminase which cuts newly synthesised hcmv dna into unit lengths for packaging into virions. although bdcrb had many desirable properties in vitro, it had poor pharmacokinetics in mice and monkeys due to hydrolysis of its glycosidic bond; therefore it was not developed for human use. much additional work in drach's and townsend's laboratories at michigan and by biron's group at burroughs wellcome ultimately led to two potential drug candidates, bdcrb pyranoside and maribavir (fig. 2) . both compounds have excellent activity against hcmv, low toxicity, and excellent pharmacokinetics. clearly, their modes of action differed markedly from that of gcv. quite unexpectedly, they have different mechanisms of action. bdcrb pyranoside has a mechanism of action very similar to its parent compound bdcrb, inhibition of dna processing. in contrast, maribavir inhibits dna synthesis, albeit indirectly. it is a 2isopropylamine derivative of bdcrb except that it has the unnatural l-sugar configuration. its mechanism of action involves inhibition of the viral kinase (pul97), which phosphorylates another viral protein, pul44. phosphorylated pul44 is necessary for viral dna synthesis. thus inhibition of pul97 by maribavir inhibits viral dna synthesis. interestingly, pul97 is also the kinase that activates (phosphorylates) gcv. resistance studies confirmed that a single mutation in ul97, resulting in a mutation in the kinase (leu397arg), was necessary and sufficient for resistance to maribavir. in a further study of resistance, virus already resistant to bdcrb was passaged in increasing concentrations of maribavir and resistant virus was isolated. this strain grew at the same rate as the wild-type virus and was resistant to both bdcrb and maribavir. as expected, resistance to bdcrb was due to known mutations in ul56 and ul89. however, no mutations were found in ul97. further investigation showed that a single base change in ul27 (t1004c) was necessary and sufficient for resistance to maribavir. the role of the encoded protein was then unknown but the amino acid mutation (leu335pro) is in the middle of the protein. similarly, biron's group detected resistance due to mutations in the ul27 gene. further research studies on maribavir have been summarized in previous icar scientific reports. cyclopropavir (cpv, fig. 3 ) was synthesized in the laboratory of jiri zemlicka, karmanos cancer institute, detroit, michigan. it is a guanosine nucleoside analog which is very active against hcmv. unlike the benzimidazole nucleosides, it also inhibits epstein-barr virus (ebv) and human herpesvirus 8 (hhv-8). like gcv, it is phosphorylated by the kinase encoded by ul97. it is more potent in vitro and in vivo than ganciclovir but has a somewhat different pattern of resistance. in one resistant strain, the key mutation formed a stop codon resulting in a truncated pul97 kinase protein. the phosphorylation of cpv by pul97 is more efficient than that of gcv, with a considerably lower k m and higher v max . interestingly, the phosphorylation of cpv to its monophosphate (cpv-mp) by pul97 is stereoselective; only the (+) isomer of cpv-mp is formed. a single enzyme, gmp kinase, phosphorylates cpm-mp to both its di-and triphosphates. in contrast, acyclovir and gcv require additional cellular enzymes to convert their diphosphates to active triphosphates. cyclopropavir is currently in phase i clinical trials for the treatment of hcmv infections. 3. the antonín holý memorial award lecture: from modified nucleoside to a chemically modified genome piet herdewijn, rega institute for medical research, ku leuven, belgium (fig. 4) . the 2013 icar began with a symposium, on the legacy of the late antonín (tony) holý , at which the establishment of a new isar award in medicinal chemistry was announced. the awardee is to be a senior scientist of international stature in medicinal chemistry and who has made innovative contributions impacting antiviral drug discovery or development. piet is, therefore, the first to receive this award. in the late 1970s, the potent activities of bvdu and bvarau against herpes simplex virus type 1 (hsv-1) and varicella zoster virus (vzv) were discovered; this work motivated piet to start antiviral research with the synthesis of carbocyclic bvdu. through to the early 1990s, he synthesized several other nucleoside analogs with bicyclic bases having good activity against hsv-1 and vzv. during the 1990s, emphasis switched to investigating the effect of modifying the sugar ring, in particular the synthesis of six-membered rings containing an oxygen or a double bond. piet showed examples of compounds with activity against hsv-1, hsv-2, vzv and hcmv. back in 1984, erik de clercq showed piet a paper on aids, one of the authors being phil furman. this publication stimulated the search for anti-hiv compounds. many compounds were discovered with potent activities (and good selectivity indices) against hiv. piet worked out the first structure-activity relationships of anti-hiv dideoxy nucleosides. starting in the late 1980s, tony holý synthesised a series of phosphonates. at the 2013 icar, erik de clercq recalled how this work led, ultimately, to tenofovir, which was to become a major success for treating hiv-infected patients. from its first introduction in 2001, its market share has increased to well over 40%. in 2002, having a single-pill regimen was agreed as a way forward to simplify, and thereby enhance, hiv therapy. this led to atripla being approved in 2006, complera in 2011 and stribild in 2012. tenofovir, in its various prodrug forms, is now available in over 130 countries and is distributed widely to the known hivinfected population. in line with this research, piet synthesized phosphonate nucleosides, with a threose sugar moiety, which showed anti-hiv activity in the same range as 9-(2-phosphonylmethoxyethyl) adenine (pmea). piet's work had taken a different pathway. it is possible to link several nucleotides together to form aptamers. for example (fig. 5) , the above antiviral nucleosides, which have a 6-membered ring in place of the natural furanose, could be incorporated into hexitol nucleic acid (hna) aptamers. x-ray studies revealed the structures of hna-rna duplexes and hna-hna duplexes, the latter having a similar overall form to that of an rna-rna duplex with the same base sequence. hna-containing aptamers were shown to be potent and specific inhibitors of trans-activating region (tar)mediated transcription. normally, an hiv encoded protein, transactivator of transcription (tat), binds to cellular factors and to the viral tar rna regulatory element, resulting in a vastly increased rate of transcription of all hiv genes. hna-containing aptamers prevents this interaction and so inhibit hiv replication. it took four years to engineer a polymerase that would utilise hnas to assemble a strand complementary to a dna template. in line with this research, hexitol-modified sirna has shown good activity in an in vivo anti-hbv model. this success stimulated the concept that it may be possible to generate new forms of biologically active dna. in order to pursue this idea, a culture system with twin growth chambers was devised. alternative nutrient media could be fed into the chambers and the culture from one chamber could be used to seed the second chamber, the former culture being removed. in this example, the aim was to replace thymine with 5-chlorouracil ( fig. 6) using escherichia coli. initially, the nutrient contained 10% 5-chlorouracil and 90% thymine. with each cycle, seeding one chamber from the previous one, the proportion of 5-chlorouracil was increased. after 180 days, in which there had been about 4000 generations of e. coli, thymine had been replaced totally by 5-chlorouracil. an interesting outcome was that the alternative base led to a change not only in the genotype but also in the phenotype; the ''new'' e. coli cells were much longer than the original. this is the first example of a dna polymerase being adapted through evolutionary pressure to accept a nucleotide analog, resulting in the generation of a new living organism. prusoff young investigator award lecture: use of nucleotide prodrugs to enhance selectivity of anti-hiv and -hcv agents adrian s. ray, gilead sciences inc., foster city, ca, usa (fig. 7) . adrian started his lecture with photos of william (bill) prusoff and reminisced of his days with bill, raymond schinazi and yung-chi (tommy) cheng. adrian presented examples to illustrate two models of how a prodrug strategy can transform a potential drug into a much improved clinical candidate. in the first, the prodrug alters the distribution of the pharmacologically active nucleotide analog to tissues where viral infection is taking place (on-target) and away from tissues resulting in adverse events (off-target). in the second, the prodrug enables one to select a drug candidate based more directly on the intrinsic properties of the active nucleotide-triphosphate analog via by-passing an inefficient activation (phosphorylation) of the corresponding nucleoside analog. sofosbuvir (sovaldi ò ), a prodrug of 2 0 -f-2 0 -c-meump, was approved in the usa on 6th december, 2013 for treatment of patients with hepatitis c. this is a fine example of a prodrug enhancing the activity of the parent compound. the nucleoside analogue, 2 0 -f-2 0 -c-meu, is poorly active due to restricted phosphorylation to the monophosphate. sofosbuvir, a nucleotide analogue prodrug of 2 0 -f-2 0 -c-meu, delivers the monophosphate into the cell and this is then further phosphorylated efficiently to give high levels of the triphosphate which inhibits hcv rna polymerase. adrian recalled being much impressed by a result reported at the meeting in 2007 of the american association for the study of liver diseases (aasld). in a phase ii monotherapy trial in patients with hcv, at day 3, the viral loads were reduced by log 10 3.2 and log 10 1.1 for vx-950 (1250 mg bid, n=10) and rg-7128 (1500 mg bid, n=8), respectively. however, from day 4 to 13, the polymerase inhibitor (rg-7128) had continued to reduce the viral load, reaching a reduction of log 10 2.7. on the other hand, the protease inhibitor (vx-950) did not give a sustained reduction, with the viral load starting to increase from day 6. at day 13, the viral load was only log 10 2.2 less than baseline. nucleotide analogues have two advantages over other classes of inhibitors. there is a high genetic barrier to resistance selection, due to the hcv rna polymerase being highly specific for its natural substrates and template. this specificity can be altered but only under extreme evolutionary pressure (see section 3). also, nucleotide analogs often have pan-genotype activity because the active site of the hcv ns5b polymerase is so highly conserved. as an example of how prodrugs can impact a discovery program, allowing for more targeted delivery and for the optimization of the intrinsic properties of the triphosphate, adrian presented the history of the gs-6620 program. the c-adenine analogue (2 0 -c-me-4-aza-7,9-dideazaa, c-nuc1) was compared to the corresponding n-nucleoside, mk608. in a genotype1b replicon assay, the ec 50 values were 2.5 lm and 0.08 lm respectively. however, their triphosphates were equally effective against hcv ns5b polymerase (ic 50 values both 0.3 lm). in the replicon system, the triphosphate of the n-nuc (mk608) was formed more efficiently than that of the c-nuc1, thus explaining the lower activity of the c-nuc1. however, in primary human hepatocytes, c-nuc1 was phosphorylated to the triphosphate more efficiently than the n-nuc (mk608). this illustrates the importance of using primary human cells. c-nuc1 seemed to have a benign in vitro toxicity profile, including not inhibiting the mitochondrial dna polymerase-gamma, but it had very significant toxicity in animals. in a collaboration between gilead and craig cameron at pennsylvania state university, the researchers sought to identify the toxicity target(s) for ribonucleotide analogues, including c-nuc1 and others that had been stopped in phase ii trials. these studies showed a correlation between c-nuc1 and the phase ii candidates, r1626, nm283 and bms986094/idx184. all the latter were efficiently incorporated into rna by the mitochondrial rna polymerase (>70% of the corresponding natural nucleotide). the triphosphate of c-nuc1 was also an efficient substrate (22% the rate of atp). in contrast, the active nucleotide analogs, formed by drugs approved for the treatment of hcv, were poor substrates. ribavirin was poorly incorporated (about 5%) and sofosbuvir was below the limit of detection (= 0.02%). more extensive in vitro and cell culture evaluation of the compounds could have saved the expense of taking them into clinical trials. understanding that the mitochondrial rna polymerase is an important target for ribonucleotide toxicity, the gilead team sought analogs that were not incorporated by this polymerase. adding a cn group to the 1 0 position of c-nuc1 did not change its activity as an hcv ns5b polymerase inhibitor (ic 50 0.3 lm) but it did reduce incorporation in the mitochondrial rna assay (<0.02%). however, in the absence of a nucleotide prodrug to bypass the first phosphorylation step, the resulting di-substituted nucleoside analog would not be a drug candidate because it was not efficiently activated in cells. application of a nucleotide prodrug strategy allowed this nucleotide to be pursued further. oral absorption, delivery of the monophosphate into hepatocytes and high hepatic extraction were criteria used as part of the prodrug optimization process. a nucleotide prodrug, gs-464335 (a mixture of diastereoisomers at phosphorous) was well absorbed in dogs (>80%). comparing the pre-hepatic and post-hepatic plasma drug levels, about 80% of the absorbed drug was taken up by the liver. inside cells, gs-464335 was converted to the corresponding monophosphate which was efficiently converted to the triphosphate. at 24 h, the triphosphate levels remained about 2-fold above the ic 90 value. a pure stereoisomer was selected and later named gs-6620. in a phase ii trial (900 mg, bid 5 days), the mean reduction in hcv load was about log 10 1.5. two subjects achieved hcv rna <25 iu/ ml. however, the pharmacokinetics and antiviral responses were highly variable. whereas the activity results were disappointing, clinical proof of concept was observed in terms of safety. gs-6620 did have a markedly improved safety profile relative to c-nuc1, progressing through chronic toxicology studies in rats and dogs at relatively high doses. the story of gs-6620 illustrates both how nucleotide prodrugs enable further progression of candidates and also the complexity of predicting the behavior of nucleotide prodrugs across species. one wonders what cell culture test or animal model may have predicted such variability. when selecting famciclovir as the prodrug for penciclovir, one potential prodrug was rejected because the pharmacokinetics in rats varied widely between individual animals (vere hodge et al., 1989) . a recent publication by adrian and his team highlights the metabolism of gs-6620 by carboxylesterase 2, an enzyme highly expressed in the human small intestine but not uniformly expressed in different animal species, as a possible reason for the highly variable and suboptimal intestinal absorption of gs-6620 in humans (murakami et al., 2014) . the focus of adrian's talk then switched to hiv. over the last 15 or 20 years in north america, the hiv-infected population has been changing, becoming older (now 33% over 50 years old vs <10% in 1995) and more likely to be obese (in every usa state, >20% adults with bmip30). this has led to a shift in the focus of antiretroviral therapy (art), from solely control of hiv replication to now include tolerability in older, possibly obese, patients. the first example given for hiv was how application of a different prodrug strategy can markedly change the distribution even when delivering the same pharmacologically active nucleotide analog. the first approved prodrug of tenofovir (tfv) was tfv disoproxil fumarate (tdf). more recently, tfv alafenamide (taf) has been progressed into clinical development. a key difference in the properties of the two prodrugs is their stability in plasma, with half-lives of 0.4 and 90 min, respectively. even with a short halflife, tdf gave better delivery of tfv into cells, as indicated by the hiv ec 50 values in cell culture assays but there clearly was room for improvement; the ec 50 values for tfv, tdf and taf are 1.2, 0.015 and 0.003 lm respectively. whereas the gain in cell culture ec 50 value may be modest, this is not the only gain. the increased stability of taf allows it to load on-target cells and tissues (e.g., lymph nodes) for a longer period of time resulting in increased lymphoid cell and tissue levels at greatly reduced circulating tfv levels, leading to less exposure to off-target tissues (e.g., kidney). in monotherapy studies after oral dosing with tdf (300 mg) and taf (25 mg), the plasma tfv auc is reduced from 1920 to 268 ng.h/ml respectively whereas the reduction in hiv load from baseline is improved, from log 10 0.97 to log 10 1.46 copies/ml, respectively, reflecting the more efficient delivery of taf to target cells and tissues. clearly the lower dose of taf (25 mg) relative to tdf (300 mg) will give taf a marked advantage when considering combination pill therapy. understanding how marked a difference a prodrug can make from the taf example, adrian went on to describe how a prodrug approach transformed a new nucleotide project in which intrinsic properties of the pharmacologically-active nucleotide analog were optimized. their starting point was gs-2128 (d4api), which had good activity against both wild-type and resistant hiv strains but was an active inhibitor of mitochondrial polymerase-gamma. on comparing the known structures of hiv rt and mitochondrial polymerase-gamma, differences in the 2 0 -binding pocket were noted. this led to gs-9148 in which 2 0 -f was added to gs-2128 (fig. 8) . compared to tfv, gs-9148 was about 3-fold less active against wild-type hiv but maintained better activity against resistant strains (k65r and multiple thymidine analog resistance mutations). most importantly, it was inactive (ic 50 >300 lm) against mitochondrial polymerase gamma. more than 50 prodrugs were synthesized and evaluated in metabolism studies and in dogs (intravenous and oral administration). then the enantiomers were tested separately in dogs. this led to the selection of gs-9131. whereas tfv is efficiently utilised by renal uptake transporters, gs-9148 was poorly taken into the kidney. no adverse renal findings were observed with the prodrug (gs-9131) in 28-day studies in rats, dogs and monkeys at the highest doses tested (300 mg, 20 mg and 30 mg/kg daily, respectively). in summary, this work has given examples of the prodrug approach being used successfully both to increase selectivity (by loading on-target tissues vs off-target tissues) and to increase activity (via by-passing metabolic constraints). adrian presented cases in which a prodrug strategy was able to fulfil the full potential of a selective, active triphosphate analog and enable its further progression as a clinical candidate. the keynote speakers were david margolis and myron cohen (fig. 9) . david margolis, university of north carolina, nc, usa in hiv-infected patients, there is a long-lasting reservoir of hiv in the form of integrated viral dna in resting cd4+ memory cells of the host immune system. therefore, even if it were possible to eliminate 100% of viral replication, a reservoir of hiv would remain. there may be reservoirs in other long-lived cells. to date, there is only one known hiv patient who has been cured of his infection, the ''berlin patient''. he was treated for cancer by chemotherapy followed by a bone-marrow transplant. being ccr5 +/à, the chemotherapy had a greater chance to remove all the ccr5+ve cells. the bone marrow donor was ccr5àve. although this patient continues to have no sign of hiv infection, this is hardly a viable treatment option for most hiv-infected patients. even in subjects with hiv replication well controlled by therapy, 70% have detectable plasma viremia which does not appear to decay over time (at least two years). to improve the sensitivity of the assay for hiv, 4 billion lymphocytes are mixed with antibody attached to magnetic beads. this selects for the cd4+ t cells, about 0.2-1 billion cells. the limit of detection is 1 copy of hiv rna/million cells, limit of quantitation is 10 copies/million cells. to reduce the reservoir of hiv, it was suggested that activation of integrated hiv in resting cd4+ t cells would give renewed hiv rna synthesis and possibly result in cell death either due to viral cytopathic effects or resulting from hiv-specific immune responses. a small clinical trial was set up to test this hypothesis. vorinostat (vor), a clinically approved drug for treating certain cancers, has been shown to bind to the active site of histone deacetylases. after a single dose, there was an increase in hiv rna (1.5 to 5-fold, mean 2.6-fold). of these subjects, 5 elected to continue with multiple doses. from the 11th to 22nd vor dose, acetylation of histones and activation of hiv rna synthesis became refractory to therapy. also, it is not known what proportion of cells, with latent hiv, can be activated. whereas a single vor dose did increase the expression of hiv rna, this is not an effective therapy for removing the hiv reservoir. myron cohen, university of north carolina, nc, usa myron noted that there are 2.5 million new hiv infections each year. in this context, anal sex may be an important factor because just one or a few virions of hiv can be infective; within 3 weeks, there is rapid virus replication throughout the body and latent hiv reservoirs of ''founder virus'' are already formed. although anal sex has been associated with homosexual couples, myron pointed out that it is not uncommon amongst heterosexual couples. although behavioral education should be encouraged, it can never be the whole answer. various approaches to the prevention of hiv transmission are being evaluated. monoclonal antibodies, broad neutralising antibody (bnab) and vaccines may have potential for prevention of transmission, but most progress is being made with dapivirine rings containing tdf. these are designed to stay in the vagina for a month. phase iii trials are ongoing. a long-acting hiv integrase inhibitor, gsk 1265744 (generally known as gsk 744), is administered i.m. once every 3 months; a two-year safety trial will be required. phase i trial has been completed and phase ii trial is being planned. by analogy with tuberculosis therapy, in which the infectious state is disabled prior to a complete cure, one wonders if hiv transmission rates may decrease with effective art use. in 2005, the hiv prevention trials network (hptn) initiated a study (hptn 052) which enrolled 1,763 hiv sero-discordant couples (couples that have one member who is hiv-infected and the other who is hiv-uninfected), mostly (97%) heterosexual couples. the infected partner had to be well enough not to require immediate art. the couples were randomised to have either immediate or delayed art. both groups received the same care including counselling on safe sex practices, free condoms, treatment for sexually transmitted infections and regular hiv testing. in may 2011, it had been announced that there had been 27 hiv transmissions in the delayed art group (877 couples) compared to only 1 in the immediate art group (886 couples), a 96% reduction. in these 28 cases, the hiv strain was linked to the partner. this is the first randomised clinical trial to show that treating an hivinfected individual with art can reduce the risk of hiv transmission to an uninfected partner. even with ''safer-sex'' counselling, there were 60 pregnancies in the delayed art group, despite that group having more incentive for safer-sex. following the announcement of this result, all infected participants were offered art. myron reported the 10th annual review of this study. in the delayed art group, there had been a total of 28 cases of hiv transmission with the hiv strain linked to the partner and 11 cases of unlinked transmission. in the one case of hiv transmission in the immediate art group, infection had been detected at day 85 of the study and further investigation suggested that the infection event was on day 1. clearly, early art is highly beneficial. cdc guidelines now recommend that all hiv infected patients should have art. 6. mini-symposium: hepatitis b virus anna lok, university of michigan, mi, usa the number of people infected with hbv world-wide, as estimated by the who and cdc in 2007, was between 223 and 240 million, but was declining due to vaccination. in the usa, vaccine use has led to a steady decline in the rate of new infections, decreasing from about 10/100,000 residents in the 1980s to about 1/100,00 today. in contrast, the prevalence of chronic hepatitis b among immigrants remains high, with no decreasing trend. when infection is acquired early in life, chronic infection is the norm. high viral load is associated with progression to liver cancer. there are 7 fda-approved drugs to treat chronic hbv infection, including entecavir (etv), emtricitabine (ftc) and tdf. with several years of continuous therapy, hbeag loss is achieved in about 40% of patients but hbsag loss (the ultimate goal, seen as a ''cure'') is still a distant prospect for most patients. however, cirrhosis can be reduced by long-term antiviral treatment. in one tdf trial at 5 years, 344/348 patients had a liver biopsy which showed that 73% of patients had improved fibrosis scores (p2 units) and that most other patients had no worsening. tdf has now been used for 6 years without detecting hbv resistance, making it one of the first line drugs. tdf is generally well tolerated but its rare side effects include nephrotoxicity (see above for a possible switch to taf when it is approved), reduction in bone mineral density and very rarely lactic acidosis. despite the major progress made in hbv therapy, there remain various challenges. one is cost, about $60,000-$72,000 for 5-year tdf therapy. pharmacy claims show that adherence is a problem; doses used are less than doses prescribed. there is a lack of accurate prediction of how hbv disease will progress in individuals. hbv dna can be integrated into the human genome at an early stage of infection. fortunately, the integrated viral dna is usually not the complete viral genome and patients, who achieve hbsag loss, rarely relapse. stefan mehrle, university of heidelberg, germany (stephan urban, head of hepatitis b research group, university of heidelberg, was originally scheduled to give this presentation). some chronic hbv-infected subjects are co-infected with hepatitis delta virus (hdv). this is a defective virus that replicates only in the presence of hbv. current antiviral drugs do not inhibit hdv. recently, heparan sulphate proteoglycan (hspg) has been shown to be essential for binding both hbv and hdv to primary hepatocytes. in 2012, human sodium taurocholate co-transporting polypeptide (hntcp) was identified as a functional receptor for hbv and hdv. hntcp is also designated as a solute carrier protein 10a1 (slc10a1). hntcp was shown to be a binding factor for the pres1 domain of the hbv l envelope protein. this interaction was found to be essential for hbv and hdv infection. whereas hbv replication is poor in cell lines derived from hepatocytes (e.g. hepg2 and huh-7) in which hntcp is usually weakly expressed, hbv replication is possible in primary human hepatocytes. the critical discovery was that over-expression of hntcp in hepg2 or huh-7 cells conferred susceptibility to hbv and hdv infection. myrcludex-b is a lipopeptide derived from amino acid residues 2-48 of the pres1 region of the hbv l protein. because it quickly (within 5 min) targets the liver, it is being developed for liver imaging and for drug targeting. it also acts as an entry inhibitor for hbv and hdv by interrupting binding between the hbv l protein and hntcp. it specifically inhibits hntcp-mediated taurocholate transport but the effect on hbv replication is much greater. myrcludex-b activity has been investigated in vivo using scid mice reconstituted with human hepatocytes. with prophylactic treatment, not one infected hepatocyte was seen. following therapeutic treatment, at week 6 post-infection, there were a few isolated infected cells. after the end of therapy, the infection seems to spread but only to neighboring cells. myrcludex-b has been synthesised on a 100 g scale. toxicology evaluation in 3 chimpanzees has been completed and clinical trials have been initiated. in a phase i trial using a 20 mg dose, myrcludex-b was well tolerated. results of a further phase i trial are due to be reported later this year (2014). a dose-ranging phase ii trial has been started. kyong-mi chang, university of pennsylvania, pa, usa anti-hbs antibodies clearly play a critical role in controlling hbv disease. their presence has been accepted as an indication of an ''effective cure''. however, these antibodies appear late in the disease course and so they must have a limited role in the early stages of the disease. what is the role of t-cell responses? in contrast to other viruses, there is a delayed onset, about 4-8 weeks rather than days. cd4+ t cells regulate the adaptive response, cd8+ t cells attack hbv-infected cells. the national institute of diabetes and digestive and kidney diseases (niddk), part of the usa national institutes of health (nih), is supporting a prospective clinical trial to investigate hbv-specific t cell responses during the course of hbv disease. there are no clear t cell differences relative to hbv genotype. the t cell responses are highest during acute hbv infection. during the chronic phase of hbv disease, t cell responses remain suppressed. in conclusion, there are a lot of players in the immune control of hbv infection but their relative contributions and how they adapt to control hbv replication are still largely unknown. 6.4. diversifying the hepatitis b pipeline: current efforts to explore novel mechanisms andrea (andy) cuconati, institute for hepatitis & virus research, pennsylvania commonwealth institute, pa, usa current hbv therapy using nucleotide anti-virals has been highly effective in controlling the infection but a ''cure'', as defined by hbsag seroconversion, has remained elusive. at best after 5 years, the rate is about 25%. other approaches are needed. myrcludex-b (see section 6.2) is the lead entry inhibitor. nvr-1221, an encapsidation inhibitor, is entering clinical trials. in addition. studies with novel nucleotide analogues are ongoing. the hbv field has been transformed recently by the introduction of cell-based antiviral assays. stefan mehrle (see section 6.2) has been leading the way. the assay read-out will need to be optimized for high-throughput screening (hts) but, already, the assay has shown some ''hits''. a few compounds inhibited encapsidation of viral rna. (the hbv virion contains partly double stranded (ds) dna but the reverse-transcription from rna to dna occurs within the capsid.) within the cell, hbv dna is transported into the nucleus where the viral dna forms covalently closed circles (cccdna). two specific inhibitors of cccdna formation have been found. current nucleotide anti-hbv compounds do give large reductions of hbv dna in plasma but only a minimal reduction in levels of the hbs antigen (about log 10 0.1). in contrast, one ''hit'', hbf-0259 inhibited surface antigen production but not genomic replication. structure-activity-relationship (sar) studies have given the current lead compound, hbv-0215. in conclusion, the cell-based assay, with complete replication of hbv, has markedly improved the screening for anti-hbv compounds although further optimization is still needed to give hts capability. adam zlotnick, university of indiana, in, usa. over the last few years, there has been much progress towards understanding the critical role of the hbv core protein -it is much more than just a protective coat for the genome because it plays a major role in the hbv life cycle. the core protein, being 183 amino acids long, is known as cp 183 . the first 149 amino acids are involved in core assembly whereas the last 34 residues, rich in serines and arginines, bind to rna. phosphorylation of the serines, particularly s155, s162 and s172, is required for specific packaging of full length hbv rna complexed to the polymerase (reverse transcriptase -pregenomic rna; rt-pgrna). this rt-pgrna complex initiates encapsidation. the core consists mainly of cp 183 but also includes other proteins (about 0.5%). adam showed us a computer model of the core, using different colours to highlight the various critical components. inside the core, the area of highest density (highlighted in red) represented the polymerase which was attached to the inner surface of the core. the ''other proteins'' in the core were shown in blue. the current thinking is that the polymerase, initially acting as a reverse transcriptase, is attached to, and guided by, an ''inside railway track''. this enables the polymerase to jump to the other end of the rna to start the reverse transcription into dna and then jump again to the other end to start, but never complete, the replication of the complementary dna strand. the self-assembly of the core is an energetically ''downhill'' process. somewhat surprisingly, it is possible to get mutations in which the core is even more stable but the rt activity is reduced. the phenylpropenamide derivative, at-130, fills a pocket in the core and so stabilizes it, similar to the change in amino acids in the mutants. in the presence of at-130, core assembly occurs faster; hence it is known as a core assembly enhancer (as adam mentioned, not a term much loved by industry, their preference is for core assembly inhibitors). regardless, the whole capsid structure changes. the binding of only a few drug molecules is required to make the core non-functional. it seems that it is easier to find compounds to enhance core assembly than inhibitors. 6.6. targeting cccdna to cure chronic hepatitis b massimo levrero, sapeinza universita' di roma, italy. the current hbv therapies of choice are tdf alone or with etv. these drugs have an extensive safety record with use up to 7 years. however, as for other nucleoside/nucleotide analogs, there is only a limited (about 1 log 10 ) reduction in the levels of hbv cccdna. the half-life of hbv cccdna seems to be long, but is still unknown. hbv replication parallels host gene expression, in that they involve the acetylation of histones, for example h 3 and h 4 . both host transcription factors and viral proteins bind to the cccdna. massimo summarized various assays to study different stages of cccdna during the replication cycle. potentially, these assays would allow the study of various approaches: to reduce or clear cccdna, to silence cccdna or to prevent the formation of new cccdna so that it would eventually be removed by dilution and cell death. for proof-of-concept, known ''epigenetic'' compounds, which act as transcription inhibitors, have shown that cccdna can be silenced. by reducing histone acetylation, the cccdna becomes too compact to allow transcription. this approach mimics, partly, therapy with interferon. this research is still at an early stage. due to time constraints, the next two speakers were asked to present brief summaries. john morrey (utah state university, ut, usa) described four mouse models but all stages of the life cycle of hbv can be studied only in the chimeric mouse model, in which human hepatocytes are used. however, this model lacks the potential to study the immune system and it is very expensive. stephan menne (georgetown university, dc, usa) described the woodchuck model. woodchuck hepatitis virus (whv) resembles the human virus and the disease in animals has many similarities to that in humans. neonatal infection becomes chronic in about 60-75% of cases. these chronic cases have virtually a 100% life-time risk of developing cancer, the time scale being about 1 year of chronic infection, followed by cancer at years 3 to 4. the use of microbicides is an active area of research for the prevention of transmission of hiv. david katz (duke university, nc, usa) described how mathematical models may aid drug product design. for example, if it is assumed that the microbicide gel is 400 microns thick, the epithelium is 200 microns and the stroma (connective tissue) is 3000 microns and if the partition coefficient between gel and epithelium in known, then it is possible to model drug transfer and suggest how various other parameters, for example the size of the subject, may modify drug delivery. it is important that different disciplines work together, for example biophysicists with behavioral scientists. biophysics can help an understanding of complex physical phenomena but human behavior can be both complex and highly variable. ralph baric (university of north carolina, nc, usa) noted that a particular infective agent, for example norovirus (nov), may cause subclinical or serious disease in different individuals. in general, animal models are designed to give consistent outcomes rather than aiming to mimic the genetic diversity found in human subjects. in a collaborative effort, mice from 8 ''founder'' strains, including 3 wild-derived strains, were selected. the 5 founder laboratory strains were all derived ultimately from a single female mouse ca 1900. the susceptibility of the 8 founder strains to severe acute respiratory syndrome coronavirus (sars-cov) differed widely (ld 50 p10 6 -10 2 ). the founder strains were cross-bred. although ca 90% of the genes was equally distributed among the new mouse lines, there were gene combinations not seen previously. after infecting mice from the different founder strains with a constant sars-cov inoculum and measuring virus load at a set time after infection, there was a correlation between virus load and disease (as measured by vascular cuffing). it was possible to relate the effect to chromosomes 3 (27%) and 13 (20%). hopefully, identification of the important genes may be achieved. by keeping the virus inoculum constant, this system better represents the clinical spectrum of disease. when using this system to evaluate a potential vaccine, it was found that mice, under the age of one year, could be protected. however, there was a range of effectiveness, from good protection to inactive. these variations may give a representation of human diversity. angela kashuba, university of north carolina at chapel hill, nc, usa in four clinical studies, truvada [a combination pill containing tdf and emtricitabine (ftc)] was taken once daily to prevent hiv transmission, known as pre-exposure prophylaxis (prep). the adherence rates were unexpectedly poor in all four studies, particularly low in the study including at risk women. for example in one study, ''high adherence'' was defined as subjects taking at least 80% of drug doses and was achieved by only 54% of subjects. possible reasons may have been the apparent risk of side-effects (the long consent form included 7 pages of side-effects) and the perception that the subjects, as individuals, were not particularly at risk of infection by hiv. importantly, the trial did confirm the concept that prep could be effective. there was >90% protection in those subjects generally taking 7 doses/week and there was some protection, albeit much less, in subjects taking 2 doses/week. adherence rates, reported by subjects, were appreciably higher than the rates evidenced by drug blood level measurements taken just before the next dose (i.e. 24 h after previous dose). in an attempt to better understand and model these data, the drug concentrations (tdf/tfv and ftc) in various tissues were measured. the ratio between drug concentrations in blood and tissue samples differed greatly for tdf/tfv, with less variations for ftc. concentration ratios of tdf/tfv were about 50 in rectal tissue but only 0.2 in vaginal tissue. for ftc, the ratios were 2.6 and 1.3, respectively. when considering the possible consequences of missed doses, the time scale for hiv infection is an important factor. it is thought that hiv takes about 1-3 h to reach the epithelial cells. clearly, adherence is a critical factor for efficacy and so a real-time objective method for measuring adherence is urgently needed before further clinical studies are initiated. 7.4. the novel nucleoside analog bcx4430 exhibits broad-spectrum antiviral activity and confers post-exposure protection against ebola and marburg viruses travis k. warren, usamriid, fort detrick, md, usa ebola and marburg viruses are members of the filovirus family. even in recent outbreaks of these diseases, including the current ebola epidemic in west africa, care workers are becoming infected and dying. drugs, which are being investigated for treating these diseases, are progressed under the fda ''animal rule''. bcx4430 is a c-nucleoside adenine analog (fig. 10 ) which is being progressed by biocryst pharmaceuticals inc. (warren et al., 2014) . in cell culture assays, bcx4430 is active against ebola and marburg viruses, (ec 50 ca 1 lm). with bcx4430 at 30 lm, there was no detectable incorporation into host dna or rna. in rats, bcx4430 is efficiently activated (phosphorylated) to the triphosphate. in a primer-extension assay, there is some read-through beyond a single residue of bcx4430, but there is effective chain termination after the first bcx4430 residue where the template has two consecutive uridine residues. bcx4430 has been tested in rodent and nonhuman primate models of marburg hemorrhagic fever. in mice, there was a dose response (30, 20, 3.3 and 1.1 mg/dose, bid) with full protection at the two higher doses (survivors, 100%, 100%, 95% and 83% respectively). in an experiment with dosing starting at different times (4 h pre-infection, 24, 48, 72, 96 and 120 h post-infection vs placebo), the placebo-treated mice died on days 6, 7 and 8 with one survivor (10%). in the treated groups, the percent survival was 80, 100, 80, 100, 100 and 30, respectively. in guinea pigs, bcx4430 (bid) with treatment starting at different times (1 h pre-infection, 24, 48 and 72 h post-infection) there was full protection (100% survival) for the pre-infection and 24 h groups, with reduced efficacy at the later start times. in cynomolgus monkeys, bcx4300 treatment was started at 1, 24 and 48 h post-infection. in the placebo group, all 6 animals died within days 9 to 12. in all the treated groups, virus loads were reduced by more than log 10 3. there was one late death in the 1 h group but the other 17 monkeys survived. various markers of potential organ damage were reduced in all treated groups. encouraged by these results, 14-day toxicology trials have recently been completed without any serious concerns. biocryst is developing bcx4430 under the fda animal rule and indenabling work is ongoing. when asked about viral resistance, travis explained that it is not ethically permissible to create resistant strains of marburg virus, but samples collected from the monkeys are being sequenced to look for mutations indicative of drug resistance. as yet, mitochondrial toxicity has not been examined. had similar bone marrow transplants, initially seemed to have been ''cured'' but hiv was detected after 70 and 200 days, respectively. latent hiv can survive in various long-lived cells for decades, especially in memory t cells. when these cells proliferate, the integrated hiv genome is duplicated as the cell divides and the cells survive so long as hiv remains silent. compounds known to activate all t-cells are too toxic to become a clinical therapy. however, latency-reversing agents (lra) have greater specificity, ideally activating only the integrated hiv, leading to the death of hiv-containing t-cells. there remains another possibility (perhaps a less popular view) that there is continued low rate of hiv replication. two clinical studies have been initiated in subjects with undetectable plasma hiv levels. raltegravir, an hiv integrase inhibitor, was added to the background therapy. latent hiv is mostly integrated into host dna but hiv may also form episomal circular dna. the proportion of the circular form increases with raltegravir treatment. in the two clinical studies, 13/45 and 9/15 subjects, respectively, had detectable hiv circles which then decayed. this implies that some de novo infection of cells is ongoing. on the other hand, art works well, with no evidence of sequence evolution in the hiv circles at 48 weeks. is it possible that raltegravir is inducing a single round of hiv replication, to give an increase in hiv circles? derek sloan, gilead sciences, foster city, ca, usa like vorinostat, (vor), romidepsin (rmd) is a histone deacetylase inhibitor which is used clinically to treat cancer. memory cd4+ t cells were taken from hiv subjects on suppressive art; ex-vivo treatment with rmd (40 nm) induced a 6-fold increase in intracellular hiv rna which persisted for 48 h. in contrast, a much higher concentration of vor (1 lm) gave a 2 to 3-fold lower response which was only transient. rmd also increased levels of extracellular hiv rna and virions. encouragingly, this ex-vivo induction of latent virus was seen at rmd concentrations that are below the levels of drug achieved in humans by clinical doses of rmd. accordingly, in a phase i/ii trial in hiv-infected subjects on art, rmd gave a better and more sustained response than vor. about 1.5% of cells containing hiv provirus were activated. although this is far too low a percentage to eliminate the latent hiv reservoir, it is hoped that combination of such lra, which give improved results in ex-vivo cell assays, may give better clinical efficacy. gilead scientists have started screening for novel lras. ''gs-1'' has been identified as a hit by hts. research on this lead is at a very early stage. gilead workers are also investigating other approaches. for example, gs-9620 is a toll-like receptor 7 (tlr7) agonist and it acts as an immune stimulator. although it is being evaluated in phase ii studies for the treatment of chronic hbv infections, the potential effect on hiv reservoirs is being investigated. in siv-infected monkeys, oral dosing of tlr7 agonist induced the activation of immune effector cells such as cd8+ t cells and nk cells. based on these data, tlr7 agonists are being further investigated for their effect on latent siv reservoirs in monkeys which have good virological suppression. another approach is to use anti-envelope antibodies. broadly neutralising antibodies (bnabs) are very effective in preventing siv infection when the viral load is low but less effective against a high-load virus challenge. in addition, a prophylactic cmv-vector-based siv vaccine was effective in preventing siv infection in rhesus monkeys. this and similar vaccines are being tested in vivo for their effects on the latent siv reservoirs. in summary, lras are able to activate hiv provirus in memory cd4+ t cells and thereby may enhance the recruitment of immune effector cells to destroy provirus-containing cells. however, a ''cure'' for hiv infection is still a distant prospect. furthermore, latent hiv reservoirs are heterogeneous and so a combination of approaches will likely be required. gerardo garcia-lerma, centers for disease control and prevention, atlanta, ga, usa proof-of-concept studies for prep, are mostly conducted in nonhuman primates. these can be used either to model a single highdose infective challenge or repeated low inoculations, about 10-50 tissue culture infective doses (tcid 50 ). since 2005, rhesus macaque models have been used in a long series of investigations. in a study, in which the monkeys were treated daily with either oral tdf or tdf/ftc and given a weekly siv inoculum rectally, tdf/ftc gave a longer delay in infection than did tdf alone. when using the vaginal infection route, tdf/ ftc gave 100% protection. in contrast, there was far less protection in clinical trials -why? one possible reason may have been that women were having the contraceptive injection, depot medroxyprogesterone acetate (dmpa). a study, in macaque monkeys given dmpa, confirmed that dosing with tdv/ftc gave good drug levels in plasma and in vaginal secretions. therefore, this did not explain the poor protection in the clinical trial. the macaque model has been used successfully to investigate various situations that are presented in the clinic. when macaques were co-infected with siv and a bacteria and treated with tdf/ftc for 12 weeks, there was good, but not complete, protection (80%). with ftc-resistant virus, tdf/ftc remained protective. in this case, ftc-resistant virus has increased susceptibility to tdf. with the k65r mutant hiv, there was protection against a low inoculum but only partial protection (ca 50%) against a high inoculum. whereas daily dosing seems to be acceptable for patients living with hiv, another option for prep is desirable. gsk-1265744 (generally known as gsk-744) is an hiv integrase inhibitor. it can be formulated with nano-particles to provide an injectable drug depot. in the macaque model, gsk-744, injected once monthly, gave full protection against repeated rectal and vaginal exposures. because metabolism of gsk-744 is much slower in humans than macaques, it was expected to remain effective in humans for up to three months. a phase i study confirmed that drug levels remained above the predicted effective level with a 20-week dosing interval. a phase ii trial is planned. another approach is to use vaginal rings, which have been in clinical use as contraceptive devices for years. in the macaque model, tdf-containing rings, replaced every 4 weeks, gave full protection. a phase iii trial has just been initiated. another option, elvitegravir (evg) and taf are being evaluated in a biodegradable polymer. although daily dosing with tdf/ftc has not proved sufficiently successful as prep in clinical use, it has proved that prep is an achievable aim and this has encouraged the progression of other options. courtney fletcher, university of nebraska, omaha, ne, usa atripla was the first triple combination pill taken once daily for hiv therapy. it contained tdf, ftc and efavirenz (efv). the macaque model has been used to investigate the differing tissue distributions of these drugs and how viral replication may be continuing wherever the drug concentrations are lowest. there are two approaches: tissue homogenates and tissue cells. tissue homogenates give both the intracellular and extracellular drug amounts. from tissues, mononuclear cells (mncs) are collected and the intracellular drug concentration measured. this approach is preferred by courtney but this option may be constrained by sample size and the drug concentration may be underestimated. for exam-ple, with raltegravir, after the mncs have been washed 3 times, the drug concentration is very low. much higher raltegravir concentrations are found when the mncs are cleaned by a rapid spin through oil. comparing an oil spin and repeated washes, the oil process gives higher drug levels, typically about 50% higher. following initial studies in macaques, a clinical study, in 32 subjects, investigated distribution of the drugs from atripla in peripheral blood mononuclear cells (pbmc) and various tissues (see above). in 12/32 subjects, there are data on the time to reduce hiv load to <48 copies/ml. in plasma, the time was 3-4 months. in lymphoid tissues, there was a much slower rate of hiv decline. also, patient variability was noted, with the faster responders having the higher drug levels. a drug may be absorbed from the gastrointestinal tract either going via the portal vein to the liver and then into blood circulation or via the lymphoid system. blood flow is about 200 times faster than lymphoid flow. when the water/1-octanol partition-coefficient (logp) of a drug is <5, absorption tends to be via the blood route. the prodrug approach can be used to alter absorption or, as for tfv, stability of the prodrugs (tdf and taf) can influence the relative concentration in lymphoid tissues (see above). this year, the three major award lectures exemplified the strength of icar, covering very different areas of research. john drach (elion award) described his journey through the early days of antiviral research, which led to the identification of novel modes of antiviral action that had not been envisaged previously. piet herdewijn (holý award) used evolutionary pressure to select dna polymerases that accept novel nucleoside analogs. the replacement of thymine by 5-chlorouracil led to the generation of a new form of e. coli. i suggest that this work has important implications in conventional antiviral research. with hiv and hcv protease inhibitors, the genetic barrier is limited by the ability of the viral protease and its substrate (the viral polyprotein cleavage sites) to co-mutate so that the virus can become resistant to the antiviral drug. so far, polymerase inhibitors have not suffered the same fate but this work shows that a poor choice of nucleotide analog could result in a resistant virus with a new type of rna in which the drug replaces a natural nucleoside. adrian ray (prusoff award), describing work at gilead, demonstrated how the prodrug concept can markedly improve both the efficacy and safety of potential drugs. their progress with hiv and hcv therapies has been remarkable. the keynote addresses tackled two emerging areas of hiv research. david margolis summarized work aiming to eradicate hiv from infected subjects and myron cohen described current progress with approaches to prevent hiv transmission. i found both these presentations to be informative and stimulating. hiv ''cure'' still seems to be a distant prospect. in contrast, prior to exposure prophylaxis (prep) has been shown to be an achievable aim although the need for daily dosing is a barrier to success. gerardo garcia-lerma described recent progress which is likely to radically change the prospects for therapeutic convenience and success. tdf-containing vaginal rings, which need replacing only once a month, are being evaluated. another exciting prospect is gsk-744 which has been formulated as a long-lasting injection. a phase i trial confirmed that the drug may be administered at 3month intervals. in the absence of a proven hiv vaccine, prep with drugs has become the most promising strategy to reduce hiv infection rates among high-risk populations. this conference also included three interesting mini-symposia: ''hepatitis b virus'', ''research triangle park'' and ''challenges in hiv infection, treatment and prevention''. an innovation this year was a session devoted to the european training network, euvirna and introduced by frank van kuppeveld. all the 18 euvirna fellows, who attended icar, gave short presentations at this session. for further information, please see the isar news (24.1) in the september issue of antiviral research for an account by frank van kuppeveld. for many years, the clinical symposium was, for me, a major highlight of icar. in my report for the 2013 icar, i expressed a hope regarding hcv therapy: ''there is the prospect that the first nucleotide analogue will be licensed by the time of our next icar meeting. the combination of a nucleotide analogue and a ns5a inhibitor looks set to transform hcv therapy across all genotypes. as for hiv, single-pill, once-daily regimens are following on quickly''. on 6th december 2013, sofosbuvir (sovaldi ò ) was the first nucleotide analog to be approved in the usa by the food and drug administration (fda) for treatment of patients with hcv. approval by the european union followed soon afterwards, in january 2014. a ns5a inhibitor, ledipasvir, formulated as a single fixed-dose combination pill with sofosbuvir, is progressing quickly through clinical trials. with such remarkable progress being achieved since the 2013 icar, i was disappointed to discover that there was no presentation on this topic at this year's icar. a paper (sofia, 2014) , which was part of a symposium in antiviral research on ''hepatitis c: next steps toward global eradication'', emphasizes recent successes. after completing therapy, a sustained virological response for 12 weeks (svr12) is regarded as a cure for hcv-infected patients. the combination of sofosbuvir/ledipasvir has shown remarkable results in clinical trials, with svr12 in the range 95-100% across genotypes. this combination was well tolerated. a nda for the sofosbuvir/ledipasvir combination pill was submitted recently. i do not recall any previous antiviral trials in which the ''intention-to-treat'' analyses showed 100% success rates. perhaps similar to the hcv symposium in antiviral research, i hope that the 2015 icar, which will be held in rome, will have a mini-symposium which will include an account of this remarkable progress. it would be interesting to have an update on the clinical impact of this combination therapy for hcv and to have an assessment on the prospects for global eradication of hcv. beside this one disappointment, there were many excellent presentations and i would like to add my thanks to the isar officers and conference committee for organizing another interesting and successful icar. metabolism and pharmacokinetics of anti-hepatitis c virus nucleotide prodrug gs-6620 beyond sofosbuvir: what opportunity exists for a better nucleoside/nucleotide to treat hepatitis c? selection of an oral prodrug (brl 42810; famciclovir) for the antiherpesvirus agent brl 39123 protection against filovirus diseases by a novel broad-spectrum nucleoside analogue bcx4430 acknowledgements i wish to thank all those authors who have kindly provided me with copies of their presentations and for giving me valuable comments. also, i thank the president of isar for asking me to prepare this meeting report. key: cord-320106-thre6r63 authors: xu, zhihui; ren, xiaoqiang; liu, yan; li, xiaodong; bai, siyu; zhong, yanwei; wang, lin; mao, panyong; wang, huifen; xin, shaojie; wong, vincent wai-sun; chan, henry lik-yuen; zoulim, fabien; xu, dongping title: association of hepatitis b virus mutations in basal core promoter and precore regions with severity of liver disease: an investigation of 793 chinese patients with mild and severe chronic hepatitis b and acute-on-chronic liver failure date: 2010-09-17 journal: j gastroenterol doi: 10.1007/s00535-010-0315-4 sha: doc_id: 320106 cord_uid: thre6r63 objective: to investigate the features of hepatitis b virus (hbv) basal core promoter/precore (bcp/pc) mutations and genotypes in a large number of mild/severe chronic hepatitis b (chb-m/chb-s), and acute-on-chronic liver failure (aclf) patients and analyze the clinical implications of the virologic features. patients and methods: sera of 793 (325 chb-m, 170 chb-s, and 298 aclf) patients admitted to or who had visited beijing 302 hospital from january 2005 to december 2008 were collected and successfully amplified for the hbv bcp/pc and a 1225-bp-long s/pol (nt 54–1278) gene regions. biochemical and serological parameters and hbv dna level were routinely performed. viral dna was extracted and subjected to a nested pcr. genotypes/subgenotypes were determined based on complete genomic sequence or on analysis of the 1225-bp-long s/pol-gene sequence. hbv genotyping was performed by direct pcr sequencing followed by molecular evolutionary analysis of the viral sequences. a p value of <0.05 (two-sided) was considered to be statistically significant. conclusions: our findings suggest that chb patients infected with bcp/pc mutant viruses are more susceptible to severe hepatitis and aclf than those with the bcp/pc wild-type virus and that aclf patients with pc mutant viruses have an increased risk of death. as such, the hbv pc mutation is a potential predictive indicator of aclf outcome. hepatitis b virus (hbv) chronically infects about 350 million people worldwide and 93 million people in china, with high risk of evolution to liver cirrhosis (lc) and hepatocellular carcinoma (hcc) [1, 2] . chronic hbv infection leads to a wide spectrum of clinical presentations, including the asymptomatic carrier state, mild and severe chronic hepatitis b (chb-m, chb-s), and acute-onchronic liver failure (aclf). in china, patients with hepatitis b-related aclf account for more than 80% of total aclf cases due to the high prevalence of chronic hbv infection. without transplantation, such patients have a high mortality rate (60-80%), resulting in 22,600 deaths annually [3] . the pathogenesis of the severity of chronic hbv infection remains largely unclear. both viral and host factors may play a role. hbv is a highly variable virus and is classified into at least eight genotypes (a-h) that may vary in geographical distribution, viral characteristics, and relationship to clinical outcomes [4] . hbv mutations in basal core promoter (bcp) and precore (pc) regions have attracted special attention because the bcp mutation may enhance hbv replication in vitro and the pc mutation abrogates translation of the hbe antigen (hbeag) which is considered to be a tolerant protein to buffer immune attack of the infected hepatocytes [5] [6] [7] . studies have been performed to clarify these virologic features in patients with acute liver failure (alf) who developed fulminant hepatitis from acute hbv infection. the occurrence of the bcp double mutation a1762t/g1764a and the pc mutation g1896a has been documented to be higher in alf patients than in those with acute hepatitis b [8] [9] [10] [11] [12] [13] [14] . a few other bcp/pc mutations have also been reported to be associated with increased hbv replication capacity and/or reduced hbeag expression in vitro and, in some cases, also associated with alf occurrence [15] [16] [17] [18] . however, the findings have been inconsistent, and to date no obvious link has been identified between hbv bcp/pc mutations and alf or fulminant hepatitis development [19] [20] [21] [22] . such clinical results may be partly due to inadequate sample sizes and the interference of viral genotypes. there is still a paucity of data on the association of hbv bcp/pc mutations and genotypes with aclf occurrence. liu et al. [23] reported that these virologic features seemed not to be associated with the fulminant and subfulminant exacerbation of chb, but their sample size was small. the severity of chronic hbv infection may exhibit a progressive process, i.e., from chb-m to chb-s and then to aclf in many cases. in the study reported here, we investigated the features of hbv bcp/pc mutations and genotypes in a large number of chb-m, chb-s, and aclf patients and analyzed the clinical implications of the virologic features. sera of 793 patients who were admitted to or visited beijing 302 hospital from january 2005 to december 2008 were collected and successfully amplified for the hbv bcp/pc and a 1,225-bp-long s/pol (nt 54-1278) gene regions. the patient cohort comprised 325 chb-m, 170 chb-s, and 298 aclf patients. the patients came from various areas of china, but mainly from the north of the country. the diagnostic criteria were based on the management scheme of diagnostic and therapy criteria of viral hepatitis [24] and diagnostic and treatment guidelines for liver failure [25] , issued by the chinese society of infectious diseases and parasitology and the chinese society of hepatology, respectively, and have been described in our previous studies [26, 27] . briefly, all patients had persistent seropositivity of hbsag for at least 6 months before enrollment. chb-m patients met the following criteria: a history of chronic hepatitis based on a histopathological diagnosis and/or compatible laboratory data and ultrasonographic findings, with mild to moderate liver disease activities that did not reach the criteria of chb-s. chb-s patients had severe liver disease symptoms, including obvious clinical manifestations and significant alterations in their biochemical parameters, such as significant serum alanine aminotransferase (alt) elevation. based on the biochemical parameters, the diagnosis of chb-s had to meet at least one of the following criteria: (1) serum albumin level b32 g/l; (2) serum total bilirubin (tbil) [85.5 lmol/l; (3) plasma prothrombin activity (pta) was 60-40%; (4) serum cholinesterase \4,500 iu/l. aclf patients met the following criteria: recent development of increasing jaundice (tbil [171.0 lmol/l or rapid increase to [17.1 lmol/l/day) and decreasing pta (\40%), with a recent development of complications, such as hepatic encephalopathy (cgrade 2), or an abrupt and obvious increase of ascites or spontaneous bacterial peritonitis or hepatorenal syndrome. the criteria for aclf have been widely used in china and are similar (but not exactly identical) with the newly issued asian pacific association for the study of the liver (apasl) criteria [28] . for all patients, there was no evidence of hcc or other metastatic liver disease; no evidence for concomitant hepatitis c/d virus (hcv/hdv) or human immunodeficiency virus (hiv) infection or autoimmune liver disease. the study was approved by the ethics committee of beijing 302 hospital. the detection of biochemical and serological parameters and hbv dna level were routinely performed in the central clinical laboratory of beijing 302 hospital. the lower limit of hbv dna detection is 500 copies/ml (equivalent to 100 iu/ml). detection of the bcp/pc mutations viral dna was extracted and subjected to a nested pcr as described elsewhere [29] . the primers were 5 0 -gac gtc ctt tgt yta cgt cc-3 0 (sense, nt 1413-1432) and 5 0 -tct gcg acg cgg cga ttg ag-3 0 (antisense, nt 2403-2422) for the first-round pcr and 5 0 -act tcg ctt cac ctc tgc ac-3 0 (sense, nt 1583-1602) and 5 0 -atc cac act cca aaa gay acc-3 0 (antisense, nt 2257-2277) for the second-round pcr. the first-round pcr consisted of equilibrating at 94°c for 3 min, followed by 10 the genotypes/subgenotypes were determined based on complete genomic sequence or on analysis of the 1225-bplong s/pol-gene sequence, which was amplified by an inhouse nested pcr assay [29] . a total of 380 hbv complete genomic sequences from individual patients were used for hbv genotyping, including 115 sequences from chb-m patients (genbank accession no.: fj386574-386689 except for fj386590), 120 sequences from chb-s patients (fj562218-562340 except for fj562263, 562306, and 562338), and 145 sequences from aclf patients (eu939536-939681 except for eu939680). hbv genotyping was performed by direct pcr sequencing followed by molecular evolutionary analysis of the viral sequences using mega 4 software. standard reference sequences were acquired from the online hepatitis virus database (http://www.ncbi.nlm.nih. gov/projects/genotyping/formpage.cgi). continuous variables were expressed as mean ± standard deviation (sd) or median. differences in continuous data were evaluated using student's t test, analysis of variance (anova), or nonparametric wilcoxon signed-ranked test, where appropriate, and categorical data were analyzed using the chi-square test and fisher's exact test. multivariate analyses with logistic regression were used to determine independent factors. statistical analysis was carried out in spss ver. 16 .0 software (spss, chicago, il). a p value of .05 (two-sided) was considered to be statistically significant. clinical background, hbv genotype, and bcp/pc mutation profiles of the patients table 1 summarizes the clinical background, hbv genotypes, and bcp/pc mutations in the three groups of patients. hbv genotypes c and b were detected in the samples of 648 and 145 patients, respectively. hbv/c2 and hbv/b2 were the dominant subgenotypes and found in 96% and 92% individual genotypes, respectively. the hbv genotyping based on the 1225-bp-long gene fragment had 100% (380/380) concordance for the classification of genotypes b and c and 98.7% concordance for the classification of subgenotypes b2 and c2 (b2 100%, c2 98.3%) in comparison with the genotyping based on complete hbv genomes. a slightly higher ratio of genotype b to c was found in aclf patients than in chb patients. compared to chb patients, aclf patients had significantly higher mutation incidences at eight of the ten sites of interest, including t1753v (c/a/g), a1762t, g1764a, c1766t, and t1768a in the bcp region and g1862t, g1896a, and g1899a in the pc region. notably, the frequencies of a1762t, g1764a, and g1896a hotspot mutations and the average substitution number at the ten sites of interest of the viral sequences increased in a stepwise manner in the three groups of patients, namely, chb-m \ chb-s \ aclf patients. correspondingly, the incidence of the bcp/pc wild-type sequence decreased in the same order. in addition, two interesting triple bcp mutations, t1753v/a1762t/g1764a and a1762t/ g1764a/c1766t/t1768a-triplet (with any three substitutions at the four sites), were more frequently detected in aclf patients than in chb patients. the frequencies of former triple mutations were 15.7, 15.3, and 29.2% for chb-m, chb-s, and aclf patients, respectively (p \ 0.01). the frequencies of latter triple mutations were 3.4, 4.7, and 12.8% for chb-m, chb-s, and aclf patients, respectively (p \ 0.01). the quadruple mutation a1762t/g1764a/c1766t/t1768a was detected in four aclf cases only. to exclude the potential influence on the results brought by age differences among patient groups, patients aged from 25 to 38 and 39 to 52 years were analyzed as independent two subsets. as shown in table 2 , patients in different illness categories had a similar age within each subset; the frequencies of a1762t, g1764a, g1896a and the average substitution number remained significantly different among the three illness groups as did the stepwise increase in the order of chb-m[chb-s[aclf patients. in addition to the ten interested sites, significant difference in variant frequencies among the three illness categories was also found at a1846t (chb-m 8.3%, chb-s 36.5%, aclf 37.5%, p \ 0.01). because hbv genotype influences bcp/pc mutational rates, we analyzed the bcp and pc mutations in genotype b and c viruses individually. table 3 summarizes the profiles of the bcp/pc mutations in patients infected with genotypes b or c virus, respectively. in patients infected with genotype b virus, a statistical difference in the occurrence of mutations among the three groups of patients was only observed at a1762t and g1764a, whereas in those infected with genotype c virus, there was a significant difference for four mutations among the groups, i.e., t1753v, g1862t, g1896a, and g1899a. the average substitution number/ sample clearly increased in a stepwise manner in the order of chb-s\chb-m\aclf patients for both genotypes b and c virus infection. the triple mutational pattern table 1 clinical features, hbv genotype, and bcp/pc mutation profile of the 793 patients enrolled in the study the clinical and virologic characteristics in relation to mortality of aclf patients of the 298 patients with aclf, 184 patients had a fatal outcome and 90 patients survived[6 months after the onset of liver failure. older age (c40 years), higher tbil level (c408 lmol/l), lower pta (b24%), higher alt level (c311 iu/ml), and the hbv pc mutation were detected as independent risk factors of death ( table 5 ). the cutoff values were the median for biochemical parameters. a age of 40 years, 10 5 copies/ml for hbv dna, and 3 for the substitution number/sample were selected as cutoff values because they were the integral values closest to the median. the outcome of hbv infection depends on the interplay between the virus, the hepatocytes, and the host's immune response. hbv bcp/pc mutations are considered to be likely involved in the driving factors of disease progression of hbv infection because bcp/pc mutations affect viral replication and/or hbeag expression, which may in turn impact on immune responses to the virus. for example, it has been proposed that expression of hbeag during perinatal infection, the major mode of hbv transmission in asia, induces immune tolerance. another potential role of hbeag in promoting persistent infection is to mimic cp so as to buffer the immune attack of the infected hepatocytes by the anti-hbc antibodies [5] . when the balance is disrupted by the emergence of hbv mutants with different phenotypes, the altered virus-cell relationship might trigger robust immune responses of the host in some instances, causing extensive hepatocyte necrosis [30] . thus, the investigation of virologic features may shed light on the pathogenesis and identify predictors of aclf development. however, the development of aclf is related to multiple factors, all of which need to be studied extensively. clinical manifestations of aclf are different from those of fulminant hepatitis on the basis of acute hbv infection. aclf manifestation also differs from the acute exacerbation of chb, which is defined as clinical symptoms along with an abrupt rise in serum alt ([200 iu/l [31] or [500 iu/l [32] ). aclf patients are relatively rare compared to the large population of chb patients. the beijing 302 hospital is one of the largest hospitals for infectious and liver diseases in china and is well known for its management of hepatitis b. patients from various areas of china come to the hospital seeking treatment, and this has allowed us to collect a larger sample of aclf patients. the efficiency of pcr amplification of hbv bcp/pc regions is greatly reduced by the nick-gap structure encompassed in the regions. a sensitive nested pcr assay with a lower limit of detection of 2000 copies/ml was developed to overcome this obstacle. the technique allowed us to analyze samples of quite low viral load, as in our previous severe acute respiratory syndrome (sars)coronavirus studies [33, 34] . a significantly higher incidence of the bcp/pc mutations at eight of the ten sites of interest was found in aclf patients than in chb patients. in particular, the occurrence of three hotspot bcp/pc mutations and average substitution number in the ten sites of interest increased with the severity of illness in a stepwise fashion ( table 1 ), suggesting that the accumulation of the bcp/pc mutations could be one of the driving factors of illness severity. taking into account that a longer duration of infection may increase the incidence of hbv bcp/pc mutation, we particularly compared different illness groups of comparable ages to minimize this factor. the results showed that the increasing trend of the three hotspot mutations (a1762t, g1764a, and g1896a) with disease severity remained unchanged in age-matched patients ( table 2 ). in addition to variants at the ten sites of interest, the frequency of a1846t was found to increase in chb-s and aclf patients compared to chb-m patients, suggesting that this variant may also be associated with disease severity. a1846t has been reported to be more frequently detected in hbeag-negative hbv infection than in hbeag-positive hbv infection [35] , but the mechanism needs further clarification. more frequent bcp mutations and less frequent pc mutations were detected in genotype c virus than in genotype b virus which confirmed previous results [36, 37] . interestingly, t1754g was an exceptional case which was more often seen in genotype b virus infection. the influence of hbv genotypes on the severity of hbv infection is still uncertain. as genotype b and c viruses have different bcp/pc mutational features, their influence on clinical outcome may be associated with the bcp/pc mutation. nevertheless, the average substitution number per sample in bcp/pc regions clearly increased with the severity of the illness categories in both genotype b and c, suggesting that the accumulation of the bcp/pc mutations increased the risk of aclf occurrence regardless of the hbv genotypes. it has been reported that the co-existence of a1762t/ g1764a with t1753v, c1766t, and t1768a may enhance viral replication in vitro and is associated with alf and advanced liver disease [38] [39] [40] . we found that t1753v-, c1766t-, and/or t1768a-containing triple mutations were more frequent in aclf patients than in chb patients, suggesting highly replicative strains with t1753c, c1766t, and t1768a bcp mutations were also most likely to be associated with aclf development. among the 57 cases with triplet b patterns, 30 (52.6%) were a1762t/ g1764a/c1766t, nine (15.8%) were a1762t/g1764a/ t1768a, and 18 (31.6%) were g1764a/c1766t/t1768a. noticeably, the last pattern has not been documented earlier and mainly occurred in aclf patients. in the luciferase reporter system, the natural g1764a/c1766t/t1768a mutant sequences have been proven to have a 1.8-fold higher transcriptional regulation activity on average than the wild-type sequences generated by reverse site-directed mutagenesis (data not shown). it has been suggested that the bcp mutations frequently emerge at the late hbeag phase of infection, whereas the pc mutations usually emerge later, at the height of the anti-hbe immune response [15] . therefore, we classified three bcp/pc mutation statuses as bcp-/pc-, bcp?/pcand bcp±/pc? and analyzed their implications. the results showed that chb-m patients infected with bcp/pc mutants exhibited more enhanced inflammatory responses (significant increase in tbil and alt levels and a slight decrease of viral load) than those with the bcp/pc wildtype virus, whereas chb-s and aclf patients did not. in contrast, chb-s patients infected with bcp/pc mutants had lower tbil and hbv dna levels than those with the wild-type virus. to date, few studies have been able to show an association between these clinical parameters and hbv bcp/pc mutations. bcp mutants have been shown to be positively correlated with increased alt levels in chronic hbv carriers and chb patients [41] , and reduced viremia associated with bcp/pc mutants was explained by the fact that enhanced hbv replication of the mutants would efficiently stimulate immune reactions, leading to the enhanced destruction of viral particles [13, 15] . the alternation of alt and hbv dna levels may be influenced by the use of antiviral treatment; furthermore, a blood test at a single time point may bias the evaluation of disease activity for some chb patients with fluctuating alt and hbv dna levels, although these influences were relatively proportionate in large-size samples in this study. further genotypic and phenotypic studies need to be performed to make a clearer outline. the rates of hbeag loss and anti-hbe positivity increased in a stepwise manner along with the emergence of bcp mutation and pc mutation in chb-m patients. in chb-s and aclf patients, bcp mutation alone did not significantly increase hbeag-negative/anti-hbe-positive rates, suggesting that bcp mutations may have diverse influence on hbeag seroconversion in different illness categories. there have been reports of the bcp double mutations being associated with lower viral loads in hbeag-positive individuals [42] and the pc mutation being correlated with high levels of hbv dna in hbeagnegative chb patients [43] . however, these associations were not observed in our study (data not shown). mutant viruses frequently coexist with wild-type viruses, and subpopulations comprising \20% of the total hbv population may be missed by direct sequencing techniques [44] . this may account for the detection of g1896a mutants in some hbeag-positive patients. interestingly, we found that aclf patients infected with pc mutants had a significantly higher mortality than those with pc wild-type hbv, indicating that the hbv pc mutation could serve as a predictive indicator for aclf outcome. in summary, our findings suggest that chb patients infected with bcp/pc mutant virus are more susceptible to severe hepatitis and aclf than those with the bcp/pc wild-type virus and that aclf patients with pc mutant virus have an increased risk of death. the results of this study further our knowledge of the virologic factors that are associated with the severity of chronic hbv infection. european association for the study of the liver. easl clinical practice guidelines: management of chronic hepatitis b hepatitis b virus in tenofovir-naive chinese patients with chronic hepatitis b contains no mutation of rta194t conferring a reduced tenofovir susceptibility characteristics of acute and sub-acute liver failure in china: nomination, classification and interval influence of hepatitis b virus genotype on the long-term outcome of chronic hepatitis b in western patients hepatitis b virus e antigen variants hepatitis b virus genetic variability and evolution possible association of vigorous hepatitis b virus replication with the development of fulminant hepatitis fulminant hepatitis b: induction by hepatitis b virus mutants defective in the precore region and incapable of encoding e antigen hepatitis b virus strains with mutations in the core promoter in patients with fulminant hepatitis two core promoter mutation identified in a hepatitis b virus strain associated with fulminant hepatitis result in enhanced viral replication clinical and molecular virological difference between fulminant hepatic failures following acute and chronic infection with hepatitis b virus mutations in the basic core promotor and the precore region of hepatitis b virus and their selection in children with fulminant and chronic hepatitis b influence of genotypes and precore mutations on fulminant or chronic outcome of acute hepatitis b virus infection association of hepatitis b virus subgenotypes and basal core promoter/precore region variants with the clinical features of patients with acute hepatitis genome replication, virion secretion, and e antigen expression of naturally occurring hepatitis b virus core promoter mutants detection and significance of a g1862t variant of hepatitis b virus in chinese patients with fulminant hepatitis initial load of hepatitis b virus (hbv), its changing profile, and precore/core promoter mutations correlate with the severity and outcome of acute hbv infection clinical outcome and virological characteristics of hepatitis b-related acute liver failure in the united states hepatitis b virus genomes of patients with fulminant hepatitis do not share a specific mutation properties of hepatitis b virus genome recovered from vietnamese patients with fulminant hepatitis in comparison with those of acute hepatitis hepatitis b virus: prevalence of precore/core promoter mutants in different clinical categories of indian patients no significant correlation exists between core promoter mutations, viral replication and liver damage in chronic hepatitis b infection precore/core promoter mutations and genotypes of hepatitis b virus in chronic hepatitis b patients with fulminant or subfulminant hepatitis chinese society of infectious diseases and parasitology; and chinese society of hepatology. management scheme of diagnostic and therapy criteria of viral hepatitis chinese society of infectious diseases and parasitology, severe liver diseases and artificial liver group, chinese society of hepatology. diagnostic and treatment guidelines for liver failure imbalanced intrahepatic cytokine expression of interferon-c, tumor necrosis factor-a, and interleukin-10 in patients with acute-on-chronic liver failure associated with hepatitis b virus infection compartmentalization and its implication for peripheral immunologically-competent cells to the liver in patients with hbv-related acute-on-chronic liver failure acute-on-chronic liver failure; consensus recommendations of the asian pacific association for the study of the liver (apasl) features and clinical implications of hepatitis b virus genotypes and mutations in basal core promoter/precore region in 507 chinese patients with acute and chronic hepatitis b hepatitis b virus mutants and fulminant hepatitis b: fitness plus phenotype role of genotype and precore/basal core promoter mutations of hepatitis b virus in patients with chronic hepatitis with acute exacerbation detection of hbv core promoter and precore mutations helps distinguish flares of chronic hepatitis from acute hepatitis b sars-associated coronavirus quasispecies in individual patients genetic variation of sars coronavirus in beijing hospital clinical significance of hepatitis b virus (hbv) genotypes and precore and core promoter mutations affecting hbv e antigen expression in taiwan epidemiological study of hepatitis b virus genotypes, core promoter and precore mutations of chronic hepatitis b infection in hong kong relationship of genotypes of hepatitis b virus to mutations, disease progression and response to antiviral therapy basal core promoter, precore region mutations of hbv and their association with e antigen, genotype, and severity of liver disease in patients with chronic hepatitis b in india effect of basal core promoter and pre-core mutations on hepatitis b virus replication sequential accumulation of the mutations in core promoter of hepatitis b virus is associated with the development of hepatocellular carcinoma in qidong the precore/core promoter mutant (t1762a1764) of hepatitis b virus: clinical significance and an easy method for detection the association of hbv core promoter double mutations (a1762t and g1764a) with viral load differs between hbeag positive and anti-hbe positive individuals: a longitudinal analysis hepatitis b virus genotypes and g1896a precore mutation in 486 spanish patients with acute and chronic hbv infection selection of a secretion-incompetent mutant in the serum of a patient with severe hepatitis b key: cord-350964-0jtfc271 authors: van nguyen, dung; van nguyen, cuong; bonsall, david; ngo, tue tri; carrique-mas, juan; pham, anh hong; bryant, juliet e.; thwaites, guy; baker, stephen; woolhouse, mark; simmonds, peter title: detection and characterization of homologues of human hepatitis viruses and pegiviruses in rodents and bats in vietnam date: 2018-02-28 journal: viruses doi: 10.3390/v10030102 sha: doc_id: 350964 cord_uid: 0jtfc271 rodents and bats are now widely recognised as important sources of zoonotic virus infections in other mammals, including humans. numerous surveys have expanded our knowledge of diverse viruses in a range of rodent and bat species, including their origins, evolution, and range of hosts. in this study of pegivirus and human hepatitis-related viruses, liver and serum samples from vietnamese rodents and bats were examined by pcr and sequencing. nucleic acids homologous to human hepatitis b, c, e viruses were detected in liver samples of 2 (1.3%) of 157 bats, 38 (8.1%), and 14 (3%) of 470 rodents, respectively. hepacivirus-like viruses were frequently detected (42.7%) in the bamboo rat, rhizomys pruinosus, while pegivirus rna was only evident in 2 (0.3%) of 638 rodent serum samples. complete or near-complete genome sequences of hbv, hev and pegivirus homologues closely resembled those previously reported from rodents and bats. however, complete coding region sequences of the rodent hepacivirus-like viruses substantially diverged from all of the currently classified variants and potentially represent a new species in the hepacivirus genus. of the viruses identified, their routes of transmission and potential to establish zoonoses remain to be determined. unlike many other communicable diseases, the burden of viral hepatitis has substantially increased over the last two decades to recently become the seventh leading cause of mortality worldwide. viral hepatitis now causes more deaths than tuberculosis, aids or malaria each year. hepatitis c virus (hcv) and hepatitis b virus (hbv) are responsible for >90% (96% in 2013) of viral viruses 2018, 10, 102 2 of 12 hepatitis-related mortality and disability. as such, these hepatitis viruses are the targets of efforts to combat viral hepatitis [1] , including hbv vaccination, development of hcv vaccines, and highly effective drugs. in contrast, hepatitis e virus (hev) is endemic in many low-income countries [2] but usually causes self-limiting hepatitis. infection with hev occasionally results in liver failure [1] . hbv, hcv, and hev are members of virus families hepadnaviridae, flaviviridae, and hepeviridae, respectively. hbv has a partially double-stranded dna genome with 4 overlapping open reading frames (orfs) [3] , whereas hcv and hev have a single-stranded rna genome [4, 5] . while the origins of these human viruses are unknown, rodents and bats are putative reservoir hosts because they host a diverse array of hepadnaviridae [6] [7] [8] , hepeviridae [7, [9] [10] [11] [12] [13] [14] [15] [16] , and genera pegivirus [17] [18] [19] and hepacivirus [17, 19, 20] of the flaviviridae family including homologues of the human hepatitis viruses under question. among these, it is of concern that a bat hepadnavirus may possess the ability to infect human liver cells [6] . several factors may contribute to the risk of zoonotic rodent or bat virus transmission. rodent meat is a popular source of protein for human consumption in vietnam, particularly in the mekong delta, where rats (rattus spp. and bandicota indica) are commonly trapped and sold live in wet markets [21] . the total annual consumption of rat meat in vietnam is estimated at 3300-3600 tonnes [22] . hoary bamboo rats (rhizomys pruinosus) are additionally farmed for human consumption. moreover, bat faeces collected from bat caves or farms is used as natural fertilizer ("guano") in vietnam. as rodents and bats are reservoirs or carriers of a significant number of zoonotic pathogens [23] and viruses with unknown zoonotic potential, there are health risks that are associated with exposure to these animals. however, a previous study [22] showed none of the surveyed rat catchers or processors were aware of infection risks from contact with live rats. consequently, no precautions were taken for the handling of rodents. in the search for viral diversity and zoonotic viruses, novel paramyxovirus and coronavirus in vietnamese bats and rats were detected in a previous study [24] . here, we report the detection pegivirus and human hepatitis-related viruses in these mammals. rodent and bat samples were collected within the vizions (vietnam initiative on zoonotic infections) framework [25] for the screening of zoonotic microorganisms [21, [26] [27] [28] . rodent samples. as it is important and essential to understand the risk associated with rodents, including those sold in the markets, a total of 435 rats purchased from markets in five of twelve provinces in the mekong delta during 2012-2015 and 82 farmed bamboo rats purchased from a market in dak lak in 2014-2015 were enrolled. in addition, 226 trapped rats were also included. rat trapping was carried out in different locations (pig and poultry farms, rice fields, fruit groves, tropical forests, markets, slaughter-house) in the provinces of dong thap during march 2013 and dak lak in april 2014, as previously described [27] . serum and liver samples were collected post-mortem. species identification of rats was carried out on the basis of morphological characteristics and sequencing of a conserved housekeeping gene [27] . all of the samples were stored in sterile tubes with rna later at −20 • c until nucleic acid extraction. special precautions were taken to avoid cross-contamination. bat samples. a total of 157 bats were trapped at six sites in the provinces of dong nai (in cat tien national park) and quang ngai in may 2013 using mist nets and harp traps as described [26] . trapped bats were speciated according to morphology [29] , and liver samples were collected and stored as described above for rats. rna was manually extracted from 638 rodent serum samples using qiaamp viral rna mini kit (qiagen, manchester, uk) and following instructions from the manufacturer. liver samples from 157 bats and 470 rodents were subjected to nucleic acid extraction using allprep dna/rna mini kit (qiagen, manchester, uk). briefly, about 30 mg of liver per sample was first lysed and homogenised using tissuelyser (qiagen, manchester, uk). the lysate was applied to an allprep dna spin column for dna to bind onto the column. ethanol was added to the flow-through and rna and bound to the membrane when the sample was passed through an rneasy spin column. after washing steps, dna and rna was eluted separately in 50 µl of nuclease-free water. extracted nucleic acid was used in screening for the targeted hepatitis viruses. in order to minimize contamination, pcr mastermix preparation, and the addition of templates were carried under separated laminar flow hoods and lab spaces. all of the surfaces, tubes, and equipment were uv irradiated between each pcr. reverse transcription using superscript iii reverse transcriptase (invitrogen, paisley, uk) was performed according to the manufacturer's instruction. synthesized cdna was screened for hepaciviruses and pegiviruses using a semi-nested pcr protocol with broad spectrum degenerate primers, which can detect all known hepaciviruses and pegiviruses. amplification conditions (using gotaq from promega, southampton, uk) included 95 • c for 3 min, and 30 cycles of denaturation (94 • c, 30 s), annealing (55 • c, 30 s) and elongation (72 • c, 30 s). similarly, hev was screened using broadly reactive primers targeting viral rna-dependent rna polymerase as described in drexler et al., 2012 [11] . dna extracted from liver samples was used for screening of hbv. degenerate primers targeting a highly conserved region of the polymerase gene of sequences from all known hbv hosts were designed for a nested pcr protocol using the above amplification conditions. primers for screening are listed in table s3 . the length of the sequenced screening fragments (excluding primer sequences) of homologues of hbv, hev, hcv, and pegivirus was 257, 284 and 360 nucleotides, respectively. for rodent hepacivirus, hev and pegivirus genomes, extracted rna from representative positive samples was subjected to deep sequencing using an illumina platform. libraries were prepared from total extracted rna using the nebnext ultra directional sequencing kit (new england biolabs, hitchin, uk) with omission of actinomycin d, then pooled and sequenced on a hiseq 4000 instrument (illumina, nr saffron walden, uk). quality control and trimming of reads were performed before genome mapping using clc genomics workbench (qiagen bioinformatics, redwood city, ca, usa) with the default affine gap cost parameters. the closest related virus genomes (genbank numbers kc815310, jx120573 and kj950934 for hepacivirus, hev and pegivirus, respectively) were used as templates for genome mapping. additional primers were designed using the obtained contigs for gap fillings. for bat hbv, primers were designed using sequences available from genbank and the obtained sequences from screening. these primers amplified amplicons, with overlapping regions as presented in table s4 . all of these nested or hemi-nested pcr protocols used superscript iii one-step rt-pcr system with platinum taq dna polymerase (invitrogen, paisley, uk) for rna viruses or q5 high-fidelity dna polymerase (new england biolabs, hitchin, uk) for hbv in the first round pcr, according to instructions from the manufacturers. q5 high-fidelity dna polymerase was also used in the second round pcr. two real-time pcr primer sets (table s5 ) in the 5 untranslated region of bamboo rat hepaciviruses and the screening fragment of other rat hepaciviruses were designed using sequences available from this study. the targeted regions were amplified from positive samples and cloned into pgem-t easy vector (promega, southampton, uk) for in vitro transcription, as previously described [30] . the obtained rna transcripts were used to generate standard curves of the real-time pcr assays for measurement of rodent hepacivirus rna titers using superscript iii reverse transcriptase (invitrogen, paisley, uk) and powerup sybr green master mix (thermo fisher scientific, northumberland, uk). sequences were imported into sse (simmonic sequence editor) [31] for the alignment and calculation of sequence distance values from reference sequences of known viruses from which sequence identities were inferred. sequence distances instead of sequence identities in the regions used for classification of hepaciviruses and pegiviruses were presented to easily compare with the species p-distance thresholds set in the proposed update to the taxonomy of the genera hepacivirus and pegivirus [32] . maximum-likelihood phylogenetic trees were reconstructed using the mega 7.0 software package [33] with 1000 bootstrap resamples. the best-fitting model for each sequence dataset (as shown in figure captions) was first determined and used for phylogenetic reconstruction. sequences obtained in this study have been assigned the following genbank accession numbers mg600410-mg600465. nucleic acid that was extracted from liver samples of 157 bats (29 species; table s1 ) and 470 rodents (six species) was screened for pegivirus and human hepatitis b, c, e viruses and their homologues ( table 1 ) by nested and semi-nested pcr assays with degenerate primers. hepaciviruses were the most commonly detected (8.1% of rodent samples, from three species), followed by hepatitis e related virus (3% of rodent samples, from four species) while hepatitis b related viral dna was only detectable in three bats (2 species). most of the hepacivirus positive samples were from farmed hoary bamboo rats in dak lak province although the predominantly sampled rat species was rattus argentiventer. coinfection with hepacivirus and hev was observed in a sample from rattus losea. all liver samples from bats were negative for hepacivirus and hepatitis e related virus and no sample was positive for pegivirus. and 335 other rats whose liver samples were screened for hepacivirus as above. hepacivirus rna was only detected in serum samples of 10 bamboo rats with positive liver samples. pegivirus rna was detected in two samples from rattus tanezumi. two real-time pcr assays specific for bamboo rat hepaciviruses, and other hepaciviruses were used to determine viral rna concentration in the positive samples. the concentration of rna ( figure 1 ) was high in both liver tissue (median, 3.35 × 10 7 copies/gram; range, 0.9 × 10 5 -1.16 × 10 9 ) and sera (median, 5.7 × 10 6 copies/ml; range, 2.3 × 10 6 -2 × 10 7 ). viruses 2018, 10, x 5 of 12 ( figure 1 ) was high in both liver tissue (median, 3.35 × 10 7 copies/gram; range, 0.9 × 10 5 -1.16 × 10 9 ) and sera (median, 5.7 × 10 6 copies/ml; range, 2.3 × 10 6 -2 × 10 7 ). amplicons derived from pcr screening experiments were all successfully sequenced and complete or near complete genome sequences were determined for representatives of the viruses by pcr or deep sequencing. after exclusion of primers, the obtained screening sequences from each targeted virus clustered in one or two clades of those with high identity and were most closely related to sequences previously reported from rodents or bats from the us [17, 18] , china [7] and vietnam [16] . rodent hepacivirus sequences (360 nucleotides) formed two well supported clades (figure 2a) . clade 1 included all of 35 sequences from rhizomys pruinosus which shared 84.5-100% pairwise nucleotide identity while three sequences (nucleotide identity of 89-99%) from rattus losea and rattus argentiventer grouped in clade 2. these clades differed from each other by mean distances of 39.6% and 33.2% at nucleotide and amino acid levels, respectively. while the four vietnamese bamboo rat hepacivirus genomes were highly similar to each other (<12% nucleotide and <3% amino acid distances in the complete coding region (cds)), they were remarkably different from the closest sequence (kc815310) with the corresponding distances of 40% and 36%, respectively ( table 2 ). the amino acid p-distances of the obtained hepacivirus sequences and kc815310 in the regions 1123-1566 and 2536-2959 (numbered relative to m62321) were 30% and 32%, respectively. the newly identified hepaciviruses therefore could be provisionally classified as members of a new hepacivirus species (figure 2b ) [32] . the other bamboo rat hepaciviruses in clade 1 may also belong to this new virus species on the basis of the high sequence identity in this clade. similarly, although complete genome sequences were not determined for hepaciviruses in clade 2, they likely belong to species hepacivirus g due to their low amino acid p-distances (7.6-8.4%) in the screening region to kj950938. the 5' untranslated region sequences of these hepaciviruses contain two mir-122 seed sites (cacucc), which were located 51 nucleotides from each other, as consistent with the suspected hepatotropism of the viruses. in contrast to host specificity of rodent hepaciviruses, the 15 hev sequences (284 nucleotides) from four rodent species were 84.4-99.3% identical to each other and phylogenetically interspersed with each other and with reference sequences from other rat species (figure 3a) . the obtained complete genome of rat hev comprised of 6960 nucleotides excluding the poly a tail. its concatenated orf1 and orf2 differed by 6.8% (table 2 ) at amino acid level to the closest match (jx120573) and these two sequences therefore belong to a same genotype in the species orthohepevirus c (figure 3b ), according to the latest proposal for classification of hepeviruses [34] . amplicons derived from pcr screening experiments were all successfully sequenced and complete or near complete genome sequences were determined for representatives of the viruses by pcr or deep sequencing. after exclusion of primers, the obtained screening sequences from each targeted virus clustered in one or two clades of those with high identity and were most closely related to sequences previously reported from rodents or bats from the us [17, 18] , china [7] and vietnam [16] . rodent hepacivirus sequences (360 nucleotides) formed two well supported clades (figure 2a) . clade 1 included all of 35 sequences from rhizomys pruinosus which shared 84.5-100% pairwise nucleotide identity while three sequences (nucleotide identity of 89-99%) from rattus losea and rattus argentiventer grouped in clade 2. these clades differed from each other by mean distances of 39.6% and 33.2% at nucleotide and amino acid levels, respectively. while the four vietnamese bamboo rat hepacivirus genomes were highly similar to each other (<12% nucleotide and <3% amino acid distances in the complete coding region (cds)), they were remarkably different from the closest sequence (kc815310) with the corresponding distances of 40% and 36%, respectively ( table 2 ). the amino acid p-distances of the obtained hepacivirus sequences and kc815310 in the regions 1123-1566 and 2536-2959 (numbered relative to m62321) were 30% and 32%, respectively. the newly identified hepaciviruses therefore could be provisionally classified as members of a new hepacivirus species (figure 2b ) [32] . the other bamboo rat hepaciviruses in clade 1 may also belong to this new virus species on the basis of the high sequence identity in this clade. similarly, although complete genome sequences were not determined for hepaciviruses in clade 2, they likely belong to species hepacivirus g due to their low amino acid p-distances (7.6-8.4%) in the screening region to kj950938. the 5' untranslated region sequences of these hepaciviruses contain two mir-122 seed sites (cacucc), which were located 51 nucleotides from each other, as consistent with the suspected hepatotropism of the viruses. in contrast to host specificity of rodent hepaciviruses, the 15 hev sequences (284 nucleotides) from four rodent species were 84.4-99.3% identical to each other and phylogenetically interspersed with each other and with reference sequences from other rat species (figure 3a) . the obtained complete genome of rat hev comprised of 6960 nucleotides excluding the poly a tail. its concatenated orf1 and orf2 differed by 6.8% (table 2 ) at amino acid level to the closest match (jx120573) and these two sequences therefore belong to a same genotype in the species orthohepevirus c (figure 3b) , according to the latest proposal for classification of hepeviruses [34] . the three hbv variants (from bat species hipposideros pomona and hipposideros larvatus) clustered with known bat hbv sequences (figure 4 ). the two bat hbv complete genome sequences comprised 3275 and 3302 nucleotides. as with other hepadnaviruses, the bat hbv genomes have four open reading frames (orfs) encoding the surface (s), polymerase (p), core (c), and x proteins. a detailed comparison of the orfs of these viruses with their closest sequences is shown in table 2 . bat031 consistently showed greatest sequence identity to ky905324 in all 4 orfs. in contrast, bat033 shared highest identity to ky905328 in the p and s orfs, but was more similar to ky905324 and ky905327 in the orfs encoding for x and c, respectively. the two vietnamese pegivirus sequences from rattus tanezumi grouped with a sequence previously reported from rattus norvegicus (figure 5a ). the amino acid p-distance between the obtained rodent pegivirus sequence and kj950934 in the region 888-1635 (numbered relative to u22303) was 17.8% and the two viruses could be classified as members of species pegivirus j (figure 5b) , according in the update to the taxonomy of the pegivirus genus [32] . the three hbv variants (from bat species hipposideros pomona and hipposideros larvatus) clustered with known bat hbv sequences (figure 4) . the two bat hbv complete genome sequences comprised 3275 and 3302 nucleotides. as with other hepadnaviruses, the bat hbv genomes have four open reading frames (orfs) encoding the surface (s), polymerase (p), core (c), and x proteins. a detailed comparison of the orfs of these viruses with their closest sequences is shown in table 2 . bat031 consistently showed greatest sequence identity to ky905324 in all 4 orfs. in contrast, bat033 shared highest identity to ky905328 in the p and s orfs, but was more similar to ky905324 and ky905327 in the orfs encoding for x and c, respectively. the two vietnamese pegivirus sequences from rattus tanezumi grouped with a sequence previously reported from rattus norvegicus (figure 5a ). the amino acid p-distance between the obtained rodent pegivirus sequence and kj950934 in the region 888-1635 (numbered relative to u22303) was 17.8% and the two viruses could be classified as members of species pegivirus j (figure 5b) , according in the update to the taxonomy of the pegivirus genus [32] . the present study reports the findings of pegivirus and human hepatitis-related viruses in vietnamese rodents and bats. the detection of hepacivirus, hev homologue and pegivirus in a number of rodent species, and hbv homologue in hipposideros larvatus indicates wider host ranges of these viruses. whereas, the identified rat hev and bat hbv showed relatively high sequence identity to previously characterized viruses infecting rattus rattus, rattus tanezumi and hipposideros pomona, the rodent pegivirus and hepacivirus showed substantial sequence distances to their closest sequences and represent new pegivirus variants and a new hepacivirus species. this highlights the incomplete genetic characterization of these viruses. thus far, only one complete genome and two complete coding sequences (including the one from this study) of rodent pegivirus are available on genbank. more highly divergent hepacivirus and pegivirus sequences are expected to be discovered from rodents in future studies. the absence of bat hev, hepacivirus, pegivirus, and low detection frequency of bat hbv are consistent with their low prevalence (0-5%) reported in previous studies [6, 7, 11, 19] . contrastingly, the prevalence of hepacivirus in the farmed bamboo rats was unprecedentedly high (42.7%). the inbred nature of farmed bamboo rats that were investigated in this study may have contributed to susceptibility to infection and likelihood of persistence [35, 36] . the existence of relatively homozygous individuals may play a key role in the maintenance of pathogens in a population [37] . the high prevalence of hepacivirus in bamboo rats also indicates the need to reconsider transmission routes of hepaciviruses. among hepaciviruses, the transmission route of hcv has been relatively well studied, while those of other hepaciviruses are mostly speculative [38, 39] . as a bloodborne virus, hcv is thought to be mainly transmitted through injections or blood transfusion. however, this does not explain how a range of divergent hcv strains have been maintained for centuries in some rural populations in central africa and southeast asia [40] . equine hepacivirus has been shown to be transmittable via direct inoculation [41] and via vertical transmission [42] . rodent hepacivirus may utilize a similar transmission route as experimental intravenous injection of the supernatants of homogenised liver tissues from infected rats lead to viraemia [43] . the high prevalence of hepacivirus in bamboo rats (in this study) and commensal rattus norvegicus (23.3% in firth et al. 2014 [18] ) indicates other more efficient transmission routes may exist such as via saliva the present study reports the findings of pegivirus and human hepatitis-related viruses in vietnamese rodents and bats. the detection of hepacivirus, hev homologue and pegivirus in a number of rodent species, and hbv homologue in hipposideros larvatus indicates wider host ranges of these viruses. whereas, the identified rat hev and bat hbv showed relatively high sequence identity to previously characterized viruses infecting rattus rattus, rattus tanezumi and hipposideros pomona, the rodent pegivirus and hepacivirus showed substantial sequence distances to their closest sequences and represent new pegivirus variants and a new hepacivirus species. this highlights the incomplete genetic characterization of these viruses. thus far, only one complete genome and two complete coding sequences (including the one from this study) of rodent pegivirus are available on genbank. more highly divergent hepacivirus and pegivirus sequences are expected to be discovered from rodents in future studies. the absence of bat hev, hepacivirus, pegivirus, and low detection frequency of bat hbv are consistent with their low prevalence (0-5%) reported in previous studies [6, 7, 11, 19] . contrastingly, the prevalence of hepacivirus in the farmed bamboo rats was unprecedentedly high (42.7%). the inbred nature of farmed bamboo rats that were investigated in this study may have contributed to susceptibility to infection and likelihood of persistence [35, 36] . the existence of relatively homozygous individuals may play a key role in the maintenance of pathogens in a population [37] . the high prevalence of hepacivirus in bamboo rats also indicates the need to reconsider transmission routes of hepaciviruses. among hepaciviruses, the transmission route of hcv has been relatively well studied, while those of other hepaciviruses are mostly speculative [38, 39] . as a bloodborne virus, hcv is thought to be mainly transmitted through injections or blood transfusion. however, this does not explain how a range of divergent hcv strains have been maintained for centuries in some rural populations in central africa and southeast asia [40] . equine hepacivirus has been shown to be transmittable via direct inoculation [41] and via vertical transmission [42] . rodent hepacivirus may utilize a similar transmission route as experimental intravenous injection of the supernatants of homogenised liver tissues from infected rats lead to viraemia [43] . the high prevalence of hepacivirus in bamboo rats (in this study) and commensal rattus norvegicus (23.3% in firth et al. 2014 [18] ) indicates other more efficient transmission routes may exist such as via saliva and bites, the zoonotic potential of the detected viruses is unknown and requires further investigation. while the identified rodent hepaciviruses appear host species specific, four rodent species were infected with highly similar hev homologues, which were phylogenetically interspersed, indicative of low host species specificity. this is a characteristic that may lead to their establishment and emergence in new hosts. understanding the receptor usage for cell entry of hev in rodents and other host species would potentially help predict the host range of the virus. furthermore, a surrogate assay with pseudotyped viruses carrying surface/envelope proteins of the identified viruses may be useful in assessing their potential to infect human liver cells. such an assay was used to show that a bat hbv could infect primary human hepatocytes [6] . in summary, this study demonstrated the wide circulation of diverse pegivirus and human hepatitis-related viruses in new rodent and bat species. the presented findings form a framework for future investigations of human transmission risk, now that the rodent and bat species infected with these viruses have been identified and the human contact groups are better defined (e.g., bamboo rat farmers, rat catchers, rat sellers, and bat farmers). the transmission routes of the identified viruses are to be determined. the following are available online at http://www.mdpi.com/1999-4915/10/3/102/ s1. the global burden of viral hepatitis from 1990 to 2013: findings from the global burden of disease study the global burden of hepatitis e virus genotypes 1 and 2 in 2005 hepatitis b: the virus and disease genetic organization and diversity of the hepatitis c virus hepatitis e virus: molecular virology, clinical features, diagnosis, transmission, epidemiology, and prevention bats carry pathogenic hepadnaviruses antigenically related to hepatitis b virus and capable of infecting human hepatocytes detection and genome characterization of four novel bat hepadnaviruses and a hepevirus in china hepatitis virus in long-fingered bats hepatitis e virus in rats hepatitis e virus genotype 3 in wild rats, united states bats worldwide carry hepatitis e virus-related viruses that form a putative novel genus within the family hepeviridae complete genome sequence of a rat hepatitis e virus strain isolated in the united states hepatitis e virus in norway rats (rattus norvegicus) captured around a pig farm novel hepatitis e virus genotype in norway rats detection of a novel hepatitis e-like virus in faeces of wild rats using a nested broad-spectrum rt-pcr characterization of full genome of rat hepatitis e virus strain from vietnam identification of rodent homologs of hepatitis c virus and pegiviruses detection of zoonotic pathogens and characterization of novel viruses carried by commensal rattus norvegicus bats are a major natural reservoir for hepaciviruses and pegiviruses evidence for novel hepaciviruses in rodents rodents and risk in the mekong delta of vietnam: seroprevalence of selected zoonotic viruses in rodents and humans. vector-borne zoonotic dis market study of meat from field rats in the mekong delta aciar monograph rodent-borne diseases and their risks for public health detection of potentially novel paramyxovirus and coronavirus viral rna in bats and rats in the mekong delta region of southern viet nam the vietnam initiative on zoonotic infections (vizions): a strategic approach to studying emerging zoonotic infectious diseases bartonella species and trombiculid mites of rats from the mekong delta of vietnam. vector borne zoonotic dis how important are rats as vectors of leptospirosis in the mekong delta of vietnam? vector borne zoonotic dis a guide to the mammals of southeast asia large-scale screening and characterization of enteroviruses and kobuviruses infecting pigs in vietnam sse: a nucleotide and amino acid sequence analysis platform proposed update to the taxonomy of the genera hepacivirus and pegivirus within the flaviviridae family mega7: molecular evolutionary genetics analysis version 7.0 for bigger datasets consensus proposals for classification of the family hepeviridae parasite-mediated selection against inbred soay sheep in a free-living, island population disease susceptibility in california sea lions consanguinity and susceptibility to infectious diseases in humans hepacivirus cross-species transmission and the origins of the hepatitis c virus viraemic frequencies and seroprevalence of non-primate hepacivirus and equine pegiviruses in horses and other mammalian species the virus whose family expanded experimental transmission of equine hepacivirus in horses as a model for hepatitis c virus vertical transmission of hepatitis c virus-like non-primate hepacivirus in horses mouse models of acute and chronic hepacivirus infection key: cord-333220-tcvs4beg authors: lee, szu-yuan; huang, jhen-gang; chuang, tsung-liang; sheu, jin-chuan; chuang, yi-kuang; holl, mark; meldrum, deirdre r.; lee, chun-nan; lin, chii-wann title: compact optical diagnostic device for isothermal nucleic acids amplification date: 2008-08-12 journal: sens actuators b chem doi: 10.1016/j.snb.2008.03.008 sha: doc_id: 333220 cord_uid: tcvs4beg we recently reported the successful use of the loop-mediated isothermal amplification (lamp) reaction for hepatitis b virus (hbv) dna amplification and its optimal primer design method. in this study, we report the development of an integrated isothermal device for both amplification and detection of targeted hbv dna. it has two major components, a disposable polymethyl methacrylate (pmma) micro-reactor and a temperature-regulated optical detection unit (base apparatus) for real-time monitoring of the turbidity changes due to the precipitation of dna amplification by-product, magnesium pyrophosphate. we have established a correlation curve (r(2) = 0.99) between the concentration of pyrophosphate ions and the level of turbidity by using a simulated chemical reaction to evaluate the characteristics of our device. for the applications of rapid pathogens detection, we also have established a standard curve (r(2) = 0.96) by using lamp reaction with a standard template in our device. moreover, we also have successfully used the device on seven clinical serum specimens where hbv dna levels have been confirmed by real-time pcr. the result indicates that different amounts of hbv dna can be successfully detected by using this device within 1 h. around the world, the hepatitis b virus is one of the most common viral pathogens, having infected more than 370 million people [1] . at present, serologic diagnosis of hbv infections is based on the viral antigens and antibodies. however, the reveal-hbv (risk evaluation of viral load elevation and associated liver disease/cancer-hepatitis b virus) study indicates that the serum level of hbv dna ( 10,000 copies/ml) is a strong risk predica-tor of hepatocellular carcinoma or cirrhosis [2, 3] . it would thus be clinically valuable to have a molecular diagnostic method for screening and monitoring the progress of hepatitis. however, the long reaction time of traditional pcr amplification and the high cost of thermalcycler are still major issues for such a screening application. therefore, it is important to develop a rapid and accurate diagnostic device for field applications as soon as possible [4] . even though many nucleic acid amplification methods are currently available, a low cost, yet rapid method would be extremely useful, especially in developing countries. there are several pcr-based amplification methods [5] , such as nucleic acid sequence-based amplification [6] and self-sustained sequence replication, for nucleic acid amplification. however, these methods require a precise instrument to provide the efficient thermal cycles and to shorten the total amplification time for a test run. in general, it takes up to 2.5 h for a pcr test with the present state of art equipment. alternatively, isothermal amplification methods, e.g., strand displacement amplification [7] , branched dna amplification, invader, rolling circle amplification [8] and loop-mediated amplification method (lamp) [9] , have been proposed for amplifying the targeted nucleic acid sequence under a single working temperature condition with special designs for the buffer system and primers to prevent non-specific amplification. it would thus allow for the development of a low-cost device for rapid pathogen detection. loop-mediated isothermal amplification (lamp), originally developed by notomi et al. [9] , utilizes a designed set of six primers, termed inner and outer primers, to recognize specific gene sequences, and a polymerase with strand displacement activity to generate large amounts of amplified product (>10 9 copies) within 1 h [10] . moreover, it has been shown that the well-known pcr inhibitors in the blood (e.g., heme) have little impact on the lamp reactions [11] . it is believed that the bacillus stearothermophilus (bst) dna polymerase used in the lamp reactions is more resistant to these inhibitors. therefore, the lamp reaction has been successfully applied for fast genetic screening tests in many acute infectious diseases, including mycobacterium tuberculosis [12] , severe acute respiratory syndrome virus [13] , human influenza viruses [14, 15] , avian influenza viruses [16] and herpes viruses [17, 18] , with special primer design and buffer adjustment. among these, the lamp method has been shown to have great promise for the amplification of hbv dna. in addition, the dna yield of the lamp reaction (10 g/25 l) is much higher than that of the traditional pcr (0.2 g/25 l) [19] . recently, we have successfully demonstrated that the level of turbidity, which is due to the by-product (magnesium pyrophosphate) of dna polymerization, has a high correlation to the amounts of amplified dna. then, we decided to work with a total of 25 l of lamp reaction volume because of the practical limitations of turbidity detection. in addition to the use of the lamp protocol, we have adapted a simulated chemical reaction to mimic the by-product production without using expensive polymerase and primers [20] . it can serve as an internal quality check for the system validation. therefore, it is our intention to design and implement a compact integrated device with a disposable chip and simple quantitative optical read-out for low-cost applications. in this study, the goal is to develop an integrated isothermal device for real-time detection of hbv viral dna via the lamp amplification method. it has two major components, a disposable pmma micro-reactor and a temperature-regulated optical detection unit (base apparatus) for real-time monitoring of the turbidity changes due to precipitation of dna amplification by-product, magnesium pyrophosphate. we decided to work with a total of 25 l of lamp reaction volume after adding 2 l of dna sample because of the practical limitations of turbidity detection. the performance of this integrated isothermal device has been tested by using within and between runs. for the applications of rapid pathogens detection, we have successfully used the device on seven clinical serum specimens and confirmed hbv dna levels with real-time pcr. the results of using this device indicate that different amounts of hbv dna can be successfully detected within 1 h with a threshold level of 10,000 copies/ml, which is the recommendatory quantity of reveal-hbv study. this integrated isothermal device can be advantageous in a wide spectrum of field applications, including pathogen detection and gene testing. the design methodology of primers used has been discussed in our previous study [21] . in brief, the target dna sequences and the partial hbv polymerase gene sequences are collected from a public data base and then aligned to find highly conserved fragments. then, the primer design can be executed by using the available software, gene runner (hastings software, inc., hudson, ny, usa), to check design parameters. the melting temperature (t m ) of each primer is calculated by the nearest-neighbor t m theory. finally, the designed primers are synthesized by the contract services (quality systems, inc., taipei city, taiwan, roc) followed by having its concentration optimized with a reaction buffer in the amplified test. the partial hbv polymerase gene was directly cloned into pgem-t easy vector (promega, madison, wi, usa) as standard template dna. the lamp assay was performed in a total of 25 l of the mixtures, which contain 20 pmol each of ib-fip (5 -tggaattagaggacaaacgggtgctgctatgcctcatctt-3 ) and ib-bip (5 -gctcaaggaacctctatgtttcgatgatgggatgggaataca-3 ), 5 pmol each of ib-f3 (5 -ggcgttttatcatcttcct-3 ) and ib-b3 (5 -aggttacttgcgaaagcc-3 ), 10 pmol each of ib-loopf (5 -taccttgatagtccagaagaacc-3 ) and ib-loopb (5 -ctacggacggaaactgcac-3 ), 0.4 mm dntps, 1 m betaine, 20 mm tris-hcl (ph 8.8), 10 mm kcl, 10 mm (nh4) 2 so 4 , 6 mm mgso 4 , 0.1% triton x-100, 5 units of the bst dna polymerase large fragment (new england biolabs, ipswich, ma, usa), and 2 l of dna standard template-a partial hbv polymerase gene cloned into a pgem-t easy vector or purified dna. we utilized a set of six primers to recognize specific hbv gene sequences. this mixture was incubated in a mastercycler ® gradient pcr machine (eppendorf, hamburg, germany) or our miniaturized device at 65 • c for 1 h. the white precipitate of reaction by-product can be observed by naked eye. aliquots of 2.5 l of lamp products were electrophoresed in 2% agarose gels (1× tbe) and then stained with sybr green i dye for verification by fluorescent imager (geldoc-it imaging system, uvp, upland, ca, usa). in addition, the sequences of lamp product were confirmed by the abi 3100-avant dna sequencer (applied biosystems, foster city, ca, usa). our integrated isothermal device has two major components, a disposable polymethyl methacrylate (pmma) micro-reactor and a temperature-regulated optical detection unit (base apparatus) for real-time monitoring of the turbidity changes due to the precipitation of dna amplification by-product, magnesium pyrophosphate. the disposable micro-reactor is constructed from two pmma parts to create a reaction chamber of 5-mm optical path length by using uv-light curing adhesives (ultrawide gn150, everwide chemical company, yunlin county, taiwan, roc). for the lamp reaction, the reaction chamber is filled with 25 l reagent manually via micropipette and then is sealed with gluey aluminum foil. the base apparatus consists of an optical detection unit, a thin-film heater, a temperature controller, and a power supply. the optical detection unit (fs-v21g, keyence corporation, osaka, japan) employs a light emitting diode (led) light source at 533 nm and a phototransistor detector with an extension of collimated optical fibers for the collection of forward scattering light. the temperature controller has a 60 w power supply and two 2 in. × 2 in. thin-film kapton tm heaters (minco, minneapolis, mn, usa), which is controlled by a proportional-integral-derivative (pid) controller (anly electronics, taipei county, taiwan, roc) with one thermal coupler feedback. after the insertion of assembled micro-reactor chips into the base apparatus, we can initiate the hbv lamp reaction at 65 • c through out the whole experimental time course. at the same time, the scattering light intensity is measured by the optical detection unit. in general, turbidity refers to the scattering of light by particles and has to be measured and calculated indirectly from eq. (1) [22] assuming no absorption in the path length: where i 0 is the intensity of incident light and i 1 is the intensity of transmitted light. during the dna polymerization process, white precipitation of magnesium pyrophosphate will be produced in the presence of magnesium ions and pyrophosphate ions as shown in the following equations: instead of using dntp and dna polymerases to initiate the precipitation, we have adapted a simulated reaction, as shown in eq. (4), to mimic the production of magnesium pyrophosphate which is used for evaluating the performance of our device: this reaction is performed in a total of 1 ml solution containing the following reagents, 1× thermolpol buffer (20 mm tris-hcl (ph 8.8), 10 mm kcl, 10 mm (nh4) 2 so 4 , 2 mm mgso 4 , 0.1% triton x-100), 2 mm mgso 4 , gradient concentrations of k 4 p 2 o 7 or k 3 po 4 from 1.2 to 0.2 mm and double-distilled water. the mixture is incubated in the disposable micro-reactor at 65 • c for 1 h to measure the end-point turbidity by our system. in addition, this experimental result was confirmed by a uv-visible spectrometer (varain, palo alto, ca, usa) at 533 nm. it also can be used to establish the correlation curve between the concentrat